article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
diabetes mellitus (dm) has emerged as one of the major global health problems and a heavy burden for all healthcare systems. current predictions estimate that by 2025 more than 480 million people globally will have an altered glucose tolerance and 380 million will have developed type 2 diabetes. among diabetic complications diabetic nephropathy (dn) has already become the leading cause of end - stage kidney disease (eskd) worldwide [3, 4 ]. moreover, progressive decline of kidney function is associated with an increase in all - cause mortality and severe cardiovascular complications in patients with diabetes [57 ]. despite important advances in understanding, for example, the molecular pathways associated with the pathogenesis of dn [8, 9 ], the clinical management of patients, and pharmacological treatments to protect the kidney function are not completely satisfactory [10, 11 ]. the diagnosis of dn is based on clinical parameters including the measurement of urinary albumin excretion rate (aer), assessment of glomerular filtration rate (gfr), and registering end - organ complications (retinopathy or neuropathy). leakage of albumin into urine (albuminuria) has been the golden marker to indirectly indicate the integrity of the glomerular filtration barrier and as an index of kidney functionality. depending on severity of damage, the level of albumin found in urine increases in a linear fashion. patients are commonly stratified as normoalbuminuric (200 g per minute or > 300 mg/24 hours) [13, 14 ]. in the diabetic patient, the onset of microalbuminuria proceeding to macroalbuminuria typically appears between 5 to 15 years and 15 to 25 years from the onset of diabetes [15, 16 ]. however, in patients with type 1 diabetes the decline of gfr is not always in concordance with the level of albuminuria and gfr reduces without clear signs of albuminuria and conversely reversion from microalbuminuria to normoalbuminuria can happen. these evidences suggest that more than 1 pathway may well be involved in the development of dn and surrogate biomarkers in support of albuminuria are badly necessary to predict the progression of dn. in the last decade urinary extracellular vesicles (uevs) have gained considerable research interest due to their content of potential key molecules for intercellular communication and the possible use as source of biomarkers [1820 ]. more in general cells secrete a surprising variety of vesicles such as exosomes, microvesicles, exosome - like vesicles, apoptotic blebs, and retrovirus - like particles (rlps) into the extracellular space [21, 22 ] apparently reflecting intracellular processes. thus, they provide a lucrative approach to better define the molecular events associated with metabolic disturbances as in diabetes. moreover, uevs have already shown to provide a promising source of biomarkers and their full potential has still to be utilised [2325 ]. in this study we reveal, for the first time, a comprehensive analysis of proteases and proteases inhibitors in uevs isolated from healthy subjects and dn in type 1 diabetes. control urine samples were collected from twelve healthy volunteers among the laboratory staff, aged 2040, in accordance with ethical protocols of the dublin city university. first morning void urine was processed within 3 h without addition of protease inhibitors. urine was anonymously tested by combur 10 test d dipstick (roche diagnostics, basel, switzerland) for the following : specific gravity, leucocytes, nitrites, proteins, glucose, ketones, urobilinogen, bilirubin, blood, and haemoglobin. all patients participated in the finnish diabetic nephropathy (finndiane) study, a nationwide multicenter study with the aim of identifying genetic and clinical risk factors for diabetic nephropathy in type 1 diabetes. the study protocol is in accordance with the declaration of helsinki, and it has been approved by the local ethics committee in each participating study centre. urinary albumin excretion rate (aer) was determined in 24 h urine collections by immunoturbidimetry (pharmacia, uppsala, sweden). the renal status was defined based on aer in at least two of three collections. uevs were purified by a hydrostatic filtration dialysis (hfd) system recently developed in our group. briefly, control and dn urine samples were centrifuged at a relative centrifugal force (rcf) of 2,000 g calculated at maximum radius of 160 mm in a swing bucket rotor benchtop universal 320 centrifuge (hettich zentrifugen, tuttlingen, germany) for 30 min at room temperature (rt) (without using break). the supernatant (sn) was poured in a funnel connected to dialysis membrane with a molecular weight cutoff (mwco) of 1,000 kda as shown in supplemental figure 1(s) (see supplementary material available online at http://dx.doi.org/10.1155/2015/289734). the hydrostatic pressure of the analyte solution is strong enough to push the solvent through the mesh of dialysis membrane carrying all the analytes below the mwco (hfdb). thus, after the first step of concentration (~3 ml) the funnel is refilled with 200 ml of deionised filtrate (0.22 m) water to rinse what is left in the concentrated urine until the volume of ~5 ml was reached again. this concentration process is called the retained solution above the 1,000 kda cutoff (hfda) was used for all the following experiments. proteins were separated by sds - page employing freshly cast t 618%, c 2.6% gradient resolving gel (80 mm 50 mm 1.5 mm). protein amounts (based on the bradford assay) were first dried by vacuum concentration and then resuspended in a strong chaotropic solution made of the following : 7 m urea, 2 m thiourea, 5% (w / v) sds, 40 mm tris - hcl, ph 6.8, 0.5 mm ethylenediaminetetraacetic acid (edta), 20% (v / v) glycerol, and 50 mm dithiothreitol (dtt) in a ratio of 0.25 g of protein per l of solution. after electrophoresis the gels were either stained with colloidal coomassie or transferred to 0.45 m nitrocellulose membrane (whatman, springfield, uk). for western blotting, membranes were saturated with odyssey blocking buffer (li - cor biosciences, lincoln, ma) and incubated with specific antibody as follows : rabbit anti - tumour suppressor gene (tsg101) (sigma aldrich, dorset, uk), rabbit anti - ubiquitin (dako, glostrup, denmark), and mouse anti - proteinase 3 (r&d biosystem, minneapolis, mn). after 6 washes in pbs - tween (0.1%, v / v) membranes were incubated with infrared dye - coupled secondary antibody with a fluorescent tag (an emission of either 680 nm or 700 nm) (li - cor biosciences) dilution 1 : 5000 2 h incubation rt. determination of molecular weight of all bands of interest and quantification of the signal were performed by odyssey infrared laser scanner software (li - cor biosciences). proteome profiler human protease array kit and proteome profiler human protease inhibitor array kit (r&d systems) were used to detect 34 proteases and 32 inhibitors, respectively. hfda pooled fractions were dried by vacuum concentration (mivac speed trap, genevac ltd, ipswich, uk) and resuspended in 50 l of 0.3% (w / v) sodium dodecyl sulphate (sds) for 2 hours. samples were diluted to 1 ml with array buffer 6 plus 0.5 ml of array buffer 4 (both buffers from r&d systems). fifteen microliters of reconstituted detection antibody cocktail was added to the sample solution and incubated for 1 hour at rt in end - over - end agitation. mix sample - antibody solutions were incubated overnight at 6c with the membrane on a rocking platform shaker. after three 10-minute washes with 1x buffer, the membranes were incubated with infrared dye - coupled streptavidin with a fluorescent tag emitting at 800 nm (li - cor biosciences), 1 : 2000 dilution for 1 h at room temperature on the rocking platform shaker. after three 10 min wash with 1x wash buffer the membrane slides were acquired by odyssey infrared laser scanner (li - cor biosciences) and relative quantification analysis was performed by odyssey infrared laser scanner software (li - cor biosciences). gelatin zymography was performed using gradient sodium dodecyl sulfate gel electrophoresis (sds - page, t = 618% c = 2.6%) copolymerized with 2 mg / ml pig skin gelatin type b (sigma). uevs (5 g per group) were incubated overnight in nonreducing laemmli buffer. (v / v) triton x-100 at 4c and were incubated overnight in collagenase buffer (50 mm tris gels were stained with coomassie bluer 250 (bio - rad) in 40% (v / v) methanol and 10% (v / v) acetic acid for 1 hour and were destained in the same solution without dye. the proteolytic activities of specific group of proteases in normo-, micro- and macroalbuminuric hfda fractions were assayed using 0.1 mm glycyl - prolyl - p - nitroanilide (gp - pna) and 0.25 mm n - benzoyl - proline - phenylalanine - arginine - p - nitroanilide (be - pfr - pna), n - methoxysuccinyl - alanine - alanine - proline - valine - p - nitroanilide (me - aapv - pna), and succinyl - alanine - alanine - proline - phenylalanine p - nitroanilide (suc - aapfpna) chromogenic substrate of chromogenic substrates to establish activity of dpp iv, kallikreins, proteinase 3, and cathepsins, respectively [23, 3335 ]. assays were performed for 20 min under same conditions of 100 mm tris - hcl buffer ph 7.8 with addition of 5 mm cacl2 except for gp - pna, for which 100 mm tris - hcl buffer ph 8.6 was used. incubations were performed at 37c for 20 min in 96-well flat bottom microplates (greiner bio one kremsmster, austria). reactions were stopped by 30% (v / v) final concentration of acetic acid. results were read using 410 nm wavelength in biotek powerwave xs device (biotek instruments inc., the specific activity has been defined as mole of 4-nitroaniline released per minute by one milligram of the protease under the assay conditions. briefly, an equivalent of 100 g of proteins from each sample was resuspended in milliq water in total volume of 375 l. next, 675 l of delipidation solution made of 60% (v / v) diisopropyl ether (dipe) and 40% (v / v) butanol were added. samples were vortexed and centrifuged for 10 min at 5000 rpm at rt. upper phase was removed ; 1125 l of dipe was added to aqueous phase and mixed end - over - end for 5 min at rt. samples were then centrifuged at 5000 rpm for 5 min in rt and the upper phase was discarded while tubes were placed under a fume hood to remove traces of an organic phase. bradford assay was performed to establish protein concentration and samples were diluted to obtain an optimal concentration for colorimetric assay. in the pilot study 12 (6 males and 6 females) control volunteers provided 15 ml of midstream first morning urine. thirty seven urine samples from diabetes patients, with different levels of albumin - proteinuria were studied. after enriching uevs by hydrostatic filtration dialysis, samples were assayed in electrophoresis and western blots for general protein patterns and detection of the respective vesicle markers including tumor suppressor gene 101 (tsg101) specific for exosome vesicles (figure 1). silver stained gels showed a good overlapping pattern with a moderate interindividual variability, most likely due to variable amounts of tamm - horsfall protein (thp). interestingly, tsg101 assay also showed a progressive signal decrease in the micro- and macroalbuminuric groups, respectively. this trend was even more evident when urine pools were created for the protease and protease inhibitor arrays (figure 2). moreover, a detectable shift of the apparent tsg101 molecular weight (mw) was observed when pools were run in adjacent lanes in the same gel. these results were confirmed in two independent western blots, the second of which was carried out with an optimised gradient gel to have a better separation in the tsg101 molecular weight (mw) region. in order to investigate this alteration in detail we assayed the ubiquitination state of exosomes. although the precise molecular mechanism of the vesicle formation and protein recruitment needs to be fully elucidated, it seems apparent that this posttranslation modification (ptm) faithfully reflects the disease pathogenesis. interestingly, ubiquitination is involved in a variety of cellular processes, including protein sorting and translocation inside the vesicle lumen during vesicle biogenesis as well as in protein degradation. in support of this, western blotting revealed a specific ubiquitination pattern in the dn groups. in all the dn groups it is possible to observe a strong signal at 8.5 kda corresponding to the monomeric ubiquitin and 17 kda (white rectangle) which is absent in the healthy control. moreover a specific pattern in the normo-, micro-, and macroalbuminuric groups with an apparently relative changing for some bands (asterisk) is visible between 50 and 75 kda. despite the fact that the challenges of using sample pools have been thoroughly debated, pools for each study group were created to overcome substantial limitation such as a relative protein recovery from a limited volume of urine. moreover a superpool made of the same amount of protein for each hfda sample was created to normalise the relative quantitative changing of the proteases array (figure 3(a)) and overcome the lack of a housekeeping protein. membrane slides were analyzed at the same time adjusting the intensity of the laser to reach the limit of saturation for the most abundant spot. the spots in positions a1,2, a19,20, and e1,2 represent the positive controls. the absence of spots in position e 7,8 (white rectangular), which is the negative control, indicates the specificity of the antibody cocktail. table 1 reports changes of 1.5-fold of the proteases, with respect to the healthy control. a positive signal of 29 proteases was detected out of 34, out of which 16 showed a significant change during progression of dn. figure 3(b) shows the plots as bar chart of the fluorescent intensity (f.i.) for each protease normalised by the f.i. of the superpool. positive spots were considered as those with a detection limit (signal - to - noise ratio) 3. a set of proteases appear to progressively increase in different groups of dn patients (especially for the cathepsin family with a progressive increase of a, c, d, l, and z) while only cathepsin e seems to decrease following a trend which becomes significant (less than 1.5-fold) in the macroalbuminuric group. in the family of kallikreins, kallikrein 3/psa, kallikrein 10, kallikrein 13, and kallikrein 6 could be biased by the gender distribution of samples in the groups. metalloprotease mmp9 is abundantly present in the normoalbuminuric group while mmp2 showed a progressive decrease reaching the threshold of 1.5-fold in the micro- and macroalbuminuric groups. other proteases which showed an interesting trend are ddp iv targets of gliptins and proteinase 3 (prtn3) or myeloblastin. ddp iv decreased in the normoalbuminic group and then increased during progression of dn while proteinase 3 (prtn3) has an opposite trend with a marked increase in the normoalbuminuric and microalbuminuric group to reach a normal level in the macroalbuminuric group. beside the relative quantitative amount we checked the activity of some of these proteases by gelatine zymography for metalloproteases (figure 4) which confirmed a clear increase of gelatinase activity in the normoalbuminuric group and by chromogenic substrates for dpp iv, kallikreins, cathepsins, and prtn3 (figure 5). spectrophotometric assays were performed in native condition and after organic delipidation to release proteases which can be localized in the vesicle lumen. after delipidation only the kallikrein family was significantly affected (full loss of activity) while all the other protease activities maintained the same profile. although there is a substantial increase of the cathepsin expression in the protease array, the colorimetric assay showed a decrease of the activity in the dn groups. moreover, it is interesting to notice that the activity of dpp iv was much lower in the dn groups independently of the levels detected in the array. proteinase 3 activity was high in the normoalbuminuric group but in the other groups it remained unchanged despite the higher levels especially in the microalbuminuric group. since proteomic profiling of uevs reported the presence of several protease inhibitors [18, 19 ], such discrepancy between activity and expression levels could be caused by the presence of protease inhibitors. based on the same assay, a protease inhibitor array to screen the expression of protease inhibitors was performed. out of 32 inhibitors 19 were present in the same pool, and 15 showed more than 1.5-fold change (table 2 and figure 6). also in this array we can identify different trends. firstly, 6 inhibitors appeared to be more abundant (cystatin b, fetuin b, angiotensinogen, serpin a8, serpin f1, and elafin) progressively in the 3 diabetic groups. those with decreased amounts showed either a progressive decrease which becomes significant in the micro- and/or macroalbuminuric groups (e.g., serpin b5 and timp-2) or very low amount in all the 3 dn groups (cystatin c e / m, emmprin / cd147, ha-2, and he4/wfdc2). finally, two protease inhibitors (lipocalin-2/ngal and protease nexin ii) showed a peculiar increase in the normoalbuminuric group and a sharp decrease in the macroalbuminuric cohort. in order to establish whether there is any functional interconnection between proteases and protease inhibitors we used the kidney & urinary pathway knowledge base (kupkb) designed to collect data set from scientific publications and other datasets related specifically to renal diseases. the query of the kupkb algorithm provided the protein network presented in figure 7. out of 30 entries which are up- or downregulated by 1.5-fold in the protease and protease inhibitor arrays, 11 entities were found to be connected as a network together. within the network we have found that cathepsin l via cystatin a is connected to the metalloproteases 9 and 2 thus, a further screening in western blot was carried out evaluating the full cohorts of samples as shown in figure 8 qualitatively confirming the array data. diabetic nephropathy (dn) is a major complication of diabetic patients, constituting the leading cause of eskd and considerably increasing cardiovascular risk and associated mortality. defining the pathophysiologic mechanisms in dn is necessary to better understand the disease and identify new targets for therapeutic intervention. kidney lesions can start to develop early during the quiescent period when the patient is still normoalbuminuric and with normal glomerular filtration rate (gfr). microalbuminuria has a solid role in the clinical practice and management of diabetic kidney disease (dkd). however, an increasing number of studies have shown that decrease of gfr can occur independently from the presence of albuminuria or progression to macroalbuminuria and therefore the utility of albuminuria itself has been questioned. thus, in addition to albumin excretion rate (aer) and gfr, selected biomarkers for the detection of early functional abnormalities have been proposed and recently reviewed by macisaac.. recently urinary exosomes or, more in general, urinary extracellular vesicles (uevs) have been actively studied for their biological role as a potentially new cell - to - cell communication system. despite the partly overlapping and confusing nomenclature, evs can be divided into various main categories with respect to their secretory pathway [21, 22 ]. thus, exosome vesicles are formed by inward invagination of the endosomal membrane in an ubiquitin - dependent mechanism which requires the endosomal sorting complex required for transport (escrt) machinery. exosomes are then released in the extracellular space when multivesicular bodies (mvbs) of late endosomes fuse with the plasma membrane and release their intraluminal vesicle cargo. microvesicles are shed vesicles or membrane particles which derive directly from the outward budding of plasma membrane in response to a variety of pathophysiological stimuli [44, 45 ]. furthermore, evs can mediate intercellular communication by delivering elements of genetic content from one cell to another in a paracellular fashion. thus, uevs faithfully reflect the antigenic characteristics of their parent cells thus making them excellent cell - type specific. this has led to an explosion of interest in evs as potential source of biomarkers as mirror of the pathophysiology of the cell of origin [19, 47 ]. thus, uevs can provide a good platform as a surrogate of a fluid biopsy to support the clinical management of, for example, diabetic patients, assuming the dn kidney damage is reflected in the repertoire of uevs with a specific fingerprint at each stage of disease progression. the first aim of this study was to isolate and characterize uevs from healthy donors and 3 cohorts of dn grouped according to the aer using a new isolation method developed in our group. this is based on a hybrid ultrafiltration - dialysis system which enriches vesicles without the interference of soluble protein like human serum albumin (hsa). as shown in figure 1 for all the samples under investigation, the main protein present in the uevs is tamm - horsfall protein (thp). thp is abundant in the healthy controls and it progressively decreases in the dn groups. no evidence of massive presence of human serum albumin (hsa) even in the macroalbuminuric group was seen. as expected, more prominent bands in the microalbuminuric and macroalbuminuric groups are visible at 62, 52, and 25 kda and these correspond to the heavy and light chains of immunoglobulin (ig) isotypes,,, and/or chains. immunoglobulins have been identified in the proteome profiling of uevs [18, 19 ] and elevated concentration of igg and iga in urine has been proposed as a novel mechanism of kidney damage independent from charge and size impairment in early dn [48, 49 ]. more dedicated studies are necessary to investigate the role of vesicles - ig interaction in dn for their role. detection of the exosomal marker tsg101 confirmed the abundance of uevs in the hfda fractions. additionally, a shift of the molecular weight of tsg101 was observed (figure 2). tsg101 can be acetylated and/or ubiquitylated and as component of the escrt - i machinery it binds ubiquitylated protein to sort it out into vesicles during its biogenesis to form the multivesicular body (mvb) which then either can release its vesicle cargo (exosomes) outside the cell and/or fuse with lysosome for degradation. thus, the ubiquitinated pattern of uevs in the healthy and dn groups was checked by western blot utilising a polyclonal antibody which recognised ubiquitin and monoubiquitinated proteins (figure 3). interestingly, the dn samples, at different stages of disease, provided a well defined and characteristic ubiquitome. this result along with decrease of tsg101 signal suggests that an impairment of the endosome / vesicle trafficking happens in the early stages of disease. ubiquitin, more in general the ubiquitin - proteasome, plays a pivotal role in the degradation of misfolded proteins, concentration, and turnover of cellular proteins. thus the ubiquitin - proteasome system works in synergy with lysosomal proteases, caspases, calpains, and separases to generate shorter polypeptides accessible to the proteasomes system for a full protein degradation. our results show convincingly that there are major intracellular changes reacting to altered microenvironment and this is reflected in the void uevs. proteases cover an important role not only in the pathogenesis of dn but more in general as the dynamic reaction obviously needed to keep the intracellular homeostasis, in our case to fight back the hyperglycaemia induced changes [54, 55 ]. in this study we wanted to focus our attention on proteases first and their well established inhibitors and how they are represented in the uevs as indicators of intracellular events. sixteen and nineteen proteases and inhibitors, respectively, changed by 1.5-fold with respect to the healthy group. cathepsins of the a, c, d, l, and xzp classes were found as markedly more abundant in the dn groups. the only one less represented is cathepsin e, while cathepsins b, s, and v did not show any change. cathepsins are lysosomal proteases, which can exert their proteolytic activity in the extracellular space in extracellular matrix (ecm) remodeling, and in synergy with mmp are implicated in the development of renal diseases (crds) [56, 57 ]. beside the increased level of cathepsin l the protease inhibitors array showed a concomitant increase of cystatin b a thiol proteinase inhibitor which, reversibly, binds cathepsin l. interestingly, neutrophil gelatinase - associated lipocalin (ngal) binds and preserves metalloproteinase 9 (mmp-9) from degradation thus supporting its gelatinase activity. increase of urinary excretion of ngal - mmp-9 has been described in diabetic subjects in a gender - specific manner. in our study proteases, protease inhibitors arrays, and their functional verification with zymography showed that this association is also reflected inside the uev fraction. intriguingly, whether these findings show a spillover reflection of the cellular reaction to elevated glucose content or a mechanism to allow specific targeting to more downstream sites of protease needs should be studied in detail. increase of the urinary level of dpp iv associated with microvesicles is correlated with the worsening of dn. in our array, we found that the level of dpp iv decreases in the normoalbuminuric group and then starts to progressively increase in the samples from patients with micro- and macroalbuminuria. independently of the levels dpp iv, its functional activity is markedly lower in the 3 dn groups than in control. sun and colleagues reported an increased excretion of dpp iv associated with microvesicles in type 2 diabetic patients. their results are in contrast with the result of our screening but the methodological approach can explain such a difference. while in our study we collected the whole amount of uevs retained in the dialysis tube, they enriched dpp iv using a specific monoclonal antibody anti - ad-1 (leucine aminopeptidase). the authors reported it to be expressed on the brush border of the proximal tubular in the cortex (s1, s2 segments) and in the outer medulla and in the medullary rays (s3 segments). however, dpp iv is widely expressed also in the glomeruli and an increase of dpp iv activity in podocytes is correlated with kidney injury [62, 63 ]. of course additional studies are necessary to better evaluate changes in the dpp iv levels in microvesicles. in order to analyze the link between the proteases and their inhibitor we used the kidney & urinary pathway knowledge base (kupkb) to specifically focus on proteins / genes relative to pathways in the kidneys. in addition to the mmps and their relative inhibitors, two relatively new proteins emerged which are potentially involved in the complexity of dn pathogenesis : myeloblastin and its natural inhibitor trappin-2. myeloblastin or proteinase 3 (prtn3) is a serine protease present in granules and the cell surface of neutrophils and monocytes. it has pleiotropic effects and multiple substrates including extracellular matrix and cytokines [64, 65 ] and it can be found in urine. recruitment of neutrophils in glomeruli and the release of prtn3 potentially lead to endothelial dysfunction. more recently podocytes have shown to actively regulate neutrophil recruitment through action of glomerular endothelial cells. prtn3 binds to the endothelial surface but it can be also internalised inducing apoptosis [69, 70 ]. moreover, prtn3 has been proposed as an inflammatory enzyme able to digest insulin - like growth factor 1 (igf-1) and the insulin - like growth factor - binding protein-3 (igfbp3) and promote glomerular inflammation in type 2 diabetes. interestingly, endothelial dysfunction and inflammation have been recently proposed as predictors of dn in type 1 and 2 diabetes [71, 72 ]. our results showed that also these mechanisms can be monitored by detecting a combination of selected proteases and their inhibitors. the protease array (figure 3), verified with the functional chromogenic activity (figure 5) and screening patients (figure 8), confirmed an increase of the level and activity already in the normoalbuminuric group : in patients with changes induced by hyperglycemia but with no signs of permanent kidney damage yet. indirectly we can generalize that hyperglycemia leads also to inflammation, contributes to the complexity of changes, and can be the ultimate functional component for apoptosis and autophagy. this is supported by the dysregulated ubiquitination mirrored in the uevs (figure 2). this is interesting as very recently it has been reported that the ubiquitination - dependent of coactivator - associated arginine methyltransferase 1 (carm1) can mediate podocyte apoptosis in dn. a more comprehensive analysis of the distinct proteases and their association to their preferential pathophysiological processes uevs have a strong potential as key elements for a fluid kidney biopsy by reflecting the respective pathophysiology, exact mechanisms involved, and often also information on the exact domain of the nephron affected. however, more detailed studies and, most preferably, correlating findings with those from tissue biopsies and clinical parameters are imperative. here we show that the new hydrostatic filtration dialysis method offers an unbiased approach for vesicle enrichment from urine and their subsequent use for distinct purposes of protease inhibitor studies. | diabetic nephropathy (dn) is one of the major complications of diabetes mellitus (dm), leads to chronic kidney disease (ckd), and, ultimately, is the main cause for end - stage kidney disease (eskd). beyond urinary albumin, no reliable biomarkers are available for accurate early diagnostics. urinary extracellular vesicles (uevs) have recently emerged as an interesting source of diagnostic and prognostic disease biomarkers. here we used a protease and respective protease inhibitor array to profile urines of type 1 diabetes patients at different stages of kidney involvement. urine samples were divided into groups based on the level of albuminuria and uevs isolated by hydrostatic dialysis and screened for relative changes of 34 different proteases and 32 protease inhibitors, respectively. interestingly, myeloblastin and its natural inhibitor elafin showed an increase in the normo- and microalbuminuric groups. similarly, a characteristic pattern was observed in the array of protease inhibitors, with a marked increase of cystatin b, natural inhibitor of cathepsins l, h, and b as well as of neutrophil gelatinase - associated lipocalin (ngal) in the normoalbuminuric group. this study shows for the first time the distinctive alterations in comprehensive protease profiles of uevs in diabetic nephropathy and uncovers intriguing mechanistic, prognostic, and diagnostic features of kidney damage in diabetes. |
pyloric stenosis (ps) is one of the most common surgical conditions affecting infants with an incidence of approximately 0.9%5.1% per 1,000 live births, generally presenting prior to 3 months of life.1,2 since the end of the 19th century, surgical intervention has been the primary treatment with first open and then subsequently laparoscopic pyloromyotomy.3 during the postoperative period, various options exist for the provision of postoperative analgesia, including opioids and non - opioid analgesics such as acetaminophen, local infiltration of the surgical site, or regional anesthesia. given the concerns of respiratory depression related to the patient s age and metabolic abnormalities, the use of opioids is generally limited or avoided.49 the current study retrospectively investigates the impact of the route of administration of acetaminophen (intravenous [iv ] versus rectal) on the analgesic effect following pyloromyotomy in infants. this study was approved by the institutional review board of nationwide children s hospital which deemed the study scientific and ethical (irb 14 - 00149), and registered at clinicaltrials.gov (nct02359305). the institutional review board of nationwide children s hospital waived the need to obtain written informed consent from the patients due to the retrospective nature of this study. infants undergoing pyloromyotomy over the past 3 years were identified and their records were retrospectively reviewed. patient demographic data included age at the time of surgery, weight, and sex. surgical information included surgical time and the type of procedure (open versus laparoscopic). the intraoperative anesthetic record was reviewed, and the following data were obtained : the route (iv or rectal) of administration and the dose of acetaminophen, additional medications that were administered intraoperatively including opioids or nonsteroidal anti - inflammatory agents, and the use of local anesthetic infiltration of the surgical site. postoperative variables included the place of tracheal extubation (operating room [or ] or postanesthesia care unit [pacu ]), pain scores, time in the pacu, the need for supplemental analgesic agents in the pacu and during the subsequent postoperative period, time to oral feeding, and time to hospital discharge. as per institutional routine, postoperative surgical pain is assessed in infants using the faces, leg, activity, cry, and consol - ability scale, which assigns a score of 010.10 to examine whether there were any statistical significant differences between the two groups (rectal and iv acetaminophen), a fisher s exact test was performed for the categorical variables. with the exception of weight, the continuous variables were nonnormally distributed ; therefore, a wilcoxon rank sum test was performed to examine the differences, while an independent sample t - test with an equal variance assumption was performed for weight. a total of 80 patients were identified who had undergone a pyloromyotomy for ps, of which 12 patients were excluded from the study as they received intraoperative opioids. the dose of iv acetaminophen was 8.63.9 mg / kg, while the dose of rectal acetaminophen was 30.76.3 mg / kg. all the patients also received local infiltration of the surgical site with 0.25% bupivacaine at the completion of the procedure. one received a dose of fentanyl in the pacu, and another received a dose of morphine in the inpatient ward. there was no difference between the two groups with regard to pain scores, time spent in the pacu, or time spent in the hospital (table 2). pacu pain scores, final pacu pain score, and average postoperative pain scores were similar in both groups (table 1). as per our clinical practice, depending on their emergence from anesthesia, the trachea of patients is either extubated in the or or in the pacu. twenty - four of 34 patients who received iv acetaminophen had their tracheas extubated in the or compared with 21 of 34 who received rectal acetaminophen. there was no difference in the number of children who tolerated oral feeds on the day of surgery or in the incidence of postoperative complications, including oxygen desaturation requiring supplemental oxygen, apnea, postoperative wound infection, persistent vomiting, and the need for surgical reexploration (table 2). the majority of patients in both groups received postoperative acetaminophen supplementation (27 and 31 in the rectal and iv acetaminophen groups, respectively). seven patients in the rectal group and three patients in the iv group did not require additional acetaminophen supplementation. the majority of postoperative acetaminophen was administered via the oral route although rectal acetaminophen was administered postoperatively in addition to oral acetaminophen in three patients in the iv group and two patients in the rectal group. there was no significant difference in the average number of supplemental acetaminophen doses between the two groups. during the postoperative course, the iv acetaminophen group averaged a total of 4.4 doses of supplemental acetaminophen versus 3.5 doses in the rectal acetaminophen group. the practice of anesthesiology involves choosing appropriate analgesic medications for a specific surgical patient population. the physiologic variability that exists among patients, including differences in gestational and chronological age, end - organ function, cardiopulmonary status, volume of distribution, and metabolic maturation, can affect drug pharmaco - dynamics and pharmacokinetics. therefore, analgesic agents must be chosen judiciously, taking into account the patient s unique physiology. however, this class of analgesics is associated with dose - dependent adverse effects which may impact postoperative outcomes especially in neonates and infants. alternative non - opioid analgesic agents exist, which may offer advantages to opioid monotherapy.11 the main theoretical advantage is the prevention of opioid side effects including constipation, nausea and vomiting, pruritus, respiratory depression, and opioid - induced hyperalgesia. opioid - related hypoventilation and apnea are of particular concern following anesthesia in neonates and infants undergoing pyloromyotomy for hypertrophic ps. cerebrospinal fluid alkalosis may persist even after the correction of systemic metabolic alkalosis and ph normalization.5,6 cerebrospinal fluid ph is one of the determinants of respiratory stimulus.57 this metabolic milieu along with hyperventilation (respiratory alkalosis), dehydration, use of neuromuscular blocking agents, the administration of inhalational anesthetic agents, and opioids during the anesthetic procedure can increase the risk of central apnea. the risk of central apnea is increased furthermore in premature infants who constitute approximately 12% of this population. neonates are especially sensitive to the respiratory depressant effects of opioids related to the immaturity of the central respiratory control centers.8 thus, an opioid - sparing technique is often advocated for these patients during pyloromyotomy.4 nonsteroidal anti - inflammatory drugs (nsaids) are an important class of non - opioid analgesics which have been used for the treatment of pain for more than a century.12 aspirin was introduced into the market by bayer in 1899. the primary mechanism by which nsaids exert their effects is via inhibition of the arachidonic acid cyclooxygenase pathways.13 this leads to a reduction in prostaglandin synthesis both peripherally at the site of injury and centrally in the spinal cord, decreasing inflammatory mediators and pain. iv ketorolac and iv ibuprofen are the two parenteral nsaids that are approved for use in the usa. however, given their adverse effect profile, it may be prudent to limit their use in the neonatal and infant population.14 acetaminophen is a commonly used non - opioid analgesic with a well - established safety and tolerability profile. it does not have the negative adverse effect profile that is associated with opioids (sedation, respiratory depression, constipation, and abuse potential). in addition, unlike nsaids, acetaminophen does not compromise renal function or increase the risk of bleeding. although standard dosing of rectal acetaminophen is similar to oral dosing (1015 mg / kg), more recent pharmacokinetic studies suggest that a larger initial loading dose (40 mg / kg) is required to achieve the desired plasma concentration.15 the preemptive administration of rectal acetaminophen has been shown to lower pain scores and decrease the need for rescue analgesia in patients, ranging from 7 years to 15 years of age, in various surgical procedures.16,17 however, due to its unpredictable systemic absorption, rectal acetaminophen s efficacy has been debated in medical literature.18 iv acetaminophen was approved by the us food and drug administration in november 2010 for the management of mild - to - moderate pain, as an adjunct to opioids for the management of moderate - to - severe pain, and the reduction in fever. as compared with peak acetaminophen plasma concentrations following oral (4560 minutes) and rectal administration (4 hours), iv acetaminophen results in rapid peak plasma concentrations at 15 minutes following infusion and an analgesic effect as quickly as 5 minutes with a duration of action up to 4 hours.19 information regarding iv acetaminophen use and dosing strategies for neonates and infants is limited. acetaminophen clearance reaches 84% of mature values by 1 year of age ; however, clearance is decreased in neonates when compared with adults.20,21 the opioid - sparing effect of iv acetaminophen remains controversial. sinatra reported a decreased need for rescue opioid therapy and a reduction in 24-hour total opioid consumption in adults undergoing major orthopedic surgery.22 dashti and korpela reported opioid - sparing effects with either rectal or iv administration.16,17 however, hiller noted no effect on total opioid needs with iv acetaminophen after major spine surgery in children and adolescents.23 our preliminary data suggest that there is no advantage with the use of iv acetaminophen over rectal acetaminophen for patients undergoing laparoscopic pyloromyotomy. the only variable for which there was a statistically significant difference between the two groups was acetaminophen dose (p<0.0001). patients who received iv acetaminophen had smaller doses (milligrams / kilograms) than patients who received acetaminophen rectally. the two groups did not differ significantly in pacu time, pain scores, acetaminophen supplementation, time to hospital discharge, time to oral feeding time, or perioperative complications. it may be that the inability to detect a difference relates to the fact that postoperative pain following laparoscopic pyloromyotomy is relatively mild and that effective analgesia can be achieved solely with the infiltration of a local anesthetic agent into the surgical site. the limitations of this retrospective study include the nonrandom distribution of patients into the two groups. in addition, as noted earlier, additional data are needed regarding acetaminophen pharmacokinetics in this age group. maintenance dosing ranging from 7.5 mg / kg to 10 mg / kg has been suggested, with some sources suggesting a loading dose of up to 20 mg / kg irrespective of age. however, regardless of the dose and the route of administration, the average pain scores were < m1 in the pacu and all patients except for one had a pain score of 0 at the time of discharge, suggesting that effective analgesia was achieved in both groups. another limitation of this retrospective study is the lack of uniform pain score documentation once on the hospital floor. pain assessment on the floor typically occurs every 4 hours ; however, some data were missing during our retrospective review. iv acetaminophen has a clear benefit in patients who can not tolerate acetaminophen via oral or rectal routes. however, outside of this scenario, the advantage of iv acetaminophen over other formulations is unclear. from a pharmacokinetics standpoint however, the clinical difference remains to be determined depending on the clinical scenario and the type of surgical procedure. in summary, for patients undergoing laparoscopic pyloromyotomy, our preliminary data suggest that there is no clinical advantage with the use of iv compared with rectal acetaminophen. pain scores, acetaminophen supplementation, pacu discharge time, length of hospital stay, and nonsurgical complications were similar in both groups (iv versus rectal acetaminophen). given the superficial nature of the surgical incision sites, infiltration with a local anesthetic agent may play a bigger role in controlling postoperative pain than the acetaminophen formulation. | backgroundduring the perioperative care of infants with hypertrophic pyloric stenosis, an opioid - sparing technique is often advocated due to concerns such as postoperative hypoventilation and apnea. although the rectal administration of acetaminophen is commonly employed, an intravenous (iv) preparation is also currently available, but only limited data are available regarding iv acetaminophen use for infants undergoing pyloromyotomy. the objective of the current study was to compare the efficacy of iv and rectal acetaminophen for postoperative analgesia in infants undergoing laparoscopic pyloromyotomy.methodsa retrospective review of the use of iv and rectal acetaminophen in infants undergoing laparoscopic pyloromyotomy was performed. the efficacy was assessed by evaluating the perioperative need for supplemental analgesic agents, postoperative pain scores, tracheal extubation time, time in the postanesthesia care unit, time to oral feeding, and time to hospital discharge.resultsthe study cohort included 68 patients, of whom 34 patients received iv acetaminophen and 34 received rectal acetaminophen. all patients also received local infiltration of the surgical site with 0.25% bupivacaine. no intraoperative opioids were administered. there was no difference between the two groups with regard to postoperative pain scores, need for supplemental analgesic agents, time in the postanesthesia care unit, or time in the hospital. there was no difference in the number of children who tolerated oral feeds on the day of surgery or in postoperative complications.conclusionour preliminary data suggest that there is no clinical difference or advantage with the use of iv versus rectal acetaminophen in infants undergoing laparoscopic pyloromyotomy. |
in late august 2003, local, state, and federal health officials began an investigation to determine the risk factors associated with an outbreak of cryptosporidiosis and to develop interventions to control it. the epidemiologic investigation resulted in 96 laboratory - confirmed cases of cryptosporidium infection and > 600 clinical cryptosporidiosis cases. brfss is an established nationwide population - based telephone survey system that primarily measures behavioral risk factors associated with leading causes of death. it is currently the largest continuous telephone survey in the world ; it expanded to all 50 states in 1993 (http://www.cdc.gov/brfss). in kansas, the health risk studies program conducts the brfss in - house and provides the capacity and expertise to design and implement special surveys. during this outbreak investigation, kdhe, the lawrence - douglas county health department, and the centers for disease control and prevention (cdc) used the brfss infrastructure, which consisted of a fully networked, computer - assisted telephone interviewing system (wincati sawtooth technologies, northbrook, il, usa) to conduct a case - control study. we conducted a matched case - control study to identify specific risk factors for infection. clinical cryptosporidiosis patients were identified during the case ascertainment portion of the study, by surveying households of elementary school children and persons who had sought healthcare for diarrheal symptoms. all laboratory - confirmed patients were enrolled, as were a random selection of clinical cryptosporidiosis patients within 4 age strata. two controls were matched to each patient, and each control was asked the same questions for the specific exposure period of the patient to whom they were matched. a maximum of 1 case - patient or control - patient per household was enrolled. the cati system relies on a networked central server with both interviewer and supervisory stations (figure 1). the system allows for questionnaire programming, record management, scheduling of calls, and monitoring the disposition of calls. telephone numbers for patients were programmed into the cati system ; controls were identified by random digit dialing. telephone numbers, which included all telephone exchanges represented in the 100,000-person county, were purchased from a commercial survey research sample provider. this sample was prescreened to remove both business and nonworking numbers but did include unlisted numbers. all residential numbers in the community were eligible, and the cati system released the telephone numbers randomly. frequency matching controls to patients was performed by inquiring for a person at the residence within a certain age range. the questionnaire was programmed into the cati system by using both range and logic checks, to minimize data entry errors, as well as skip patterns, which allow the respondent to answer only those questions that pertain to them. twenty brfss personnel were trained in two 1-hour training sessions on the use of the outbreak instrument and conducted pilot testing of the questionnaire for appropriate wording and skip patterns. kansas health risk studies program computer - assisted telephone interview (cati) system architecture for case - control study. approximately 11,400 telephone calls were made, and 770 interviewer hours were used in a 41-day period to complete 151 case - patient and 302 control interviews. the average interview length for completion of the case questionnaire was 28 minutes, and the average interview length for completion of the control questionnaire was 16 minutes (table). data from the investigation showed multiple risk factors associated with cryptosporidium infection, including exposure to several recreational water venues. this study highlights the feasibility and potential benefits of a coordinated effort between chronic and infectious disease sections at local, state, and federal public health agencies in responding to an acute infectious disease outbreak. we used existing infrastructure and resources in the chronic disease division of a state health department to conduct a communitywide case - control study. to our knowledge, this is the first time a cati system based at a state health department has been used to respond to an acute infectious disease outbreak. the brfss program at kdhe has facilitated the development of the internal expertise and infrastructure necessary to design and implement large - scale and complex telephone surveys. this program includes providing a cohort of trained interviewers who could efficiently collect data to allow a comprehensive assessment of the risk factors associated with cryptosporidium infection in this outbreak. with the wincati system, interviewers were able to enter questionnaire data directly into the computerized system in real time, thus creating a database that could be easily converted into a variety of statistical programs for data analysis. the questionnaire was programmed to require certain data before proceeding (logic checks) or to warn the user of an incorrect entry (data checks), thus decreasing the possibility of missing or including incorrect data. use of an existing infrastructure did not require immediate recruitment and training of volunteer interviewers, the traditional method for outbreak investigations, but provided a trained interviewing staff. additionally, this mechanism liberated the professional public health staff to focus their efforts on the multifaceted public health interventions required in a communitywide outbreak. the use of existing cati systems may be of value in several circumstances. as demonstrated here, in large, communitywide outbreaks, cati systems can provide substantial resources and personnel capacity that may substantially enhance investigation efforts in responding to a public health threat. additionally, cati systems, similar to brfss, are well - suited for performing long - term studies, for on - going studies attempting to determine the source of sporadic infectious disease cases, and for public health surveillance. they can also provide a practical means of obtaining controls for case - control studies. nevertheless, several limitations should be noted about the use of population - based telephone surveys in responding to acute outbreak scenarios. unlike traditional communicable disease control programs, community telephone survey efforts, such as brfss, were not created for immediate response, and therefore their use in this context has some limitations. these include the time required to program the questionnaire into a cati system and the organization of professional staff time in an outbreak situation. the preprogramming of generic infectious disease outbreak questionnaire modules (e.g., demographics, clinical symptoms, or foodborne or waterborne exposures) into a cati system may help decrease the start - up time required for questionnaire implementation. these include smaller focal outbreaks in which the use of many resources and lengthy start - up times would be disadvantageous ; particularly when these investigations are within the capacity of existing communicable disease programs. these include the following : selection bias, inclusion of only those who have a home telephone number ; and response bias. in addition, those who participate may be different from those unwilling to participate, and declining response rates have been noted among telephone surveys (12). moreover, the regular use of a cati infrastructure, like brfss, for acute outbreak situations needs to be further assessed to prevent it from detracting from standard brfss activities. cati systems, therefore, may not replace existing disease investigation programs but have the potential to supplement these programs. using existing state - based infrastructure in the chronic disease arena should be considered as a potential response strategy for future public health emergencies, and state health departments should consider developing plans and identifying financial resources for implementing similar strategies when performing large - scale investigations. because many state health departments may contract with a survey research firm to perform population - based telephone surveys, including reference to special studies related to urgent public health needs using cati systems provides an innovative and potentially valuable adjunct to current outbreak investigation methods and should be considered as a viable addition or alternative for conducting acute outbreak investigations, particularly during large - scale, emergency situations when resources are limited. | in august 2003, a communitywide outbreak of cryptosporidiosis occurred in kansas. we conducted a case - control study to assess risk factors associated with cryptosporidium infection by using the telephone survey infrastructure of the behavioral risk factor surveillance system. using existing state - based infrastructure provides an innovative means for investigating acute outbreaks. |
the internal globus pallidus (gpi) and substantia nigra pars reticulata (snr) are the basal ganglia (bg) output nuclei. besides projecting to the thalamus to form the cortico - bg loops (chevalier., 1985 ; smith and bolam, 1989 ; alexander and crutcher, 1990 ; delong, 1990 ; smith., 1998 ; haber, 2003), output nuclei also project to pons and brain stem to control descending pathways and central patterns generators (cpgs) that regulate muscular tone and automatic or rhythmic motor responses (takakusaki., 2003, 2004 ; grillner., 2008). in birds, reptiles, and lower vertebrates in which the cortex is not well developed, the control of brain stem nuclei is a main function of the bg (reiner., 1998 ; grillner., 2005, 2008 ; gale and perkel, 2010). in the snr, inhibitory postsynaptic currents (ipscs) are in part provided by striatonigral direct pathway terminals (grofov and rinvik, 1970 ; chevalier., 1985 ; smith and bolam, 1991 ;, 1996 ; matuszewich and yamamoto, 1999), which possess functional presynaptic dopamine d1-receptors whose activation increases direct pathway inhibition (porceddu., 1986 ; altar and hauser, 1987 ; floran., 1990 ; radnikow and misgeld, 1998 ; chuhma., enhancement of direct pathway inhibition facilitates movements while its reduction represses them (albin., 1989 ; in contrast, subthalamonigral afferents compose the last step of the indirect pathway (nakanishi. presynaptic modulation of subthalamonigral terminals by dopamine uses both classes of dopamine receptors : d1 and d2 (ibez - sandoval., 2006). activation of d1 enhances while activation of d2 depresses subthalamonigral excitatory postsynaptic currents (epscs). interestingly, simultaneous blockade of both receptors induced larger evoked epscs, suggesting that d2-receptors have more influence than d1-receptors in the modulation of transmission (ibez - sandoval., 2006). in parallel, the external globus pallidus (gpe) also sends an inhibitory input to snr (bevan., 1996 ; kita, 2007 ; connelly., 2010). we found that d2-class receptors regulate these terminals with no sign of d1-receptor modulation as compared to striatonigral d1-mediated modulation in the same preparation. interestingly, and as shown before for subthalamonigral afferents (ibez - sandoval., 2006), we found that addition of selective receptor antagonists disclose a tonic action of ambient dopamine levels on both, striatonigral and pallidonigral afferents, supporting the notion that dopamine receptors are sensing extracellular dopamine continuously (yanovsky., 2003). furthermore, the blockade of all dopamine receptor types altogether induced a recurrent bursting firing pattern in snr projection neurons, a mode of firing typically seen in both parkinsonian humans and animals (e.g., magill., 2001 ; walters., 2007 ; walters and bergstrom, 2009 ; zold., 2009). this finding indicates that it is enough to acutely block dopamine receptors to induce a parkinsonian firing pattern in snr neurons. given the direct projection of snr to brain stem nuclei controlling muscular tone and cpgs activation, a question as to whether dopamine dysfunction in the output nuclei is enough to produce some parkinsonian signs (morris., 1994 ; hemsley and crocker, 1998 ; hikosaka., 2000 ; procedures were carried out in accordance with the national institutes of health guide for care and use of laboratory animals (nih publications no. 8023, revised 1996) and were approved by the institutional animal care committee of unam. methods have been reported elsewhere (beurrier., 2006 ; ibez - sandoval., 2006). briefly, wistar rats (1540 postnatal day), were anesthetized with isoflurane, decapitated, and their brains removed. parasagittal or parahorizontal slices (300 m) containing the neostriatum (nst), globus pallidus (gp), and substantia nigra pars reticulata (snr) were obtained with a vibratome in saline of the following composition (in millimolar) : 124 choline chloride, 2.5 kcl, 1.0 mgcl2, 1.2 nah2po4, 2.0 cacl2, and 10 glucose (~4c 95% o2, 5% co2). whole - cell patch - clamp recordings were performed on rat snr neurons (ibez - sandoval., 2006, 2007). neurons within the snr were visualized with infrared differential interference videomicroscopy using a x60 water immersion objective. for voltage - clamp recordings micropipettes 25 m resistance were filled with internal saline containing high cl (in millimolar) : 70 kh2po4, 36 kcl, 2 mgcl2, 10 hepes, 1.1 egta, 0.2 na2atp, 0.2 na3gtp, 5 mm qx-314, 5 mm cscl, and 0.1% biocytin (ph 7.2 ; 275 mosm / l) that allowed to record inward ipscs from snr neurons after field stimulation in the internal capsule (ic) 0.51.0 mm outside the snr border (radnikow and misgeld, 1998 ; wallmichrath and szabo, 2002). bipolar pencil shaped concentric tungsten electrodes, 11.5 m at the tip, and 1 k dc resistance were used. for current - clamp recordings we used internal saline of the following composition (in millimolar) : 120 kso3ch4, 10 nacl, 10 egta, 10 hepes, 1 cacl2, 2 mgcl2, 2 atp - mg, 0.3 gtp - na (ph 7.3, 290 mosm / l. superfusion saline contained antagonists for glutamatergic receptors : 10 m 6-cyano-7-nitroquinoxaline-2,3-dione (cnqx) and 50 m d-()-2-amino-5-phosphopentanoic acid (apv) to isolate ipscs. in parasagittal slices, 3 out of 10 recordings evoked pallidonigral ipscs and the rest evoked striatonigral ipscs (figure 1). in parahorizontal slices 6 out of 10 recordings evoked pallidonigral ipscs and the rest evoked striatonigral ipscs. ipscs from each source were easily discernible with electrophysiological techniques (figure 1 ; connelly., 2010) so that when an obvious mixture of ipscs from both sources was obtained, it was discarded from the present analysis. a paired - pulse protocol was employed with inter - pulse intervals of 50 ms to evaluate changes in the paired - pulse ratio (ppr) of evoked ipscs (ppr = 2nd ipsc/1st ipsc) to verify presynaptic actions of transmitters (ibez - sandoval., 2006). because striatonigral fibers pass through the gpe, d2-class selective agonists were tested in slices taken from animals with a stereotaxic lesion (ibotenic acid) of the gpe (1.4 mm ap, 3.4 l, and 4.7 mm v) and compared to recordings obtained without a lesion. ibotenic acid solution (dissolved in pbs adjusted to ph 7.4 with naoh 3.0 g/0.4 l) was used to lesion the gpe. (a) striatonigral inhibitory postsynaptic currents (ipscs) exhibited paired - pulse facilitation. (c) short - term synaptic plasticity (stp) from striatonigral afferents is facilitation. (e) intensity amplitude plots (i a plots) from striatonigral ipscs exhibit a sigmoidal shape. (f) i a plots from pallidonigral ipscs exhibit a jump to maximal amplitude after reaching threshold. a plots were fitted to : a(i) = amax/(1 + e) where a(i) = ipsc amplitude as a function of stimulus intensity, amax = maximal amplitude reached, k = slope factor, and ih = stimulus intensity necessary to reach ipsc amplitude equal to half maximal amplitude. drugs were stored as dry aliquots and stock solutions were prepared prior to each experiment and added to the perfusion solution in the final concentration indicated. skf 81297 : ()-6-chloro-2,3,4,5-tetrahydro-1-phenyl-1h-3-benzazepine hydrobromide (10 nm50 m) ; sch 23390 : 7-chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1h-3-benzazepine (50 nm and 1 m) ; cnqx : 6-cyano-7-nitroquinoxaline-2,3-dione (10 m), d - ap-5 : d-()-2-amino-5-phosphopentanoic acid (50 m), bicuculline methiodide or methchloride (10 m), and qx-314 (5 mm inside the recording pipette), all were obtained from sigma - aldrich (st. louis mo, usa). the neurons in the present work were snr projection neurons (n = 250 ; see : ibez - sandoval., 2006). ipscs parameters from different afferents, i.e., striatonigral and pallidonigral were compared with mann ipscs parameters in the same synapses before and after adding a given drug were compared with wilcoxon 's t - tests. at least 10 min of stable recordings before and after administering the drugs were used to reach stable average ipscs amplitudes. differences in parameters of fitted functions were compared by using their estimation error and student 's t - tests. figure 1 shows that striatonigral and pallidonigral synaptic inputs can not be confused (connelly., 2010). for similar stimulus, evoked striatonigral ipscs were significantly smaller than pallidonigral ipscs (mean sem for the first ipsc of a paired response) : 235 50 pa (n = 32) vs. 1399 152 pa (n = 20 ; p < 0.0001), respectively. responses to paired - pulse stimulation were also different : striatonigral ipscs showed paired - pulse facilitation : ppr = 1.41 0.07 (figures 1a, g ; n = 30) whereas pallidonigral ipscs always exhibited paired - pulse depression : ppr = 0.4 0.06 (figures 1b, g ; n = 19 ; p < 0.0001), although not always as strong as that depicted in figure 1d. short - term plasticity (10 pulses at 20 hz) exhibited facilitation without failures in striatonigral connections (figure 1c ; n = 8), whereas it exhibited depression with intermittent failures in pallidonigral synapses (figure 1d ; n = 4). the decay time constant / rise time ratio was also different : 4.5 0.5 (n = 30) in striatonigral synapses and 12.6 0.8 in pallidonigral synapses (n = 19 ; p < 0.0001) showing that pallidonigral ipscs are briefer than striatonigral ones (connelly., 2010). intensity amplitude (i a) relationships were also constructed and fitted to a three parameter sigmoidal function (tecuapetla., 2005) : where a(i) = ipsc amplitude as a function of stimulus intensity, amax = maximal amplitude reached, k = slope factor, and ih = stimulus intensity necessary to reach ipsc amplitude equal to half maximal amplitude. all three parameters were significantly different when comparing ipscs from striatonigral vs. pallidonigral afferents : amax : 430 3 pa vs. 1512 10 pa (n = 8 ; p < 0.0001) ; k = 3.6 0.3 vs. 14 5 (n = 8 ; p < 0.0001) and ih : 2.3 0.2 vs. 1.1 0.1 (n = 8 ; p < 0.005). these features coincide with a previous report (connelly., 2010) and were verified qualitatively by evoking ipscs from either the subthalamic nucleus (nst) or the gpe, however, in these occasions ipscs were considerably smaller and amplitude could not be compared by itself given the different distances from stimulating and recording electrodes (not shown). striatonigral ipscs features have been well described (radnikow and misgeld, 1998 ; wallmichrath and szabo, 2002 ; beurrier., 2006 ; chuhma., 2011) as well as ipscs from pallidal origin making synapses into the snr and other nuclei (tecuapetla., 2005 ; baufreton., 2009 ; connelly., 2010). finally, three of these variables were used to build a cluster plot (figure 1 g) which confirmed the easiness to separate ipscs from each source. as it has been repeatedly demonstrated, the action of dopaminergic d1-class selective agonists at nanomolar concentrations was that of enhancing striatonigral ipscs (floran., 1990 ; radnikow and misgeld, 1998 ; chuhma., 2011) : striatonigral ipsc increased 153 10% after 300 nm skf 81297 (n = 15 ; p < 0.001) and the paired - pulse ratio (ppr = ipsc2/ipsc1) decreased from 1.4 0.13 in the control to 1.0 0.12 during skf 81297 (p < 0.001), confirming a presynaptic modulation. these actions were reversible and blocked by 100 nm of the d1-antagonist sch 23390 (n = 5 ; not shown here but see below) indicating that at these concentrations the action is specific. in addition, here we show that the agonists have no significant action on pallidonigral ipscs (cf., figures 2a, b). contrasting actions of d1- and d2-receptor agonists on striatonigral and pallidonigral ipscs. (a) 100 nm of the selective d1-class receptor agonist, skf 81297, enhanced striatonigral ipscs. (b) (c) 500 nm of the selective d2-class receptor agonist, quinelorane, had no significant action on striatonigral ipscs. record 3 in each frame is the superimposition of records 1 and 2 after normalization of the first ipsc to better appreciate the ppr change when it is present. contrasting results were obtained when a selective d2-class receptor agonist, 500 nm quinelorane, was employed : striatonigral ipscs suffered no significant alteration (figure 2c ; n = 5 ns ; chuhma., 2011) whereas pallidonigral ipscs were significantly inhibited (figure 2d) by 73 18% (figure 2d ; n = 19 ; p < 0.0001). ppr increased from 0.76 0.1 to 1.83 0.2 (p < 0.001), suggesting a presynaptic action. these actions were reversible and blocked by 500 nm sulpiride, a d2-antagonist (n = 5 ; not shown but see below). summarizing, physiological action of d1-receptor agonists on striatonigral terminals is that of ipsc enhancement as previously shown (floran., 1990 ; radnikow and misgeld, 1998 ; chuhma., 2011) with no action on pallidonigral terminals on the other hand, physiological action of d2-receptor agonists on pallidonigral ipscs is that of depression with no significant action on striatonigral terminals. therefore we were forced to infer that reports about d1-mediated inhibition of striatonigral terminals (miyazaki and lacey, 1998) were either involving a non - specific action, a pallidal contamination, or both. to test this hypothesis we used larger micromolar concentrations of the d1-agonist while evoking ipscs from both pathways. figures 3a, b show that 5 m skf 81297 decreased ipscs evoked from both set of terminals. striatonigral ipsc decreased 82 13% (n = 18 ; p < 0.001) and pallidonigral responses decreased by 35 15% (n = 6 ; p < 0.005). these actions could not be blocked by micromolar concentrations of sch 23390 (not shown), suggesting that they were not specific. in view of these results response relationship (c r plot) using a wide range of skf 81297 concentrations while stimulating striatonigral afferents. this c r plot can be seen in figure 3c : it is biphasic. when the hill equation was fitted to the ascending (specific part) ec50 was 440 60 nm and the hill coefficient 1.6 0.2, suggesting cooperativity and a specific action at submicromolar concentrations. moreover, the fact that pallidonigral inputs are also affected when they do not respond when submicromolar concentrations of agonists are used confirmed non - specific actions. record 3 in each frame is the superimposition of representative records 1 and 2 after normalization of the first ipsc to better appreciate the ppr change when it is present. (c) concentration response relationship (c r plot) showed a biphasic response on striatonigral responses : once 3 m are surpassed, ipscs decay with increasing concentrations. ascending c r plot was fitted with the hill equation finding a submicromolar ec50. given the low concentrations of agonists needed to activate d1- and d2-class receptors in their respective terminals (striatonigral and pallidonigral) we inferred that, perhaps, endogenous extracellular dopamine exerts a tonic action on these receptors. figures 4a, b show that 50 nm of a d1-class receptor selective antagonist, sch 23390, are enough to inhibit striatonigral ipscs with no significative action on pallidonigral ipsc. striatonigral ipsc decreased from 319 75 in the control to 150 11 pa after 50 nm sch 23390 (n = 12 ; p < 0.02). figures 4c, d confirm these findings and further show that potency and speediness of d1-action is concentration dependent. almost abolished when a low micromolar antagonist concentration is maintained in the superfusion (figure 4c). traces chosen at different times during the time course, superimposed, and normalized to the amplitude of the first ipsc, show that the ppr is greatly increased from 1.9 0.4 in the control to 2.4 0.6 after sch 23390 (n = 21 ; p < 0.001 ; when the ipsc is abolished ppr can not be measured) ; confirming a presynaptic site of action. on the other hand, sch 23390 did not produce any action on pallidonigral ipsc at any concentration (figure 4d). in summary, d1-receptors in direct pathway striatonigral terminals are sensitive detectors of extracellular dopamine. moreover, (a) 50 nm of selective dopamine d1-receptor antagonist, sch 3390, are enough to reduce striatonigral ipsc amplitude. (c) increasing d1-antagonist concentration (1 m) greatly reduced ipsc while speeding up dopamine actions on striatonigral ipsc, suggesting a concentration dependent mechanism. (e) 500 nm u-9914a, a selective d3-type receptor antagonist, significantly enhanced pallidonigral ipsc. (f) 500 nm ly750, a selective d4-type receptor antagonist, significantly increased pallidonigral ipsc. record 3 in each frame is the superimposition of representative records 1 and 2 after normalization of the first ipsc to better appreciate the ppr change when it is present. in addition, figures 4e, f illustrate the actions of selective antagonists for d3- and d4-type dopamine receptors : 500 nm u-9914a, a selective d3-type receptor antagonist enhanced pallidonigral ipscs by 262 16% after (n = 12 ; p < 0.001) while the ppr decreased from 0.87 0.08 in the control to 0.51 0.1 during the antagonist. on the other hand, 500 nm ly750, a selective d4-type receptor antagonist increased pallidonigral ipscs by 170 20% (n = 7 ; p < 0.001) while ppr decreased from 0.78 0.07 in the control to 0.57 0.09 during the blockade. sulpiride a generic d2-class receptor antagonist had similar actions (not shown) : pallidonigral ipscs increased by 150 14% (n = 3) while ppr decreased from 0.77 0.03 in the control to 0.35 0.01 during blockade. to summarize, d3/4-receptors in pallidonigral terminals (murray., 1994 ; bevan., 1996 ; marshall., 2001, 2009 ; gasca - martinez., 2010) are sensitive to extracellular dopamine, which has the role of tonically repressing the force of these synapses. some functional differences in the actions of these receptor types perhaps deserve further investigation (cf., figures 4e, f). finally, because subthalamonigral terminals are also tonically controlled by presynaptic dopamine receptors (d1- and d2-class ; ibez - sandoval., 2006) and because blockade of these receptors enhance subthalamonigral epscs (ibez - sandoval., 2006), we propose the following hypothesis based in the present and previous results (radnikow and misgeld, 1998 ; acosta - garca., 2009 ; chuhma., 2011) : that acute blockade of both d1- and d2-class (including d3/4-types) receptors (by 1 m sch 23390 plus 1 m sulpiride) altogether may decrease direct pathway synapses (striatonigral) and, at the same time, enhance indirect pathway synapses (subthalamonigral and pallidonigral), both actions being required in physiopathological models of parkinsonism to elicit the signs of the disease. the result can be seen in figure 5 : snr neurons shifted from a tonic firing pattern in the control to a bursting firing pattern after blockade of dopamine receptors (n = 7 neurons ; ibez - sandoval., 2007). spontaneous tonic firing was the usual firing pattern recorded in snr neurons in control conditions (top). during acute blockade of dopamine d1- and d2-class receptors (1 m sch 23390 plus 1 m sulpiride) snr firing pattern shifted from tonic to a bursting pattern in n = 7 cells ; two cells exhibited bursting before adding the blockers. to see whether besides striatonigral and pallidonigral afferents, subthalamonigral afferents were also contributing to this firing mode, the glutamate nmda - receptor antagonist, 50 m apv was added to the bath saline (bottom). the firing tended to return to a tonic firing pattern but it was frequently interrupted by sudden hyperpolarizations. one of the most supported neuronal correlates of parkinsonism : recurrent bursting in snr neurons, was similar to that previously reported in vivo and in vitro (hammond., 2007 ; ibez - sandoval., 2007 ; walters., 2007 ; walters and bergstrom, 2009 ; zold., 2009) transitions from tonic to bursting firing mode can rarely be seen spontaneously in control preparations (ibez - sandoval., 2007). to see whether excitatory subthalamonigral afferents, that is, the stn - gp circuit, was participating in this firing behavior, we added the nmda - receptor antagonist apv (50 m) to provoke a partial block of stn influence. the result was that the firing pattern became less bursty and more tonic (ibez - sandoval., 2007), however, firing was still abruptly interrupted by sudden hyperpolarizations, probably coming from enhanced pallidonigral inputs. the present work shows that extracellular dopamine concentrations are tonically being sensed by the synaptic terminals of inhibitory inputs to the snr in opposite ways. thus, blockade of d1-type receptors in striatonigral (direct pathway) afferents decreased striatonigral inhibition while blockade of d3/4-types receptors in pallidonigral terminals enhanced pallidonigral inhibition. still other inputs to the snr have to be studied to see whether they are presynaptically modulated. in addition, they exhibit short - term facilitation and are positively regulated by d1-receptors (floran., 1990 ; radnikow and misgeld, 1998 ; connelly., 2010) strong evidence for the last property has been obtained with optogenetic techniques (chuhma., 2011), supporting the present and previous reports. in comparison, pallidonigral ipscs are larger and exhibit different degrees of short - term depression (connelly., 2010). notably, short - term facilitation works as a high pass filter of incoming inputs whereas short - term depression works as a low pass filter (abbott and regehr, 2004). in contrast, subthalamonigral excitatory synapses are controlled by both d1- and d2-class receptors (ibez - sandoval., selective dopamine receptor agonists exert their specific actions at nanomolar or low micromolar concentrations but higher concentrations become non - specific, thus explaining previous contradictions (cf., miyazaki and lacey, 1998 ; radnikow and misgeld, 1998) and probably similar discrepancies within the striatal / accumbinal circuitry (guzman., 2003 ; taverna., 2005). to summarize : d1-receptor activation enhances gaba release in terminals from medium spiny neurons of the direct pathway whereas d3/4-receptor activation represses gaba release from pallidonigral terminals. because nanomolar concentrations of selective receptor agonist are needed to modify transmission, we hypothesized that administrations of selective dopamine receptor antagonist would disclose the actions of endogenous dopamine present in the extracellular space. therefore, to disclose the action of ambient endogenous dopamine we applied selective d1- and d3/4-receptor antagonists. our findings were that according to the concentration, suppression of endogenous dopamine action greatly reduced striatonigral transmission while it enhanced pallidonigral transmission. these results indicated that extracellular dopamine concentrations are regulating synaptic release probability in both types of connections, increasing release probability in striatonigral synapses and decreasing release probability in pallidonigral synapses. therefore, the following working hypothesis resulted from the present experiments : tonic levels of dopamine in snr are necessary to maintain the normal function of direct pathway connections and maintain in check indirect pathway synapses from both pallidonigral terminals (present work) and subthalamonigral terminals (ibez - sandoval., 2007). the logical functional consequence of this hypothesis was tested : blockade of tonic dopamine action would enhance indirect pathway transmission and reduce direct pathway input thus yielding a previously observed neuronal correlate of parkinsonism : snr neurons shifted their tonic firing pattern to a bursting firing pattern typical of subjects with the disease (takakusaki., 2004 ; rivlin - etzion., 2006 ; hammond., 2007 ; ibez - sandoval., 2007 ; walters. tonic spontaneous firing is preserved in the slice preparation in both gpe and stn (e.g., beurrier., 1999 ; chan., 2011). calcium imaging techniques recording dozens of cells simultaneously within the striatal circuit show that there is always some spontaneous activity in striatal spiny neurons in control conditions (carrillo - reid., 2008). moreover, there is a great amount of convergence between the striatum and the substantia nigra and inhibitory striatonigral events are of large amplitude (e.g., chuhma., 2011). therefore, the lost balance between direct and indirect pathways by the acute blockade of dopamine receptors is the most probable cause of bursting in snr neurons during the present experiments. postsynaptic dopamine receptors on snr neurons can not explain bursting because their function is to increase tonic firing frequency via a cation current ; their blockade resulting in lower tonic frequency with irregularities, but not continuous bursting behavior (lee and tepper, 2007 ; zhou., 2009). because the change in firing pattern of snr neurons was achieved acutely by blocking dopamine receptors one can speculate what would happen during a chronic absence of dopamine in the output nuclei of the bg. the absence of dopamine (e.g., parkinsonism) may reduce the function of direct pathway synapses in such a way that maintaining this state of affairs in the long - time would lead to loss of direct pathway synapses due to long - term synaptic plasticity. in contrast, maintaining a high function in pallidonigral and subthalamonigral synapses would produce long - term potentiation of these synapses. these events taken together may tend to change the circuitry permanently, making not only l - dopa inefficient but, perhaps, making the chronic diseased circuitry radically different than the control or healthy circuit : that is, more dependent on the subthalamopallidal loop (magill. bursting in snr neurons leads to tremor and rigidity (hemsley and crocker, 1998 ; takakusaki., moreover, this configuration of synaptic weights would lead to the loss of high pass filtering of snr inputs (direct pathway 's short - term facilitation) and an increase in low pass filtering of snr inputs (pallidonigral short - term depression ; abbott and regehr, 2004) setting the stage to favor the entrance to an akinetic frequency lock (hutchison., 2004 ; avila., 2010). consequently, therapeutic ways of activating the direct pathway in the chronic patient may be fundamental to avoid irreversible plastic changes in the network (hammond., 2007 ; walters and bergstrom, 2009 ; zold., 2009 ;, they exhibit short - term facilitation and are positively regulated by d1-receptors (floran., 1990 ; radnikow and misgeld, 1998 ; connelly., 2010) strong evidence for the last property has been obtained with optogenetic techniques (chuhma., 2011), supporting the present and previous reports. in comparison, pallidonigral ipscs are larger and exhibit different degrees of short - term depression (connelly., 2010). notably, short - term facilitation works as a high pass filter of incoming inputs whereas short - term depression works as a low pass filter (abbott and regehr, 2004). in contrast, subthalamonigral excitatory synapses are controlled by both d1- and d2-class receptors (ibez - sandoval., 2006). selective dopamine receptor agonists exert their specific actions at nanomolar or low micromolar concentrations but higher concentrations become non - specific, thus explaining previous contradictions (cf., miyazaki and lacey, 1998 ; radnikow and misgeld, 1998) and probably similar discrepancies within the striatal / accumbinal circuitry (guzman., 2003 ; taverna., 2005). to summarize : d1-receptor activation enhances gaba release in terminals from medium spiny neurons of the direct pathway whereas d3/4-receptor activation represses gaba release from pallidonigral terminals because nanomolar concentrations of selective receptor agonist are needed to modify transmission, we hypothesized that administrations of selective dopamine receptor antagonist would disclose the actions of endogenous dopamine present in the extracellular space. therefore, to disclose the action of ambient endogenous dopamine we applied selective d1- and d3/4-receptor antagonists. our findings were that according to the concentration, suppression of endogenous dopamine action greatly reduced striatonigral transmission while it enhanced pallidonigral transmission. these results indicated that extracellular dopamine concentrations are regulating synaptic release probability in both types of connections, increasing release probability in striatonigral synapses and decreasing release probability in pallidonigral synapses. therefore, the following working hypothesis resulted from the present experiments : tonic levels of dopamine in snr are necessary to maintain the normal function of direct pathway connections and maintain in check indirect pathway synapses from both pallidonigral terminals (present work) and subthalamonigral terminals (ibez - sandoval., 2007). the logical functional consequence of this hypothesis was tested : blockade of tonic dopamine action would enhance indirect pathway transmission and reduce direct pathway input thus yielding a previously observed neuronal correlate of parkinsonism : snr neurons shifted their tonic firing pattern to a bursting firing pattern typical of subjects with the disease (takakusaki., 2004 ; rivlin - etzion., 2006 ; tonic spontaneous firing is preserved in the slice preparation in both gpe and stn (e.g., beurrier., 1999 ; chan., 2011). calcium imaging techniques recording dozens of cells simultaneously within the striatal circuit show that there is always some spontaneous activity in striatal spiny neurons in control conditions (carrillo - reid., 2008). moreover, there is a great amount of convergence between the striatum and the substantia nigra and inhibitory striatonigral events are of large amplitude (e.g., chuhma., 2011). therefore, the lost balance between direct and indirect pathways by the acute blockade of dopamine receptors is the most probable cause of bursting in snr neurons during the present experiments. postsynaptic dopamine receptors on snr neurons can not explain bursting because their function is to increase tonic firing frequency via a cation current ; their blockade resulting in lower tonic frequency with irregularities, but not continuous bursting behavior (lee and tepper, 2007 ; zhou., 2009). because the change in firing pattern of snr neurons was achieved acutely by blocking dopamine receptors one can speculate what would happen during a chronic absence of dopamine in the output nuclei of the bg. the absence of dopamine (e.g., parkinsonism) may reduce the function of direct pathway synapses in such a way that maintaining this state of affairs in the long - time would lead to loss of direct pathway synapses due to long - term synaptic plasticity. in contrast, maintaining a high function in pallidonigral and subthalamonigral synapses would produce long - term potentiation of these synapses. these events taken together may tend to change the circuitry permanently, making not only l - dopa inefficient but, perhaps, making the chronic diseased circuitry radically different than the control or healthy circuit : that is, more dependent on the subthalamopallidal loop (magill. bursting in snr neurons leads to tremor and rigidity (hemsley and crocker, 1998 ; takakusaki., moreover, this configuration of synaptic weights would lead to the loss of high pass filtering of snr inputs (direct pathway 's short - term facilitation) and an increase in low pass filtering of snr inputs (pallidonigral short - term depression ; abbott and regehr, 2004) setting the stage to favor the entrance to an akinetic frequency lock (hutchison., 2004 ; avila., 2010). consequently, therapeutic ways of activating the direct pathway in the chronic patient may be fundamental to avoid irreversible plastic changes in the network (hammond., 2007 ; walters., 2007 ; walters and bergstrom, 2009 ; zold., 2009 ; bateup., 2010 ; kravitz., 2010) the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. | previous work has shown the functions associated with activation of dopamine presynaptic receptors in some substantia nigra pars reticulata (snr) afferents : (i) striatonigral terminals (direct pathway) posses presynaptic dopamine d1-class receptors whose action is to enhance inhibitory postsynaptic currents (ipscs) and gaba transmission. (ii) subthalamonigral terminals posses d1- and d2-class receptors where d1-class receptor activation enhances and d2-class receptor activation decreases excitatory postsynaptic currents. here we report that pallidonigral afferents posses d2-class receptors (d3 and d4 types) that decrease inhibitory synaptic transmission via presynaptic modulation. no action of d1-class agonists was found on pallidonigral synapses. in contrast, administration of d1-receptor antagonists greatly decreased striatonigral ipscs in the same preparation, suggesting that tonic dopamine levels help in maintaining the function of the striatonigral (direct) pathway. when both d3 and d4 type receptors were blocked, pallidonigral ipscs increased in amplitude while striatonigral connections had no significant change, suggesting that tonic dopamine levels are repressing a powerful inhibition conveyed by pallidonigral synapses (a branch of the indirect pathway). we then blocked both d1- and d2-class receptors to acutely decrease direct pathway (striatonigral) and enhance indirect pathways (subthalamonigral and pallidonigral) synaptic force. the result was that most snr projection neurons entered a recurrent bursting firing mode similar to that observed during parkinsonism in both patients and animal models. these results raise the question as to whether the lack of dopamine in basal ganglia output nuclei is enough to generate some pathological signs of parkinsonism. |
though, the advantages of central venous catheter (cvc) placement outweigh the disadvantages significant risks are associated with the insertion and maintenance of a cvc. we report an unusual complication of cvc, discovered during thoracotomy, which possibly goes unnoticed in an unknown number of patients. a 37-year - old male with cystic bronchiectasis in the left lower lobe was scheduled for left lower lobectomy. computerized tomography scan of the chest revealed cystic bronchiectasis in the left lower lobe with consolidation. imaging can not show infection and mild bronchiectasis in the right middle lobe. following placement of routine monitors, thoracic epidural catheter after induction of general anesthesia, the patient was intubated with right sided 41 fg double lumen tube. left infraclavicular access for cvc was selected as the patient had to undergo left thoracotomy. venipuncture was performed 1 cm lateral to the curvature of the middle third of the clavicle with the needle pointing horizontally directed at the sternal notch until free aspiration of blood was obtained. positive pressure ventilation was withheld during the cvc insertion until free flow of blood was obtained. the blood aspirated during the insertion was uninterrupted and no air or fluid was noticed. the catheter was fixed at the mark of 12 cm from the tip of the catheter. bedside chest xray to confirm cvc position was not immediately available and thus, the cvc was only used for monitoring the waveform. no fluids were infused through the cvc. during the surgical exploration, it was noticed that cvc was traversing the superior aspect of the pleural cavity [figure 1 ]. position of the cvc tip was reconfirmed and was found to be satisfactory as per the waveform and aspiration of blood. central venous catheter traversing the superior aspect of the pleural cavity suspecting the puncture site as a potential site for bleeding, it was decided to remove the catheter before thoracic cavity was closed. while it was being removed under vision, bleeding was noticed from both puncture sites at the pleural surface. cvcs are routinely inserted in a variety of patients for assessment of intravascular depletion, hemodynamic monitoring, delivery of vasoactive drugs, long - term intravenous access for antibiotic treatment or parenteral nutrition, pulmonary artery catheterization and placement of transvenous cardiac pacemakers. the success of cvc cannulation follows a precise protocol of execution, including methods to verify correct insertion, advancement and final location as well as detecting mechanical and positioning complications. complications of variable magnitude with incidence of (5 - 19%) can accompany the placement of cvc. these complications in decreasing order of frequency include inadvertent arterial puncture or catheterization, puncture of lung apex with or without clinically manifest pneumothorax, thoracic duct injury, venous air embolism, tracheal puncture, hemoptysis, seizures and acute severe asthma. isolated pleural dome puncture in a patient with severe coagulopathy has resulted in life - threatening hemothorax due to continuous bleeding from the puncture site in the pleura. however, this is the first report of transpleural placement of cvc discovered accidentally during thoracotomy in a patient with normal thoracic anatomy. in our patient, it resulted in bleeding from the puncture site when cvc was removed under vision with the chest open. complications unique to the infraclavicular route are direct brachial plexus injury and injury to the clavicle and the periosteum of the first rib. isolated pleural dome puncture is generally detected only if there is pre - existing fluid, blood or air in the pleural dome, none of which was present in our patient. puncture of normal lung apex is unusual by this approach as it lies caudad to the first rib. however, it can occur if positive pressure ventilation and/or large tidal volumes are used or in a patient with grossly disturbed anatomy. lung apex was intact despite pleural injury in our patient possibly because intermittent positive pressure ventilation was withheld during the venous puncture. hemothorax appearing after removal of cvc is well - mentioned in the literature, but suggested possible mechanism is mostly vessel erosion, trauma to the adjacent tissue, displaced catheter tip and coagulopathy. continuous bleeding from the puncture site is generally expected in patients with coagulopathy, but in our patient fibrosis of the adjoining tissue due to lung pathology probably prevented this complication.(bleeding in your case occurred only when cvc was removed at thoracotomy). viewing the above case, bleeding from the punctured pleura despite correct placement of the catheter tip should be considered as a possible cause in unexplained cases of delayed hemothorax. thoracotomy provided us the opportunity to view transpleural cvc placement, which might have occurred in many cases without being noticed. therefore, it should always be remembered that transpleural cvc can occur in patients even with normal thoracic anatomy and aspiration of blood and correct cvc tracing may not always exclude transpleural placement of cvc. although, all these devices improve the safety of cvc placement, none of them have been proved to identify such minor details like a small pleural dome puncture before entering the vascular lumen. careful review of the literature does not reveal any clinical signs or diagnostic methods to identify or prevent the isolated pleural dome injury in a closed chest. some anesthesiologists may prefer to continue with the same cvc post - operatively also if the catheter tip is well - positioned. we preferred to remove the catheter under the vision and noticed significant bleeding as well. we therefore, suggest (based on a single case absolute certainty for this can not e established) that catheter should be removed and the requirement for local hemostasis checked. a few learning points from the above study are : aspiration of blood and normal cvc waveform do not exclude the transpleural placement of cvcintravascular placement of the catheter tip does not mean that the catheter has taken the correct path and has not traversed through the pleuraa transpleuraly placed cvc should be considered among the causes of a delayed hemo or pneumothorax or pleural effusion through intrapleural infusionstranspleural cvc if noticed during thoracotomy, should be removed under direct vision and hemostasis secured even if the coagulation profile is normal. aspiration of blood and normal cvc waveform do not exclude the transpleural placement of cvc intravascular placement of the catheter tip does not mean that the catheter has taken the correct path and has not traversed through the pleura a transpleuraly placed cvc should be considered among the causes of a delayed hemo or pneumothorax or pleural effusion through intrapleural infusions transpleural cvc if noticed during thoracotomy, should be removed under direct vision and hemostasis secured even if the coagulation profile is normal. | we report an uncommon complication of subclavian central venous catheterization, discovered at thoracotomy. the central venous catheter (cvc) was placed by left infraclavicular route after induction of general anesthesia. cvc was secured after aspiration of blood and satisfactory central venous tracing. on thoracotomy, cvc was noticed to traverse the pleural cavity while the tracing was normal. cvc was thus removed consequent to which bleeding from each puncture site was noticed, that were secured surgically. |
vascular endothelial growth factor (vegf) and its receptors are thought to play a pivotal role in tumor angiogenesis. bevacizumab is a humanized monoclonal antibody designed to block vegf - a and has proved to be effective in colorectal cancer, nonsmall cell lung cancer, renal cell carcinoma, ovarian carcinoma, and glioblastoma multiforme [28 ]. in the field of breast cancer, bevacizumab has generated more controversies and discussions than any other targeted therapy. in february 2008, the fda granted accelerated approval to bevacizumab in combination with paclitaxel for the first - line treatment of metastatic, her2-negative metastatic breast cancer (mbc), based on promising results of the eastern cooperative oncology group (ecog) 2100 trial. on july 20th 2010, the oncologic drugs advisory committee (odac) of the fda 's center for drug evaluation and research voted 12 to 1 against the use of bevacizumab in combination with chemotherapy for the first - line treatment of advanced breast cancer. this was followed by a definitive announcement by the fda revoking approval of bevacizumab for this indication. nonetheless bevacizumab is still approved by different regulatory agencies across several countries as a standard antiangiogenic drug for the treatment of first - line advanced breast cancer. with more than 20,000 breast cancer patients currently being randomized into bevacizumab studies, it is crucial to define which magnitude of endpoint or risk / benefit ratio is expected. in this study, we performed a meta - analysis of randomized phase iii studies evaluating bevacizumab for the first - line treatment of metastatic breast cancer [1113 ]. the magnitude of risks and benefits of adding bevacizumab to the standard treatment of advanced cancer are discussed in the context of recent controversies and ongoing randomized phase iii clinical trials. medline searches were performed to identify eligible studies, which were restricted to phase iii, randomized, controlled trials comparing the combination of bevacizumab to chemotherapy with chemotherapy alone for the first - line treatment of mostly her2-negative advanced breast cancer. the proceedings of the san antonio breast cancer symposium, european society of medical oncology, and american society of clinical oncology annual meetings were examined for presented abstracts. based on these criteria, the e2100, avado, and ribbon-1 were selected for our meta - analysis. data abstraction was conducted independently by three investigators (j. r. rossari, o. metzger - filho, and m. paesmans) in accordance with the preferred reporting items for systematic reviews and meta - analyses (prisma) guidance. for each study the following information was extracted : publication or presentation date, first author 's last name, sample size, primary endpoints, regimens used, dosage and scheduling of chemotherapy and bevacizumab, line of treatment, number of chemotherapy cycles, additional treatments given (regardless of study arm), follow - up period, number of outcome events, information pertaining to study design, pfs definition, tumor response criteria, data on pfs, orr and os, subgroup evaluation, quality of life analysis, crossover, if any, and toxicities. the impact on pfs and os of adding bevacizumab to a chemotherapy regimen was measured in terms of the hazard ratio (hr). for each study, two of the studies included in this meta - analysis were designed to compare more than one bevacizumab arm with a control group, either to evaluate different doses of the drug (avado), or to evaluate its combination with different cytotoxic agents (ribbon-1). to render the statistical analysis of these comparisons feasible, each analysis was treated as a different study, and a hr was extracted from all of them. whenever possible, hr was also estimated for pfs according to subgroups of patients defined a priori (age, hormone receptor status, prior adjuvant chemotherapy, prior taxane therapy, and length of disease - free interval [dfi ]). for some subgroups, it was necessary to extrapolate hrs and their variances from graphical representations. individual hr estimates were then combined into overall hr using fixed effects or random effects models, depending on the outcome of the heterogeneity x - test. if heterogeneity was not detected (at the 10% significance level), heterogeneity was quantified by the i coefficient that measures the percentage of total variation across studies that is due to heterogeneity rather than chance. by convention, this impact was considered statistically significant if the 95% confidence interval (ci) for overall hr did not overlap 1.00. the association of bevacizumab with toxicities and response rate were calculated in terms of odds ratios, applying the same statistical methods described above. three randomized phase iii studies evaluating the impact of adding bevacizumab to chemotherapy in the first - line treatment of her2-negative mbc have reported positive results in terms of overall response rate (orr) and progression - free survival (pfs). e2100, avado, and ribbon-1 are the focus of this meta - analysis and the key results of the three trials are summarized in table 1 [1113 ]. the e2100 study showed that the addition of biweekly bevacizumab 10 mg / kg to weekly paclitaxel doubled the pfs when compared with paclitaxel alone in the first - line treatment of patients with her2-negative mbc without an overall survival (os) gain. subsequently, the avado study randomized patients to docetaxel alone or in combination to bevacizumab (at two dose levels of 15 mg / kg or 7.5 mg / kg) and demonstrated improvement in pfs and no os benefit. in the avado study treatment in contrast to e2100, 40% of patients enrolled on avado received bevacizumab in the second - line setting. the ribbon-1 trial in which bevacizumab 15 mg / kg was added to capecitabine, anthracycline, or taxane - based chemotherapy similarly showed improved pfs without os benefit. approximately 60% of patients randomized in the ribbon-1 trial received bevacizumab as second - line chemotherapy. the pfs gain observed in the e2100 trial was not replicated with the same magnitude in the subsequent phase iii studies (avado and ribbon-1), and os could not be demonstrated. the three studies selected for this meta - analysis represented a total of 2,695 patients, with the number of patients in each study ranging from 722 to 1,237. the avado and ribbon-1 trials were double - blinded, placebo - controlled studies, while the e2100 trial was an open - labeled study with patients randomly assigned to paclitaxel alone or the combination of paclitaxel and bevacizumab. figure 1 shows the hr for pfs in each individual trial and the overall analysis. the hr for pfs of the bevacizumab arms were evaluated separately and compared to the control arms in the avado and ribbon-1 trials. our meta - analysis shows a statistically significant benefit obtained by adding bevacizumab to chemotherapy in the first - line treatment of mbc patients : the overall hr was 0.70 (95% ci, 0.57 to 0.86), corresponding to a 30% reduction of the hazard of progression for bevacizumab - based regimens. statistically significant heterogeneity was observed between the studies (p = 0.0006), i = 77%. pfs was assessed according to hormone receptor status (positive or negative), prior adjuvant chemotherapy (yes or no), age (24 months, while ribbon-1 considered 12 months versus > 12 months. the addition of bevacizumab to chemotherapy consistently showed a pfs benefit in all analyzed subgroups, as shown in figure 2. interaction tests were carried out and did not reveal any significant interaction between analyzed covariates and bevacizumab effect (p = 0.74). figure 3 shows the hr for os in each individual trial and the overall analysis. as was the case with pfs, the hrs of the clinical trials with two bevacizumab arms (avado and ribbon-1) were evaluated separately, and each was compared to the control group. individually, none of the studies showed a significant os benefit of adding bevacizumab to chemotherapy as first - line treatment of mbc. our results show no statistically significant benefit of adding bevacizumab to chemotherapy in the first - line treatment of mbc patients (hr 0.95, 95% ci, 0.85 to 1.06). no heterogeneity was identified between the trials (p = 0.65), i = 0%. as shown in figure 4, the odds ratio of response associated with the addition of bevacizumab to chemotherapy was 1.81 (95% ci, 1.532.14). again, no heterogeneity was seen between trials (p = 0.55), i = 0%. the results did not change when the arm of the ribbon-1 trial containing capecitabine (and no taxane) was removed from the analysis (odds ratio 1.83 ; 95% ci, 1.522.19 ; p test for heterogeneity 0.39) to evaluate the effect of adding bevacizumab to a taxane - based chemotherapy. the addition of bevacizumab to chemotherapy increased the probability of grade 3 - 4 hypertension (random effects odds ratio 5.56 ; 95% ci, 1.6618.62), proteinuria (fixed effects odds ratio 5.35 ; 95% ci, 2.8010.20), sensory neuropathy (fixed effects odds ratio 1.48 ; 95% ci, 1.111.99), and cardiac events including left ventricular (lv) dysfunction and congestive heart failure (fixed effects odds ratio 3.36 ; 95% ci, 1.418.01). no significant increase in the risk of gastrointestinal (gi) perforation was seen in mbc patients treated with bevacizumab (fixed effects odds ratio 0.94 ; 95% ci, 0.312.85). bevacizumab combined with chemotherapy in the first - line treatment of mbc significantly improved orr and pfs, but also increased grade 3 - 4 toxicities. one of the most frequently cited reasons for conducting a meta - analysis is the increase in statistical power that it affords ; however, inherent limitations may limit the accuracy of results. in this study, we acknowledge the following limitations : first, it was conducted using published study results, rather than individual patient data. second, for the two studies with more than one bevacizumab containing - arm, control arms had to be duplicated in order to give each comparison independent statistical treatment. third, despite being the primary endpoint in all three trials, the definition of pfs was not precisely specified in all of them. despite limitations our results provided similar conclusions when compared to other studies [1922 ]. three meta - analyses evaluated the efficacy of bevacizumab plus chemotherapy for the treatment of mbc, and provide interesting points of comparison with our study [1921 ]. analyzed five studies, including a phase ii study and one trial with bevacizumab and capecitabine after first - line chemotherapy for mbc, and found global hrs similar to the ones we report : 0.70 (95% ci 0.600.82) for pfs and 0.90 (95% ci 0.801.03) for os. analyzed four studies involving a total of 2,860 patients, to verify the clinical efficacy of bevacizumab in the salvage treatment of mbc, and reported pfs (hr 0.69, 95% ci, 0.580.81), os (hr 0.92, 95% ci, 0.821.03), and orr (hr 1.53, 95% ci, 1.371.71). o ' shaughnessy. conducted a meta - analysis including individual patient data from the e2100, avado, and ribbon-1 studies and showed a 36% reduction in the risk of a pfs event (hr = 0.64, 95% ci 0.570.71) and no median os gain (hr = 0.97 ; 95% ci 0.8613.08). however, one - year survival rate was statistically significant increased for patients treated in the bevacizumab - arms (77% versus 82%, p = 0.003). in this study, the addition of bevacizumab to chemotherapy statistically increased pfs in all analyzed subgroups. importantly, her2-positive disease was not allowed in the avado and ribbon-1 studies, and only about 1% of patients participating in e2100 had her2 overexpressing tumors. our results seem to concur with those obtained by o'shaughnessy. in a comparison of the subgroup analyses performed in the same studies. similar pfs benefit with the addition of bevacizumab was observed in patients according to hormone receptor - negative status, age, and previous exposure to taxane. comparing with their meta - analysis, beyond efficacy in terms of pfs and os, our study also adds relevant information about the safety profile of bevacizumab in this population of patients. the results of individual bevacizumab phase iii studies and meta - analyses motivated important discussions about adequate endpoints for breast cancer studies. whether pfs benefit can be used as a surrogate for os in breast cancer patients is a matter of debate, and os continues to be the endpoint of choice to assess the efficacy of new treatments for patients with mbc. the availability of bevacizumab as second - line treatment for some patients enrolled in the avado and ribbon-1 studies might therefore be considered a confounding factor, which could in turn have affected the chance of demonstrating an os benefit in the intent - to - treat analysis. an earlier phase iii study failed to demonstrate pfs benefit when bevacizumab was added to capecitabine for patients with mbc previously treated with both an anthracycline and a taxane, and at least one prior chemotherapy regimen for metastatic disease. that finding has been recently challenged by the results of the ribbon-2 trial, which demonstrated orr and pfs gains with the addition of bevacizumab to second - line chemotherapy. if the benefits of bevacizumab are extended to subsequent lines of treatment after first disease progression, crossover is likely to pose an important obstacle for detecting os gains in first - line chemotherapy. recently, the results of two large neoadjuvant clinical trials evaluating the addition of bevacizumab to different chemotherapy regimens further increased the controversies surrounding bevacizumab therapy for breast cancer. both the national surgical adjuvant breast and bowel project (nsabp) b-40 and the geparquinto (gbg44) were designed to evaluate whether the addition of bevacizumab to chemotherapy would increase the rates of pathologic complete response (pcr) in women with early - stage her2-negative breast cancer. in both studies, the rates of pcr defined as the absence of invasive disease in the breast, irrespective of nodes, were in favor of bevacizumab (16.5% without bevacizumab versus 20.5% with bevacizumab in the gbg44 trial, and 28.2% versus 34.5% in the nsabp b-40 trial). however, neither trial showed significant differences when pcr was defined as the absence of invasive disease in the breast and lymph nodes (gbg44 : 18.3% versus 21.7%, p = 0.07 ; nsabp b-40 : 23.0% vresus 27.6%, p = 0.08, both resp. without and with bevacizumab). in contrast to our results and previous findings, subgroup analysis of the nsabp b-40 trial and gbg44 studies suggested differential benefit of bevacizumab according to breast cancer subtypes [27, 28 ]. intriguingly, the results were not in the same direction. in the gbg44, the rates of pcr were increased with bevacizumab in patients with hormone receptor - negative, while the nsabp b-40 showed increased pcr in the with hormone receptor - positive cancers. in the current analysis, bevacizumab therapy was associated with increased proteinuria, hypertension, cardiovascular dysfunction, and sensory neuropathy. in agreement with our findings, a combined analysis of five phase iii trials in advanced breast cancer showed a statistically significant increase in proteinuria (or = 27.68), hypertension (or = 12.76), and left ventricular dysfunction (lvd) (or = 2.25) with the addition of bevacizumab. in addition, hemorrhagic events (or = 4.07) were also associated to bevacizumab. moreover, gastrointestinal perforation was associated to bevacizumab therapy among 12,294 patients evaluated with a relative risk (rr) of 2.14 (95% ci 1.193.85), but statistically significant only for colorectal cancer patients. hypertension was associated to bevacizumab therapy in a meta - analysis conducted among 12,049 patients across several tumor subtypes with a rr of 5.38 (95% ci 3.637.97). venous thromboembolism was associated to bevacizumab therapy among 7,956 patients studied with a rr of 1.33 (95% ci 1.131.56), but not significant in the breast cancer subset. arterial thromboembolic events including cardiac ischemia was increased in a meta - analysis including 12,617 patients with a rr of 1.44 (95% ci 1.081.91). an additional study found an incidence of arterial thromboembolism of 0.7% in bc patients treated with bevacizumab, which was not significantly higher when compared to chemotherapy alone (rr = 1.47, 95% ci 09.277.95). serious congestive heart failure (chf) was associated to bevacizumab therapy among 3,784 bc patients evaluated with a rr of 4.74 (95% ci 1.6611.18). a higher risk of fatal adverse event was associated with bevacizumab therapy among 10,217 patients evaluated (rr = 1.46, 95% ci, 1.091.94). however, in the subset of breast cancer studies no significant increase in fatal adverse events was observed (rr = 0.69, 95% ci, 0.31.62). fatal adverse events were attributed mainly to gastrointestinal perforation, neutropenia, and hemorrhage and more likely to occur among patients with pancreatic and lung cancer. for instance, in the athena trial, which prospectively evaluated the safety of bevacizumab in combination to taxane regimens among 2,551 bc patients, fatal adverse events occurred in 0.7% of patients. hence, a clear understanding of the magnitude of bevacizumab benefit, toxicity, and benefit across breast cancer subgroups is of paramount importance. bevacizumab is under evaluation across several phase iii studies and correct estimates of treatment related toxicities and efficacy from previous studies are fundamental to the appropriate guidance and conduct of ongoing studies (table 2). in the advanced setting, phase iii studies are estimated to enroll over 4,000 patients. bevacizumab is being studied in combination to different chemotherapy regimens (nct00600340, nct01303679, nct01131195, nct00785291) ; as maintenance therapy (nct01250379, nct00929240) ; in combination with more than one cytotoxic drug (nct01200212) ; in combination with trastuzumab (nct00520975, nct00391092) ; and in combination with hormonal therapy. cancer and leukemia group b (calgb) 40503 trial (nct00601900) randomizes patient with locally advanced or metastatic bc to receive tamoxifen or letrozole, with or without bevacizumab. similarly, another study (nct00545077) randomizes postmenopausal patients with advanced bc for endocrine therapy (letrozole or fulvestrant) alone or in combination with bevacizumab. importantly, a broad spectrum of phase iii studies are expected to randomize about 15,000 early breast cancer patients into four large adjuvant studies (table 3). the recent decisions by fda regarding use of bevacizumab in patients with mbc has turned the spotlight on the risk - versus - benefit of adding bevacizumab to chemotherapy. today, thousands of women with breast cancer are being randomized into bevacizumab studies ; therefore, it is imperative to define which magnitude of endpoint or risk / benefit ratio is expected. moreover, there is a great need to identify and validate biomarkers to aid clinical decisions in the treatment with antiangiogenic therapies. the side effects associated with bevacizumab are considerable and predictive biomarkers to identify subgroups most likely to benefit are needed. in a retrospective analysis conducted in the e2100 study, vefg polymorphisms were able to predict not only bevacizumab benefit but also toxicity. however, validation of biomarker findings in subsequent studies is needed and the incorporation of translational research questions into prospective clinical trials should be mandatory. | background. randomized studies have shown different magnitude of bevacizumab benefit in the treatment of advanced breast cancer. regulatory agencies have modified bevacizumab treatment indications across different regions. in this study, we perform a meta - analysis of phase iii studies aiming to interrogate the magnitude of bevacizumab benefit for the treatment of first - line her2-negative metastatic breast cancer (mbc). methods. data from studies e2100, avado and ribbon-1 were used to calculate the benefit of bevacizumab in terms of tumor overall response rate (orr), progression - free survival (pfs), overall survival (os), and toxicities. combined statistical estimates of hazard ratios (hr) and odds ratios were calculated using fixed - effects or random - effects models. results. a total of 2,695 patients were evaluated. combining bevacizumab with different chemotherapy backbones resulted in a 30% risk reduction of pfs events (hr = 0.70 ; 95% confidence interval [ci ], 0.570.86) and increased orr (odds ratio 1.81 ; 95% ci, 1.532.14). no os benefit could be demonstrated (hr = 0.95 ; 95% ci, 0.851.06). bevacizumab significantly increased the incidence of adverse events such as proteinuria, hypertension and cardiovascular events. conclusions. bevacizumab combined with chemotherapy in the first - line treatment of mbc significantly improved orr and pfs, but also increased grade 3 - 4 toxicities. no significant os advantage was observed. |
in a remarkable number of patients suffering from low back pain (lbp), a specific physiological or structural abnormality can not be found. although implementation of imaging strategies aids to exclude serious underlying mechanical etiologies of lbp, this complaint in majority of cases might be associated with the inflammatory processes.1 on the other hand, the observed pain in ~5% of those suffering from lbp is due to the inflammation in the spinal column.2,3 the most important signs of inflammatory low back pain (ilbp) can include age at onset of back pain 3 months, night pain and early morning pain, and increase in pain with exercise.4 ilbp is the main symptom of the spondyloarthopathies (spas). the spas, a diverse group of inflammatory arthritides, are of five types in adults including ankylosing spondylitis (as), reactive arthritis (rea), psoriatic arthritis (psa), undifferentiated spondyloarthropathy (uspa), and spa due to enteropathic arthritis (ena).5 as the management and therapeutic approaches applied to mechanical lbp and ilbp are distinct, discrimination of these two types is essential.6 nonsteroidal anti - inflammatory drugs (nsaids) are primarily used for the treatment of ilbp.7 however, in patients with unsatisfactory response to the mentioned drug, the regimen may be modified by addition of other drugs such as methotrexate (mtx) or sulfasalazine.7 the addition of such drugs is mostly required for patients with concomitant peripheral arthritis.810 sulfasalazine can be considered as a disease - modifying antirheumatic drug, which has been effectively useful for preventing the clinical manifestations of spa and peripheral arthritis.7,10 recent reviews on the effectiveness of this drug have demonstrated a marked improvement in inflammatory markers such as erythrocyte sedimentation rate (esr) as well as considerable decrease in inflammatory symptoms such as morning stiffness.1114 in the present study, the overall prevalence and the main underlying etiologies of ilbp were determined, and the effectiveness of sulfasalazine in the treatment of patients suffering from ilbp and mechanical lbp was examined. these patients referred to the rheumatology clinics with a primary complaint of lbp (from july 2013 until august 2015). lbp was defined as any pain occurring in the region between the lower ribs and inferior gluteal folds. patients suffering from ilbp and those having mechanical lbp were classified into two distinct groups according to the new york criteria (figure 1).6 patients with any history of trauma or lumbar surgery, discopathy problems, arthrosis, or any lumbar congenital abnormalities were excluded from the study. the study was approved by the semnan university of medical sciences research ethics committee, and all the patients gave written informed consent. baseline data of all the patients including demographics, disease duration, and underlying predisposing diseases were collected prior to treatment. moreover, all the patients were asked routine questions during a physical examination of active lumbar range of pain, motion, and stiffness. the underlying diagnoses were categorized based on specific diagnostic criteria, such as uspa, as, and rea. radiographic evaluation of lumbar and sacroiliac joints was conducted by one specialist, which led to the identification of cases with sacroilitis. moreover, blood samples were drawn to measure serum human leukocyte antigen b27 marker, esr, and c - reactive protein (crp) levels. patients were allowed to receive any nsaid at an inflammatory dose. if no response was observed within 2 weeks, another type of nsaid was prescribed. if no response was noticed again within the following 2 weeks, the patients concurrently received sulfasalazine 2 g per day. however, if no response to treatment was observed over the next 2 months, the patients were considered as resistant to sulfasalazine treatment. response evaluation was done using ankylosing spondylitis disease activity score (asdas) criteria that are based on back pain, spinal pain, peripheral pain, inflammation back pain at night, duration of morning stiffness, crp, esr, patient assessment of global disease activity, and fatigue. asdas 3.5 defines very high disease activity.15 patients were subsequently followed - up for assessing response rate with a mean follow - up time of 16 months. data are presented as mean standard error for continuous variables and as percentages for categorical variables. wilk test, chi - square test, student s t - test, and one - way analysis of variance. also, multiple logistic regression analysis was performed to determine the main predictors of response to sulfasalazine. all the statistical analyses were performed using statistical package for the social sciences (version 19.0 ; ibm corporation, armonk, ny, usa). among 1,779 participants, 118 (6.6%) suffered from ilbp, and 1,661 (93.3%) patients had mechanical lbp. the patients of the ilbp group were significantly younger than the mechanical lbp group (p<0.001) (36.20.9 and 44.90.4 years, respectively). mean age and disease duration of those with ilbp with respect to underlying disease are presented in table 1. moreover, among those with ilbp and mechanical lbp, 52.5% and 19.1% were male, respectively (p<0.001). the main underlying diagnoses of ilbp were uspa (61.0%), as (24.6%), rea (9.3%), psa (4.2%), and ena (0.8%). the crp level was significantly increased in 20.3% of patients, and esr was also elevated in 20.3% of them. moreover, radiographic pictures of sacroiliac joint of all the patients were available, which revealed that 47.5% of patients had sacroiliac joint changes. the patients with ilbp were followed - up for evaluating the response rate to different drug regimens with an average follow - up period of 16 months. during this follow - up period, four (3.4%) patients demonstrated adequate response to only nsaids, 68 patients (57.6%) showed response to both nsaids and sulfasalazine, 31 patients (26.3%) revealed response to adding mtx, and 15 patients (12.7%) were on biological agents. responses to sulfasalazine were significantly different with regard to the types of underlying etiologies of ilbp (p=0.001). the response rates to sulfasalazine among those with rea and uspa were 54.5% and 69.4%, respectively (figure 2). the response rate to sulfasalazine according to sex and underlying disease is presented in table 2. logistic regression results showed that among all the variables, only underlying disease had a significant effect on the sulfasalazine response. the odds for response to treatment was 3.53 times higher in uspa patients compared to other patients (odds ratio = 3.53, 95% confidence interval : 1.637.68, p=0.001). first, the most common underlying factors pertinent to the appearance of ilbp are uspa followed by as. the spas including as, rea, psa, and uspa can be regarded as a diverse group of inflammatory arthritides, which are commonly featured by ilbp and have a specific criterion in rheumatologic field, and ilbp is a common sign in all of them. with consideration of this definition, the diagnosis of these spas should be mainly suspected in young patients who present with ilbp.16 response to anti - inflammatory drugs should be considered as one of the significant criteria for differentiating mechanical lbp from ilbp.17 second, it was revealed that with administration of nsaids, response rate to the treatment regimen was only 3.4%, while with addition of sulfasalazine to the regimen, the response rate was significantly elevated ~17 times compared to the former regimen. although, recent guidelines published by the assessment of spondyloarthritis international society (asas) recommend nsaids as first - line agents for treatment of axial and peripheral manifestations of spa, and sulfasalazine and mtx are disease - modifying antirheumatic drugs considered for the treatment of as and other forms of spas. also, the efficacy of sulfasalazine in axial spa is similar to mtx ; it is not recommended in the most recent asas guidelines for axial disease.18 sulfasalazine is useful in as patients who do not respond to or who have contraindications to nsaids, as well as in those with coexisting ena. in particular, it is often given to treat peripheral joint involvement, for which it has demonstrated efficacy, but there is no evidence that it improves spinal mobility, enthesitis, or physical function.19 according to the conducted studies, in patients with spas, the combination therapy with sulfasalazine is more effective than either nsaid alone or its combination with mtx. with respect to the baseline characteristics, only the underlying predisposing factor was the main determinant of response to sulfasalazine in patients suffering from ilbp. on the other hand, the highest and the lowest response rates to this drug some previously conducted studies showed that the type and nature of underlying diagnosis as well as the type of involved joints can predict how well the patients will respond to sulfasalazine. it has been demonstrated that sulfasalazine might have higher effects on ilbp in patients without peripheral joint disease.11 the results of benitez - del - castillo study on patients with an average of 10 years of as without peripheral joint disease demonstrated that more patients reported successful treatment with sulfasalazine as it is more effective than placebo in the treatment of severe lbp.20 in another randomized controlled trial conducted by clegg, it was shown that sulfasalazine was effective for peripheral arthritis in patients with as, psa, and rea ; however, it was not markedly different from placebo in the subset of patients with predominantly axial disease. the observed finding can be possibly attributable to the longer and more advanced disease in the patients with as.13 also, in a study by braun, sulfasalazine was no better than placebo for the treatment of the signs and symptoms of uspa ; however, sulfasalazine was more effective than placebo in the subgroup of patients with ilbp and no peripheral arthritis.11 most of the studies is about ilbp in as patients, but brent and kalagate in their study investigated sulfasalazine s effect on all kinds of spas. they found that sulfasalazine is useful in uspa (similar to our study) and ena.21 nissil studied 85 as patients with relatively short disease duration and found that the sulfasalazine group reported less morning stiffness after 26 weeks of treatment and inflammatory markers were seen to fall significantly.22 an earlier randomized controlled trial on patients with an average of 10 years of as without peripheral joint disease found that considerably more patients reported treatment with sulfasalazine to be more effective than placebo.20 it seems that the association between the type of spas and the response rate to sulfasalazine might interact with the duration and severity of the underlying diagnosis, which requires to be evaluated in further studies. to put in a nutshell, the present study reveals that the underlying spas play a crucial role in the appearance of ilbp. it is also found that response to anti - inflammatory drugs in rheumatoid arthritis patients is potentially increased by adding sulfasalazine to the former drugs. a limitation of this study was low sample size in some background groups, so evaluation of treatment response in all groups was impossible. currently, biologic drugs such as anti - tnf are recommended for the treatment of patients with spa accompanying ilbp, but these drugs are not easily available and are of high costs. the results of our study showed that use of sulfasalazine with or without nsaids may reduce treatment complications, especially in the cases of uspa, and is also cost - effective. | in the current study, the overall prevalence and the main underlying etiologies of inflammatory low back pain (ilbp) were determined, and the effectiveness of treatment with sulfasalazine was investigated in patients with inflammatory versus mechanical low back pain (lbp). in a prospective study conducted from july 2013 until august 2015, 1,779 consecutive patients within the age range of 1850 years with a primary complaint of lbp referring to the rheumatology clinics were included. the patients were classified into two distinct groups : those suffering from ilbp (n=118) and those having mechanical lbp (n=1,661). patients were followed - up for assessing the response rate to sulfasalazine with a mean follow - up time of 16 months. results showed that among the total number of participants, 6.6% suffered from ilbp. the main underlying diagnoses of ilbp were undifferentiated spondyloarthropathy (uspa) (61.0%) and ankylosing spondylitis (24.6%). during the follow - up period, 3.4% of the participants had an appropriate response to only nonsteroidal anti - inflammatory drugs, 57.6% to sulfasalazine, 26.3% to addition of methotrexate to the previous regimen, and 12.7% to biological agents. multiple logistic regression results showed that the underlying disease had a significant effect on the sulfasalazine response. the odds for response to treatment was 3.53 times higher in uspa patients compared to other patients (odds ratio = 3.53, 95% confidence interval : 1.637.68, p=0.001). in 69.4% of the participants, the highest response to sulfasalazine was found, which was related to the underlying uspa. this study found that an adequate response to nonsteroidal anti - inflammatory drugs in patients with ilbp was potentially increased by adding sulfasalazine. thus, the observed response rate was dependent on the nature of underlying spondyloarthropathy. |
achalasia cardia is a primary motility disorder of the esophagus characterized by aperistalsis of the body of the esophagus and failure of relaxation of the lower esophageal sphincter (les) appropriately in response to swallowing.1 it is a chronic, benign disease of unknown etiology and is a common cause of dysphagia. the first case of this condition was reported by sir thomas willis in 1674 in which he described esophageal dilation with whalebone in a patient who had dysphagia and a dilated esophagus. the term achalasia was coined by hurst in the year of 1927, which means absence of relaxation, more specifically, inadequate les relaxation in the absence of distal mechanical obstruction.2 the mainstay of treatment of achalasia cardia is the relief of the functional obstruction at the level of the gastroesophageal junction. about 5% of all cases occur in children ; while only a few are reported in infants.3 here we present our experience in two infants suffering from achalasia cardia, and both cases were treated successfully. a nine month - old female infant was admitted with complaints of regurgitation of feed, non - projectile vomiting, repeated fever and cough with occasional breathlessness for the last three months. the girl regurgitated every feed effortlessly even in upright position within minutes of ingestion of food. she had no family history of the same illness. on examination, the baby was malnourished and anemic with loss of subcutaneous fat. complete hemogram revealed anemia (hb- 8.4gm %) with neutrophilic leukocytosis (totalleukocyte count (tlc) - 13,200/ml ; neutrophil-72%). the serum total protein was 4 g / dl, with a serum albumin of 2 g / dl. blood glucose, urea, creatinine levels and liver function test were within normal limits. the chest x - ray demonstrated bilateral patchy opacities suggesting bronchopneumonia and an absence of the fundic gas shadow. she was treated conservatively for her regurgitation. though bronchopneumonia responded to antibiotic therapy, her regurgitation persisted. the presence of regurgitation of feeds and absence of fundic gas shadow guided us to perform barium swallow examination to rule out achalasia cardia. barium swallow examination showed dilatation of the esophagus with hold - up of the contrast material and smooth narrowing of the distal esophagus with the typical bird s beak appearance (figures 1 and 2). the presence of congenital causes of obstruction was ruled out by performing esophagoscopy. as symptoms and investigational findings suggested achalasia cardia, the infant underwent a modified heller s esophagocardiomyotomy through open abdominal approach with antireflux procedure (toupet posterior partial fundoplication). the nasogastric tube was removed on the fifth post - operative day, and oral feeding was resumed. the girl became asymptomatic in the post - operative period, and she started to gain weight with improvement of her general condition. an eleven month old severely malnourished girl was admitted to the pediatric medicine department, suffering from regurgitation of food after each feed with repeated pulmonary infections. on examination, the baby was severely malnourished and anemic. complete hemogram revealed anemia (hb- 7.2 gm %) with normal total leukocyte count. the serum total protein was 3.5 g / dl, with a serum albumin of 1.8 g / dl. blood glucose, urea, creatinine levels and the level of liver enzymes were within normal limits. after correction of anemia and other parameters, the baby underwent open anterior esophagocardiomyotomy with toupet posterior partial fundoplication operation. the nasogastric tube was removed on fourth post- operative day. with the symptomatic relief, both babies were followed for a year and are doing well and gaining weight without any problems. in the united kingdom, the incidence of achalasia cardia has been estimated to be 0.51.0 in 100,000 persons per year, and the prevalence has been estimated to be around 8 per 100,000. during the period (from 1998 to 2008), the mean incidence of childhood achalasia in the u.k. was 0.18/10,000 children / year. the incidence increased in each of these successive years.4 the incidence of achalasia cardia in asian and african populations is lower than that of the british populations (0.3 per 100,000).5 racial variations have also been reported. among the asian populations, no difference in incidence is seen between whites and non - whites.6 there is no sex predilection for the disease.7 the peak incidence of achalasia cardia is between the ages of 30 and 60 years and it is exceedingly rare in first two decades of life.8 very few patients (45%) with achalasia become symptomatic prior to 15 years of age.9 achalasia cardia is a primary esophageal motility disorder. the main pathophysiology is the failure of les to relax and the absence of esophageal peristalsis. these lead to a functional obstruction at the gastro - esophageal junction. according to the etiology, the disease can be classified into a primary neurogenic abnormality with failure of the inhibitory nerves supplying the sphincter and progressive degeneration of ganglion cells and a deficiency of the myenteric plexus ganglion cells, secondary to gastroesophageal reflux disease, chagas disease, or viral infection.10 allgrove and colleagues described a rare condition (allgrove syndrome) where achalasia cardia was associated with isolated glucocorticoid deficiency with alcrimia.11,12 achalasia cardia is a very rare condition in pediatric age group particularly in infants. the first case in an infant was reported by king in 1953.13 this child was diagnosed at the age of 6 months. after failure of anticholinergic therapy, heller s esophagocardiomyotomy was performed at the age of 9 months which led to an excellent symptomatic improvement. due to the rarity of the disease in infants, there is lack of extensive experience with the disease entity in this age group. the two large institutional series of achalasia cardia comprise only few patients in the age group below 1 year.12,14 paucity of experience about the disease in infancy leads to delay in the diagnosis and treatment of the condition. the common presenting features of achalasia cardia are dysphagia, regurgitation of feeds, emesis, failure to thrive, weight loss, heart burn, chest pain and recurrent lower respiratory tract infections.15 because the most common characteristic feature of achalasia cardia is vomiting of uncurdled milk, which is the same symptom of gastro -esophageal reflux disease (gerd),16 physicians should keep achalasia in mind when evaluating children with persistent vomiting or failure to thrive as occurred in our cases. plain radiograph may demonstrate the absence of the fundic air bubble, and sometimes a mediastinal air fluid level may present. the barium swallow with cineesophagogram may show the following features : dilated esophagus, body aperistalsis with smooth narrowing of the distal esophagus and esophagogastric junction also described as bird - beak sign. endoscopic assessment is essential to rule out other causes of esophageal obstruction, e.g. congenital membrane and acquired stricture. endoscopy will also demonstrate retained saliva with frothy appearance which will obscure the mucosa and, in advanced cases, sigmoid esophagus with retained food debris can be found. typical manometric findings of achalasia are high resting pressure of the lower esophageal sphincter (les) with incomplete relaxation of the les with wet swallows and aperistalsis of esophageal body. the manomertic studies are, generally, not done in children due to technical difficulty. pharmacological (isosorbide dinitrate, calcium channel blockers, injection of botulinum toxin) and mechanical modalities of treatment are mainly used in older children and adults with varying success. esophageal dilation with pneumatic dilators has been used in older children, but this procedure has not been used in infants due to its disadvantages and risks.17 patients with surgical risk factors are candidates for medical therapy. sublingual nitrates are more effective than calcium channel blockers in terms of onset of action and esophageal emptying.18 surgical esophagocardiomyotomy is reserved for the patients who failed the primary dilatation or had recurrence of the symptoms following dilatation. laparoscopic cardiomyotomy not only decreases the morbidity but also causes relief of dysphagia in 80% of cases for 5 years following the procedure.19,20 different studies comparing the efficacy of graded pneumatic dilatation with that of laparoscopic cardiomyotomy show better remission rate with the laparoscopic procedure.21,22,23 in the series reported by cloud, 6 out of 7 patients who had undergone heller s operation had an excellent result, and only one patient required post - operative dilatation.24 the proximal esophageal dilatation returned to normal within 2 years and cineradiography showed return of peristalsis. several authors have recommended the additional antireflux procedure to the myotomy.25,26 modified heller s esophagocardiomyotomy with fundoplication by open or laparoscopic approaches is considered to be the gold standard to relieve the functional obstruction in the distal esophagus and gastroesophageal junction. both the trans - abdominal and the transthoracic routes can be used.27 the trans - abdominal route along with anti - reflux procedure has been reported to result in better outcome.9 though some surgeons prefer a transthoracic approach,28 it is easier to perform an adequate antireflux procedure through the trans - abdominal route. gavrilu advocated trans - abdominal myotomy and antireflux procedure using a flap of greater curvature of stomach to be sutured over esophageal mucosa through a left subcostal incision.29 the operation resulted in dramatic relief of symptoms with disappearance of pulmonary symptoms and rapid weight gain. most of the series however prefer nissen - rossetti total fundoplication after the myotomy, but it carries a higher incidence of dysphagia and gastroesophageal reflux than that of toupet posterior partial fundoplication.30,31 in our two cases, we had performed toupet posterior partial fundoplication with successful outcome. in conclusion, achalasia cardia is a rare entity in infants. a high index of suspicion is required to diagnose this condition in infants. even though gerd is a more common presentation than achalasia cardia, the latter condition should be kept in mind in the differential diagnosis in infants with symptoms of intractable regurgitation, persistent vomiting, dysphagia and failure to thrive. an early diagnosis and prompt surgery | achalasia cardia is a neuromuscular disorder of unknown etiology involving the body of the esophagus and lower esophageal sphincter (les). it is characterized by aperistalsis of the body of the esophagus and failure of relaxation of lower esophageal sphincter. it usually affects patients between the ages of 30 and 60 years. it is unusual in childhood and extremely rare in infants. we report two cases of achalasia cardia in infants. both cases were treated with open heller s esophagocardiomyotomy with anti - reflux procedure. |
three - dimensional (3d) computer reconstruction of a target volume or of a surface is an important activity in modern biomedical imaging. the accurate anatomical reconstruction in trauma or for use in image - guided intervention relies on mathematical imaging technology ; and this paper develops the mathematical technique of stochastic function recovery and illustrates its use for noisy boundary reconstruction. this is an alternative approach to the standard polynomial - based methods that we see as an add - on or complement to other techniques in use or being developed to improve upon the reconstruction of noisy boundary data to provide enhanced biomedical visualization. the ability to distinguish features related to boundaries is intrinsic to technology of visualization. for example, in mri imaging, a range of specialized methods have been developed for extracting information from signals so as to reconstruct images representing internal body structures. boundary recovery techniques apply to complex surgical procedures as with electroanatomical mapping that tracks the position of catheters inside the body with sparse signals recorded from electrodes at the tip of the catheter. resulting surface maps must integrate real - time measurements with preoperative mr or ct images, and account for mapping data errors in registration and error due to patient movement. in general, when signals are affected by noise, it must be effectively removed in order to improve the visualization and compared with other medical imaging modalities, ultrasound images suffer from speckle noise that often makes for weak or incomplete boundaries. our approach is to use stochastic convolution - deconvolution operators [1, 57 ], which have useful statistical properties, to smooth noisy surface data in a manner that does not obliterate detail, and which effectively removes gaussian noise. the motivation for the approach is that, intrinsically, stochastic interpolation using probabilistic kernels for the generating function of the row space of the linear operator performs well at removing noise when used to approximate data. however, the difficulty in applying these methods directly is that they bias the data to a mean of zero. in approximating one - dimensional data, however, in approximating multidimensional data, this can cause an apparent shift in the approximant when working in parametric coordinates. this is because the gaussian kernels used smooth positive values to their mean value, thus potentially shifting the coordinates nearer the origin. when we approximate in one dimension, the data values are shifted to the mean, however, the coordinates are not touched. if we are using parametric data, the coordinates are the data values ; and this means that the data can be shifted in (x, y) or (x, y, z) space. the less data existing or the greater the smoothing, the more will be this shift. for example, when data is taken from a circle centered on the origin, the approximating curve is a circular curve centered on the origin, but of smaller radius, and the greater the smoothing applied in the approximation (if the data is very noisy), the smaller the area circumscribed by the approximating curve. as the number of sample points however, for coarse surface data that is only smoothly varying, this can cause difficulties. one approach is to make use of stochastic interpolation. creating a dense noisy data set from the sparse noisy data using interpolation is followed by approximating this fine data set to recover the smoothed surface curve, thereby mitigating the shifting of the mean. while workable, this approach has several disadvantages, most notably that it requires a more costly interpolation step. it also requires the application of the technique more than once, and in the second or subsequent applications, the approximation must be done on a fine data set, meaning that many more points require approximation, again incurring a larger computational cost. the solution is to make use of the convolution - deconvolution properties of stochastic interpolation combining the densification step with the approximation step. however, we introduce an approximate means for doing the interpolation that interpolates for smooth data, but which approximates for noisy data, thus avoiding the costly need to construct the inverse operator needed for interpolation. consider the task of sampling a known function f(u) at points f(uk) = vk with uk [0, 1 ] so as to determine its value at xj [0, 1 ]. the stochastic interpolant to the data { (uk, vk) }, k = 1,, n is given by (1)bmnann1v, where v = (v1, v2,, vn) is the data vector, and where ann is a row stochastic matrix whose coefficients consist of the n n values ajk. choosing the generator of the row space of ann to be the bernstein functions (named after bernstein as the derivation of this form that can be obtained from the bernstein polynomials), we have (2)ajk=12[erf(uk+1xjn)+erf(xjukn) ] with > 0 on the partition wk = (uk+uk+1)/2, with w0 = and wn = yielding a stochastic matrix. setting xj = uj generates the entries of ann, and setting xj to any set of m consecutive values in [0, 1 ] generates the coefficients of bmn, that is, the coefficients of bmn are constructed in the same manner as for ann, except that the nodes xj at which bjk is evaluated may differ from the values at which the data are given. while any probability density function (pdf) can be used, appropriately replacing the mean and variance of the gaussian in (2), a pdf based on the normal distribution is consistent with the problem of filtering gaussian noise. in stochastic interpolation, with the coefficient of ann generated by (2), we can interpret ann as the discrete deconvolution of the data yielding the preimage generated by annv. this preimage is then convolved by bmn to yield an m - vector of values that interpolates the data v at the output coordinates xj, j = 1,, m ; the output coordinates are those that were used to generate the coefficients of bmn. it is for this reason that we have elected to represent the matrix a using another symbol b since it is desirable to emphasize its role in convolution. defining wk = (uk + uk+1)/2 with w0 = u0/2 and wn = 1 + un/2 with constant yields a coefficient structure in which ann is a diagonal matrix times a symmetric toeplitz matrix : ann = dtnn. inversion or solution of these matrices can be accomplished in (n) operations, however in the cases of interest to us, this is not necessary. it is possible to do better than this using an approximate inverse in which the row space of ann ann is generated directly. while evaluating bmnann is still (n), it is significantly faster than the toeplitz matrix inversion of ann to obtain ann. the approximate inverse is an approximation precisely because annann inn, that is, in applying stochastic interpolation to the data v, there is an error:(3)e0=vannanniv=(innannanni)v. thus the interpolant to the data can be expressed using successive correction to the errors using (4)v = annanniv+e0=annanniv+aannie0+e1 =annanniv+annannie0+annannie1 + +annanniep+ep+1.substituting for ek, from k = 0 to p, gives (5)v = annanni(k=0p(innannanni)k)v+ep+1, and truncating the sum gives a working formula in which vv even for larger values of, so that the method nearly interpolates. truncating at p = 2 and applying the formula to generate m output values instead of n gives (6)v=bmnanni(inn+gnn+gnn2)v, where gnn = (inn annann). provided that in (2) is small, the error in constructing ann using ann is small, however if larger values of are used, then greater smoothing is applied to the data and the use of (6) becomes necessary when is larger than 0.05. however, it will become apparent that it is because of this greater smoothing that it is unnecessary to apply any corrections as shown in (6), and thus the direct computation of bmnannv is found to be convenient and efficient, requiring only a single matrix multiply. in working with stochastic data recovery, it is obvious that bmnv using the bernstein functions mollifies the data vector v, and thus provides an approximation vector of length m to the initial vector v of length n. consider the evaluation of bmnannv where the generator of the row space of ann and bmn are given by (2). this interpolates the data provided that b, meaning that the variance of the gaussian pdf that is used to generate bmn, is the same as the variance a that is used to generate ann. if instead b > a, then the preimage annv will be oversmoothed when bmn is applied to the preimage, and the result will be approximation. similarly, if b a. to demonstrate this form, note that the intended construction is to evaluate bpnannv, where p is significantly greater than n with b = a, and then applying smoothing to this densified data by multiplying by cmp, where c > a. in effect, this interpolates the data and then smooths it by the application of the approximation cmp to the densified data. thus a two - step algorithm can be described as follows : compute densified interpolant bpnannv to the data vector v;compute boundry approximant cmp(bpnannv). compute densified interpolant bpnannv to the data vector v ; compute boundry approximant cmp(bpnannv). this algorithm is equivalent to the following : compute densified boundry approximate interpolant bmnannv, to the data vector v ; that is, there exist c and b such that applying cmp to bpnann is the same, or nearly the same, as applying bmn to ann. the use of ann for a wide range of a instead of ann introduces some additional smoothing, allowing for less smoothing to be used on the convolution step, that is, when applying bmn. the construction of ann is not difficult, remarkably being given by the inverse of the generator of the row space of ann. the elements of the approximate inverse are given by the reciprocals of the coefficients of ann. it is for this reason that the direct inversion of ann, or solution of the system using efficient toeplitz solvers, is not needed. the only exception may be when the data is free of noise and exact interpolation without any smoothing is desired. compute densified boundry approximate interpolant bmnannv, to the data vector v ; the reconstruction of surface data is done using a parametric representation { si}i = 1 in which si = (x(ti), y(ti)) for two - dimensional data, and si = (x(ti), y(ti), z(ti)) for three - dimensional data, where 0 ti 1. the recovery of the data is done using (1) or its modification using an approximate inverse ann, applied successively to the data pairs { (ti, xi) }, { (ti, yi) } in two dimensions and to the data triplets { (ti, xi) }, { (ti, yi) }, { (ti, zi) } in three dimensions. for example, in the case of interpolating two - dimensional data, we apply bmnannx and bmnanny to obtain the interpolant to the position vector x and the position vector y, or we apply bmnannx and bmnanny to obtain the approximate interpolants. in reconstructing a parametrically represented surface generated from image data from pixel values, for instance, an algorithm for boundary detection and sorting is necessary. in our analysis, it is assumed that this is available, however the errors generated in parameterizations of the surface may not be entirely random, and thus systematic errors in surface representation will also be introduced. for the purpose of assessing the performance of the boundary recovery algorithms, it will be assumed that the errors are random gaussian with a mean of zero, with variable variances, generated using the random variable (7)=2log(r1) cos (2r2), where r1 and r2 are two random numbers uniformly distributed in the interval [0, 1 ]. thus the parametrically ordered data { (x1(ti),, xd(ti)) }, with d = 2 or 3, and i = 1,, n, are perturbed to yield the data sets { (x1(ti) + (1)i,, xd(ti) + (d)i)}. in applying stochastic data recovery to the problem of finding the shape of a parametrically defined boundary, the problem of closed curves needs to be addressed. in the presence of large amount of noise, the two endpoints of the parametrically defined curves may not match : while ideally (x1(t1),, xd(t1)) = (x1(tn),, xd(tn)) in the case of a close loop, in the presence of errors this will not be the case. finally, in implementing the algorithm, it was found that the dependence of (2) on n in the denominator made the choice of dependent on n, as the boundary data density increased, the recovery using any given value of produced increasingly rougher curves as n increased, and thus it was found convenient to evaluate ajk and bjk based on a constant value of. additionally, the algorithm was applied to all of the boundary data associated with a parametric data set to construct the boundary curve, rather than decomposing the data into overlapping blocks. the merits of using all of the data are a slight improvement in accuracy, while the drawbacks are that the cost of evaluating the algorithm increases as the block size increases, and this should be born in mind in applying the algorithm to large complex three - dimensional data sets. the values for a and b depend on the amount of noise, as well as on the presumed smoothness of the boundary data. while this seems to present difficult choices, it is less complicated than it appears, as the choice for a will usually be any sufficiently small value. for example, setting a 10 allows for representing the data as nearly piecewise linear along the boundaries. in contrast, the choice for b requires some evaluation as this determines the smoothness of the recovered boundary. we begin by applying the process to the recovery of the boundary of a disk defined parametrically by 12 uniformly distributed points with no random errors in the data as shown in figure 1. the figure clearly illustrates the aforementioned difficulty of attempting to approximate (smooth parametric data). in examining figure 1(a), it is also important to observe that the beginning and the end of the curve are joined by a straight line in this example. the reason is that the slope of the approximant to the data (x(t1), y(t1)), (x(t2), y(t2)), is not the same as the slope to the data, (x(tn1), y(tn1)), (x(tn), y(tn)), and thus in this example, the first approximated point (r1, s1) does not agree with the last approximated point (rm, sm), and are joined graphically with a straight line to close the curve. a solution to the mismatch is to overlap the curves during reconstruction, that is, at several points away from the last point, and ending the construction several points away from the first point, then only using the curve from the first to the last point. in all of the studies presented, there is no attempt to overlap the curves in order to magnify these boundary affects, and to demonstrate that they are mostly negligible, as seen in figure 1(b), whenever the construction is done correctly. for large data sets where it may be computationally advantageous to block the data, overlapping the endpoints is readily accomplished. it is important to realize that if the number of points representing the disk were to be much more than 12, then it would have been difficult to visualize the contraction of the recovered boundary curve since the approximation is convergent. thus for a sufficiently large number of data points, the difference between the approximating curve and the curve itself becomes arbitrarily small. recovering the boundary of a disk becomes more difficult, as shown in figure 2, particularly if the amount of noise is quite large. in this example, the gaussian noise for a disk of radius 5 is specified as = 3 yielding an extensively scattered data set. while the level of noise in this illustrative example is much higher than would be expected in any realistic imaging situation, the example serves a two - fold purpose : (1) on the one had it shows the robustness of the method at recovering a reasonable representation of the surface from the data that is more consistent with noise than data, and (2) it shows that the effects of errors in constructing the parameterization are less of an issue than might be presumed. in the figure, the connectivity of the boundary data is not ordered in moving counterclockwise around the circle, and so it is quite likely that any minor errors in parameterization, for example, using even the simplest unconstrained nearest neighbor search of the data, would cause unrecoverable errors in the surface representation that is recovered. as expected, reducing the noise to = 1/2 significantly improves the recovery, even for half as many points, as shown in figure 3. while both of these figures are typical, the symmetry and the smoothness of the boundary of the disk make the recovery somewhat less challenging than for a more complex geometrical shape. thus the performance of the algorithm is examined on a star - shaped region generated from the vertex data { (8,65), (72,65), (92,11), (112,65), (174,65), (122,100), (142,155), (92,121), (42,155), (60,100), (8,65)}. note that the recovery makes use of that on both steps is the same as that used in recovering the boundary of the disk. the shape of the star in figure 5 has become more wiggly using the smoothing parameters the same as in the case of lesser noise. the problem is a classical one : there is no means to discern the shape of the figure from the noisy data, except to note that an acceptable shape is determined by the smoothness of the boundary that is intrinsic to the figure. in this case, changing the smoothing can accommodate this subjective assessment, as illustrated in figure 6. note that the recovered boundary is consistent with the curve recovered from the less noisy data set : compare figures 4 and 6 as shown in figure 7. the effects of doubling the smoothing by taking b to be twice as large are clearly evident. since the noise in both cases was generated using the same seed, it is only the magnitude of the excursions away from the star 's boundary that change, and hence the figures are directly comparable. this perhaps most plainly illustrates that interaction between noise and smoothing, as the two curves are nearly identical. even when the noise is doubled again to = 16, the shape of the recovered curve using = 0.0004 is remarkably consistent, as shown in figure 8. at this level of noise there is some loss of resolution of the limbs, however the recovered boundary is recognizable as being related to the two boundaries obtained in figures 4 and 6. while this is artificial in that the amount of noise in the data in real problems is not known, it does demonstrate the robustness of the algorithm at consistently recovering the boundary data irrespective of the added noise. since the approximate interpolant fails to interpolate when is large or, more appropriately, fails to interpolate rapidly varying data, quite some effort was expended in developing mechanisms for being able to use large for smoothing and yet still maintain some fidelity with the boundary data while constructing the preimage. as it developed, this iterative correction was not necessary : the algorithm performed well even without the introduction of any corrections. in part, this is due to the rather simple shapes, and the relatively large amounts of noise that were examined. in the case when a surface is oscillating rapidly with the noise much less than this surface oscillation, it is clearly necessary to implement the algorithm using this additional correction. indeed, given sufficiently rough surface data, it may be necessary to use stochastic interpolation as otherwise some high - frequency surface details will be oversmoothed by the approximate inverse construction. examination of several attempts at domain boundary reconstruction in two dimensions is encouraging using the stochastic data recovery techniques. in particular, qualitative assessments demonstrate the viability of utilizing stochastic function recovery methods for reconstructing parametrically defined edges. since the approach is intrinsically one dimensional, its extension to three dimensions is not difficult, and thus can easily be implemented and tested on more realistic problems. moving to three dimensions poses no additional cost other than that more data has to be processed, that is, the algorithmic costs scale directly with the number of lines being evaluated, and the number of points on each line at which the algorithm is applied. it should be noted that the proposed technique does not solve all problems involving noisy surface reconstruction, however it does provide an additional tool for analysis. the gaussian - based kernels (the bernstein functions) which were used to generate the row space of the matrices, were remarkably effective at cancelling the noise even under the most extreme conditions where the noise essentially obliterated the image shape. of course, this noise was gaussian and so it is only reasonable that the proposed approach would work well in these circumstances. for other types of noise, the use of alternative probability density functions for generating the mollifiers is easily accomplished, and thus the method has substantial design flexibility, and these options need to be explored in detail to ascertain their utility at cancelling these other types of noise. the computational advantages of the technique are that it requires only two matrix multiplies of the data vector, and thus the approach is relatively cost effective. moreover, the method is easily implemented in parallel, and further computational gains in efficiency can be achieved by blocking the data since typically only a segment of the entire data vector is needed to recover the data in any region. if fixed block sizes can be implemented, then the cost of the two matrix vector multiplies can be further reduced as the matrix - matrix multiply needs to be done only once, and so the algorithm reduces to a single - block matrix - vector multiply. | determining the outline or boundary contour of a two - dimensional object, or the surface of a three - dimensional object poses difficulties particularly when there is substantial measurement noise or uncertainty. by adapting the mathematical approach of stochastic function recovery to this task, it is possible to obtain usable estimates for these boundaries, even in the presence of large amounts of noise. the technique is applied to parametric boundary data and has potential applications in biomedical imaging. it should be considered as one of several techniques to improve the visualization of images. |
in a recent article for critical care link and colleagues reported that the reversible platelet glycoprotein iib / iiia antagonist tirofiban may prevent platelet activation and preserves platelet numbers during continuous venovenous haemodialysis in patients with cardiogenic shock. acute kidney failure is a frequent complication in the critically ill, particularly so in patients with severe sepsis / septic shock or with acute myocardial infarction / cardiogenic shock. often this complication will entail the need for renal replacement therapy until kidney function recovers. contact of blood with artificial surfaces of extracorporeal systems, however, may lead to platelet activation, to formation of platelet monocyte aggregates, and to induction of inflammation. in the majority of cases, extracorporeal therapy thus requires an effective anticoagulation strategy that, in turn, may put the patient at risk of bleeding complications. especially during continuous renal replacement therapy (crrt), platelet dysfunction may occur with increased activation and aggregation and ultimately with platelet loss. in recent years, glycoprotein iib / iiia antagonists have found their way into clinical routine, serving as powerful receptor blockers in the final stage of platelet activation ; for example, in patients with acute coronary syndromes and percutaneous transluminal angioplasty [4 - 6 ]. these antagonists have also been proposed as a pharmacological strategy to prevent platelet loss during extracorporeal circulation, especially in cardiac surgery (platelet anaesthesia) ; however, their potential role in extracorporeal renal replacement therapies is unclear at present. in their pilot study link and colleagues randomly assigned 40 patients with cardiogenic shock and acute kidney failure requiring crrt to two groups, either receiving unfractionated heparin (ufh) (n = 20) or receiving a combined anticoagulation with ufh and tirofiban (n = 20). they found in the group receiving only ufh that the percentage of platelet monocyte aggregates was significantly increased (p < 0.001) and the platelet number was significantly decreased (p < 0.001). in contrast, platelet monocyte aggregates and the decrement in platelet numbers were significantly reduced under combined therapy (p < 0.001). there were no significant differences between the groups regarding the efficacy of crrt, the haemofilter lifespan, or bleeding events. platelet transfusions were only necessary in three patients of the ufh group (p = 0.016). the authors conclude that, in patients with cardiogenic shock and acute kidney injury requiring crrt, the use of tirofiban in addition to ufh prevents platelet loss and platelet monocyte interaction and may preserve platelet function. whilst these findings are of interest and are of potential clinical relevance, caution needs to be exercised in their interpretation. as is also reflected in the present study, patients with acute coronary syndromes and cardiogenic shock will often be subjected to a variety of specific (pharmacological and nonpharmacological) interventions that may impact on platelet function and/or number. this includes the administration of anticoagulants (heparins, heparinoids, thrombin inhibitors), antiplatelet agents (glycoprotein iib / iiia antagonists, acetylsalicylic acid, thienopyridine), and catecholamines, as well as treatment with intraaortic counterpulsation. in a fairly small and heterogeneous cohort the same holds true for the potential influence of the type and mode of the extracorporeal treatment and materials, and, last but not least, for the metabolic control / uraemic state of the patient. moreover, the response of individual patients to acetylsalicylic acid and/or thienopyridin may vary considerably up to the point of the new and not completely understood phenomenon of thienopyridine nonresponders, an issue that will also have to be carefully considered in a subsequent study. the platelet numbers in the ufh therapy group were more than halved, dropping from an average of (216 64.3) 10/l to as low as (87.3 41.1) 10/l within 4 days three patients with platelet counts < 20 10/l even requiring platelet transfusions. given the fact that the authors used modern polysulphone capillary haemofilters and employed a continuous venovenous haemodialysis regime that reduces transmembrane pressures and thus reduces shear stress compared with postdilution continuous venovenous haemofiltration, the observed extent of platelet loss seems unusually large and remains unexplained. in summary, the study by link and colleagues raises the important question of whether platelet anaesthesia with tirofiban prevents platelet activation and loss during crrt. the data presented indicate a significantly reduced platelet loss with additional glycoprotein iib / iiia antagonist therapy compared with ufh therapy alone. owing to the small sample size, however, the potential impact of additional treatment variables could not be clarified. a substantially larger, adequately powered study | link and colleagues present a pilot study investigating platelet function and platelet numbers in patients with cardiogenic shock and acute kidney failure undergoing continuous venovenous haemodialysis. their data indicate a significantly reduced platelet loss with combined therapy of unfractionated heparin plus tirofiban, the glycoprotein iib / iiia antagonist, compared with unfractionated heparin therapy alone. owing to the small sample size, however, the potential impact of additional treatment variables (antiplatelet agents, intraaortic counterpulsation) could not be clarified. a substantially larger, adequately powered study is therefore called for to establish the potential clinical relevance of these findings. |
children and adolescents with gerd usually have a history of vomiting and spitting up as an infant. if gerd is left untreated, it can lead to dysphagia, odynophagia, esophageal stricture, chronic hoarseness, laryngitis or respiratory problems such as coughing or reactive airway disease in children and non - cardiac chest pain or barrett s esophagus in adults. proper evaluation and appropriate therapy may result in better long - term outcomes, such as improved quality of life and reduction in the overall health - care burden. traditional catheter - based esophageal ph monitoring is uncomfortable and cumbersome ; many parents may forego testing for their children, leaving them undiagnosed and consequently untreated or under treated for this disorder. in gastric juices have been detected in the middle ear, which this indicates that gerd can cause chronic otitis media with fluid collection. testing with a ph probe can cause nasal and throat irritation in some, impairing the ability to maintain a normal diet. the catheter itself remains visible, causing many patients to alter their exercise and activity routines during the test period. these changes in the patient s routine may provide false negative findings and adversely affect the reliability of the results. parents are also unhappy with these limitations. some of our patients have refused to eat and drink properly and some missed school days while the ph probe catheter was in place. shoreview, mn) may offer a more desirable diagnostic option for ph monitoring for pediatric patients and their parents in terms of comfort and convenience. the purpose of this retrospective study is to analyze the efficacy, safety and reliability of the bravo capsule placement procedure and its related complications. after obtaining institutional review board approval, the records of all patients who underwent bravo ph analysis from january 2002 to december 27, 2010 were reviewed. as per our institute s upper gastrointestinal (gi) endoscopy protocol, all endoscopies were performed in the operating room and under general anesthesia. all patients were requested to stop proton pump inhibitors one week and if on h2 receptors, two days prior to the procedure. the procedure was discussed with patients and parents, and consent was obtained. patients were told that they might feel some chest pain, pressure and discomfort after anesthesia or later during swallowing. additionally, patients were told that it was not necessary to retrieve the capsule since it would fall spontaneously within a few days and pass through the gastrointestinal tract. the procedure was performed by using an olympus gif-160 gastrointestinal videoscope (olympus, center valley, pa). the bravo capsule was placed at 87% of the endoscopically determined distance from the incisor teeth to the z line. a series of questions with yes and no responses for substernal or chest pain, dyspnea, dysphagia, odynophagia, vomiting, abdominal pain and gastrointestinal bleeding were asked. parents and children were also asked to rank their activity level and overall satisfaction with the bravo capsule test on a likert scale ranking from 1 to 5. the data was downloaded via an infrared link to a computer using polygram net ph analysis software. results were analyzed with software package spss (version 14.0 ; spss, chicago, il) and the mann - whitney u test minitab software (version 14 ; minitab, state college, pa). within the past eight years a total of 219 patients (134 females and 85 males) were identified and their data evaluated. indications for endoscopy and bravo capsule placement were for evaluation of persistent epigastric abdominal or substernal pain, heartburn, gerd and chronic cough. bravo capsule was placed successfully in all patients. in two patients, a conventional ph catheter and bravo capsule premature detachment was suspected in three patients (1.36%) due to sudden decrease of ph followed by an increase to a ph > 6. in these patients, abdominal x - rays showed the presence of the capsules in the patients small bowels. these happened early in the study, when we had less experience with using the bravo capsule. we did not notice it happening again after we learned how to deliver the capsule. in one patient (0.45%), malfunction of the recording device was detected although the patient tolerated the procedure very well. one of our patients (0.45%) deleted the data from the recording device and another patient underwent placement of the bravo capsule twice during five years. except for these five patients, ph tracings for the remainder of patients were available for interpretation (table 1). there were no significant differences between the ph data obtained with the ph probe catheter and the bravo capsule in our patients where the ph probe and bravo capsule were placed simultaneously ; however the tracing from the ph probe showed a slightly more alkaline ph. in 3 out of 214 patients (1.45%), one (0.45%) complained of chest, back and shoulder pain soon after bravo capsule placement, while still in the recovery room. the patient s chest x - ray was normal and pain resolved after the first meal. during the study, a total of 9 out of 214 patients (4.2%) reported a sensation of the capsule in their chests without any pain at meals (table 2). none of our patients reported vomiting, sore throat, dysphagia, feeling bad, refusal to go to school, or inability to eat regular meals in 48 hours of this study. the use of a ph probe, bravo wireless ph monitoring system and impedance method measures both acid and nonacid reflux disease. the use of the impedance method is limited in children and mostly used in research studies. the conventional ph probe test is very helpful and is the most reliable technique to evaluate the severity and frequency of gerd at any age. it is important to have this prognostic information for proper management of patients who remain symptomatic and it also gives us information in patients with extra gastroesophageal manifestation of reflux disease. this piece of information along with clinical and biopsy findings helps the physician to manage patients most effectively and assists with the decision to consider a nissen fundoplication. in our practice, many patients have refused this test. some patients removed the probe just after it was inserted in the operating room under anesthesia, when moved to the recovery room, or soon after they arrived home. removal is usually because the catheter causes local irritation and discomfort to the nasal area. failures of the conventional ph probe test include wire breakage, failure to record, patient removal or the catheter coiling in the throat and mouth during a vomiting episode. patient may modify their diet and daily physical activity or resting on a couch when a ph probe test is used. the bravo capsule ph analysis was accepted and well tolerated in 93.9% of our patients. the catheter - free bravo ph monitoring system collects ph data and transmits it via radio frequency. it is easy and takes only a few minutes to be placed following endoscopy, and gathers ph data for 48 hours. there is a significant reduction in acid detection if it is placed at 10 centimeters when compared to 5 centimeters above the lower esophageal sphincter in patients with acid reflux disease. in adults. occasional un - attachment of the capsule is possible if the capsule hole does not touch the esophageal surface during suctioning time. with the bravo capsule analysis proper explanation of the procedure, and patient awareness of possible short - term chest pain will reduce anxiety and lessen complaints in children and teenagers. we have suggested that patients consume regular meals and chew their food well, avoiding large bites and chunky food. this may be one of the reasons that our patients did well with no pain or odynophagia, due to the lack of pressure or stretching on the capsule by a large meal. it has been reported that 60% of patients with associated chest pain will have esophageal hypercontractibility when motility is performed with the bravo capsule in place. after 48 hours, a follow up clinic visit was scheduled which was preferred by both patients and parents, mostly because patients were able to go to school and continue their regular work and activities without restrictions. in this study patients rarely complained of feelings of short substernal pressure during swallowing. we believe that feelings of pressure and chest pain should resolve after one or two meals. we avoided bravo ph analysis in patients with crohn s disease, small bowel and esophageal stricture, because the capsule may not pass through the gastrointestinal tract. we did not insert the capsule in patients with severe erosive esophagitis due to poor attachment, and those with esophageal varices due to risk of bleeding, and in patients with intestinal pseudo - obstruction due to motility disorders. simultaneous recording of esophageal acid exposure with conventional ph monitoring and a wireless system have been performed in 40 patients suggestive of reflux disease. there was a significant correlation with the 24-hour esophageal acid exposure that was recorded. in this study, the bravo catheter - free system under - recorded the acid exposure compared to the conventional ph probe test. some have reported that the bravo system detected fewer refl ux events of short duration compared with a catheter - based system. in our study, we had simultaneous conventional and bravo ph analysis in two patients. in both, the bravo wireless ph monitoring system has been reported in adults to be safe, reliable, well tolerated and convenient for the patient. our patients reported fewer complaints than others, possibly due to explanation of the procedure, their expectation of some discomfort and chewing modifications. complications reported by others have been associated with nasal intubations for transnasal placement of the conventional catheter. those include sore throat, and trauma to the naso - pharynx or bloody nose. for bravo complaints include premature detachment of the capsule, failure of the capsule to slough in time and pain or discomfort associated with the capsule, requiring endoscopic removal. in one study, four patients (3.4%) required upper endoscopy for removal of the ph capsule within 2 to 8 days of attachment because of severe pain upon swallowing. in our study none required capsule removal. upper ph monitoring of children with the bravo ph capsule was evaluated in 25 children age 3 months to 11 years and revealed no serious complications. the test was done to evaluate patients with extra esophageal reflux disease that presented as asthma, croup, bronchitis, sinusitis, laryngomalacia, subglottic stenosis and reactive airway disease. non - endoscopic ambulatory transnasal placement of a wireless capsule for esophageal ph monitoring has been performed for feasibility, safety and effi cacy in 39 adult patients. in this study, 2 patients had epistaxis, 3 with laryngeal irritation and 20 had foreign body sensation in the chest. endoscopic removal of the capsule was performed in some patients due to constant retrosternal pain. another report of 85 adults noted that 3 (4%) required removal of capsule because of pain. use of the bravo ph monitoring system has been approved for adults by the united states food and drug administration. this is a significant advancement in the evaluation of patients with gerd because of potentially better tolerability and the ability to record data over a 48-hour period. the bravo ph capsule is easy to insert in children and they able to resume their normal activities without missing school and work. this test is safe and more informative because of a 48-hour recording period compared to 24 hours by the conventional ph probe test. the bravo ph monitoring system is a safe, reliable, and effective diagnostic tool with good tolerance for pediatric patients suspected of suffering from gerd. | backgroundgastroesophageal reflux disease (gerd) is a common problem seen in pediatrics and adolescents. the bravo ph monitoring system is a capsule that detects and quantifies the severity of reflux disease. this test is also valuable for evaluation of patients with extra - gastrointestinal manifestations of gerd such as asthma, chronic cough, hoarseness, aspiration pneumonia, and pre / post fundoplication surgery. this study evaluates the safety and reliability of this procedure in children.methodsfrom january 2002 to december 2010, 219 patients (85 males and 134 females), ages 6 - 18 years underwent upper endoscopy with biopsies and placement of the bravo capsule.resultsin 201 out of 219 patients, the bravo ph monitoring procedure completed within 48 hours without any complaints. in 3 out of 219 patients, the ph dropped to less than 2 after 30 minutes. this indicated that the capsule moved from the esophagus to the stomach. one other patient deleted all data while playing with the recorder at home. in another patient, there was recorder malfunction. three patients presented with chest pain, one with chest and back pain and nine patients had a mild sensation of sub - sternal pain for two hours or less. none of the patients needed to retrieve the capsule.conclusionbravo capsule ph monitoring of the esophagus is reliable, safe, well tolerated and free from significant complications, and preferred by young adolescents. with the bravo capsule, adolescents can attend school and continue their normal physical activities without interruption. |
muscle fatigue involved in inspiration, such as diaphragm muscle, external intercostal muscle, or parasternal intercostal muscle, induces a shortness of breath resulting in impaired exercise tolerance1, 2. in addition, diminished respiratory muscle strength results in the reduced efficiency of coughing to remove airway secretions (phlegm), which increases the risk of atelectasis or pneumonia after surgery or prolonged bed rest3, 4. age - related physiological changes in the respiratory system, such as decrease in pulmonary elasticity, fusion of the sternal bone and costal cartilage, or increases in thoracic kyphosis, augment the reduction of respiratory muscle strength and respiratory function5. indeed, in japan, pneumonia has recently overtaken cerebrovascular disease as the third leading cause of death, reflecting the aging of society. thus, it is essential to maintain respiratory function, including respiratory muscle strength, for a healthy daily life, particularly for the elderly. as a part of health promotion activities, aquatic exercise has generally been accepted in the clinical settings of rehabilitation and various sports facilities6, 7. people with obesity8, joint diseases9, or lumbago10, 11 benefit from aquatic exercise, wherein they can avoid unnecessary exercise load on the joints because of self - weight using buoyancy and can perform exercise more safely. in addition, they can efficiently strengthen the muscles of the upper and lower extremities using water viscosity and pressure in aquatic exercise9,10,11,12. breathing underwater requires great effort mainly because of the following two aspects : first, blood volume shifts into the chest cavity because of the increased venous return from the lower extremities ; second, inflexibility of the chest wall and diaphragm shifts toward the cranial side because of the hydrostatic pressure resulting into restricted pulmonary compliance13,14,15. regarding the effect of water depth on respiratory function, the pulmonary vital capacity (vc), forced expiratory volume during the first second (fev1.0), and functional residual capacity (frc) are decreased during water immersion at the clavicular or cervical level16,17,18. furthermore, de andrade. reported that the decrease in the maximum inspiratory muscle strength during water immersion was greater when the water level was at the clavicle than at the xiphoid process because of the higher water pressure at the clavicular level19. therefore, aquatic exercise, such as swimming or walking in water, is an ideal exercise for health promotion, which can add an aspect of resistance training through water viscosity to aerobic exercise. in addition, the specific circumstance of resistance to chest expansion during the inspiratory phase may be useful for developing respiratory muscle strength. previous studies have reported that exercise in water for 810 weeks improves the respiratory muscle strength and exercise tolerance of healthy individuals, and patients with chronic obstructive pulmonary disease and spinal cord injury20,21,22. however, it has not been clarified how the water depth during exercise in water affects respiratory muscle strength. accordingly, the hypothesis was built that inspiratory muscle strength would decrease after aquatic exercise training by muscle fatigue depending on the water depth. thus, we investigated, 1) the effect of water immersion at different water depths on respiratory function, and 2) the effect of inspiratory muscle training during water immersion at different water levels on respiratory muscle strength. sedentary, healthy male college students aged between 20 and 22 were recruited for this study. subjects who had a history of respiratory or cardiovascular disease, hypertension (resting systolic blood pressure (bp) 140 and/or diastolic bp 90), diabetes, obesity (body mass index (bmi) 30), or smoking habits were excluded. the applicants who met the inclusion criteria participated in the study after familiarizing themselves with the experimental protocol, e.g. the spirometry measurement method and inspiratory load breathing (ilb). this study was approved by the institutional review board of osaka city university graduate school of medicine (approval no. 2629), and registered with the university hospital medical information network - clinical trial registry this study also conformed to the principles of the declaration of helsinki, and written informed consent was obtained from all of the subjects prior to the experiment. the subjects were required to attend the laboratory on three separate days for three trials at different water depths, the umbilical level (ul), the 4th rib level (rl), and the clavicular level (cl) trials, in a random order, with at least 3 days separating each trial. in all sessions, a depth - variable water bath (aquaexmill ocu1, sanplatec, osaka, japan) was used, and the water temperature was maintained at 32 1.0 (sd) c, the insensible temperature, to minimize the stress on the body23, 24. at the beginning of each session, subjects sat immersed in the water bath with the depth at the umbilical level for 5 min, and then the respiratory function and respiratory muscle strength were evaluated as baseline measurements. next, subjects sat immersed at one of 3 different water levels (ul, rl, or cl). after an additional 5 min, the measurements were repeated for the purpose of evaluating the effects of water immersion at the different depths on the respiratory function and respiratory muscle strength. then, the subjects performed 15-min ilb in the sitting position, followed by the continuous evaluation of respiratory muscle strength immediately, and 5 min, and 10 min after they had completed ilb immersed in water at the umbilical level in the sitting position. the water levels were adjusted by changing the height of the chair. the respiratory function and respiratory muscle strength after ilb the subjects conducted 15 min breathing at a respiratory rate of 15 breaths per min, synchronized with a metronome, during which the inspiratory muscle load was adjusted to 30% of the maximum inspiratory pressure (pimax) at baseline using an inspiratory loading device (threshold imt, philips, usa). the load of 30% of pimax during ilb was adopted, because it is commonly used as the load in the settings of respiratory muscle training for healthy subjects25. the subjects were asked to take normal breaths by maintaining their tidal volumes (tvs) as in usual respiration at rest, not deep breaths, during the ilb. tidal volume (tv), vc, inspiratory capacity (ic), inspiratory reserve volume (irv), and expiratory reserve volume (erv) were measured as indices of respiratory function using a spirometer (as-507, minato, osaka, japan). pimax and maximum expiratory pressure (pemax) in the oral cavity were also evaluated using a sthenometer attached to the spirometer (aam337, minato, osaka, japan) according to the method of black and hyatt26 and used as surrogate indices of inspiratory and expiratory muscle strength, respectively. chest circumference (cc) was measured with a measuring tape at the xiphoid process level. the rate of change of each parameter of respiratory function and respiratory muscle strength from baseline was calculated using the following equation : rate of change (%) = [(a measured value)(baseline value) ] / (baseline value) 100 weight and height were measured before the first experiment. body mass index (bmi in kg / m) was calculated as body weight (kg) divided by height (m) squared. all statistical analyses were performed using stat view statistical software package (ver5.0, sas, cary, nc, usa). data were expressed as the mean standard deviation (sd) unless otherwise indicated. one - way analysis of variance (anova) with repeated measurements and subsequent multiple pairwise comparisons (scheffe method) was performed to evaluate the effects of water immersion at different water depths on the rate of change in the respiratory function and respiratory muscle strength from baseline. the effects of water depth and ilb on change and the rate of change in the respiratory function and respiratory muscle strength were examined using two - way (trial time) anova with repeated measurements. in the case of a significant time or trial effect, post - hoc multiple pairwise comparisons (dunnett method) were performed. eight applicants, aged 21.3 0.5 years, who met the inclusion criteria were enrolled in the present study. their mean values of height, weight, and bmi were 1.73 0.1 m, 64.4 7.5 kg, and 21.5 1.5 kg / m, respectively. changes in the parameters of respiratory function and respiratory muscle strength following water immersion in each trial are shown in table 1table 1.the effect of water immersion on respiratory function and respiratory muscle strengthulrlclbaselineafter immersionbaselineafter immersionbaselineafter immersionvc (l)4.10.74.10.64.00.53.90.54.00.53.60.5tv (l)0.70.20.70.20.70.40.70.40.70.30.80.3ic (l)2.40.62.40.62.30.52.50.42.50.62.90.8erv (l)1.60.41.60.41.70.51.40.51.50.40.80.5irv (l)1.70.61.70.61.70.41.90.31.80.42.10.7cc (cm)76.85.176.75.176.15.275.95.176.85.275.95.1pemax (cmh2o)104.422.8106.533.1101.520.8100.226.1105.325.898.724.9pimax (cmh2o)96.524.392.419.992.127.889.627.597.323.690.124.1values are means sd.ul : umbilicus ; rl : 4th - rib ; cl : clavicle ; vc : vital capacity ; tv : tidal volume ; ic : inspiratory capacity ; erv : expiratory reserve volume ; irv : inspiratory reserve volume ; cc : chest circumference ; pemax : maximal expiratory pressure ; pimax : maximal inspiratory pressure. there were no significant changes in any parameter due to water immersion in each trial. when we compared the rates of change in each parameter among the three trials, as shown in table 2table 2.the effect of water immersion at different water depths on the rate of change in respiratory function and respiratory muscle strengthrate of change (%) ulrlclvc0.81.31.71.29.71.0tv0.12.65.46.58.46.7ic1.70.810.74.114.15.2erv1.21.617.16.146.38.1irv2.22.014.45.617.28.0cc0.10.10.20.71.10.1pemax2.13.61.23.16.32.3pimax4.32.42.73.57.32.4values are means sem. p < 0.05, vs. ul. p < 0.05, vs. rl.abbreviations are as table 1., the decreases in vc (ul : 0.8 1.3, rl : 1.7 1.2, cl : 9.7 1.0%, p = 0.01 for cl vs ul, p = 0.03 for cl vs rl), erv (ul : 1.2 1.6, rl : 17.1 6.1, cl : 46.3 8.1%, p = 0.01 for cl vs ul, p = 0.02 for cl vs rl), and cc (ul : 0.1 0.1, rl : 0.2 0.7, cl : 1.1 0.1%, p = 0.04 for cl vs ul, p = 0.04 for cl vs rl) from baseline were significantly greater in the cl trial than in the rl and the ul trials. the increase in ic was also significantly greater in the cl trial than that in the ul trial (ul : 1.7 0.8, rl : 10.7 4.1, cl : 14.1 5.2%, p = 0.02 for cl vs ul, p = 0.12 for cl vs rl). the rates of changes in the other parameters of respiratory function and muscle strength did not show significant differences among the trials. ul : umbilicus ; rl : 4th - rib ; cl : clavicle ; vc : vital capacity ; tv : tidal volume ; ic : inspiratory capacity ; erv : expiratory reserve volume ; irv : inspiratory reserve volume ; cc : chest circumference ; pemax : maximal expiratory pressure ; pimax : maximal inspiratory pressure values are means sem. p < 0.05, vs. ul. p < 0.05, vs. rl. changes in respiratory muscle strength following ilb in each trial are shown in table 3table 3.the effect of inspiratory load breathing at different water levels on respiratory muscle strengthbaseline0 min after ilb5 min after ilb10 min after ilbpimax (cmh2o)ul96.524.389.720.998.623.499.422.8rl92.127.888.425.694.224.5100.222.3cl97.323.684.423.299.921.4100.525.4pemax (cmh2o)ul104.422.8114.428.3102.723.5109.023.3rl101.520.894.323.1103.124.799.825.7cl105.325.8102.221.1103.820.0105.716.0values are means sd. abbreviations are as table 1.. there were no significant differences in these parameters among three trials. regarding the rate of change in respiratory muscle strength following ilb, compared to the baseline, pimax was reduced immediately after ilb in the cl trial, and the reduction was significantly greater than in the rl and the ul trials (ul : 7.0 1.5%, rl : 6.7 4.8%, cl : 14.1 4.1%, p = 0.04 for cl vs ul, p = 0.03 for cl vs rl). on the other hand, pemax was not affected by ilb in any of the trials, and there was no difference in the rate of change in pemax among the three trials. in the present study, the decreases in vc and erv during water immersion were significantly greater in the cl trial compared to those in the other trials. reported that vc and forced expiratory volume in 1 s during water immersion reduced in proportion to the depth of the water, and that the reduction became significant when the depth was at the cervical level16. dahlback and buono. also reported that vc was significantly decreased by water immersion at the clavicle level27, 28. kurabayashi. reported that cc was reduced by 0.5 cm with water immersion at cervical level depth, compared to that before submersion29. in the present study, the reduction in cc was significantly greater in the cl trial than in the other trials, and this is also consistent with the results of kurabayashi. therefore, it is likely that the chest wall is compressed by the hydrostatic pressure of water immersion to the clavicular level or deeper. speculation has emerged that the abdominal wall as well as the chest wall is compressed by hydrostatic pressure during water immersion resulting in cranial shift of the diaphragm, which would reduce the compliance of the chest cavity, or vc. a cranial shift in the diaphragm and reduced compliance of the chest cavity would also minimize the alveolar size at the end - expiratory phase, which may decrease erv, and, in contrast, increase ic. in the present study, neither pimax nor pemax were affected by water immersion, regardless of the depth of the water. in regard to pimax, our results were consistent with the findings of schoenhofer.30 who reported that pimax was decreased by water immersion to the clavicular level compared to the baseline before submersion, but that the decrease was not statistically significant. it is generally recommended that the measurement of pimax is performed at the maximum expiratory phase, based on the theory of the length - tension relationship31. in short, the maximum expiratory phase is determined by the balance between expiratory muscle contraction and the opposing elastic dilatation pressure of the lung and thorax. in this phase, the inspiratory muscles and the diaphragm are extended to the utmost and demonstrate maximal tensile strength to generate maximal inspiratory pressure with the support of the elastic dilatation pressure of the lung and thorax. water immersion could assist the subjects to easily retain maximum expiratory phase, and it may be the reason why pimax was not impaired by water immersion in the present study. regarding pemax, our results support the findings of de andrade.19 who reported that pemax during water immersion did not differ regardless of the depth of the immersion. primarily, submersion accompanied by decreases in vc and cc may be unfavorable conditions for measuring pemax from the perspective of the length - tension relationship cited above. however, it is possible that hydrostatic pressure against the entire thorax in the cl trial may have assisted expiration resulting in minimal influence of immersion on pemax. to the best of our knowledge, no previous report has investigated the influence of water depth during submerged forced respiration on respiratory muscle fatigue. in the present study, the decrease in pimax immediately after ilb was significantly greater in the cl trial than that observed in the other trials. in the cl trial, it is possible that hydrostatic pressure against the entire thorax may have added an excessive load on the inspiratory muscle besides the original load of 30% of pimax during ilb. in addition, it is possible that an extra inspiratory load was elicited by reduced alveolar compliance following increased venous return under the influence of hydrostatic pressure on the lower extremities. this may be why the greatest decrease in pimax following ilb was found in the cl trial ; it reflected more severe inspiratory muscle fatigue compared to the other trials. on the other hand, although it is considered that even in the rl trial, hydrostatic pressure against the lower part of thorax affected the expansion of the chest cavity, at least in part, there was no significant decrease in pimax following ilb in the rl trial, as well as in the ul trial. de andrade. showed that neither water immersion to the depth of iliac crest nor the xiphoid process level reduced vc compared to that measured on dry land19. their findings suggest that immersion to the depth of the xiphoid process level or shallower does not yield enough hydrostatic pressure on the chest wall or venous return to the mediastinal space to impair the expansion of the chest cavity. therefore, immersion to ul or rl in our study was unlikely to have additionally loaded the inspiratory muscles. in the present study, the decrease in pimax immediately after ilb in the cl trial had completely recovered at 5 min after ilb. our results support the findings of suzuki. who reported that pimax was transiently decreased immediately after resistance load respiration training, but the decrease was no longer observed 5 min after the cessation of the training32. approximately 60% of the muscle contained in the diaphragm is comprised of red muscle fibers33, which are characterized by fatigue resistance and endurance strength. this may be a reason why fatigue of the inspiratory muscle induced by ilb was quickly recovered in our cl trial. in contrast to pimax, pemax showed no change from baseline following ilb in any trial. in the present study, furthermore, hydrostatic pressure against the chest wall could possibly have assisted expiratory muscles to contract. therefore, our immersed ilb may have resulted in no remarkable fatigue of the expiratory muscles. the results of this study suggest that the deeper the immersion depth, the greater the fatigue of the inspiratory muscles. generally, training - associated factors which cause muscular fatigue, such as metabolic stress or local hypoxia, are necessary for eliciting muscular hypertrophy and strengthening34. therefore, the results of this study have important implications for exercise in water for patients with chronic respiratory diseases, in which the strengthening of respiratory muscles is widely accepted as a therapeutic strategy. regardless of the presence of a chronic disease, from a health promotion perspective, our results will be useful for determining the depth of water for aquatic exercise. however, it is not clear whether training producing greater inspiratory muscle fatigue results in greater muscle strength. it also has to be determined whether the results of our study of healthy young adults can wholly be applied to patients with chronic respiratory diseases whose respiratory muscles are already fatigued, even at rest. in addition, the water resistance during aquatic exercise varies according to the kinetic rate, i.e., a lower kinetic rate correlates with a smaller water resistance in aquatic exercise. it is possible that respiration in water at low frequency reduces the load against the chest wall in aquatic respiration exercise. therefore, it is necessary to develop effective aquatic exercise protocols for strengthening respiratory muscles. first, the values of pimax and pemax had high variation among individuals. therefore, the small number of subjects may not have been enough to verify the influence of ilb on respiratory muscle fatigue. furthermore, our subjects performed ilb with a prescribed inspiratory load and respiratory rate. however, subjects were only asked to maintain their tvs with normal respiration at rest. although we found no significant difference in tvs during water immersion among the trials, it is not certain whether the subjects could keep tvs during ilb constant across the trials. therefore, there is a possibility that differences in tvs influenced the magnitude of inspiratory muscle fatigue. in summary, forced respiration during the deepest level of water immersion caused the greatest inspiratory muscle fatigue in healthy young men. further studies are needed to develop an exercise regimen that can be utilized in the field of sports or clinical settings that makes the most of the characteristics of submersion and aquatic exercise. | [purpose ] the purpose of the present study was to evaluate the effect of water immersion at different water depths on respiratory function and the effect of inspiratory load breathing (ilb) during water immersion at different water depths on respiratory muscle strength evaluated by maximum inspiratory and expiratory pressures (pimax and pemax, respectively). [subjects ] eight healthy men participated randomly in three trials. [methods ] all sessions were conducted with the participants in a sitting position immersed in a water bath. we evaluated respiratory function, pimax and pemax during submersion at three different levels of water depth (umbilicus ; 4th - rib ; or clavicle, cl) and after subsequent 15-min ilb. [results ] decreases in vital capacity and expiratory reserve volume from baseline by water immersion were significantly greater in the cl trial than those in the other trials. in the cl trial, pimax was immediately reduced after ilb compared to that at baseline, and the reduction was significantly greater than those in the other trials. pemax was not affected by ilb in any of the trials. [conclusion ] forced respiration during deeper water immersion caused greater inspiratory muscle fatigue in healthy young men. |
the underwater environment produces some pathophysiological problems due to the fast changing of its bounded pressure which may cause various illnesses that might be difficult to detect and treat. our nervous system is an organ which is very sensitive to underwater pressure changes, and a damaged nervous system can lead to hazardous disorders. hyperbaric condition can be considered as a risk factor for cerebral ischemic events and strokes in divers (1 - 4). the trembling of hands, postural instability, gastrointestinal problems, somnolence and cognitive dysfunction are some of the diving related disorders developed by a hyperbaric condition called high pressure neurological syndrome (hpns) (5). clinical symptoms of nitrogen narcosis are similar to alcohol intoxication which leads to a temporary dysfunction of neuromuscular and intellectual activity and the disturbance of behavior and personality. this condition generally occurs in depths of deeper than 30 meters (100 ft). nitrogen narcosis leads to hallucinations, unconsciousness and even death at a depth of 90 to 100 meters (5). zeba showed that the cases of diving cns barotraumas are rare but its symptoms are diverse and include dysesthesias, complete quadriplegia and encephalopathy (6). moreover, long term diving may cause various problems, the most common of them being the lack of concentration and numbness of hands and feet (7). although there is much evidence emphasizing neurological effect of barotraumas in divers, there is not any data about the effect of high pressure condition on intracranial pressure. in some studies ultrasound (us) has been called as a noninvasive technique to detect increased intracranial pressure (icp) (8) in conditions such as hydrocephalus (9,10) and trauma (11, 12). however, in this study we investigated the effect of long term diving practice upon optic nerve and sheath diameters as a non - invasive indicator of intracranial pressure changes in professional divers. an informed consent was taken from all of the participants, and the study was approved by the tehran university medical sciences (tums) ethics committee. the study group consisted of 21 professional male scuba divers between 26 and 66 years of age having totally 42 eyes, and the control group consisted of 19 non - diving healthy male patients having 38 eyes. all of the participants had at least 2 years of scuba diving history without any previous history of eye disease or abnormal vision, head trauma or brain disorders. the diving depths were about 25 to 50 meters which was varied for different individuals. control group subjects were selected from healthy individuals with the following criteria : 1) not having any history of diving, working or living in very low or high atmospheric pressure conditions, 2) not having any history of eye or brain injuries or diseases, 3) not having any history of blurred vision, eye pain, and low visual acuity. all divers and the control group cases completed a questionnaire including demographic data, medical and diving history. all patients were examined in the supine position. descriptive analysis of quantitative and qualitative variables were performed and presented in a table. possible association between onsd and scuba diving was examined by mann - whitney u - test. then, the relationship between qualitative data such as education and marriage, and quantitative data such as age and experience was determined using chi2 test and spearman correlation test, and after this, comparison of onsd and diving experience was made by linear regression model. an informed consent was taken from all of the participants, and the study was approved by the tehran university medical sciences (tums) ethics committee. the study group consisted of 21 professional male scuba divers between 26 and 66 years of age having totally 42 eyes, and the control group consisted of 19 non - diving healthy male patients having 38 eyes. all of the participants had at least 2 years of scuba diving history without any previous history of eye disease or abnormal vision, head trauma or brain disorders. the diving depths were about 25 to 50 meters which was varied for different individuals. control group subjects were selected from healthy individuals with the following criteria : 1) not having any history of diving, working or living in very low or high atmospheric pressure conditions, 2) not having any history of eye or brain injuries or diseases, 3) not having any history of blurred vision, eye pain, and low visual acuity. all divers and the control group cases completed a questionnaire including demographic data, medical and diving history. descriptive analysis of quantitative and qualitative variables were performed and presented in a table. possible association between onsd and scuba diving was examined by mann - whitney u - test. then, the relationship between qualitative data such as education and marriage, and quantitative data such as age and experience was determined using chi2 test and spearman correlation test, and after this, comparison of onsd and diving experience was made by linear regression model. most of them worked far from their place of residence, (13 ; 86.6%). the mean diameter of the two optic nerve sheaths was observed to be higher than 5.7 mm in thirty five divers. the mean of the left optic nerve and sheath diameters was significantly higher than the right ones in the diver group (p=0.001,). no difference was found between right and left onsd in the control group (p>0.05) ; but age of divers had influence on the right onsd (p=0.01 ; r=0.6). thus a significant difference was witnessed in the optic nerve diameters of diver group and control group (p= 0.01, p=0.05). mean diameter of left and right optic nerve sheaths in diver group was 6.420.87, 6.520.63 respectively. it was significantly higher than the mean of the left and right optic nerve sheaths in control group which was 4.87 0.57 and 4.95 0.59, respectively (p=0.001, p= 0.001).(see in figs. 1 & 2) no relationship was found between optic nerve sheath and optic nerve diameters and bmi, but a significant relationship was noticed between both optic nerve sheath diameter and the diving, after age adjustment which is shown in table 2. effect of hyperbaric condition on brain and nervous systems was already known to some extent. however, the result of this study gives evidence that divers have a higher onsd than that of the general population reported by related studies (13 - 17). the ultrasound - based evaluation of the optic nerve sheath diameter is a highly suggestive method for the determination of increasing intracranial pressure especially in a critical situations. sensitivity and specificity of this method is estimated to be higher than 90%, whereas, that of tayal study was reported to be only 63% (11) our research has also assessed the effect of atmosphere on onsd. onsd increase was seen at high altitudes, and so it is assumed that onsd increase may be associated with severe symptoms of acute mountain syndrome (ams) and may be related to intracranial pressure (18). however, this claim could not be proved in a separate study undertaken for this purpose. it was shown that the development or amelioration of mild high altitude headache (hah) has no association with intracranial pressure (19). therefore, there is a controversy over the claim that atmospheric pressure variations have affect on the optic nerve sheath diameter. in comparison to the normal range of osnd of normal population which is estimated to be below 5.7 mm (11, 16, 20), little research has been done on the effect of bar pressure or barotraumas on optic nerve ; and peripheral neuropathy after decompression sickness is a rare event. the mechanism of injury is assumed to be a manifestation of decompression illness with a gas bubble causing blood flow obstruction and an ischemic infarct (21). in one case - report, sixth nerve palsy and sensory loss and ataxia was reported after decompression sickness (22). thus the two possible mechanisms are : 1) high pressure conditions may cause temporary increase of intracranial pressure, and then increase of onsd ; 2) a blood flow obstruction or / and the effect of bar pressure on the performance of some enzymatic systems such as carbonic anhydrides enzyme, which may cause onsd increase. even though no study investigated the effect of age on onsd, a relationship was noticed between diving history and the optic nerve diameter even after making adjustments for age in our study. according to previous studies, increase of onsd is an indicator of severe increase of intracranial pressure and so in emergency cases it can be used for diagnosis in place of invasive methods. hence, on the basis of the results of this study, the effects of bar pressure on onsd increase can be used for the diagnosis of intracranial pressure increase. this study had some limitations too, such as intracranial pressure could not be measured by invasive method in healthy individuals, because invasive evaluation of normal population is unethical. another limitation was the low number of participants, as only a few divers had agreed to participate in this study. there was also one advantage by this study which is the origin of a new idea. however, more investigations are suggested for considering optic nerve and sheath diameters increase as a sure marker of intracranial pressure increase, especially in divers. in this study, we showed divers have a higher optic nerve diameter than that of the general population reported by other studies. although high optic nerve sheath diameter was previously seen in emergency situation caused by high intracranial pressure, we found that optic nerve sheath in normal divers is higher than the normal control group. however, our result can not yet be considered as a marker of intracranial pressure in divers as it was conducted on an insufficient number of subjects and so a bigger study should be undertaken for this purpose. | background : there is not any data available about the effect of high bar pressure condition on intracranial pressure. in this study, the effect of diving on the optic nerve and sheath diameters as non - invasive markers of intracranial pressure has been investigated. methods : twenty professional male divers from twenty one volunteers were chosen for this cross - sectional study. only one person who had a history of barotraumas was excluded. each diver then completed a questionnaire on demographic data, medical and diving history. nineteen other volunteers were selected to represent a control group. a 10-mhz linear ultrasonic probe was used to measure the optic nerve sheath diameters of both eyes in closed and supine position and its relationship with diving history of divers was determined. results : it was found that divers have a higher mean optic nerve sheath diameter compared to the normal population as previously reported by other studies. the mean diameter of the left and right optic nerve sheaths were 6.40.7, 6.50.9 mm respectively and a significant relationship between optic nerve sheath diameter and diving history was found. conclusion : results showed that divers have a higher optic nerve diameter than the general population. however, our result can not yet be considered as a marker of intracranial pressure in divers as it was conducted on an limited number of subjects and so a bigger study should be undertaken for this purpose. |
it is usually controlled by cis - acting factors, such as au - rich elements (ares) in the 3utr, and transacting factors, such as rna - binding proteins, mirna, and ribonucleases (reviewed in refs. traditionally, the 3utr has been viewed as the region most recognized by rna - binding proteins such as tristetraprolin (ttp / zfp36) and hur, and that exoribonucleases largely mediate mrna decay. conversely, very few mammalian endoribonucleases are known and they were shown to cleave at ua di - ribonucleotides. rnase l has a substrate cleavage preference at uu and ua in single - stranded viral mrnas during acute viral infections and possibly in cellular mrnas under certain conditions. another endoribonuclease has been described that preferentially cleaves single - stranded mrna - coding regions inside ua and ug in several mrnas, including c - myc, mdr1, and -globin. since ua and uu dinucleotides are common targets for these known endoribonucleases, we sought to eliminate, or at least reduce, uw (w = a or u) dinucleotides in the coding region of several genes, without affecting the protein code. the ua dinucleotides are generally under - represented in human and other vertebrate genomes and are further deficient in the mrna when compared to nontranscribed dna. deficiency of uw frequency in coding regions may impose a selection against endoribonuclease - mediated mrna decay inside ua dinucleotides. in this report, we showed that mrna stability increased as a result of reduction in uw frequency, leading to increased protein production. this observation suggests a general approach for rational design of synthetic genes to yield robust protein expression. the uw frequency was reduced in synthetic genes by choosing alternative codons that do not contain uw, as well as by replacing uw in the dicodon boundary by changing the first codon (figure 1a). several coding regions were utilized to assess the approach, namely the reporter genes enhanced green fluorescent protein (egfp) and luciferase and the biotechnology related genes interferon- and hepatitis b surface antigen (hbsag ; figure 1b). the modification resulted in a significant reduction of uu dinucleotides (> 68%, p < 0.001, -test). the ua and, to a lesser extent, au dinucleotides were reduced as a result of the sequence modification, whereas ga dinucleotide frequency (used as a control) did not decrease (figure 1b). the mammalian expression vectors harboring these sequences were cotransfected with red fluorescent protein plasmid into the hek293 cell line, and then the protein expression levels were assessed in comparison to unmodified sequences (figure 1c). there was increased protein expression (five- to eight - fold) from expression constructs with uw - reduced coding regions. when inserted, with red fluorescent protein plasmid also, into the cho1 cell line, which is a biotechnology standard cell line, the modified expression cassettes also gave higher protein expression (figure 1d). thus, the data demonstrate that uw reduction in coding regions leads to higher protein expression. in order to evaluate the effect of sequence modification on dna uptake as a factor in transfection efficiency, we cotransfect the different expression vectors with a rhodamine - conjugated linear polyethylenimine derivative. we found no statistically significant difference in dna uptake between the wild type and the sequence modified uw - reduced constructs (supplementary figure s2). a marginal significance (p = 0.06) was observed for the uw - reduced hbsag construct, but this small increase (19% increase) played only a little role in the substantial increase in protein expression (400%, figure 1c). the polyethylenimine - mediated transfection of wt and uw - reduced egfp gave comparable results to liposomal - mediated transfection in that uw - reduced egfp showed increased expression (supplementary figure s1). next, we focused on egfp so that we could study both mrna and protein expression (by fluorescence). a representative image of wt egfp and uw - reduced egfp shows a dramatically enhanced fluorescence, whereas no increase is shown for the cotransfected red fluorescent protein, plasmid (figure 2a and b). expression of the uw - reduced luciferase - coding region under conditions of low amounts of transfected dna (10 ng / well) was higher when compared to 75 ng / well (figure 2c). the data in figure 2 and supplementary figure s2, taken together, indicate that the enhancing effects of uw reduction on protein expression are not related to preferential dna uptake or to variations in transfection efficiency. furthermore, we have examined the mrna half - life changes due to the uw sequence reduction. we employed the one - phase exponential decay model which describes kinetics in which the levels of a substance never decay to zero but reach a plateau. this is the case of our mrna decay curves here, which fit the model with superior goodness of fit (r 0.95). also, others ' work applied the one - phase exponential decay model on mrna kinetics that behaves in a manner where decaying mrna levels do not reach zero but a plateau. we found that the mrna for the uw - reduced egfp had a longer half - life (2.53-fold increase, p = 0.01, f - test) compared to the wt mrna, indicating that uw frequency reduction led to mrna stabilization (figure 3a). it is generally known that such a modest degree of mrna half - life increase can lead to a substantial enhancement of protein expression. steady - state mrna levels were also higher (2.75-fold, p < 0.05) when expressed from the uwr - egfp construct compared to the wild - type unmodified egfp dna (figure 3b). when egfp and uwr - egfp - coding regions were fused with 3utr that contained are from the unstable tumor necrosis factor - mrna, higher protein expression was observed from the uwr - egfp construct compared to the wt egfp (32-fold versus 8-fold, p < 0.001 ; figure 3c). in general, under conditions of low mrna expression, transgene expression usually correlated positively with protein expression. in order to understand the mechanism of increased mrna stability due to uw reduction in coding regions, we first investigated the involvement of rnase l by overexpression and small interfering rna experiments. we found that overexpression of ha - tagged rnase l did not reduce mrna stability of either egfp or uwr - egfp (figure 4a, b). western blotting demonstrate expression of transfected rnase l by probing with antibody to the ha tag (figure 4a, b ; insets). at the protein level, we also noted that rnase l did not reduce the levels of wt or uwr egfp, although there was a slight increase in wt egfp expression (figure 4c). hence, in general, we found either no effect or an inconsistent effect of rnase l overexpression or of treatment with a small interfering rna to rnase l (data not shown). we therefore resorted to another strategy that utilized the c124r zinc finger mutant form of ttp (ttp / zfp36). the ttp binds to ares as small as uauuuau and the c124r mutant fails to bind to ares. however, c124r can still interact with a number of general mrna decay enzymes such as those involved in deadenylation (e.g., caf1), decapping, and exonuclease activity. this dominant negative activity appears to be specific to the 3utr - are at lower concentrations, but we hypothesized that it may have broader effects at higher concentrations in a manner independent of the 3utr. thus, we overexpressed c124r ttp in hela tet - off cell line and studied the effects on uw - reduced egfp mrna and wild - type mrna. western blotting confirmed expression of the transfected c124r ttp (figure 4d, e insets). the mrna half - life was assessed for both wt egfp and uwr egfp transcripts released from constructs under regulation of tet - off cytomegalovirus promoter. the dominant negative effect of c124r ttp, as demonstrated by mrna stabilization, was clearly observed in the case of the response of wt egfp mrna turnover (figure 4d). further increases in uwr egfp mrna stabilization were not observed as a consequence of the dominant negative effect of c124r ttp (figure 4e). subsequently, no increase in protein production (fluorescence) from uwr egfp mrna was observed in response to the dominant negative effect of c124r (figure 4f, middle columns). in contrast, wt egfp protein levels were affected by the stabilizing effect of c124r on wt egfp mrna (figure 4f, left columns). in addition to tumor necrosis factor- mrna, c124r ttp (but not wild - type ttp) has been shown recently to increase an array of au - rich mrnas such as upa, upa receptor, nf - kappa b inhibitor, matrix metalloproteinase-1, and interleukin-10. the c124r has the ability to increase protein expression from uwr egfp transcripts only when the uwr egfp - coding region is fused with are-3utrs, such as those of tumor necrosis factor- (figure 4f, right columns). this aspect may lead to an improved use of uw - reduced reporter genes such as egfp and luciferase, which is post - transcriptional effect of gene expression specific to the 3utr. the present approach differs from the classical codon optimization that depends on species - specific bias of codon usage, and it is thought to be a natural selection for translational optimization. this served as the basis for improving overexpression of proteins in host cells of a different species. our approach is different : first, unlike classical codon bias optimization, both codon and dicodon boundaries are considered here. second, this rationalized approach is based on reduction of uw dinucleotides ; these dinucleotides are rare in mammalian coding regions and have been shown to correlate with accelerated mrna decay. our approach has led to increased mrna stabilization and, subsequently, increased protein expression levels. however, other possible post - transcriptional effects, such as translation, are likely to take part as well. validation of this role of modification on translation efficiency would require a different set of experiments. the very modest increase (for example, a 14% increase) in mrna stability observed with classical codon optimization may possibly be due to an inherited partial uw reduction. for example, the preferred human codon for isoleucine is auc rather than auu or aua. overall, by resisting mrna decay using reduced uw frequency and elimination of uw in dicodon boundaries, this rationalized approach may find utility as a general method to boost recombinant protein production in mammalian cells. the uw reduction approach may find broader applications if confirmed in other expression systems, such as those based on bacterial and insect cells. also, the approach remains to be tested with stable cell lines expressing the uw - reduced coding regions, as unlike transient transfection, potential regulatory mechanisms such as dna methylation may adversely affect stable transgene expression. the approach can enhance reporter genes for difficult to transfect cells or can be used to study 3 utr - mediated post - transcriptional effects due to instability sequences, such as ares, or mirna action. synthetic biology. coding regions of egfp, luciferase, interferon 2a, and hbsag were modified according the following algorithm : (i) by exchanging uw - containing codons with synonymous codons that lack or reduce uw (supplementary table s1) and (ii) by destroying the uw dicodon boundary by exchanging the first codon with synonymous codons (supplementary table s2). the modified coding region sequences (supplementary table s3) were synthesized by geneart (regensburg, germany) and all constructs, including wild - type coding regions, weresubcloned using sali and bamh1 sites in the same vector (gwiz ; genlantis, san diego, ca). the vector is expressed under control of the cytomegalovirus / intron a promoter and with the stable bovine growth hormone 3utr. cloning of the are derived from the tumor necrosis factor- mrna 3utr was previously described. dinucleotide frequency analysis was executed by the compseq program, an emboss algorithm that calculates nucleotide composition in a given sequence (http://mobyle.pasteur.fr/cgi-bin/portal.py#forms::compseq). the formula of observed (0) over expected (e) frequency ratio is as follows : (xy o / e = dxy / nxny, where nx denotes the frequency of nucleotide x, and dxy is the frequency of the dinucleotide (xy). cell lines and transfection. the hek293 and cho1-k cell lines were obtained from american type culture collection (rockville, md) and cultured in dmem medium (invitrogen, carlsbad, ca) or dmem / f12 (in case of cho1-k) supplemented with 10% fbs and antibiotics. the tet - off hela cell line, obtained from clontech (mountain view, ca), was maintained in dmem with selection drug g418 (sigma, st louis, mo). cells were transfected with vectors using lipofectamine 2000 reagent (invitrogen) according to the manufacturer 's instructions. all transfections were performed in several replications, and our intrawell transfection efficiency was < 6% variation. the red fluorescent protein expression vector (evrogen, san diego, ca) was used at ratio of the test plasmid concentration for the purpose of normalization. for rna experiments, egfp (50 ng per 1 10 cells) was used for monitoring transfection efficiency. luciferase expression was assessed using the luciferase assay system from promega (madison, wi) and a luminometer. interferon- and hbsag was quantified by enzyme - linked immunosorbent assay (elisa) obtained from pbl (piscataway, nj) and abzyme (piscataway, nj). for transfected cells with c124r ttp expression vector (a gift from dr perry j. blackshear, nih, us) and ha - tagged rnase l expression vector (synthesized by geneart), western blottings were performed to confirm the protein expression from the vectors. sds gels (protogel ; national diagnostics, atlanta, ga) followed by transfer to nitrocellulose membranes (hybond ecl ; amersham biosciences, piscataway, nj). membranes were hybridized with primary antibody to goat anti - ttp (1/500) (santa cruz biotech, santa cruz, ca), rat anti - ha a (1/50) (roche, basel, switzerland), or mouse anti - gapdh (1/500 ; abcam, cambridge, uk) followed by the appropriate secondary horseradish peroxidase -conjugated antibody. signal detection was performed with ecl western blotting detection reagents (amersham biosciences, amersham, uk). the fluorescence intensity was assessed using high - resolution images obtained from an automated laser - focus high - throughput bd pathway 435 imager (bd biosciences, san jose, ca). the variance in gfp fluorescence among replicate the experiments were normalized with red fluorescent protein plasmid at ratio of the test plasmid concentration. image processing, segmentation, and fluorescence quantification were facilitated by the proxcell program previously described. fluorescence of egfp (excitation, 488 nm ; emission, 507 nm) and red fluorescent protein (excitation, 553 nm ; 574 nm) was processed with appropriate filters of the bd imager. data are presented as mean sem of total fluorescence intensity in each well, with replicate readings ranging from three to four, as indicated in the text. the student t - test was used when comparing two data groups, while analysis of variance was performed for each data set having three or more data groups. dna uptake. the rhodamine - conjugated linear polyethylenimine derivative (excitation at 550 nm ; emission at 575 nm) was used to assess the uptake of dna by the wild type and modified plasmids. cells were transfected with a complex of 0.75 l of jetpei - fluor (polyplus, paris, france) and 200 ng of the plasmid dna. after 18-hour incubation, the cells were visualized by automated fluorescence microscopy and the fluorescence quantified as described above. this protocol was also repeated in the presence of the lipofectamine 2000 to assess its compatibility during liposomal transfection and was found compatible. reverse transcription was performed using 200 ng total rna, 500 ng oligo dt(1823), 500 mmol / l dntp mixture, 20 u rnasin (pharmacia, milton keyries, uk), and 200 u of superscript ii (invitrogen). real - time pcr was performed using custom - made primer sets (applied biosystems, foster city, ca) and taqman master mix according to the manufacturer 's instructions. the 6-carboxyfluorescein - labeled taqman hybridization probes were designed to target the junction of exons 1 and 2 of egfp or uwr egfp to minimize dna contamination. the primer set for egfp : forward ctccatcttcgcggtagct, reverse ttcttctcctttgctagccatttct, probe : ccgccgttcagtcg ccgt. the primer set for uwr egfp : forward ctccatcttcgcgg tagct, reverse ccatggtggcaagcttgtc, probe : ccgccgtt cagtcgccgt. as internal control, we used a vic - labeled gapdh mrna probe (applied biosystems). the primer sets failed to amplify vector dna (negative control) and were specific for the complementary dna. pcr protocol was as follows : initiation steps : 2 minutes at 50 c followed by 10 minutes at 95 c, denaturing step : 15 seconds at 95 c, and annealing / extension 1 minute at 60 c. the amounts of molecules of complementary dna were calculated using chroma 4 dna engine cycler (bio rad, hercules, ca) software and an eight - point standard curve using serial dilutions of purified and quantified amplicon dna. the use of standard curve method ensures that all amplifications proceed with a comparable and high efficiency. the lowest internal control measurement was set as 1 fold and the copy number of the wt egfp and uwr egfp were normalized. hela tet - off cells were cotransfected with teto - regulated wt or uwr egfp constructs, along with vector, c124r ttp, or rnase l expression vector overnight, and then treated with doxycycline (1 g / ml) to shutoff transcription. the rna was extracted by the rnazol method at multiple points and then subjected to reverse transcription - qpcr as described above. to ensure equal proportions of transfected cells for each time point, cotransfections were performed in 10-cm culture plates using 4 g of the vector dna, and 24 hours later the cells were split into 6-well plates. the mrna half - life was determined using a one - phase exponential decay model. the equation y = span exp(k x) + plateau describes the kinetics of mrna decay. y starts out equal to span + plateau and decreases to plateau with a rate constant k. the half - life of the decay is 0.6932/k. expression of wt and uwr egfp after pei - mediated transfection. click here for additional data file. | uu and ua dinucleotides are rare in mammalian genes and may offer natural selection against endoribonuclease - mediated mrna decay. this study hypothesized that reducing uu and ua (uw) dinucleotides in the mrna - coding sequence, including the codons and the dicodon boundaries, may promote resistance to mrna decay, thereby increasing protein production. indeed, protein expression from uw - reduced coding regions of enhanced green fluorescent protein (egfp), luciferase, interferon-, and hepatitis b surface antigen (hbsag) was higher when compared to the wild - type protein expression. the steady - state level of uw - reduced egfp mrna was higher and the mrna half - life was also longer. ectopic expression of the endoribonuclease, rnase l, did not reduce the wild type or uw - reduced mrna. a mutant form of the mrna decay - promoting protein, tristetraprolin (ttp / zfp36), which has a point mutation in the zinc - finger domain (c124r), was used. the wild - type egfp mrna but not the uw - reduced mrna responded to the dominant negative action of the c124r zfp36/ttp mutant. the results indicate the efficacy of the described rational approach to formulate a general scheme for boosting recombinant protein production in mammalian cells. |
patients fulfilling criteria for ftd were consecutively recruited from the centre for aging brain and neurodegenerative disorders, university of brescia, italy, from december 2001 to july 2014. all patients underwent somatic and neurologic evaluation, routine laboratory examination, and a complete mental status evaluation. each patient was screened for monogenic inherited disease, such as grn, mapt, or c9orf72 mutations. stringent exclusion criteria were applied as follows : (1) cerebrovascular disorders, previous stroke, hydrocephalus, and intracranial mass documented by mri ; (2) history of traumatic brain injury or another neurologic disease ; (3) relevant medical problems (e.g., poorly controlled diabetes or hypertension ; cancer within the past 5 years ; clinically important hepatic, renal, cardiac, or pulmonary disorders) ; (4) history of major depressive disorder, bipolar disorder, schizophrenia, substance abuse disorder, or mental retardation according to dsm - iv criteria ; (5) csf -amyloid / tau amyloid profile of alzheimer disease type (available in almost 60% of patients) to avoid confounding effects of different neuropathologic substrates ; and (6) logopenic variant of ppa (lvppa). a comprehensive neuropsychological and behavioral assessment, including basic activities of daily living and instrumental activities of daily living, was carried out. the neuropsychological testing was performed by a standardized neuropsychological battery including mini - mental state examination, frontotemporal dementia - modified clinical dementia rating scale (ftd - modified cdr), raven colored progressive matrices, controlled oral word association test and category fluency, clock drawing test, rey complex figure copy and recall, story recall test, digit span, trail making test a and b, token test, and de renzi imitation test. in addition, the aachener aphasie test was further administered to patients with ppa (data not shown). the lvppa diagnosis was supported by the pattern of atrophy in posterior / presylvian or parietal regions at the mri examination ; -amyloid 42 and total tau csf determinations were also considered. the work conformed to the helsinki declaration and was approved by the local ethics committee of brescia hospital, italy. three single nucleotide polymorphisms located within kiaa0319/ttrap / them2 locus (rs17243157 g / a), dcdc2 (rs793842 a / g), and cntnap2 (rs17236239 a / g) genes were evaluated. the amplification protocols were designed as follows : 5 minutes at 95c for the first cycle, denaturation at 95c for 30 seconds, annealing ranging from 59c to 66c for 30 seconds (depending on the analyzed polymorphism), extension at 72c for 30 seconds for the subsequent 35 cycles, and a final extension at 72c for 5 minutes. the pcr products were analyzed on 2% agarose with 0.005% of ethidium bromide to reveal the reaction and to verify their size. to evaluate rs17243157 and rs793842 polymorphisms, denaturing high performance liquid chromatography (dhplc) analysis on the wave nucleic acid fragment analysis system was performed (transgenomic, santa clara, ca). samples with an altered dhplc profile were purified with microcon centrifugal filter devices (amicon bioseparations ; millipore corp, billerica, ma) and sequenced. nucleotide direct sequencing was performed on genomic dna for both strands by the abi 3500xl dna analyzer (applied biosystems, foster city, ca) and analyzed using chromas (technelysium pty ltd, south brisbane, australia). to assess rs17236239, direct sequencing was performed for both strands from purified pcr on the abi 3500 dna genetic analyzer (applied biosystems), according to the manufacturer 's instructions, and analyzed using chromas (technelysium pty ltd). brain images were collected using 2 different mr scanners : (1) 1.5 t mr scanner (siemens symphony, erlangen, germany), equipped with a circularly polarized transmit receive coil to acquire 3d magnetization - prepared rapid gradient echo (mprage) t1-weighted scan (repetition time [tr ] = 2,010 milliseconds, echo time [te ] = 3.93 milliseconds, matrix = 1 1 1, in - plane field of view [fov ] = 250 250 mm, slice thickness = 1 mm, flip angle = 15) ; and (2) 1.5 t mr scanner (siemens avanto) to acquire 3d mprage t1-weighted scan (tr = 2,050 milliseconds, te = 2.56 milliseconds, matrix = 1 1 1, in - plane fov = 256 256 mm, slice thickness = 1 mm, flip angle = 15). preprocessing and statistical analyses were performed using the statistical parametric mapping (spm8) software package (wellcome department of imaging neuroscience, london, england, http://www.fil.ion.ucl.ac.uk/spm) running on matlab 7.1 (mathworks, natick, ma). for voxel - based morphometry (vbm) analysis, images were spatially normalized to a reference stereotactic template (montreal neurological institute [mni ]) and smoothed by a gaussian kernel of 10 10 10 mm full width at half maximum. gray matter (gm) and white matter (wm) differences according to genotype status for each polymorphism were evaluated by vbm analyses in all ftd groups (behavioral variant of ftd [bvftd ] and ppas together) and in ppas, respectively. an analysis of covariance model design was applied by entering 4 groups, i.e., (1) bvftd carrying at - risk genotype, (2) bvftd not carrying at - risk genotype, (3) ppa carrying at - risk genotype, and (4) ppa not carrying at - risk genotype, and the covariates of no interest, i.e., age, sex, disease severity (as measured by ftd - modified cdr), presence of monogenic disease, and scanner type. total intracranial volume, i.e., gm + wm + csf, was introduced in all the statistical analyses as a global nuisance variable to avoid the confounding effect on cortical atrophy. correlation analysis between cognitive performances and regional gm and wm atrophy clusters was carried out. for this, the clusters of gm and wm atrophy obtained in the previous analysis (comparison between the at - risk group and not - at - risk group) were selected as regions of interest (rois), and the mean density was calculated for each patient. this approach relies on the assumption that functionally correlated brain regions show a greater concordance in gm and wm volumes as a result of mutually trophic influences or common experience - related plasticity. for this, the clusters of gm and wm atrophy obtained in the previous analysis (comparison between the at - risk group and not - at - risk group) were used as seed regions, exploring the pattern of covariance between the gm volume of each seed and the gm volume throughout the whole brain. for all the aforementioned analyses, the threshold was established at p 200 voxels. bvftd = behavioral variant of frontotemporal dementia ; ftd = frontotemporal dementia ; ppa = primary progressive aphasia. the inverse comparisons (greater gm / wm volume in gg 200 voxels. bvftd = behavioral variant of frontotemporal dementia ; ftd = frontotemporal dementia ; ppa = primary progressive aphasia. the inverse comparisons (greater gm / wm volume in gg < a) did not show any clusters above the pre - established threshold. no differences of gm and wm atrophy in patients with ftd grouped according to dcdc2 (gg vs ga / aa) and cntnap2 (gg vs ga / aa) genotypes were found at the pre - established threshold. as the effect of kiaa0319 polymorphism was mainly found in ppas, further analyses were carried out in this group. patients with ppa carrying kiaa0319 a had greater involvement of both gm and wm in the left middle temporal gyrus as compared with kiaa0319 gg (figure 3 and table e-3). (a) gray matter (gm) atrophy in patients with primary progressive aphasia (ppa) carrying kiaa0319 a vs kiaa0319 gg (a<gg). (b) correlation analysis between the gm volume of the middle temporal gyrus and semantic fluency / short story. (c) white matter (wm) atrophy in patients with ppa carrying kiaa0319 a vs kiaa0319 gg (a<gg). (d) correlation analysis between the wm volume of the middle temporal gyrus and semantic fluency. structural correlation analysis to assess interhemispheric and intrahemispheric connectivity according to kiaa0319 genotype was carried out. in patients with ppa carrying at - risk kiaa0319 a genotype, decreased structural gm correlation between the left middle temporal gyrus (peak mni coordinates x, y, z : 56, 2, 20) and other both interhemispheric and intrahemispheric brain regions was highlighted, as compared with patients with ppa carrying kiaa0319 gg. the same pattern was seen for wm density (figure 4 and table e-4). pattern of gray matter (a) and white matter (c) structural correlation of the middle temporal gyrus with other regions of the brain in primary progressive aphasia (ppa) kiaa0319 a vs ppa kiaa0319 gg. linear correlation of decreased gray matter (b) and white matter (d) structural association between brain regions in ppa kiaa0319 a (dashed lines) vs ppa kiaa0319 gg (continuous lines). in the present study, we tested whether genetic variations in specific dyslexia - related genes were involved in modulating the clinical phenotypes in an extensively characterized cohort of patients with ftd. dyslexia is known to run in families and has been associated with a number of susceptibility genes. it might be hypothesized that in some cases, such genetic predisposition may interfere with initial development of language ; in others, the effect may remain dormant for decades but resurface as ppa or as ftd with language disturbances in patients with an ongoing neurodegenerative disease. this is even supported by the evidence that different neuropathologic mechanisms can cause ppa, and on the other hand, that an identical neuropathologic entity may lead to ppa, bvftd, or, in other cases, amnestic dementia. thus, susceptibility factors interact with the neurodegenerative process to determine the anatomical location. in our sample, the majority of patients with ppa were women, which suggests the presence of sex - related vulnerability, as already reported in previous studies in which a male predominance in the semantic subtype and female prevalence in the nonfluent subtype were observed. moreover, grn mutations were overrepresented in patients with language variants, which reflects a peculiar role of the grn gene in language networks. to further explore genetic susceptibility to language impairment in ftd, functional genetic variations within 3 genes involved in language disabilities, in particular kiaa0319 rs17243157 g / a, dcdc2 rs793842 a / g, and cntnap2 rs17236239 a / g, were analyzed with respect to their effect on brain structures and the correlation with cognitive performances. it is noteworthy that, of all 3 genes, only the kiaa0319 a (ga or aa) genotype was demonstrated to influence brain damage in language areas, therefore supporting the specificity of the results. no specific patterns of greater atrophy were identified as associated with dcdc2 and cntnap2 polymorphisms, although we can not exclude the possibility that with a larger patient sample or different approaches, an effect of these genes could also be found in patients with ftd. kiaa0319 functional polymorphism was shown to determine gm atrophy in the left inferior and middle temporal gyri and wm involvement in the middle temporal gyrus and to be associated with the semantic fluency test and the short story scores. of note, these results were stronger in patients with ppa than in those with bvftd. furthermore, in patients with ppa carrying the at - risk kiaa0319 polymorphism, damage of the left temporal lobe showed an interhemispheric and intrahemispheric breakdown with the rest of the brain. the areas found to be affected by kiaa0319 genetic variation are known to be one of the hubs of phonological, articulatory planning, and syntactic processes and are most notably affected in patients with dyslexia. accordingly, several independent studies reported that kiaa0319 allelic variants were associated with different reading and spelling abilities, being able to reduce kiaa0319 gene expression, and affecting neuronal migration in the developing neocortex. in healthy controls, kiaa0319 polymorphism was shown to influence asymmetric functional activation of superior temporal sulcus, suggesting its role in modulation and lateralization of phonemic process. our results further contribute to understanding of the effect of kiaa0319 on language networks in patients with ftd and have major relevance for those who present prominent language deficits at disease onset. indeed, the results we reported are not necessarily about ppa caused by a specific neuropathologic substrate, and further studies could explore whether the dyslexia genes may also influence brain atrophy in other neurodegenerative conditions, including lvppa and alzheimer dementia. unfortunately, we have no reliable information on learning disabilities in these patients, in part because the diagnosis of learning disabilities is relatively recently recognized. these findings shed light on genetic predisposition in defining how a disease process becomes distributed asymmetrically and how it targets language networks. indeed, the identification of a possible genetic risk factor for language deficits in ftd represents a possible molecular target for the development of disease biomarkers or future therapeutic strategies. all authors made substantial contributions to conception and design, and/or acquisition of data, and/or analysis and interpretation of data. donata paternic : first draft of the manuscript, imaging analysis, and interpretation of data. antonella alberici : first draft of the manuscript, patient cohort, and analysis and interpretation of data. barbara borroni : first draft of the manuscript, patient cohort, analysis and interpretation of data, and study conceptualization and design. | objective : in this study, we evaluated whether variations within genes specifically associated with dyslexia, namely kiaa0319, dcdc2, and cntnap2, were associated with greater damage of language - related regions in patients with frontotemporal dementia (ftd) and primary progressive aphasia (ppa) in particular.methods:a total of 118 patients with ftd, 84 with the behavioral variant of ftd (bvftd) and 34 with ppa, underwent neuropsychological examination, genetic analyses, and brain mri. kiaa0319 rs17243157 g / a, dcdc2 rs793842 a / g, and cntnap2 rs17236239 a / g genetic variations were assessed. patients were grouped according to clinical phenotype and genotype status (ga / aa or gg). gray matter (gm) and white matter (wm) differences were assessed by voxel - based morphometry and structural intercorrelation pattern analyses.results:patients carrying kiaa0319 a (ga or aa) showed greater gm and wm atrophy in the left middle and inferior temporal gyri, as compared with kiaa0319 gg (p < 0.001). the effect of kiaa0319 polymorphism was mainly reported in patients with ppa. in patients with ppa carrying at - risk polymorphism, temporal damage led to loss of interhemispheric and intrahemispheric gm and wm structural association. no effect of dcdc2 and cntnap2 was found.conclusions:genes involved in dyslexia susceptibility, such as kiaa0319, result in language network vulnerability in ftd, and in ppa in particular. |
small cell carcinoma is a malignancy that occurs mainly in the lung, and primary lesions in the head and neck are very rare. extrapulmonary small cell carcinoma (epscc) shows a fair response to either chemotherapy or chemoradiotherapy, similar to small cell lung carcinoma (sclc) ; however, poor prognosis has been reported due to its high metastatic potential. irinotecan hydrochloride (cpt-11), a topoisomerase i inhibitor, has been reported to be effective against sclc. here, we report a rare case of epscc of the tonsil, treated with cpt-11 and cisplatin (cddp), which is the recent treatment protocol for sclc. the present case represents the first report of cpt-11 usage for epscc of the oropharynx. our case suggests that cpt-11 and cddp may become an effective treatment option for epscc of the oropharynx. a 65-year - old male presented to our hospital complaining of sore throat for 2 weeks. he smoked heavily (70 cigarettes per day for 40 years) and was also a long - time alcohol drinker. physical examination revealed an ulcerated mass in the left palatine tonsil and multiple swollen left neck lymph nodes. computed tomography (ct) scans of the head and neck revealed a well - defined, 3.2 3 cm mass in the left tonsil with multiple left cervical lymph node involvement. hematoxylin and eosin - stained sections revealed nests of monotonous, small, round carcinoma cells with scant cytoplasm and frequent mitotic figures in the subepithelial tissue (fig. immunohistochemically, the tumor cells were positive for neural cell adhesion molecule (cd56), synaptophysin, chromogranin, cytokeratin, and epithelial membrane antigen ; the cells were negative for s-100 protein, hmb-45, leukocyte common antigen, and thyroid transcription factor-1 (fig. these findings indicated small cell carcinoma. to differentiate primary small cell carcinoma from a metastatic sclc, in addition, systemic workup, such as of the brain, as well as abdominal ct and fdg - pet showed negative findings for distant metastasis. the tumor was diagnosed as oropharyngeal cancer, t2n2bm0 (tnm classification, uicc, 2002). because cardiac echo revealed severe aortic stenosis and moderate aortic regurgitation, the patient received aortic valve replacement before treating the epscc of the tonsil. the tonsillar mass then grew to 4.6 3.8 cm, and the left neck lymph nodes also progressed (fig. one month after the cardiac operation, he underwent radiotherapy of the tonsil and the bilateral cervical area with a dosage of 65.4 gy in 35 fractions. he was also planned to receive three courses of chemotherapy with a regimen including cpt-11 (60 mg / m, days 1 and 15) and cddp (30 mg / m, days 1 and 15) at 4-week intervals. because severe thrombocytopenia occurred after the first course of chemotherapy, the second and third courses were performed with reduced doses of cpt-11 (48 mg / m, days 1 and 15) and cddp (24 mg / m, days 1 and 15) at 3-week intervals. epscc compromises only 2.54% of all small cell carcinomas and is commonly found in the esophagus, colon, pancreas, uterus, and breast. it reveals a fair response to either chemotherapy or chemoradiotherapy but exhibits a poor prognosis. in general, the clinical course of epscc is known to be aggressive because of frequent metastases and recurrences. systemic disease from the onset of treatment, even when no distant metastasis is recognized at the first medical examination. in the head and neck region, the most common sites are the larynx, nose, and paranasal sinuses, and the major salivary glands. primary small cell carcinoma of the tonsil is rare ; only 11 cases have been reported [3, 4, 5, 6, 7, 8, 9 ]. the prognosis of patients with epscc of the tonsil has been poor, as 6 of those 11 patients died from the disease mainly due to systemic metastasis. when a diagnosis of epscc arising in the head and neck region is made, the patient should be evaluated first to determine whether the disease is a primary or metastatic cancer. primary sclc is rarely occult because it is aggressive and fast - growing. in our case, chest and abdominal ct and fdg - pet revealed no other lesions, and the tonsillar mass was determined to be the primary lesion. the histopathological aspects of epscc include round, oval- to spindle - shaped small cells with dense chromatin, absence of nucleoli, and inconspicuous cytoplasm. mitosis, necrosis, apoptosis, and lymphatic, vascular, and perineural invasion are common. immunohistochemical staining for neuroendocrine markers, including chromogranin a, synaptophysin, and cd56, is usually positive. in this case, histologic features and immunoreactivity for neuroendocrine markers were suggestive of epscc. although the treatment of this tumor has not been defined clearly, it can require surgical excision of the localized tumor, radiation therapy to the primary site, multiple - drug chemotherapy, or a combination of these modalities. platinum - based chemotherapy, such as the use of etoposide (vp-16) and cddp, has been recognized as the standard regimen for epscc. recently, cpt-11 combined with cddp was found to be more effective than vp-16 and cddp. two cases of chemotherapy using cpt-11 and cddp have been reported for epscc arising in the head and neck region : one in the larynx and the other in the nasal cavity [10, 11 ]. both cases achieved long - term remission. in our case, radiation therapy to primary and locoregional sites followed by immediate chemotherapy with cpt-11/cddp resulted in complete remission of the tumor, although the patient later died of liver metastasis. in this report, we describe a case of small cell carcinoma of the tonsil treated by combined chemotherapy with cpt-11/cddp after radiotherapy. this is the first report on the use of combined cpt-11/cddp chemotherapy in small cell carcinoma of the oropharynx. | we report a rare case of extrapulmonary small cell carcinoma arising in the palatine tonsil treated by combined chemotherapy with irinotecan / cisplatin following irradiation therapy. this chemotherapy regimen was recently found to be effective for small cell lung carcinoma. our case is the first report of combined irinotecan / cisplatin chemotherapy to treat extrapulmonary small cell carcinoma of the oropharynx. |
hiv is a preventable chronic, life - threatening illness affecting fetal and maternal health, increasing both morbidity and mortality in both infected and noninfected children worldwide [13 ]. given the lack of an effective vaccine and the complexity of life - long treatment, prevention of maternal to child transmission (pmtct) continues to be a crucial public health need globally. it has been well established that pregnant women have a significantly higher risk of hiv acquisition during gestation and while breastfeeding than their nonpregnant counterparts, due to behavioral factors, such as decreased condom use, and biological factors such as immunosuppression [4, 5 ]. prior research in england, in african countries, in the united states, and by our own group in brazil demonstrates that despite universal antenatal testing of women, hiv infected babies are born to women who had negative hiv tests during early prenatal care, implicating seroconversion during pregnancy and breastfeeding [611 ]. furthermore, studies conducted at our institution in porto alegre, brazil, demonstrated that women known to seroconvert during pregnancy have a much higher hiv mtct rate, than those with an unknown seroconversion time (transmission rate of 33% in the first group versus 8.2% in the latter). in fact, recent evidence indicates that infant hiv infection related to new maternal hiv-1 infection after antenatal hiv screening could account for up to 40% of all ongoing mother - to - child transmission in low and middle income countries [9, 12 ]. the source of these new infections during pregnancy is likely the mother 's sexual partner. therefore, there is a renewed interest in expanding pmtct efforts to include the mother 's sexual partner. with the goal of trying to expand pmtct to the entire family unit including the male partners, we performed this initial study to determine the proportion of pregnant women who have knowledge of their sexual partner 's hiv status results at the time of labor and delivery and their comfort in discussing hiv testing with their sexual partners during prenatal care and/or labor and delivery as well as to evaluate their risk factors for hiv acquisition. we decided to perform the study in porto alegre because the prevalence of hiv in pregnant women there rose from 0.5% in 1997 to 6.5% in 2002. at hospital conceiao, a large tertiary county medical center providing care to a large sector of the low to middle income population of the metropolitan area, the hiv seroprevalence rates range from 3 to 5% in pregnant women receiving prenatal care, and 5 to 10% among pregnant women without prenatal care. prior to study initiation, we hypothesized that women continue to participate in high risk behavior during pregnancy and will agree to discuss hiv testing with partners in order to optimize their infant 's health. we performed a cross - sectional study in a population of pregnant women who self - reported themselves as either hiv negative or hiv untested and who gave birth to a live born infant at conceiao hospital, a government - run county hospital in porto alegre, brazil. inclusion criteria included women who were in a steady heterosexual relationship for more than 3 months and older than 18 years of age. of note, per hospital protocol, all women admitted for labor and delivery receive rapid hiv testing on admission. for our study, all hiv positive women were excluded. from february 2009 to august 2009, 3211 women who fulfilled the entry criteria and were hospitalized for labor and delivery were approached for participation in the study. after informed consent by the mother was obtained, interviewers administered a confidential scripted oral survey in portuguese when participant was not in active labor (pre- and post - partum), questioning them on topics such as demographics (age, race, employment, salary, residence location, etc.), time in their current relationship, risk factors for hiv acquisition (condom use, sexual practices, and symptoms / signs of stds), knowledge of partner 's hiv status, and comfort in speaking about hiv testing with sexual partner. descriptive statistics were provided for all data collected. two - sample t - test and pearson chi - square statistics were used to analyze continuous and categorical outcomes, respectively. a multivariate logistic regression analysis was performed to evaluate parameters associated with woman 's knowledge of partner 's status and comfort in discussing hiv testing with partner. variables included in the model were age, race, marital status, employment, incomes, condom use, and knowledge of women 's own hiv status. all computations were done using stata 10 statistical software (statacorp, college station, texas). irb approval was obtained through both the ucla institutional review board and the grupo conceiao irb. the most common reasons given for not participating in the study included lack of available partner (n = 81), missed contact (patient discharged or unavailable prior to interview) (n = 601), or women already diagnosed as hiv positive (n = 39.) the mean age of participating women was 27 years of age, with a range from 18 to 47 years. approximately 92% (n = 2270) of women were living with or married to their partners, 92% (n = 2270) were in a stable relationship for at least 1 year and 72% (n = 1766) self - identified their race as white (table 1). evaluating participant 's hiv risk factors revealed that almost all women were sexually active during pregnancy including 97% (n = 2399) of women who practiced vaginal sex, 29% (n = 729) who practiced oral sex, and 15% (n = 363) who practiced anal sex (table 2). eighty - two percent (n = 2022) of women stated that they never used condoms during pregnancy. all had received hiv testing during labor and delivery (per hospital protocol), and 89% (n = 2190) knew their own hiv status. forty - six percent (n = 1131) knew their partner had undergone hiv testing and 42% (n = 1042) knew the actual hiv test results. none of them stated that they knew their partners were hiv positive. when asked whether they felt comfortable discussing hiv testing with their sexual partner, 96% (n = 2366) confirmed that they would feel comfortable having this discussion with their partners, and 4% (n = 99) said they would prefer not to discuss it. table 3 shows factors that were felt to be associated with women 's knowledge of partner 's hiv status as well as their comfort in discussing hiv with their partner. multivariate logistic regression analysis showed that patients with more years of education, who were in a relationship for more than 1 year, and who already knew their own status during pregnancy were more likely to know their partners ' hiv status (p < 0.05). patients who were in a relationship for more than 1 year, and married / living together were more likely to be comfortable discussing hiv testing with their partners (p < 0.05). table 4 displays reasons why the 99 women did not feel comfortable discussing hiv testing with their partners. the most common reason was embarrassment (23%, n = 23), and stigma (7%, n = 7). even after being prompted with responses, only 3% (n = 3) stated they feared abandonment if hiv testing was discussed, 0 individuals indicated fear of physical abuse, and 1% (n = 1) expressed concern for emotional abuse. of the responses that were not prompted by interviewer (other category), 22% (n = 22) of women stated that they did not feel comfortable asking their partners to get hiv tested because their partner would refuse, 17% (n = 17) of women stated that it would be inconvenient for their partners to be tested because of other responsibilities, and 13% (n = 13) started that they could not contact their partners either because they had left town or because they were in prison. pregnant women in porto alegre are at risk of hiv acquisition since almost all remain sexually active, yet few consistently use condoms. the results are concerning in that it is likely that a large portion of cases of hiv pmtct at the conceiao hospital, the largest public tertiary institution in the metropolitan area of porto alegre, may be occurring because of maternal seroconversion during pregnancy. of the last nine infants who acquired hiv from infected mothers between 2004 and 2006, 3 infants acquired it from women who are known to have seroconverted during pregnancy with a negative test in the first trimester and a positive hiv test during labor and delivery, 5 infants acquired hiv from mothers who had an unknown time of seroconversion, and 1 acquired it from a known hiv positive mother. the risk is considerable particularly because the south of brazil is the area of highest hiv seroprevalence (35%) in the country [6, 15 ]. more than half of the women in our study population did not know their partner 's hiv status, placing them at risk for seroconversion during pregnancy. fortunately, 96% of women felt comfortable discussing hiv testing with their partners, which suggests it is feasible for women to agree to bring in their partners for hiv testing during prenatal care. of the 4% who did not feel comfortable discussing hiv testing with their partners, the most common reasons included embarrassment and concern that their partner would refuse testing, both of which could be addressed through appropriate counseling. almost none of participants stated they had genuine fears of physical or emotional abuse, even when verbally prompted for these responses. partner violence against hiv positive women has been observed in 4% to 6.6% of women who disclose their hiv status to their partners [16, 17 ]. specifically in the state of rio grande do sul, where this institution is located, a study conducted in 2009 showed that 43% of women in the general population had experienced lifetime violence and 18.2% reported violence during pregnancy. although women in our study did not indicate any concerns regarding partner violence, multidisciplinary involvement and counseling efforts should be prioritized so that women are protected from violence if the approach of partner testing is implemented during pregnancy or in the peripartum period. our data demonstrated that being in a relationship for longer than one year was associated with higher rates of knowledge of one 's partner hiv status and increased degree of comfort in discussing hiv testing, suggesting that women feel more secure discussing more sensitive issues, such as sexually transmitted infections, if the relationship has proven stable by withstanding the test of time. women who felt more comfortable discussing hiv with their partner were also significantly more likely to be married / living with their partners, which may reflect a similar sense of intimacy. however, it is important to note that in a study done in kenya, women who were married were more likely to seroconvert during pregnancy and the postpartum period, so married couples may represent a high risk group for seroconversion. interestingly, our analysis also showed that women who knew their own hiv status were also more likely to know their partner 's hiv status. likely, these women had received education regarding hiv as part of the voluntary counseling and testing and had greater awareness of the risks of acquiring hiv from their partners as a sexually transmitted disease. thus, the experience of receiving hiv voluntary counseling and testing (vct) may have motivated them to discuss hiv testing with their sexual partners. prior studies in brazil and in other countries have shown that decreased education is associated with lower rates of hiv vct in pregnant and nonpregnant women [1922 ]. our study shows that education is not only associated with women receiving appropriate vct for themselves, but also with knowing the hiv status of their partner. therefore, education may play a significant role both in pregnant women receiving appropriate care for themselves, and also in any efforts involving hiv vct of their partners. the limitations of our study include the fact that data was collected through self - reports by an interviewer previously unknown to the patient. as the survey included very personal information such as condom use and sexual practices / risk factors it is possible that patients did not disclose intimate information as they were inhibited by the presence of the interviewer. our surveys were conducted in a low - income county hospital in the south of brazil, which may also limit extrapolation of our data to other settings. however, given that the patient population was comprised of women referred to conceiao through a vast network of peripheral clinics throughout the city, our survey likely captured a representative sample of the general population of low to middle income women of porto alegre and adjacent neighborhoods. we focused on women who had a sexual partner for greater than 3 months, which may not be generalizable to the entire population of pregnant women. however, we assumed people who were not with a steady heterosexual partner for greater than 3 months may actually be at higher risk of hiv acquisition since having multiple partners increases risk of hiv transmission. there may be a real need to screen partners of women undergoing vct for prenatal care, as a public health measure to effectively reduce sexual transmission and mtct of hiv-1, particularly in areas of high hiv-1 seroprevalence. data demonstrates that women not only have a higher rate of infection during pregnancy, but also have higher mother - to - child transmission rates during pregnancy and breastfeeding [46, 9 ]. studies in kenya, swaziland, south africa, and botswana have shown hiv seroincidence rates in pregnant women ranging from 1.3 to 16.8 infections/100 person years [9, 10, 24, 25 ]. these high rates are not only concerning when considering their implications for women 's health, but also doubly alarming since transmission rates to the infant are higher during acute maternal hiv infection [6, 8, 11 ]. our study highlights the importance of protecting women during this vulnerable time, since most remain sexually active without condom use. hopefully, these results can inform future efforts to expand prenatal care to involve not only the mother, but the entire family as well. in the future, interventions can focus on testing partners of pregnant women during prenatal care, and if the partners refuse testing, potentially offering appropriate antiretroviral prophylaxis to women in very high risk settings during this susceptible period. | recent studies suggest that acquisition of hiv-1 infection during pregnancy and breastfeeding is associated with a high risk of hiv mother - to - child transmission. this study evaluates risk factors associated with hiv acquisition during pregnancy in women delivering at a large metropolitan medical facility located in the south of brazil. from february to august 2009, our group conducted a cross - sectional study assessing women 's risk for hiv acquisition by administering an oral survey to peripartum women. of 2465 participants, 42% (n = 1046) knew that partner had been tested for hiv. during pregnancy, 82% (n = 2022) of participants never used condoms ; yet 97% (n = 2399) practiced vaginal sex. multivariate logistic regression analysis showed that patients with more years of education, in a relationship for more than 1 year, and who knew their own hiv status were more likely to know their partners ' hiv status (p < 0.05). those who were in relationship for more than 1 year and were married / living together were more likely to be comfortable discussing hiv testing with partners (p < 0.05). in conclusion, women in brazil are at risk of hiv - infection during pregnancy as they remain sexually active, often do not know their sexual partner 's hiv status, and have minimal condom use. |
home care is a rapidly expanding and evolving industry. as levit and her colleagues highlight, home health is the fastest growing component of medicare expenditures. medicare spending on the home health benefit has grown from $ 2.12 billion in 1988 to $ 10.5 billion in 1993 and is projected to exceed $ 22 billion by the end of this century. home health care expenditures represented 5.3 percent of total medicare spending in 1993 and have experienced annual growth rates exceeding 25 percent every year since home health coverage criteria were clarified in 1988. in addition to a mandatory home health benefit, medicaid provides two optional sources of funding for home care services : the personal care optional benefit and the section 1915(c) home and community - based care waiver program. medicaid home health expenditures have risen from $ 2 billion in 1988 to $ 4.5 billion 1993, while home and community - based care waiver dollars have grown from $ 3.8 million in 1982 to close to $ 3 billion in 1993. factors contributing to increased use of home care services include the aging of the population, the development of complex medical technologies that can be provided in the home, and a growing capacity among home care providers and other community - based agencies to respond to increasing demand. public policy changes, including the implementation of medicare hospital prospective payment in 1984 and the clarification of medicare home health coverage requirements in 1988, have added to the demand for home care services. these trends are consistent with preferences among the elderly and persons with disabilities to receive services in home and community, rather than institutional settings. there is increasing attention within government and the private sector being focused on the access, quality, and cost of home care services. in particular, hcfa is interested in determining how medicare and medicaid can more actively and responsibly address the issues associated with rapid growth of home care services. research questions central to the policy debate include : who uses home health services ? what is the accessibility and quality of home health services provided under public programs ? how do we improve the efficiency, effectiveness, and accountability of skilled and unskilled care services provided in home settings ? how effective are home health services in new forms of service delivery, such as health maintenance organizations (hmos) and other forms of managed care ? in the opening article, vladeck and miller describe the agency 's medicare home health initiative and current activities under way to improve the structure and administration of the home health benefit the authors identify strategic goals for improving the medicare home health program and summarize hcfa initiatives presently in operation to accomplish these goals. four key areas are addressed : quality assurance, administration and operations, policy, and research. vladeck and miller give particular attention to the role of research and demonstrations in providing information to inform policymaking, and highlight some of the more significant projects now under development that will shape the agency 's future responses to this rapidly changing industry. the next series of articles highlights research and demonstration activities sponsored by hcfa to inform the policy debate. the article by mauser and miller provides a recent profile of home health users. relying on data from hcfa 's 1992 medicare current beneficiary survey, the authors analyze the sociodemographic characteristics of medicare home health users, the differences in use rates and expenditures for various subgroups of medicare beneficiaries, and the factors that explain beneficiary use of home health care under the program. when compared with medicare beneficiaries who do not use home health services, medicare home health users are found to be more likely to be disabled, live alone, have lower income, and, as a result, are more likely to be receiving medical assistance under medicaid. home health utilization and expenditures are highly skewed in the medicare program, with 6.3 percent of medicare beneficiaries accounting for almost 30 percent of total home health agency (hha) expenditures. age, eligibility for medicaid, and the availability of other post - acute - care services (e.g., skilled nursing facility [snf ] care, outpatient rehabilitation services) affect the likelihood that medicare beneficiaries will use home health care benefits. one of the key hcfa policy initiatives outlined in the vladeck and miller article is the agency 's effort to revise the medicare home health conditions of participation for hha services. shaughnessy, crisler, schlenker, arnold, kramer, powell, and hittle report on research sponsored by hcfa since 1988 to develop outcome - oriented quality - of - care indicators for home health services. an outcome - based quality improvement (obqi) system is discussed, in which outcomes of care are analyzed, adjusted for patient risk factors. while some outcome measures are specific to a given quality indicator group (quig) (the stratification scheme used to adjust for patient risk), other outcome measures are useful for multiple quigs. the authors further explore the operational and technical issues involved in implementing such an information system as part of a medicare quality assurance system. they argue that, properly developed and implemented, an obqi system has the potential to become the framework for a new partnership among payers, providers, and consumers to promote continuous quality improvement in the delivery of home health care services under the medicare program. the second home care quality article, by kane, kane, illston, and eustis, focuses on the issue of defining, measuring, and monitoring the quality of non - clinical home care services. the authors note that personal care and other support services are among the most important services that hhas provide to assist persons with disabilities in maintaining their independence as well as supplementing informal care provided by family and friends. the authors analyze the importance of these aspects in evaluating the overall quality of home care services. they note the importance of identifying and measuring the enabling factors that might supplement structure, process, and outcome measures of the clinical aspects of home health services delivery, in order to provide a more complete picture of quality assurance in home settings. the authors examine the relationship between non - clinical dimensions of home care worker performance such as courtesy, punctuality, reliability, and honesty and client satisfaction. the authors also note the different perspectives and priorities that various stakeholders have in addressing quality - of - care issues in home care, and the need for a partnership among all affected parties payers, regulators, providers, and consumers to meet effectively the challenges of improving home care services in the 1990s. again, as in the shaughnessy. article, the authors ' findings suggest that a priority among all affected groups is the development of outcome - based quality - of - care performance indicators that reflect both clinical and non - clinical aspects of home care services. the next two articles focus on another major policy research initiative within hcfa the development of a prospective payment system for medicare home health services. currently, medicare reimburses hhas on a reasonable - cost basis. in the omnibus budget reconciliation act of 1986, congress mandated that the department of health and human services research and test the feasibility of paying hhas on a prospective basis for services provided to medicare beneficiaries. phillips, brown, bishop, klein, ritter, schore, skwara, and thornton report on the first - year findings of the first phase of a two - part hcfa - sponsored hha prospective payment demonstration. this phase of the demonstration tested the feasibility of paying hhas on a prospectively determined per - visit rate for each of the six basic service categories that medicare covers in the benefit skilled nursing services, physical therapy services, occupational therapy services, speech therapy services, home health aide services, and medical social work services. based on data from the first year of operation, the authors find no significant effect of prospective payment on hhas ' cost per visit, the volume of services rendered, agency revenues, surplus revenue (profitability), or quality of care. the hhas under prospective payment did not appear to avoid patients who required more expensive care. the authors caution that these findings must be considered preliminary, and that a final assessment of the prospective payment demonstration should await the receipt and analysis of data for the full 3 years of the demonstration. the second article on prospective payment, by goldberg and schmitz, reports on the findings of research conducted as part of a development effort for the second phase of the hcfa - sponsored hha prospective payment demonstration. this phase of the demonstration tests a payment system that sets rates for each episode of hha - provided care. the authors report on research designed to establish the length of episode for which agencies would be paid. the analytical issues addressed in the study include establishing the length of the episode, establishing outlier policies for visits that fall outside of the episode period, analyzing how different definitions of episode length affect utilization patterns across agencies of different types, and estimating how they are likely to respond to prospective payment incentives under different episode definitions. the authors ' results indicate that establishing episode lengths is difficult in home health care, given the tail of very long episodes (averaging 265 days) that skews the distribution of average annual hha visits and charges. also, these episode differences vary by agencies of different types, with rural agencies, proprietary agencies, large agencies, new agencies, and freestanding agencies having longer episode lengths than urban, non - profit, and smaller, well - established agencies that were hospital - based. importantly, many of the differences in reimbursement per episode are not driven by reimbursement per visit, but by the quantity of visits provided during the episode. this is precisely what the per - episode payment demonstration is designed to test : the ability of agencies to change the number, type, and duration of visits under a payment system that compensates on the basis of an entire episode of care rather than on a visit - by - visit basis. kane, finch, chen, blewett, burns, and moskowitz examine home care services in the broader context of post - hospital care, focusing specifically on the factors that determine the decision to discharge patients to their home and whether those going home receive home health services. using information obtained from medical records, patient interviews, and medicare administrative claims data, the authors developed a model for predicting the likelihood a hospital patient would be discharged home and, if so, what clinical, functional, and cost outcomes are associated with that discharge decision. the authors examine patient outcomes for five high - volume hospital diagnosis - related groups (drgs) in three cities. home care patients ' use of other formal and informal care, and total medicare expenditures, are also measured. in general, the authors found that none of the clinical measures of severity or comorbidity explained the decision of discharge planners to send a patient home ; functional measures were much more predictive of these decisions. however, the predictive variables associated with a discharge home were not necessarily the variables that predicted a better outcome for such patients. also, for the most part, the relationships differed by drg. the authors conclude that the discharge planning decision is complex, and that more sophisticated information technology is needed to assist discharge planners in selecting the best modality of post - hospital care for medicare beneficiaries. the article by manton, stallard, and woodbury provides another perspective on profiling medicare home health users by examining longitudinal trends in medicare home health and snf utilization and expenditures from 1982 - 90. relying on three waves of data from the national long - term care survey, they analyze changes in disability status within the medicare population during the 1980s and how these trends affected use of medicare home health and snf care. their findings regarding the growth of home care services since 1982 are consistent with the more recent trends noted by mauser and miller : (1) both the number of beneficiaries using home health benefits and the average number of visits per user have increased steadily, and (2) the presence of disability plays an important role in determining the amount of home care services an individual will use. the authors report increases in use at all levels of disability, with increases most pronounced among medicare beneficiaries who were identified as having problems with instrumental activities of daily living and mobility, those whose impairments presented problems with heavy housework, and those who were cognitively impaired. the authors conclude that there is a complementarity in hha and snf use ; hha services tend to be used by persons with serious health problems whose disability appears to be more of a consequence of illness, whereas snf use seems to be concentrated among those with serious functional disability of potentially longer standing. an implication of this study is that a better understanding of the relationship between health and functioning may lead to more cost - effective methods of targeting extended medicare home health and snf benefits to meet the most serious and acute aspects of disabled persons ' long - term care needs. another area of increasing policy interest is the role of home care services in managed care settings. shaughnessy, schlenker, and hittle compare the health status outcomes of medicare beneficiaries who receive home health services in hmos and in the fee - for - service (ffs) system. relying on longitudinal data collected on patient demographics, clinical and functional outcomes, and characteristics of the home environment during 1989 and 1991, the authors analyze changes in utilization, mortality, and patient outcomes during a 12-week period following admission into a home care program. adjusting for case - mix differences between patients in both settings, the authors find that medicare beneficiaries obtaining home health services in the ffs sector have a greater tendency to improve or stabilize during the interval between home health admission and 12 weeks later or discharge (whichever occurred first). according to the authors, the inferior hmo outcomes were accompanied by lower utilization and cost of home health services for hmo patients, a pattern that was particularly evident among contractual hmo patients. the authors conclude that although more research clearly is needed to better understand the relationship between the organization of home health care services in hmo settings and patient outcomes, more attention should be given to outcome - based quality assurance and care practices in hmo settings that may be overly restrictive in terms of the use of home health care services. the article by silberberg, estes, and harrington examines the role of uncertified home care agencies in the home care delivery system, and analyzes different perspectives among key stakeholders at the state level regarding the funding and regulation of these providers. whereas only certified hhas may participate in the medicare program, states may reimburse uncertified agencies and independent providers, as well as certified agencies, under the medicaid personal care services option and the home and community - based care waiver program. based on interviews with representatives of government, industry, and consumer groups in the states of california, texas, and pennsylvania, the authors analyze different perspectives on issues associated with the cost, access, and quality of services provided by uncertified agencies, and the implications for funding and regulating of these programs under medicaid. the authors find that the issue of the quality of care provided by uncertified agencies is the most prevalent policy concern across all stakeholder groups. providers and government representatives reportedly are most concerned about regulation of agency practices ; consumer groups representing persons with disabilities are most concerned about the level of consumer control and the ability of consumers to direct agency services independent of regulatory control and oversight. on access issues, the authors report that providers and consumers are most concerned about the availability of public funding for non - medical home care services, while government stakeholders are more likely to desire a balance between cost containment and concerns of access and quality. an implication of the authors ' findings is that the development of effective public policy regarding the provision of home care services by uncertified agencies will require greater communication and negotiation among various stakeholders on how to accommodate different perspectives on regulation and consumer - directed services, and how to reconcile the desire among many groups to increase overall spending levels for home care services in an environment increasingly sensitive to the growing costs of long - term care services in states. the continued growth of home care programs will increase policymakers ' interest in finding ways to improve the effectiveness and efficiency of home care services for medicare and medicaid beneficiaries. the articles in this issue are illustrative of the ways in which research and demonstrations can provide information to monitor the continuing evolution of the home care industry and test new innovations to inform the policy development process. hcfa will continue to monitor the performance of its current home care programs as well as explore new approaches to home care coverage, payment, service delivery, and quality assurance. all of these initiatives will be aimed at improving the overall capability of medicare and medicaid home care programs to better serve beneficiaries who increasingly rely on these services to maintain their independence and quality of life in community - based settings. | this overview discusses articles published in this issue of the health care financing review, entitled issues in reforming home health care. articles focus on basic policy issues in the financing and delivery of home care services, illustrate how research provides insights into these issues, and report on some recent research and demonstration initiatives that are designed to further our understanding of how to improve the effectiveness and efficiency of home care services under medicare and medicaid. |
ovarian cancer is the most lethal gynecologic malignancy among women, with an estimated 150 000 annual deaths worldwide. however, due to the unspecific and inconspicuous symptoms in the early stage of ovarian cancer, there are no effective and accurate detection methods for this disease. moreover, although the initial response to surgical resection and platinum - based chemotherapy is relatively high, most patients still have recurrence and chemo - resistance to ovarian cancer. as a result, diagnosis of most ovarian cancer cases occurs at advanced stages, which is associated with poor prognosis, as shown by the low 5-year overall survival rate. therefore, there is an urgent need for further investigation of potential markers for prognosis, mechanisms of ovarian carcinogenesis, and therapeutic targets for novel alternative treatments. obesity provides a unique adipose tissue microenvironment in which several cytokines, including adiponectin, are secreted exclusively by differentiated adipocytes. adiponectin is a 25-kda adipocytokine composed of 244 amino acids and involved in insulin sensitivity and lipid metabolism. in adults, recently, adiponectin has been reported to act as anti - tumor factor through inhibiting cancer cell growth, proliferation, and migration, as well as promoting apoptosis [1113 ]. binding its receptors by adiponectin could activate a variety downstream signaling pathways, such as 5-amp - activated protein kinase (ampk) and wnt signaling. on the other hand, recent studies reported that adipor1 is positively correlated with the risk of obesity - associated malignancies such as endometrial, pancreatic, renal, colon, and breast carcinomas [1619 ]. however, little is known about expression of adipor1 in epithelial ovarian cancer (eoc) and its pathological implications. in this study, we analyzed the expression of adipor1 in human cancerous epithelial ovarian tissues by immunohistochemical assay. the pathological features, progression - free survival (pfs), and overall survival (os) were further analyzed to investigate the relationship between adipor1 expression and prognostic outcomes of patients with eoc. this was a retrospective study enrolled 73 patients diagnosed with eoc in the second affiliated hospital, dalian medical university from july 2008 to december 2014. all participating patients were formally informed for the purpose of this study and a letter of consent was signed by every individual involved. all patients had been confirmed to have eoc and had received 46 rounds of postoperative platinum - based chemotherapy according to nccn guidelines. patients ages ranged from 26 to 77 years, and the average age was 59.9610.19 years. among all patients, 67 (91.78%) had serous adenocarcinoma, 3 (4.11%) had endometrioid adenocarcinoma, 2 (2.73%) had clear cell adenocarcinoma, and 2 (2.73%) had mucous adenocarcinoma. the 73 eoc patients were divided into 2 groups : the low - to - medium differentiation group (28 with low differentiation and 29 with low - to - medium differentiation) and the medium - to - high differentiation group (14 with medium differentiation, 1 with medium - to - high differentiation, and 1 with high differentiation). the expression level of adipor1 in ovarian cancer tissues was analyzed by immunohistochemical staining. all surgically obtained specimens were preserved in the pathology center of the second affiliated hospital, dalian medical university for further analysis. samples were fixed in formalin, embedded in paraffin, and cut into 4-m sections. for antigen retrieval, tissue sections were treated in a microwave oven with citrate buffer solution (ph 6.0) for 20 min and blocked with normal goat serum for 1 h. after rinsing in pbs 3 times, the slides were incubated for 1 h with anti - human adipor1 antibody (ab126611, 1 : 100 ; abcam, cambridge, uk) as the primary antibody. a hrp - conjugated goat anti - rabbit igg h&l (ab6721, 1 : 500 ; abcam, cambridge, uk) all immunohistochemical - stained slides were independently evaluated by 2 pathologists who were blinded to the patients medical records. positivity of the samples was determined by the presence of brown or tan staining within the cytoplasmic membrane and/or cytoplasm. sections that contained more than 5% stained cells were considered as adipor1-positive samples, otherwise slides were considered as negative samples. for the semi - quantitative analysis of immunohistochemical staining for adipor1 expression, a h - score based analysis was conducted, as previously described. all statistical analyses were performed using the spss 13.0 software package (spss inc., this was a retrospective study enrolled 73 patients diagnosed with eoc in the second affiliated hospital, dalian medical university from july 2008 to december 2014. all participating patients were formally informed for the purpose of this study and a letter of consent was signed by every individual involved. all patients had been confirmed to have eoc and had received 46 rounds of postoperative platinum - based chemotherapy according to nccn guidelines. patients ages ranged from 26 to 77 years, and the average age was 59.9610.19 years. among all patients, 67 (91.78%) had serous adenocarcinoma, 3 (4.11%) had endometrioid adenocarcinoma, 2 (2.73%) had clear cell adenocarcinoma, and 2 (2.73%) had mucous adenocarcinoma. the 73 eoc patients were divided into 2 groups : the low - to - medium differentiation group (28 with low differentiation and 29 with low - to - medium differentiation) and the medium - to - high differentiation group (14 with medium differentiation, 1 with medium - to - high differentiation, and 1 with high differentiation). all surgically obtained specimens were preserved in the pathology center of the second affiliated hospital, dalian medical university for further analysis. samples were fixed in formalin, embedded in paraffin, and cut into 4-m sections. for antigen retrieval, tissue sections were treated in a microwave oven with citrate buffer solution (ph 6.0) for 20 min and blocked with normal goat serum for 1 h. after rinsing in pbs 3 times, the slides were incubated for 1 h with anti - human adipor1 antibody (ab126611, 1 : 100 ; abcam, cambridge, uk) as the primary antibody. a hrp - conjugated goat anti - rabbit igg h&l (ab6721, 1 : 500 ; abcam, cambridge, uk) all immunohistochemical - stained slides were independently evaluated by 2 pathologists who were blinded to the patients medical records. positivity of the samples was determined by the presence of brown or tan staining within the cytoplasmic membrane and/or cytoplasm. sections that contained more than 5% stained cells were considered as adipor1-positive samples, otherwise slides were considered as negative samples. for the semi - quantitative analysis of immunohistochemical staining for adipor1 expression, a h - score based analysis was conducted, as previously described. all statistical analyses were performed using the spss 13.0 software package (spss inc., chicago, il). out of the 15 normal ovarian tissue samples, adipor1expression was observed in 11 samples (73.33%). in the 73 eoc patients, the expression of adipor1 the frequency of adipor1 expression in normal ovarian tissues was higher than in eoc tissues ; however, no significant difference between the 2 groups was observed (p=0.966) (table 1, figure 1). two independent - samples nonparametric tests indicated that expression of adipor1 was negatively correlated with patient classification as being in the terminal stage of disease according to the international federation of gynecology and obstetrics (figo) stages and degree of differentiation of ovarian tissue (p0.05, all) (table 3, figure 2). cox proportional hazards regression modeling was used to evaluate the effects of various clinicopathological characteristics, including adipor1 expression, figo stage, ascites, diabetes, and platelet count on pfs of patients with eoc. the multivariate analyses identified adipor1 expression as an independent positive prognostic indicator of pfs. other pathologic features, such as figo stages and ascites, also had a significant effect on pfs (table 4). our data indicated that adipor1 expression, figo stage, ascites, and diabetes were correlated with os of eoc patients (table 5). the median os of adipor1-positive eoc patients was 60.2 months, which was significantly higher than the 23.5 months found in the adipor1-negative group (p0.05, all) (figure 3, table 6). taken together, the multivariate analyses revealed that adipor1 expression could be an independent positive prognostic indicator of os of eoc patients (table 6). out of the 15 normal ovarian tissue samples, adipor1expression was observed in 11 samples (73.33%). in the 73 eoc patients, the expression of adipor1 the frequency of adipor1 expression in normal ovarian tissues was higher than in eoc tissues ; however, no significant difference between the 2 groups was observed (p=0.966) (table 1, figure 1). two independent - samples nonparametric tests indicated that expression of adipor1 was negatively correlated with patient classification as being in the terminal stage of disease according to the international federation of gynecology and obstetrics (figo) stages and degree of differentiation of ovarian tissue (p0.05, all) (table 3, figure 2). cox proportional hazards regression modeling was used to evaluate the effects of various clinicopathological characteristics, including adipor1 expression, figo stage, ascites, diabetes, and platelet count on pfs of patients with eoc. other pathologic features, such as figo stages and ascites, also had a significant effect on pfs (table 4). our data indicated that adipor1 expression, figo stage, ascites, and diabetes were correlated with os of eoc patients (table 5). the median os of adipor1-positive eoc patients was 60.2 months, which was significantly higher than the 23.5 months found in the adipor1-negative group (p0.05, all) (figure 3, table 6). taken together, the multivariate analyses revealed that adipor1 expression could be an independent positive prognostic indicator of os of eoc patients (table 6). obesity is currently regarded as a risk factor for ovarian cancer, but it is still unclear how obesity contributes to ovarian carcinogenesis. adiponectin, a protein hormone that regulates many metabolic processes, has been recently reported to be a crucial mediator during the progression of several malignancies associated with obesity, and adiponectin receptor 1 (adipor1) expression in several cancers has been found to be associated with favorable prognosis for patients. however, the role of adipor1 in carcinogenesis is controversial because expression level of adipor1 varies greatly among different cancers. compared to normal tissue samples, there was a significant increase in the expression of adipor1 in pancreatic cancer and oesophageal adenocarcinoma ; in contrast, the percentage of adipor1-positive cells was significantly lower in endometrial carcinoma. moreover, in a recent study, the mrna levels of adiponectin and adipor1 were significantly lower in cancerous ovaries than in normal ovaries, which is consistent with our observation. in our study, adipor1 immunostaining tended to be less intense in cancerous epithelial ovarian tissues compared with normal ovarian tissue, but the difference was not significant, suggesting that adipor1 is involved in the carcinogenesis and progression of ovarian cancer. a previous report suggested that adiponectin and its receptors can decrease neoplasm metastasis and repress angiogenesis through activation of mitogen - activated protein kinase (mapk). an in vitro study based on 6 gastric cancer cell lines showed that adiponectin treatment can induce apoptosis and inhibit the proliferation of gastric cancer cell lines. moreover, sirna knock - down of adipor1 suppressed the growth inhibitory effects of adiponectin in gastric cancer cell lines. taken together, these data show the potential role adipor1 plays in the development and prognosis of cancer, which may also apply to ovarian carcinogenesis. tiwari. reported that the expression of adiponectin and adipor1 was detectable in eoc tissues and ovarian cancer - derived cell lines. to investigate the relationship between adipor1 and ovarian cancer, we evaluated the correlation between adipor1 expression and clinicopathological features in ovarian cancer patients. advance figo stage, ascites, and short platinum - free intervals were confirmed to be correlated with adipor1 expression in eoc patients. a retrospective study revealed that figo stage is one of the most reliable predictors of the prognosis of patients with eoc. our data showed that adipor1-positive staining in eoc tissues was negatively correlated with advanced figo stage in eoc patients, which is in agreement with previous reports. moreover, data from colorectal cancer also showed that adipor1expresstion was negatively associated with tumor grade, and patients with negative expression of adipor1 were shown to be more prone to occurrence of extrathyroidal invasion and multicentricity in thyroid cancer. presentation of ascites is frequently associated with carcinogenesis of ovarian cancer at the end - stage of disease, and affects the progression of neoangiogenesis. however, we found no correlation between adipor1 expression and ascites in our study, indicating that expression of adipor1 is of great importance in delaying carcinogenesis in eoc patients. however, the details of the mechanisms involved need further investigation in larger prospective studies. recent studies indicated that adipor1-positive expression significantly contributed to improvement of prognosis in different cancers [3032 ]. accordingly, adipor1 was proposed as a potential quantitative biomarker for clinical outcomes of eoc patients. moreover, due to the important role adipor1 plays in mediating the carcinogenesis and progression of eoc, it might be as a promising anti - tumor therapeutic target. more detailed research on the cellular and molecular functions of adipor1 in eoc is needed. moreover, in survival analysis, eoc patients with adipor1-positive expression had significantly longer survival than those with adipor1-negative expression. accumulating data demonstrate that pfi is a reliable predictor of response and survival after platinum - based chemotherapy for patients with recurrent carcinomas. patients with more than 12 months of pfi had significantly longer pfs and os compared to patients with less than 6 months of pfi. however, no significant correlation between adipor1 expression and pfi was observed in patients in our study. on the other hand, the enrolled patients had disproportional representation of cancer types and figo stages : there were fewer cases of low - to - medium vs. medium - to - high differentiation and figo stages i ii vs. iii iv cases, which is a limitation of our study. it was reported that epithelial ovarian cancers account for 8590% of ovarian cancers, with a subset of epithelial ovarian cancers and high - grade serous ovarian cancers (hgsocs) representing nearly 70% of all ovarian cancer cases. moreover, most patients are not diagnosed until the disease is at an advanced stage. therefore, there were more serous ovarian cancers and figo iii iv cases in our study. to further confirm our observation, a large - scale investigation with equal distribution of cases based on differentiation and figo stage is needed. our study results suggest that the expression of adipor1 is an independent prognostic indicator in patients with eoc and is associated with longer pfs and os. | backgroundadiponectin receptor-1 (adipor1) has been reported to be associated with the risk of obesity - associated malignancies, including epithelial ovarian cancer (eoc). the aim of this study was to determine if adipor1 could serve as a prognosis indicator for patients with eoc.material/methodsin this study, expression of adipor1 in 73 eoc patients consecutively admitted to our hospital was detected by immunohistochemical staining. univariate and multivariate analyses were performed to assess the relationship between adipor1 expression level and progression - free survival (pfs) and overall survival (os) rates in patients.resultsa relatively lower expression of adipor1 in the cancerous tissues was detected compared to normal ovarian tissues, but the difference was not significant (p>0.05). adipor1 expression level in eoc patients was negatively correlated with advanced figo stages in patients and tumor differentiation, but had no correlation with pathological types, presenting of ascites, shorter platinum - free interval (pfi), diabetes, preoperative and postoperative body mass index (bmi), or platelet counts (p>0.05). moreover, patients with adipor1 expression had a significantly longer pfs and os compared to the negative expression group (p<0.001).conclusionsour findings suggest that adipor1 expression level in cancerous tissues might serve as an independent prognostic indicator in eoc patients and is associated with longer pfs and os. |
male sd rats (simonsen laboratories, gilroy, ca) were housed individually and maintained on a 12-h light / dark cycle (lights on at 0600 h) with ad libitum access to pelleted rodent food (f6 diet ; harlan teklad, madison, wi) and tap water. all experimental procedures were approved by the washington state university institutional animal care and use committee, which conforms to national institutes of health guidelines. for the fourth - ventricle cannula implantation, rats were anesthetized using 1.0 ml / kg body wt of a ketamine / xylazine / acepromazine cocktail (5 ml ketamine hcl, 100 mg / ml, fort dodge animal health, fort dodge, ia ; 2.5 ml xylazine, 20 mg / ml, vedco, st. joseph, mo ; 1 ml acepromazine, 10 mg / ml, vedco ; and 1.5 ml 0.9% saline solution) and placed in a stereotaxic device. a 26 g cannula (15.0 mm long) was implanted 1.55 mm rostral to the occipital suture, 0 mm lateral to midline and 6.36.4 mm ventral to the skull surface (29). fourth - ventricle injections were delivered over a 3- to 5-min period using a pb-600 repeating dispenser (hamilton, reno, nv). the position of the fourth - ventricle cannula for each rat was confirmed after the experiments by staining hindbrain sections with cresyl violet. only rats with a cannula correctly inserted into the fourth ventricle were used for data analysis. for glucoprivic feeding tests, rats were injected subcutaneously with 2dg (200 mg / kg body wt in 0.9% sterile saline ; sigma - aldrich, st. food intake was measured beginning immediately after the injection and at various intervals thereafter, as indicated. the ampk inhibitor, compound c (cc ; sigma - aldrich), was dissolved in dmso (3 g/l) and was injected into the fourth ventricle at a volume of 1 l per rat 1015 min before 2dg injection. at this the ampk activator aicar (sigma - aldrich) was dissolved in saline and injected into the fourth ventricle at a dose of 20, 100, 300 (or 500) nmol per rat in 3 (or 5) l saline. the immunotoxin dsap (82 ng/200 nl ; advanced targeting systems, san diego, ca) or control unconjugated saporin (sap) (17.2 ng/200 nl), dissolved in 0.1 mol / l pbs (ph 7.4), was infused bilaterally through a pulled - glass capillary pipette (30-m tip diameter) positioned stereotaxically just dorsal to the targeted site in the paraventricular hypothalamic nucleus (pvh). stereotaxic coordinates for the pvh injection site were 1.8 mm caudal and 0.45 mm lateral to bregma and 7.37.4 mm ventral to dura mater (29). the amount of unconjugated sap in the control solution approximated the amount of sap present in the dsap conjugate (21%), as indicated in the manufacturer s product information. previous work comparing sap and uninjected controls demonstrated that sap did not produce behavioral or significant histological signs of toxicity (2). glucoprivic feeding induced by 2dg (200 mg / kg) was tested 3 weeks after dsap or sap injections. one week later, expression of pampk and total ampk in hindbrain after the 2dg injection was measured. the dsap lesion was evaluated by western blot analysis of tyrosine hydroxylase (th) expression in hindbrain sites of interest and in a separate group of lesioned rats using immunohistochemistry (ihc) staining to detect dbh - positive cell bodies. two methods were used to confirm the dsap lesion because we knew that western blot analysis would detect the th present in the punched sample from terminals and processes of unlesioned catecholamine neurons not targeted by pvh dsap injection. thus, western blots of th would not reflect the destruction of catecholamine cell bodies in the lesion site as accurately as ihc. for ihc, brains were sectioned coronally into four serial sets (40-m thickness) and stained using standard avidin - biotin - peroxidase ihc techniques (13). cell bodies expressing dbh were detected by murine anti - dbh antibody (1:10,000 ; millipore, billerica, ma) and counted in three consecutive sections (29) at each of four hindbrain regions. tissue sites containing catecholamine cell groups were micropunched or dissected from hindbrain for western blot. catecholamine cell groups are defined according to the paxinos and watson (1998) rat brain atlas (29). however, we refer to the middle portion of c1 as c1 m, which extends from 12.72 to 12.30 mm caudal to bregma. at designated times after treatment, rats were anesthetized deeply with halothane (halocarbon products, north augusta, sc) and were quickly decapitated. the brain was removed and frozen on dry ice. in 2dg - induced ampk experiments, a 2-mm - thick coronal section was cut, using obex (defined here as the caudal border of the area postrema) to locate the caudal border of the slice (02.0 mm rostral to obex). then, the desired regions from this 2-mm - thick slice were micropunched with a stainless steel sample corer that had a 1.0-mm inner diameter (fine science tools, foster city, ca). tissue punches were collected from three areas (from a1c1 m, from an [noncatecholamine ] area medial to a1c1 m [ventromedial medulla (vmm) ], and from a2c2 in the nucleus of the solitary tract [nts ]). micropunched samples were quickly placed into a radioimmunoprecipitation assay (ripa) buffer for protein isolation. the accuracy of the punches was confirmed by western blot using antibodies against enzymes for catecholamine synthesis (dbh and th). representative images of dbh and th western blots for a1c1 m, vmm, and a2c2 tissue punches were shown in fig. were expressed more strongly (more than three times) in a1c1 m and a2c2 samples than in the vmm samples, indicating the accuracy of the punches.. a : coronal section of rat hindbrain (paxinos and watson) showing the positions of each 1.0-mm - diameter circular punches used for western blots. punches 1, 2, or 3 included a1c1 m, vmm, or a2c2, respectively. b and c : immunoblots of dbh, th, and -actin from different tissue micropunches are indicated in a. higher expression levels of dbh and th were found in punch 1 (a1c1 m) tissue (b) or punch 3 (a2c2) tissue (c) than in the adjacent punch 2 (vmm) tissue in all individual rats. ap, area postrema ; cc, central canal ; py, pyramidal tract ; sp5, spinal trigeminal tract. in aicar - induced ampk experiments, two 2-mm - thick coronal sections were cut, using obex to locate the position of the cuts (02.0 and 2.04.0 mm rostral to obex, respectively). slice 1, the dorsal part, included a2, c2, and the nts. tissue sections were quickly placed into ripa buffer for protein isolation and then used for western blot. hindbrain tissues were first incubated with ripa buffer (50 mmol / l tris, ph 8.0 ; 150 mmol / l nacl ; 1.0% (octylphenoxy)polyethoxyethanol ; 0.5% sodium deoxycholate ; and 0.1% sds), with 1 mmol / l sodium ortho - vanadate, 1 mol / l okadiac acid, and 1/10 (vol / vol) protease inhibitor cocktail (roche diagnostics, penzberg, germany) for 30 min on ice. after centrifugation (14,000 rpm for 15 min at 4c), an equivalent amount of protein (20 g per lane) for each sample was separated by sds - page. the resolved proteins on the gel were transferred to a nitrocellulose membrane (amersham, piscataway, nj). the membranes were blocked in 5% nonfat dry milk in tris - buffered saline/0.05% tween 20 and incubated with one of the following primary antibodies in blocking solution for 1618 h at 4c. the membranes were then washed with tris - buffered saline/0.05% tween 20, incubated in goat anti - rabbit igg, goat anti - murine igg, or donkey anti - goat igg antibody conjugated with peroxidase (1:4,000 ; dakocytomation, glostrup, denmark) and developed with the enhanced chemiluminescence method (amersham) and exposed to x - omat film (kodak, rochester, ny). the following antibodies were used : murine anti-actin (1:10,000 ; sigma - aldrich), rabbit anti - ampk (1:1,000 ; santa cruz biotech, santa cruz, ca), rabbit anti - pampk (thr172) (1:1,000 ; millipore), goat anti - dbh (1:600 ; santa cruz biotech), and murine anti - th (1:6,000 ; millipore). densitometric analysis of blots was performed using scion image software (scion, frederick, md). the intensity of each band for each protein was quantified and normalized with housekeeping gene -actin expression in the same membrane. the levels of total ampk or pampk were expressed as a percentage over that in the rats injected with saline., we used unpaired t test or one - way anova using sigmastat (systat software, san jose, ca). after significance was determined by anova, multiple comparisons between individual groups were tested using a post hoc fisher protected least significant difference (plsd) test. for the fourth - ventricle cannula implantation, rats were anesthetized using 1.0 ml / kg body wt of a ketamine / xylazine / acepromazine cocktail (5 ml ketamine hcl, 100 mg / ml, fort dodge animal health, fort dodge, ia ; 2.5 ml xylazine, 20 mg / ml, vedco, st. joseph, mo ; 1 ml acepromazine, 10 mg / ml, vedco ; and 1.5 ml 0.9% saline solution) and placed in a stereotaxic device. a 26 g cannula (15.0 mm long) was implanted 1.55 mm rostral to the occipital suture, 0 mm lateral to midline and 6.36.4 mm ventral to the skull surface (29). fourth - ventricle injections were delivered over a 3- to 5-min period using a pb-600 repeating dispenser (hamilton, reno, nv). the position of the fourth - ventricle cannula for each rat was confirmed after the experiments by staining hindbrain sections with cresyl violet. only rats with a cannula correctly inserted into the fourth ventricle were used for data analysis. for glucoprivic feeding tests, rats were injected subcutaneously with 2dg (200 mg / kg body wt in 0.9% sterile saline ; sigma - aldrich, st. food intake was measured beginning immediately after the injection and at various intervals thereafter, as indicated. the ampk inhibitor, compound c (cc ; sigma - aldrich), was dissolved in dmso (3 g/l) and was injected into the fourth ventricle at a volume of 1 l per rat 1015 min before 2dg injection. at this the ampk activator aicar (sigma - aldrich) was dissolved in saline and injected into the fourth ventricle at a dose of 20, 100, 300 (or 500) nmol per rat in 3 (or 5) l saline. the immunotoxin dsap (82 ng/200 nl ; advanced targeting systems, san diego, ca) or control unconjugated saporin (sap) (17.2 ng/200 nl), dissolved in 0.1 mol / l pbs (ph 7.4), was infused bilaterally through a pulled - glass capillary pipette (30-m tip diameter) positioned stereotaxically just dorsal to the targeted site in the paraventricular hypothalamic nucleus (pvh). stereotaxic coordinates for the pvh injection site were 1.8 mm caudal and 0.45 mm lateral to bregma and 7.37.4 mm ventral to dura mater (29). the amount of unconjugated sap in the control solution approximated the amount of sap present in the dsap conjugate (21%), as indicated in the manufacturer s product information. previous work comparing sap and uninjected controls demonstrated that sap did not produce behavioral or significant histological signs of toxicity (2). glucoprivic feeding induced by 2dg (200 mg / kg) was tested 3 weeks after dsap or sap injections. one week later, expression of pampk and total ampk in hindbrain after the 2dg injection was measured. the dsap lesion was evaluated by western blot analysis of tyrosine hydroxylase (th) expression in hindbrain sites of interest and in a separate group of lesioned rats using immunohistochemistry (ihc) staining to detect dbh - positive cell bodies. two methods were used to confirm the dsap lesion because we knew that western blot analysis would detect the th present in the punched sample from terminals and processes of unlesioned catecholamine neurons not targeted by pvh dsap injection. thus, western blots of th would not reflect the destruction of catecholamine cell bodies in the lesion site as accurately as ihc. for ihc, brains were sectioned coronally into four serial sets (40-m thickness) and stained using standard avidin - biotin - peroxidase ihc techniques (13). cell bodies expressing dbh were detected by murine anti - dbh antibody (1:10,000 ; millipore, billerica, ma) and counted in three consecutive sections (29) at each of four hindbrain regions. tissue sites containing catecholamine cell groups were micropunched or dissected from hindbrain for western blot. catecholamine cell groups are defined according to the paxinos and watson (1998) rat brain atlas (29). however, we refer to the middle portion of c1 as c1 m, which extends from 12.72 to 12.30 mm caudal to bregma. at designated times after treatment, rats were anesthetized deeply with halothane (halocarbon products, north augusta, sc) and were quickly decapitated. the brain was removed and frozen on dry ice. in 2dg - induced ampk experiments, a 2-mm - thick coronal section was cut, using obex (defined here as the caudal border of the area postrema) to locate the caudal border of the slice (02.0 mm rostral to obex). then, the desired regions from this 2-mm - thick slice were micropunched with a stainless steel sample corer that had a 1.0-mm inner diameter (fine science tools, foster city, ca). tissue punches were collected from three areas (from a1c1 m, from an [noncatecholamine ] area medial to a1c1 m [ventromedial medulla (vmm) ], and from a2c2 in the nucleus of the solitary tract [nts ]). micropunched samples were quickly placed into a radioimmunoprecipitation assay (ripa) buffer for protein isolation. the accuracy of the punches was confirmed by western blot using antibodies against enzymes for catecholamine synthesis (dbh and th). representative images of dbh and th western blots for a1c1 m, vmm, and a2c2 tissue punches were shown in fig. were expressed more strongly (more than three times) in a1c1 m and a2c2 samples than in the vmm samples, indicating the accuracy of the punches.. a : coronal section of rat hindbrain (paxinos and watson) showing the positions of each 1.0-mm - diameter circular punches used for western blots. punches 1, 2, or 3 included a1c1 m, vmm, or a2c2, respectively. b and c : immunoblots of dbh, th, and -actin from different tissue micropunches are indicated in a. higher expression levels of dbh and th were found in punch 1 (a1c1 m) tissue (b) or punch 3 (a2c2) tissue (c) than in the adjacent punch 2 (vmm) tissue in all individual rats. ap, area postrema ; cc, central canal ; py, pyramidal tract ; sp5, spinal trigeminal tract. in aicar - induced ampk experiments, two 2-mm - thick coronal sections were cut, using obex to locate the position of the cuts (02.0 and 2.04.0 mm rostral to obex, respectively). slice 1, the dorsal part, included a2, c2, and the nts. tissue sections were quickly placed into ripa buffer for protein isolation and then used for western blot. hindbrain tissues were first incubated with ripa buffer (50 mmol / l tris, ph 8.0 ; 150 mmol / l nacl ; 1.0% (octylphenoxy)polyethoxyethanol ; 0.5% sodium deoxycholate ; and 0.1% sds), with 1 mmol / l sodium ortho - vanadate, 1 mol / l okadiac acid, and 1/10 (vol / vol) protease inhibitor cocktail (roche diagnostics, penzberg, germany) for 30 min on ice. after centrifugation (14,000 rpm for 15 min at 4c), an equivalent amount of protein (20 g per lane) for each sample was separated by sds - page. the resolved proteins on the gel were transferred to a nitrocellulose membrane (amersham, piscataway, nj). the membranes were blocked in 5% nonfat dry milk in tris - buffered saline/0.05% tween 20 and incubated with one of the following primary antibodies in blocking solution for 1618 h at 4c. the membranes were then washed with tris - buffered saline/0.05% tween 20, incubated in goat anti - rabbit igg, goat anti - murine igg, or donkey anti - goat igg antibody conjugated with peroxidase (1:4,000 ; dakocytomation, glostrup, denmark) and developed with the enhanced chemiluminescence method (amersham) and exposed to x - omat film (kodak, rochester, ny). the following antibodies were used : murine anti-actin (1:10,000 ; sigma - aldrich), rabbit anti - ampk (1:1,000 ; santa cruz biotech, santa cruz, ca), rabbit anti - pampk (thr172) (1:1,000 ; millipore), goat anti - dbh (1:600 ; santa cruz biotech), and murine anti - th (1:6,000 ; millipore). densitometric analysis of blots was performed using scion image software (scion, frederick, md). the intensity of each band for each protein was quantified and normalized with housekeeping gene -actin expression in the same membrane. the levels of total ampk or pampk were expressed as a percentage over that in the rats injected with saline. all results are presented as means sem. for statistical analysis of data, we used unpaired t test or one - way anova using sigmastat (systat software, san jose, ca). after significance was determined by anova, multiple comparisons between individual groups were tested using a post hoc fisher protected least significant difference (plsd) test. as shown in fig. 2a, pampk was significantly increased by 2dg in ventrolateral medulla punches, which included a1c1 m, 45 min after the injection (193.6 13.8% in the 2dg group vs. 100.0 6.1% in the saline group ; p 0.4 between groups). total ampk expression was not altered by 2dg in any of the sampled regions at the time points tested (fig. tissue homogenates were obtained 45 or 120 min after saline (control) or 2dg (200 mg / kg s.c.) equivalent amounts of protein were subjected to sds - page and immunoblotted with anti - pampk, anti - total ampk, or anti-actin antibody. a : upper panel : immunoblots of pampk and -actin in a1c1 m, vmm, and a2c2 regions with saline or 2dg injection. b : upper panel : immunoblots of total ampk and -actin in a1c1 m and a2c2 regions. the intensity of each band was quantified and normalized with -actin and expressed as the percentage of saline control rats. p 0.1). in a separate experiment, food intake was measured at both 2 and 4 h after 2dg injection. between 0 and 2 h, sap rats ate 4.8 1.1 g vs. 0.2 0.1 g for dsap rats, whereas between 2 and 4 h, dsap rats ate 0.4 0.1 g vs. 0.5 0.1 g for sap rats (n = 5 for each group). 2dg increased the pampk expression in a1c1 m in the sap rats at 45 min after 2dg injection (p 0.6), indicating that sap injections did not retrogradely lesion hindbrain catecholamine neurons. 4) showed that pvh dsap injection eliminated dbh - positive fibers in the pvh and significantly reduced the number of dbh - positive cells in the a1c1 m, which heavily innervate the pvh, as shown previously (15,32). the number of dbh - positive cells was reduced in the a1c1 m to 21.5% of the number present in sap rats. a : representative ihc images of dbh staining in a sap - injected (a and c) or dsap - injected (b and d) rat in pvh (a and b) or the hindbrain a1/c1 region (c and d). scale bar = 0.5 mm. b : dbh - positive cells in each of the hindbrain regions. p 0.1) or 7 h (97.1%, p > 0.8) after injection (fig. 5). cc or the control solvent, dmso, was injected into the fourth ventricle 1015 min before 2dg (200 mg / kg s.c.) or saline (sal) injection. food intake was measured for the next 7 h. p 0.4 between groups). total ampk expression was not altered by 2dg in any of the sampled regions at the time points tested (fig. tissue homogenates were obtained 45 or 120 min after saline (control) or 2dg (200 mg / kg s.c.) equivalent amounts of protein were subjected to sds - page and immunoblotted with anti - pampk, anti - total ampk, or anti-actin antibody. a : upper panel : immunoblots of pampk and -actin in a1c1 m, vmm, and a2c2 regions with saline or 2dg injection. b : upper panel : immunoblots of total ampk and -actin in a1c1 m and a2c2 regions. the intensity of each band was quantified and normalized with -actin and expressed as the percentage of saline control rats. p 0.1). in a separate experiment, food intake was measured at both 2 and 4 h after 2dg injection. between 0 and 2 h, sap rats ate 4.8 1.1 g vs. 0.2 0.1 g for dsap rats, whereas between 2 and 4 h, dsap rats ate 0.4 0.1 g vs. 0.5 0.1 g for sap rats (n = 5 for each group). 2dg increased the pampk expression in a1c1 m in the sap rats at 45 min after 2dg injection (p 0.6), indicating that sap injections did not retrogradely lesion hindbrain catecholamine neurons. 4) showed that pvh dsap injection eliminated dbh - positive fibers in the pvh and significantly reduced the number of dbh - positive cells in the a1c1 m, which heavily innervate the pvh, as shown previously (15,32). the number of dbh - positive cells was reduced in the a1c1 m to 21.5% of the number present in sap rats. a : representative ihc images of dbh staining in a sap - injected (a and c) or dsap - injected (b and d) rat in pvh (a and b) or the hindbrain a1/c1 region (c and d). scale bar = 0.5 mm. b : dbh - positive cells in each of the hindbrain regions. p 0.1) or 7 h (97.1%, p > 0.8) after injection (fig. 5). effect of cc, an ampk inhibitor, on 2dg - induced feeding. cc or the control solvent, dmso, was injected into the fourth ventricle 1015 min before 2dg (200 mg / kg s.c.) or saline (sal) injection. food intake was measured for the next 7 h. p 6 h after 2dg- or insulin - induced hypoglycemia, if nutrients are withheld during the glucoprivic episode (3336). additional work will be required to determine how ampk phosphorylation and its downstream effects in a1c1 m and other neurons are related to the stimulation and time course of glucoprivic feeding. although the results of pharmacological ampk manipulations do not provide strong support for a role in transduction of the glucoprivic signal, several experimental observations have linked ampk activation with transcriptional changes appropriate to increasing food intake. first, overexpression of the dominant - negative ampk subunits in the ventromedial hypothalamus suppresses food intake, reduces body weight, and decreases expression of the orexigenic neuropetide genes npy and agrp in the arcuate nucleus, whereas expression of constitutively active ampk subunits in that region increases feeding, body weight, and enhances the fasting - induced increase of npy and agrp in the arcuate nucleus (23). injection of aicar into the lateral ventricle enhances npy expression in the hypothalamus, as shown by northern blot (37). our previous work is consistent with the possibility that npy gene expression also is a target of ampk in the hindbrain. studies have shown that dbh and npy are colocalized in a1c1 catecholamine neurons (15,32) and are both required for glucoprivic feeding (2,3,1214,38). simultaneous silencing npy and dbh by injection of small - interfering mrna into the a1c1 region blocks feeding in response to systemic glucoprivation but fails to block feeding when either of these genes is blocked separately (16). npy in a1c1 catecholamine neurons would be a feasible target of ampk because it appears to be in the hypothalamus. in the current study, we found a significant enhancement of pampk by 2dg in the ventral (including a1, a1/c1 overlap, and c1 m), but not in dorsal, hindbrain micropunches (including a2, c2, and the nts). the neurons in the ventral hindbrain regions also were more sensitive to ampk activation because aicar injection into the fourth ventricle increased pampk expression in the ventral but not the dorsal part of the hindbrain. (39) have reported an enhancement of pampk in rat nts after 2448 h of food deprivation. first, the differences may be attributed to the differing treatments used in these two studies. food deprivation over this period alters nutrient and gastrointestinal signals known to act on the vagus nerve and/or the nts (40) and are a likely stimulus for ampk activation, whereas the major responses to glucoprivation occur by direct effects of glucoprivation within the brain. our dorsal hindbrain tissue punches included the entire extent of the nts in order to sample both the a2 and c2 cell groups. (39) found, however, that the caudal nts at the level of the area postrema was sensitive to cc exposure, whereas the rostral nts was not. if this differential response also occurs during glucoprivation, then our sampling method may have diluted the pampk signal to a nonsignificant level. in support of this, we found that pampk expression was increased by ~30% in the a2c2 micropunches at both 45 min and 2 h after the 2dg treatment. basal levels of pampk in dsap rats were slightly enhanced in the a1c1 m compared with sap rats. the mechanisms underlying this apparent slight enhancement and the cell types contributing to this increase were unclear in the current study. one possibility is that activated glia cells, which persist for prolonged periods after neuronal destruction, were present in the a1c1 area as a correlate of catecholamine neuron degeneration and may have contributed to enhancement of basal ampk phosphorylation levels. regardless of the cell type responsible, it is clear from the current study that this enhanced basal pampk did not enhance, and therefore presumably was not related to, glucoprivic feeding. in summary, we found that 2dg - induced glucoprivation activated pampk in the hindbrain region containing a1c1 m catecholamine neurons. this activation was site specific (it did not occur in adjacent noncatecholaminergic tissue). both 2dg - induced glucoprivic feeding and the enhancement of pampk in the a1c1 m were completely abolished by retrograde dsap lesion of a1c1 m neurons, suggesting a major contribution of these neurons to the pampk enhancement. activation of ampk by fourth ventricular aicar induced a brief feeding response, and preinhibition of hindbrain ampk activity by cc briefly impaired the feeding response to 2dg. these results suggest that ampk may contribute to the functions of a1c1 catecholamine neurons during glucoprivation and may indicate a role for ampk as a glucosensory transduction mechanism for the initiation of systemic glucoregulatory responses. | objectiveto examine the role of amp - activated protein kinase (ampk) in the control of glucoprivic feeding by hindbrain catecholamine neurons.research design and methodsmicropunched hindbrain samples were collected from control and 2-deoxy - d - glucose (2dg)-injected rats for western blot analysis of phosphorylated (activated) ampk (pampk). samples also were collected from 2dg - injected rats pretreated with anti - dopamine--hydroxylase conjugated to saporin to lesion hindbrain catecholamine neurons. in a second experiment, rats were given a fourth - ventricle injection of compound c (cc) or 5-aminoimidazole-4-carboxyamide ribonucleoside (aicar), an inhibitor and activator of ampk, to identify a role for ampk in hindbrain neurons required for elicitation of 2dg - induced feeding.resultssystemic 2dg stimulated food intake in controls but not in catecholamine - lesioned rats. in controls, but not catecholamine - lesioned rats, 2dg also increased phosphorylated thr172 at ampk subunits (pampk) in hindbrain micropunches containing catecholaminergic cell groups a1 through the middle region of c1 (a1c1 m). increased pampk was not observed in the adjacent noncatecholaminergic ventromedial medulla or in the a2c2 catecholamine cell groups in the dorsal hindbrain. fourth - ventricle injection of cc attenuated 2dg - induced feeding during the first 2 h of the test, and aicar alone increased food intake only during the first 60 min of the 4-h test.conclusionsresults indicate that ampk in catecholaminergic a1c1 m neurons is activated by glucoprivation. therefore, ampk may contribute to the glucose - sensing mechanism by which these neurons detect and signal a glucose deficit in the service of systemic glucoregulation. |
reports have described the increasing use of endoscopic ultrasound - guided hepaticogastrostomy (eus - hg) to treat malignant biliary obstruction in patients with endoscopic retrograde cholangiopancreatography (ercp) failure. however, a previous review article noted that despite its high success rate, eus - hg is associated with a relatively high rate of adverse events 1, which is attributable to the lack of standardized protocols and specialized equipment. previously at our institution, eus - hg was performed on three patients using a biliary dilation catheter for hepaticogastric fistula dilation and a 7-cm, straight plastic stent or 8-cm fully covered metal stent. however, in two of the three patients, achieving fistula dilation was time - consuming and the stent migrated into the peritoneal cavity in two of the three patients. recently, we introduced a 6f cystotome (cysto gastro set ; endo - flex, gmbh, voerde, germany) for fistula dilation and an 8-mm, 12-cm covered stent with a 1-cm uncovered portion at the distal, intrahepatic end (bare - end type, niti - s biliary s - type ; taewoong medical, seoul, korea) (fig., we present our experience with four cases of eus - hg in which our institutional procedure (6f cystotome and 8-mm, 12-cm covered metal stent) was used, and evaluate the safety of this procedure. bare - end type niti - s biliary s - type stent with a 1-cm uncovered portion at the distal end (red arrow) ; the remaining portion is fully covered. between october 2014 and august 2015, we treated four consecutive cases of malignant biliary obstruction via eus - hg with a 6f cystotome and 8-mm, 12-cm covered metal stent. procedural consent was obtained from each patient, and the institutional review board granted permission to review the patients records. m, male ; f, female ; bd, bile duct ; hgs, hepaticogastrostomy ; fu, follow - up ; eus, endoscopic ultrasound all procedures were performed using a convex - type echoendoscope (gf - uct260 ; olympus medical systems, tokyo, japan) and carbon dioxide insufflator. the left intrahepatic bile duct was punctured from the stomach using a 19 g needle (sonotip ; medi - globe, rosenheim, germany) under doppler imaging guidance to avoid any intervening arteries or veins. after aspirating the bile juice, a small amount of contrast medium was injected to visualize the biliary tree. next, a 0.025-in guidewire (visiglide ; olympus medical systems, tokyo, japan) was inserted into the bile duct through a 19 g needle, which was subsequently exchanged for an ercp catheter with a 3.5f tip (pr - v110q ; olympus medical systems, tokyo, japan) to avoid guidewire shearing. the guidewire was then advanced into the common or right intrahepatic bile duct, and the fistula was dilated using a 6f cystotome (cysto gastro set) ; subsequently, an electrosurgical high - frequency generator (esg-100 ; olympus medical systems, tokyo, japan) with the diathermy current set to the cut mode (90 w in pulse - cut slow mode) was used. finally, we placed an 8-mm, 12-cm covered stent with a 1-cm uncovered portion at the distal, intrahepatic end (bare - end type, niti - s biliary s - type) from the left intrahepatic bile duct to the stomach. a 71-year - old man presented with a malignant biliary stricture and gastric outlet obstruction due to unresectable advanced gastric cancer, for which he had undergone endoscopic transpapillary biliary drainage (ebd), gastrojejunostomy bypass, and chemotherapy, respectively. ercp was attempted to restore the transpapillary biliary drainage, but malignant invasion prevented the passage of a side - viewing endoscope through the antrum of the stomach. although we could reach the ampulla by passing a single - balloon enteroscope (sbe) through the gastrojejunostomy anastomosis, ebd restoration failed. therefore, we decided to perform eus - hg and successfully placed a bare - end type, niti - s biliary s - type stent from the left intrahepatic bile duct (segment 3 : b3) to the stomach (fig. the patient experienced post - procedural abdominal pain that was relieved in a few days. he developed acute cholangitis on day 109 post - eus - hg for which endoscopic reintervention was not attempted, as his performance status had deteriorated because of cancer progression. fluoroscopic image showing a cystotome over a guidewire inserted into the intrahepatic bile duct. a fluoroscopic image showing a metallic stent placed from the left intrahepatic bile duct to the stomach. c schema of this case, showing the malignant stenosis (yellow arrow) and the metallic stent (red arrow) placed from the left intrahepatic bile duct to the stomach. a 71-year - old man had undergone extrahepatic bile duct resection and choledochojejunostomy for distal cholangiocarcinoma. he was referred to our department 2 months after surgery with obstructive jaundice caused by a malignant stenosis of the afferent loop. ebd using a sbe was attempted, but the endoscope could not be passed through the afferent loop stenosis. similarly, a guidewire could not be passed through the stenosis, and it was therefore impossible to treat the afferent loop stenosis via balloon dilation or stent placement. therefore, we decided to perform eus - hg and successfully placed a bare - end type, niti - s biliary s - type stent from the left intrahepatic bile duct (segment 3 : b3) to the stomach (fig. the patient did not experience abdominal pain after the procedure and was discharged on day 7 post - eus - hg. he was readmitted for acute cholangitis on day 32 post - eus - hg ; an esophagogastroduodenoscopy was performed for biliary drainage, and the stent was found to be occluded with biliary sludge. accordingly, we inserted an endoscope (q260j ; olympus medical systems) in the stent opening and aspirated the sludge, thus restoring the bile flow (fig. before the patient died due to cancer progression on day 215 post - eus - hg, acute cholangitis and stent occlusion due to biliary sludge occurred seven times (every 2 4 weeks) and each time, the same treatment was performed. b fluoroscopic image showing a metallic stent placed from the left intrahepatic bile duct to the stomach. c schema of this case, showing the malignant afferent loop stenosis (yellow arrow) and the metallic stent (red arrow) placed from the left intrahepatic bile duct to the stomach. the inside of the stent was cleaned. a 71-year - old woman presented with malignant duodenal stenosis and biliary stricture resulting from unresectable pancreatic cancer. an ebd for the biliary stricture was impossible because a side - viewing endoscope could not be passed through the duodenal stenosis. therefore, we placed a duodenal stent (niti - s pyloric duodenal d - type stent ; taewoong medical) in the malignant duodenal stenosis and performed eus - hg for biliary drainage. we successfully placed a bare - end type, niti - s biliary s - type stent from the left intrahepatic bile duct (segment 3 : b3) to the stomach (fig. the patient did not experience abdominal pain after the procedure and was discharged on day 8 post - eus - hg. she was later readmitted for acute cholangitis on day 57 post - eus - hg. we performed cholangiography by inserting an ercp catheter (pr - v104q ; olympus medical systems) into the stent using a side - viewing endoscope (jf-260v ; olympus medical systems). the cholangiogram revealed sludge within the stent, which we removed using a retrieval balloon catheter (extractor pro xl ; boston scientific japan, tokyo, japan ; fig. despite continued chemotherapy, the patient died of cancer progression on day 146 post - eus - hg. a computed tomography showing a duodenal stent in the malignant duodenal stenosis and a biliary stent placed from the left intrahepatic bile duct to the stomach. the inside of the stent was cleaned using a retrieval balloon catheter over a guidewire. a 91-year - old man was admitted to our institution with obstructive jaundice caused by pancreatic cancer. ercp was initially attempted but failed due to malignant invasion of the duodenum ; accordingly, we decided to perform eus - hg. before attempting this procedure, we placed clips on the esophagogastric junction to facilitate recognition under fluoroscopic guidance. we punctured the left intrahepatic bile duct (segment 2 : b2) using a 19 g needle, and placed a bare - end type, niti - s biliary s - type stent from the left intrahepatic bile duct (b2) to the stomach (fig. the patient did not experience abdominal pain after the procedure and was discharged on day 17 post - eus - hg. fluoroscopic image showing a cystotome over a guidewire inserted into the intrahepatic bile duct. a endoscopic image at the time of stent placement, showing a metallic stent protruding from the stomach wall. b computed tomography image showing the placement of a metallic stent from the left intrahepatic bile duct to the stomach. a 71-year - old man presented with a malignant biliary stricture and gastric outlet obstruction due to unresectable advanced gastric cancer, for which he had undergone endoscopic transpapillary biliary drainage (ebd), gastrojejunostomy bypass, and chemotherapy, respectively. ercp was attempted to restore the transpapillary biliary drainage, but malignant invasion prevented the passage of a side - viewing endoscope through the antrum of the stomach. although we could reach the ampulla by passing a single - balloon enteroscope (sbe) through the gastrojejunostomy anastomosis, ebd restoration failed. therefore, we decided to perform eus - hg and successfully placed a bare - end type, niti - s biliary s - type stent from the left intrahepatic bile duct (segment 3 : b3) to the stomach (fig. the patient experienced post - procedural abdominal pain that was relieved in a few days. he developed acute cholangitis on day 109 post - eus - hg for which endoscopic reintervention was not attempted, as his performance status had deteriorated because of cancer progression. fluoroscopic image showing a cystotome over a guidewire inserted into the intrahepatic bile duct. a fluoroscopic image showing a metallic stent placed from the left intrahepatic bile duct to the stomach. c schema of this case, showing the malignant stenosis (yellow arrow) and the metallic stent (red arrow) placed from the left intrahepatic bile duct to the stomach. a 71-year - old man had undergone extrahepatic bile duct resection and choledochojejunostomy for distal cholangiocarcinoma. he was referred to our department 2 months after surgery with obstructive jaundice caused by a malignant stenosis of the afferent loop. ebd using a sbe was attempted, but the endoscope could not be passed through the afferent loop stenosis. similarly, a guidewire could not be passed through the stenosis, and it was therefore impossible to treat the afferent loop stenosis via balloon dilation or stent placement. therefore, we decided to perform eus - hg and successfully placed a bare - end type, niti - s biliary s - type stent from the left intrahepatic bile duct (segment 3 : b3) to the stomach (fig. the patient did not experience abdominal pain after the procedure and was discharged on day 7 post - eus - hg. he was readmitted for acute cholangitis on day 32 post - eus - hg ; an esophagogastroduodenoscopy was performed for biliary drainage, and the stent was found to be occluded with biliary sludge. accordingly, we inserted an endoscope (q260j ; olympus medical systems) in the stent opening and aspirated the sludge, thus restoring the bile flow (fig. 3d f). before the patient died due to cancer progression on day 215 post - eus - hg, acute cholangitis and stent occlusion due to biliary sludge occurred seven times (every 2 4 weeks) and each time, the same treatment was performed. b fluoroscopic image showing a metallic stent placed from the left intrahepatic bile duct to the stomach. c schema of this case, showing the malignant afferent loop stenosis (yellow arrow) and the metallic stent (red arrow) placed from the left intrahepatic bile duct to the stomach. a 71-year - old woman presented with malignant duodenal stenosis and biliary stricture resulting from unresectable pancreatic cancer. an ebd for the biliary stricture was impossible because a side - viewing endoscope could not be passed through the duodenal stenosis. therefore, we placed a duodenal stent (niti - s pyloric duodenal d - type stent ; taewoong medical) in the malignant duodenal stenosis and performed eus - hg for biliary drainage. we successfully placed a bare - end type, niti - s biliary s - type stent from the left intrahepatic bile duct (segment 3 : b3) to the stomach (fig. the patient did not experience abdominal pain after the procedure and was discharged on day 8 post - eus - hg. she was later readmitted for acute cholangitis on day 57 post - eus - hg. we performed cholangiography by inserting an ercp catheter (pr - v104q ; olympus medical systems) into the stent using a side - viewing endoscope (jf-260v ; olympus medical systems). the cholangiogram revealed sludge within the stent, which we removed using a retrieval balloon catheter (extractor pro xl ; boston scientific japan, tokyo, japan ; fig. the patient died of cancer progression on day 146 post - eus - hg. a computed tomography showing a duodenal stent in the malignant duodenal stenosis and a biliary stent placed from the left intrahepatic bile duct to the stomach. a. fluoroscopic image at the time of reintervention. the inside of the stent was cleaned using a retrieval balloon catheter over a guidewire. b endoscopic image at the time of reintervention. a large amount of sludge was removed from the inside of the stent. a 91-year - old man was admitted to our institution with obstructive jaundice caused by pancreatic cancer. ercp was initially attempted but failed due to malignant invasion of the duodenum ; accordingly, we decided to perform eus - hg. before attempting this procedure, we placed clips on the esophagogastric junction to facilitate recognition under fluoroscopic guidance. we punctured the left intrahepatic bile duct (segment 2 : b2) using a 19 g needle, and placed a bare - end type, niti - s biliary s - type stent from the left intrahepatic bile duct (b2) to the stomach (fig. the patient did not experience abdominal pain after the procedure and was discharged on day 17 post - eus - hg. fluoroscopic image showing a cystotome over a guidewire inserted into the intrahepatic bile duct. a endoscopic image at the time of stent placement, showing a metallic stent protruding from the stomach wall. b computed tomography image showing the placement of a metallic stent from the left intrahepatic bile duct to the stomach. as noted in the introduction, a previous review article reported a relatively high rate of adverse events associated with eus - hg, with an average complication rate of 17.0 % 1. the reported major complications associated with this procedure include cholangitis, bleeding, stent migration, peritonitis, and bile leakage. we believe that smooth fistula dilation is necessary to reduce the risk of intraabdominal bile leakage associated with frequent device exchange and a long procedure time. at our institution, we have used a 6f cystotome (cysto gastro set) for fistula dilation during eus - guided biliary drainage since october 2014. this coaxial device is fitted with a guidewire and allows safe and rapid fistula dilation. other institutions have used a biliary dilation catheter, balloon dilation catheter, and cystotome for fistula dilation during eus - guided biliary drainage, as reported in a japanese multicenter retrospective study 2. that retrospective study reported that eus - guided choledochoduodenostomy was unsuccessful in two patients treated without a cystotome owing to fistula dilation failure, whereas eus - guided biliary drainage, including eus - hg, was successful in all cases involving a cystotome. smooth fistula dilation was possible in all four of our cases ; in addition, we achieved a mean procedure time of 27.5 minutes and did not encounter peritonitis due to bile leakage in any of our cases. recently, another study reported the usefulness of a novel fine - gauge balloon catheter for hepaticogastric fistula dilation 3. further studies of safe and useful methods of fistula dilation are required. according to the literature, the complication of stent migration to the peritoneal cavity may occur in both the early and late post - eus - hg phases and might lead to a very poor prognosis. the literature describes a case in which a 6-cm covered metallic stent migrated with a fatal outcome, and a case in which an 8-cm covered metallic stent migrated, necessitating surgical treatment 4 5. before incorporating a bare - end type, niti - s biliary s - type stent, we performed eus - hg in three patients but two of them experienced stent migration. in one case, a 7-cm straight plastic stent migrated to the peritoneal cavity on day 2 post - eus - hg, necessitating percutaneous drainage ; in the other case, an 8-cm covered metallic stent migrated to the peritoneal cavity during the procedure, necessitating the placement of an additional metallic stent. from the above literature and our experiences, we believe that 10-cm or longer stents should be used to avoid stent migration. in a recent report, severe complications, including stent migration, did not occur in 12 patients with eus - hg using a 10-cm or 12-cm bare - end type, niti - s biliary s - type stent 6. although all of those cases also involved eus - antegrade stenting for biliary stenosis, the report suggests that eus - hg with a 10-cm or longer metallic stent is safe. we achieved technical success in all cases involving the placement of 12-cm stents, and none of the patients experienced complications such as stent migration. moreover, a recent report described a significantly shorter median stent patency duration in patients who underwent eus - hg with a stent length < 3 cm in the luminal portion, relative to those with a stent length 3 cm ; therefore, we believe that a longer stent should be used for eus - hg 7. in all of our cases, in addition, the diameter of the stent used in eus - hg remains controversial. in our cases, we used an 8-mm stent to avoid stent dysfunction due to granulation of the hepatic side of the stent, which is caused by intrahepatic bile duct overexpansion. however, the outcomes achieved with this stent diameter should be compared with outcomes following the placement of 6-mm and 10-mm stents. only a few reports have described endoscopic reintervention after eus - hg with a metal stent ; these include a case in which the portion of the stent that protruded into the stomach was trimmed using argon plasma coagulation, and a case of hepaticogastric fistula in which a metal stent was exchanged while retaining the guidewire and endoscopic nasobiliary drainage tube 8 9. of our four patients, three exhibited stent dysfunction and two underwent endoscopic reintervention (patients 2 and 3). successful reintervention was performed by aspirating biliary sludge from the inside of the stent with a conventional endoscope in patient 2, and by removing sludge with a retrieval balloon catheter and a side - viewing endoscope in patient 3. in patient 2, acute cholangitis and stent occlusion due to biliary sludge occurred frequently. despite the absence of malignant duodenal stenosis, considerable quantities of food were found in the patient s stomach at each endoscopic re - intervention. delayed gastric emptying was thought to be the cause of frequent stent occlusion, but prokinetic agents were not effective. an anti - reflux covered metal stent was reported to be useful for transpapillary biliary drainage in patients with recurrent biliary metal stent occlusion, and the potential usefulness of this stent type in patients with eus - hg should be investigated 10.in summary, our experiences with the cases described here have led us to conclude that eus - hg with a 6f cystotome and an 8-mm, 12-cm covered metal stent is likely safe ; however, further large - scale investigations will be required to confirm our findings. | background and study aims : an iincreasing number of reports describe endoscopic ultrasound - guided hepaticogastrostomy for malignant biliary obstruction in patients with endoscopic retrograde cholangiopancreatography failure. however, this procedure has not yet been standardized ; as a result, the rate of adverse events, including bile leakage and stent migration, is relatively high. here, we report our experience with four cases of endoscopic ultrasound - guided hepaticogastrostomy performed according to our institutional procedure. |
consumer - directed healthcare (cdhc) is center stage in health policy debates. many politicians and corporate leaders hope that high deductible health insurance policies will cut costs by coaxing people to think twice before visiting the emergency department (ed), drug store, or mri suite. the basic idea is that americans are too well insured ; if they spend their own money so the logic goes they will spend it more wisely. sometimes, after a morning in the clinic during cold season when we are inundated with snifflers seeking antibiotics, we see the attraction of such incentives. but then comes a patient with sniffles and pneumonia, or a diabetic heading toward a foot amputation for want of timely podiatric care and reluctance to endure constant needling, or a woman looking for any excuse to put off the discomfort and embarrassment of a mammogram or pelvic exam, or a middle - aged man who finds the prospect of colonoscopy disquieting. little of what we do to our patients is pleasant for them, and past studies indicate that patients facing steep out - of - pocket costs skip vital care, not just useless visits.1 medical care differs from most consumer goods. so far as we know, there is no biological need for a flat - panel television. true, clothing, food, and shelter are necessities, but neither bad genes nor bad luck compels you to buy the high - priced versions those purchases are generally driven by comfort, aesthetics, or social norms, not fear for life and limb. for patients, the luck of the draw usually dictates the care they must buy. men do not require pap smears, birth control pills, obstetrical care, or routine breast exams. americans of european descent rarely suffer sickle cell disease, or non - jews tay sachs. diabetes and cancer which reflect a mix of bad luck and bad choices do not just bring medical complications ; they bring financial ones as well. in addition, cdhc ups the ante, amplifying the financial consequences of both bad luck and unfortunate choices. consumer - directed healthcare policies offer lower premiums in exchange for higher deductibles at least $ 1,050 per person and $ 2,100 per family annually, often as high as $ 10,000 annually. in the ideal case, such plans are coupled with health savings accounts (hsas)tax - free accounts that can be used to pay for the deductible and for medical services like cosmetic surgery that are entirely excluded from coverage. however, half of cdhc enrollees have nothing in their hsas.2 under cdhc, healthy people with very low medical expenses win ; they get lower premiums and pay only trivial additional amounts out - of - pocket. however, others lose. the medical expenditure panel survey (meps) which collects detailed medical spending data on a nationally representative sample of americans allows prediction of some likely losers. using data from the 2003 meps,3 we tabulated the numbers and proportions of insured individuals with various conditions whose health care costs exceeded $ 1,050 or $ 2,100, as well as the mean and median expenditures for these groups. precise modeling of cdhc s financial impact is difficult for several reasons : (1) the complexity of the thousands of different cdhc plans now on the market ; (2) variability in families marginal tax rates, which determine the size of the tax subsidy to hsas (those with higher incomes generally enjoy larger tax subsidies) ; (3) variations in families insurance coverage (in some families, husbands, wives, children, and step children have different coverage) ; and (4) the fact that individuals coverage may change in the course of a year. however, the federal government s thresholds for defining high deductible health plans that qualify for hsa tax exemptions $ 1,050 for an individual and $ 2,100 for a family we inflated 2003 spending figures to 2006 dollars using centers for medicare and medicaid services projected change in per capita personal health expenditures between 2003 and 2006.4 we omitted individuals over 65 from most analyses because most cdhc proposals exclude this group, many of whom have costly illnesses and virtually all of whom are covered by medicare. not only do we (including one of the authors) suffer the pain of childbirth, but it is also expensive. additionally, we are more diligent in seeking care for chronic illnesses like diabetes and hypertension. while only one third of insured men under 45 hit $ 1,050 each year in medical costs, 55.6% of insured young women reached this figure (table 1). similar cost disparities disadvantage insured women between 45 and 65, 74.2% of whom consume $ 1,050 or more in medical care annually. overall, insured women s median health expenditure is $ 997 higher than men s. even subtracting a few hundred dollars for the cost of mammograms and pap smears (exempted from the deductible in a few cdhc plans), women are still big losers. table 1mean and median per capita health spending and percentage spending less than $ 1,050 and $ 2,100 among insured americans according to age, sex, and diagnosis, 2006 n (millions)mean per capita annual expendituremedian per capita annual expenditurepercent of individuals with annual expenditure 6414.5149,9434,23118.029.2females 018 years30.2921,35645071.884.8 1844 years39.6283,3631,26644.462.8 4564 years28.2795,9742,87125.841.3 > 64 years19.8649,3204,33414.627.7males 186461.8924,14084754.269.0females 186467.9074,4511,84436.753.8 mean and median per capita health spending and percentage spending less than $ 1,050 and $ 2,100 among insured americans according to age, sex, and diagnosis, 2006 the odds are even worse for sick people. more than 90% of insured diabetics cross the $ 1,050 annual spending mark ; more than half spend at least $ 5,000. similar figures apply to the millions of people with heart disease, emphysema, arthritis, or a history of stroke. even hypertension or asthma makes you a very bad bet to stay under $ 1,050, or even $ 2,100. most kids are lucky they use less than $ 500 worth of care each year. however, needing even a single prescription medication changes the odds. of the 12.1 million insured kids in that category, 58.6% zoomed past $ 1,050. women, with rare exceptions, do not choose their sex. yet, cdhc will penalize them, as well as men whose major sin is chronic illness, and many of us who are turning gray. moreover, as healthy, low - cost patients flee to cdhc plans, premiums for the sick who remain in non - cdhc coverage will skyrocket. already in the federal employee health benefits program, cdhc plans are segregating young, higher - income men from the costlier female and older workers.5 for wal - mart s management, shifting to cdhc plans is an explicit strategy to push sicker, high - cost workers to quit.6 consumer - directed healthcare also seems unfair and unwise on other accounts. a single mother with one child who makes $ 16,000 annually would save $ 19.60 in income taxes by putting $ 2,000 into an hsa.7 a similar mom earning $ 450,000 would save $ 720 in taxes. it seems unwise because cdhc incentives selectively discourage low - cost primary and preventive care. even 1 day in the hospital would push a patient past the deductible threshold, eliminating any cost - saving incentives for the small group of sick patients who account for the vast majority of health costs. patients without known heart disease trying to decide whether their chest pain warrants an ed visit would skimp ; or perhaps a young woman whose abdominal pain may be caused by indigestion, or an ectopic pregnancy ; or a young man with mild hypertension. consumer - directed healthcare incentives to skimp on these relatively low - cost services are unlikely to constrain overall health spending. the united states already has the world s highest out - of - pocket spending and the highest health costs. copayments in switzerland a nation near the top of the health spending charts have not reduced total health expenditures.8 in canada, charging copayments had little impact on costs ; doctors less frequently saw the poor (and often sick) patients who could not pay, but their appointment slots were filled by more affluent patients who could.9,10 this offset has not been examined in u.s. higher copayments for medications in quebec resulted in increased ed visits, hospitalizations, and deaths for the poor and elderly,11 confirming the rand experiment finding in the united states that copayments increase the risk of dying for the sick poor.1 moreover, cdhc and hsas add new layers of expensive health care bureaucracy. already, insurers and investment firms are vying for the estimated $ 1 billion annually in fees for managing hsas, and blue cross and unitedhealth have chartered their own banks and announced special health care credit cards12presumably charging hefty interest to patients with empty hsas. patients must assiduously document their out - of - pocket payments to assure that coverage kicks in once the deductible is met. for doctors, cdhc means collecting fees directly from patients, many of them unable to pay, a task even costlier than billing insurers.13 moreover, doctors and patients will still have to play by insurers utilization review and other rules failure to do so disqualifies bills from counting toward the patient s deductible. some propose mitigating cdhc s adverse effects by waiving out - of - pocket costs for some high - value services such as recommended preventive care. accurately linking out - of - pocket cost to clinical value as they suggest would require much more than a list of procedures. for instance, the cost effectiveness of a pap smear depends on the details of sexual history. are we really to report to insurers the number of lifetime male sexual partners for each of our female patients ? additionally, how will insurers tailor financial incentives to get patients to the ed promptly if their undiagnosed chest pain signifies cardiac ischemia, but not if it is heartburn ? behind the rhetoric of consumer responsiveness and personal responsibility, cdhc sets in motion huge resource transfers. the sick and middle - aged pay more, whereas the young and healthy pay less. the poor skip vital care while the rich enjoy tax - free tummy tucks. and, as in every health reform in memory, bureaucrats and insurance firms walk off with an ever larger share of health dollars. | many politicians and business leaders are advocating high deductible health insurance plans linked with health savings accounts so - called consumer - directed healthcare. these policies penalize the sick, discourage needed care (especially primary and preventive care), and direct tax subsidies towards the wealthiest americans. they offer little hope of slowing the growth of health care costs and add further bureaucratic costs and complexity to our health care financing system. |
chronic recurrent multifocal osteomyelitis (crmo), a disorder that primarily affects children and adolescents, is characterized by episodic osseous pain over several years. crmo is an idiopathic, aseptic, auto - inflammatory disease with no uniformly effective treatment. the long bones of the lower extremities are frequently affected, and skull involvement is rare. although in the majority of patients with crmo, symptoms resolve post - puberty, the bone pain that accompanies the active disease is severe. the critical factors leading to its diagnosis are patient demographics, clinical course, and lesion localization. at the time of symptom onset, an 11-year - old boy initially reported right coxalgia at rest, without edema or fever. a review of the patient s family history showed that his father had idiopathic bilateral femur head necrosis. the patient could not run and had stopped exercising, but his pain did not improve. one month later, he visited an orthopedic surgeon, where a radiograph of the pelvis showed sclerosis of the right side of the sacrum and decreased bone mineral density in the right femur. an outpatient examination was performed to determine his height (142 cm [0.1 sd ]), body weight (36 kg [0.2 sd ]), current heart rate (85 beats / min, with a regular rhythm), blood pressure (124/73 mmhg), respiratory rate (15 breaths / min), oxygen saturation (99%, ambient air), and body temperature (36.3). the patient did not present any remarkable chest or abdominal findings, or other abnormalities such as a rash. the patient s hematological workup revealed a slight elevation of inflammatory markers, but the complete blood count, liver enzyme levels, renal function, and coagulation were normal (table). the patient had a slightly elevated c - reactive protein (crp) level and an erythrocyte sedimentation rate (esr) of 41 mm / h. urinalysis revealed extreme elevation of type i collagen cross - linked n - telopeptide (ntx), with an ntx / creatinine ratio of 429.1 nmol bone collagen equivalent (bce)/mmol creatinine (cre) (normal range 1366), suggestive of bone resorption. the patient s urine 2 microglobulin (mg) level was normal (111 g / l), with slight elevation of serum complement levels. his interleukin (il)-6 level was 9.6 pg / ml (normal < 9.5), and il-10 level was 3.1 pg / ml (normal < 6.8). magnetic resonance imaging (mri) using fat - suppressed t2-weighted images (wi) showed a heterogeneous, high - intensity area on the right side of the sacrum (fig. 1). a coronal view showed a low - intensity area within the same lesion using t1wi ; there were no abscess formations. computed tomography (ct) of the pelvis showed a high - density area in the same lesion, suggesting sclerosis, chronic osteomyelitis, or osteosarcoma. low attenuation imaging of the area anterior to the sacrum showed soft tissue edema. at this point, fat suppressed t2-weighted magnetic resonance images show a heterogeneous high intensity area on the right side of the sacrum (white arrow). a course of antibiotics was administered for 14 days but did not alter the disease course. the non - steroidal anti - inflammatory drug (nsaid) ibuprofen was started at 200 mg / day and the symptoms improved, but complete relief was not attained. three months later, a bone biopsy was performed to rule out the possibility of malignant bone tumors, such as an osteosarcoma. upon pathologic examination, mild, mainly lymphocytic, inflammatory cell infiltration indicated chronic osteomyelitis, without suppurative infection (fig. one year later, the patient developed occipital headaches, accompanied by a decrease in pelvic pain. there was palpable edema in the occipital lesion, and the size of the swelling was 3 cm. axial and sagittal fat - suppressed t2wi demonstrated a focus of increased signal intensity in the occipital bone, with the area of increased intensity extending into the epidural space and scalp (fig. 3b). the previous osteolytic lesion improved, but another lesion appeared as an osteolytic change in the occipital bone (fig. technetium-99m - hydroxymethylene diphosphonate (tc - hmdp) scintigraphy showed increased uptake in the occipital bone and the right side of the sacrum, leading to a diagnosis of crmo, which was controlled using ibuprofen (200 mg / day). we ruled out langerhans cell histiocytosis (lch) after considering the sacral biopsy and radiological findings, and because the head lesion appeared recently. the bone pain and swelling of the occipital lesion gradually improved with nsaid treatment over one year. one year and 4 months later, diffusion - weighted mri imaging showed a new, asymptomatic region on the left (opposite) side of the sacrum. the serum cytokine profiles at this time were almost normal ; the values are as follows (normal values in parentheses) : il-6 was <3 pg / ml, neopterin was 3.9 nmol / l (< 5), soluble tumor necrosis factor receptor (stnf - r)1 was 940 pg / ml (4841,407), stnf - r2 was 2,630 pg / ml (8292,262), and il-18 was 300 pg / ml (< 500). over the following two years, there were no cutaneous findings. photomicrograph of the sacral bone biopsy, demonstrating connective tissue with mild infiltration by mononuclear inflammatory cells. axial (left) and sagittal (right) fat - suppressed t2-weighted images demonstrate a focus of increased signal intensity on the occipital bone. head ct shows that the previous osteolytic lesion improved (upper), but a new lesion appeared as an osteolytic change (lower). crmo is a skeletal auto - inflammatory disorder of unknown cause that primarily affects children and adolescents. the disease is a rare, nonpyogenic bone inflammation that was first described by giedion. in 1972 as " an unusual form of multifocal bone lesions with subacute and chronic symmetrical osteomyelitis. " the prevalence of crmo is estimated to be less than 1/1,000,000. a 5-year follow - up study revealed the mean age of onset to be 10 years (range 414 years). symptoms include pain, local swelling, and warmth in the absence or presence of fever. crmo mainly affects the metaphyses of the long bones, the pelvis, shoulder girdle, and, less commonly, the spine and skull. skull involvement, as described in this report, is very rare. therefore, it is important to explore the etiology of crmo and the reason for its primary localization to the metaphyses and epiphyses of the long bones, which are areas involved in bone growth in children and adolescents. it is likely that osteoclast cells or cytokines at the lesion sites in crmo are associated with the etiology. for this patient, we could not evaluate the state of disease using the serum inflammation data, including the cytokine profiles. we speculated about the reason for the onset of this rare skull involvement in this patient. our patient s father had idiopathic bilateral femur head necrosis, suggesting that an examination of the genetic mutations common to them may be worthwhile, although there are no data to support the concept that crmo is a monogenic disease. our patient demonstrated bone pain and swelling on the back of the head in the absence of fever. reports of crmo involving skull lesions are scarce, and the well - documented cases involve flat bones such as the ilium and mandible. we believe that the skull lesions were caused by crmo, although we could not examine the histopathological findings via skull biopsy because the patient experienced remission and exacerbation of his skull lesions. as one of the differential diagnoses, we had to consider lch because our case had skull lesions, although we excluded malignancy and infectious osteomyelitis. we discovered a report of a child with a frontal and sphenoid bone lesion, which was the first case report of crmo involving the skull. to the best of our knowledge, this report provides the second description of skull involvement in a pediatric crmo patient. the aim of publishing this case report is to indicate that crmo should be considered when the skull is affected in pediatric osteomyelitis patients. crmo is a self - limited disease, but sequelae of the disease occasionally occur. the clinical course is unpredictable, with considerable variation in the severity and time course. exacerbations and spontaneous remissions, as well as inflammatory conditions of the skin and gastrointestinal tract, have been reported. malignancy, pyogenic infections, and atypical presentation of juvenile arthritis need to be ruled out by correlating the history, clinical findings, and biopsy results. pathogens are generally not cultured from the blood, bone, or joints of crmo patients, but patients may report symptoms of psoriatic skin involvement, including palmoplantar pustulosis. such patients are categorized as having synovitis, acne, pustulosis, hyperostosis, and osteitis (sapho) syndrome, which represents an inflammatory spectrum. this syndrome may or may not be associated with dermatological manifestations. to date, our patient has not presented skin lesions, but he will be followed to determine whether skin lesions appear in the future. treatment typically involves nsaids, corticosteroids, tumor necrosis factor (tnf) inhibitors, and bisphosphonates. mutations in lpin2 cause a syndromic form of crmo known as majeed syndrome, while mutations in pstpip2 cause a murine form of the disorder. recent studies in murine chronic multifocal osteomyelitis, majeed syndrome, deficiency of the interleukin-1 receptor antagonist (dira) syndrome, and sapho syndrome reveal abnormalities in innate immune system function. il-1 pathway dysregulation is present in several of these disorders, and blocking il-1 therapeutically controlled the disease in dira, majeed syndrome, and some cases of sapho and crmo. laboratory findings are of little diagnostic value because they typically reveal nonspecific evidence of inflammation, such as altered esr and crp levels. novel insights into the pathogenesis of crmo suggest a link to the failure to produce il-10 and the resulting imbalance of pro - inflammatory il-6 and tnf - alpha levels, in conjunction with disease expression. a diagnosis is supported by the presence of osteolytic lesions, with surrounding sclerosis apparent on radiographs ; asymptomatic lesions frequently appear in nuclear scans. in our patient, mri and ct revealed the involvement of the surrounding soft tissue, specifically the anterior soft tissue of the sacrum, the overlying scalp, and the underlying epidural space and dura mater of the head. at the time of our initial observation, the patient s bone alterations were limited to the occipital bone, but follow - up head ct scans revealed a new lesion in a different area of the occipital bone. in our patient, the bone scan readily detected lesions throughout the body. the demonstration of lesions at various typical sites is crucial for a correct diagnosis. in a report involving 14 pediatric crmo cases, the mean age of symptomatic onset was 9.6 years and the mean disease duration was 5.3 years. however, in a study of 22 crmo children, seven patients developed noticeable deformities and five had leg - length discrepancies lasting 2.520 years. the conclusion of the second study was that crmo is not a benign condition, and if it is not followed to maturity, it can have disabling sequelae that include physical and psychological complications. this report describes the second case of skull involvement in pediatric crmo, which occurred in an 11-year - old boy. we thank akihiro yachie, md, department of pediatrics, kanazawa university and shunji hasegawa, md, department of pediatrics, yamaguchi university, for measuring the serum cytokine levels. | abstractan 11-year - old boy was diagnosed with chronic recurrent multifocal osteomyelitis (crmo) and presented with right sacro - femoral and occipital lesions. initially, a tumor was suspected. however, the bone biopsy showed osteomyelitis with a negative bacterial culture. bone scintigraphy revealed inflammatory changes on multiple bone lesions. the slight elevation in inflammatory markers such as c - reactive protein was of little clinical value. he was diagnosed with crmo by sacral biopsy, and the clinical course progressed, with the presence of a new occipital lesion observed after the 1-year follow - up. the administration of non - steroidal anti - inflammatory drugs successfully improved his clinical symptoms. the presence of a skull lesion in the occipital bone of a pediatric patient with crmo has not been previously reported. |
the increasing number of road traffic accidents in our country has made it extremely difficult to analyze the exact reported incidence of mortality and morbidity due to airway and facial trauma. the incidence of maxillofacial trauma and airway involvement as a result of roadside accidents is quite varied and an approximate incidence of 22% is reported from developed countries. in india alone, accidents account for the highest fatality rate reaching to almost peak of 1520 times than that of developed nations. the roadside accidents have acquired an epidemic proportion and are putting an extra burden on our health resources. the primary management of the injuries, specifically to the airway and facial structures, is of prime importance to the attending anesthesiologist and the intensivist. maxillofacial trauma is invariably associated with head injuries and injuries to the other vital organs can further increase the mortality and morbidity statistics. though there is heterogeneity in the actual reported incidences of such trauma but the common denominator in majority of these accidents is the involvement of young males. however, the primary concerns remain about the initial resuscitation and further management of such injuries. while attending to such patients, numerous challenges have to be faced by the attending anesthesiologist and intensivist besides clinical difficulties. medico - legal and ethical aspects are also few of the major concerns in the present day scenario of increased awareness among general public when such patients are attended to in various hospital settings. equally important is the availability of back - up services like intensive care unit (icu) and trauma team so that the necessary interventions are carried out at the earliest. there are only a few isolated reports in indian set - up which have reported concomitant maxillofacial trauma with associated head injuries and as such larger studies are required to evaluate and manage such challenging injury patterns. however, the most important aspect during initial assessment include the difficulties of appropriate evaluation of neurological status as majority of these patients are either under the influence of alcohol or suffer serious associated head injuries. the present study was carried out to analyze retrospectively the demographic profile of the patients, nature of injuries, types of interventions needed, factors responsible for such trauma, management of these injuries and the outcome in these patients, medico - legal and ethical aspects and a genuine attempt for the identification of preventable factors in such injuries. after obtaining the permission from the concerned hospital authorities, the records of 129 patients were reviewed retrospectively who had sustained maxillofacial trauma and concomitant head injury and were admitted in our institute during the period of july 2008 to august 2011. the inclusion criteria consisted of only those patients who had sustained combined cranio - facial trauma and/or associated injuries to neck, chest and peripheral tissues. patients with fractures of long bones, pelvic fractures, and blunt abdominal injuries were excluded from the study. the study specifically stresses upon the facts related to demographic profile of the patients, nature and type of injuries, factors responsible for infliction of such injuries, need for airway management / intubation and possible mechanical ventilation, need for tracheostomy and the outcome in such patients due to availability of multiple support facilities. the institute is located on national highway and caters to 4.55 lakh of rural population of the adjoining areas. patients had received initial resuscitative measures by trauma team in the emergency department after admission. airway assessment and securing blood samples, computed tomography scan, ultrasound and x - rays were the main diagnostic intervention which had been undertaken during initial primary resuscitation. some of the patients had undergone emergency operative interventions. rests of the patients had been shifted to icu for observation and management and after the surgical procedures ; operated patients had also been shifted to the icu. majority of the patients were mechanically ventilated and in few of them tracheostomy had also been performed for various indications. delayed surgical interventions had also been carried out after initial conservative management especially for the maxillofacial trauma. during their stay in icu, routine monitoring had been carried out which included heart rate, blood pressure, pulse oximetry, ecg, end tidal carbon dioxide etc. day to day only those patients were discharged who had regained consciousness and had a good recovery. at the end of study, all the data was arranged and compiled systematically and was subjected to statistical analysis using mann - whitney and chi - square tests using spss version 15.0 for windows. value of p < 0.05 was considered significant and p < 0.001 as highly significant. at the end of study, all the data was arranged and compiled systematically and was subjected to statistical analysis using mann - whitney and chi - square tests using spss version 15.0 for windows. value of p < 0.05 was considered significant and p < 0.001 as highly significant. a total of 129 patients were admitted to the emergency ward of our institute from july 2008 to august, 2011 with injuries to facial structures and cranium alone, and/or associated injuries to other organs in few of the patients. majority of these cases were of roadside accidents that were brought either by relatives and friends or by the passersby and police personals. in all these patients, initial baseline parameters were observed and duly recorded into their respective records. the demographic profile of these patients is as shown in table 1. demographic profile of craniofacial trauma victims the nature of injuries sustained by these patients was diverse and majority of them had multiple patterns of injuries as shown in table 2. showing the nature of injuries sustained by the patients the presenting clinical picture of these patients also exhibited a huge diversity [table 3 ]. ear, nose and throat bleeding was present in a significant percentage of patient population (70.54%). the loss of consciousness (33.33%), restlessness and agitation (25.58%), dyspnea and chest pain (19.38%) and vomiting (11.62%) on admission were the other presenting symptoms and signs. majority of these patients (91.47%) presented with associated superficial bruises, abrasions, lacerations and external soft tissue injury. clinical presentation of signs and symptoms on admission majority of these patients were managed by immediate airway securing and intubation (59.69%) and immediate operative intervention (41%). mechanical ventilation, blood transfusion, tracheostomy and ionotropic support was instituted wherever deemed necessary [table 4 ]. the inclusion of combined maxillofacial trauma and head injury patients alone in the present study was deliberate as the basic concept revolved around the airway and intensive care management and not the surgical aspect alone. secondly, an attempt was made to assess the predictors of outcome in such patients. the assessment of such patient is very difficult as they are usually either under the influence of alcohol or have decreased gcs score due to associated head injuries. the emphasis was to dwell upon the factors responsible for injuries, types of interventions needed specifically for the airway management, the outcome of timely management and the impact of availability of icu services and trauma team in the prognosis of these serious fatal injuries. the number of patients who suffered roadside accidents was significantly higher in the age group of 1540 years (p < 0.001). the male gender predominance (83.72%) among these victims was statistically significant (p < 0.001) as was the alcohol consumption (31.78%). 0.001) was that majority of these victims (76%) belonged to rural background. thus, demographic characteristics of craniofacial trauma are no different from those due to polytrauma where young male predominance is a common characteristic, and in majority of the cases alleged alcohol consumption is invariably present. however, a strikingly different aspect from other studies is the predominance of rural population in the present study and this is due to the fact that institute is located on the national highway and there are more than a hundred of villages in the surrounding area which it caters to. the higher consumption of alcohol and substance abuse in our country has further enhanced the statistical record of rta. the day by day increasing competition in all the fields has reduced the chances of employment and jobs. as a result, younger generation has to move from place to place in search of a suitable job and sometimes the job demands too much travelling on their part. one other big reason is that males in our indian society, whether young or old, tend to take responsibility upon them to carry out all the away home chores. the increasing use of mobile phones while driving is acquiring an epidemiologic proportion and the number of accidents during such negligent driving has not been reported accurately up till now. in the present study, nature of head injuries revealed that extra - dural hematoma (20.93%) was the most common finding followed by sub - dural (17.83%) and subarachnoid hemorrhage (13.18%). the injury to skull included fractures of frontal bone (20.15%), sphenoid bone (11.63%), orbital roof (13.18%) and fracture of cribriform and ethmoid bone complex (13.18%) with associated csf rhinorrhea. there were few associated injuries to other organ systems as well (36.43%), which were not life threatening and included undisplaced fractures of minor bones including ribs, abrasions, bruises and lacerations to various soft tissue structures. the biggest drawback during initial care includes lack of proper pre - hospital care and the timely transportation of these accident victims to the health centers. from time to time various guidelines have been published in dealing with craniofacial trauma but till today there is no universally accepted protocol in managing and prevention of this menace in the developing nations like india. the popularity of pre - hospital trauma life support guidelines has increased manifold in the west but it is a big laggard in our country due to a multitude of problems. the one big solution is the extensive training of paramedics in the transportation and resuscitation of critically injured patients. at present, our institute has come out with a novel and innovative reform as we have started a 1-year international academic and practical course in critical care for technicians and paramedics in collaboration with a canadian university. this project is the first of its kind in the country, and the basic aim is to train these primary caregivers with the best of knowledge and practices of both the developing and the developed world. the most common clinical presentation of these patients to emergency department includes loss of consciousness, agitation and restlessness, oro - nasal bleed, facial swelling, respiratory distress and vomiting and the similar scenario was observed in our study as well. the most common indication for immediate surgical intervention included depressed skull fracture, extradural hematoma (edh), sub - dural hematoma (sdh), brain contusion with intracranial bleed, csf rhinorrhea and fractured maxillofacial bones interfering with airway. airway management is of prime importance in these patients as the facial fractures, oro - nasal bleed and disrupted facial anatomy throws huge challenges to the attending intensivist in securing the airway. equally critical becomes the support of circulation as the trauma in these patients is invariably associated with circulatory shock. pupillary examination is an important component during initial evaluation but one should not get misguided by these observations as pupillary signs and size can be misleading sometimes due to hypoxemia, hypotension, hypothermia, 3 cranial nerve palsy, and various other etiological factors. the craniofacial trauma throws numerous challenges when they are first attended in the hospital. if the identity of the victim is in doubt, it opens the doors of numerous medico - legal concerns about the initiation of advance treatment after completion of initial resuscitative efforts. many a times, decision has to be taken on urgent basis as head injury and other associated life - threatening injuries require urgent operative intervention. the emergency surgery in craniofacial trauma is further warranted by csf leak which occurs in 1112% of cases with basal skull fractures, and the incidence in our study prevailed to the extent of 15%. the main goals of neurosurgical intervention at the earliest are to prevent the irreversible pressure changes in the brain, external deformity of the skull, sealing the csf leak and to avoid meningitis and sinusitis. sometimes, after the initial resuscitation, surgery is delayed in consideration of the optimization of hemodynamic status and regression of soft tissue swelling. long - term complications of such injuries include mucocele or pyocele, meningitis, subdural empyema and brain abscess. the controversy is never ending with regards to indication for surgery, timing of surgery, the best operative approach, the choice of material to close dural leaks and bone defects etc. the priority for surgery in craniofacial trauma this warrants a close co - ordination of neurosurgeon, anesthesiologist, intensivist, maxillofacial surgeon, plastic surgeon and the ent specialist in the process of precise diagnosis, decision about the time of surgery and surgical approach and availability of intensive care facilities. our task became much simpler as we have a well - equipped trauma unit and a trauma team, which is always available in the hospital for dealing with any type of emergency or mass disaster. in 77 (59.69%) patients, immediate airway protection and intubation was mandatory on account of their airway trauma, respiratory distress, deteriorating clinical condition, intra - oral bleed and progressively decreasing gcs score [table 4 ]. among 129 admissions, immediate emergency operative intervention was required in 53 (41%) patients who had sustained head injuries while delayed surgery was carried out both for the head injury as well as the repair of facial bones in 76 (59%) of the patients. mechanical ventilation was carried out in 65.90% of the patients as and when required during different stages of their stay in icu. blood transfusion was required due to presenting picture of severe hemorrhage or due to ongoing losses in emergency trauma ward in 28.68% of the victims, while 21.70% of these patients required ionotropic support as well for maintaining the hemodynamic stability. chest tube insertion was necessitated in 8.52% of the patients due to the presenting pneumo - hemothorax. tracheostomy was performed in 22.48% of the patients and surprisingly this was performed as an elective procedure for various indications and the availability of fiberoptic bronchoscope negated the need for surgical airway intervention in the emergency trauma ward. we observed a mortality of 16.28% in these patients and that was mainly involving the patients with gcs score of less than 5 [table 4 ]. the traditional surgical management of complex craniofacial trauma is usually performed in three stages where immediate craniotomy is followed by orbitofacial repair in 710 days and last of all cranioplasty is carried out after 612 months. however, early single stage repair of craniofacial trauma was carried out in 12 of the craniofacial trauma victims due to massive disruption of facial bones and csf rhinorrhea. the earlier studies have also concluded that such intervention can be undertaken with an acceptable rate of morbidity and mortality, a decreased need for re - operation and improved cosmetic and functional outcome. the further considerations in our cases include decreased icu stay, cost - effectiveness and lesser anesthetic exposure as well. but the big question in these circumstances pertains to obtaining the valid consent for such an emergency operative intervention. this problem was faced by us in more than 12% of the patients with craniofacial trauma who had a severe degree of intracranial bleed and disruption of facial bones that necessitated an emergency operative intervention. the consent for surgery was obtained from the appropriate hospital authorities to proceed for surgery as that was the only possible life - saving measure. otherwise a delay in the appropriate therapy could have put their life into a situation of no hope. there is huge debate about such interventions and on the basis of medico - legal aspects the answer to such problems is plain one and that is not to undertake any surgical intervention in such circumstances. but if we keep an ethical view in consideration, such operative intervention should be undertaken to prevent the precious lives. certain protocols and amendments are also required in the constitution to deal with such delicate matters. in certain other cases when the patient gets identified but the relatives express their inability to bear any expenses of surgery and intensive care, it causes a huge dilemmatic situation for the attending doctors because these types of injuries takes a little time but definitely these interventions are life saving. referring them to another tertiary government institute again seems to be unethical as not only it will be a time - consuming transportation and wasting precious life - saving moments but will also not ensure whether they will get any timely and appropriate treatment there. the novel solution to this problem at least in our hospital included a clause for free treatment, which is provided to 2530% of such poor patients who are fighting for their life in emergency wards and icus. the provision of such a treatment methodology is not enough and the root cause of this menace has to be treated both at regional and national levels. education of the public about all the risk factors of accidents and their hazards has to be properly disseminated. at a local level our institute has been continuously coming up with various educational and awareness camps related to the timely management of all the medical and surgical emergencies and cover more than 120 villages with a total population of more than 4.5 - 5 lakh. continuing the efforts on similar lines, the institute is providing training to various volunteers from all these villages and teaching them how to effectively deal with such emergencies especially related to pre - hospital care and their transportation. institute has deployed ambulances at various critical points along with helpline numbers to deal with such emergencies. though the incidence of spinal injury is approximately 10% in such trauma cases but surprisingly we observed cervical spine injury in only 7 patients and fortunately there were no significant neurological deficits in these patients. the lower incidence can also be possibly explained on the basis of lower number of total cases in our study, which may have influenced the statistics. as per the american college of surgeons advanced trauma life support (atls) eastern association for the surgery of trauma guidelines, a missed or delayed diagnosis of cervical spine injury may be associated with permanent neurological damage. though the gcs, no consumption of intoxicants and drugs, no significant distracting injuries and no signs or symptoms related to cervical spine injury are the essential parameters to exclude the diagnosis, it was however not possible in 36.50% of patients as they were under the influence of alcohol and gcs could not be measured with preciseness. craniofacial trauma should be managed on priority basis with an emphasis on initial resuscitation measures, which included securing the airway, hemodynamic stabilization and evaluation and treatment of injuries to other vital organs. the decision of early and delayed surgical intervention can be well taken by a thorough discussion of the case between the various specialists of the trauma team. maxillofacial trauma with head injuries demands special attention as airway compromise is invariably present and it is difficult to assess the neurological status always due to inebriated state and severity of head injury. the management of craniofacial trauma requires special efforts from the well - trained trauma team and the early referral of such injuries to a well - equipped health center do decrease the incidence of mortality and morbidity. the role of pre - hospital care and pre - hospital trauma life support guidelines is as important as advanced trauma life support measures. preventive measures and legislations regarding traffic rules require a review also as higher incidence of accidents among young adults has acquired gigantic epidemiologic picture. certain amendments in the constitution as well as strict compliance of road traffic rules are essential to decrease the incidence of such injuries. | background and objectives : maxillofacial trauma is commonly associated with other injuries, predominantly head injuries. the predictors of outcome in such concomitant injuries have been studied the least. the present study aims at the evaluation of types of injury, management and outcome of patients sustaining maxillofacial trauma and concomitant cranial injuries.materials and methods : a retrospective study was carried out in the department of anesthesiology and intensive care. a case series of 129 patients was evaluated who were admitted in icu (intensive care unit) with maxillofacial trauma and head injuries. the data was then compiled systematically and analyzed using spss windows and value of p 90%) and male gender predominance with male to female ratio of 5 : 1. fracture maxilla and nasal bones were the most commonly encountered injuries (51.93%) followed by mandibular fractures (39.53%) and fracture of zygomatic bones (28.68%). eighty five patients (65.90%) required mechanical ventilation, tracheostomy was needed in 29 (22.48%) patients and 81 (62.8%) patients were operated for head injuries as well. majority of the victims were aged between 15 and 40 years.conclusions:maxillofacial trauma and cranial injuries are common among young males and so is the nature of injuries, that is, rsa. besides facial injuries, head injuries are important determinant of outcome in such patients. timely resuscitation and surgical interventions at specialized centers are of prime importance as far as a better prognosis is concerned in such injuries. |
we developed and followed a standardized protocol to do this meta - analysis in accordance with the preferred reporting items for systematic reviews and meta - analyses (prisma) guidelines.28 two investigators (x.l. independently conducted literature searches of medline, embase, and the cochrane central register of controlled trials published from january 1965 (index date) to march 2014, using keywords and medical subject headings (table1). all relevant studies and review articles (including meta - analysis) and the reference lists of the identified articles were checked manually. institutional review board approval is not applicable because the current study is a systematic review and meta - analysis, which is not considered research involving human subjects. search strategy for medline articles were included (1) if the study was an rct that assigned at least 1 group of participants to exercise training and 1 group to control and (2) if crf (absolute and relative maximal oxygen uptake) or circulating cvd biomarkers of lipid and lipoprotein metabolism, glucose intolerance and insulin resistance, systemic inflammation, or hemostasis were measured at baseline and at the end of the trial. all abstracts about rcts reporting the effect of exercise training on cvd - related biomarkers or crf we excluded studies (1) if the study design was not a rct ; (2) if the exercise intervention was acute (1 week), because we are interested in the effects of exercise interventions of moderate to long duration ; (3) if interventions were based on education or counseling rather than a structured exercise training assignment ; (4) if maximal oxygen consumption, or vo2max, was indirectly calculated through heart rate or fixed time testing and no other biomarkers of interest to this study were reported ; (5) if levels of circulating biomarkers were not directly measured ; (6) if values of outcome measures at the end of trials were not reported ; (7) if participants had severe chronic diseases (preexisting cvd, liver or kidney diseases, or cancers), any other conditions that could potentially compromise participants capacity to exercise (disability, frailty, declined activities of daily living, or wheelchair dependency), or any mental conditions (depression, anxiety, schizophrenia, bipolar disorder, parkinson s disease, or alzheimer s disease) ; (8) if participants were identified as trained professionals, athletes, or soldiers ; (9) if participants were infants, children, or adolescents ; or (10) if participants were pregnant, postpartum, nursing, had recent surgery, or were undergoing rehabilitation exercise. if multiple articles were published based on the same trial, data were retrieved as 1 independent trial. if there were duplicate results from the same trial, the most updated and comprehensive ones were extracted. in total the following information was extracted from all eligible studies : general information (first author s name, article title, and country of origin), study characteristics (study design, eligibility criteria, randomization, blinding, cointervention, dropout rate, and reason for dropping out), participant characteristics (age, sex, ethnicity, body mass index, life style, health status, and number of participants in each group), intervention and setting (exercise type, duration, intensity, and supervision), and outcome measures (definition of outcomes, statistical techniques, pre- and postintervention means, standard deviation, sample size of each arm, and adverse events). maximal oxygen uptake vo2max was measured directly and determined based on the highest vo2 obtained prior to volitional fatigue. in this meta - analysis, we focused on biomarkers in blood samples, including plasma, serum, and whole blood. all samples for fasting glucose and insulin measurement in the studies were collected after > 10 hours of fasting.) using the cochrane collaboration s tool for assessing risk of bias.29 this included random sequence generation, allocation concealment, blinding of participants and personnel, blinding of outcome assessment, incomplete outcome data, selective reporting, and other sources of bias. for each trial, the risk of bias was reported as low risk, unclear risk, or high risk. the criteria for classifying exercise interventions as moderate exercise or vigorous exercise are summarized in table2. if the intensity measures were not reported in individual studies, maximum heart rate, maximum heart rate percentage, speed of running, metabolic equivalent, oxygen uptake, or relative metabolic rate were used to classify exercise intensity. to maintain independence, the most vigorous intervention and the control group in each trial were included in the primary analysis if multiple training groups of different intensities were compared with a single control group. sensitivity analyses were performed by conducting separate analyses of all eligible comparisons for moderate and vigorous exercise interventions, respectively. criteria used for exercise intensity classification mean levels and standard deviations of crf and cvd biomarkers after the exercise interventions from individual trials were used to calculate weighted mean differences (wmds) and 95% cis using dersimonian and laird random - effects models.30 between - study heterogeneity was examined using q statistics and i statistics.31,32 i 25%, 50%, and 75% is suggestive, respectively, of low, medium, and high heterogeneity. egger s tests were used to formally test publication bias.33 if there was any evidence of publication bias, the trim and fill method was used to evaluate the impact of publication bias.34 all eligible trials were analyzed in subgroup analyses conducted within the strata of the predetermined potential modifiers, including age (mean or median 10 hours of fasting. methodological quality was assessed by 2 investigators (x.l., x.z.) using the cochrane collaboration s tool for assessing risk of bias.29 this included random sequence generation, allocation concealment, blinding of participants and personnel, blinding of outcome assessment, incomplete outcome data, selective reporting, and other sources of bias. for each trial, the risk of bias was reported as low risk, unclear risk, or high risk. the criteria for classifying exercise interventions as moderate exercise or vigorous exercise are summarized in table2. if the intensity measures were not reported in individual studies, maximum heart rate, maximum heart rate percentage, speed of running, metabolic equivalent, oxygen uptake, or relative metabolic rate were used to classify exercise intensity. to maintain independence, the most vigorous intervention and the control group in each trial were included in the primary analysis if multiple training groups of different intensities were compared with a single control group. sensitivity analyses were performed by conducting separate analyses of all eligible comparisons for moderate and vigorous exercise interventions, respectively. criteria used for exercise intensity classification mean levels and standard deviations of crf and cvd biomarkers after the exercise interventions from individual trials were used to calculate weighted mean differences (wmds) and 95% cis using dersimonian and laird random - effects models.30 between - study heterogeneity was examined using q statistics and i statistics.31,32 i 25%, 50%, and 75% is suggestive, respectively, of low, medium, and high heterogeneity. egger s tests were used to formally test publication bias.33 if there was any evidence of publication bias, the trim and fill method was used to evaluate the impact of publication bias.34 all eligible trials were analyzed in subgroup analyses conducted within the strata of the predetermined potential modifiers, including age (mean or median 20 studies included, and cutoff points used for categorizing modifiers were arbitrarily selected. third, due to the heterogeneity of exercise training programs and the limited number of rcts that provided separate data, this meta - analysis can neither perform a dose - response analysis nor distinguish exercise types. we maximized the utility of data regarding exercise duration and intensity available from original rcts and found that exercise effects were not significantly different across subgroups defined by duration and intensity. our findings are consistent with previous evidence showing that both moderate and vigorous exercise training has similarly favorable effects on cardiometabolic health.213 the duration threshold at which exercise exerts its effects needs further investigation. fourth, to maintain independence, we selected 1 comparison from each trial with exercise groups of different intensities compared with 1 single control group. the results may potentially be subject to bias by excluding several eligible intervention groups with moderate intensity ; however, we found that the direction and magnitude of the effects on most of the outcome measures were quite similar between moderate and vigorous interventions (table8). finally, like any meta - analysis, our results may be prone to publication bias and inherent weaknesses of individual studies. in conclusion, this large meta - analysis of rcts clearly shows that exercise training significantly improved crf and some traditional and novel cvd biomarkers in adults without cvd, indicating the causal role of exercise in the primary prevention of cvd morbidity and mortality. indiana university school of medicine strategic research initiative grant (zhang and song), r01dk09406 (roberts) and p50hl105188 (roberts) from the national institutes of health (nih), and brown university. the nih, brown university, or indiana university had no role in the design and conduct of the study ; the collection, management, analysis, and interpretation of the data ; or the preparation, review, or approval of the manuscript. | backgroundguidelines recommend exercise for cardiovascular health, although evidence from trials linking exercise to cardiovascular health through intermediate biomarkers remains inconsistent. we performed a meta - analysis of randomized controlled trials to quantify the impact of exercise on cardiorespiratory fitness and a variety of conventional and novel cardiometabolic biomarkers in adults without cardiovascular disease.methods and resultstwo researchers selected 160 randomized controlled trials (7487 participants) based on literature searches of medline, embase, and cochrane central (january 1965 to march 2014). data were extracted using a standardized protocol. a random - effects meta - analysis and systematic review was conducted to evaluate the effects of exercise interventions on cardiorespiratory fitness and circulating biomarkers. exercise significantly raised absolute and relative cardiorespiratory fitness. lipid profiles were improved in exercise groups, with lower levels of triglycerides and higher levels of high - density lipoprotein cholesterol and apolipoprotein a1. lower levels of fasting insulin, homeostatic model assessment insulin resistance, and glycosylated hemoglobin a1c were found in exercise groups. compared with controls, exercise groups had higher levels of interleukin-18 and lower levels of leptin, fibrinogen, and angiotensin ii. in addition, we found that the exercise effects were modified by age, sex, and health status such that people aged < 50 years, men, and people with type 2 diabetes, hypertension, dyslipidemia, or metabolic syndrome appeared to benefit more.conclusionsthis meta - analysis showed that exercise significantly improved cardiorespiratory fitness and some cardiometabolic biomarkers. the effects of exercise were modified by age, sex, and health status. findings from this study have significant implications for future design of targeted lifestyle interventions. |
exercise physiology and the salutatory effects on weight loss, fat reduction, and insulin sensitivity have been described in great detail. these beneficial effects are now considered to reflect, at least in part, the effect of exercise on the activation of amp - activated protein kinase (ampk). in obese non - diabetics, exercise has been shown to reduce the risk of developing type 2 diabetes by up to 46%. physical training, consisting of 20 min cycling or running, 20 min swimming at submaximal heart rate, followed by 20 min of warm up / cool down three times per week for 4 wk, resulted in a significant reduction in body weight and percentage body fat, and this was associated with improved whole - body glucose uptake, decreased fasting insulin concentrations, and increased circulating adiponectin and mrna expression in muscle. among patients with type 2 diabetes mellitus, increasing exercise led to a reduction in fasting plasma glucose. the 24-hour energy expenditure, whether measured in a respiratory chamber or by using doubly labelled water, increases linearly with increasing body weight. multivariate analysis shows that fat - free mass is the major determinant of energy expenditure, with minor influences of fat mass, age, and gender. nevertheless, the considerable interindividual variation is currently unexplained. there is at the present time little evidence for major adaptations of energy expenditure during overfeeding, and changes in body weight and body composition appear to be the major factors that, by increasing energy expenditure, allow energy balance to be restored. the body - weight gain may therefore be seen as an adaptative change to overfeeding [6, 7 ]. total energy expenditure can be subdivided into three main components : basal metabolic rate (bmr) ; the thermic effect of food, or diet - induced thermogenesis ; energy expended in physical activity (pha). the first two components can be measured opportunely with reasonable accuracy and have been fully studied in lean and obese subjects. there is actually no clear evidence that a low bmr is a factor in the development of obesity, even if the issue continues to be debated [8, 9 ]. the thermic effect of food, and more specifically the thermic effect of carbohydrate, has been shown to decrease in obese subjects [10, 11 ]. this decrease may, nevertheless, be secondary to obesity - related insulin resistance and is of too small magnitude to account for a major weight gain. nonexercise activity thermogenesis (neat)the energy expended for everything we do that is not sleeping, eating, or sports - like exercise and pha, that is crucial for weight control, may be important in the physiology of weight change. we review the current concepts about energy expenditure and evaluate the pha in the context of this knowledge and the available literature. during pha, mechanical work associated with muscle contractions clearly requires energy. as a result of the associated loss of energy as heat during atp synthesis in the mitochondria and atp hydrolysis during muscular contraction, pha may thus have a major impact on the total 24-hour energy expenditure and energy balance. based on the possible means by which alterations in pha can impact on 24-hour energy expenditure and energy balance, the following hypotheses can be formulated. this response would induce to a lower energy expenditure for any given work load and would probably contribute to the realization of a positive energy balance in affected subjects. it was further shown to be similar in both lean and post - obese women. there is then little reason to suppose that this factor might be involved in body - weight gain., nevertheless, showed that a common polymorphism of uncoupling protein 2, a protein with close homology to the uncoupling protein of brown adipose tissue ubiquitously expressed in man, was associated with a lower energetic efficiency of muscle contractions. therefore, brown adipose tissue, where uncoupling protein 1 (ucp1) activity uncouples mitochondrial respiration, is an important site of facultative energy expenditure. ucp1 single nucleotide polymorphisms (snps) could represent thrifty factors that promote energy storage in prone subjects. these observations and the relationship between this polymorphism and body weight remain to be further evaluated. bmr is higher in trained subjects than in sedentary subjects of the same weight, but the difference can be principally ascribed to changes in body composition, with a lower fat mass and a higher fat - free mass, metabolically active body mass in trained athletes. when exercise training is associated with a substantial negative energy balance, bmr may better still decrease. the increase in energy expenditure induced by a -adrenergic stimulation, derived by mental stress, was also found to be unchanged in obese subjects after a 6-week period of physical training. third, the total energy expended in pha, that is, the period of time devoted daily to pha, may play an important role in determining energy balance. nevertheless, this component of daily energy expenditure is actually very difficult to assess accurately. the doubly labelled water method permits evaluation of total energy expenditure under conditions of everyday life over several days and, therefore, is likely to include habitual pha. the difference between the total energy expenditure and the basal energy expenditure, the suprabasal energy expenditure (see), comprises both the thermic effect of food and pha. this finding strongly suggests that the amount of energy expended in pha is low in obese subjects. whether a low pha exists before obesity, or is merely a consequence of it, remains an open question at the present time. the conclusion from the substantial literature on this topic is that during an acute bout of exercise in untrained fed subjects, carbohydrate oxidation replaces the major portion of the extra energy expended. in endurance - trained subjects consequently, there is an increased ability to oxidize lipids, due to the upregulation of the enzyme amp - activated protein kinase in skeletal muscle. the outcomes are increased maximal o2 consumption and a higher proportion of fat oxidized during the exercise of low - to - moderate intensity. at high intensity, there is evidence that endurance - trained athletes consume a diet containing a high proportion of carbohydrate. due to the hierarchy in substrate oxidation mentioned earlier, these dietary habits perhaps impact on substrate oxidation in everyday conditions. it can be expected, therefore, that athletes who conserve a stable body composition while consuming such a diet will have a high 24-hour oxidation of carbohydrates. in healthy lean untrained subjects studied in a respiratory chamber, moderate pha increased total energy expenditure, essentially by increasing carbohydrate oxidation when the exercise took place after a meal. nevertheless, the same exercise performed in the fasting state, before breakfast, led to a marked increase in lipid oxidation. in fact, since the subjects were fed the same isoenergetic diet under both conditions, exercising before breakfast versus after breakfast led to a negative lipid balance and to a positive carbohydrate balance. it might, therefore, be hypothesized that exercise in the fasting state may preferably promote lipid utilization and favourably affect body composition by decreasing fat stores. this hypothetical scheme appears unlikely, nevertheless, if the diet consumed is not changed, since the positive carbohydrate balance will probably increase carbohydrate oxidation. is there an effect of food intake on pha ? it has been recognized for several decades that severe underfeeding leads to behavioural adaptations that result in a decreased spontaneous pha. more recently, there have been reports suggesting that overfeeding increases energy expenditure more than would be predicted on the basis of body weight and lean body mass changes [26, 27 ]. furthermore, this increase in energy expenditure showed marked interindividual variations and was inversely correlated with body - weight gain. in fact, since changes in bmr and in the thermic effect of food were mainly accounted for by alterations in body composition and dietary intakes, this increase in suprabasal energy expenditure was attributed to a stimulation of spontaneous pha. such pha was unrelated to exercise and hence was termed nonexercise activity thermogenesis (neat). neat is the energy expended for everything we do that is not sleeping, eating, or sports - like exercise. it includes the energy expended walking to work, typing, performing yard work, undertaking agricultural tasks, and fidgeting. the first approach is to measure or estimate total neat. here, total daily energy expenditure is measured and from it, the bmr plus thermic effect of food is subtracted. the second approach is the factorial approach whereby the components of neat are quantified and total neat calculated by summing these components. the amount of neat that humans perform represents the product of the amount and types of physical activities and the thermogenic cost of each activity [28, 29 ]. the factors that impact a human 's neat are readily divisible in biological factors such as weight, gender, body composition, and environmental factors such occupation. the variability in neat might be viewed as random and unprogrammed but human data contradict this thesis. it appears that changes in neat accompany experimentally induced changes in energy balance and may be important in the physiology of weight change. it then becomes intriguing to dissect mechanistic studies that delineate how neat is regulated by neural, peripheral, and humoral factors. neat may be a carefully regulated tank of physical activity that is crucial for weight control. there is no much understanding of the mechanisms that may probably be responsible for the stimulation of neat during overfeeding at the present time. calorimetric studies show that 24-hour energy expenditure increases in healthy subjects after short - term carbohydrate, but not fat, overfeeding [30, 31 ]. this effect was not correlated to the increase in plasma leptin concentrations observed after carbohydrate overfeeding. several animal studies show that the stimulation of the melanocortin-4 receptor (mc4r) is associated with an increase in spontaneous pha [32, 33 ]. showed that new mc4r mutations in a large number of severely obese adults living in southern italy. these mutations, not present in normal - weight individuals, are further evidence that defects in the melanocortin pathway are related to severe obesity. how the intake of specific macronutrients impact on this pathway and the mechanisms involved remains to be clarified. the hypothesis that physical activity exerts beneficial effects on body - weight status by mechanisms not associated to an increase in energy expenditure should be considered. nevertheless, data on energy expenditure and body composition do allow some conclusions to be drawn. if an endurance - trained athlete consistently expends a substantial amount of energy in pha and at the same time maintains a constant weight and body composition, energy intake must have been increased appropriately, most probably spontaneously. the mechanisms responsible for this increase in energy intake have not been completely studied. as a result of the complex network in the central nervous system that regulates energy expenditure and the known effects of pha on neuroendocrine regulations, it is very likely that the relationship between energy expended in pha and food intake are is complex. nevertheless, endurance - trained athletes are characterized by a low fat mass, which may be the result of previous periods of negative energy and fat balances. they have low plasma leptin levels too, which are mainly ascribable to the low fat mass, since comparable leptin levels are observed in very lean sedentary subjects. several studies have searched for a direct inhibition of leptin release by acute or chronic exercise. except for a decrease in plasma leptin levels following particularly intense exercises such as an ultra - marathon, these researches have failed to identify a long - lasting reduction in leptin levels after exercise [3640 ]. it may specify that a substantial decrease in fat - free mass induced by exercise is required to decrease leptin secretion before low plasma leptin in turn increases food intake. intriguingly, this absence of effects of exercise contrasts with the effect of severe energy restriction, which quickly decreases plasma leptin levels before any marked changes in body composition occur. it may specify that exercise is more efficient than severe energy restriction in the promotion of weight loss without excessive rebound hyperphagia. the effects of pha on energy metabolism and body - weight control remain incompletely understood. there is ample evidence that physical training is associated with low body weight and low fat mass. this relationship unequivocally suggests that negative energy and fat balances are correlated with physical training. the negative energy balance is perhaps to be at once secondary to the quantity of energy expended while exercising, so there is no evidence that exercise influences other components of energy expenditure. the negative fat balance is probably secondary to this negative energy balance. in obese individuals the amount of energy expended in pha appears to be small, which certainly represents a factor that could prevent weight loss. it appears useful to focus on obese patients also in general practice in order to recognize sedentary life styles and encourage pha through individualized programs. some studies [43, 44 ] show a mild and nonsignificant reduction of bmr in patients treated with an integrated dietetic plus physical exercise program and a significant reduction of bmr in surgically treated patients. it will be necessary to have a larger number of patients to confirm these findings. our knowledge of the pathological consequences of the lack of adequate exercise on adipose tissue, skeletal muscle, and the liver is improving, and this will help establish more specific guidelines for the proper exercise regimens that will improve underlying metabolic pathways. neat and physical activity, that is crucial for weight control, may be important in the physiology of weight change. two issues that remain to be resolved are whether pre - obese individuals have a low pha level that contributes to weight gain and, if so, what are the biological determinants of this low pha. | we review the current concepts about energy expenditure and evaluate the physical activity (pha) in the context of this knowledge and the available literature. regular pha is correlated with low body weight and low body fat mass. the negative fat balance is probably secondary to this negative energy balance. nonexercise activity thermogenesis (neat) and physical activity, that is crucial for weight control, may be important in the physiology of weight change. an intriguing doubt that remains unresolved is whether changes in nutrient intake or body composition secondarily affect the spontaneous physical activity. |
bovine (bam) and rat (ram) alveolar macrophages were incubated in vitro with dq12 quartz or uicc chrysotile asbestos either alone or in the presence of dipalmitoyl lecithin (dpl). the reaction of the cells of both species to the untreated dust particles was similar qualitatively and quantitatively, with a loss of viability and release of lactate dehydrogenase and n - acetyl - beta - glucosaminidase after 20 hr of incubation. in the presence of dpl, the toxicity of quartz to bam disappeared completely, whereas the protective influence of the phospholipid was distinctly diminished in the case of ram. the presence of lavage fluid was less effective than that of pure dpl. there was no protective influence of dpl with asbestos either for bam or for ram. the effects of phagocytizable, suspended quartz particles were compared with the effects of the same type of particles fixed on a glass surface to exclude the possibility of phagocytosis. the effect of the suspended particles on the viability and release of enzymes was more pronounced than that of the fixed particles. on the other hand, superoxide anion production was stimulated to a much higher degree by the fixed quartz particles. this could be explained by the continuing contact of the outer cell membrane with the silica surfaces, whereas free particles were rapidly phagocytized. the release of lysosomal enzymes induced by fixed quartz particles was a secondary phenomenon following cell death.imagesfigure 4. afigure 4. bfigure 4. cfigure 4. d |
|
antigen - activated cd4 t cells differentiate into either th1 or th2 cells, producing proinflammatory or proallergic cytokines, respectively. the best understood mode of regulating th cell differentiation is the cytokine environment during primary t cell activation, with il-12 associated with th1 development and il-4 with th2 development. however, it is still uncertain how these cytokines mediate their effect on differentiation 1. coffman and reiner 1 recently articulated three competing models, each compatible with the observed effects of cytokines on differentiation. in the instructive model, cytokine signaling precedes progenitor commitment ; that is, cytokines direct each progenitor towards a defined fate through a program of molecular cues. in the selective model, progenitor commitment is independent of cytokines ; that is, progenitor cells stochastically commit to various fates, and cytokines subsequently act by favoring the selective outgrowth of a particular lineage. in a hybrid instructive - selective model, the ratio of progenitors initially committing to each fate may be altered by cytokines, but cytokine - driven selective outgrowth of committed cells is retained as a required mechanism of polarization. an instructive model seemed compatible with known molecular processes in t cells, such as cytokine regulation of transcription factor expression and cytokine - dependent chromatin alterations in the il-4 locus 23. further, the specific requirement of the transcription factors signal transducer and activator of transcription (stat)4 45 and stat6 67 in th1 and th2 development, respectively, was generally interpreted to indicate an instructive role for cytokines in th differentiation. however, the analysis of stat4- and stat6-deficient t cells was done on bulk populations and not performed specifically to distinguish instructive or selective models of development. stat4 and stat6 activation could either initiate an instructive program or alternately might simply mediate signals for selective outgrowth of committed th1 or th2 cells. moreover, certain findings, such as monoallelic cytokine expression 8910, a role of cell cycle in cytokine regulation 111213, and stat6-independent th2 development 141516 have provided an impetus to reconsider the issue of instructive versus selective differentiation. the difficulty in distinguishing between these models by previous studies arises from their inability to directly track fates and measure relative outgrowth of individual progenitors. initial bulk population analysis suggested that th2 development was absolutely il-4 dependent, consistent with either model 67. th2 development has recently been reported to occur in stat6-deficient animals 1516 and to be dependent on gata-3 expression independently of il-4 and stat6 17. gata-3 expression, although augmented by il-4 through stat6, can also be achieved independently of il-4, involving a stat6-independent pathway of autoactivation. this feature of gata-3 expression allows progenitors to acquire a stable, cytokine - independent phenotype in which gata-3 directs the elaboration of downstream hallmarks of th2 development that occur in response to il-4. importantly, ectopic gata-3 expression in stat6-deficient t cells induces all developmental components of the th2 phenotype such as c - maf expression, chromatin remodeling of the il-4 locus, and th2 cytokine gene expression 17. further, th2 commitment need not be absolutely il-4 dependent, as other factors, such as tcr / cd28 signaling 18 and il-12 1719 can regulate gata-3 expression. thus, any signal that can regulate gata-3 expression would also be expected to regulate th2 development. in this study, we have used two recently described technologies, cellular affinity matrix sorting and retroviral tagging, to determine whether gata-3 functions to promote outgrowth of cells that have stochastically committed to il-4 production (selection), or whether gata-3 mediates programmatic alterations in gene expression without affecting outgrowth of uncommitted progenitors (instruction). to accommodate the known effects of gata-3 expression in stat6-deficient t cells, the selective model must adopt gata-3, rather than stat6, as a mediator of selective outgrowth of th2 cells. however, in a direct test of this hypothesis, we found no evidence that gata-3 influences selective outgrowth when expressed in stat6-deficient t cells developing under any conditions. rather, gata-3 expression increased the proportion of il-4committed progenitors, even when developing in the presence of il-12, a condition predicted by the selective model to inhibit the outgrowth of cells committed to the th2 phenotype. these data exclude purely selective models of th2 development and provide strong evidence that gata-3 instructs th2 development without inducing selective outgrowth. in vitro cultures of do11.10 tcr transgenic wild - type and do11.10 stat6 cd4 t cells were stimulated with ova protein under neutralizing conditions in the presence of il-4 (11b11, 10 g / ml), il-12 (tosh, 10 g / ml), and ifn- (h22, 10 g / ml). 7 d after primary activation, live cd4/il-4secreting cells were purified as described previously 17 with the following modifications. cell cultures were restimulated with pma / ionomycin for 2.5 h and subsequently labeled with the bifunctional ab conjugate specific for cd45 (30-f11) and il-4 (bvd6 - 24g2) for surface - capture of secreted il-4. the cells were then diluted in medium and allowed to secrete il-4 for 30 min at 37c as described 17. il-4secreting cd4 t cells were identified by staining with a secondary mab il-4pe (11b11-pe ; bd pharmingen) and mcd4tricolor (gk1.5-tc ; caltag). il-4 and il-4 cells were purified by facs sorting as described 2021. do11.10 stat6 cd4 t cells were activated for 36 h with ova under th1 (rmil-12 [10 u / ml ], and il-4) or th2 (il-12, and ifn- and/or rmil-4 [100 u / ml ]) conditions. t cell cultures were then transduced with retroviral culture supernatants derived from the transient transfection of the phoenix - ecotropic retrovirus packaging cell line 19. percentages of retroviral - transduced cells were monitored for the expression of retroviral marker proteins green fluorescence protein (gfp) and hcd4 by facs analysis. stat6 cd4 t cells were activated with ova protein under either th1 or th2 conditions and transduced with retroviral vectors as described in the text. cells were rested in bulk culture to day 7 of activation and cd4gfp cells were purified by facs sorting. purified t cells were cloned by single - cell deposition cloning by facs sorting into 96-well plates containing 5 10 irradiated balb / c splenocytes, ova protein (0.5 mg / ml), and rhil-2 (50 u / ml) in 200 l medium (dmem supplemented with l - glutamine [0.2 mm ], nonessential amino acids [10 m each ], sodium pyruvate [100 m ], -mercaptoethanol [50 m ], and penicillin / streptomycin [100 u / ml each ]). cellular outgrowth was monitored between days 1015 of plating, and individual clones were expanded by restimulation with irradiated balb / c splenocytes, ova protein, and rhil-2 (50 u / ml). genomic dna derived from independent t cell clones were amplified for the detection of both the control gfp - expressing retrovirus (gfprv) and the gata-3-gfp integrated retroviral vectors by a two - step nested pcr technique. these pcr reactions were performed with the following primers : gfprv, first set : 5-cctacatcgtgacctgggaagccttgg, 5-gttccgctgcctgcaaagggtcgc, nest : 5-ggtcaagccctttgtacaccctaagcctcc, 5-cctaggaatgctcgtcaagaagacagggc ; gata-3-gfp, first set : 5-cctacatcgtgacctgggaagccttgg, 5-ggtgaagagatgaggactggagtggcc, nest : 5-ccctttgtacaccctaagcctccgcc, 5-ggagggtaaacggacagaggcccc. as controls, genomic dna from nontransduced and single - transduced t cells from bulk culture populations clones used in the study were infected by one type of retrovirus, positive for either gfprv or gata-3-gfp, but not both. in vitro cultures of do11.10 tcr transgenic wild - type and do11.10 stat6 cd4 t cells were stimulated with ova protein under neutralizing conditions in the presence of il-4 (11b11, 10 g / ml), il-12 (tosh, 10 g / ml), and ifn- (h22, 10 g / ml). 7 d after primary activation, live cd4/il-4secreting cells were purified as described previously 17 with the following modifications. cell cultures were restimulated with pma / ionomycin for 2.5 h and subsequently labeled with the bifunctional ab conjugate specific for cd45 (30-f11) and il-4 (bvd6 - 24g2) for surface - capture of secreted il-4. the cells were then diluted in medium and allowed to secrete il-4 for 30 min at 37c as described 17. il-4secreting cd4 t cells were identified by staining with a secondary mab il-4pe (11b11-pe ; bd pharmingen) and mcd4tricolor (gk1.5-tc ; caltag). il-4 and il-4 cells were purified by facs sorting as described 2021. do11.10 stat6 cd4 t cells were activated for 36 h with ova under th1 (rmil-12 [10 u / ml ], and il-4) or th2 (il-12, and ifn- and/or rmil-4 [100 u / ml ]) conditions. t cell cultures were then transduced with retroviral culture supernatants derived from the transient transfection of the phoenix - ecotropic retrovirus packaging cell line 19. percentages of retroviral - transduced cells were monitored for the expression of retroviral marker proteins green fluorescence protein (gfp) and hcd4 by facs analysis. do11.10 stat6 cd4 t cells were activated with ova protein under either th1 or th2 conditions and transduced with retroviral vectors as described in the text. cells were rested in bulk culture to day 7 of activation and cd4gfp cells were purified by facs sorting. purified t cells were cloned by single - cell deposition cloning by facs sorting into 96-well plates containing 5 10 irradiated balb / c splenocytes, ova protein (0.5 mg / ml), and rhil-2 (50 u / ml) in 200 l medium (dmem supplemented with l - glutamine [0.2 mm ], nonessential amino acids [10 m each ], sodium pyruvate [100 m ], -mercaptoethanol [50 m ], and penicillin / streptomycin [100 u / ml each ]). cellular outgrowth was monitored between days 1015 of plating, and individual clones were expanded by restimulation with irradiated balb / c splenocytes, ova protein, and rhil-2 (50 u / ml). genomic dna derived from independent t cell clones were amplified for the detection of both the control gfp - expressing retrovirus (gfprv) and the gata-3-gfp integrated retroviral vectors by a two - step nested pcr technique. these pcr reactions were performed with the following primers : gfprv, first set : 5-cctacatcgtgacctgggaagccttgg, 5-gttccgctgcctgcaaagggtcgc, nest : 5-ggtcaagccctttgtacaccctaagcctcc, 5-cctaggaatgctcgtcaagaagacagggc ; gata-3-gfp, first set : 5-cctacatcgtgacctgggaagccttgg, 5-ggtgaagagatgaggactggagtggcc, nest : 5-ccctttgtacaccctaagcctccgcc, 5-ggagggtaaacggacagaggcccc. as controls, genomic dna from nontransduced and single - transduced t cells from bulk culture populations were amplified in parallel pcr reactions. clones used in the study were infected by one type of retrovirus, positive for either gfprv or gata-3-gfp, but not both. the observation that both il-4 and ifn-producing t cells can emerge under nonpolarizing conditions has been interpreted to suggest that a random, or stochastic process generates the initial phenotype repertoire, motivating the selective model 1911. indeed, when naive progenitors are activated under conditions in which il-12, il-4, and ifn- are all neutralized, a persistent population of cells was still observed that committed to the production of either il-4 or ifn- (fig. 1 c). by the selective model, the increase in populations developing in fully polarizing conditions (fig. b) arise from the selective outgrowth of cells that stochastically commit even in the absence of these conditions (i.e., from the populations in fig moreover, this interpretation is consistent with persistence of a small il-4producing population even in stat6-deficient mice (fig. f), which are proposed to represent committed progenitors whose phenotypes are fixed and awaiting selective outgrowth via the effects of polarizing cytokines. however, the instructive and selective models differ in their predictions of how committed cells should respond to subsequent il-4 exposure. in the selective model, commitment is permanent, with subsequent cytokine exposure altering cell growth, but not differentiation. in the instructive model, commitment results from cytokine - derived signals, which could be delivered even after initial activation. these predictions can be distinguished by testing responses of committed progenitors to the polarizing effects of il-4. to test this experimentally, cells initially committed to an il-4producing phenotype or il-4nonproducing phenotype would need to be separated and analyzed independently for differentiation when exposed to il-4 (fig. to separate il-4producing from il-4nonproducing committed cells, we used the novel cellular affinity matrix technology for purifying live cells based on their il-4 secretion 17. wild - type and stat6-deficient (stat6) do11.10 naive t cells were activated in the presence of anti 2 b, a), and cd4 t cells were sorted into il-4nonsecreting cells (fig. each population was then divided and restimulated either in the presence of il-4 or anti il-4 mab (11b11) for 7 d. upon restimulation, il-4 and ifn- production by individual cells was measured by intracellular staining (fig.. 2 b, c) retained this property at a frequency compatible with differentiated th2 cells (fig. the frequency of il-4positive cells in both wild - type and stat6-deficient populations was only slightly increased by exposure to il-4 in secondary culture (fig. cells that initially had not produced il-4 and were not exposed to il-4 in secondary culture remained negative for il-4 production later (fig. however, wild - type cells that were initially il-4 negative (fig. 2 b, b), and were exposed to il-4 in secondary culture showed a significantly increased frequency of il-4producing cells (compare fig. 2 b, e to d), consistent with redirection to an il-4producing fate. 2 b, compare m to l), suggesting that the effect required an intact il-4 signaling pathway. thus, this effect can not be explained as a continued stochastic generation of il-4producing cells, as the selective model would predict this to also occur in stat6-deficient cells as well as in wild - type cells exposed to anti in addition, we observed only a minor population of cells committed to producing ifn- in wild - type cells sorted for being il-4 negative (fig. the percentage of this population in wild - type and stat6-deficient cells was not influenced by either the presence or absence of il-4 (fig. thus, in these experiments, the expansion of ifn-producing th1 cells was not seen, eliminating its potential influence on inhibiting th2 development in stat6-deficient t cells. in summary, il-4 exposure appears to direct th2 commitment even after the initial period predicted by the selective model to generate the stochastic fixed repertoire. due to the kinetics of gene activation, the frequency of il-4 staining in activated th2 cells is not 100%, but 3050%, consistent with previous reports 20212223. thus, it is still possible to interpret the above results as consistent with the selective model by explaining the apparent redirection of cells in fig. 2 as the il-4dependent outgrowth of th2-committed cells that simply happened to not produce il-4 at the time of sorting. thus, to rigorously distinguish these aspects of selection from instruction, it is therefore necessary to track progenitor fates and frequencies as they expand in culture. to do this, we developed a retroviral - based tagging system in which either a gfp retrovirus or a gata-3expressing retrovirus is used to mark cells by infection during the initial activation (fig. instructive and selective models differ in how they predict progenitors will respond to tagging by the gata-3expressing retroviruses. to account for the known effects of gata-3, the selective model predicts that cells committing to either il-4positive or il-4negative fates should each expand in response to gata-3, but should not alter their respective fates (fig., the instructive model predicts that, independent of initial commitment, progenitors tagged by gata-3 may undergo redirection of fate toward il-4 production. the control retrovirus expressing only the gfp tag is not predicted to alter fates in either model. in essence, the selective model predicts outgrowth of both gata-3expressing th1 and th2 clones, whereas the instructive model predicts that gata-3 infected clones will be strongly skewed to a th2 fate, with marked reduction in the numbers of gata-3infected th1 clones. to eliminate any bias, we blinded this tagging experiment to the identity of the retrovirus by infecting progenitors with a mixture of control and gata-3 retroviruses, both expressing gfp as the retroviral marker. the identity of the retrovirus infecting each clone was revealed by pcr only at the end of the experiment. stat6-deficient progenitors were infected with gfp and gata-3 retroviruses and activated in either th1 or th2 conditions. on day 7, single retrovirally infected cd4 cells were directly cloned into nonselecting conditions (i.e., in the absence of il-12, il-4, or ifn-). clones were expanded and characterized for il-4 and ifn- expression by elisa to assign phenotype (fig. 3 b), and only then was the identity of the infecting retrovirus determined. the majority of clones exhibit cytokine production that is near to one of the cytokine axes, consistent with polarization observed in bulk populations. the phenotype of each clone was assigned based on its cytokine production being above or below the diagonal, after which the retrovirus identity was determined (fig. 3 b, c f). stat6-deficient cells that were infected with control gfp retrovirus were strongly skewed to the th1 phenotype, regardless of initial activation conditions (fig. the low number of il-4producing clones is compatible with the observed frequency of il-4positive cells in bulk populations (fig. however, stat6-deficient clones infected with the gata-3 retrovirus were markedly skewed to the th2 fate, even in those clones whose progenitors were activated under th1-inducing conditions (fig. further, there was no apparent difference in the numbers of clones obtained under various conditions, arguing against any gross differences in selective outgrowth. thus, the results of this retroviral tagging experiment are inconsistent with predictions of the selective model described above. to try to accommodate for this last experiment, the selective model could be slightly revised to propose that the growth - promoting effects of gata-3 can only be exerted in cells that are also committed to il-4 production, and not in other cells. in this revised selective model, the decreased number of gata-3infected th1 clones would be due to the inability of gata-3 to promote outgrowth of non il-4producing cells, rather than from the conversion of their phenotype from th1 to th2 fate. although it may be conceivable to construct a selective mechanism to restrict the effects of gata-3 in this way, importantly this possibility can be tested using a dual - marker retroviral system to simultaneously track both fate and expansion of committed cells over time. we carried out this approach using unique markers to distinguish two retroviruses, with the control retrovirus expressing hcd4, and gata-3 retrovirus expressing gfp. in these experiments (fig. 4), stat6-deficient progenitors were infected with a mixture of control retrovirus and gata-3 retrovirus in the same cultures, and activated under either th1 or th2 conditions. cells were expanded together in bulk culture, and il-4 production by individual cells was analyzed on day 7 and on day 14 after secondary stimulation, allowing direct measurement of the frequency and phenotype of cells over time. on day 7 and day 14, cells were activated with pma / ionomycin for 4 h and stained for intracellular production of il-4. b), and the percentage of il-4positive cells in each gate was measured by intracellular il-4 staining (fig. 4 c). last, the proportion of each retrovirally infected population is expressed as a percentage of the whole population (fig. 4 d). infection by the control virus had no effect on il-4 production by cells over time, either in the th1- or th2-activated conditions (fig. 4 c), as expected. in contrast, infection by the gata-3 retrovirus (gfp - positive cells) markedly increased the percentage of il-4positive cells between day 7 and day 14. this effect occurred in both th1 and th2 conditions, and these data were highly reproducible in replicate experiments (table). importantly, the percentage of il-4producing cells within the gata-3 population increased even though the total percentage of gata-3infected cells remains constant over time, consistent with a continuing developmental effect. finally, the prediction of the revised selective model is not observed ; that is, we observe a constant ratio of cells infected with control or gata-3 retrovirus over time in both conditions, rather than an increase in the proportion of gata-3expressing cells as predicted by the selective model. first, we observed an apparent redirection of fate caused by exposure of previously non il-4producing cells to an il-4producing phenotype, inconsistent with the selective model. second, we observed that gata-3 strongly skewed the frequency of individual clones that commit to il-4 production but did not exert selective outgrowth of clones already committed to the th1 fate, as would be predicted by the selective model. finally, using dual - tag retroviral infection, we directly measured the fate and expansion of distinctly committed cells, which revealed an increasing frequency of il-4 production in the absence of any apparent increase in size of this committed population. taken together, these results strongly support an instructive interpretation of recent findings regarding the transcriptional regulation of gata-3induced th2 development. the initial production of il-4 by small numbers of stat6-deficient t cells is consistent with either the stochastic expression of gata-3 in a small percentage of t cells or with the regulated expression of gata-3 by additional factors, including the tcr / cd28 signaling pathway, as described recently 18. however, it is possible that il-4 could exert some selective / growth - promoting effects on committed th2 cells that may not completely involve stat6-dependent gata-3 regulation 24. for example, we observed a 10% increase in the proportion of il-4producing cells in both wild - type and stat6-deficient th2 cells after secondary exposure to il-4 (fig. 2 b, f to g and n to o). however, this observation may be consistent with either instructive or selective models ; instructive, if il-4 could augment expression of gata-3 or other transcription factors through stat6-independent pathways, which we have not excluded ; selective, if il-4 could alter cell survival or proliferation through a stat6-independent pathway such as insulin receptor substrate (irs)-1 25. regardless, our results exclude models exclusively requiring selection to explain gata-3induced th2 development, and strongly support the existence of an instructive component in this process. | although interleukin (il)-12 and il-4 polarize naive cd4 + t cells toward t helper cell type 1 (th1) or th2 phenotypes, it is not known whether cytokines instruct the developmental fate in uncommitted progenitors or select for outgrowth of cells that have stochastically committed to a particular fate. to distinguish these instructive and selective models, we used surface affinity matrix technology to isolate committed progenitors based on cytokine secretion phenotype and developed retroviral - based tagging approaches to directly monitor individual progenitor fate decisions at the clonal and population levels. we observe il-4dependent redirection of phenotype in cells that have already committed to a non il-4producing fate, inconsistent with predictions of the selective model. further, retroviral tagging of naive progenitors with the th2-specific transcription factor gata-3 provided direct evidence for instructive differentiation, and no evidence for the selective outgrowth of cells committed to either the th1 or th2 fate. these data would seem to exclude selection as an exclusive mechanism in th1/th2 differentiation, and support an instructive model of cytokine - driven transcriptional programming of cell fate decisions. |
in the united states nearly 40,000 deaths are attributed to metastatic breast cancer (mbc) annually. once breast cancer has metastasized it is usually fatal ; however, intensive research into the causes of breast cancer and the development of an array of effective targeted therapeutics has improved survival for these women. circulating tumor cell (ctc) analysis is a promising tool to address the need for better disease management, potentially improving both survival and quality of life for mbc patients. ctcs represent the hematogenous phase of metastasis. they were initially observed over 150 years ago as a leukemia - like manifestation of cancer with very high concentrations of malignant cells in the peripheral circulation. most instances of metastatic solid tumors are not accompanied by high concentrations of ctcs, so these cells were not a focus of tumor biology research or clinical application until contemporary studies demonstrated the frequent presence of ctcs in patients with solid tumors, albeit at very low concentrations [57 ]. the development of methods to reliably detect ctcs in the peripheral circulation has enabled the study of their behavior and has facilitated their clinical use. of the technologies that have been developed to isolate and enumerate ctcs, immunomagnetic isolation using cell surface epithelial cell adhesion molecule (epcam) antibodies, followed by semiautomated fluorescence microscopy analysis has been most widely used. in 2004 the cellsearch system (veridex, raritan, nj, usa), which is based on this approach, was cleared by the usa food and drug administration as an aid in monitoring patients with mbc [8, 10 ]. the clinical relevance of ctcs was first demonstrated in a landmark study from cristofanilli and colleagues in patients with progressive mbc on palliative therapy. in that study, the authors showed that classification of patients based on a cutoff of 5 ctcs per 7.5 ml of blood using the cellsearch system informed survival prognosis. this result was subsequently confirmed in patients with newly diagnosed mbc starting first - line therapy. the prognostic properties of ctcs were shown to be robust during therapy by hayes and colleagues. budd. reported that comparison of ctc enumeration to traditional radiologic assessment as measures of disease status in mbc showed that ctc assessment was a more reproducible indicator of disease status that could be measured earlier in the course of treatment. similar results have been published demonstrating the relationship of ctc enumeration to survival in prostate, colorectal, and lung cancers and other malignancies (e.g., [1517 ]). the fatal nature of mbc, the role of ctcs in metastasis, their prognostic value, and the deficiencies of imaging and existing biomarkers for monitoring disease progression created a motivating environment to use ctc enumeration to guide clinical decision making in mbc. in 2007 beveridge reported the use of serial ctc measurement using the cellsearch system to guide therapeutic intervention in a community - based oncology practice. in that work, 50 patients with mbc had ctc measurements at baseline and at subsequent monthly intervals during treatment, along with radiographic studies and ca 27.29 biomarker determinations. a treatment algorithm was developed and implemented with a goal of managing therapy to achieve 100 ctc per 7.5 ml) ; this subgroup is characterized by very short survival. conversely, approximately 1/3 of mbc patients do not have detectable ctc in their peripheral circulation, which constitutes a positive prognostic factor relative to patients with 1 ctc at baseline and during treatment. a recently published meta - analysis examined the prognostic value of ctc measurement in both early stage breast cancer and mbc both at baseline and during treatment. the pooled hr from included studies showed that ctcs were associated with significantly increased risks of disease progression and death, confirming the robust prognostic value of ctc enumeration. finally, two currently ongoing clinical trials, swog s0500 from the southwestern oncology group and circeo-1 at the institut curie, have as their objective to assess the impact of ctc guidance of treatment decisions on patient outcomes. in both the swog s0500 trial and the circeo-1 trial the choice of therapy is contingent on measured ctc levels ; the relationship of changes in survival to use of ctc counts will be reported. status for mbc, use of the 5 ctc per 7.5 ml cutoff for categorization of prognosis is supported for patient management. recent results suggest that additional prognostic categories may be useful. for mbc, use of the 5 ctc per 7.5 ml cutoff for categorization of prognosis critical to the application of ctc information to disease monitoring will be an understanding of the influence of disease subtype or type of therapy on ctc behavior. the studies that established the clinical utility of ctc enumeration [1114 ] did not directly assess the effect, if any, of the type of therapy (small molecule, monoclonal antibody, radiation, etc.) on the subsequent prognostic value of ctc measurement. the prognostic value of ctc enumeration has consistently been shown to be independent of hormone or chemotherapy. there have been two reports in which targeted therapy of overexpressed her2 gene product, epidermal growth factor receptor, using either trastuzumab or lapatinib in combination with chemotherapy in mbc appeared to modify the predictive value of ctc counts, possibly due to preferential benefit to the worse prognosis group [24, 35 ]. an additional report described lack of prognostic value of ctc during therapy in patients treated with bevacizumab. however, other studies have examined chemotherapy alone or in combination with monoclonal antibody components [36, 37 ] and have not observed an impact of therapy type on ctc prognosis. some of these same foundational studies also showed that ctcs were shed into the circulation irrespective of hormone receptor or her2 status [11, 12 ]. subsequently, ctcs have been isolated from peripheral blood of patients with hormone receptor positive, her2 overexpressing and triple negative tumors [24, 35, 36, 3840 ]. reports that have examined the relationship between mbc molecular subtype and ctc predictive value for survival have not demonstrated an impact of molecular subtype on prognostic value of ctc counts [24, 35, 36, 40 ], although two possible exceptions merit mention. one study reported that average ctc counts were lower in inflammatory breast cancer (ibc) than in other types of mbc. kaplan - meier survival estimates were not significantly different for ibc patients with 5 ctcs and those with < 5 ctcs. the study was small, so the relationship of ctc levels to ibc prognosis merits additional research to reach a definitive answer. a second study suggested that mbc characterized by exclusively bone metastasis may have elevated ctc counts compared to other forms of mbc. status therapy type does not appear to influence ctc prognostic value, although monoclonal antibody therapies may preferentially benefit patients with a worse prognosis based on ctc levels. all molecular subtypes of mbc appear to shed similar levels of ctcs as detected by the cellsearch system. initial reports indicate that molecular subtype does not affect the prognostic value of ctc enumeration. therapy type does not appear to influence ctc prognostic value, although monoclonal antibody therapies may preferentially benefit patients with a worse prognosis based on ctc levels. all molecular subtypes of mbc appear to shed similar levels of ctcs as detected by the cellsearch system. initial reports indicate that molecular subtype does not affect the prognostic value of ctc enumeration. current practice is to use radiologic imaging and serum tumor markers, in conjunction with clinical assessment, to monitor disease status. the initial report from budd and colleagues described the relationship between radiologic evaluation and ctc assessment. in comparing radiologic progression to ctc levels, the authors concluded that ctc levels were less variable, highly reproducible, and better correlated with prognosis than imaging studies. since that publication, several studies have compared ctcs to traditional radiologic imaging [20, 25 ]. liu. showed a strong correlation between ctc results and radiographic disease progression in mbc. the authors concluded that their data supported the clinical utility of serial ctc enumeration in conjunction with standard radiographic imaging to monitor disease status and treatment efficacy. ctc enumeration has also been compared to imaging with fluorodeoxyglucose positron emission tomography / computed tomography (fdg - pet / ct) [30, 43 ]. serial radiographic imaging and fdg - pet / ct were shown to correlate with ctc levels, with ctc counts having the advantages of higher precision, better responsiveness to disease state changes, and predictive capability. a potential limitation to ctc enumeration is an apparent lack of sensitivity [30, 43 ]. nevertheless, these studies concluded that ctc measurement is valuable because of its speed, high specificity, and low variability and suggested continued use of imaging in patients without detectable ctcs [30, 43 ]. however, as noted previously, the absence of ctcs is in itself a relative positive prognostic factor that should be considered along with imaging results. sequential assessments of serum tumor markers, such as ca 27.29 and ca 15 - 3, are often used in conjunction with imaging and clinical evaluation to monitor therapy response. the comparative performance of ctc enumeration to serum tumor markers has also been reported [18, 23, 31, 36 ]. reported that ca 27.29 was prognostic of survival when evaluated in a univariate analysis, as was ctc count but that in a multivariate model including both factors, only ctc count remained significant as a predictor of survival. in his prospective study, it was reported that ctcs had a high specificity (89%) and moderate sensitivity (70%) to detect radiologic disease progression, while ca 27.29 had a high sensitivity (85%) and a low specificity (31%) in this case series. beveridge also found that changes in ctc, but not ca 27.29, predicted pfs. bidard. evaluated ctc count, ca 15 - 3, carcinoembryonic antigen (cea), lactate dehydrogenase (ldh), cyfra21 - 1, and alkaline phosphatase (alp) as survival predictors and concluded that these measures had globally similar performance. hartkopf and colleagues compared ca 15 - 3 concentrations during therapy to ctc counts and found that they were significantly related to each other as well as to os. although serum tumor markers and ctc counts share some properties, differences between these measures are apparent. serum tumor markers can become elevated in nonmalignant disease states, when patients are experiencing a response to treatment, and may respond slowly to changes in disease status. in contrast, ctcs have high specificity for mbc and respond promptly to changes in disease state [8, 14, 44 ]. comparison of ctc enumeration to imaging [12, 14 ] and serum tumor marker measurement [18, 36 ] shows that ctc level is an independent prognostic factor for survival in mbc. in turn, this suggests that ctc information reflects some aspect of tumor biology not interrogated by the other tools. statusctc counts correlate with imaging assessment and serum tumor marker determination but may have specificity and ease - of - use advantages. ctc counts, imaging, and serum tumor markers may have complimentary roles in monitoring disease status. ctc counts correlate with imaging assessment and serum tumor marker determination but may have specificity and ease - of - use advantages. ctc counts, imaging, and serum tumor markers may have complimentary roles in monitoring disease status. the ultimate goal for clinical application is to integrate ctc information into disease management strategies. although the cellsearch system has received fda clearance for use in mbc and is being used in the community setting to help monitor mbc patients, few studies have been published describing the impact of ctc information on patient care. as discussed by bednarz - knoll. and beveridge, the clinical objective is to maintain ctc concentrations below 5 per 7.5 ml, although decreasing ctc concentrations from baseline / pretreatment to the first in - treatment assessment can be considered a positive indication of effective therapy. the ultimate clinical goal is to achieve and maintain ctc counts of < 5 per 7.5 ml at subsequent ctc assessments [18, 46 ]. both of these criteria have support from the studies described above. wang. used measurement of phosphorylated gamma - h2ax in ctcs to monitor therapy of heavily pre - treated mbc patients with progressive disease in a phase i trial of investigational dna damaging therapeutic agents. the level of nuclear phosphorylated gamma - h2ax is proportional to the number of dna double - strand breaks caused by dna damaging agents. the level of nuclear gamma - h2ax was assayed in ctcs isolated from serial blood samples during treatment on the study protocol. the study results showed that gamma - h2ax levels in ctcs correlated with exposure to dna damaging agents, which suggests that this approach will enable monitoring of therapeutic effectiveness and adjustment at the cellular level. one case study and one case series describing treatment strategies that include ctc monitoring have been published. the single case report of a patient with progressive metastatic inflammatory breast cancer in which disease progress was monitored using ctc counts, in conjunction with other biomarkers, was published by liu and colleagues. ctc concentration and epidermal growth factor receptor status were monitored, along with the serum levels of ca 15 - 3. initiation of therapy resulted in a dramatic remission and a reduction in ctc count to zero at 9 weeks of therapy. ctc counts began to rise again at the 18-week measurement, followed by ca 15 - 3 three weeks later. interestingly, there has been just a single report since beveridge 's article that describes a treatment regimen incorporating ctc enumeration via the cellsearch system in the clinical decision making process for patients with mbc. graham and colleagues reported on results from a community practice case series where ctc monitoring was used in conjunction with other biomarkers to guide treatment decisions. ctc levels that reached 5 ctc per 7.5 ml or more during treatment suggested a decision to use more aggressive therapy, accounting for patient preference and other clinical factors. reduced ctc levels supported use of lower morbidity regimens in the subsequent round of treatment. analysis of disease - specific survival for patients according to the highest level of ctc observed suggested that reduced ctc levels are associated with improved survival. the literature provides ample support for the concepts on which the beveridge algorithm was originally based. the decision point of 5 ctc per 7.5 ml blood in mbc the molecular subtype of mbc (except possibly ibc) and, generally, type of therapy do not affect use of ctc information. finally, ctc counts correlate with radiologic disease progression and with serum tumor marker levels but provide additional useful information. based on the growing body of evidence supporting clinical use of ctc analysis, some community - based practices are moving toward routine use of ctc information to facilitate monitoring of disease status from a simple venipuncture. the evidence discussed above suggests that the beveridge algorithm, used in conjunction with clinical judgment, conventional imaging studies, and tumor biomarkers is a valid guide to use ctc information for mbc therapy. figure 1(b) shows an updated algorithm that incorporates ctc information in the monitoring strategy. in this model, patients with newly diagnosed mbc starting systemic therapy undergo ctc testing, in addition to imaging, physical exam, and serum tumor marker measurement as part of their clinical assessment (figure 1(b), left). patients with ctc counts below the decision level of 5 ctc can be managed to standard of care for their disease, using periodic ctc measurement to monitor disease status. levels of ctcs at or above the decision point suggest that more careful monitoring of disease state is warranted. ctc counts are repeated 1 - 2 cycles later to allow for ctc levels to stabilize before considering therapy effectiveness. if the ctc count is < 5 at the follow - up assessment, the patients are managed to the standard of care, and disease status is monitored with periodic ctc counts, with imaging performed when clinically indicated. if the ctc count is 5, treatment failure is possible and new therapeutic options may be considered if the elevated ctc counts persist. in addition to the decision point of 5 ctcs per 7.5 ml of blood, the direction and magnitude of change in ctc levels are important to consider. a decreasing ctc count that is approaching the decision point value might be considered evidence of effective treatment, although the ultimate goal remains a ctc count below 5. this approach is consistent with the results from coumans and colleagues, which demonstrate that patients with an unfavorable ctc level at baseline whose ctc level falls during treatment to favorable levels survive longer than those with ctc levels that do not decrease. the authors conclude that the cutoff of 5 ctcs is appropriate and that achieving a ctc level below this at 6 to 8 weeks posttreatment is the best indicator of treatment success. patients already receiving therapy for mbc, but without a ctc count prior to initiation of therapy can have a ctc count at the time of any clinical assessment to establish a reference ctc level for comparison (figure 1(b), right). elevated ctc counts suggest re - testing after a period of continued therapy to establish a trend to guide subsequent treatment decisions. ctc counts below 5 or decreasing to near 5 suggest effective treatment that can be monitored with ctc counts as described previously. our experience suggests considering clinical context, including the clinical behavior of the individual 's tumor, when deciding how often to measure ctc levels after baseline in a monitoring strategy. for example, estrogen receptor positive mbc with bone - predominant metastases is often a disease with an indolent course compared to mbc with visceral metastases. favorable ctc counts (0 to 4 ctc per 7.5 ml) in patients with indolent tumors can be placed on a schedule to measure ctc every 2 - 3 months. patients with ctc levels at or above 5 or with visceral metastases are monitored monthly with ctc counts. we have also found serial monitoring of ctc levels as described previously to be useful in assessing patient prognosis where other assessments may not give a clear answer. this is because ctc measurements provide additional information beyond that provided by other assessments ; ctc measurements capture information about the biology of the tumor [14, 36, 50 ] meaning changes in ctc levels may reveal changes in disease status that are not apparent by other assessments. for example, imaging studies provide information on location, volume, and metabolic activity of the tumor ; however, response to therapy on imaging does not always correlate well with survival and may reveal a mixed response to treatment. furthermore, not all metastatic nodules visible to imaging will impact the prognosis of the patient. these features of standard assessments can lead to conflicts with clinical judgment that ctc information can help resolve. to illustrate, imaging may reveal an enlarged pulmonary nodule, yet the clinical presentation may not be poor. if the ctc level is favorable, then prognosis is favorable, and we may recommend continuation of the current therapy. conversely, elevated ctc counts in the face of stable imaging or serum tumor markers suggest poorer prognosis and might suggest that the current therapy may not be effective. this may lead us to alter therapy before changes are evident on imaging or in serum tumor marker levels. therefore, use of ctc counts to monitor disease status can reduce reliance on imaging thus sparing the patient exposure to ionizing radiation and reducing costs, can speed transition to potentially more effective treatment, and can potentially improve quality of life. the beveridge algorithm, as originally published, however, clinical experience and suggestions in the literature indicate that certain therapeutic situations or clinical features of mbc, such as bone metastasis - predominant mbc or trastuzumab therapy, may influence how ctc counts are used. documenting ctc counts in other clinical situations that are not addressable using clinical trials will add to body of knowledge on how best to use ctc - based information to better manage cancer. for example, ctc counts may be informative in situations of mixed responses on imaging or appearance of new metastatic foci that are not likely to affect the survival of the patient, situations that probably will not be subjected to study in clinical trials. capture of this information in case reports, along with documentation and sharing of routine clinical experience, will add clarity to clinical use of ctc information. beyond enumeration, an advantage to ctcs relative to imaging and serum tumor markers is the access they may grant to molecular information about the tumor. for example, ctcs may provide a more easily accessible tissue source for evaluation of biomarkers, such as her2 [52, 53 ] and multidrug resistance proteins. a great deal more remains to be learned about the biology of ctcs in breast cancer. appreciation is growing for the complexity of breast and other cancers and the heterogeneity of the disease, even within the individual patient. information from ctcs may be critical to facilitate access to personalized medicine for patients with cancer in the future. | circulating tumor cells (ctcs) were discovered nearly 150 years ago but have only recently been recognized as a feature of most solid tumors due to their extremely low concentration in the peripheral circulation. several technologies have been developed to isolate and analyze ctcs, which can now be routinely accessed for clinical information. the most mature of these (the cellsearch system) uses immunomagnetic selection of epithelial cell adhesion molecule to isolate ctcs for analysis. studies using this system have demonstrated that categorization of patients into high and low ctc groups using a validated decision point is prognostic in patients with metastatic breast, colorectal, or prostate cancer. initial attempts to use ctc counts to guide therapeutic decisions appeared to yield positive results and key concepts in clinical application of ctc information, including the ctc cutoff, predictive value in disease subtypes, and comparison to current evaluation methods, have been demonstrated. clinical studies of the impact of ctc counts in routine clinical practice are ongoing ; however, recent published evidence on the clinical use of ctcs in metastatic breast cancer continues to support these concepts, and experience in the community oncology setting also suggests that ctc enumeration can be useful for therapy management. |
a 56-year - old man was hospitalized because of pain and numbness in his left hand since he slipped a week earlier., we found that the motor and sensory functions of his left hand were normal. his laboratory data, including anti nuclear antibody, anti - neutrophil cytoplasmic antibody, and rheumatoid arthritis factor, were within normal limits. however, the laboratory analysis showed decreased protein c and s concentrations (protein c antigen, 57% ; protein s antigen, 19%). the diagnostic work - up to determine the degree of lesion included a computed tomography (ct) angiography, which showed an intraluminal lesion of the left upper extremities vessel. in the ct scan, coincidently, we stumbled across a mass lesion on the aortic arch. for the evaluation of the incidental mass lesion, we performed a chest ct scan and transthoracic echocardiography. the ascending aorta and the aortic arch had intact intima and a normal size (fig. 2). in transthoracic echocardiography, we found a floating mass in the lesser curvature of the aortic arch (fig. 3). we decided to surgically remove this floating mass because of the risk of peripheral embolization, including thrombectomy for the brachial and radial artery occlusion of the left arm. a median sternotomy was performed, a venous cannula was inserted in the ra auricle, extracorporeal circulation was begun, and the central temperature was decreased to 25. the patient was then in total circulatory arrest. an incision was made in the aortic arch, and the 3.0-cm intraaortic mass was completely removed (fig. the mass had no definite stalk, and its attachment site in the aorta was relatively normal. we also removed the thrombus of the left upper extremities through the brachial artery. in the postoperative peripheral angiography, one week later, the patient recovered without complications and was discharged on the regimen of warfarin. aortic thrombi, however, are another important cause of arterial thromboembolism. factors related to an arterial thrombus are arteriosclerosis, arterial dissection, trauma, malignant tumor, and hemostatic disorder. in this case, the patient had protein c and s deficiency, which induced a hypercoagulable disorder. the presence of pedunculated thrombi in the aortic arch as in this case is rare. the incidence of embolic events from mobile aortic thrombi is 73%. in this case, the patient had a thrombus in his left arm. they occur more commonly in patients of advanced age and those with several cardiovascular risk factors. in our case the most frequent location of thoracic aorta thrombi is the region of the aortic isthmus and the portion distal to the aortic arch, at the side opposite to the origin of the subclavian artery. ct and echocardiography can be used for the diagnosis of aortic thrombi. in particular, transthoracic and transesophageal echocardiography have high diagnostic accuracy and allow the assessment of the size, morphology, and anchoring site of the thrombus, as well as the characteristics of the aortic wall. further, to determine the cause of the thrombus, we should consider a survey for hypercoagulable disorder. a definite diagnosis requires histological and immunohistochemical studies. in a differential diagnosis with other mass lesions, such as tumors, the treatment of aortic thrombi is considered necessary because of the risk of a massive systemic embolization. thrombolysis can be a possible treatment, but there is a risk of thrombolytic agents selectively lysing the stalk of the lesion, releasing the bulk of the lesion into the systemic blood stream. we believe that in selective patients with acceptable surgery for cardiopulmonary bypass and definite systemic embolic events due to highly mobile aortic thrombi, surgical treatment has been successful. this case is reported in order to inform the readers of a rare case where floating thrombi in the aortic arch of patients with embolization were successfully treated surgically. | floating thrombi in the aortic arch are very rare and an unusual source of systemic embolism. herein, a case of a 3-cm thrombus in the aortic arch is reported. it was a floating, highly mobile thrombus attached to the lesser curvature of the aortic arch. the patients had a hypercoagulable disorder induced by protein c and s deficiency. the thrombus was operatively removed with a favorable outcome. |
a 17-year - old healthy male was seen with complaints of painless swelling over the left eye for the past four weeks. the rest of the systemic and ocular history was not significant. on examination his vision was 20/20 both eyes. on slit - lamp examination there was erythematous, subconjunctival nodular mass in the left eye [figure 1 ]. the lesion had a smooth surface with normal surrounding sclera and was not tender. hemoglobin, red blood cell count, total and differential white blood cell count, platelet count, erythrocyte sedimentation rate (esr) and blood smear were normal. hematoxylin and eosin stained sections showed a mixed cellular infiltrate, predominantly composed of histiocytes mixed with lymphocytes, including plasma cells and polymorphous nuclear leucocytes. histiocytes were filled with pink cytoplasm and contained lymphocytes, a pathognomic finding also known as lymphophagocytosis [figure 2 ]. stains for bacteria, fungus and acid - fast bacilli were negative. the patient was started on systemic prednisolone (1mg / kg body weight) on a tapering dose for a period of four weeks. at six weeks follow - up there were no new lesions and the subconjunctival mass showed no increase in size. rosai and dorfman first described sinus histiocytosis with massive lymphadenopathy in 1969.1 this disease mainly presents as a massive painless cervical adenopathy in children or young adults of african ancestry. extranodal disease has been found to occur in 43% cases which may be widespread and most frequently involves the respiratory tract, paranasal sinuses, visceral organs, skin, bone, central nervous system, genitourinary tract, and orbit.2 other features include low- grade fever, leukocytosis with neutrophilia, elevated esr, and hypergammaglobulinemia.5 ocular involvement is relatively uncommon (8.5%), and most cases have presented as lymphoproliferation in the soft tissues of the orbit and eyelids.6 epibulbar mass as isolated finding of extranodal rdd is very rare with only four cases reported in the literature so far.7 - 9 the underlying cause of rdd is unclear. epstein - barr virus2 and human herpes virus 6,10 have been isolated in a few patients, but no clear association has been identified. autoimmune disease, immunocompromise, and neoplastic cell disease may be a cause, but this remains unclear.2 there are rare associations with polycythemia vera, joint disease, glomerulonephritis, hematological antibodies, and wiskott- aldrich syndrome.2 the diagnosis of rdd is made on histopathology. characteristic histological features are histiocytic infiltration admixed with lymphocytes and other inflammatory cells. one typical feature of this entity has been emperipolesis, with histiocytes demonstrating phagocytosed lymphocytes and plasma cells. the histiocytes are typically filled with pink cytoplasm and often contain lymphocytes, a pathognomic finding also known as lymphophagocytosis. histiocytes in rdd, langerhan cell histiocytosis, and other histiocytosis express s-100, a neural tissue - specific protein ; however, the pathophysiology of this s-100 expression remains obscure. although positive staining for s-100 strongly suggests rdd, it is not absolutely required to make the diagnosis in the presence of typical histology of rdd.9 the disease is classically described to have an indolent, self - limiting course ; however, this is not always the case. the various stages of disease progression are remission, recurrence, persistent but stable, primary progressive and death caused by the disease. the therapy for rdd is yet to be determined because of the rarity of the disease and its propensity for spontaneous remission. excision, radiation therapy, chemotherapy and systemic steroids have all been tried by different authors. the first line of interventional therapy to be considered is gross total excision along with adjuvant steroids or more aggressive chemotherapy or radiotherapy when necessary.11 in our patient the disease was stable at six weeks, however a close follow- up is needed to watch for any increase in size of the lesion or systemic spread. rosai - dorfman disease is an entity that is part of a group of orbital / systemic disorders, including xanthogranulomas and sclerosing inflammation of the orbit, which share numerous anatomic, histological and pathophysiologic features. the differential diagnosis of rdd should include orbital sclerosing inflammation, xanthogranulomatous disease, b - cell lymphoma, and benign lymphoid hyperplasia.11 other disorders that may superficially resemble rdd include burkitts lymphoma, granulocytic sarcoma, rhabdomyosarcoma, neuroblastoma and langerhans cell histiocytosis. the growth pattern of lymphoma and lymphoid hyperplasia are similar but these lesions do not have the cicatrizing feature seen with rdd. sclerosing inflammation and xanthogranulomas can be differentiated by histological and immunohistochemical differences.11 although the orbit and eyelid are common extranodal sites for ocular rdd, isolated epibulbar presentation is very rare. the authors would like to highlight that rdd may present as epibulbar nodules without any other nodal or extranodal involvement in young healthy adults and should be considered in the differential diagnosis by clinicians when evaluating epibulbar masses. | rosai - dorfman disease is a rare idiopathic disorder characterized by painless lymphadenopathy with cervical involvement in more than 80% cases. we report a case of rosai - dorfman disease presenting as an isolated epibulbar mass in a healthy young adult male. epibulbar involvement in rosai - dorfman disease is a rare presentation as can be seen from a review of all literature. the presentation, differential diagnosis and treatment are discussed. |
idiopathic granulomatous mastitis (igm) is an uncommon disease which usually arises in premenopausal women shortly after their last childbirth. its etiology is unclear, however, breast - feeding and the use of oral contraceptives could exert an influence in its pathogenesis. very often clinical and radiological findings mimic multifocal breast cancer and the diagnosis is made by histopathology. etiopathogenesis of igm often involves an inflammatory mechanism which could be resolved by the administration of corticosteroids or methotrexate, negating the requirement complete surgical excision. cases of igm are related to the chronic use of selective inhibitors of serotonin reuptake (ssri) during antidepressant therapy are underestimated and should be treated with non - surgical therapeutic approaches. the postulated causes have included autoimmune diseases such as granulomatous thyroiditis, granulomatous prostatitis, granulomatous orchitis, immune response to local trauma, local irritants, undetected organisms such as viruses, mycotic, and parasitic infections, hyperprolactinemia, diabetes mellitus, alpha-1 antitrypsin and the use of oral contraceptives. interestingly, it has been reported that antipsychotic therapy can be associated with hyperprolactinemia and that the onset of breast enlargement can occur during chronic antidepressant therapy suggesting a possible side effect of ssri. in particular ssri could exert a perturbation in dopamine secretion, counteracting its role in repressing prolactin gene expression, leading finally to hyperprolactinemia and associated igm. in this regard, it seems worthy of noting the findings about a functional crosstalk between serotonin and dopamine receptors. in our opinion, surgical excision of the lesion is not necessary in cases of antidepressant therapy - related igm, and where possible, a conservative approach based on administration of an antiinflammatory therapy is favored. histopathological confirmation, combined with exclusion of malignancy and other causes of granulomatous disease, is of great importance in guiding clinical decision making and preventing inappropriate and unnecessary treatments. a retrospective study by erhan. reviewed delayed wound healing or recurrence after excisional biopsy, or those who have had an incisional biopsy only, if prolactin level was normal, reexcision and oral prednisone usage may be curative. in patients with a high prolactin level and who had recurrence, medical treatment to control prolactin levels this study seems, therefore, to underline an unexpected and underestimated prognostic value of blood prolactin levels, which could exert an interesting role in the recurrence of igm. as hyperprolactinemia can be induced by ssri, whose chronic use can cause gm, in these particular cases the ideal management of patients is not surgical excision, given that lesions are not malignant, but are probably caused by an hypersecretion of prolactin by the pituitary gland related to alteration of serotonin / dopamine metabolism. if this pathogenetic hypothesis is validated it could be reasonable to propose a suspension of ssri therapy to monitor the evolution of breast lesions, which would regress spontaneously, or alternatively, a therapy aimed to control prolactin blood levels and/or to modulate inflammation could be achieved. igm raises important diagnostic and therapeutic dilemmas, as more than 50% of the reported cases are initially mistaken for breast carcinoma. occasionally some patients may be subjected to mastectomy as a consequence of a false positive fine - needle aspiration cytology (fnac) result, as has been previously reported. the practice of performing mastectomy merely on the basis of triple assessment (clinical, mammographic, and fnac findings consistent with malignancy), therefore, does not seem to be necessarily justified. in this paper we emphasize the importance of diagnosis of igm, which in the non malignant forms should not be treated surgically. in particular we draw attention to cases of igm related to antidepressant (ssri) therapy, postulating that these clinical scenarios must also be approached conservatively. | granulomatous mastitis is a rare benign inflammatory disease of the breast with multiple etiologies such as tuberculosis, sarcoidosis, foreign body reaction, and mycotic and parasitic infections. in contrast, idiopathic granulomatous mastitis (igm) is characterized by the presence of chronic granulomatous lobulitis in the absence of an obvious etiology. clinically and radiologically it may mimic breast carcinoma and so awareness of surgeons, pathologists, and radiologists is essential to avoid unnecessary mastectomies. cases of igm are reported during antidepressant therapy in patients also showing high levels of prolactinemia. in these cases, we believe that surgical excision must be avoided being replaced with a conservative management of the pathological condition based on a corticosteroid treatment. |
scapular spine stress fractures are uncommon following cuff tear arthropathy, there are only six reported cases in the english literature. management of these fractures remains a challenge because of poor bone quality and persistent deforming force at the fracture site. management of these fractures can be conservative or surgical, with good functional outcome being associated with fracture union. conservative management can lead to asymptomatic nonunion, and there is a risk of recurrence of symptoms leading to a painful stiff shoulder. we present a case of bilateral scapular spine stress fractures that was treated operatively on one side and conservatively on the other with satisfactory functional outcome, besides we reviewed the literature to find the optimal treatment option. a 61-year - old right - hand dominant gentleman was referred to our clinic with sudden deterioration bilateral shoulder pain and loss of function. he was a retired ambulance driver with long - standing and established bilateral massive rotator cuff tear and arthropathy (worse on the left). clinically, he had very limited and painful, active movements bilaterally (30 of abduction and forward flexion, no external rotation and internal rotation to sacrum). he was tender over both scapular spines, with significant site mobility and pain on the left side. shoulder radiographs, computed tomography (ct) and magnetic resonance imaging (mri) revealed chronic bilateral massive rotator cuff tears with significant retraction of the supraspinatus and infraspinatus associated with fatty infiltration. there was associated superior migration of the humeral head on both sides with the loss of acromio - humeral space. bilateral stress fractures of the spine of scapula were noted with the left side being significantly displaced with no evidence of healing [figure 1 ]. the patient had a history of chronic obstructive pulmonary disease (copd) and suffered from noninsulin - dependent diabetic mellitus. computed tomography reconstruction on initial presentation showing bilateral scapula spine fractures. note the left side is grossly displaced compared to the right although, he initially had severe pain in both shoulders, symptoms in his right shoulder reduced with conservative treatment after 2 months, with diminishing pain and functional improvement. this was further confirmed with x - rays and ct scans showing callus formation and progression to union [figure 2 ]. however, his left side remained symptomatic with pain, abnormal mobility at the fracture site, and no radiological evidence of healing [figure 3 ]. the patient underwent a successful open reduction and internal fixation of the left scapular spine with 3.5 mm limited contact dynamic compression plate (synthes) and iliac crest bone grafting. postoperatively the arm was immobilized in a polysling allowing rotational movements and pendulum exercises for 4 weeks. this was followed by active assisted forward flexion and abduction to 90 for further 2 weeks and a full range of movement exercises as tolerated by the patient after 6 weeks. the fracture progressed to union uneventfully with significant improvement in symptoms and function in his left shoulder [figure 4 ]. as the patient 's symptoms improved, he refused further treatment and arthroplasty for his cuff tear arthropathy as his level of symptoms were manageable. at the final follow - up at 2 years, the patient was asymptomatic with regards to the scapular spine fractures with reasonably good function [table 1 ]. his oxford shoulder score (oss) was 30 for both shoulders and disabilities of the arm, shoulder and hand (dash) score was 30.8 at the final follow - up. radiograph (left) and computed tomography scan (right) of the right shoulder after conservative treatment showing evidence of callus formation and healing. this correlated well with clinical symptoms of reducing pain and improving function radiograph (top left), magnetic resonance imaging (top right) and computed tomography (bottom) of the left shoulder showing evidence of nonunion of the scapula spine fracture, this correlated with persistent symptoms of pain and increased mobility at the fracture site follow - up computed tomography scan of the left shoulder at 2 years after open reduction and internal fixation with plates and screws showing bony union massive rotator cuff tears alter the kinematics of the gleno - humeral articulation. in patients with massive cuff tears, the humeral head comes into contact with the overlying acromion during movements in the arm. this may lead to antero - superior migration of the humeral head and altered bio - mechanics. during shoulder movements, the elevated humeral head transfers increased loads across the acromion, and the spine of scapula. over time, these abnormal forces on the acromion could lead to remodeling of the acromion and spine of scapula according to wolfe 's law with acetabularization of the acromion. however, in patients with other predisposing factors such as osteopenia in our patient and other patients reported in the literature, the risk of stress fractures increases because of the reduced remodeling potential. copd can be a mechanical factor, where chronic cough produces repetitive micro - trauma to an already weakened bone. in our case, steroid use, chronic cough, and osteopenia secondary to long - standing copd in addition to long - standing cuff tear arthropathy likely led to the stress fractures. a medline search was conducted to find all articles on scapular spine stress fractures from 1966 to march 2013 [table 2 ]. groot., treated two such patients with physiotherapy, analgesics and ultrasound bone growth stimulation, however, the fractures did not unite, and the patients ended up with painful stiff shoulders [table 2 ]. interestingly, one of their patients whose symptoms settled initially presented after 10 months with recurrence of severe pain. this raises doubts about leaving the asymptomatic nonunion without treatment, as it can lead to further disability in an already compromised shoulder. shindle., in his study tried conservative treatment in two patients and eventually ended up operating on both. in one patient where the fracture was fixed with plates and screws, the fracture united and the patient regained painless shoulder elevation despite cuff deficiency at 3 months. in the second patient, the scapula fracture failed to progress to union with conservative management but was minimally displaced. her pain was not thought to be due to a fracture, so a reverse total shoulder arthroplasty was performed, however, the patient developed postoperative infection and died. biomechanically, reverse total shoulder arthroplasty reverses the forces responsible for stress fractures of acromion and scapular spine in cuff tear arthropathy, however increased tension, and elongated deltoid can potentially worsen the situation by increasing the stress in acromion and scapular spine in the opposite direction. in patients with scapular spine stress fracture following reverse total shoulder arthroplasty, operative fixation is the treatment of choice, as poor functional results were associated with conservative treatment. roy, treated a patient with minimal symptoms from a scapular spine stress fracture conservatively. the patient was wheelchair - bound and was admitted in a medical ward for heart failure and chronic varicose ulcers. at 6 months the outcome scores measured at the final follow - up did not accurately reflect his recovery from the scapular spine stress fractures. some components of the score, such as household chores and shopping and recreational activities, were limited because of his severe copd rather than his shoulder problems. however, the oss and dash scores were equal at final follow - up for both shoulders highlighting the fact that the fracture union is essential to regain prefracture levels of function. based on present literature review, union following symptomatic scapular spine stress fracture is associated with good functional outcome. however, even in patients with painless nonunion, there is a risk of recurrence of symptoms that may result in a painful stiff shoulder. if conservative treatment fails, operative treatment can be considered if the shoulder remains symptomatic. scapular spine stress fractures are rare, but can occur in patients with a combination of massive rotator cuff tear with arthropathy and poor bone quality. fracture union either by conservative or operative route is associated with a good functional outcome and is supported by our literature review. | we report a case of bilateral scapular spine stress fracture, treated conservatively on one side and operatively on the other side. besides, we performed a literature review to establish management options. a 61-year - old right - handed gentleman came to our clinic with acute on chronic deterioration of shoulder pain and loss of arm function. clinical assessment and investigations revealed long - standing bilateral rotator cuff tear and scapular spine stress fractures. the fracture on the right side united with conservative management for 2 months. however, his left side remained symptomatic with pain, abnormal mobility and no radiological evidence of union. the fracture progressed to union after fixation and bone grafting. at the final follow - up at 2 years, the patient was asymptomatic with regards to the fractures with oxford shoulder score (oss)-30 and disabilities of the arm, shoulder and hand (dash)-30.8. fracture union either by conservative or operative treatment is associated with good functional outcome and is supported by our review. |
pathways of gene silencing and small regulatory rnas such as mirnas (micrornas) and sirnas (short interfering rnas) are widespread in almost all eukaryotic organisms [1, 2 ]. these pathways are known to act in development, heterochromatin formation, regulation of gene expression at transcription, posttranscription, and translation level, or mrna stability [35 ]. biochemical rna silencing and small regulatory rnas processes are mediated by a number of proteins which include dicers, argonautes, and rna - dependent rna polymerases [3, 6 ]. investigations in eukaryotes have revealed that these proteins are encoded in a family with variable number of genes [1, 69 ]. in the pathways of gene silencing and small regulatory rnas these proteins are ~100-kd, highly basic proteins and share the domain structure that comprises an n terminal, paz, mid, and a c - terminal piwi domain [6, 10, 11 ]. the paz domain (~100 aa) facilitates binding of 3 end of sirna, while the piwi domain binds the 5 end of sirna. this domain has marked similarity with rnaseh family of ribonucleases which is carried out by an active site usually carrying an asp - asp - his (ddh) motif and it possesses the catalytic amino acid residues required for endonucleolytic cleavage of the target rna but in some of the argonaute proteins (hsago3) which have ddh domain but do not appear to have slicer activity, it suggests that the presence of a ddh motif does not necessarily imply slicer activity [1114 ]. at least three subfamilies of argonaute proteins have been identified in eukaryotes : the argonaute subfamily present in plants, animals, and yeasts, the piwi subfamily found only in animals, and the worm - specific argonaute or wago subfamily present in c. elegans. members of both argonaute and piwi subfamilies possess the characteristic ddh metal binding signature residues in their piwi domains, while most of the wago proteins lack them [7, 15, 16 ]. the piwi proteins are expressed specifically in the germline cells and are known to interact with a subset of small rna called piwi - interacting rna that are longer (2631 nt) than sirna and mirna (2124 nt). piwi class performs the small rna in animal germ cells but in plants it is performed by member(s) of the argonaute class [13, 17 ]. the argonaute protein family was first identified in plants, and members are defined by the presence of paz (piwi - argonaute - zwille) and piwi domains. argonaute proteins are highly conserved between species and many organisms encode multiple members of these genes. plant argonaute proteins are evolutionarily conserved and in the phylogenic analysis group divided into three clades. the numbers of argonaute genes vary in different species, ranging from 1 in the fission yeast schizosaccharomyces pombe to 27 in the nematode worm c. elegans [7, 11, 13, 17 ]. there are eight argonaute genes in mammals and five genes in the d. melanogaster genome [7, 13 ]. argonaute proteins are ubiquitously expressed and bind to sirnas or mirnas to guide posttranscriptional gene silencing either by destabilization of the mrna or by translational repression. although various aspects of argonaute function have been identified, many argonaute proteins are still poorly characterized [11, 13, 1517 ]. at present, some reports reveal genome - wide organization and expression analysis of plant argonaute gene family in oryza sativa, zea mays, arabidopsis thaliana, medicago truncatula, and solanum lycopersicum [12, 1820 ]. numbers of argonaute genes in plant such as a. thaliana are 10 members with some of them being characterized with respect to biological function. argonaute1 and argonaute10 are involved in shoot meristem, argonaute4 is involved in rna - directed dna methylation and silencing of a small class of transposons, and argonaute7 is involved in the juvenile - adult transition in vegetative development [13, 21 ]. plant reproduction also requires rnai machinery, in which argonaute1 acts in effecting the full expression of leafy (lfy), apetala1 (ap1), and agamous (ag), encoding transcription factors to determine meristem identity, flowering transition, and/or flower organ identity. in addition, argonaute1 plays a central role in the posttranscriptional gene silencing of curlyleaf (clf), encoding a polycomb group protein that maintains the repression of both knotted - like homeobox (knox) genes and homeotic genes ag and apetala3 (ap3) in vegetative leaves, and in pollen development [21, 22 ]. argonaute10 is initially expressed throughout the embryo but becomes limited to the provascular strands and the adaxial sides of the cotyledons at about the globular stage. the completion of whole genome sequencing (wgs) of important crops has opened a new dimension of genetic data mining, which will ultimately impact agricultural and industrial use of these crops in upcoming years. sequences derived from large - scale sequencing projects are informative in functional genomics research and provide the opportunity to genome - wide scan of gene families and comprehensive comparative genome study is essential for understanding the evolution and function of each gene family in plants. although studies on argonaute have been covered in different biological systems, the availability of genome sequences of more organisms has provided significant information about newly sequenced genes encoding argonaute proteins in higher plants. this represents an avenue for gene discovery and functional comparative genomics studies. in this study, we report on the phylogenetic relationship and the structural and functional characterization of argonaute gene subfamilies in higher plants. the aim of this investigation is characterization and bioinformatic analysis of argonaute protein in 32 plant species and a. thaliana as a reference. argonaute genes of 32 plants were verified by blastp searches (according to default program settings) using arabidopsis thaliana atago1 to atago10. likewise, an e - value threshold (the number of times that a match, or a better match, occurs by chance within the database of 0 to 1e 50) was used. evaluation of argonaute candidates was done based on the identification of domains in the ncbi conserved domains database (cdd) that is specific for the different proteins : paz (cd02846) of superfamily (cl00301), mid (5 rna guide strand anchoring site), piwi (cd04657) of superfamily (cl00628), and total protein (pln03202). the domains were identified as part of the ncbi web - based blast interface which includes an rps - blast search versus the position - specific scoring matrices in cdd (v3. the obtained sequences were also subjected to reciprocal blastp searches, ensuring that they indeed were most similar to proteins of the respective family. most searches were conducted using the nonredundant protein database at ncbi and phytozome of june 2013 (http://www.phytozome.net/). argonaute genes were prefixed with the corresponding genus and species initials. for phylogenetic analysis of conserved domains, phylogenetic trees were constructed using mega 4 software based on the sequence of argonaute to determine the distribution and evolutionary trend of argonaute in plants using the neighbor - joining (nj) method with 100 bootstrapping replicates. three - dimensional structure of proteins was performed by the phyre server and three - dimensional structures were received as the pdb format. then this format was fed to yasara software to draw three - dimensional structure, c - terminal, n - terminal, and also three domains paz, mid, and piwi. transcript levels of arabidopsis thaliana, oryza sativa, medicago truncatula, vitis vinifera, glycine max, populus trichocarpa, prunus persica, malus domestica, and aquilegia coerulea argonaute genes were analyzed by multiple methods. first, est mining was performed in the ncbi est database (http://www.ncbi.nlm.nih.gov/dbest/) using megablast tool. parameters of searching were as follows : maximum identity > 95%, length > 200 bp, and e value < 10. secondly, expression data in the plantgdb and magi databases, including est, cdna, and puts (plantgdb unique transcripts), were retrieved by the gdb genome browser tool. third, est mining was performed in the dfc - plant gene indices est database (http://compbio.dfci.harvard.edu/tgi) using identifiers or keywords and expression summary tools. chromosomal position of argonaute genes of several plants including arabidopsis thaliana, brachypodium distachyon, glycine max, medicago truncatula, populus trichocarpa, and vitis vinifera was plotted using the ncbi map viewer tool (http://www.ncbi.nlm.nih.gov/mapview/) and for cucumis sativus was plotted using cucumber genome database (http://cucumber.genomics.org.cn/page/cucumber/index.jsp) map viewer tool. the first step of our analysis was to identify all argonaute genes from 32 plant species that their genome was sequenced (table 1). to identify argonaute genes and their putative encoded polypeptides present in arabidopsis genome, initially, keyword search of argonaute against a. thaliana genome database was performed (http://www.ncbi.nlm.nih.gov/). it was found that 10 members had been annotated as argonaute genes displayed in numbers 110 (ref a. thaliana argonaute). a. thaliana argonaute genes were used in phytozome database as query using the blastp search engine. in most cases, whenever significant similarity to argonaute sequence was identified in other species, the genomic sequence was excised and homology - based gene predictions were performed using the most similar query as a guide. blastp analysis was carried out to search against a database from thirty two species. for most of the gene families, the numbers of identified putative argonaute genes varied from 6 in carica papaya to 24 in panicum virgatum. some of the argonaute genes loci had alternative transcripts. in this study, only the transcript with most conserved domains, which is the transcript with lowest e - value of domain examination, was selected. these argonaute genes were designated by ago. to examine the relationships of argonaute proteins and investigate the evolutionary history of this protein family among the plants, phylogenetic trees were constructed using mage v4.0 program by the n - j method. because of large numbers of studied plant species and large numbers of putative argonaute proteins, phylogenetic tree for argonaute proteins was drawn in the separate section. in order to visualize phylogenetic relationships clearly, shortened gene names were used on the phylogenetic trees. we divided plants into four groups and division was based on a phylogeny tree of species in phytozome v9.1 website. phylogenic analysis divided argonaute genes of these plants into three classes 1, 2, and 3. third class has 31 sequences and was classified into two subclasses like first phylogeny (figure 2). third class has 20 sequences and was classified into two subclasses like phylogenies one and two (figure 3). third class has 25 sequences and was classified into two subclasses like first phylogeny (figure 4). bioinformatics analysis of argonaute protein plant was done using the conserved domains database (ncbi) and domains sequences were drawn for each group and placed side by side. argonaute proteins usually have paz, mid, and piwi domains and all of participated sequences in our investigation had paz, mid, and piwi domains but length and location of these domains in each sequence were variable (figure 5). structural analysis of the argonaute protein sequence in studied plants revealed that all of the sequences that had similar structure and location of domains in the protein are identical ; therefore, it seems that all of these proteins have been highly conserved and operate the same activities. results showed that argonaute protein contained -helix and -folding, belonging to a hybrid protein structure and creating the suitable location for performing the activity to synthesize the specific binding pocket that anchors the characteristic two - nucleotide 3 overhang that results from digestion of rnas by rnase iii (a step in the processing of small rnas) or this structure has proper location for implicated mid domain in protein - protein interactions (figure 7). our analysis showed that most of the plant ago examined encode paz, mid, and piwi domains. luago1 has two paz domains and one mid and piwi domain. besides three conserved domains, mdago13 encodes two more domains ribosome - inactivating protein and dyw family of nucleic acid deaminases which are located before conserved domains. mdago5 had two complete groups of paz, mid, and piwi domains that are placed after gamma - thionin family domain (figure 5). mdago1 as well as regular domains had two extra domains which are placed after these domains and their names are zinc finger c - x8-c - x5-c - x3-h type and ab - hydrolase associated lipase region, respectively (figure 5). also fvago1 in addition to paz, mid, and piwi domains had alpha - crystallin domain (acd) of alpha - crystallin - type small (s) heat shock proteins (hsps) that is located in front of paz domain. except for regular domains, fvago9 has gt1-sucorus syntas domain additionally which is located after piwi was placed and glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. sequence of brago5 had regular domains as well as two cims n terminals like domains which are located after the piwi domain (figure 5). argonaute genes in ricinus communis, linum usitatissimum, populus trichocarpa, malus domestica, fragaria vesca, arabidopsis lyrata, capsella rubella, vitis vinifera, brassica rapa, carica papaya, mimulus guttatus, and solanum lycopersicum did not have alternative transcripts, but manihot esculenta, medicago truncatula, phaseolus vulgaris, glycine max, cucumis sativus, prunus persica, arabidopsis thaliana, thellungiella halophila, gossypium raimondii, theobroma cacao, citrus sinensis, citrus clementina, eucalyptus grandis, solanum tuberosum, aquilegia coerulea, sorghum bicolor, zea mays, setaria italica, panicum virgatum, oryza sativa, and brachypodium distachyon argonaute genes had different alternative transcripts (table 1). argonaute genes loci in aquilegia coerulea had highest alternative transcripts number compared to that of other studied plants. ago15 gene locus in the aquilegia coerulea with 17 different transcripts had the highest argonaute alternative transcripts (table 1). in order to determine the synteny between argonaute genes in the studied plants the physical locations of argonaute genes physical locations of small number of argonaute genes such as glymago8, glymago12, glymago21, ptago4, ptago8, ptago11, ptago14, ptago15, bdago1, bdago14, and csago7 were not found in the ncbi database. in a. thaliana ago1, ago2, ago3, and ago7 were located on chromosome 1, ago4, ago5, and ago6 were on chromosome 2, and ago8, ago9, and ago10 were on chromosome 5. distachyon ago6, ago10, ago9, ago3, ago5, and ago7 were on chromosome 1, ago13 and ago11 were on chromosome 2, ago2 and ago4 were on chromosome 3, ago12 was on chromosome 4, and ago1 and ago14 were on chromosome number 5. in the cucumis sativus ago1, ago2, and ago3 were located on chromosome 1, ago5 was on chromosome 4, ago4 was on chromosome 5, and ago6 was on chromosome 6. however no argonaute gene was located on chromosomes 2, 3, and 7 (figure 6). in the glycine max ago12 was on chromosome 1, ago5, ago11, and ago14 were on chromosome 2, ago7 was on chromosome 4, ago6 was on chromosome 5, ago8 and ago18 were on chromosome 6, ago2 was on chromosome 9, ago4 was on chromosome 10, ago10 was on chromosome 12, ago16 was on chromosome 13, ago17 was on chromosome 15, ago15 was on chromosome 14, ago1 was on chromosome 16, ago9 was on chromosome 17, and ago3, ago13, and ago19 were on chromosome 20. however no argonaute gene was located on chromosomes 3, 7, 8, 11, 18, and 19. in the medicago truncatula ago4 was on chromosome 2, ago8 was on chromosome 3, ago3 was on chromosome 4, ago5, ago6, and ago7 were on chromosome 5, and ago1 was on chromosome 8 (figure 6). in the populus trichocarpa which has 19 chromosomes and according to the chromosome gene map location of argonaute gene on populus trichocarpa chromosome ago5 was on chromosome 1, ago10 was on chromosome 6, ago11 and ago2 were on chromosome 8, ago6 was on chromosome 9, ago3 and ago8 were on chromosome 10, ago1 was on chromosome 12, ago12 was on chromosome 14, and ago9 was on chromosome 16. however no argonaute gene was located on chromosomes 2, 3, 4, 5, 7, 11, 13, 15, 17, 18, and 19. in the vitis vinifera ago12 was on chromosome 1, ago2 was on chromosome 5, ago3 and ago14 were on chromosome 6, ago1 and ago8 were on chromosome 8, ago9, ago10, and ago11 were on chromosome 10, ago4 was on chromosome 11, ago7 was on chromosome 12, ago6 was on chromosome 13, and ago5 was on chromosome 17. however no argonaute gene was located on chromosomes 2, 4, 7, 9, 14, 15, 16, 18, and 19. in the vitis vinifera ago13 was on chromosome 3 but location of this gene is not distinct on chromosome 3 (figure 6). expressed sequence tags (est) data can provide valuable information about gene expression research. expression profiles of argonaute genes were investigated by multiple strategies in this study (table 2). est mining results indicated that major argonaute genes were expressed in checked tissues and organs. however, expression evidences of some argonaute genes were detected in only one tissue or organ. examination of the expression profiles of argonaute proteins in some of the plants indicated that these proteins have high expression in the seed, leaf, root, and shoot in the studied plants. in the a. thaliana the expression of seven argonaute genes in different tissues including leaf, root, flower, seed, hypocotyls, and ovule was studied. five argonaute genes were studied in the rice and their expression was detected in the root, leaf, shoot, flower, seed, pollen, callus, panicle, and ovule. all rice argonaute genes were expressed in the callus and only one gene was expressed in pollen. in the medicago truncatula expression profiles of six argonaute genes were studied in the root, leaf, flower, seed, stem, cotyledon, and callus. most of genes were expressed in the root and only one argonaute was expressed in callus. in the vitis vinifera data for six argonaute genes in glycine max in different organs including leaf, shoot, flower, seed, hypocotyl, and cotyledons were studied. all of argonaute genes transcripts were detected in the seed and only one gene was expressed in hypocotyls. information related to populous trichocarpa argonaute expression was available for five argonautes in different organs including root, leaf, stem, cambium, and buds. all of genes were expressed in leaf and stem and three argonaute genes were expressed in cambium and bud. in prunus persica only a few pieces of information related to expression of argonaute protein existed which this argonaute protein expressed in the fruit and mesocarp. information about expression of argonaute genes in malus domestica only existed for three genes that were expressed in the leaf, flower, buds, and fruit. number of genes expressed in root, leaf, shoot, and flower was approximately equal. in general, expression was determined for the 28 argonaute genes in root, 30 in the leaf, 18 in the shoot, 24 in the flower, 20 in the seed, 8 in the stem, 8 in the callus, 7 in the cotyledon, 6 in the bud, 4 in the ovule, 4 in the fruit, 3 in panicle, 3 in the cambium, 2 in the hypocotyl, 2 in the pistil, 1 in the pollen, 1 in the pericarp, and 1 in mesocarp. in general most expression was related to leaf and seed ; lowest number of genes was expressed in the pollen, pericarp, and mesocarp (table 2). the average argonaute sequence length was 972 amino acids, the longest length was related to mdago1 with 2583 aa, and the shortest length was related to pvago1 with 376 aa. the average of molecular mass was 108 kd, the highest was for mdago1 with 288 kd, and the lowest was for pvago1 with 42 kd. average isoelectric point of the proteins was 9.39, the lowest was related to mgago7 with 6.38, and the highest was for pviago18 with 9.96. average of aliphatic index was 80, the highest was related to gmago4 with 92.57, and the lowest was for pviago1 with 66.986. the highest count of hydrophobic was for mtago6 with 0.432 and the highest count of hydrophilic was for sbago5 with 0.527. the lowest count of hydrophobic was for vvago10 with 0.234 and the lowest count of hydrophilic was for mtago6 with 0.31. average count of charged residues was 0.099 and 0.128 for negative and positive, respectively. average alpha helix was 27, the highest was related to mdago1 with 71 alpha helices and the lowest was related to bdago1 with 11 alpha helices. average beta strand was 38, the highest was related to mdago1 with 99 beta strands and the lowest related to vvago3 and vvago4 with 18 beta strands (table 3 supplementary data available online at http://dx.doi.org/10.1155/2014/967461). classification and phylogenetic analysis of argonaute proteins among the 32 plants showed that these proteins have high level of conservation. all of the phylogenetic trees were classified in the same manner and consisted of three subclasses. similar results were obtained for each of plant argonaute proteins that were classified into three classes. most of the sequences had paz, mid, and piwi domains and only variation among these sequences was related to length and location of domains in each sequence. structural analysis of the sequences of argonaute protein revealed that all of the sequences had similar structure and location of domains in the protein. plant argonaute showed a wider range of biochemical characters such as molecular weight and length compared to previous studies [11, 15, 30 ]. among plants argonaute proteins the higher average of lengths and weight belonged to brassica rapa and was 1024 aa 139 kda, respectively. the isoelectric point is the ph at which a particular molecule or surface carries no net electrical charge. the aliphatic index of a protein is a measure of the relative volume occupied by aliphatic side chain and an increase in the aliphatic index increases the thermostability of globular protein. different amount of this factor may related to different behavior of argonautes in terms of thermostability. numbers of beta strands and alpha helices in these proteins were different which may be related to size of each sequence and amino acids content and secondary structure of proteins. one of the important results of this investigation was finding of unusual domains in some of argonaute proteins. all of the regular argonaute proteins had only one paz, mid, and piwi domain, but luago1 had two paz domains, one mid, and one piwi domain. mdago4 had two sets of paz, mid, and piwi domains which repeated in direct tandem and a gamma - thionin was located before these domains. gamma - thionins c - termini domain is an important determinant on antifungal activity and antimicrobial activity. these peptides were named gamma - thionins or defensins that can be classified into four main subtypes according to their specific functions. extra domains may be related to duplication in loci luago1 and mdago5 but existence of gamma - thionin domains in the argonaute protein is not clear and needs more investigation. mdago5 in addition to paz, mid, and piwi domains had two argonaute unusual domains zinc finger c - x8-c - x5-c - x3-h type and ab - hydrolase associated lipase. zinc finger proteins belong to a superfamily divided into nine classes (c2h2, c8, c6, c3hc4, c2hc, c2hc5, c4, c4hc3, and ccch) according to the numbers of conserved cysteine (c) and histidine (h) residues and the spacing between these conserved residues. most of the characterized ccch - type zinc finger proteins are associated with rna metabolism, including rna cleavage, rna degradation, rna polyadenylation, or rna export by binding to rna. in arabidopsis, the ccch - type protein hua1 is involved in the processing of agamous pre - mrna as an rna - binding protein during flower development. another arabidopsis ccch - type protein, attzf1, shuttling between the nucleus and cytoplasmic foci, can bind both dna and rna in vitro and is likely involved in gibberellin acid / abscisic acid - mediated developmental and environmental responses through dna or rna regulation. ccch - type gene family may be involved in abiotic or biotic stress tolerance like plant - pathogen interaction, which regulates resistance to the fungal pathogen, enhancing tobacco tolerance to salt stress. most of the characterized ccch - type zinc finger proteins are associated with rna metabolism by binding to the target mrna and transcriptionally regulate gene expression by binding to dna. c3h12 may regulate disease resistance by promoting the cleavage or degradation of mrnas of some defense - responsive genes that encoded proteins function as negative regulators in rice - xoo interaction and thus remove the suppression on defense positive regulators [32, 35 ]. mdago13 in addition to paz, mid, and piwi domains had two domains ribosome - inactivating proteins (rips) and dyw family of nucleic acid deaminases. ribosome - inactivating proteins (rips) are toxic - glycosidases that depurinate the universally conserved alpha - sarcin loop of large rrnas. rips are widely distributed among different plant genera and within a variety of different tissues. recent work has shown that enzymatic activity of at least some rips is not limited to site - specific action on the large rrnas of ribosomes but extends to depurination and even nucleic acid scission of other targets. for plants, rips have been linked to defense by antiviral, antifungal, and insecticidal properties demonstrated in vitro and in transgenic plants. dyw family of nucleic acid deaminases is a family of nucleic acid deaminases prototyped by the plant ppr dyw proteins that are implicated in chloroplast and mitochondrial rna transcript maturation by numerous c to u editing events. the name derives from the dyw motif present at the c - terminus of the classical plant ppr dyw deaminases. members of this family are present in bacteria, plants, naegleria, and fungi. the classical dyw family contains an additional c - terminal metal - binding cluster composed of 2 histidines and a cxc motif and is often fused to ppr repeats. ascomycete versions, which are independent lateral transfers, contain a large insert within the domain and are often fused to ankyrin repeats. fvago1 had alpha - crystallin domain (acd) of alpha - crystallin - type small (s) heat shock proteins (hsps) placed in front of the paz domain. alpha - crystallin domain (acd) of alpha - crystallin - type small (s) heat shock proteins (shsps) is small stress induced proteins with monomeric masses between 12 and 43 kda, whose common feature is the alpha - crystallin domain (acd). shsps are generally active as large oligomers consisting of multiple subunits and are believed to be atp - independent chaperones that prevent aggregation and are important in refolding in combination with other hsps. -crystallins were originally recognized as proteins contributing to the transparency of the mammalian eye lens. subsequently, they have been found in many, but not all, members of the archaea, bacteria, and eucarya. since -crystallins are induced by a temperature upshift in many organisms, they are often referred to as small heat shock proteins (shsps) or, more accurately, -hsps. -crystallins are integrated into a highly flexible and synergistic multichaperone network evolved to secure protein quality control in the cell. their chaperone activity is limited to the binding of unfolding intermediates in order to protect them from irreversible aggregation. glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. glycosyltransferases are a ubiquitous group of enzymes that catalyse the transfer of a sugar moiety from an activated sugar donor onto saccharide or nonsaccharide acceptors. the sucrose - phosphate synthases in this family may be unique to plants and photosynthetic bacteria. this enzyme catalyzes the synthesis of sucrose 6-phosphate from fructose 6-phosphate and uridine 5-diphosphate - glucose, a key regulatory step of sucrose metabolism. the activity of this enzyme is regulated by phosphorylation and moderated by the concentration of various metabolites and light. these enzymes are present in both prokaryotes and eukaryotes, and they generally display exquisite specificity for both the glycosyl donor and the acceptor substrates. in eukaryotes, most of the glycosylation reactions that generate the diversity of oligosaccharide structures of eukaryotic cells occur in the golgi apparatus. sequence of brago5 in addition to paz, mid, and piwi domains also has two cims n terminal like domain which are located after the piwi domain, cims : cobalamin - independent methonine synthase, or mete, c - terminal domain like. many members have been characterized as 5-methyltetrahydropteroyltriglutamate - homocysteine methyltransferases, mostly from bacteria and plants. this enzyme catalyses the last step in the production of methionine by transferring a methyl group from 5-methyltetrahydrofolate to l - homocysteine without using an intermediate methyl carrier. the active enzyme has a dual (beta - alpha) 8-barrel structure, and this model covers the c - terminal barrel and a few single - barrel sequences most similar to the c - terminal barrel. it is assumed that the homologous n - terminal barrel has evolved from the c - terminus via gene duplication and has subsequently lost binding sites, and it seems as if the two barrels forming the active enzyme may sometimes reside on different polypeptides. the c - terminal domain incorporates the zinc ion, which binds and activates homocysteine. this is the first report of unusual argonaute domain that needs more experimental analysis to find the role of these domains especially for argonaute genes. the results of number of alternative transcripts related to ago gene analysis show that some of the plants do not have alternative transcripts of argonaute gene but some of the plant such us aquilegia coerulea most of the argonaute loci produce alternative transcripts and the level of these alternative transcripts was highest in comparison with loci in other studied plants. chromosome location of the argonaute gene map for available a. thaliana, brachypodium distachyon, cucumis sativus, glycine max, medicago truncatula, populus trichocarpa, and vitis vinifera map chromosomes proves they do not have synteny. expression profiles of argonaute proteins in some of the plants indicated that these proteins have high expression in the seed, leaf, root, and shoot in the studied plant. previous study data demonstrated that these genes exhibited different expression levels in biotic and abiotic stress treatments such as response to cold, salt and dehydration stress, water deficit, and virus infection stresses. this shows that the transcriptional and posttranscriptional control of gene expression mediated by srnas are probably involved in plant adaptation to biotic and abiotic environmental changes. argonaute expression in the different tissue and in different circumstance may show the probable roles of these genes in plant growth and development. this study provides a comparative genomic analysis addressing the phylogenetic relationships and evolution of the argonaute gene family in 32 plant species from different families. the results of this study demonstrate that argonaute proteins in the phylogenetic analysis have three highly conserved subfamilies existing in plants. existence of paz, mid, and piwi domain in all of the sequences revealed that this protein has high conservation in different plant species. however, the role and function of some unusual domains are not clear. future studies using these argonautes will help us to determine the biological function of these genes. expression of argonaute proteins in all of the tissue showed that this protein was involved in most pathways of the plant system. some of the plants such us aquilegia coerulea have alternative transcripts and the level of these alternative transcripts was highest in comparison with other plants. | argonaute protein family is the key players in pathways of gene silencing and small regulatory rnas in different organisms. argonaute proteins can bind small noncoding rnas and control protein synthesis, affect messenger rna stability, and even participate in the production of new forms of small rnas. the aim of this study was to characterize and perform bioinformatic analysis of argonaute proteins in 32 plant species that their genome was sequenced. a total of 437 argonaute genes were identified and were analyzed based on lengths, gene structure, and protein structure. results showed that argonaute proteins were highly conserved across plant kingdom. phylogenic analysis divided plant argonautes into three classes. argonaute proteins have three conserved domains paz, mid and piwi. in addition to three conserved domains namely, paz, mid, and piwi, we identified few more domains in ago of some plant species. expression profile analysis of argonaute proteins showed that expression of these genes varies in most of tissues, which means that these proteins are involved in regulation of most pathways of the plant system. numbers of alternative transcripts of argonaute genes were highly variable among the plants. a thorough analysis of large number of putative argonaute genes revealed several interesting aspects associated with this protein and brought novel information with promising usefulness for both basic and biotechnological applications. |
preparation of hard tissues for the insertion of dental implants is usually performed by drilling at high - speed with irrigation. recently, a new concept of low - speed drilling (50 rpm) without irrigation was suggested as an alternative to the conventional procedure123. the low - speed drilling has several advantages over the high - speed drilling with irrigation. another advantage is the possibility to collect the bone cut by the drills without contamination by saliva, which can be used for an autograft6. the low - speed drilling can also provide the operator with more precise information on the path of the drill so that corrections can be made if necessary. kim.1 measured the temperature change in pig rib bone during implant site preparation by drilling at 50 rpm without irrigation and reported that drilling at 50 rpm without irrigation did not produce overheating. in the study, the animal bone without a uniform cortical layer was used. in an attempt to provide more rigorous data, in this study we evaluated heat generation during the low - speed drilling procedure without irrigation. this in vitro study was designed to simulate the clinical conditions involved in implant site preparation. a total of 10 artificial bone blocks (solid rigid polyurethane foam ; sawbones, vashon island, wa, usa) similar to human d1 bone were used in this study.(fig. 1) the artificial block bone d1 was based on the american society for testing and materials. the blocks consisted of both the cortical layer (thickness, 3 mm ; density, 0.8 g / ml) and the cancellous layer (thickness, 15 mm ; density, 0.48 g / ml). drill guides, which could accurately guide drills into their predetermined locations and orientations were designed and fabricated to be placed on the blocks. type k thermocouples (yokogawa, tokyo, japan) were used to measure temperature changes during drilling. a 4-channel handheld data logger thermometer that could measure temperature at 4 sites simultaneously (yokogawa) and allowed constant, real - time temperature readings was used to read the thermocouples. temperature measurements were made during site preparation with the diameter 2 mm twist drill (dio inc. was drilled to a predetermined depth with a 1 mm bur using the surgical drill guide. one thermocouple was inserted vertically into the 1-mm holes prepared to a depth of 6 mm. the thermocouple was placed 1 mm away from the anticipated periphery of the osteotomy to measure the temperature without damaging the cable while drilling.(fig. 2) after fixing the thermocouple, the drill guide was placed in the block and fixed using fixation screws.(fig. 3) to duplicate clinical operating conditions, the bone blocks with the thermocouple were immersed in a 37 water bath (fig. ten blocks were divided into the test and control groups (5 blocks each). in the test group, drilling was performed with the drill guide to a 10-mm depth at a rotation speed of 50 rpm without irrigation. in the control group, drilling was performed with the drill guide to a 10-mm depth at a rotation speed of 1,500 rpm with irrigation. an automated cooling system was used to deliver continuously normal saline to the external wall of the drill throughout drilling at a rate of 40 ml / min. to eliminate the effect of the drill guide on the external irrigation, additional irrigation was performed manually with a simple syringe to deliver the saline solution directly to the drill bone interface. apart from the drill speed and the irrigation, the procedures were the same for both groups. after drilling, accuracy and precision in maintaining the 1 mm distance between the thermocouple canal and the drill preparation was determined using a standard dental radiograph. the thickness of the bone substitute wall between the drill preparations and the thermocouple canals was measured. once the 1 mm wall between them was confirmed, data were included in the study. temperature values were stored in a personal computer and then analyzed using the spss version 15.0 for windows (spss inc., student 's t - test was used to calculate significant differences between the two groups. sixty drilling procedures using drill guides were performed in each group. the average drilling times were 25 and 10 seconds for the test and control groups, respectively.(fig. 4) the low - speed drilling required approximately 15 seconds longer than the high - speed drilling. data from 6 drilling sites in each group were excluded from this study, as the wall between the drill preparations and the thermocouple canals did not remain intact. the mean maximum temperatures at the drilling sites were 40.9 (range, 37.7-43.9) in the test group and 39.7 (range, 37.8-43.3) in the control group.(table 1) although statistically significant differences existed between the two groups, the low - speed drilling did not produce overheating. eriksson and albrektsson7 reported that a bone temperature of 47 for 1 minute can cause bone cell necrosis. in the present study, overheating was considered when the bone temperature was higher than 47. in terms of the heat generated during drilling, in the present study we measured temperature changes during low - speed drilling without irrigation. the measured temperature increase was very low in this experiment, compared to the critical temperature of 477. the results of this study indicated that the low - speed drilling without irrigation might be useful for implant surgery. kim.1 measured the temperature change during implant site preparation by drilling at 50 rpm without irrigation with three different drill systems and reported that drilling at 50 rpm without irrigation did not produce overheating. giro.2 evaluated the effect of the surgical technique on implant integration by performing osteotomies at 50 rpm without irrigation and 900 rpm with irrigation. the authors concluded that both techniques showed similar results and did not affect the integration of implants. gaspar.3 evaluated immediate histological alterations in rabbit tibias produced by low - speed drilling (50 rpm) without irrigation and conventional drilling (800 rpm) under profuse irrigation and concluded that the effects of implant site preparation on bone by the low - speed drilling without irrigation and the conventional drilling under abundant irrigation are similar. when drilling in bone, the recorded temperatures change exponentially with the distance to the heat sensitive element, and reproducing the position of the thermocouple in relation to the source of heat is necessary. a distance of 1 mm between the heat - producing area and the recording device is standard in most studies on heat production during drilling8910 and was accomplished using a drill guide that could accurately guide drills into their predetermined locations and orientations, the accuracy of which was tested by a standard dental radiograph. to fabricate well - tailored drill guides in the present study, diagnostic casts were created, a resin template was made using clear acrylic resin and then metal sleeves were placed in the resin template. arguably, a slower rotational speed requires more drilling time, thus producing more frictional heat and likely overheating during drilling11. in the present study, low - speed drilling required approximately 15 seconds longer in the artificial bone block that was similar to human d1 bone, compared to high - speed drilling. drill wear caused by repeated use may result in increased heat production and further damage to the bone tissue10, thus affecting the process of osseointegration of implants12. in our previous study, after 40 uses, the implant drills used in the present study were determined to generate more heat. therefore, the drills in the present study were used only 10 times to drill into the bone effectively. our results suggest that low - speed drilling without irrigation may not lead to overheating during drilling. | objectivesin this study we evaluated heat generation during the low - speed drilling procedure without irrigation.materials and methodsten artificial bone blocks that were similar to human d1 bone were used in this study. the baseline temperature was 37.0. we drilled into 5 artificial bone blocks 60 times at the speed of 50 rpm without irrigation. as a control group, we drilled into an additional 5 artificial bone blocks 60 times at the speed of 1,500 rpm with irrigation. the temperature changes during diameter 2 mm drilling were measured using thermocouples.resultsthe mean maximum temperatures during drilling were 40.9 in the test group and 39.7 in the control group. even though a statistically significant difference existed between the two groups, the low - speed drilling did not produce overheating.conclusionthese findings suggest that low - speed drilling without irrigation may not lead to overheating during drilling. |
a 66-year - old japanese woman was referred to us with a 6-month history of decreased vision and metamorphopsia in the left eye. visual acuity was 20 / 16 for the right eye and 20 / 32 for the left eye. fundus examination showed mild epiretinal membrane in the macula of the right eye, and an elevated, oval, 1-disc - diameter, reddish - orange lesion accompanied by serous detachment of the neurosensory retina in the macula of the left eye (fig. during the choroidal arteriolar filling phase of icg angiography (hra2 ; heidelberg engineering, heidelberg, germany), branching vessels (arterioles) appeared in blocked fluorescence, and a few dilated choroidal venules with dye leakage manifested in the early choroidal venular filling phase (fig. the dye proceeded extremely slowly in the choroidal venules, leaking to form polypoidal vessels. notably, the early choroidal venular filling phase revealed pulsatile movements as subtle rhythmic variations in the caliber of the choroidal venule at an a - v crossing (fig. 1b, yellow arrowhead), where the venule (fig. her left eye was diagnosed as pcv and treated with photodynamic therapy using verteporfin (visudyne ; novartis ag, basel, switzerland) according to the standard protocol (698-nm laser system, 50 j / mm, 83-s exposure time, 2,650 m spot size). within 3 months after treatment, the reddish - orange lesion gradually decreased in size with complete disappearance of the retinal detachment (fig. the present findings support the hypothesis that pulsations in pcv might occur at a - v crossings or at a - v shunts, as discussed in our previous study. importantly, the pulsations disappeared when dye leakage from the polypoidal vessel ceased after treatment, suggesting a relationship between venous pulsations and polypoidal vessel formation. regarding venous pulsations, spontaneous venous pulsation (svp) is well known on the optic disc, where the central retinal vein and artery are fixed to the bundle of the lamina cribrosa by dense collagen and elastic tissues, resulting in the vessel lumen being narrow at this location, and accounting for the greater frequency of occlusion at or near this site. svp is generally believed to be caused by the oscillation of intraocular pressure, which is transmitted to the intraocular central retinal vein across the vessel walls, during the cardiac cycle at a significantly higher level than the pressure in the retrolaminar portion of the central retinal vein. this theory may also explain the mechanism of pulsation in our case : the venous pulsations may be caused by oscillations of intraocular pressure transmitted to the choroidal venule during the cardiac cycle when there is a significant difference in intravenous pressure between both sides of the a - v crossing. the cause of the difference in intravenous pressure may be that the choroidal venule is made unusually narrow by the compression at the a - v crossing. in the retina, branch retinal vein occlusion occurs at the a - v crossing portion, particularly in arteriolar sclerosis : a vein compressed by an artery is occluded, showing stasis and dilation in the portion proximal to the a - v crossing. in the present case, a similar mechanism might contribute to the venous stasis and the increase in intravenous pressure, resulting in dilation of the portion proximal to the a - v crossing, that is, the polypoidal vessel, although occlusion did not occur. consequently, fluctuations in blood flow may occur at an a - v crossing, causing variations in the caliber of the venule. previous clinicopathologic studies revealing a close relationship between pathologic polypoidal choroidal venules and arterioles support this possibility. this study suggests that unusual compression at a - v crossings may make the venule polypoidal, and fluctuations of blood flow and pressure in the venule may cause pulsatile movements in the vessel wall. further studies elucidating the relationships between pulsation, a - v crossings, and polypoidal vessels would be helpful in understanding the pathogenesis of the formation of polypoidal vessels. | it has been reported that pulsations in abnormal vessels are observed on indocyanine green (icg) angiography in half of patients with polypoidal choroidal vasculopathy (pcv), although the mechanism of the pulsation is unknown. in this study, we report a case of pcv showing venous pulsations at an arterio - venous (a - v) crossing, and discuss a possible mechanism of polypoidal vessel formation and pulsations in pcv. a 66-year - old female presented with a reddish - orange elevated lesion and serous retinal detachment in the macula of her left eye, and was diagnosed as pcv. she was treated with photodynamic therapy (pdt), and followed - up through routine examinations, including icg angiography. icg angiography at presentation showed a branching vascular network and choroidal venules with dye leakage (polypoidal vessels) in the left eye. pulsations, supposedly of venous origin, were observed at an a - v crossing in the abnormal vessels. within 3 months after pdt, the polypoidal vessel ceased to leak and the pulsations vanished. the reddish - orange lesion gradually decreased in size with complete disappearance of retinal detachment. this study suggests that an unusual compression at an a - v crossing may make a venule polypoidal, and fluctuations of blood flow and pressure in the venule may cause pulsatile movements of the vessel wall. |
autophagy is generally considered to be a cell survival mechanism and may also contribute to cell death, depending on its various biological contexts.sphingolipids were first discovered in brain extracts in 1876, and within a century of intensive research, the chemical structures of thousands of individual sphingolipids had been elucidated.sphingolipid-associated autophagy contributes to a range of diseases, including neurodegeneration, tumors, metabolic disorders, and heart diseases. autophagy is generally considered to be a cell survival mechanism and may also contribute to cell death, depending on its various biological contexts. sphingolipids were first discovered in brain extracts in 1876, and within a century of intensive research, the chemical structures of thousands of individual sphingolipids had been elucidated. sphingolipid - associated autophagy contributes to a range of diseases, including neurodegeneration, tumors, metabolic disorders, and heart diseases. sphingolipids are abundant lipid components of eukaryotic plasma membranes that function in a wide range of biological processes. are sphingolipids involved in the composition of autophagic membranes?why do perturbations of sphingolipid metabolism by chemotherapy and nutrition starvation trigger lethal autophagy and protective autophagy, respectively?sphingolipid - mediated signals that have long been known to induce apoptosis are now also recognized to cause autophagy. are sphingolipid - associated apoptosis and autophagy interlinked?how does sphingolipid - associated autophagy occur and to what extent do alterations in autophagy contribute to disease phenotype?what drugs or compounds that target sphingolipid metabolism are attractive candidates for therapeutic development ? sphingolipids are abundant lipid components of eukaryotic plasma membranes that function in a wide range of biological processes. are sphingolipids involved in the composition of autophagic membranes ? why do perturbations of sphingolipid metabolism by chemotherapy and nutrition starvation trigger lethal autophagy and protective autophagy, respectively ? sphingolipid - mediated signals that have long been known to induce apoptosis are now also recognized to cause autophagy. how does sphingolipid - associated autophagy occur and to what extent do alterations in autophagy contribute to disease phenotype ? autophagy is generally considered to be a cell survival mechanism, and this process also contributes to cell death in several situations. sphingolipids (sls) are ubiquitous components of membrane structures, and renewed interest in sls has focused on sl - induced intracellular and extracellular signaling. moreover, studies have uncovered that a dynamic balance among sl metabolites is significant in cell fate determination. here we review the key aspects of bioactive sls that have emerged as important effectors in regulating the autophagic pathway, mediating the cross talk between apoptosis and autophagy, and determining the associated cell fate. a deeper understanding of the relationship between sl metabolism and autophagy explains how intact or impaired sl - related autophagic pathways are involved in the malfunctions associated with neurodegeneration, cancer, and other diseases. we also discuss how autophagy - regulating drugs work via cells ' sl metabolism and the methods that could be used to monitor sl - related autophagy. present and future investigations regarding sl - related autophagy will help to develop novel treatment strategies to control autophagy - related diseases. sls represent a significant class of lipids that contain a backbone of sphingoid bases and are ubiquitous constituents of membranes in eukaryotes. sls were first discovered in brain extracts in 1876, and within a century of intensive research, the chemical structures of thousands of individual sls had been elucidated. the sl metabolic pathway displays an intricate network of reactions that result in the formation of multiple sls, including ceramide (cer), dihydroceramide (dhcer), and sphingosine-1-phosphate (s1p). first, a substantial portion of sls are derived from de novo biosynthesis in most organisms, with the condensation of serine and palmitoyl - coa catalyzed by serine palmitoyl transferase to generate dehydrosphinganine. dehydrosphinganine is subsequently reduced to form dihydrosphingosine (sphinganine), which is then n - acylated by dhcer synthase to produce dhcer or cer. second, through hydrolysis via a complex lipid - turnover pathway, several specific hydrolases are involved in the turnover process, including sphingomyelinases (smases) and glucocerebrosidase (gcase). in addition to the above two sources, cer is also recycled. in this pathway, sphingosine is recycled into cer via cer synthases (cers) ; therefore, this pathway is also called the salvage pathway. the cellular metabolic homeostasis of the sphingolipidome is often achieved through the coordination of the biosynthesis and removal of sl species, which requires a delicate balance between de novo biosynthesis, turnover, and recycling. sls are found in cellular membranes, lipoproteins, and other lipid - rich structures ; however, they are synthesized in the endoplasmic reticulum (er) and golgi apparatus. the scheme in figure 1 depicts the subcellular localization of sl biosynthesis, turnover, and recycling. in addition, sls may be incorporated into other intracellular compartments, such as mitochondria or autophagosomes. the turnover and recycling of sls also occur at several intracellular locations, including the endosome, phagosome, and lysosome. thus, sls travel between organelles, and this transport occurs via either transport vesicles or transfer proteins. cert (cer transfer protein) and fapp2 (four - phosphate adaptor protein 2) have proved to be two critical sl - trafficking proteins that regulate the trafficking of sls to specific compartments within cells. lipids are increasingly implicated in the control of the membrane remodeling and vesicle transport that underlie the biogenesis of autophagosomes. however, our knowledge of whether and how sl trafficking is associated with the autophagic process remains incomplete. sls are considered to primarily have roles as components of membranes and other biological structures. however, several sl metabolites, including cer, dhcer, and s1p, have drawn attention as bioactive signaling molecules that mediate cell growth, differentiation, senescence, apoptosis, and autophagy. autophagy, ' which is derived from greek and means to eat oneself, ' ensures the synthesis, degradation, and recycling of cellular components in eukaryotic cells ranging from yeasts to mammals. at present, the following three modes of autophagy have been identified : macroautophagy (which is commonly called autophagy, ' including in this review), microautophagy, and chaperone - mediated autophagy. during the autophagic process, nonspecific or targeted cytoplasmic constituents the formation of the autophagosome is a multistep process that includes the biogenesis of the isolation membrane, followed by its elongation and closure. most autophagy - related genes (atgs) contribute to autophagosome formation, and many are well conserved from yeasts to mammals. sls are abundant lipid components of eukaryotic plasma membranes that function in a wide range of biological processes, which make sls strong candidates as possible autophagosomal lipids. several studies have implied that sls, and especially cer, are autophagosomal membrane components. in addition, sls formed by de novo biosynthesis in the er might be a driving force for the formation of the autophagosomal vacuole, in what has been referred to as the membrane extension ' step, which occurs after many of the associated autophagosomal proteins have been recruited. because the enzymes required for de novo cer biosynthesis reside in the er, it is possible that they might be recruited into autophagosomes and perhaps continue to produce sls there. the best - characterized pathway regulating autophagy includes a class i phosphatidyl inositol 3-kinase (pi3k) and mammalian target of rapamycin (mtor), which act to inhibit autophagy. although how autophagy is suppressed by these molecular signals remains to be revealed, mtor complex 1 (mtorc1) is known to phosphorylate the autophagy regulatory complex, ulk1 (containing unc-51-like kinase 1), the mammalian atg13 protein, and focal adhesion kinase - interacting protein of 200 kd (fip200). indeed, different bioactive sl species have been shown to mediate distinct autophagic pathways, described as protective autophagy and autophagy - associated cell death (figure 2), which have opposing functions in cellular life - or - death decisions. cer, which is known to induce cell cycle arrest and has been implicated in important physiological roles in cell differentiation, senescence, migration, adhesion, and inflammatory responses, is the key intermediate in sl metabolism. exogenous cer - related autophagy was shown to trigger autophagy - associated cell death, which occurs in several malignant cell types, including colon cancer, breast cancer, cervical cancer, nasopharyngeal cancer, and glioma cells. in addition to exogenous cer, endogenous cer species are critical for the induction of autophagy. tamoxifen, an estrogen receptor antagonist used to treat several types of breast cancer, has been shown to induce autophagy - associated cell death by increasing endogenous cer levels. for example, cer has been found to stimulate autophagy by regulating classic or atypical autophagic pathways and signals. via these signals, class i pi3k and akt negatively regulate autophagy, but a class iii pi3k is needed for the activation of autophagy. cer was found to promote the interaction of class iii pi3k with other regulators of autophagy and to inhibit akt by activating phosphoprotein phosphatase 2a. moreover, exogenously added cer and the accumulation of endogenous cer due to treatment with certain chemotherapeutic drugs, such as tamoxifen, inhibit the mtor signaling pathway, which has a central role in inducing autophagy and increasing the expression of beclin1, an upstream regulator of autophagy. a short - chain cer analog has also been associated with the induction of autophagy - associated cell death by increasing the transcription of the bh3-only protein, a mitochondria - associated protein that induces nonapoptotic cell death. a recent study showed that cer directly interacts with microtubule - associated protein light chain 3 (lc3) on mitochondrial membranes to induce deadly autophagy via an increase in intracellular mitophagy. s1p has been found to induce survival - mediated or protective autophagy under nutrient starvation, distinct from cer - associated autophagy - associated cell death. in contrast to cer - related autophagy, s1p - mediated autophagy has not been shown to be related to the accumulation of beclin1 protein or to the suppression of class i pi3k or akt. however, mtor was still inhibited by increased s1p levels, which suggests that s1p induces autophagy via inhibiting mtor and is independent of the class i pi3k signal. dhcer has been used as a negative control for cer treatments to induce autophagy because dhcer has long been thought to be biologically inactive. however, dhcer was recently identified as a novel sl - based mediator of autophagy. endogenously added dhcer induced a transient, early increase in dhcer levels via inhibition of dhcer desaturase, such as xm462, which successively promoted autophagy and reduced etoposide toxicity in gastric and colon cancer cells. however, anticancer agents such as fenretinide (4-hydroxy (phenyl) retinamide or 4-hpr) and gamma tocotrienol (a lipophilic antioxidant of vitamin e) induced cancer cell death through the elevation of intracellular dhcer levels. interestingly, none of the reported cer - mediated autophagic pathways is induced by both cer and dhcer. intriguingly, the accumulation of dhcer may serve as an additional switch ' to regulate cell fate ; however, the biological activity of dhcer remains controversial and unclear. in addition to the major sls that induce autophagy, gangliosides and several rare sls are also involved in autophagy - related cell fate decisions. an increase in the amount of lc3-ii and an accumulation of autophagic vacuoles were observed in cells that underwent ganglioside treatment. cer methylaminoethyl phosphonate and sphingadienes are two rare sls that promote autophagy - associated cell death through the downregulation of pi3k / akt and the activation of beclin1, similar to cer. overall, although cer, dhcer, and s1p are all able to induce autophagy, the effects of s1p - mediated autophagy are markedly mild compared with the effects elicited by cer. dhcer - related autophagic effects are moderate, and their intensity level lies between the levels caused by cer and s1p. treatment with chemotherapeutic agents often promotes the biosynthesis of intracellular cer and leads to autophagy - associated cell death ; however, elevation in s1p levels is typically a cell response to nutrition starvation and mediates cytoprotective autophagy. furthermore, cells maintain a dynamic equilibrium between the levels and the effects of cer, dhcer, and s1p. the conversion of cer to s1p simultaneously accumulates the survival effects and removes the death signals. this observation has led to the concept of a so - called sl rheostat ' or sl biostat, ' based on the relative amounts and reciprocal roles of these antagonistic metabolites, which are critical in guiding the destiny of cells. apoptosis generally initiates cell death, whereas autophagy is primarily a protective process for the cell that may also contribute to cell death. there is a sophisticated and not yet fully understood association between autophagy - related cell death and survival that depends on various biological situations. in certain cellular contexts, autophagy functions as a stress response to suppress apoptosis and promote cell survival. however, in other cases, autophagy may serve as a mechanism for caspase - dependent or -independent cell death. certain sls are now thought to elicit autophagy ; however, they have also been known to induce apoptosis. cer is a well - established inducer of apoptosis via activation of the mitochondrial pathway. in a number of different cell types, dhcer has also been suggested to exhibit antiapoptotic effects because the lipid inhibits cer channel assembly in isolated mitochondria. in addition, other sl metabolites, such as sphingosine and ganglioside, are involved in the modulation of apoptosis and autophagy. sl - associated apoptosis and autophagy are interlinked. the conversion of cer to s1p switches the cell fate from apoptosis to autophagy - induced survival. several exogenous stimuli, and particularly the activation of the enzymes that interconvert cer and s1p, such as sphingosine kinases, lead to an increase in s1p levels, a corresponding reduction in cer levels, and the antagonistic effects of cer. in addition, dhcer has been proposed to exhibit antiapoptotic effects to promote cell survival during hypoxia through the induction of autophagy, while also serving as a lipid reserve for the rapid production of cer to address cellular damage on reperfusion. dhcer serves as a unique regulator of cell fate, controlling the switch ' between cytoprotective autophagy and cer - mediated apoptosis in response to stress. intriguingly, cer promotes both apoptosis and autophagy through the inhibition of class i pi3k and akt signaling or the mtor pathway. furthermore, suppressors of apoptosis, such as the bcl-2 family, also directly bind and control beclin1. disruption of the beclin1bcl-2 complex has also emerged as a common mechanism in cer - associated autophagy. in addition to altering the balance between beclin1 and bcl-2 protein levels, endogenous cer liberates beclin1 for autophagy induction through the jnk - mediated phosphorylation of bcl-2. notably, bcl-2 has emerged as a critical regulator of the cer - mediated cross talk between autophagy and apoptosis. although the primary function of autophagy is to aid in adaptation to cellular stress under adverse conditions by enabling cells to degrade cytosolic proteins and organelles to generate a supply of essential nutrients, autophagy has also emerged in the pathological process of many disorders, including neurodegeneration, tumors, immunity responses, and heart diseases. sphingolipidoses are a collection of more than 40 genetically distinct disorders caused by inherited deficiencies of lysosomal hydrolytic activities or lipid transport. these deficiencies result in intracellular accumulations of cholesterol and lipids in the endosomal / lysosomal network, usually leading to signs of neurodegeneration. the biochemical abnormalities in sphingolipidoses are complex and lead to the accumulation of sl metabolites by diverse pathways (table 1). pick disease type c (npc) is a complex neurodegenerative sphingolipidosis characterized by the accumulation of unesterified cholesterol, sls, and complex gangliosides in late endosomes and lysosomes. the disease is caused by mutations in either the npc1 or the npc2 gene, which disturbs not only the regular transport of endocytosed lipids but also the autophagic flux, leading to an accumulation of autophagic vacuoles in cells. npc1 and npc2 are genes whose protein products mediate proper intracellular lipid transport through pathways that are incompletely understood. the brains of afflicted humans and npc - deficient animal models are marked by a loss of neurons. histological studies and cell culture experiments have shown that defective lysosomal degradation of autophagosomes may contribute to the abnormal autophagic flux. the deficiency present in npc promotes both the generation of autophagosomes and the impairment of autophagic flux. an imbalance between induction and flux through the autophagic pathway contributes to cell stress and neuronal loss in npc. gaucher disease (gd), a kind of sphingolipidosis, is characterized by the accumulation of glucosylceramide or glucosylsphingosine in the lysosomes of the cells of the monocyte / macrophage system. in gd, the point mutations within the gba (glucosidase, beta, acid) gene lead to the production of acid -glucosidase with functional, kinetic, trafficking, and/or stability defects and a resultant decrease in lysosomal function and increase in the accumulation of glucosylceramide and glucosylsphingosine. gd can be classed into three subsets, based on the age of onset and the presence of central nervous system abnormalities. type 1 is known as the non - neuronopathic form, and types 2 and 3 are differentiated from type 1 by neurodegeneration of the central nervous system with either rapid or chronic progression. reported that mutation of saposin (sap) c, and not a direct gba gene mutation, was associated with the type 3 or type 1 phenotype in cases of gd. the decrease in / absence of sap c affected gcase intracellular localization, resulting in lysosomal lipid accumulation and enhanced autophagy. this study suggested that sap c might have a role in intralysosomal sl transport, as indicated by the accumulation of glucosylceramide and cer in the lysosomes of the sap c - mutant cells. in addition, deficient degradation of autophagic substrates in cells in gd can lead to an increased risk of parkinson disease. for npc, gd, and other sphingolipidoses, the relevance of the impairment of autophagic flux to disease pathogenesis remains poorly defined. in addition, the extent to which the accumulation of autophagic substrates contributes to neuron dysfunction needs to be determined in future studies. dysregulated sl metabolism occurs in numerous cancers and has been shown to contribute to cancer progression and chemoresistance. several species of sls have been shown to have aberrant expression or metabolism in cancer cells. the tumor suppressor cer and the tumor promoter s1p are generally recognized to trigger autophagy ; however, cer and s1p have different outcomes regarding cell death and survival. nevertheless, recent studies have suggested that de novo - generated cer - associated autophagy can be lethal as well as protective for cells. for example, beljansky. determined that enhancement of cer levels through treatment with a sphk 2-selective inhibitor suppresses tumor growth by leading to autophagy - associated cell death. conversely, park. suggested that cer - cd95-perk signaling promotes cell death via the cascade activation of caspase proteins ; however, gene silencing of atg5 further strengthened the cell death process, indicating that the autophagy was protective. the contradictory activities may correspond to variations among cers in their carbon chain lengths, double bond numbers, subcellular distributions, and versatile targets. in addition, cer is metabolized into s1p by sphk 1 or sphk 2, which are associated with protective autophagy and other biological behaviors, including survival, infiltration, angiogenesis, metastasis, and resistance to anticancer drugs in cancer cells. intact and impaired sl - related autophagy has significant implications for many other diseases and pathological processes. for example, cers 5-mediated autophagy has recently been implicated in lipotoxic cardiomyopathy and hypertrophy. in addition, kdo 2-lipid a induced substantial alterations in sl metabolism and composition in raw264.7 cells, a mouse macrophage - like cell line. these changes apparently promote the de novo sl biosynthesis that is required for autophagosome generation, which is suggested to have an essential role in the processes of the innate immune response. cer also mediates the augmentation of interleukin-1(il-1) levels and the release of tumor necrosis factor (tnf) alpha that are induced by toll - like receptor 4, and this process may contribute to the enhanced inflammatory response in metabolic diseases, including obesity and diabetes, which are characterized by dyslipidemia. overall, the aberrations in the bioactive sls that mediate autophagy have been associated with diverse pathological conditions, including neurodegeneration, carcinogenesis, metabolic diseases, and inflammatory responses. understanding the specific mechanism connecting sl - related autophagy and these diseases has substantial implications for revealing these diseases ' biochemical characteristics and for designing and developing new therapeutic strategies. many human disease states may be caused by the aberrant regulation of sl metabolism - associated autophagy ; therefore, drugs and compounds that target sl metabolism, including chemotherapeutic drugs, sphingomimetics, and enzyme inhibitors, are attractive candidates for therapeutic development (table 2). many chemotherapeutic drugs elicit autophagy and exert their anticancer properties by increasing the intracellular levels of sls. a large number of malignant cells often acquire genetic deletions or mutations that render them resistant to the classic apoptotic cell death that is induced by many anticancer therapies, which ultimately results in poor prognosis. in these cases, the use of autophagy - inducing drugs offers an alternative way to induce cell death in apoptosis - resistant tumors. as reviewed in the present paper, one of the major results of the chemotherapy - mediated increase in the levels of intracellular sls, such as cer and dhcer, is cell death induction by autophagy in various human cancer cells. autophagy is initiated by tamoxifen, an antagonist of the estrogen receptor, leading to an increase in endogenous cer levels that acts against breast cancer cells. arsenic trioxide, a potent antineoplastic agent, has been used clinically for the treatment of certain types of leukemia. arsenic trioxide was shown to induce the biosynthesis of cer in both acute promyelocytic leukemia and adult t - cell leukemia cells, and the cytotoxic effects were attributed to the induction of both apoptosis and autophagy. -tetrahydrocannabinol, the major active component of marijuana, was reported to induce the activation of autophagy - mediated apoptotic cell death by increasing de novo cer biosynthesis. moreover, sl metabolism may be involved in the regulation of autophagy by other chemotherapeutic drugs, including, but not limited to, etoposide, doxorubicin, and daunorubicin. resveratrol is a natural polyphenolic phytoalexin produced by grapes and other berries that exerts its cancer - preventive properties in several animal models and exhibits its potent anticancer activities in leukemia and many solid tumors. the capacity to trigger dhcer biosynthesis contributes to resveratrol - induced autophagy - associated cell death. puissant. found that resveratrol initiates autophagy in chronic myelogenous leukemia cells through the amp - activated protein kinase (ampk)-dependent induction of autophagy and that p62 is also required for resveratrol - mediated autophagy. whether other polyphenolic compounds, such as curcumin, which has two phenolic hydroxyl groups : genistein, which has three phenolic hydroxyl groups ; and quercetin, which has four phenolic hydroxyl groups, are implicated in sl metabolism and sl - mediated autophagy remains to be determined. in clinical trials, the promise of 4-hpr as a therapeutic agent is enhanced by its unique ability to activate the autophagy - associated cell death pathway when the apoptotic pathway is deregulated, which is a characteristic that is not shared by other chemotherapeutic agents, including cisplatin and etoposide. furthermore, the accumulation of dhcer following treatment with 4-hpr was found to induce cell cycle arrest in neuroblastoma cells. sl metabolism is an exploitable target for the discovery of novel chemotherapeutics, and this target has been validated through the development of several sphingomimetics. safingol, a synthetic sphinganine, triggers autophagy in several tumor cell types by the suppression of class i pi3k and akt signaling. safingol has been assessed in phase i clinical trials alone or in combination with cisplatin for adults with advanced solid tumors and for children with neuroblastoma. safingol treatment was shown to trigger a dose - dependent decrease in s1p levels, and safingol is a promising representative drug whose primary mechanism for promoting tumor cell death is autophagy. targeting enzymes in sl metabolism is another attractive avenue to provide therapeutic benefits in sl - related human diseases. acid smases (asmases) and acid ceramidases (acdases) are crucial enzymes that modulate the synthesis and degradation of cer in sl metabolism. acdase overexpression has been observed in cancer cell lines and primary tumors and contributes to resistance to chemotherapy and radiation. the consequence of acdase overexpression is the ability to convert cer, which is often produced as a proapoptotic response to stress, to sphingosine, which can then be converted to s1p. in addition to the ability to metabolize the cer produced in response to stress, turner. found that prostate cancer cell lines overexpressing acdase also have an increased lysosomal density and increased levels of autophagy. identified an analog of cyclosporin a, psc 833 (valspodar, novartis pharma ag, basel, switzerland), a second - generation, non - immunosuppressive p - glycoprotein antagonist that inhibits acdase and generates autophagy - associated cytotoxicity in pancreatic cancer cells. b13 was found to be a potent cdase inhibitor that induced colon cancer cell death and the inhibition of colon tumor growth in a xenograft model. furthermore, lcl385, a b13 analog, enhanced the sensitivity of prostate cancer cells to radiation and inhibited tumor growth in a nude mouse model. another novel b13 analog, lcl204, has been shown to overcome the resistance of head and neck squamous carcinoma cells to fas - induced cell death in both in vitro and in vivo experiments. most acdase inhibitors are lysosomotropic agents and cause lysosomal destabilization and a change in sl metabolism enzymes in the lysosomal compartment., asmase seems to reside in classic lysosomes, where it mediates the catabolism of sphingomyelin. asmase activity is essential for lysosomal stability and the survival of cancer cells, as well as for the multidrug - resistant phenotype. because of their ability to inhibit autophagic flux, certain asmase inhibitors, such as chloroquine, siramesine, and clomipramine, are currently being tested as anticancer agents in several clinical trials and laboratory studies. asmase was also found to be a target for the treatment of niemann pick disease type a (npa), which is caused by loss - of - function mutations in the asmase gene and is a lysosomal storage disorder leading to neurodegeneration. fibroblasts from npa patients and asmase - knockout mouse brains show similar autophagolysosome accumulation and impaired autophagy. a recent study has suggested that the control of lysosome trafficking and fusion by asmase is essential to normal autophagic flux in coronary arterial smooth muscle cells and has a protective role in atherosclerosis. other chemotherapeutic treatments, such as several histone deacetylase inhibitors, were also demonstrated to lead to leukemic cell death by enhancing cer production via the degradation of sphingomyelin. one of these histone deacetylase inhibitors is suberoylanilide hydroxamic acid, which was demonstrated to trigger autophagy - associated cell death in apoptosis - deficient tumor cells, such as chondrosarcoma cells. numerous well - developed and convenient experimental methods and techniques that can be used to detect autophagy in different species systems exist. to establish that an autophagic response is occurring in sl - related autophagy, multiple methods have been used, including cellular ultrastructure studies by transmission electron microscopy, an lc3-puncta formation assay combined with immunoblots for autophagic cargoes (for example, p62 and nbr1), and the detection of autophagy - related molecules. in addition, performing a large - scale and comprehensive sphingolipidomic analysis has been challenging in the study of sl - associated autophagy. both nets and hooks are indispensable tools to allow efficient fishing ' for multiple intermediates and products directly from the sophisticated process of sl metabolism. because there is an obvious overlap between the subcellular localization of enzymes needed for sl biosynthesis and autophagosome formation, sls autophagy - associated cell death and cell survival represent the so - called yin - yang ' regulatory mechanism. the balance has been exemplified by interconvertible sls that produce opposite autophagic effects on cells that were termed as sl rheostat ' or sl biostat '. in addition, the increase in intracellular cer levels usually results from chemotherapy and often stimulates autophagy - associated cell death, although this increase has also been found to be cytoprotective. in contrast, starvation treatment triggers protective autophagy via increasing s1p levels. however, the underlying mechanisms by which chemotherapy and nutrient deprivation mediate different regulation are still largely unknown. sls mediate the cross talk between apoptosis and autophagy because certain sls share several common kinase signaling pathways that regulate cell fate that affect both apoptosis and autophagy or execute a seesaw type of regulation of key molecules. increasing new knowledge on the biochemistry and cell biology of sl - mediated autophagy is beneficial for deepening our understanding of sl - associated diseases, including neurodegeneration, cancer pathogenesis, and inflammatory responses. an imbalance between induction of and flux through the autophagic pathway contributes to cell stress and neuronal loss in npc. intact and impaired sl - related autophagy has significant implications for the development of malignant tumors. in addition, the current understanding of the effects of multiple sls on the modulation of various autophagy - related cell fates has primarily arisen from exogenous sls or pharmacological perturbations of sl metabolism. the identification of sl - mediated cytoprotective autophagy that can be shifted to cell death may provide a novel strategy for cancer therapy, including chemotherapy, sphingomimetics, sl metabolic enzyme inhibitors, and histone deacetylase inhibitors. | the autophagic process involves encompassing damaged proteins and organelles within double- or multi - membraned structures and delivering these molecules to the lytic compartments of vacuoles. sphingolipids (sls), which are ubiquitous membrane lipids in eukaryotes, participate in the generation of various membrane structures, including rafts, caveolae, and cytosolic vesicles. sls are a complex family of molecules that have a growing number of members, including ceramide, sphingosine-1-phosphate, and dihydroceramide, which have been associated with the essential cellular process of autophagy. this review highlights recent studies focusing on the regulation and function of sl - associated autophagy and its role in cell fate, diseases, and therapeutic interventions. |
periodontitis is a multifactorial chronic inflammatory disease characterized by destruction of tooth - supporting tissues. the progression of periodontal destruction involves complex interaction between periodontal bacteria and cells of immune system. the complex cytokine network that mediates the immune response includes proinflammatory cytokines, anti - inflammatory cytokines, and specific cytokine receptors. cytokines play an important role in the initiation, progression, and the host modulation of periodontal disease. statins, 3-hydroxy 3-methylglutaryl coenzyme a (hmg - coa) reductase inhibitors, prescribed to prevent cardiovascular and cerebrovascular diseases. the effectiveness of statin medication is based on their capacity to reduce serum cholesterol levels, primarily low - density lipoprotein (ldl) cholesterol. statins inhibit hmg - coa reductase and decrease the production of mevalonate, geranyl pyrophosphate, and farnesyl pyrophosphate, and subsequent products on the way to construction of the cholesterol molecule. thus, statins could inhibit inflammation, by inhibition of the cholesterol pathway and intracellularly interfering with ras superfamily protein function. interleukin (il)-1 is found in two active forms, il-1 and il-1 encoded by separate genes. both are potent proinflammatory molecules and are the main constituents of what was once called osteoclast - activating factor. the proinflammatory effects of il-1 include stimulation of endothelial cells to express selectins that facilitate recruitment of leukocytes and induction of prostaglandin e2 by macrophages and gingival fibroblasts. gingival crevicular fluid (gcf) provides a noninvasive means of studying the host response factor by change of constituents in the fluid. the inflammatory exudate from gingival microcirculation crosses inflamed periodontal tissue and en route collects molecules of potential interest from the local inflammatory reaction. therefore, the fluid offers a great potential source of factors like inflammatory mediators, tissue break down products, and host derived enzymes that may be associated with tissue destruction. increase in the levels of inflammatory mediators in gcf may be of diagnostic value in evaluating periodontal disease status. although gcf il-1 levels in periodontal disease have been studied extensively, ours could be the first study carried out to know the influence of statin medication on the inflammatory mediator especially il-1. statins also have shown to have anti - inflammatory effect. the aim of our study was to know the effect of statin medication on the inflammatory mediator gcf il-1 levels in chronic periodontitis subjects. all the volunteers were informed about the aim and the methods of the present study and gave written consent to participate. thirty patients of age group between 40 and 60 years were selected from the outpatient pool of department of periodontics, thaimoogambigai dental college and hospital, chennai. the selected subjects were grouped into two ; group - i consists of subjects with generalized chronic periodontitis and on statin medication and group - ii consists of subjects with generalized chronic periodontitis. generalized chronic periodontitis is defined by having the following criteria, subjects with clinical attachment loss of 35 mms in more than 30% of sites. other inclusion criteria were subjects with minimum number of 15 teeth, plaque index and gingival index scores of 23 for both the groups. group - i subjects were on atorvastatin medication with the dosage of 20 mg / day for a minimum period of 6 months. exclusion criteria included diabetes mellitus, smokers, and subjects on long - term steroid medications and underwent periodontal treatment in the past 6 months. a full mouth periodontal examination was carried out which included plaque index, gingival index, and clinical attachment level (cal). all gcf samples were collected from the site with maximum cal in the forenoon at the same time of the day, to allow for circadian variation seen in gcf volume. a calibrated volumetric pipette of 5 l capacity was placed extracellularly for collection of gcf [figure 1 ]. the collected sample was then transferred to a sterilized plastic vial with the help of air spray. micropipette for collecting gcf gcf samples were analyzed for il-1 using commercially available enzyme - linked immunosorbent assay (elisa) (avibion human il- elisa kit, ani biotech). the total amount of cytokines in gcf was expressed as pictogram (pg / ml). independent sample t - test was done for intergroup comparison of clinical parameters and gcf il-1 levels. all gcf samples were collected from the site with maximum cal in the forenoon at the same time of the day, to allow for circadian variation seen in gcf volume. a calibrated volumetric pipette of 5 l capacity was placed extracellularly for collection of gcf [figure 1 ]. the collected sample was then transferred to a sterilized plastic vial with the help of air spray. micropipette for collecting gcf gcf samples were analyzed for il-1 using commercially available enzyme - linked immunosorbent assay (elisa) (avibion human il- elisa kit, ani biotech). the total amount of cytokines in gcf was expressed as pictogram (pg / ml). data were expressed as mean and standard deviations. data analysis was carried out using spss as software for statistics. independent sample t - test was done for intergroup comparison of clinical parameters and gcf il-1 levels. all gcf samples were collected from the site with maximum cal in the forenoon at the same time of the day, to allow for circadian variation seen in gcf volume. a calibrated volumetric pipette of 5 l capacity was placed extracellularly for collection of gcf [figure 1 ]. the collected sample was then transferred to a sterilized plastic vial with the help of air spray. gcf samples were analyzed for il-1 using commercially available enzyme - linked immunosorbent assay (elisa) (avibion human il- elisa kit, ani biotech). the total amount of cytokines in gcf was expressed as pictogram (pg / ml). independent sample t - test was done for intergroup comparison of clinical parameters and gcf il-1 levels. independent sample t - test was done for intergroup comparison of clinical parameters and gcf il-1 levels. the mean scores of gcf il-1 levels in group - i and group - ii were 180.73 32.15 and 308.20 27.73 pg / ml, respectively. on comparison of mean gcf il-1 levels of groups i and ii, gcf il-1 levels in generalized chronic periodontitis subjects who were on statin medication (group - i) were lower (180.73 32.15) than the generalized chronic periodontitis subjects (308.20 27.73) without statin medication (group - ii). the difference was statistically significant (p < 0.001) [table 1 and figure 4 ]. the mean values of plaque index and gingival index scores of group - i and group - ii were 2.6 and 2.6 and 2.5 and 2.6, respectively. the mean values of cals of group - i and group - ii were 4.1 and 3.9 mms, respectively. on comparison of mean values of plaque index score, gingival index score and cals of group - i and group - ii, the difference was statistically non significant, [tables 2 and 3 ]. group - i and group - ii subjects were selected in such a way that both groups have similar amount of clinical parameters like gingival inflammatory status, plaque score, and clinical attachment loss. mean gcf interleukin-1 levels in patients of chronic periodontitis mean gcf il-1b levels in groups - i and ii mean plaque index scores in patients of chronic periodontitis mean gingival index scores of patients of chronic periodontitis periodontal disease process is site - specific and has multifactorial origin where periodontal pathogens, host response, genetic, systemic, and behavioral risk factors interplay to develop the disease process. hence, various measures have been taken to include microbial, immunologic, systemic, and genetic factors, in addition to traditional clinical and radiographic parameters, for assessing patient 's periodontal status. inflammatory mediator levels within the gcf have been considered as subclinical marker of progression and severity of periodontitis. in our study, we used micropipette of known internal diameter for collection of gcf. gcf in the crevice migrates into the tube by capillary action and because the internal diameter is known the volume of fluid collected can be accurately determined by measuring the distance the gcf has migrated. advantage of this technique is that it provides undiluted sample of native gcf whose volume can be accurately assessed as given by griffiths. in our study, group - i and group - ii subjects were selected in such a way that both groups have similar amount of clinical parameters like gingival inflammatory status, plaque score, and clinical attachment loss, and their mean values between two groups were statistically nonsignificant. in this study, the mean gcf il-1 levels were lower in chronic periodontitis patients on statin medication than chronic periodontitis patients without statin medication which is similar to study reported by sakoda., who found that simvastatin reduces il-1-mediated production of inflammatory mediators il-6 and il-8 in cultured human epithelial cell lines. our study could be the first study to assess the gcf il-1 levels in chronic periodontitis patients who are on statin medication. one reason could be that statins deplete the isoprenoids, which inhibit the signalling pathway for il-1- and il-6-mediated inflammation as stated by omoigui. isoprenoid precursors are necessary for the posttranslational lipid modification (prenylation) and are needed for the function of ras and guanosine triphosphatases (gtpases). these gtpase proteins such as ras, rho, rac, and rab (particularly rho) are intracellular signalling proteins which, when activated, are involved in receptor coupled transduction of signals from extracellular stimuli to cytoplasm and the nucleus. another reason for the anti - inflammatory effect of statins could be due to the beneficial effects of statins which is mediated through the lowered ldl cholesterol levels, which has been suggested to have anti - inflammatory properties as given by matsuura. sangwan., in his study found that hyperlipidemic patients are more prone to periodontal disease and statins have positive impact on periodontal health. periodontitis is widely accepted as a risk factor for cardiovascular disease due to elevated inflammatory mediators in periodontal lesions and consequently increased serum levels. the administration of statins to cardiovascular patients may have additional benefits through inhibition of inflammation in oral tissues. meisel., described statins as effect modifiers in the relationship between periodontitis and its inflammatory counterparts in the systemic circulation. lindy., reported that patients on statin medication exhibited fewer signs of periodontal injury than subjects without statin regimen and cunha - cruz., showed the association of statin use with reduced tooth loss rate in chronic periodontitis patients. these finding indicate that statins might have beneficial effect not only in periodontal disease but also in cardiovascular disease. simvastatin and atorvastatin, as a local drug delivery, have shown to have several advantages in the treatment of periodontal diseases. the antioxidant and anti - inflammatory properties of locally delivered statins could further facilitate healing of periodontal intrabony defects. however, long - term clinical studies in human subjects are required to evaluate the potential benefits of statins in periodontal regenerative therapy. statins are now among the frequently prescribed medication and are currently used by about 25 million people worldwide. the safety and tolerability of statins myopathy and its serious complication rhabdomyolysis are the potential effect of therapy with the available statins, but occur very rarely. the population treated with statins is likely to increase dramatically in near future, because they are now recommended also for people with low or normal cholesterol level, especially as a secondary prevention. the results of our study proved the anti - inflammatory effect of statins on chronic periodontitis. patients of chronic periodontitis receiving statins would have additional benefits, if the anti - inflammatory effect of statins is confirmed through longitudinal further studies. | objectives : statins are the group of lipid - lowering drugs commonly used to control cardiovascular and cerebrovascular diseases. statins have potential anti - inflammatory effect by blocking the intermediate metabolites of the mevalonate pathway. the objective of this study was to evaluate the anti - inflammatory effect of statin medication in chronic periodontitis patients.materials and methods : thirty patients of age group between 40 and 60 years were selected from the outpatient pool of department of periodontics, thaimoogambigai dental college and hospital, chennai. thirty patients selected were grouped into two groups, group - i consists of patients with generalized chronic periodontitis and on statin medication and group - ii consists of patients with generalized chronic periodontitis. clinical parameters were recorded and gingival crevicular fluid (gcf) samples were analyzed for interleukin (il)-1 using commercially available enzyme - linked immunosorbent assay.results:the mean gcf il-1 levels in generalized chronic periodontitis patients who are on statin medication (group - i) were lower than the generalized chronic periodontitis patients without statin medication (group - ii).conclusion : reduction of gcf il-1 levels in statin users indicate that statins have anti - inflammatory effect on periodontal disease. |
minimally invasive surgical (mis) total knee arthroplasty (tka) was developed to facilitate early and intermediate - term rehabilitation. mis generally includes reduced length of skin incision, less invasive arthrotomy, avoidance of tibiofemoral dislocation or hyperflexion, and use of special cutting blocks and retractors [2, 5 ]. for example, in terms of typical knee scores, some authors reported superior results for mis tka [2, 4, 7 ], whereas others found outcomes to be similar for mis tka and conventional tka [12, 13, 15 ]. given the less invasive dissection of the extensor apparatus, mis tka might also be associated with better post - operative gait characteristics. one research group found superior gait pattern among mis patients [1, 9 ], but their studies dealt only with navigated mis tka and failed to analyse kinetic gait data. conflicting findings were reported by satterly. in a recent publication. comparing the tka approaches, midvastus, subvastus and mini - parapatellar with the standard parapatellar approach similarly, wegrzyn. reported no advantages in gait characteristics for mini - subvastus mis tka as compared to conventional tka. also, nestor. compared mis and standard tka with regard to gait characteristics and reported no effect of the surgical approach. however, that study failed to analyse kinetic and kinematic gait data. to the best of our knowledge, only few studies to date have investigated potential effects of mis tka on gait characteristics. while some researches investigated only navigated mis tka [1, 9, 16 ], others failed to determine a full set of gait parameters (kinetics, kinematics). investigated gait after standard tka versus mis tka (mini - subvastus) and reported no advantage for the mis procedure. given conflicting reports in the literature, it was the aim of our study to determine in a prospective, comparative setting whether mis influences the outcome of tka in terms of typical 3d gait parameters. as mis tka claims to apply a less invasive dissection of the extensor apparatus, we expected that this would result in, e.g. faster walking speed, less double support time, higher vertical ground reaction force, improved sagittal knee rom. to know whether these ideas are true might influence orthopaedic surgeons decisions whether to do or not to do mis in tka (together with other outcome parameters such as revision rate, score outcome and quality of life). it was hypothesized that mis would affect temporospatial parameters (h1), ground reaction forces (grf) (h2), knee kinematics (h3) and knee kinetics (h4). it was also planned to investigate kinematic and kinetic variables of joints other than the knee, but these were defined as exploratory and therefore not linked to a hypothesis. applying a prospective, comparative study design, consecutive patients with osteoarthritis on the waiting list for tka were included. exclusion criteria were (1) age younger than 55 years or older than 80 years, (2) neuromuscular or neurodegenerative disease, (3) prior arthrodesis in any joint of the lower limbs (except for toes ii v), (4) prior tka on the contralateral side, (5) prior arthroplasty of the ipsilateral hip or ankle and (6) constant need for walking aids. 1patient flow patient positioning, antibiotic and deep vein thrombosis prophylaxis, draping and tourniquet control were standardized, and identical cruciate - retaining tkas were performed in both groups (scorpio ; stryker corp, kalamazoo, mi, usa) using intramedullary referencing in the femur and extramedullary referencing in the tibia. in accordance with the clinical routine at our institution, the patella was left unresurfaced. in the standard tka group, a midline skin incision and a standard medial parapatellar arthrotomy were performed and the patella was everted. the prosthesis was implanted according to the manufacturer s instructions using a measured resection technique and standard cutting blocks and instruments. in the mis tka group, a midline skin incision was followed by a medial mini - midvastus arthrotomy (13 cm). special downsized retractors and cutting jigs were used in accordance with the operation manual for the scorpio mis procedure, as provided by the manufacturer. the major differences as compared to standard tka were less invasive arthrotomy, absence of patella eversion, use of special instruments and the fact that the tibiofemoral articulation was dislocated or hyperflexed only during cementing of the tibia [2, 5 ]. patients were mobilized from the second post - operative day under supervision of our physiotherapists. exercises included continuous passive motion, assisted and unassisted knee extension, walking and stair - climbing with two crutches, and progression as tolerated. preoperative data were collected 1 month before surgery, and post - operative data were collected 8 weeks post - operatively. 3d gait analysis was performed preoperatively and 8 weeks post - operative with a 3d motion analysis system (vicon, oxford, uk and amti, watertown, ma, usa) applying a 4-segment lower - body marker model. during level walking at self - selected speed temporospatial parameters, joint angles (kinematics), external joint moments (kinetics) and grfs were determined with the software packages of the manufacturer of the motion analysis system (workstation v4.6 and polygon authoring tool v3.1 ; vicon, oxford, uk). this study shows that with dynamic calibration, overall accuracy was 63 5 m. the study protocol was approved by the ethics committee of our medical university, and written informed consent was obtained from all patients before inclusion in the study. to analyse the impact of mis on 3d gait parameters, we used a multivariate analysis of variance (manova) including the main effects time (pre- and post - surgery) and surgical group and the group - by - time interaction effect. the gait parameters (i.e. the dependent variables) were grouped according to the hypotheses h1 to h4 and analysed separately. to determine the significance of the multivariate tests, we used the hotelling - spur statistics. power analysis was done for a group - by - time interaction in a repeated measure analysis of variance including two groups and two time points (alpha = 0.05, beta = 0.20). the interaction term reflects differences with regard to the change in gait pattern between the two groups. a sample size of 20 patients per group (40 in total) is sufficient to detect an interaction effect of cohen s f = 0.45. sample characteristics are given as means, standard deviations, range and frequencies. to analyse the impact of mis on 3d gait parameters, we used a multivariate analysis of variance (manova) including the main effects time (pre- and post - surgery) and surgical group and the group - by - time interaction effect. the gait parameters (i.e. the dependent variables) were grouped according to the hypotheses h1 to h4 and analysed separately. to determine the significance of the multivariate tests power analysis was done for a group - by - time interaction in a repeated measure analysis of variance including two groups and two time points (alpha = 0.05, beta = 0.20). the interaction term reflects differences with regard to the change in gait pattern between the two groups. a sample size of 20 patients per group (40 in total) is sufficient to detect an interaction effect of cohen s f = 0.45. pre- and post - operative participant characteristics are detailed in table 1.table 1participant characteristics presented as means and standard deviationsmis tka (n = 17)standard tka (n = 20) p valueage (year)66.4 5.068.2 7.2n.s.height post - operative (month)1.66 0.081.65 0.08n.s.weight post - operative (kg)81.3 13.583.4 11.5n.s.bmi post - operative (kg / m)29.5 3.830.7 3.5n.s.gender female1111n.s. male69side left97n.s. right813 bmi body mass index, tka total knee athroplasty, mis minimally - invasive surgery participant characteristics presented as means and standard deviations bmi body mass index, tka total knee athroplasty, mis minimally - invasive surgery for the temporospatial parameters, we found the factor surgical group to have no influence. however, we observed a significant pre - to - post - operative increase in stride length for both groups (p = 0.031). analysis of the vertical component of the grf did not reveal any influence of the factors surgical group or time, nor were there time group interactions for any of the three components of grf (h2). for sagittal knee kinematics, neither the surgical group nor the factor time was seen to have an influence, nor were there time group interactions. frontal knee kinematics showed significant time group interactions for the maximum valgus during gait (p = 0.001) : in pre - to - post - operative comparison, the maximum valgus increased in the mis group, whereas it decreased in the conventional group (h3). sagittal knee moments (extensor and flexor moment) were affected neither by the surgical group nor by the time. no time group interactions were observed. similarly, there were no group differences or time group interactions in knee moments in the frontal plane (h4). (for detailed results, see tables 2 and 3).table 2descriptive statistics of temporospatial and kinematic gait parametersunitmis tkatkaprepostprepostmeansdmeansdmeansdmeansdtemporospatial parameter gait velocitym / s0.90.20.90.20.80.20.90.2 stance% gait cycle60.82.660.52.162.34.161.42.4 swing% gait cycle39.22.639.52.137.74.138.72.4 double supports0.30.10.30.10.30.20.30.1 double support% gait cycle24.06.122.14.125.88.823.94.5 stride lengthm1.10.21.10.11.00.21.00.1 cadencesteps / min102.713.1102.38.0101.411.7102.311.3 step widthm0.10.00.10.00.20.00.20.0 gait cycle durations1.20.21.20.11.20.21.20.1kinematics sagittal sagittal knee angle (+ values : flexion) max knee flexion stance19.27.821.55.520.08.018.36.9 max knee flexion swing56.711.058.76.352.29.152.37.0 min knee flexion gait cycle12.56.815.34.313.48.113.06.2 knee flexion at toe off33.97.33.365.234.47.334.15.2 knee flexion at foot strike14.56.215.94.314.37.512.55.6 total sagittal knee rom gait cycle45.111.744.96.840.310.441.27.9 sagittal hip angle (+ values : flexion) max hip flexion gait cycle32.46.534.85.937.16.735.66.7 min hip flexion gait cycle5.46.74.07.41.89.81.66.7 total sagittal hip rom gait cycle37.75.238.84.035.37.937.24.8 sagittal ankle angle (+ values : dorsiflexion) first minimum gait cycle1.710.63.33.81.97.64.64.1 maximum gait cycledeg17.010.316.33.416.76.916.53.3 second minimum gait cycle4.612.16.06.62.69.94.37.3 total sagittal ankle rom gait cycle23.35.023.03.921.25.722.84.8 frontal frontal pelvis angle (pelvic obliquity) (+ values : up) maximum gait cycle1.72.71.42.72.23.32.82.8 minimum gait cycle2.82.42.62.12.32.91.92.1 total frontal pelvis rom gait cycle4.52.04.02.24.52.24.62.4frontal hip angle (+ values : abduction) maximum gait cycle6.55.79.73.87.45.97.44.0 minimum gait cycle0.86.12.64.30.16.60.14.3 total frontal hip rom gait cycle7.33.57.13.47.53.67.33.6 frontal knee angle (+ values : varus) maximum stance8.55.85.05.07.48.56.96.4 minimum stance2.65.16.34.05.86.94.45.0 total frontal knee rom stance11.04.611.35.013.25.711.26.2table 3descriptive statistics of kinetic gait parameters and ground reaction forcesunitmis tkatkaprepostprepostmeansdmeansdmeansdmeansdground reaction forces grf vertical (fz) (+ values : up) fz1 : first maximumn / kg9.60.49.60.29.70.49.50.3 fz2 : first minimumn / kg8.60.68.70.48.70.58.70.3 fz3 : second maximumn / kg9.90.69.90.49.70.59.70.4 fz1-time : time to fz1% stance31.17.430.35.131.27.431.66.4 fz2-time : time to fz2% stance48.76.649.45.951.58.851.36.9 fz3-time : lime to fz3% stance70.58.474.25.074.74.973.73.3 grf ap shear (fx) (+ values : anterior) fx1 : minimumn / kg0.80.21.00.21.00.40.90.2 fx2 : maximumn / kg1.10.41.30.41.10.41.20.3 fx1-time : time to fx1% stance16.85.516.76.916.66.015.75.2 fx2-time : time to fx2% stance86.14.589.11.985.66.287.83.1 grf ml shear (fy) (+ values : lateral) fy1 : first minimumn / kg0.40.20.40.10.50.10.50.1 fy1-time : time to fy1% stance31.26.633.04.930.47.831.65.7kinetics (internal joint moments) sagittal sagittal hip moment (+ values : extensor) maximum gait cycle0.70.20.80.20.80.30.80.2 minimum stance0.30.20.30.20.30.10.30.1 minimum swing0.20.10.30.10.30.10.30.1 sagittal knee moment (+ values : extensor) maximum gait cycle0.20.10.30.10.20.10.20.1 minimum stance0.30.10.20.10.20.10.20.1 minimum swingnm / kg0.20.10.20.10.20.00.20.0 sagittal ankle moment (+ values : plantarflexion) maximum gait cycle1.30.31.30.21.30.31.30.2 frontal frontal hip moment (+ values : abduction) maximum stance0.90.21.00.20.90.20.90.2 frontal knee moment (+ values : abduction) maximum stance0.50.20.30.20.50.20.40.1 minimum stance0.10.00.00.00.10.10.00.0 descriptive statistics of temporospatial and kinematic gait parameters descriptive statistics of kinetic gait parameters and ground reaction forces beyond the hypotheses also no significant group differences were found for joint angles or joint moments of the hip or ankle. as the most important finding of our study, mis was seen to not result in a superior walking pattern 8 weeks after tka. most gait patterns showed no significant differences between groups, except for inferior results in mis patients regarding maximum valgus kinematics. an attempt to integrate our results in the findings made in previous research revealed that the specific issue of gait characteristics of mis versus standard tka was only rarely dealt with. two months post - operative wegrzyn. compared gait in mini - subvastus mis tka and standard tka patients. similar to our findings, they observed no advantages for the mis procedure. also, nestor. investigated gait after mini - midvastus mis tka versus standard tka and found no differences between the groups. however, no comprehensive gait analysis was performed because kinetic and kinematic gait data were not assessed. satterly. investigated the effect of four different surgical approaches in navigated tka (medial parapatellar, mini - medial parapatellar, medial subvastus and mini - midvastus) with regard to gait characteristics. they reported that none of those approaches showed a superior outcome with regard to gait. however, the results of that study might be of less relevance for the specific issue at hand, because the authors (a) analysed navigated tka and (b) did not report having investigated strict mis tka as previously defined [2, 5 ]. our findings stand in contrast to those of a research group that found superior gait pattern in mis patients [1, 9 ]. however, again the authors investigated navigated mis tka, which is a slightly different issue, and failed to collect kinetic gait data. in summary, only the above - mentioned study by wegrzyn. investigated all aspects of 3d gait analysis (temporospatial, kinematic and kinetic parameters) after non - navigated mis tka versus non - navigated standard tka. recently, the results of our mis versus standard tka population were published in terms of other outcome parameters : womac scores, knee extensor / flexor torque, radiographic outcome and tourniquet / operating time. we found womac score, knee extensor and flexor strength to have equal results, and leg axis, component positioning and tourniquet / operating time in mis patients to even be slightly inferior. thus, it would seem that the concept of mis tka does not work in our hands. we feel that this can not be attributed to a learning curve, because mis tka has been routinely performed at our institution for 5 years. for this reason, we regarded ourselves as being beyond the learning curve as published by king. however, and also in the light of the above - mentioned studies [1, 9, 16 ], it can be speculated whether computer - assisted surgery could have altered our findings. more valgus kinematics in mis tka might also be discussed in the context of the above - mentioned previous publication. whole leg axis was significantly more valgus in the mis tka group as determined by whole leg radiographs. those findings of static alignment are in good agreement with the valgus kinematics during gait (dynamic alignment) observed in the current study. the slightly inferior component positioning and whole leg alignment in mis tka were attributed to the limited surgical access. it indeed might also be speculated whether such valgus leg alignment is associated with medial condylar lift - off. as previous research indicated that condylar lift - off is related to increased polyethylene wear [6, 17 ] regardless of the issue of mis versus conventional, there is good consensus that in most patients, tka is advantageous in terms of pain and function. reviewed studies that investigated gait in tka patients versus controls and reported as follows : tka patients have (1) less total sagittal knee rom, (2) less knee flexion during the swing phase, (3) less rom during the loading phase of stance (4) abnormal (non - biphasic) knee moment pattern in the sagittal plane. others even reported that tka did not result in improvement of any of the kinetic or kinematic gait pattern although the patients had benefitted in terms of pain and function. therefore, it could be argued that gait analysis is not a useful tool for evaluation of tka. in this connection, we agree with wright who recommended a combination of a knee score, a health - related quality - of - life questionnaire and an activity score. firstly, we did not randomize the patients because of the impracticability of persuading surgeons to modify routines with which they were comfortable. more post - operative measurement would have provided additional information on the course of gait recovery. thirdly, mis tkas were always performed by one of two experienced knee surgeons, whereas standard tkas were performed by a larger pool of surgeons with varying degrees of experience. that could have exerted a favourable impact on the gait parameters in the mis group, while in actual fact, we found no differences. in addition, it would have been of interest to test also at different walking speeds and inclinations (e.g. treadmill) and to perform further tests in the early post - operative period (e.g. after 4 weeks). as we investigated only the mini - midvastus type of mis surgery, we can not expand our findings to other types of mis tka surgery (e.g. subvastus or quadsparing). however, the study at hand is the second publication (after wegrzyn.) to report on an investigation of all aspects of 3d gait analysis (temporospatial, kinematic and kinetic) after non - navigated mis tka versus non - navigated standard tka. therefore, we believe it substantially contributes to the current scientific knowledge. the strengths of the study also lie in its prospective, comparative design (level of evidence : 2). in addition to other tools (knee scores, quality - of - life scores, revision rates, etc.), gait analysis delivers important information on the outcome of tka, especially regarding functional outcome. in conclusion, we did not identify superior gait characteristics in mini - midvastus mis tka patients 2 months post - operative. because we previously also determined equal or slightly inferior results of mini - midvastus mis tka with regard to knee scores, knee torque, radiographic outcome and tourniquet / operating time, we discontinued the procedure. | purposeprevious studies dealing with gait after minimally invasive surgery (mis) total knee arthroplasty (tka) are rare and insufficient. it was the purpose of the study to determine in a prospective, comparative setting whether mis influences the outcome of tka in terms of typical 3d gait parameters.methodspatients scheduled for tka or mis tka were invited to participate. mis tka was defined as tka with shorter skin incision, mini - midvastus arthrotomy, special instruments, and avoidance of tibiofemoral dislocation and patella eversion. all other intra- and perioperative aspects were identical for both groups. a 3d gait analysis was performed with a vicon system 1 month preoperative and 8 weeks post - operative. a multivariate analysis of variance was conducted including the main effects time (pre- and post - surgery) and surgical group and the group - by - time interaction effect.resultsseventeen mis tka patients and 20 tka patients were eligible for the final analysis. we determined neither inter - group differences nor time group interactions for any gait variables (temporospatial, ground reaction forces, joint angles and joint moments)except for the varus valgus knee kinematics. in pre- to post - operative comparison, the maximum valgus sway increased in the mis group, whereas it decreased in the conventional group (p = 0.001).conclusionfrom our findings, it was concluded that mis tka does not result in a superior walking pattern 8 weeks post - operative. because we previously also observed mini - midvastus mis tka to have equal or slightly inferior results with regard to knee scores, knee torque, radiographic outcome and tourniquet / operating time, we discontinued the procedure.level of evidenceprospective comparative study, therapy, level ii. |
cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (cadasil) is a systemic arteriopathy due to missense mutations of notch3 gene. earlyonset ischemic strokes and vascular dementia are the main clinical features. migraine, psychiatric disorders, and epileptic seizures are additional features 1. asymptomatic cerebral microbleeds are also frequent, while spontaneous lobar hemorrhages are very rare 2. vascular dementia generally follows recurrent strokes, while progressive subcortical dementia without strokes is rare 3, 4. cognitive decline generally starts with alterations in attention and executive functions and is the result of dysfunction within the subcortical / frontal network. in contrast, visuospatial abilities, recognition, and semantic memory generally remain spared until the late stages 5. the pathological hallmarks of cadasil are the degeneration of vascular smooth muscle cells (vsmcs) and extracellular accumulation of granular osmiophilic materials (goms) 6. notch3 gene mutations are stereotyped and alter the odd number of cysteines in one of the 34 egflike repeats (coded by exons 224) of notch3. earliest studies suggested that notch3 gene mutations were mainly clustered in some exons, but the increasing number of new mutations out of these exons strongly weakens this assumption, with relevant meanings about the molecular diagnosis. in fact, due to the high costs, the mutation screening covering the whole region coding for egf repeats is not generally performed in all cases 7. we report a cadasil patient carrying a notch3 gene mutation involving exon 24 and presenting with recurrent transient global amnesia (tga) and atypical cognitive decline. a 73yearold woman underwent our observation for recurrent tga, cognitive impairment, psychiatric disorders, and delirium. her father experienced his first stroke at age of 52 and suffered from recurrent cerebrovascular events. the amnesia involved both anterograde and retrograde memory, consciousness was spared, and neurologic deficits were absent. the episodes endured, respectively, 18 and 10 h. a gradual and spontaneous recovery occurred. at electroencephalographic registrations, acute cerebral lesions were absent at brain mri, although some focal white matter hyperintensities were noticed in flair and t2dependent images. according to the criteria of hodges and warlow 8, a diagnosis of tga was made in both cases. about 2 years later, memory difficulties, disturbs in spatial and temporal orientation and name anomia onset. 18ffdg pet revealed a reduction of perfusion in the left temporal lobe, in the right parietal lobe and in the both frontal lobes. a suspect of alzheimer 's disease was made, and she was treated with donepezil first, then with memantine and finally with rivastigmine without any improvement. five years later, she started suffering from recurrent vascular events, including a transient visual deficit and a transient global aphasia. finally, she was admitted in hospital for an acute worsen of her orientation, attention, and language disturbance, recovered spontaneously in 24 h. the neurologic examination was consistent for a progressive subcortical dementia with mild pyramidal and extrapyramidal involvement. brain mri disclosed a multifocal hyperintense damage of the white matter, mainly subcortical, apparently sparing the ufibers and with the typical involvement of the temporal poles (fig. as the clinical features and the mri findings were suggestive for cadasil, skin biopsy and notch3 gene analysis were performed. the flair images (a k) demonstrated the multifocal damage of the white matter involving the brainstem (a), the temporal poles (a, e, i), the left external capsule (f), the periventricular regions (e, j, k), the subcortical regions apparently sparing the ufibers (b k). the gradientecho image (l) showed one microbleed in the right basal ganglia region. a severe degeneration of vsmcs and paspositive material was found in the tunica media. at electron microscopy, goms were detected in several arteriolar vessels, as well as vsmc degeneration, loss of adherence between vsmcs, and abundant cellular debris. genomic dna was extracted from peripheral blood leukocytes and amplified by pcr with 23 sets of primers specific to investigate coding sequences and intron exon boundaries of exons 224 of notch3 gene. the pcr products were sequenced in both directions using the abi prism bigdye terminator cycle sequencing ready reaction kit and abi prism 377 (applied biosystems). transcript notch3001 (ensembl genome browser entry # enst00000263388) was used as standard sequence. the notch3 gene analysis disclosed an alteration of the coding sequence within the exon 24. this variation consisted in the substitution of a guanidine with a thymine at the second position of the codon 1298 and leaded to the replacement of a cysteine with a phenylalanine (p.cys1298phe), causing the loose of a cysteine in the egflike domain 33 (fig. 2). this mutation was not found in 100 healthy individuals and was recently reported to cause cadasil 9. notch3 gene analysis. the forward sequence of the exon 24 disclosed the heterozygous gt substitution at the second position of the codon 1298 (tgcttc). the clinical features of the case reported here were suggestive for a slow progressive subcortical dementia onset in seventh decade and proceeded by recurrent tga and psychiatric disorders. in cadasil, tga is very unusual, although there are many factors which potentially could cause tga, such as migraine, seizures, cerebrovascular events, and mood disorders. diagnosis is clinical, although diffusionweighted images can reveal focal signal alterations in ca1 field of hippocampus, when mri was performed 2 days after the event 8, 10. in our case, clinical criteria were present, but no diffusion abnormalities were noticed, although there was evident the involvement of the white matter very close to the hippocampus. in recurrent tga patients, an increase prevalence of hippocampal lesions was reported, suggesting preexisting vulnerability of memory network 11. in cadasil, temporal white matter involvement is frequent and very early, even in presymptomatic subjects and in pediatric cases, where temporal lobe was the second most involved after frontal lobe 1, 12. our report suggest to consider cadasil in those cases with recurrent tga, especially when mri shows multifocal hyperintensities affecting the cerebral white matter or when it is followed by cognitive decline. cognitive impairment in cadasil is similar to that reported for sporadic subcortical ischemic vascular dementia and is thought to the result of dysfunction within the subcortical / frontal network due to the leukoaraiosis, although a multiinfarction origin based on the accumulation of cerebral infarcts was also proposed 5, 13, 14. cognitive decline preceding strokes is unusual in cadasil, but several cases were reported 1, 3, 4. in these cases, it is not clear whether the cognitive impairment is due to the accumulation of focal asymptomatic ischemic lesions rather than the disconnection mechanism due to the diffuse white matter damage. in our patient, the cognitive decline correlated better with leukoaraiosis : mri showed diffuse white matter damage, with the typical involvement of temporal lobe, while lacunar infarcts were rare. moreover, only one microbleed was found and the involvement of the white matter near ufibers supported a disconnection mechanism. these findings were similar to our previous case report of vascular dementia preceding strokes 4. in our patient, there were several stigmata addressing toward cadasil diagnosis : the family history, the psychiatric disorders, the migraine with typical aura but with the atypical late onset, the eeg alterations, and, at the end, the recurrent vascular events. despite these features, the late onset of the cognitive decline, the slow gradual progression, and the presence of amnestic deficits probably were misleading temporal pole involvement, which is rare in chronic hypertensive encephalopathy, is high specific for cadasil, especially when bilateral, as well as the external capsule involvement 7. the p.cys1298phe mutation was recently reported, but there is no information about the clinical presentation 9. until now, only two mutations were reported within the exon 24, both in italian patients. it must be stressed that in this case the recognition of the pathogenetic mutation has required necessarily the analysis of the whole sequence coding the 34 egflike repeats. a partial study would fail to identify the mutation, hindering the diagnosis of cadasil and the following genetic counseling in other family members. due to the high cost of a complete screening, notch3 gene analysis frequently is limited to those cases with strong suspect 7. thus, patients carrying unrecognized notch3 mutations with unusual clinical presentation can miss the diagnosis. so, it should be considered that even when the partial notch3 gene analysis is normal, cadasil is still possible and, in the presence of concrete suspect, skin biopsy is necessary to achieve the correct diagnosis. in conclusion, the striking features of this case were the atypical late onset of the vascular dementia, the recurrent tga preceding cognitive decline, and the identification of a notch3 gene mutation affecting the exon 24 that is rarely involved in cadasil. phenotype correlation, the incomplete description of the distribution of cadasil mutations in the different populations and the lack of sensitive biomarkers, in the presence of a clinical suspect, the diagnosis of cadasil can be excluded only completing the mutational analysis of the whole sequence coding the 34 egflike repeats. | key clinical messagedespite transient global amnesia is considered unusual in cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (cadasil) and causal relation is still unclear, this report suggests to consider cadasil in those patients with recurrent transient global amnesia, especially when mri shows multifocal hyperintensities affecting the cerebral white matter or when it is followed by cognitive decline. |
however, metastatic disease can arise in approximately 20%30% of patients and accounts for over 28,000 deaths a year in the united states.1 androgen - deprivation therapy (adt) has been the standard treatment for advanced and metastatic prostate adenocarcinoma for decades and is achieved by medical castration (luteinizing - hormone releasing hormone [lhrh ] agonist or antagonist) or surgical castration (bilateral orchiectomy). although the disease is initially sensitive to adt, resistance is inevitably acquired, leading to castrate - resistant prostate cancer (crpc) which is incurable. however, there are several agents which can improve survival in such patients (see table 1). antiandrogens are oral compounds that compete with endogenous ligands for the androgen receptor (ar), and when bound induce a conformational change that impedes transcription of key androgen - regulated genes. steroidal antiandrogens were first developed in the late 1960s, can be distinguished by their physiologic progestational effects, and include agents such as cyproter - one acetate, megestrol acetate and medroxyprogesterone. the nonsteroidal antiandrogens, including flutamide, nilutamide and bicalutamide, act only at the androgen receptors and are generally better tolerated by patients. the addition of bicalutamide to standard care, either as monotherapy or as adjuvant treatment, improved progression - free survival (pfs) in men with locally - advanced prostate cancer, but not in patients with clinically localized disease.2 in the setting of metastatic prostate cancer, survival in men treated with bicalutamide monotherapy was found to be inferior when compared to castration.3 the combination of medical or surgical castration with an antiandrogen, known as combined androgen blockade, may possibly improve five - year overall survival when compared to lhrh monotherapy (hazard ratio [hr ] = 0.87 ; 95% confidence interval [ci ], 0.810.94)4, although the significance of this finding has been debated. intriguingly, an antiandrogen withdrawal effect can be observed in up to 25% of patients after discontinuation of these agents following clinical or biochemical progression.5 in this situation, bicalutamide can undergo an antagonist - to - agonist switch, thereby paradoxically stimulating ar activity and promoting prostate tumor cell growth. castrate - resistant prostate cancer (crpc) is defined as cancer progression in the setting of castrate levels of serum androgens (generally 60 weeks in these patients (compared with 29 weeks in chemotherapy - pretreated men). there were soft tissue responses reported in 22% of patients with measurable disease, while 56% of men had stabilized bone disease lasting 12 weeks or more. in addition, there was conversion from unfavorable (> 5/7.5 ml) to favorable (4. the study was designed to have a power of 90% to detect a hazard ratio of 0.76 for death in the enzalutamide group, as compared with the placebo group, using a two - sided type - i error rate of 0.05. a single interim analysis was planned after 520 deaths had occurred (80% of the expected 650 total events). because of the positive finding of improved survival favoring enzalutamide, the study was unblinded after this interim analysis at the recommendation of the data and safety monitoring committee,11 and those men on placebo were allowed to cross - over and receive enzalutamide. men treated with enzalutamide demonstrated an improved survival of 4.8 months more than those receiving placebo (p 30% increase in analgesic use, and was determined by the mean of worst pain over seven days and analgesic use by the patients for disease - related pain.11 pain palliation as defined above was achieved in 45% of those on enzalutamide compared to 7% of those receiving placebo (p = 0.008). the investigators reported that 28% of patients in the enzalutamide arm had pain progression compared to 39% of patients on placebo (p = 0.002). on the fact - p scale, median time to pain progression was not yet reached for patients receiving enzalutamide compared with 13.8 months for patients on placebo, representing a risk reduction of 44% (hr = 0.56 ; p = 0.0004). there was also a mean reduction in pain severity (average of 4 severity items on the brief pain inventory - short form) of 0.65 in favor of patients receiving enzalutamide (p < 0.001). the total quality - of - life (qol) score on the fact - p showed that qol was dramatically improved in patients taking enzalutamide : 43% had improvement in qol versus 18% in the placebo arm.11 while the affirm study did not mandate concurrent corticosteroid use given together with the study drug, the concomitant administration of steroids was not prohibited either. to this end, approximately 30% of the patients in the affirm trial received corticosteroids at baseline and 48% were initiated on steroid therapy during the trial.12 a post - hoc analysis demonstrated that men who were taking corticosteroids (in both the enzalutamide and the placebo groups) had inferior survival compared to those who did not take steroids. the first is that patients requiring the introduction of steroids may have had more advanced disease with the presence of disease - related symptoms which mandated steroid use. an alternative explanation is that corticosteroids may have inadvertently stimulated aberrant androgen receptors through promiscuous binding to the ar, inducing a more rapid disease progression. importantly, the beneficial effect of enzalutamide was maintained regardless of whether or not steroids were also co - administered. patients on enzalutamide had improved outcomes in terms of overall survival, radiographic pfs, and time to psa progression compared to individuals on placebo regardless of their steroid use, further confirming the benefit of this agent.12 based on the positive results of the affirm study, the us food and drug administration approved enzalutamide on august 31, 2012 for men with metastatic castration - resistant prostate cancer who have already received prior docetaxel - containing chemotherapy. as a result of this product label, enzalutamide can not currently be recommended for men with metastatic crpc who have not yet received chemotherapy, although the off - label use of this agent in the pre - chemotherapy setting is an attractive prospect. indeed, a role for enzalutamide in all patients with metastatic crpc is hinted at by the data from the phase i / ii studies, where enzalutamide appeared efficacious (and potentially even more efficacious) in chemotherapy - nave patients. to conclusively ascertain whether enzalutamide has a role in the pre - chemotherapy space, a second randomized phase iii study of enzalutamide versus placebo in men with chemotherapy - nave metastatic crpc the primary endpoints of this trial (prevail) are overall survival and progression - free survival, considered as co - primary endpoints. secondary endpoints include time to initiation of cytotoxic chemotherapy, and time to first sre. a number of additional trials are currently underway that are evaluating enzalutamide in a diverse set of patient populations, as well as in novel combinations with other agents (discussed below). a selected list of these studies in shown in table 2. i / ii study, the most common grade 34 adverse event was dose - dependent fatigue (11% patients), which was only observed at doses of 240 mg or greater, and generally resolved after dose reduction.8 in the affirm study, there were very few toxicities that were more common in the enzalutamide arm, and these included fatigue (all grades, 33.6% vs 29.1%), diarrhea, musculoskeletal pain, headache, hypertension and hot flashes. overall, the enzalutamide group had a lower incidence of grade 34 adverse events (45.3% vs 53.1%).10 the most common adverse reactions (occurring in 5% of patients) were asthenia / fatigue, back pain, diarrhea, arthralgia, hot flashes, peripheral edema, musculoskeletal pain, headache, upper respiratory infection, muscular weakness, dizziness, insomnia, lower respiratory infection, spinal cord compression and cauda equina syndrome, hematuria, paresthesia, anxiety, and hypertension. a large number of these adverse events were probably related to disease progression rather than the study drugs, since their incidence was similar in both treatment arms. in addition, it should be noted that enzalutamide is a strong inducer of cyp 3a4 and a moderate inducer of cyp 2c9 and cyp 2c19. these combinations can alter the plasma exposure of enzalutamide and should be avoided if possible. conversely, concomitant use of strong cyp 2c8 inhibitors can increase the plasma exposure to enzalutamide. this is likely related to inhibition of the -aminobutyric acid (gaba)-gated chloride channels by enzalutamide, which lowers the seizure threshold.10 in the phase i / ii study, seizures were reported in three out of 140 patients, all of whom were taking doses above 360 mg and were also concurrently being treated with other medications that may have contributed to a lower seizure threshold.8 all subsequent studies used 160 mg as the dose of enzalutamide. in the affirm trial, patients with a history of seizures or with other risk factors for seizures were excluded from trial entry. in addition, patients who were on medications that were known to lower seizure threshold (ie, insulin, antiarrhythmics) were also excluded. during the affirm study, 5 of 800 patients receiving enzalutamide (0.6%) had seizures compared to 0% in the placebo arm.10 of those individuals, two had brain metastases, one had received lidocaine, and one had brain atrophy associated with alcohol use. each of these characteristics could increase the risk of seizures. patients who experienced a seizure discontinued therapy permanently and all seizures resolved and did not recur. longer follow - up of affirm identified two additional patients that experienced seizures, and thus the overall seizure risk when combining data from all completed enzalutamide studies is approximately 1.0% (10 of 940 total patients). finally, there was an increased incidence of headaches in patients who received enzalutamide, and it is unclear whether this could be classified as migraine. both androgen use and seizure activity have been associated with migraine and therefore an improved understanding as to the exact mechanism of this side effect is warranted. unfortunately, resistance to antiandrogens emerges invariably over time, and enzalutamide is no exception. ar gene rearrangement is a mechanism of crpc progression which can result in constitutively active truncated ar splice variants that lack the ar - ligand binding domain. ar spice variants have been suggested to be associated with resistance to enzalutamide in prostate cancer cell lines.13 in addition, treatment with enzalutamide may result in elevations of testosterone and dihydrotestosterone in plasma and bone marrow, suggesting that overexpression of cyp17 and increased intracrine / paracrine androgen synthesis may also promote continued growth of crpc.14 alternatively, it has been proposed that enzalutamide resistance may be associated with cellular fas - associated death domain - like interleukin 1-converting enzyme inhibitory protein (c - flip) expression, which is a key regulator of caspase-8 (flice)-promoted apoptosis.15 however, the exact mechanism of resistance to enzalutamide in human crpc is largely unknown and is currently being investigated as this could influence both future treatment and outcomes in the individual patient. the success of enzalutamide has prompted investigators to explore additional next - generation ar signaling inhibitors for the treatment of prostate cancer. arn-509 is a competitive ar inhibitor with similar activity to enzalutamide and is antagonistic to ar overexpression.16 it inhibits ar nuclear translocation and dna binding resulting in tumor growth inhibition and apoptosis. preclinical activity demonstrated that arn-509 binds ar with five - fold greater affinity than bicalutamide. in a crpc xenograft model, arn-509 showed greater efficacy than enzalutamide. notably, the maximal therapeutic response was attained at a lower relative dose compared to enzalutamide and achieved higher steady - state plasma concentrations. this would suggest that arn-509 may have a higher therapeutic index and might possibly be more effective than current antiandrogens including enzalutamide.16 similarly to enzalutamide, arn-509 also binds gaba receptors weakly. however, it appears to exhibit less central nervous system penetration, which could suggest a lower seizure - inducing potential. in a phase i study, the drug was found to be well tolerated with 50% psa declines observed in 42% of patients.17 with longer follow - up, the psa response rate increased to 55%.18 up to 90 men with crpc will be enrolled onto the phase ii portion of the study.19 the phase ii trial has a unique design, in that it allows three separate patient populations : men with non - metastatic crpc, men with metastatic crpc, and men with abiraterone - refractory crpc. a placebo - controlled phase iii trial of arn-509 (spartan) is currently being planned for patients with non - metastatic crpc with a psa doubling time of < 10 months. in addition to the prevail trial in men with chemotherapy - nave crpc, enzalutamide will continue to be investigated in earlier disease settings. for example, there is a randomized double - blind phase ii study comparing enzalutamide to bicalutamide in men with crpc who have progressed after lhrh agonist monotherapy,20 a phase ii study of single - agent enzalutamide in men with recurrent hormone - nave prostate cancer,21 and a neoadjuvant study of enzalutamide combined with leuprolide and dutasteride in patients scheduled to undergo radical prostatectomy22 (table 2). enzalutamide is also an attractive therapeutic option to combine with other standard or novel agents. the combination of enzalutamide and a selective cyp450c17 inhibitor (such as abiraterone) has also been proposed. enzalutamide is effective in the presence of low levels of circulating androgens, whereas increased adrenal - derived androgen levels have been found to predict likelihood of response to ketoconazole with improved survival compared to patients with lower levels.23 similar finding have been reported with abiraterone, where it has been shown that higher baseline levels of circulating adrenal androgens predict abiraterone responses while undetectable androgen levels predict abiraterone resistance.23 in addition, another proposed mechanism of resistance with the use of abiraterone has been activation of the mutated androgen receptor induced by glucocorticoid use, which is a necessary treatment to prevent the mineralocorticoid side effects of abiraterone. the addition of enzalutamide could inhibit such ar activation.24 in men with crpc treated with enzalutamide, levels of plasma testosterone, bone marrow testosterone and plasma dht do not decrease, whereas nuclear ar expression is reduced or unchanged.14 abiraterone acetate has been demonstrated to decrease plasma testosterone and increase ar copy number, and therefore one could suggest evaluation of the combination of enzalutamide and abiraterone. currently a phase ii study to determine the safety and tolerability of abiraterone combined with enzalutamide is underway (nct01650194), and a large intergroup study is also being designed to compare the efficacy of enzalutamide monotherapy versus enzalutamide plus abiraterone in men with chemotherapy - nave crpc. the last few years have seen a bounty of new therapeutic options in the treatment of advanced prostate cancer14 due to improvements in our understanding of this disease. it is now abundantly clear that the androgen receptor in crpc continues to play a crucial role in driving the disease, which has led to the development of novel androgen signaling inhibitors. enzalutamide is a second - generation nonsteroidal antiandrogen that has demonstrated significant activity in metastatic crpc, improving both the length, as well as the quality of life. in addition, due to its very favorable safety profile, it is likely to become an increasingly important drug in the treatment of various stages of prostate cancer moving forward. enzalutamide will likely be used earlier in the disease, and the results from the prevail study are eagerly anticipated. the questions as to how best to sequence therapy and whether to combine therapies remain challenges to overcome over the next several years. finally, understanding mechanisms of primary and acquired resistance to enzalutamide will be critical if we are to design future therapies for men with enzalutamide - refractory disease. | introductionenzalutamide is an oral androgen receptor (ar) signaling inhibitor that was specifically engineered to overcome castration - resistant prostate cancer (crpc) harboring ar amplification or overexpression. enzalutamide has demonstrated significant activity in men with metastatic crpc.aimsto update the evidence and provide an overview of the available data on enzalutamide.evidence reviewpeer reviewed articles published and listed in medline search were reviewed. in addition, relevant asco and esmo abstracts were searched. the activity of enzalutamide is mediated by potently antagonizing the full - length ar, impairing translocation of the ar from the cytoplasm into the nucleus, and inhibiting the transcriptional activity of the ar by modulating the interaction of the ar with androgen - response elements in gene promoter regions. enzalutamide has a favorable safety profile and the most common adverse events include fatigue, hot flashes and headache ; 1% of patients experienced seizure.place in therapythe affirm phase iii study evaluated the clinical utility of treatment with enzalutamide in men with docetaxel - refractory metastatic crpc. enzalutamide improved overall survival compared to placebo, with a median overall survival of 18.4 months versus 13.6 months respectively.conclusionenzalutamide has demonstrated impressive efficacy in men with metastatic crpc, moving swiftly from a phase i / ii study to two pivotal phase iii trials testing this agent in both chemotherapy - pretreated as well as chemotherapy - nave crpc patients. ongoing studies are aiming to explore the utility of enzalutamide in earlier stages of the disease, and to investigate the optimal sequencing and combination of enzalutamide with other standard and novel therapies for prostate cancer. |
more than 50% of individuals with voice disorders have benign alterations of the vocal fold mucosa. polyps are one of the most frequent vocal cord lesions and are the most prevalent indication for laryngeal microsurgery. like nodules, polyps are caused by overuse and abuse of the voice1, although they may also occur as a result of a single traumatic incident2 3. trauma can affect the superficial vases of the lamina propria causing the liquids within to overflow, displacing the epithelial layer and inducing scarring due to the deposition of fibrin and vascular proliferation. depending on the type of vascularization, polyps are classified as angiomatous or hemorrhagic if accompanied by vascularity or as hyaline or gelatinous in the absence of vascularization. the clinical picture is characterized by dysphonia related to intense vocal use, and is generally well - defined and recognized by the patient. the dysphonia is constant, and may progressively worsen. the voice presents as hoarse and breathy ; sometimes it can be rough and, infrequently, diplophonic. a diagnosis is made by assessing the clinical history, and by perceptive analysis and observation of the phonatory system, which includes assessments of the phonatory posture adopted, articulation, and attitude. vocal polyps can have many presentations and characteristics, and the aim of our study was to identify the characteristics of the polyps found in our population. the objective of this study was to analyze and compare the features of polyps (intrinsic characteristics, associated lesions, and treatment outcomes) from patients undergoing laryngeal surgery at our hospital. this prospective study was conducted from february 2010 to february 2011 using an electronic computerized protocol once the approval of the ethics committee had been obtained (caee : 0286.0208.000 - 11). we used the sinpe electronic protocol with the sinpe analyzer for data analysis5 6 7. the protocol - based software program is capable of storing and manipulating data on a theoretical basis. the sinpe analyzer module is used to create reports, graphs, and statistics summarizing the main findings. a specific protocol for laryngeal disorders among the master ent protocol available in sinpe was used for the analysis ; only patients diagnosed with vocal fold polyps were analyzed. in total, the inclusion criteria were as follows : a diagnosis of polyps, clinical laryngoscopy, and intraoperative confirmation of the diagnosis by anatomopathology. exclusion criteria were as follows : a diagnosis of infiltrative processes or storage disease (vocal polyps not identified upon anatomopathologic examination). of the 245 patients who underwent surgery during the study period, 93 (36.61% of lesions) with vocal polyps and an indication for microsurgery were evaluated. these 93 patients were classified into 2 groups according to the physical and histological characteristics of the lesions : (a) those with angiomatous polyps (n = 63, 67.75%) and (b) those with gelatinous polyps (n = 30, 32.25%). comparisons between the 2 groups were made according to 12 anatomic and surgical parameters based on the polyp characteristics. parameters 18 refer to the intrinsic characteristics of the polyps (table 1), parameters 9 and 10 refer to polyp - associated lesions (table 2), and parameters 11 and 12 refer to the treatment strategy (table 3). the protocols were performed on the day before surgery after the pre - anesthetic consultation, and supplemented during the postoperative follow - up. endolaryngeal microsurgeries were performed in the operating room of the same institution using suspension laryngoscopy (sl) by 3 doctors from the laryngology and voice service department. during sl, statistical analyses were performed using the chi - square test to compare the variables discussed above, and the significance level was set at p < 0.05. all 93 patients underwent laryngeal surgery due to a diagnosis of polyps of the vocal folds during the period february 2010 to february 2011. of these, 63 (64.74%) had angiomatous and 30 (32.26%) had gelatinous polyps. regarding sex, 51 were male and 42 female. the distribution according to the 12 parameters for each type of polyp is shown in tables 4, 5, and 6. benign lesions of the vocal folds represent a significant problem for otolaryngologists because they are very common and require a multidisciplinary treatment approach. when such lesions do not respond to drug therapy and/or speech therapy, surgery is required with the aim of increasing phonatory function or establishing a histological diagnosis by biopsy8 9. in our study, we found 93 (36.61%) polyps among 245 patients with vocal fold lesions who underwent laryngeal surgery during the period from february 2010 to february 2011 in our hospital. this was the most frequent diagnosis observed in this study, which supports the reports by haas & doderlein, mossallam, and lehmann and kleinsasser, who noted that polyps were the main indication for laryngeal microsurgery10 11 12 13. angiomatous polyps were more common (63 patients, 64.74%) than gelatinous polyps (30 patients, 32.26%). in addition, we noticed a male predominance among patients with angiomatous polyps and a female predominance among those with gelatinous polyps. the chi - square test (significance level, p = 0.008) showed that the type of polyp was dependent on sex. the male predominance of angiomatous polyps (65.08%) is consistent with the findings reported in the literature3 14 15, but there was no male predominance of gelatinous polyps. instead, these were more common in women (66.67%), which is a similar finding to that obtained by dailey, who reported a female incidence of 62% among patients with gelatinous polyps16. in addition, female patients with increased vocal fold mass have a lower pitch, which has a greater impact on the social life of these patients than is the case with male patients. regarding size, the statistical analysis demonstrated that the polyp size was dependent on type. most angiomatous polyps were of medium size (68.25%) whereas most gelatinous polyps were small (56.67%) (p = 0.001). angiomatous polyps were also found most frequently in the middle third of the vocal fold (51.43%), whereas the gelatinous polyps tended to be found in the middle and posterior thirds of the fold (36.67% each) (p = 0.02). thus, the position of the polyp in the vocal fold was also dependent on type. in our study, both angiomatous and gelatinous polyps were predominantly found on the right vocal fold (p = 0.009), and so there is also a relationship between polyp type and its location on the vocal fold. reported similar findings14, whereas sakae.17 reported that polyps were found in the left vocal fold in 53% of cases. the presence of msa occurred in 47.61% of patients with angiomatous polyps, in comparison with 20% of patients with gelatinous polyps (p = 0.02). there was thus also a correlation between polyp type and the presence of msa (greater in angiomatous polyps). in sakae. reaction nodular lesions were found in 41.26% of the patients with angiomatous polyps and 43.33% of the patients with gelatinous polyps. there was no statistical difference between the two groups (p = 0.97). in eckley. 's study14, 37% of patients had reaction lesions, confirming the suspicion that the impact of the polyp on the healthy vocal fold can cause long - term alterations in the epithelial layer of the contralateral vocal fold14 18. regarding the msa, stria were the most frequently encountered lesions (49.9%) in angiomatous polyps, whereas varicosity was predominant in gelatinous polyps (66.66%). in eckley. 's study14, stria were the most frequently encountered msa (70%). in our study, the patients underwent larynx surgery with sl, which led to considerable improvement in voice quality and the remission of other symptoms. the surgical technique most commonly used for angiomatous polyps is to grab the polyp and resect it with a microscissors (57.14%). for gelatinous polyps, the main surgical technique is to create a medial microflap and then resect it with a microscissors (60%). all of the patients underwent speech therapy with optimal developments in most cases (88.89 and 93.33% for those with angiomatous and gelatinous polyps, respectively). there is a consensus regarding the use of postoperative speech therapy and appropriate follow - up and successful outcome9. there was a male predominance among patients with angiomatous polyps, and a female predominance among those with gelatinous polyps. there was also a correlation between the size of the polyp, and its position and location in the vocal fold and the presence of msa. different surgical techniques were used, but the postoperative results were similar and satisfactory once the therapy was complete. | summary introduction : dysphonia is the main symptom of lesions that affect the vocal tract. many of those lesions may require surgical treatment. polyps are one of the most common forms of vocal cord lesions and the most prevalent indication for laryngeal microsurgery. there are different types of polyps, and their different characteristics can indicate different prognosis and treatments. aim : to conduct a comparative study of polypoid lesions (angiomatous and gelatinous) in patients undergoing laryngeal microsurgery via an electronic protocol. method : we prospectively evaluated 93 patients diagnosed with vocal fold polyps ; the polyps were classified as angiomatous or gelatinous. results : in total, 93 patients undergoing laryngeal microsurgery were diagnosed with vocal fold polyps. of these, 63 (64.74%) had angiomatous and 30 (32.26%) gelatinous polyps. most patients with angiomatous polyps were men ; their polyps were frequently of medium size, positioned in the middle third of the vocal fold, and accompanied by minimal structural alterations (msa). in contrast, the majority of patients with gelatinous polyps were women ; their polyps were smaller, positioned in the middle and posterior third of the vocal fold, and were not accompanied by msa. both types of polyps were more frequently located on the right vocal fold. conclusion : angiomatous polyps were more frequently encountered than gelatinous polyps. in addition, correlations between polyp type and sex, polyp size, position, location, and the presence of msa were observed. different surgical techniques were used, but the postoperative results were similar and satisfactory after speech therapy. |
irrigation has been recognized to have been playing a crucial role in addressing the central challenges caused by food insecurity and rainfall uncertainty. it offers more yield assurance than rainfed agriculture and tends to improve the quality and value of crop yields. it is also often the key to successful commercial production of certain crops that can not tolerate water stress or require very close regulation of inputs. furrow irrigation is especially recommended for growing row crops on medium to heavy textured soils. it is preferred over other surface irrigation methods due to its simplicity and low capital cost. in samaru, northern nigeria, furrow irrigation is one of the most widely used means of water application to crops. furrow irrigation method has been understood as one of the common farming practices that causes soil erosion in the irrigated farms. report 75% of idaho furrow irrigated fields lost entire a horizon in the upper reaches together with a 2- to 4-fold increase in topsoil at the lower ends, reducing productivity by 25% over preerosion values and reducing yields by 2050% in areas where topsoil is lost. furrow irrigation - induced erosion (fiie) has been identified as one of the greatest global threats to sustainable agricultural productivity and to clean water. preventing irrigation - induced erosion from irrigated agriculture is therefore imperative to the preservation of natural ecosystems. data on fiie needed for planning and management of furrow irrigation is scarce in the study area. reasonably tested fiie models are needed to estimate soil erosion in furrow irrigated fields from changing irrigation practices or to allocate soil erosion limits for various farming / management practices. in nigeria, up to 90% of irrigated farms are surface - irrigated, out of which furrow irrigation is one of the most widely practiced methods [3, 4 ]. but serious soil erosion occurs during irrigation and it is more pronounced in furrow irrigation methods [1, 5 ]. reported that 21% of the 15 million hectares of irrigated land in the united states of america (usa) is affected by soil erosion. significant erosion can reduce crop productivity in fields and degrades water quality of receiving water bodies. carter reported a 25% decrease in crop yields in southern idaho due to furrow irrigation. the need for information on furrow irrigation erosion presses harder in the face of the high degree of unskillful handling of irrigation practices among many nigerian farmers. typical furrow irrigation in nigeria could be described as haphazard as the selection of the flow stream sizes, length of furrows, furrow widths, depth of tillage, choice of direction of flow of water, frequency of water application, cropping pattern, and so forth does not follow specific pattern, determinants, or schedule. mostly, the length of the farms determines the lengths of furrows, or it is irregularly subdivided into smaller lengths, sometimes as short as 20 m ; that can be filled up quickly during irrigation to shorten the duration of their water. consequently, a lot of soil might have been lost during furrow irrigation in nigeria. however, the quantity of soil loss taking place on nigerian farms due to furrow irrigation is still unknown, especially with reference to particular flow stream size, furrow length, and furrow width. reliable quantitative data on the extent and rates of soil erosion is necessary for sustainable and comprehensive assessment of the magnitude of the problem for developing effective soil conservation measures. another gap that exists in the present knowledge of soil loss, at least in this study area, is that no technique for estimating soil loss has been applied or tested in irrigated furrows despite its importance in soil loss studies. this implies that each time current soil loss data is required for planning and research in the study area, field estimations, data collections, laboratory analysis, and labour will have to be involved. given the continued growth of irrigation activities in nigeria in response to the growing population and national support for irrigated agriculture, such as the case of fadama project amongst others, and the elevated national priority given to environmental and water quality protection, which is strongly linked to erosion, soil erosion in irrigated farms then becomes a major problem. but there is still relatively little or no published data that systematically quantifies the extent of irrigation - induced erosion. this is amazingly true despite many organized efforts from the government, nongovernmental organizations, and the academia toward funding for erosion inventory and for development of technology to understand, predict, and/or mitigate soil erosion that has been focused on rainfall - induced erosion only. having this problem at hand, the need for estimating soil erosion in furrow irrigated fields with a view to reducing it to the barest possible has therefore become very important. thus, accurately simulating furrow irrigation erosion becomes practically indispensable for planning and evaluating management practices and for meeting water quality standards. models are very important tools for understanding and predicting soil erosion and could be used in conservation planning and erosion control. a variety of erosion models exist focusing on different spatial and temporal scales, with varying degrees of complexity and precision to address furrow irrigation - induced erosion. for example, adeniji developed equations for stream front advance distance (m), stream erosion rate (m / s), and water runoff (l / s) for furrow irrigation : (1)e = a3kstxmaxb3k6, where e = soil erosion rate (m / s) by a given furrow irrigation stream at the lower end of the length, x max ; a 3 = function of stream size and soil aggregate stability ; k 5 and k 6 = functions of acceleration due to gravity, mass density of water, and dynamic viscosity ; and b 3 = function of initial silt and clay content and soil dispersibility factor. one of the limitations of (1) is that it did not include some variables such as soil infiltration rate, duration of water flow in the furrows, and the effect of furrow geometry. further, besides the fact that the equation was developed for saskatoon environment, the range of values of some factors such as a 3 and b 3 was not available and could vary in space. the model therefore could not give a straightforward estimate of soil erosion in irrigated furrow. gardner and lauritzen proposed an equation relating critical flow and critical slope in furrow irrigation that was amended by criddle, hamad and stringham, trout and neibling, and spofford and koluvek. but fiie is a function of many other factors that were not captured in their equation. another two soil erosion models recently tested for uses in irrigation are water erosion prediction project (wepp) and the surface irrigation model (srfr). wepp model is a steady - state erosion model ; erodibility parameters can not change during irrigation. preliminary evaluation showed the model did not predict any soil erosion unless default baseline erosion parameters were reduced. the model overpredicted soil loss and deposition and only predicted when runoff was greatly underpredicted or detachment was greatly overpredicted. the srfr is a surface irrigation model that simulates water advance, infiltration, and recession. it has a provision for the user to input furrow geometry, soil infiltration and roughness characteristics, and irrigation management. some of the model output parameters are runoff, infiltration, irrigation efficiency, distribution uniformity, and deep percolation. this model is not a steady - state erosion model like the wepp model, so the erosion parameters can vary during irrigation. it also does not calculate the effects of tillage on soil erosion parameters or predict erosion from a field or watershed for several years. the advantage of the srfr model is the more detailed representation of furrow irrigation hydraulics and non - steady - state erosion predictions. the limitation of this model is its complexity due to many components used in its building, especially the transport capacity component ; furthermore the erodibility factor of the model did not represent furrow irrigation erosion in its entirety, and unity was assigned in it during the testing of the model. this makes the model difficult to adopt. the idaho natural resources conservation service (nrcs) in idaho developed surface irrigation soil loss model (sisl) to estimate soil loss from furrow irrigated fields it is a simple empirical model that uses a formula similar to the universal soil loss equation (usle). an evaluation of sisl showed that the absolute differences between measured and predicted values were often large and it does not take into account the variability of soil erosion with respect to the major variables affecting furrow irrigation. the applicability of this model in estimating soil erosion in irrigated furrow is thus questionable. further, the solutions of most of the models are generally subject to computational difficulties and inaccuracies. this study was consequently conceived to build up a model for estimating soil erosion in furrow irrigation in the semiarid region of northern nigeria. the furrow irrigation - induced erosion (fiie) model was developed using dimensional analysis following the concept of buckingham -theorem considering the variables in table 1. however, the principles of the buckingham -theorem require that all the variables to be used in the dimensional analysis be theoretically independent. some of the variables in table 1 were therefore eliminated, to arrive at the decision variables (table 2) used in the model development. consider (i)1=fq,,k, e = fqa1b1kc1e, m0l0t0=l3t1a1ml1t2b1t3l3c1ml2t1, (ii)m : 0=b1 + 1, (iii)b1=1, (iv)l : 0=3a1b13c12, (v)t : 0=a12b1 + 3c11. substituting 1 for b into (iv) and (v) yields (2)a1=0, c1=13. therefore 1 = f 1(q k e), or (vi) the above procedure was used to develop four other -terms. consider (3) 1=ek1/3, 2=xq1/2k1/6, 3=wq1/2k1/6, 3=k1/3i, 5=tq1/2k1/2. the -terms obtained above were combined to form three -terms ; thus, a new 1 herein called 1n was obtained by taking the product of 1, 2, 3, and 4. the new 2 called 2n was obtained from product of 2 and 3. the original 5 was taken as the new 3 now called 3n : (4) 1n = exwiqk1/3, 2n = xwqk1/3, 3n = tq1/2k1/2. hence the three p i terms required and the equation can be written as (5)1=f2,3. data necessary for the completion of the model development were collected during the 2009/2010 and 2010/2011 irrigation seasons at the irrigation research field of the institute for agricultural research (iar) farm, samaru - zaria, along zaria - sokoto road (111n, 738e, on the altitude of 686 m above mean sea level). the field was ploughed, harrowed, and ridged at 0.75 m spacing thereby creating the furrows in which irrigation was conducted. the basic infiltration rate of the soil was determined using the inflow - outflow method. slope of the field was determined in each of the two trials using the dumpy level surveying instrument. the hydraulic shear stress,, was obtained following the guidance of schwab.. the soil erodibility, k, was determined by adopting the universal soil loss equation (usle) the time of flow of water was measured directly from the field with a stopwatch. prior to commencement of irrigations, water - sediment collection stations were established 5 m before the end of each furrow. flow of water in the furrows was measured using a cutthroat flume installed 5 m from entry upstream of each of the furrows for the measurement of inflows and at the tail end of the furrows. one liter of water - sediment samples was collected at each of the established measurement points for determination of sediment concentrations. these samples were filtered into preweighed metal containers ; the collected residues were oven - dried at 105c over 24-hour period and reweighed in laboratory. the sediment concentrations (g / l) that were calculated from the dried residues and the runoff volumes runoff volume was calculated as the product of the runoff discharge (l / s) (from the downstream flumes) and duration of runoff discharge. soil erosion at the end of the furrows was calculated as the product of the sediment concentrations and runoff volumes divided by the wetted area. the wetted areas were calculated as the product of the top widths of flow of water and the lengths of the furrows [8, 2325 ]. from the dimensional analysis the general solution of (5) which gives three dimensionless groups characterizing this phenomenon can therefore be written as (6)=exwiqk1/3,xwqk1/3,tq1/2k1/2,exwiqk1/3=fxwqk1/3,tq1/2k1/2. dimensionless plots of 1n against 2n and 1n against 3n were performed as shown in figures 1 and 2. in all the cases, there exists good relationship between 1n and 2n and between 1n and 3n with coefficient of determination (r) in the neighborhood of 0.9500 as shown in figures 1 and 2. the regression equations derived from the graphs were used as the component equations in the model development : (7) 1n=0.1400 + 1.35362n r2=0.9567, 1n=0.0221 + 2.04473n r2=0.9456. it follows that 1n can be obtained as linear combinations of (7). that is, (8)1n=+2n+3n. from (8), it can be deduced that (9)y = n+x1+x2. multiplying through by x 1 yields (10)x1y=x1+x12+x1x2 and multiplying by x 2 yields (11)x2y=x2+x1x2+x22. the values of,, and were obtained using the multiple linear regression analysis using the procedure detailed by bernett. and presented as follows : (12)nx1x2x1x12x1x2x2x2x1x22yx1yx2y, where y, x 1, and x 2 represent 1n, 2n, and 3n, respectively, and n is number of observations, which is 12 in this case. substituting the values of y, x 1, and x 2 in (12) yielded (13)=124.4213.87524.4211.7841.65273.87521.65271.60872.02480.85540.8191. using crammer 's rule procedure,,, and were found to be 0.04618, 0.3973, and 0.2122, respectively. then (8) became (14)1n=0.04618 + 0.39732n+0.21223n. to assess the extent of the accuracy of the simulation behavior of the model, the efficiency criteria (ecs) were used to study the error margin between the simulated and observed fiie values. the ecs used were the coefficient of variation (cv), nash - sutcliffe efficiency (nse), index of agreement (d), and root mean square error (rmse) [27, 28 ]. the ecs were presented in (15)rmse=i=1noipi2n, cv = s.do,d=1i1noipi2i=1npio+oio2,nse=1i=1noipi2i=1noio2, where o and p are observed and predicted fiie values, respectively, and s.d and are o standard deviation and mean of observed values of fiie. the general prediction equation for a system or process involving three -terms formed by addition of the component equations as given in (14). inserting the expressions of the -terms yields the prediction equation as presented in (16)exwiqk1/3=0.3973xwqk1/3 + 0.2122tq1/2k1/2 0.04618. equation (16) was further simplified to yield the prediction equation as presented in (17)e=qk1/3xwi 0.3973xwqk1/3 + 0.2122tq1/2k1/20.04618 or (18)e=0.3973i+0.2122tq1/2xwik1/6 0.04618qk1/3xwi. in order to assess the degree to which the developed model is an accurate representation of the real world, the soil erosion output simulated using the model (18) was validated against a different set of soil erosion data that were collected in trial 2. the relationship between the observed field data and model prediction is presented in figure 3. the uncertainties in the model output and experimental outcomes produced the variation in the points on the figure. the slope and intercept of the regression equation being 0.8383 and 0.0083 were closer to unity and zero, respectively, and the r of 0.7268 exhibits a high degree of agreement between the model output and the field measured soil erosion data. this implies that the model is a good representation of real soil erosion in irrigated furrow and demonstrates the model 's ability to predict soil erosion in irrigated furrows. any error in the model prediction is therefore expected to be within the confidence limit. the index of agreement (d) indicated the best value, signifying the very good predictive capacity of the model. similarly, the value of the nse falls within the range of 0.5 to 1 ; the model can then be judged to have a good performance. it was shown that the range of nse lies between 1.0 (perfect fit) and 1 such that efficiency lower than zero would demonstrate a poor prediction capacity of the model. the root mean square error (rmse) and coefficient of variation (cv) were also low signifying low degree of variation between the observed and predicted values. generally, the analysis demonstrated a good predictive capacity of the model. in analyzing the sensitivity of the model to the building variables, the factor perturbation simulation (fps) the sensitivity coefficients (s.c.) for each variable were obtained using (19)s.c.=ev, where s.c. is the sensitivity coefficient and e and v are changes in furrow irrigation erosion and variables, respectively. during the analysis, one parameter was varied at a time while the other parameters were kept fixed to make sure that the sensitivity method was monocriteria. a 10% increase in the values of each perusal of the table shows that the sensitivity coefficients of the variables ranged from 128.03 to 0.0004 for all the independent variables. the results of the sensitivity analysis revealed that the model is most sensitive to changes in stream size that has the dominantly highest s.c. it was followed by soil erodibility, k, but with a very wide gap between them. this analysis also showed that the model is least sensitive to changes in time of flow. this implies that errors in measuring stream size may lead to larger errors in the model 's prediction. overall, the analysis emphasized the importance of stream size and hence the need to commit more attention and resources to its measurement. furrow irrigation is still one of the most used irrigation methods in samaru - zaria and environs. furrow irrigation - induced erosion (fiie) is one of the silent problems militating against sustainable irrigated agriculture in the area. accurately simulating furrow irrigation erosion is essential for assessing loads and evaluating best management practices for meeting water quality standards. irrigation - induced erosion has some unique differences from rainfall erosion, such as water flowing on to dry soil and furrow flow rate decreasing with distance and increasing with time. a model for estimation of furrow the fieldwork included measurements of flow and soil loss and runoff on experimental field plots. a close agreement was achieved between the model output and the practically measured soil erosion, demonstrating a high degree of confidence. the performance evaluation of the model shows that the model has high prediction efficiency signifying that the model has high accuracy and precision and can be used for schematization and watershed project. the sensitivity analysis using the factor perturbation approach revealed that the model is most sensitive to water flow stream size advocating for more attention to be paid to stream size during operation and management of furrow irrigation. owing to possible variation in soil properties space and time and/or management practices, analysis of the seasonal variation of sensitivity of the model with respect to the building variables further studies are needed to extrapolate this study on a broader scale in nigeria and across several soil types and testing in furrows longer than 100 m. this was not done here because of space constraint. conducting this work on a long - term basis, on an institutional scale, say for 10 years, | assessment of soil erosion and sediment yield in furrow irrigation is limited in samaru - zaria. data was collected in 2009 and 2010 and was used to develop a dimensionless model for predicting furrow irrigation - induced erosion (fiie) using the dimensional analyses approach considering stream size, furrow length, furrow width, soil infiltration rate, hydraulic shear stress, soil erodibility, and time flow of water in the furrows as the building components. one liter of water - sediment samples was collected from the furrows during irrigations from which sediment concentrations and soil erosion per furrow were calculated. stream sizes q (2.5, 1.5, and 0.5 l / s), furrow lengths x (90 and 45 m), and furrow widths w (0.75 and 0.9 m) constituted the experimental factors randomized in a split plot design with four replications. water flow into and out of the furrows was measured using cutthroat flumes. the model produced reasonable predictions relative to field measurements with coefficient of determination r 2 in the neighborhood of 0.8, model prediction efficiency nse (0.7000), high index of agreement (0.9408), and low coefficient of variability (0.4121). the model is most sensitive to water stream size. the variables in the model are easily measurable ; this makes it better and easily adoptable. |
amalgam is a restorative material especially suitable for classes i and ii restorations in teeth that encounter heavy chewing forces. the advantages of amalgam restorations include resistance to wear, tolerance to a wide range of clinical placement conditions, and excellent load - bearing properties [13 ]. however, amalgam restorations may also present degradation in the intraoral environment due to secondary caries, fracture, marginal breakdown, and wear [46 ]. the traditional solution for those failures has been the complete replacement of the restorations, which may also include minor imperfections in the restorations, and replacement of defective restorations represents a major concern in dental practice, reaching up to 60% of operative dentistry interventions. consequently, the median survival time (mst) of amalgam varies from 2 to 11 years, but most studies place it at over 5 years [810 ]. complete replacement of restorations has the disadvantages of being time consuming, unnecessary removal of healthy tooth tissue, enlarging preparations and restoration sizes [11, 12 ], the risk of converting the restoration to an indirect restoration, and the possibility of major injuries in pulp tissues [1214 ]. during the last years, new strategies, such as repair and refinishing of localized defects, have shown improvement in the quality of the defective restorations and increased longevity of restorations with minimal intervention [1517 ]. repair rather than replacement of failing restorations is a part of minimally invasive dentistry, preservation of natural tooth structure, early detection of carious lesions, nonsurgical interventions, and a modified surgical approach that includes delayed restoration and smaller tooth preparations with modified cavity designs. the aim of this clinical trial was to assess the long - term performance of two minimally invasive clinical procedures, repair and refinishing, as treatments for localized defects of classes i and ii amalgam restorations. the institutional research and ethical board of the dental school at the university of chile approved this randomized clinical trial (project pri - odo-0207). fifty - two patients, 26 female (50%) and 26 male (50%), were recruited at the operative dentistry clinic at the dental school, university of chile, santiago. patients were aged 18 through 80 years (mean age, 28.3 18.1 years). a total of 160 defective restorations (97 class i, 63 class ii) presenting one or more clinical features that deviated from ideal were included in the study. the restorations ' clinical conditions ranked from bravo to charlie according to the united states public health service (usphs)/ryge criteria (see table 1). patients with localized deficiencies of amalgam restorations that were clinically judged to be suitable for repair or refinishing according to usphs criteria (table 1), patients with more than 20 teeth, restorations in functional occlusion with an opposing natural tooth and at least one proximal contact area with an adjacent tooth, patients older than 18 years old, and patients who signed the consent form and completed a registration form were included in the study. patients with contraindications for regular dental treatment based on their medical history, patients who had special aesthetic requirements that could not be solved by the alternative treatments, patients with xerostomia or who were taking medication that significantly decreased salivary flow, patients with high caries risk, and patients with psychiatric or physical diseases that interfered with tooth hygiene were excluded from the study. one hundred sixty defective restorations were evaluated in accordance with usphs criteria and assigned according to the following criteria.restorations with clinically diagnosed secondary caries (charlie) or undercontoured anatomical form defects (bravo) were randomly assigned to the repair or replacement group (randomization was performed by power analysis and sample size system in pass software v. 2008, keysville, ut, usa). diagnosis of active secondary caries was made according to ekstrand 's criteria.restorations with overcontoured anatomic form, luster, or roughness defects were randomly assigned to the refinishing (bravo and charlie) or no - treatment group (bravo).restorations with marginal defects (bravo) were randomly assigned to either the repair, refinishing, replacement, or no - treatment group. the treatment groups were labeled (a) : repair (n = 19) ; (b) : refinishing (n = 64) ; (c) : replacement (n = 21) ; (d) : no treatment (n = 56). restorations with clinically diagnosed secondary caries (charlie) or undercontoured anatomical form defects (bravo) were randomly assigned to the repair or replacement group (randomization was performed by power analysis and sample size system in pass software v. 2008, keysville, ut, usa). restorations with overcontoured anatomic form, luster, or roughness defects were randomly assigned to the refinishing (bravo and charlie) or no - treatment group (bravo). restorations with marginal defects (bravo) were randomly assigned to either the repair, refinishing, replacement, or no - treatment group. two examiners underwent calibration exercises (jm and ef, cohen 's kappa interexaminer coefficient 0.74 at baseline and 0.87 at five years). the examiners assessed the restorations independently by direct visual and tactile examination (mouth mirror number 5, hu friedy mfg. chicago, il, usa, and explorer number 23 hu friedy) and indirectly by radiographic examination (bite wing) at baseline (immediately after treatment) and each year up to five years after treatment. the four examined parameters were marginal adaptation (ma), anatomic form (a), surface roughness (r), and secondary caries (sc) (table 1). if any difference was recorded between the two examiners, and if they did not reach an agreement, a third clinician who also underwent calibration exercises (gm) made the final decision. a change from bravo to alpha was considered an improvement, and a change from alpha to bravo represented deterioration. repair : carbide burs were used to explore the defective margins of the restorations, beginning with the removal of part of the amalgam restorative material adjacent to the defect. once this material was removed and the exploratory cavity preparation did not include any stained or soft tooth tissues, a dispersed - phase amalgam (original d, wykle research, inc, carson city, nv, usa) was used to repair the preparation. refinishing : defective areas of the amalgam restoration were smoothed using carbide burs (numbers 12 and 30, brasseler usa, savannah, ga, usa). on the occlusal and buccal / lingual surfaces, silicone - impregnated points (brownie / greenie / supergreenie, shofu dental corporation, menlo park, ca, usa) were used for polishing. when the proximal area was affected, the defective areas were smoothed with aluminum oxide finishing strips (sof - lex, 3 m espe).replacement : the defective restoration was totally removed and replaced with a new amalgam (tytin, kerr corporation, orange, ca, usa). rubber dam isolation was used for this procedure.no treatment : the defective amalgam restorations did not receive any treatment.patients were recalled each year for up to five years for clinical evaluation by the same blinded examiners, applying the same criteria used at baseline. repair : carbide burs were used to explore the defective margins of the restorations, beginning with the removal of part of the amalgam restorative material adjacent to the defect. once this material was removed and the exploratory cavity preparation did not include any stained or soft tooth tissues, a dispersed - phase amalgam (original d, wykle research, inc, carson city, nv, usa) was used to repair the preparation. rubber dam isolation was used for this procedure. refinishing : defective areas of the amalgam restoration were smoothed using carbide burs (numbers 12 and 30, brasseler usa, savannah, ga, usa). on the occlusal and buccal / lingual surfaces, silicone - impregnated points (brownie / greenie / supergreenie, shofu dental corporation, menlo park, ca, usa) were used for polishing. when the proximal area was affected, the defective areas were smoothed with aluminum oxide finishing strips (sof - lex, 3 m espe). replacement : the defective restoration was totally removed and replaced with a new amalgam (tytin, kerr corporation, orange, ca, usa). the results of each group in terms of degradation were analyzed by the wilcoxon nonparametric test to compare the pre- and postoperative conditions. additionally, the performance of all groups was contrasted using the z test to determine the differences between upgrade and downgrade restoration quality. the mst of the restorations was determined by the kaplan - meier test at each annual recall examination. from the original cohort of 52 patients with 160 restorations, 45 patients with 108 restorations were assessed (67.5%) at the fifth year (66 class i and 42 class ii restorations). the distribution of the restorations in the groups was as follows : refinishing (n = 46), repair (n = 11), replacement (n = 15), and no treatment (n = 36). during the five - year followup, 52 restorations (32.5%) were lost to follow up due to orthodontic treatment where restorations were covered by metallic bands (n = 3), address changes or no attendance (n = 39), and restorations that presented a charlie rating during a prior study observation (n = 10). the latter were fully replaced and removed from the study. the results are presented as percentages of alpha ratings in the different groups. after an initial improvement in all treatment groups, all groups showed a trend to downgrade during the observation period in all parameters, except in secondary caries. throughout the observation period, a charlie rating was observed in only a small number of restorations (10/160, 6.25%) : 3 at the first year, 2 at the second, 2 at the third, 1 at the fourth, and 2 at the fifth. the refinishing and repair groups presented no difference in alpha - rated restorations between the baseline and the fifth - year examination regarding marginal adaptation. in contrast, the replacement group presented more alpha - rated restorations at five years than at baseline (p = 0.021). no - treatment group showed a reduction of alpha - rated restorations between the baseline and five - year evaluations (p = 0.029) (figure 1). the kaplan - meier test showed that the refinished and no - treatment groups showed a median survival time (mst) of three years for marginal adaptation after five years. the repair and replacement groups each showed a mst of four years (figure 8). regarding the anatomic form parameter, the three treated groups showed no difference between baseline and five years. no treated group showed a downgrade in alpha - rated restorations (figure 2). all treatment groups maintained the same clinical condition as presented at baseline (p > 0.05). no treated group showed a significant downgrade in surface roughness after five years (p0.005) (figure 3). the refinishing, replacement and no - treatment groups showed a mst of five years, and the repair group showed a mst of four years (figure 5). the repair group showed a nonsignificant improvement in secondary caries after five years (p = 0.157), while the replacement group had a significant improvement (p = 0.046). the refinishing (n = 1), and no - treatment groups (n = 2) presented a low rate of caries lesions (figure 4). amalgam longevity is an important issue for patients, governments, and dentists to define the cost of dental treatment. minimal - intervention dentistry, such as repair or refinishing of localized defects of restorations, could increase the longevity of the amalgam restorations and reduce patient stress regarding treatment cost. repair and refinishing showed a high level of clinical acceptance by patients in this study. most of the restorations ' performance was assessed as clinically acceptable, including alpha or bravo ratings in all experimental groups. the success of repair and refinishing allowed a significant increase in the lifetime of the original restorations with minimal intervention, as most of these procedures could be performed without dental anesthesia. in general, the results show that repairing and refinishing restorations with localized defects are effective and increase the mst of the restorations. this study showed an association between the type of treatment and prognosis, assuming clinical criteria for restoration repair instead of traditional replacement based on quality assessment and the mst of those procedures. the choice of refinishing or repair resulted in tooth tissue preservation instead of unnecessary tooth structure removal, as in the case of the replacement group [17, 19, 20 ]. the present study did not show a biological risk for the teeth : there were no tooth fractures, a low rate of restoration failures, and no pulp injuries. the main reason for restoration failures is secondary caries lesions located at the margins of the restorations. these lesions should be clinically differentiated from stained and ditched margins in order to find soft dental tissue or carious areas. random assignation in our study was carried out after considering the types of restoration defects. it was not possible to allocate the restorations completely randomly because there are ethical concerns with, for example, secondary caries. additionally, some localized defects will not improve with minimally invasive treatment, for instance in the case of undercontoured restorations in the refinishing group. only recently have a number of dental schools included restoration repair in their educational programs, which could explain why repair is not popular yet in operative dentistry. after five years, 96.3% of the restorations presented alpha ratings for secondary caries, with no significant differences between repair and replacement (see case of repair figures 915). according to this observation, repair must be considered a conservative procedure and can be used safely when there is a small caries lesion with easy access. this finding is consistent with previous research, which indicated that the presence of secondary caries is a localized process originating from the surface and not involving the entire restoration [2225 ]. fifty percent of the repaired restorations had an alpha rating after 2 years in marginal adaptation. this might be explained by the fact that other clinical conditions, such as cavity design, occlusal contacts, and bruxism, were not modified. if marginal adaptations fail, it is possible to reduce marginal discrepancies by applying other minimally invasive procedures, such as marginal flowable resins or marginal sealant, which is a practical, easy, and fast alternative to sealing the gap with pits and fissure sealant. marginal sealants perform better than repair over time [11, 17, 19, 20 ]. full replacement of restorations promotes less preservation of healthy tooth tissues and is also more time consuming than restoration repair, and yet it is the most prevalent procedure in general dental practice [7, 1114, 26 ]. a recent study suggests that repaired restorations could outlast restorations that have been replaced, and one possible reason for this is that most of the original restoration is kept intact. although the use of resin - based composite to repair amalgam restorations is considered an appropriate process whenever a proper surface conditioned technique is applied [27, 28 ], restorations were repaired with amalgam based on the low cost and long - term effectiveness of this material. fifty percent of the restorations maintained alpha - rated anatomic form and surface roughness for at least 4 years in restorations that were refinished. these two parameters were the ones that suffered the greatest deterioration over time : 30.4% and 23.9% of restorations were alpha - rated for these two parameters after 5 years, compared to 8.3% and 30.6%, respectively, in the control group (p < 0.001). refinishing could be considered a preventive measure because it reduces the possibility of plaque accumulation, as the restoration may achieve an anatomical form similar to the tooth, making it favorable for improvements towards restoration function and longevity [19, 3032 ]. prior to the refinishing procedure, radiographic examination is mandatory to establish the thickness of the restorations because in shallow restorations the dentin could be exposed or the mechanical properties of the restoration could be impaired. this problem could be avoided by analyzing bite - wing radiographs in the same way that caries lesions are detected. in general, refurbishing is recommended only for improving contoured defects. full replacement of the restoration did not present secondary caries during the study period, similar to repair. in general, replacement showed the same trend of downgrade as observed in other groups, but it had an increased alpha rating for marginal adaptation (greater than the refinishing and no - treatment groups), and it had a similar performance to the repair group. regarding secondary caries and surface roughness, the most relevant downgrade was observed in the no - treatment group regarding anatomic form. this finding support the idea that it is necessary to treat small localized defects of amalgam restorations in order to prevent future damage. for this reason, it could be considered the only parameter for which it is possible to compare the performance of the four treatments. in this context, the replacement group presented the best performance, as it was the only one that showed more alpha - rated restorations at five years than at baseline. the no - treatment group showed a significant downgrade in the period of the study. the present five - year clinical study supports the concept that repair treatment is as effective as total replacement of restorations with localized defects and reduces biological costs to the patient. minimally invasive treatments of defective amalgam restorations presented similar results to the restorations that were replaced. | replacement of dental restorations has been the traditional treatment for defective restorations. this five - year prospective clinical trial evaluated amalgam restorations with localized defects that were treated by means of repair or refurbishing. fifty - two patients (50% female and 50% male, mean age 28.3 18.1 years, range 1880) with 160 class i and class ii defective restorations were included. the study focused on the application of two minimally invasive treatments for localized restoration defects and compared these with no treatment and total replacement as negative and positive controls, respectively. restorations were assessed by two calibrated examiners according to modified u.s. public health service criteria, including marginal adaptation, anatomic form, secondary caries, and roughness. at five years, recall was examined in 45 patients with 108 restorations (67.5%). the results suggest that repair treatment is as effective as total replacement of restorations with localized defects, reducing biological costs to the patient and providing new tools to the clinician. refinishing restoration is a useful treatment for localized anatomic form defects. |
improvements in the mechanical properties of composite resins and esthetic needs have brought about an increase in the application of these materials. weak bonding to dentin surface remains, however, is deemed as one of the major problems of composite resin restorations especially in gingival floor of cavities. application of low elastic modulus materials such as flowable composites, glass ionomer (gi) or resin modified glass ionomer (rmgi) under the composite restorations, known as sandwich technique is one of suggested methods for improving the bond strength to dentin. in traditional sandwich technique introduced by mclean the bond strength between gi and composite was weak and various methods have been suggested for improving the bond strength including application of acid or resin coating on unset or maturated gi. in spite of the fact that bond strength is fairly improved by these methods, low tensile strength of gi is still reported to cause cohesive fracture in gi before deboning occurred in the interface. some studies suggest the application of rmgi instead of gi in sandwich technique due to better mechanical properties, more resistant to moisture and higher bond strength to composite, rmgi can bond chemically to composite through co - polymerization of un - reacted monomer (hydroxyethyl methacrylate [hema ]) in air - inhibited layer of surperfacial surface of cured rmgi with adhesive systems or composite resins. furthermore, it may provide covalent chemical bond between adhesive resin systems and residual monomer in polyacid chains within the cured rmgi. the total etch adhesive systems that need etching before applying have widely been used in restorative procedures. the etching and rinsing processes may remove calcium and aluminum from gi and reduce the cohesive strength of it. however, there are contradictory results reported in the literature about the effects of acid etching on bond strength of rmgi to composite. etching of rmgi may have no effect, adverse effect, or improving effect on bond strength. the self - etch approach either two - or one - step adhesives are more user - friendly due to the time - saving and simplified procedure. the application of self - etch adhesives on gi or rmgi improve the bond strength to composite in comparison with total etch adhesives. in co - curing technique, two different light - cured materials were coincidently polymerized. knight el al. in their study suggested the application of co - curing technique for rmgi and composite can decrease the internal stress in composite restorations and also reduce the clinical steps. furthermore, simultaneous curing of rmgi with composite increases the bond strength between gi and composite. a study by tulunoglu. applied a co - curing technique for coincident polymerization of different adhesive systems with rmgi and concluded that although this method may increase in micro - leakage in self - etch adhesive, but, it has no significant effect in three - or two - step total - etch adhesives. the authors assumption was that simultaneous curing of rmgi and adhesive systems may increase penetration of adhesive systems into rmgi before curing and so the bond strength will improve. hence, the aim of the present study was to evaluate the shear bond strength (sbs) of rmgi to composite resin, using different adhesive systems with co-/pre - curing techniques. the null hypotheses were as follows : the application of different adhesive systems has no effect on sbs between rmgi and composite.the curing techniques (co - or pre - curing) have no effect on sbs. the application of different adhesive systems has no effect on sbs between rmgi and composite. the curing techniques (co - or pre - curing) have no effect on sbs. a total of 60 specimens of rmgi (fuji ii lc, gc co ; japan) were prepared according to manufacturer 's instructions, filled in 2 mm height of the transparent plastic rings (2 mm diameter 6 mm height) and kept uncured. the surface of rmgi samples were flattened by hand instrument and divided into two groups of 30. two different curing techniques were applied : in pre - curing technique, the prepared rmgi specimens were stored in a dark environment for 1 min and then light cured (blue phase c8, ivoclar vivadent ; schaan, lichtenstien) at 800 mw / cm for 20 s. the specimens were randomly divided into three subgroups of ten according to adhesive systems (total - etch, two - step self - etch and one - step self - etch) were applied. the adhesive systems used in this study are listed in table 1. in the total - etch group, acid etch was applied for 15 s, rinsed for 10 s and air dried. each adhesive system was used according to manufacturer 's instructions and light cured at 800 mw / cm for 20 s. the intensity of the irradiation was measured by radiometer before application. in co - curing groups, the procedure is similar to the former group, after 1 min of storage in a dark environment ; however, uncured rmgi samples are coincidently cured with adhesive systems applied on it. then, two layers of 2 mm heliomolar composite (ivoclar vivadent ; schaan, lichtenstien) were placed in plastic ring and each layer was cured for 40 s. all procedures were performed by a single operator. samples were stored in 100% humidity for 48 h and then sbs was measured by zwick universal testing machine (zwick / z250, type kap - z, zwick roell group ; ulm, germany) at cross head speed of 1 mm / min. two samples of each group were prepared for scanning electron microscope (sem) evaluation. failure mode was determined by streo - microscope evaluation (leo, 1450 up, zeiss ; oberkochen, germany) and classified as adhesive, cohesive of composite, cohesive of rmgi and mixed. normal distribution of the data was confirmed using the kolmogorov - smirnov test and data were analyzed using two - way anova, tukey 's post - hoc and independent t - tests with a pre - set significance level of 0.05. two - way anova showed that both variables (curing technique and type of adhesive systems) had a significant effect on sbs (p = 0.04 for curing technique and p = 0.00 for adhesive systems). tukey 's post - hoc test indicated that both self - etch adhesive systems provide higher bond strength than the total - etch adhesive system (p < 0.05) while there was no significant difference between two self - etch adhesive systems. independent t - test presented that the application of co - curing technique increased the sbs in the both of self - etch adhesive systems (p = 0.001 for adhese and p = 0.04 for adhese one f) but, decreased the sbs in total - etch adhesive system (p = 0.015). the mean shear bond strength values (mpa) of experimental groups the distributions of failure mode in the various experimental groups are displayed in table 3. distribution of failure mode in experimental groups in the total - etch pre - cured group, severe crack and voids was observed in composite - adhesive interface while in the co - cured group of this adhesive, severe crack and voids appeared in rmgi - adhesive interface. in both self - etch adhesive systems either pre - cured or co - cured, no crack or void was observed in the two interfaces. in the co - cured two - step self - etch adhesive group, the obvious resin tags formation at resin - rmgi interface was observed. two - way anova showed that both variables (curing technique and type of adhesive systems) had a significant effect on sbs (p = 0.04 for curing technique and p = 0.00 for adhesive systems). tukey 's post - hoc test indicated that both self - etch adhesive systems provide higher bond strength than the total - etch adhesive system (p < 0.05) while there was no significant difference between two self - etch adhesive systems. independent t - test presented that the application of co - curing technique increased the sbs in the both of self - etch adhesive systems (p = 0.001 for adhese and p = 0.04 for adhese one f) but, decreased the sbs in total - etch adhesive system (p = 0.015). the distributions of failure mode in the various experimental groups are displayed in table 3. in the total - etch pre - cured group, severe crack and voids was observed in composite - adhesive interface while in the co - cured group of this adhesive, severe crack and voids appeared in rmgi - adhesive interface. in both self - etch adhesive systems either pre - cured or co - cured, no crack or void was observed in the two interfaces. in the co - cured two - step self - etch adhesive group, the obvious resin tags formation at resin - rmgi interface was observed. the results of current study reject both of the hypotheses : adhesive systems andcuring technique have no effect on sbs. curing technique have no effect on sbs. among the three different adhesive systems applied, the total - etch adhesive has the lowest value of sbs. acid etching and rinsing are important factors that will possibly have significant effect on bond strength. a study by bracket and huget demonstrated that the application of acid etching can improve the bond strength between rmgi and composite. in contrast, kerby and knobloch demonstrated this procedure can decrease the bond strength through a partial elimination of hema and un - reacted methacrylate groups in air - inhibited layer. however, some studies showed the inhibition or decreasing of penetration of acid into rmgi due to the high resin content and formation of polymeric matrix. therefore, they concluded that acid etching has no significant effect on bond strength of rmgi to composite. the application of adhesive systems may improve the bond strength between composite and rmgi or traditional gi. in the current study, both self - etch adhesive systems had higher sbs than the total - etch adhesive. this finding is consistent with the results obtained by arora. and kasraie. similarly, kandaswamy. concluded that mild self - etch adhesive had higher bond strength than the strong self - etch or total etch adhesive when they were applied on the unset gi cement. demonstrated that the application of self - etch primer on unset gi improved the bond strength in comparison with application of this adhesive or total - etch adhesive on set gi. the lower the viscosity adhesive used, the better the bond strength may be achieved, uncured hema in the surface of rmgi may improve the wetting ability of adhesive resins. the observation of noticeable resin tags formation in sem micrographs of co - cured two - step self - etch adhesive group may be due to lower viscosity or better wet ability of this adhesive. the penetration of resin into rmgis may improve the strength of these cements and therefore, the failure mode may change. evaluation of the failure mode in this group showed that the number of cohesive failure of rmgi decreased and mixed failure was the most frequently failure mode was observed. in the total - etch co - cured group, acid was applied before formation of the resinous matrix so, acid could penetrate more into rmgi. the formation of weak salt on the surface of rmgi, removing or decreasing calcium and aluminum ions that reduce the tensile strength of rmgi and reduction in hema content may be explanations for reduction of bond strength in this experimental group. furthermore, the increase of the cohesive failure mode in this group, in comparison with the other groups, points out the weakening effect of acid application on the uncured rmgi structure. sem analysis showed the cracks and voids in rmgi - resin adhesive interface that further confirmed this hypothesis. there are contradictions about the failure mode observed in the previous studies since they reported the cohesive failure of gi / rmgi, mixed or adhesive as the most failure mode observed. in the current study, the most of specimens in total - etch co - cured group fractured cohesively in rmgi that remarks the detrimental effect of acid etching on uncured rmgi. in other groups, adhesive or mixed failure modes were the most observed failure modes. in sem micrographs of two self - etch groups, no cracks and voids in any interfaces gopikrishna. concluded that the carboxylic groups in self - etch primer can chemically bond with calcium in gi as they bond to calcium of hydroxyapatite in dentin. the other factor to keep in mind is that leaching the metallic ions during the etching and rinsing procedure can decrease the mechanical properties of gi. hence, in the current study acid - etch was applied after 1 min - that 's an acceptable time for clinical use - until acid - base reaction induced rather initial setting and reduced the leaching the metallic ions. thickness and tensile strength of gi cement, type, viscosity and stress polymerization of composite, handling procedure and total removing the residual acid (if acid etch was applied) are other certain factors may affect the bond strength between gi or rmgi and the composite. in the current study, all adhesives are chosen from the same manufacturer, so that they will be only slightly different in chemical compositions that may affect the bond strength. in this condition, different application methods of these adhesives may have more effect on sbs than the little chemical composition differences. the application of co - curing technique and self - etch adhesive systems may improve the sbs between composite and rmgi. the authors suggested to evaluate the effect of the co - curing technique and the self - etch adhesive in clinical situation in future research. furthermore, the assessment of the application of co - curing technique on bond strength of gi based - adhesives is required. | aim : to evaluate bond strength between rmgi and composite using different adhesive systems and curing techniques.materials and methods : sixty prepared samples of rmgi were randomly divided into six groups according to adhesive systems (total - etch, two - step self - etch and all - in - one) and curing techniques (co - curing and pre - curing). in co - curing technique, the adhesive systems were applied on uncured rmgi samples and co - cured together. in the pre - curing technique, before application of adhesive systems, the rmgi samples were cured. composite layers were applied and shear bond strength was measured. two samples of each group were evaluated by sem. failure mode was determined by streomicroscope.results:both curing methods and adhesive systems had significant effect on bond strength (p - value < 0.05). there was an interaction between two factors (p - value < 0.05). both self - etch adhesives had significantly higher shear bond strength than the total - etch adhesive (p - value < 0.05). the co - curing technique improved the bond strength in self - etch adhesives, but decreased the bond strength in total - etch adhesive (p - value<0.05).conclusion : the application of self - etch adhesive systems and co - curing technique can improve the bond strength between the rmgi and composite. |
advances in chemotherapy and radiotherapy have altered the natural course of disease in patients with systemic cancer, who now live longer than ever before. on the downside, prolonged survival has led to increased incidence of distant spread of disease, leptomeningeal metastasis being one such dreaded complication. however, prompt diagnosis and treatment in these patients can not only provide symptomatic relief and improve the quality of life but can also increase survival. contrast - enhanced mr has not only increased the sensitivity and specificity to detect meningeal disease but can act as a guide to biopsy and assess response to therapy. advances in cytological techniques and tumour markers have further increased the sensitivity in detection of malignant cells in the cerebrospinal fluid. three layers of meninges that envelope the brain are the duramater, the arachnoid and the pia mater. the dura, also called the pachymeninx, is composed of two layers, the outer periosteal and the inner meningeal layer that are fused except where they enclose the venous sinuses. the outer layer is a tough fibrous structure that firmly attaches to the inner surface of the cranium forming the periosteum of the inner table and blends imperceptibly with the pericranium on the outer table at the various sutures and the skull base foramina. one exception is its continuity across the optic foramen and superior orbital fissures to form the periosteal lining of the orbital walls. referred to as the periorbita, it is of significance when deciding the approach to orbital surgery. the inner true meningeal layer forms various reflections that compartmentalize and stabilize the brain parenchyma. it differs from the outer periosteal layer in that it continues into the spinal canal through the foramen magnum and extends across the various smaller skull base and intervertebral foramina as the dural sheath of the various cranial and spinal nerves before forming the perineurium. this anatomic arrangement is of clinical significance as disease processes involving the exiting nerves can spread retrogradely along the nerves and their dural sheaths. in the globe, tram - track enhancement of the perioptic dural sheath is suggestive of a meningioma. the arachnoid is the middle meningeal layer that closely abuts the dura externally with the potential subdural space between them. the pia invests the sulci and gyri whereas the arachnoid jumps from one gyrus to another. the pia forms the tela choroidea and the choroid plexus that is central to cerebrospinal fluid (csf) production whereas the arachnoid aids in csf absorption by forming the arachnoid granulations. thus leptomeninges are central to csf physiology and it is not difficult to comprehend why disease processes that affect the meninges inadvertently affect csf production or resorption, sometimes heralding the onset of meningeal disease. the csf fills in the subarachnoid space between the arachnoid and pia, which is narrow over the cerebral convexities but widens to form large cisternal spaces in the skull base. a superficial cerebral focus can rupture into the subarachnoid space and spread along the convexities into the basal cisterns. this is widely believed to the origin of basal exudates in tuberculosis and one of the possible causes of spread of malignant disease. the pia arachnoid space complex continues around the small vessels at the skull base as the perivascular virchow robin spaces. primary malignant tumours of the meninges are extremely rare and mostly sarcomas ; it is believed they have an association with previous radiation therapy,. there are anecdotal case reports of primary diffuse leptomeningeal gliomatosis,, primary leptomeningeal lymphoma and melanoma. the most common malignant involvement of the meninges is by secondary involvement referred to as meningeal carcinomatosis. primary central nervous system (cns) tumours that commonly metastasize to the meninges include medulloblastoma and ependymoma in children and glioblastoma multiforme in adults. non - cns malignancies that commonly spread to the meninges include breast, lung, melanoma, gastrointestinal and genitourinary malignancies and haematological malignancies such as leukaemias and lymphomas. patients typically present with signs of raised intracranial pressure as a result of hydrocephalus or cranial neuropathies due to effects of tumours cells on cranial nerves in the subarachnoid space. it is important to understand the various probable mechanisms of tumour spread to understand the various imaging findings in such patients. spread of tumour cells to the meninges can occur by haematogenous spread or direct contiguous infiltration. haematogenous dissemination to the dura can be in form of single or multiple focal deposits or diffuse infiltration. dura is involved by contiguous extension from malignancies of the nasopharynx and paranasal sinuses (fig. 1) or from calvarial deposits from breast, lung and even the prostate. t1w staging mri (a) shows a mass (asterisk) in the left ethmoid sinus with orbital extension and involvement of the periorbita. contrast - enhanced follow - up mri (b) shows tumour recurrence with involvement of the dura. t1w staging mri (a) shows a mass (asterisk) in the left ethmoid sinus with orbital extension and involvement of the periorbita. contrast - enhanced follow - up mri (b) shows tumour recurrence with involvement of the dura. haematogenous spread to the leptomeninges can potentially occur via seeding of the choroid plexus, along perivascular spaces or the bateson 's vertebral venous plexus. a primary brain tumour like a glioblastoma multiforme or parenchymal deposit in proximity to the brain surface can contiguously involve the adjoining pial lining and subsequently disseminate into the subarachnoid space. some tumours as medulloblastoma and ependymoma have a propensity to dissemination and meningeal involvement due to their intraventricular location and thus close proximity to the csf pathway (fig. post - contrast sagittal (a) and axial (b, c) fat - saturated t1w images of the thoracic spine shows multiple focal enhancing nodules (arrows) in the spinal subarachnoid space. cranial and leptomeningeal subarachnoid spaces are continuous and imaging and treatment protocols should include the entire neuraxis. diffuse subarachnoid dissemination in a case of medulloblastoma. post - contrast sagittal (a) and axial (b, c) fat - saturated t1w images of the thoracic spine shows multiple focal enhancing nodules (arrows) in the spinal subarachnoid space. cranial and leptomeningeal subarachnoid spaces are continuous and imaging and treatment protocols should include the entire neuraxis. cerebrospinal subarachnoid is continuous and thus disease processes affecting the brain can spread to the spine and vice versa. thus despite focal neurologic signs and symptoms, imaging and treatment protocols for leptomeningeal disease should include the entire neuraxis. contrast - enhanced magnetic resonance imaging (mri) has unequivocal increased sensitivity and has replaced contrast computed tomography (ct) in evaluation of patients with suspected leptomeningeal carcinomatosis,,. this is not only due to the inherent better contrast resolution with mri but also because a beam hardening artefact beneath the inner table limits the visualization of meningeal enhancement with ct. it is important to understand the pattern of meningeal enhancement in normal patients so as to predict pathologic meningeal enhancement with some degree of certainty and reduce the false positive rates. the dura lacks the blood brain barrier and thus normally enhances following administration of intravenous contrast. the normal enhancement is typically thin, smooth and discontinuous and seen more over the cerebral convexities than in the basal regions, (fig. post - contrast coronal t1w (a) and axial gradient recalled echo (gre) (b) images. note the thin discontinuous enhancement (small white arrows) of the dura over the cerebral convexities. normal enhancing meningeal vessels in the sulci (small black arrowheads) should not be confused with pial enhancement. post - contrast coronal t1w (a) and axial gradient recalled echo (gre) (b) images. note the thin discontinuous enhancement (small white arrows) of the dura over the cerebral convexities. normal enhancing meningeal vessels in the sulci (small black arrowheads) should not be confused with pial enhancement. the enhancement pattern is dependent on several factors including the strength of the magnet, type of pulse sequence and amount of contrast. more extensive and long segments of enhancements are seen with greater field strengths and high dose of paramagnetic contrast,. the long repetition time (tr) and large flip angles used in gradient echo imaging results in decreased saturation of the contrast - enhancing meninges in contrast to the markedly saturated background tissues. thus contrast - enhanced gradient echo sequence typically demonstrates diffuse meningeal enhancement in normal subjects compared with the thin and discontinuous enhancement in the spin echo sequences. contrast - enhanced t1-weighted (t1w) images in 3 orthogonal planes is considered the most sensitive in detection of meningeal disease of any cause. it is better to acquire post - contrast images with fat saturation as they are more sensitive in detecting calvarial deposits,. fluid attenuated inversion recovery (flair) due to suppression of the csf signal is highly sensitive to subarachnoid disease and post - contrast flair has been shown to be a useful adjunct to fat - saturated t1w images in detection of meningeal disease. leptomeningeal carcinomatosis can cause focal or diffuse enhancement of the meninges, ependymal lining and perivascular spaces and secondary complications of hydrocephalus and cranial neuropathies. neoplastic involvement of the dura leads to diffuse enhancement along the inner table of the skull vault (fig. as expected, pial involvement leads to wavy enhancement that closely follows the brain surface along the depths of the sulci, (fig. 6). pre - contrast (a) and post - contrast (b) axial t1w images at the level of lateral ventricles demonstrate a calvarial deposit (asterisk) in the frontoparietal region associated with enhancing thickening of the underlying dura (white arrows) that could be reactive or due to contiguous dural involvement as in this case. figure 5biopsy proven dural deposit in the falx in a case of breast carcinoma. contrast - enhanced axial (a), coronal (b) and diffusion weighted (c) images shows an enhancing dural based mass in relation to the falx in the posterior interhemispheric fissure that demonstrates restricted diffusion. figure 6pial - subarachnoid pattern of enhancement. a known case of non - small cell carcinoma of the lung with signs of raised intracranial pressure. axial t2w image (a) shows hydrocephalus with transependymal seepage of csf. post - contrast fat - saturated axial (b) and coronal (b) t1w images demonstrate diffuse pial enhancement in the depths of the sulci and over the cerebellar folia (black arrowheads). pre - contrast (a) and post - contrast (b) axial t1w images at the level of lateral ventricles demonstrate a calvarial deposit (asterisk) in the frontoparietal region associated with enhancing thickening of the underlying dura (white arrows) that could be reactive or due to contiguous dural involvement as in this case contrast - enhanced axial (a), coronal (b) and diffusion weighted (c) images shows an enhancing dural based mass in relation to the falx in the posterior interhemispheric fissure that demonstrates restricted diffusion. pial - subarachnoid pattern of enhancement. a known case of non - small cell carcinoma of the lung with signs of raised intracranial pressure. post - contrast fat - saturated axial (b) and coronal (b) t1w images demonstrate diffuse pial enhancement in the depths of the sulci and over the cerebellar folia (black arrowheads). it is conceivable that the arachnoid gets involved subsequently due to its close anatomic proximity to the dura on the outside and the communication with the pia via the subarachnoid space on the inside and eventually all the meningeal layers become involved (fig. this is the basis of two patterns of meningeal enhancement : the dura arachnoid type and the pia contrast - enhanced axial (a)) and coronal (b) demonstrates diffuse dural (yellow arrows) and leptomeningeal enhancement (black arrows) in a known case of melanoma. contrast - enhanced axial (a)) and coronal (b) demonstrates diffuse dural (yellow arrows) and leptomeningeal enhancement (black arrows) in a known case of melanoma. the pial pattern of enhancement shows a higher incidence of csf positive cytology presumably due to contiguity with the subarachnoid space. there are cases of isolated dural involvement that are repeatedly negative for tumour cells on csf and mr imaging can guide biopsy and assess response to therapy in such cases. alteration of csf physiology leads to hydrocephalus that maybe associated with transependymal seepage of csf, referred to as interstitial oedema (fig. there are many entities that may mimic leptomeningeal carcinomatosis and the radiologist must be familiar with them to reduce false positive rates and prevent unnecessary meningeal biopsies. focal or diffuse meningeal enhancement may persist long after a craniotomy and has been postulated to be reactive to bleeding into the subarachnoid space at the time of surgery and does not necessarily indicated infection or tumour involvement,. patients suspected of meningeal carcinomatosis frequently undergo ventricular shunt placement for hydrocephalus that can cause focal / diffuse meningeal enhancement as a result of meningeal fibrosis, (fig. 8). contrast - enhanced fat - saturated t1w axial (a) and coronal (b) images demonstrates diffuse dural enhancement over the frontoparietal convexities (black arrows). csf examination was negative for infection or malignant cells and the patient was clinically well on long - term follow - up. note the right - sided ventriculoperitoneal shunt on the coronal image (small white arrowhead). contrast - enhanced fat - saturated t1w axial (a) and coronal (b) images demonstrates diffuse dural enhancement over the frontoparietal convexities (black arrows). csf examination was negative for infection or malignant cells and the patient was clinically well on long - term follow - up. note the right - sided ventriculoperitoneal shunt on the coronal image (small white arrowhead). in patients who have undergone spinal puncture for csf cytology, diffuse pachymeningeal enhancement when associated with subdural collections and tonsillar herniation should alert the clinician for possible intracranial hypotension. some conditions are commonly found in the general population and can cause focal / diffuse meningeal enhancement. resolved subdural hematoma / empyema may show persistent thickening and enhancement of the dura adjacent to the skull vault. various infectious / inflammatory disorders such as tuberculosis and fungal infections and granulomatous disorders such as sarcoidosis could be difficult to differentiate radiologically from neoplastic meningitis and may require meningeal biopsy for differentiation. idiopathic cranial pachymeningitis is a rare disorder that causes diffuse thickening and enhancement of the dura and requires biopsy for definitive diagnosis (fig. other relatively rare and anecdotal pathologic entities that can cause meningeal involvement are langherhan cell histiocytosis, neurocutaneous syndromes such as meningiomatosis and sturge weber syndrome. figure 9contrast - enhanced axial t1w images at the level of third (a) and fourth ventricles (b) demonstrates diffuse dural enhancement over the cerebral convexities including the falx and the tentorium (black arrows). contrast - enhanced axial t1w images at the level of third (a) and fourth ventricles (b) demonstrates diffuse dural enhancement over the cerebral convexities including the falx and the tentorium (black arrows). cerebrospinal subarachnoid is continuous and thus disease processes affecting the brain can spread to the spine and vice versa. thus despite focal neurologic signs and symptoms, imaging and treatment protocols for leptomeningeal disease should include the entire neuraxis. contrast - enhanced magnetic resonance imaging (mri) has unequivocal increased sensitivity and has replaced contrast computed tomography (ct) in evaluation of patients with suspected leptomeningeal carcinomatosis,,. this is not only due to the inherent better contrast resolution with mri but also because a beam hardening artefact beneath the inner table limits the visualization of meningeal enhancement with ct. it is important to understand the pattern of meningeal enhancement in normal patients so as to predict pathologic meningeal enhancement with some degree of certainty and reduce the false positive rates. the dura lacks the blood brain barrier and thus normally enhances following administration of intravenous contrast. the normal enhancement is typically thin, smooth and discontinuous and seen more over the cerebral convexities than in the basal regions, (fig. post - contrast coronal t1w (a) and axial gradient recalled echo (gre) (b) images. note the thin discontinuous enhancement (small white arrows) of the dura over the cerebral convexities. normal enhancing meningeal vessels in the sulci (small black arrowheads) should not be confused with pial enhancement. post - contrast coronal t1w (a) and axial gradient recalled echo (gre) (b) images. note the thin discontinuous enhancement (small white arrows) of the dura over the cerebral convexities. normal enhancing meningeal vessels in the sulci (small black arrowheads) should not be confused with pial enhancement. the enhancement pattern is dependent on several factors including the strength of the magnet, type of pulse sequence and amount of contrast. more extensive and long segments of enhancements are seen with greater field strengths and high dose of paramagnetic contrast,. the long repetition time (tr) and large flip angles used in gradient echo imaging results in decreased saturation of the contrast - enhancing meninges in contrast to the markedly saturated background tissues. thus contrast - enhanced gradient echo sequence typically demonstrates diffuse meningeal enhancement in normal subjects compared with the thin and discontinuous enhancement in the spin echo sequences. contrast - enhanced t1-weighted (t1w) images in 3 orthogonal planes is considered the most sensitive in detection of meningeal disease of any cause. it is better to acquire post - contrast images with fat saturation as they are more sensitive in detecting calvarial deposits,. fluid attenuated inversion recovery (flair) due to suppression of the csf signal is highly sensitive to subarachnoid disease and post - contrast flair has been shown to be a useful adjunct to fat - saturated t1w images in detection of meningeal disease. leptomeningeal carcinomatosis can cause focal or diffuse enhancement of the meninges, ependymal lining and perivascular spaces and secondary complications of hydrocephalus and cranial neuropathies. neoplastic involvement of the dura leads to diffuse enhancement along the inner table of the skull vault (fig. as expected, pial involvement leads to wavy enhancement that closely follows the brain surface along the depths of the sulci, (fig. pre - contrast (a) and post - contrast (b) axial t1w images at the level of lateral ventricles demonstrate a calvarial deposit (asterisk) in the frontoparietal region associated with enhancing thickening of the underlying dura (white arrows) that could be reactive or due to contiguous dural involvement as in this case. figure 5biopsy proven dural deposit in the falx in a case of breast carcinoma. contrast - enhanced axial (a), coronal (b) and diffusion weighted (c) images shows an enhancing dural based mass in relation to the falx in the posterior interhemispheric fissure that demonstrates restricted diffusion. figure 6pial - subarachnoid pattern of enhancement. a known case of non - small cell carcinoma of the lung with signs of raised intracranial pressure. post - contrast fat - saturated axial (b) and coronal (b) t1w images demonstrate diffuse pial enhancement in the depths of the sulci and over the cerebellar folia (black arrowheads). pre - contrast (a) and post - contrast (b) axial t1w images at the level of lateral ventricles demonstrate a calvarial deposit (asterisk) in the frontoparietal region associated with enhancing thickening of the underlying dura (white arrows) that could be reactive or due to contiguous dural involvement as in this case contrast - enhanced axial (a), coronal (b) and diffusion weighted (c) images shows an enhancing dural based mass in relation to the falx in the posterior interhemispheric fissure that demonstrates restricted diffusion. a known case of non - small cell carcinoma of the lung with signs of raised intracranial pressure. post - contrast fat - saturated axial (b) and coronal (b) t1w images demonstrate diffuse pial enhancement in the depths of the sulci and over the cerebellar folia (black arrowheads). it is conceivable that the arachnoid gets involved subsequently due to its close anatomic proximity to the dura on the outside and the communication with the pia via the subarachnoid space on the inside and eventually all the meningeal layers become involved (fig. this is the basis of two patterns of meningeal enhancement : the dura arachnoid type and the pia contrast - enhanced axial (a)) and coronal (b) demonstrates diffuse dural (yellow arrows) and leptomeningeal enhancement (black arrows) in a known case of melanoma. contrast - enhanced axial (a)) and coronal (b) demonstrates diffuse dural (yellow arrows) and leptomeningeal enhancement (black arrows) in a known case of melanoma. the pial pattern of enhancement shows a higher incidence of csf positive cytology presumably due to contiguity with the subarachnoid space. there are cases of isolated dural involvement that are repeatedly negative for tumour cells on csf and mr imaging can guide biopsy and assess response to therapy in such cases. alteration of csf physiology leads to hydrocephalus that maybe associated with transependymal seepage of csf, referred to as interstitial oedema (fig. there are many entities that may mimic leptomeningeal carcinomatosis and the radiologist must be familiar with them to reduce false positive rates and prevent unnecessary meningeal biopsies. focal or diffuse meningeal enhancement may persist long after a craniotomy and has been postulated to be reactive to bleeding into the subarachnoid space at the time of surgery and does not necessarily indicated infection or tumour involvement,. patients suspected of meningeal carcinomatosis frequently undergo ventricular shunt placement for hydrocephalus that can cause focal / diffuse meningeal enhancement as a result of meningeal fibrosis, (fig. 8). contrast - enhanced fat - saturated t1w axial (a) and coronal (b) images demonstrates diffuse dural enhancement over the frontoparietal convexities (black arrows). csf examination was negative for infection or malignant cells and the patient was clinically well on long - term follow - up. note the right - sided ventriculoperitoneal shunt on the coronal image (small white arrowhead). contrast - enhanced fat - saturated t1w axial (a) and coronal (b) images demonstrates diffuse dural enhancement over the frontoparietal convexities (black arrows). csf examination was negative for infection or malignant cells and the patient was clinically well on long - term follow - up. note the right - sided ventriculoperitoneal shunt on the coronal image (small white arrowhead). in patients who have undergone spinal puncture for csf cytology, diffuse pachymeningeal enhancement when associated with subdural collections and tonsillar herniation should alert the clinician for possible intracranial hypotension. some conditions are commonly found in the general population and can cause focal / diffuse meningeal enhancement. resolved subdural hematoma / empyema may show persistent thickening and enhancement of the dura adjacent to the skull vault. various infectious / inflammatory disorders such as tuberculosis and fungal infections and granulomatous disorders such as sarcoidosis could be difficult to differentiate radiologically from neoplastic meningitis and may require meningeal biopsy for differentiation. idiopathic cranial pachymeningitis is a rare disorder that causes diffuse thickening and enhancement of the dura and requires biopsy for definitive diagnosis (fig. other relatively rare and anecdotal pathologic entities that can cause meningeal involvement are langherhan cell histiocytosis, neurocutaneous syndromes such as meningiomatosis and sturge weber syndrome. figure 9contrast - enhanced axial t1w images at the level of third (a) and fourth ventricles (b) demonstrates diffuse dural enhancement over the cerebral convexities including the falx and the tentorium (black arrows). contrast - enhanced axial t1w images at the level of third (a) and fourth ventricles (b) demonstrates diffuse dural enhancement over the cerebral convexities including the falx and the tentorium (black arrows). meningeal carcinomatosis is the single most common cause of malignant involvement of the meninges and is increasingly seen due to advances in cancer therapy and prolonged life span of cancer patients. tumour cells can involve any of the 3 meningeal layers in a diffuse / nodular form and csf dissemination of these cells can lead to cranial neuropathies and hydrocephalus. contrast mr imaging not only acts as an important adjunct to csf cytology in diagnosis but can also guide in biopsy and assessing response to therapy. it is important for the clinician to be aware of imaging findings of meningitis carcinomatosis and the various mimics, thereby instituting definitive treatment in positive cases and avoiding unnecessary biopsy in others. | abstractprimary malignant tumours arising from the meninges are distinctly uncommon, and when they occur, they are usually sarcomas. in contrast, metastatic meningeal involvement is increasingly seen as advances in cancer therapy have changed the natural history of malignant disease and prolonged the life span of cancer patients. the meninges can either be infiltrated by contiguous extension of primary tumours of the central nervous system, paranasal sinuses and skull base origin or can be diffusely infiltrated from haematogenous dissemination from distant primary malignancies. imaging in these patients provides crucial information in planning management. this article reviews the pertinent anatomy that underlies imaging findings, discusses the mechanism of meningeal metastasis and highlights different imaging patterns of meningeal carcinomatosis and the pitfalls. |
g protein - coupled receptors (gpcrs) compose the largest family of membrane - bound receptors and many members still have unrevealed functions. efforts have been made to find ligands for gpcrs, and a broad range of ligands, including small organic compounds [1, 2 ], eicosanoids, peptides, and proteins, have been identified. members of the mas - related gpcr (mrgpr) family are known to be expressed mainly in the subpopulations of sensory neurons. this has resulted in their having another name sensory neuron specific receptors (snsrs). mas - related g - protein coupled receptor member d (mrgprd), formerly called mas - related gene d (mrgd) and also referred to as hgpcr45 or tgr7, belongs to the mrgpr family and is known to be mainly expressed in the dorsal root ganglia (drg) [6, 912 ]. when phylogenic trees of the hmrgpr family and the mouse mrgpr family are compared, variation of the members found in those phylogenic trees are not parallel. members of the human mrgpr family may cover other functions from the ones revealed by studies with the mouse mrgpr family. we hypothesized mrgprd could possess functions besides the ones in the drg and found a spheroid forming activity. at this time, for mrgprd, beta - alanine (ala) is the only known ligand that would be physiological. when we screened a physiologically active substance library and a known small compound library, we found two novel ligands for mrgprd, that is, beta - aminoisobutyric acid (aiba) and diethylstilbestrol (des). as ala promoted spheroid growth of mrgprd stably expressing cells, it would be useful to obtain antagonists in order to analyze the tumorigenic character of mrgprd. we obtained mu-6840 as an antagonist of mrgprd by high - throughput - screening at a large small chemical library. since it specifically inhibits the growth of spheroids formed with cells stably expressing mrgprd, mu-6840 is a potential anticancer agent. in this paper, we will discuss the novel ligand, the antagonist, and the novel character of mrgprd. dulbecco 's modified eagle medium (dmem), minimum essential medium alpha without nucleic acids (-mem), rpmi1640, opti - mem i reduced serum media (opti - mem), grace 's insect medium, penicillin - streptomycin, hanks ' balanced salt solution (hbss), and lipofectamine 2000 were purchased from invitrogen corporation, usa. dmem inositol - free was purchased from mp biomedicals, usa. psv2-dhfr was purchased from atcc, usa. fetal bovine serum (fbs) was purchased from sanko junyaku, japan. pathdetect nfat cis - reporting system and pathdetect elk1 trans - reporting system were purchased from agilent technologies, usa. guanosine diphosphate (gdp), guanosine 5-o-(3-thiotriphosphate) (gtps), saponin, licl, formic acid, and bovine serum albumin (bsa) were purchased from sigma - aldrich inc., usa. leadseeker beads, rna binding ysi, myo-[2-h ] inositol and gtps [s ] were purchased from ge healthcare, uk. hek293 cells (ds pharma biomedical corporation, japan) were maintained in dmem with 10% fbs and penicillin - streptomycin at 37c under 5% co2. cho / dhfr cells (ds pharma biomedical corporation, japan) expressing hmrgprd (described in this paper) were maintained in -mem with 10% fbs dialyzed and penicillin - streptomycin at 37c under 5% co2. nih/3t3 cells (atcc, usa) were maintained in rpmi1640 with 10% fbs and penicillin - streptomycin at 37c under 5% co2. human adrenergic alpha 1a receptor (adra1a, ay389505.1) gene and human mrgprd (hmrgprd, nm_198923.2) gene were cloned into pcdna3.1 (invitrogen, usa) (hereafter referred to as pcdna - adra1a and pcdna - hmrgprd, resp.). using lipofectamine 2000, 20000 hek293 cells in each well of a 96-well multiplate were transfected with a set of 3 plasmids, consisting of one from each category as follows : (1) pnfat - luc plasmid (pathdetect nfat cis - reporting system), or pfr - luc plasmid with pfa2-elk1 plasmid (pathdetect elk1 trans - reporting system) ; (2) prl - tk ; (3) pcdna3.1, pcdna - adra1a, or pcdna - hmrgprd. twenty - four hours after the transfection, the cells were lysed and transferred to optiplate-96. samples were prepared in accordance with the manufacturer 's instructions for the dual - luciferase reporter assay system (promega) and measured with the arvo sx 1420 multilabel counter (wallac). the signal intensity of each sample was calculated by dividing the value of firefly luciferase luminescent by the value of renilla luciferase luminescent within the same sample. the cell culture media used in this assay was dmem with 10% fbs, which may contain ala less than 0.5 m, at least 40 times lower than the ec50 of ala to mrgprd. pfast - bac - hmrgprd - gi, in which bovine gi (nm_174324) was fused to hmrgprd in frame and cloned into pfast - bac (invitrogen corporation), was served to obtain baculovirus possessing hmrgprd - gi, using the bac - to - bac baculovirus expression system with pfast - bac1 in accordance with the manufacturer 's instructions. sf9 cells in suspension culture were infected with the baculovirus possessing hmrgprd - gi at moi = 2 to 5 and maintained for 72 hours at 27c. briefly, cells were suspended in a membrane preparation buffer (20 mm hepes - koh, 1 mm edta, 2 mm mgcl2, complete edta - free, ph7.4) before being put in the n2 cavitation apparatus (fike metal products), and then pressurized at 600 psi for 30 minutes on ice. burst cells were collected and separated from the nuclear fraction by centrifugal separation (1,800 xvg for 10 minutes). the supernatant was centrifuged at 100,000 x g for 30 minutes to obtain a membrane fraction. the pellet was then resuspended in a membrane stock buffer (20 mm tris - hcl, 10% glycerol, complete edta - free, ph7.4) and kept as a hmrgprd - gi expressing membrane at 80c. one microgram of the hmrgprd - gi expressing membrane, 0.44 nm gtps [s ], 5 m gdp, the compound of interest, and 3.65 mg / ml leadseeker beads were prepared with an assay buffer (20 mm hepes, ph7.3, 100 mm nacl, 10 mm mgcl2, 1 mm edta, 100 g / ml saponin) in standard white 384 well assay microplates (corning inc.) at final volume of 60 l. after incubating the microplates at room temperature for 1 hour cho / dhfr cells were transfected with psv2-dhfr and psr - hmrgprd, where hmrgprd was cloned into an original vector containing sr promoter, using lipofectamine2000 to establish hmrgprd / cho / dhfr cells, stable cho / dhfr cell lines which overexpress hmrgprd. three thousand six hundred hmrgprd / cho / dhfr cells were plated onto each well of black 384 well cell culture microplates (corning inc.) and cultured for 2 days. in accordance with the manufacturer 's instructions for the flipr calcium 3 assay kit (molecular devices), the loading buffer, in which calcium 3 assay solution was diluted with a hh buffer (hbss, 25 mm hepes, ph7.4, 2.5 mm probenecid), was added to each well after media disposal and kept at 37c for 1 hour under 5% co2. for the agonist screening, the hh buffer containing a test compound was added to each well and then the fluorescence transition caused by 488 nm excitation light was detected using flipr (molecular devices). for the antagonist screening, the hh buffer containing the test compound was added and incubated for 10 minutes and then the fluorescence transition was detected as the hh buffer containing ala was added to each well. ten thousand hmrgprd / cho / dhfr cells were plated onto each well of 96-well cell culture microplates and cultured for 6 hours, which were then labeled using labeling media (dmem inositol - free, 10% fbs dialyzed, 1 nci / ml myo-[2-h]inositol) and cultured overnight. labeling media was replaced with an ip assay buffer (200 mm hbss, 25 mm hepes, ph7.0, 0.1% bsa, 20 mm licl) that contained test compounds and was incubated for 1 hour for the agonists screening and incubated for 15 minutes for the antagonists screening. for the antagonist screening, in addition to the test compounds, ala was added and incubated for 1 hour. after removing the assay buffer, 20 mm formic acid was added and incubated for 3 hours at 4c. formic acid lysate was added to rna binding ysi and shaken vigorously in optiplate-96 (perkin elmer). the microplates were incubated at room temperature overnight and examined for radioactivity using topcount (perkin elmer). the retro - x system (clontech laboratories, mountain view, ca) was used to generate nih/3t3-hmrgprd cells, which are nih/3t3 cells stably expressing hmrgprd and nih/3t3-rasv12 cells, which are nih/3t3 cells stably expressing rasv12. the viral solution obtained from 293 - 10a1 cells (established in our laboratory), which were transformed with either plncx - hmrgprd or plncx - rasv12, was used to establish those overexpressing cells. five thousand nih/3t3-hmrgprd cells or nih/3t3-rasv12 cells were plated onto each well of a celltightspheroid (sumitomo bakelite co., ltd.) and cultured overnight in rpmi1640 medium supplemented with 10% fbs, which may contain ala less than 0.5 m, at least 40 times lower than the ec50 of ala to mrgprd. no agonists were used in this assay. in accordance with the manufacturer 's instructions for the celltiter - glo luminescent cell viability assay (promega), an assay solution was added to each well, and the cell lysate solution was then transferred to optiplate-96 to be measured with the arvo sx 1420 multilabel counter (wallac). mrgprd is a gpcr that induces intracellular calcium ion influx and inhibits adenylyl cyclase activity by g protein signaling and camp production in response to ala [6, 9, 13, 14 ]. to confirm these signaling pathways, we performed reporter systems using nfat as a downstream signal of the gq subunit and elk1 as a downstream signal of the gi subunit. together with either of those reporters, hmrgprd or adra1a, which is known to couple to both the gq and gi subunits and used as a positive control, were transfected to the cells to measure their signals. the plasmid which constitutively expresses renilla luciferase by thymidine kinase promoter was also transfected simultaneously as an internal control of the assay to normalize transfection efficacy and cell growth of each sample. the endogenous signaling activities of the gpcrs were observed as relative units which were the quotients of either nfat or elk1 signal divided by constitutive signal. as shown in figures 1(a) and 1(b), both adra1a and hmrgprd showed signals depending on the gq subunit as well as the gi subunit. no signal was seen for either pathways when no gpcr was added (figures 1(a) and 1(b)). we found very high signals of hmrgprd for both nfat and elk1 compared to those of adra1a : 19 times for nfat and 28 times for elk1, respectively (figures 1(a) and 1(b)). the difference can be explained by assuming the two - state model, where gpcrs exist in equilibrium between an inactive (r) state and an active (r) state. as we used the same molar concentration of plasmid for hmrgprd and adra1a and no ligand was added to this assay, these results indicate that the equilibrium of hmrgprd is much more shifted to the r state than that of adra1a, in other words, hmrgprd exhibits strong constitutive activity. these results indicate that expressing hmrgprd in the cells can reinforce downstream signals without any ligand. currently, ala and gamma - aminobutyric acid (gaba) are commonly regarded as physiological ligands of mrgd and both molecules are deeply related to neurotransmission. when phylogenic trees of the hmrgpr family and the mouse mrgpr family are compared, variation of the members found in those phylogenic trees this difference may cause the hmrgpr family members to have functions besides the ones revealed by the studies with mice. therefore, we hypothesized hmrgprd may have other functions besides neurotransmission. since finding physiological ligands may help us deduce possible functions, we executed gtps binding assay using gi fused hmrgprd to screen a physiologically active substance library. for gtps binding assay, as the membrane fraction of hmrgprd - gi expressing sf9 cells was used and no ala was contained in the assay buffer (20 mm hepes, ph7.3, 100 mm nacl, 10 mm mgcl2, 1 mm edta, 100 g / ml saponin) (see section 2.4), the signals we detected were completely dependent on the compounds added to be tested. compounds considered as hits were tested with a calcium flux assay. for the calcium flux assay, only transient signals were detected and compounds were added with a buffer (hbss, 25 mm hepes, ph7.4, 2.5 mm probenecid) that did not contain ala (see section 2.5) ; therefore, the signals detected were again completely dependent on the compounds added for testing. we found 3 compounds that were positive, each of which in turn underwent an ip assay. for the ip accumulation assay, dmem inositol - free media with 10% fbs dialyzed was used to label myo-[2, 3]inositol, then the labeling media was replaced with an ip assay buffer (200 mm hbss, 25 mm hepes, ph7.0, 0.1% bsa, 20 mm licl), that did not contain any ala (see section 2.6) ; therefore, accumulated ips were attributed to the compound added for testing. the 3 compounds which we considered as hits were ala (figure 2(a)), aiba (figure 2(b)), and des (figure 2(d)) whose ec50s are shown in table 1. representative dose - response curves of these compounds in each assay are shown in figure 3. in all assays, the activity value of hmrgprd with the saturated concentration of ala was set as 100% for each assay system, and activity values are shown in percentages. for the ip assay, since the cells were kept in the assay buffer containing compound for an hour, a much higher des concentration than the cells could tolerate was needed to calculate ec50 ; therefore, we could not obtain ec50 of des in the ip assay. aiba was a newly found agonist, which was as potent as ala, and had a structure similar to ala (figure 2). we also tested gamma - aminobutyric acid (gaba), which shares the same moiety with ala and ala (figure 2) and had showed some activity for hmrgprd in previous study. although with much weaker activity, gaba also worked as an mrgprd agonist (table 1, figure 3). one of the nearest neighbors of hmrgprd is mas1 oncogene, which shows focus formation when transfected into nih-3t3 cells [6, 16 ]. also, there is information that ala, aiba, and gaba are related to some kinds of tumors [1722 ]. we took notice of oncogenicity and found that hmrgprd - transformed fibroblast cells could form spheroids. we next screened a large chemical library to obtain mrgprd antagonists which would help us examine the novel character of mrgprd, the spheroid forming activity. using ala as a ligand for mrgprd, a high - throughput screening (hts) for antagonists was executed by the calcium flux method utilizing flipr, and mu-6840 (figure 4) was selected as a hit. mu-6840 did not inhibit signals of the following gpcrs : ccr4, ccr5, ccr7, ccr8, cxcr3, s1pr1, p2y12r, ogr1, oxer1, gpr84, gpr14, or ghs - r (data not shown). as shown in table 2, mu-6840 inhibited ala signals through hmrgprd dose - dependently in all methods tested here, namely, calcium flux (figure 5(a)), gtps binding (figure 5(b)), ip accumulation (figure 5(c)), and spheroid proliferation (figure 5(d)). we did not use the endogenous signaling assay mentioned above (section 2.3) because it is not suitable for detecting the effects of compounds due to the following reasons : (a) the transient transfection assay requires 24 hours to garner enough luciferase expression to be measured quantitatively ; (b) cells can not tolerate compound addition at the same time as transfection, as this would cause cell damage ; (c) if the compound is added after suitable luciferase expression has been reached, the translated luciferase prior to compound addition remains and only the luciferase being transcribed / translated during compound addition would be inhibited, which would make the basal signal high enough to mask the inhibitory effect of the compound. in figures 5(a), 5(b), and 5(c), values are shown in percentages : the value at adding only ala with no antagonist is set as 0% ; the value at adding neither ligand nor antagonist is set as 100%. for the calcium flux assay (figure 5(a)), as no endogenous activity could be measured, the maximum inhibition never exceeded 100%. on the other hand, for the gtps binding assay (figure 5(b)) and ip accumulation assay (figure 5(c)), the maximum inhibitions exceeded 100% as these assays are able to detect hmrgprd 's strong constitutive activity. these excesses indicate that mu-6840 can act as an inverse agonist. owing to hmrgprd 's endogenous activity (figures 1(a) and 1(b)), when hmrgprd is stably expressed, nih/3t3, which would not form spheroids by itself, can form spheroids with no ligand, such as ala. in this spheroid assay (see section 2.7), the culture media, rpmi1640, does not contain ala. in addition, ala which would come from fbs, taking up 10% of the media, could be negligible for the following reasons : the ala concentration of normal serum is around 4 m [23, 24 ] which makes ala concentration in this media less than 0.5 m ; ec50s of ala to hmrgprd is higher than 20 m (table 1). when ala was added to this assay system, spheroid growth of nih/3t3-hmrgprd was promoted, although no effect was seen with the spheroid growth of nih/3t3-rasv12 cells, overexpressing oncogenic gene rasv12 (data not shown). it shows that the spheroid proliferation of nih/3t3-hmrgprd is dependent on mrgprd signaling pathways. in order to determine the effect of the compounds, a spheroid proliferation assay is more suitable than a focus formation assay. for a spheroid assay, it is common to use rasv12 as a positive control [25, 26 ]. in the spheroid assay, mu-6840 inhibited nih/3t3-hmrgprd spheroid proliferation, which was dependent on basal activity of mrgprd, that is, independent of any agonist. furthermore, mu-6840 did not inhibit spheroid proliferation of nih/3t3-rasv12 cells (figure 5(d)). mrgprd belongs to the mas - related gpcr family, which has been shown to be expressed in the drg [6, 912 ]. when phylogenic trees of the hmrgpr family and the mouse mrgpr family are compared, variation of the members found in those phylogenic trees this difference may cause the hmrgpr family members to have functions besides the ones revealed by the studies with mice. being one of the members of hmrgpr, we hypothesized that mrgprd could have other functions besides the ones in drg and found a spheroid forming activity. in this study, we found 2 physiologically active substances as novel ligands for mrgprd : aiba and des (figures 2(b) and 2(d)). ala has long been widely known to act as a ligand for glycine receptors and gaba receptors in the central nervous system [2732 ]. since mrgprd is known to be expressed in the drg [6, 912 ], it is reasonable that ala acts as a ligand of mrgprd to have some roles in the nervous system. besides the nervous system, mrgprd may also have roles in renin - angiotensin system by releasing arachidonic acid in response to angiotensin (ang) ii metabolites, although no direct signals, that is, calcium flux, ip accumulation, and so forth, of mrgprd in response to ang ii metabolites are shown. on the other hand, besides being one of the nearest members of mas1 oncogene [6, 16 ], there is some information that ala, as well as aiba, is related to some types of tumors. rat or mouse mammary tumors contain high levels of taurine, ala, and gaba, which are enriched in neural tissue and which are not seen in normal rat or mouse mammary tissue. ala concentrations in nerve - related tissue are shown to be about 50 m in rat sciatic nerve and 60 m in cat brain [24, 34 ], which are higher than ec50 of ala to mrgprd in a calcium flux assay (table 1). cancer patients were more prone to have increased urinary aiba excretion than patients with different diseases. the percentage of high urinary aiba excreter was higher in urinary bladder carcinoma patients compared to patients with urinary bladder papilloma or cystitis, or healthy volunteers. the massive amounts of aiba in the urine of burkitt 's lymphoma patients were measured, and the degree of elevation of aiba excretion seemed to be related to the amount of tumor mass present [20, 21 ]. aiba excretion in patients with chronic myeloid leukemia was directly correlated to the leukocyte count, the indicator of tumor cell mass. the average aiba level in the urine of patients with burkitt 's lymphoma is about 170 times higher than that of normal subjects. since the serum concentrations of aiba in normal subjects are about 2.5 m, even if the difference of the serum aiba level is not as conspicuous as that of in urine, only 30 times difference is enough to exceed the ec50 of aiba to mrgprd in a calcium flux assay (table 1). all together, these suggest that ala and aiba may be involved in tumorigenicity by enhancing mrgprd oncogenic signals. however, it does not exclude the possibility that increasing concentrations of ala and aiba is just a sign of the existence of cells with high metabolic rates, such as cancer cells, as ala and aiba are degradation products of nucleic acids. besides ala, aiba, gaba, and des, 5 synthetic agonists for mrgprd are reported [14, 36 ]. at least two of them are specific to mrgprd, in other words they do not activate other mas - related gpcrs. considering ec50s and the concentrations in vivo, we assume that ala and aiba are the ones which can contribute to the physiological functions of mrgprd. another new aspect we would like to focus on is the high endogenous signaling activity of mrgprd. there are publications that some gpcrs, such as human 2 adrenoceptor, exhibit significant basal, agonist - independent g protein activation, which is associated with the number or ratio of the active (r) state receptors [15, 37, 38 ]. in the report of ajit., they noted that our studies indicate that mrgd rna expression inversely correlated with larger beta - alanine induced calcium transient functional responses as assessed by flipr responses in the explanation of their selection of the cloned mrgprd expressing cell for a calcium flux assay. we also had a similar experience with this episode, and we assume this phenomenon clearly implies mrgprd 's high basal activity : if there are many mrgprds in the cells, the signal has already reached the maximum without any ligand, and no transient signal with the ligand could be detected, since flipr can only detect transient signal. regarding mrgprd 's high endogenous signaling activity, just expressing a suitable amount of mrgprd may add cells of a tumorigenic phenotype. high mrgprd expression might attribute to some types of cancer, as we have detected a very high mrgprd expression in some clinical cancer tissues (data not shown). mu-6840, a specific mrgprd antagonist and possibly acting as an inverse agonist, has the potential ability to become an anticancer agent. | mas - related g - protein coupled receptor member d (mrgprd) is a g protein - coupled receptor (gpcr) which belongs to the mas - related gpcrs expressed in the dorsal root ganglia (drg). in this study, we investigated two novel ligands in addition to beta - alanine : (1) beta - aminoisobutyric acid, a physiologically active substance, with which possible relation to tumors has been seen together with beta - alanine ; (2) diethylstilbestrol, a synthetic estrogen hormone. in addition to the novel ligands, we found that transfection of mrgprd leads fibroblast cells to form spheroids, which would be related to oncogenicity. to understand the mrgprd novel character, oncogenicity, a large chemical library was screened in order to obtain mrgprd antagonists to utilize in exploring the character. the antagonist in turn inhibited the spheroid proliferation that is dependent on mrgprd signaling as well as mrgprd signals activated by beta - alanine. the antagonist, a small - molecule compound we found in this study, is a potential anticancer agent. |
chronic infection with hepatitis b virus (hbv) results in an estimated 786 000 deaths annually worldwide 1. infected individuals may remain asymptomatic for long periods but are at risk of progressive liver disease, and can transmit the virus to other susceptible individuals. the primary marker for screening and laboratory diagnosis of hbv infection is hepatitis b surface antigen (hbsag), a component of the virus envelope that is also found in the blood in great excess as noninfectious subviral particles. immunoassays with high sensitivity and specificity for hbsag detection are used in developed countries and are subject to strict regulatory requirements and quality assurance. while hbsag testing has been at the forefront of blood screening and subsequent improvements to public health, the cost and the lack of access to commercial immunoassays can limit their usefulness in resource - limited settings and among marginalized high - risk populations including injection drug users, immigrants and the homeless. the time and expense involved in blood processing and patient call - back and counselling can be considerable, and many patients are lost to follow - up. high - quality point - of - care (poc) testing may overcome some of these hurdles and reduce costs. these tests have a range of diagnostic accuracy and generally do not have the same sensitivity and specificity as commercial screening immunoassays, potentially returning false - negative or false - positive results leading to subsequent inappropriate clinical management. with ten different hbv genotypes (a j), genetic diversity presents a major challenge, and genotype - dependent reduced sensitivity has been shown with some assays 2. in addition, hbv variants carrying amino acid substitutions in the a determinant of hbsag can escape detection 24 ; such amino acid substitutions can emerge under the selective pressure of antiviral therapy (e.g. lamivudine) or immune response (e.g. postvaccination). the nanosign hbs poc strips using samples from patients infected with different hbv genotypes and defined specimens with substitutions in the a determinant. we also used the test to screen a panel of at - risk patients and compared the results with standard - of - care (soc) serologic testing. the nanosign hbs poc strip (bioland, seoul, south korea) is a chromatographic immunoassay. a mouse monoclonal antibody to hbsag (capture reagent) is immobilized on a nitrocellulose membrane. a second mouse monoclonal antibody to hbsag, conjugated to colloidal gold, is in a fibre pad in contact with the membrane (detector reagent). when the strip is placed into the serum sample, the solubilized conjugate binds to any hbsag present. the resulting complex migrates by passive diffusion along the test strip until it is captured by the antibody immobilized on the nitrocellulose membrane and forms a visible coloured band. a coloured control band, confirming that the colloidal gold conjugate is functional, must also appear for the test to be valid. the manufacturer claims the assay can detect hbsag concentrations as low as 1.4 iu / ml. forty - five hbsag - positive serum samples from patients with chronic hbv infection were obtained from a bio - repository at the victorian infectious diseases reference laboratory, melbourne, australia. hbv genotype was determined using the online hbv genome analysis program seqhepb, as previously described 5,6. g, were assessed for hbsag titre with the roche elecsys hbsag ii quantification assay (roche diagnostics, mannheim, germany). the dead volume remaining in the elecsys sample cup after quantification (100 l) was used to evaluate the nanosign hbs poc strips. eight samples with known substitutions in the hbv a determinant were tested with both assays, undiluted and at a dilution of 1/100. nanosign hbs poc strips were used to screen serum samples from 297 individuals at risk of hbv in local clinical settings (health fairs and outreach events) in parallel with soc serologic testing for hbsag through a commercial laboratory (quest diagnostics eia ; madison, nj, usa). trained technicians under the supervision of a pharmacist or physician performed and read the results of the poc tests. the 37 samples tested included hbv genotypes a (n = 4), b (n = 4), c (n = 6), d (n = 4), e (n = 8), f (n = 4) and g (n = 7). two hbv genotype c samples were the divergent subgenotype c4, found only in indigenous australians, which has a surface gene region most closely related to hbv genotype j 7. all 37 samples tested positive for hbsag using the poc strips (sensitivity 100%). hbsag - negative samples did not produce any signal (specificity 100%), even when samples were seropositive for hepatitis a virus or hepatitis c virus. testing serially diluted serum samples (fig.1a) showed that the poc strips reliably detected hbsag at a concentration of at least 50 iu / ml for all genotypes and at lower concentrations for some genotypes. we acknowledge that this detection limit is similar to or slightly higher than most hbsag enzyme immunoassays 3 ; however, poc strips appear to be sensitive enough to detect hbsag levels in serum from chronically infected patients across a range of genotypes. nanosign hbs poc test strip results for a panel of serum samples with known hbv genotypes (panel a) and for eight samples with a determinant mutations (panel b). hbsag titres measured by elecsys hbsag ii assay are indicated under each strip in iu / ml. the assay control band is on the right of each strip with the sample band on the left. common hbsag variants surface (s)d144e and sg145r, in particular, showed clear reactivity. this is notable because the immune selection pressure following extensive vaccination programmes has led to increased frequency of these variants, particularly sg145r 8. the sm133l variant appears as a false negative in several hbsag test kits, even at concentrations above the detection limit established for wild - type hbv samples 3. our results suggest that nanosign hbs poc strips can detect a broad range of hbsag variants. it would be informative to evaluate the poc strips using additional mutants known to escape detection with other tests. among the 297 patients tested, 72% were vietnamese attending community outreach events at churches and health fairs, 66% were female and the mean age was 54 years. only 4% reported being born in the united states and 42.4% reported having access to health care. poc testing was 73.7% sensitive and 97.8% specific for the detection of hbsag (table1). the positive predictive value was 70%, and the negative predictive value was 98.2%, thus poc testing failed to detect 26% of positive cases of hbv infection, but identified 98% of those requiring vaccination. the cost of soc was five times higher than poc, costing $ 126.43 vs. $ 25.30 per positive case. the high rate of false negatives could have been related to operator error, low hbsag levels, assay degeneration or lot variation. results of hbsag screening with nanosign hbs poc test strips and commercial standard - of - care (soc) testing soc serologic testing performed by quest diagnostics. the 37 samples tested included hbv genotypes a (n = 4), b (n = 4), c (n = 6), d (n = 4), e (n = 8), f (n = 4) and g (n = 7). two hbv genotype c samples were the divergent subgenotype c4, found only in indigenous australians, which has a surface gene region most closely related to hbv genotype j 7. all 37 samples tested positive for hbsag using the poc strips (sensitivity 100%). hbsag - negative samples did not produce any signal (specificity 100%), even when samples were seropositive for hepatitis a virus or hepatitis c virus. testing serially diluted serum samples (fig.1a) showed that the poc strips reliably detected hbsag at a concentration of at least 50 iu / ml for all genotypes and at lower concentrations for some genotypes. we acknowledge that this detection limit is similar to or slightly higher than most hbsag enzyme immunoassays 3 ; however, poc strips appear to be sensitive enough to detect hbsag levels in serum from chronically infected patients across a range of genotypes. nanosign hbs poc test strip results for a panel of serum samples with known hbv genotypes (panel a) and for eight samples with a determinant mutations (panel b). hbsag titres measured by elecsys hbsag ii assay are indicated under each strip in iu / ml. the assay control band is on the right of each strip with the sample band on the left. common hbsag variants surface (s)d144e and sg145r, in particular, showed clear reactivity. this is notable because the a determinant fragment 137147 constitutes the antigen domain recognized by neutralizing antibodies. immune selection pressure following extensive vaccination programmes has led to increased frequency of these variants, particularly sg145r 8. the sm133l variant appears as a false negative in several hbsag test kits, even at concentrations above the detection limit established for wild - type hbv samples 3. our results suggest that nanosign hbs poc strips can detect a broad range of hbsag variants. it would be informative to evaluate the poc strips using additional mutants known to escape detection with other tests. among the 297 patients tested, 72% were vietnamese attending community outreach events at churches and health fairs, 66% were female and the mean age was 54 years. only 4% reported being born in the united states and 42.4% reported having access to health care. poc testing was 73.7% sensitive and 97.8% specific for the detection of hbsag (table1). the positive predictive value was 70%, and the negative predictive value was 98.2%, thus poc testing failed to detect 26% of positive cases of hbv infection, but identified 98% of those requiring vaccination. the cost of soc was five times higher than poc, costing $ 126.43 vs. $ 25.30 per positive case. the high rate of false negatives could have been related to operator error, low hbsag levels, assay degeneration or lot variation. results of hbsag screening with nanosign hbs poc test strips and commercial standard - of - care (soc) testing soc serologic testing performed by quest diagnostics. in conclusion, in a laboratory setting, we demonstrated that nanosign hbs poc strips can detect hbsag at levels much lower than normally found in the blood of infected individuals and that the strips were nonreactive for samples previously shown to be hbsag negative. in addition, the poc assay detected a range of hbv genotypes and a determinant variants. in a clinical setting, although the poc assay demonstrated high specificity, false negatives were frequent. as hbv genotype and hbsag variants do not appear to alter the results based on our study, the high number of false negatives could be explained by operator or batch variation. nevertheless, the poc assay still offers advantages for testing in both developed and resource - limited countries due to its low cost (0.50 $) and immediately available results (20 min from phlebotomy to laboratory test assessment). this affordable and rapid test could provide a significant improvement in hbsag screening options for high - prevalence groups, drastically lowering screening costs and reducing the barriers to testing. b tran is the executive director of the asian pacific health foundation, a non - profit organization. | early identification of chronic hepatitis b is important for optimal disease management and prevention of transmission. cost and lack of access to commercial hepatitis b surface antigen (hbsag) immunoassays can compromise the effectiveness of hbv screening in resource - limited settings and among marginalized populations. high - quality point - of - care (poc) testing may improve hbv diagnosis in these situations. currently available poc hbsag assays are often limited in sensitivity. we evaluated the nanosign hbs poc chromatographic immunoassay for its ability to detect hbsag of different genotypes and with substitutions in the a determinant. thirty - seven serum samples from patients with hbv infection, covering hbv genotypes a g, were assessed for hbsag titre with the roche elecsys hbsag ii quantification assay and with the poc assay. the poc assay reliably detected hbsag at a concentration of at least 50 iu / ml for all genotypes, and at lower concentrations for some genotypes. eight samples with substitutions in the hbv a determinant were reliably detected after a 1/100 dilution. the poc strips were used to screen serum samples from 297 individuals at risk for hbv in local clinical settings (health fairs and outreach events) in parallel with commercial laboratory hbsag testing (quest diagnostics eia). poc testing was 73.7% sensitive and 97.8% specific for detection of hbsag. although the poc test demonstrated high sensitivity over a range of genotypes, false negatives were frequent in a clinical setting. nevertheless, the poc assay offers advantages for testing in both developed and resource - limited countries due to its low cost (0.50 $) and immediately available results. |
a 68-year - old man initially presented with a one - month history of cough, heartburn, and episodes of nocturnal regurgitation. eight months prior to presentation, he had undergone lagb for class iii obesity with a body mass index (bmi) of 41 kg / m. preoperatively, he had radiographic evidence of a small hiatal hernia but no history of gastro - esophageal reflux disease (gerd). his medical history was also notable for chronic obstructive pulmonary disease (copd), obstructive sleep apnea, type ii diabetes, hypertension, and hyperlipidemia. his vital signs were normal, and there were no significant findings on physical examination. a clinical diagnosis of gerd was made and omeprazole 20 mg twice daily was initiated. an upper gastrointestinal series was ordered which demonstrated a more dilated hiatal hernia, significant reflux, and probable stricture formation. there was normal peristalsis on manometry, but the lower esophageal sphincter was not well assessed during the procedure. barium swallows under fluoroscopy guidance showed evidence of esophageal dysmotility and hiatal hernia (fig. barium follow thorough fluoroscopy showing the lap - band (dashed arrow) as well as the hiatal hernia (solid arrow). over a period of 15 months, he had three surgical repairs for recurrent hiatal hernias and suffered from progressively worsening symptoms with nasal and oral regurgitation. he remained reluctant to have his band completely deflated as the procedure had resulted in a significant reduction in his bmi from 41 to 27. one month after being discharged from the pneumonia admission, he presented with a productive cough, worsening dyspnea, anorexia, and fatigue. on examination, he was hypoxemic with an oxygen saturation of 88% and tachypneic with a respiratory rate of 28 breaths per minute. his breath sounds were normal but there was dullness to percussion at the left lung base and bilateral, pitting lower extremity edema. blood tests showed leukocytosis with a white blood cell count of 11,200 cells / ml. chest radiograph indicated persistent left lower lobe infiltrate (fig. 2) and a chest computed tomography (ct) scan revealed bilateral pulmonary nodules that were too numerous to count along with left lower lobe consolidation (fig. 3a and b). in light of these findings, there was concern for metastatic disease. (a) and (b) ct chest showing left lower lobe pneumonia and bilateral but predominant left lower lobe pulmonary nodules. after 7 days of levofloxacin and prednisone, he underwent bronchoscopy with evacuation of copious amounts of vegetable matter and mucus plugs. lung biopsy was consistent with organizing aspiration pneumonia, and follow - up chest cts at 1 and 3 months showed continued resolution of the nodules, strongly supporting an inflammatory etiology. with persistent symptoms of reflux and aspiration, resulting in poor quality of life, and radiographic evidence of esophageal dysmotility, the decision was made to completely deflate the gastric band. over the next 4 months, lagb is gaining popularity as an effective bariatric procedure with the advantages of being relatively safe, minimally invasive and reversible. long - term esophageal complications of this procedure, some of which include esophageal dilatation, dysmotility and gerd, have being reported and in some instances are further complicated by pulmonary complications such as recurrent bronchial aspiration and pneumonia, bronchiectasis, and lung abscesses. an observational study of 749 patients by parikh. reported a 0.8% incidence of aspiration pneumonia (10). however, a recent retrospective cohort study by avriel., looked at major respiratory adverse events after lagb (11). in their study of 2,100 patients who underwent lagb, the most commonly reported major respiratory complications included aspiration pneumonia (19 patients) and pulmonary abscess (four patients). additionally, they also recognized the initiation of chronic diseases such as interstitial lung disease and bronchiectasis. a prior case series by nehoda. reported two cases of immediate pulmonary complication in the form of aspiration pneumonia and had a decreased overall complication rate. however, they did not report any delayed pulmonary complications from surgery (12). first, patients that undergo the lagb procedure are morbidly obese and already possess one or more of risk factors for developing aspirations such as obstructive sleep apnea, presence of extra - thoracic restriction, exertional dyspnea, hypoventilation syndrome, and gerd. second, adjustable gastric banding may provide a sufficient antireflux barrier in most of the obese patients with gerd. however, a subset of patients may be at higher risk of developing pulmonary complications (13, 14). for instance, patients with preoperatively defective esophageal body motility, lagb may aggravate gerd symptoms and esophageal dilatation (15). in fact a comparative study by suter. proposed that preoperative testing should be routinely performed (16). they also concluded that low amplitude of contraction in the lower esophagus and increased esophageal acid exposure should be regarded as contraindications to lagb and patients with such findings should be offered an alternative procedure, such as roux - en - y gastric bypass. interestingly, a prospective case series compared two surgical procedures, laparoscopic roux - en - y gastric bypass to lagb in supermorbid obese patients. they reported that patients who underwent lagb experienced a greater incidence of late complications requiring reoperations, had less weight loss, less reduction of medical comorbidity, and were dissatisfied (17). as described in our case presentation, our patient required multiple reoperations and eventual release of band causing significant morbidity. while there is no established tool to help risk - stratify patients, a review of literature suggests that abnormal preoperative ph monitoring, pre - existing esophageal dysmotility and an esophageal caliber > 35 mm are risk factors, while a preceding history of gerd or hiatal hernias are inconsistent predictors (13, 14). however, possible causes of failures in our patient consist of gerd, persistent hiatal hernia requiring repeated revisions, primary surgical technique error, complicated anatomy requiring revisions, and lack of consideration of converting to a laparoscopic sleeve gastrectomy or laparoscopic roux - en - y gastric bypass during those revisions. essential criteria for the radiologic evaluation of lagb are well described and consist of : position of port and tubing ; stoma size ; and volume of each upper gastric portion (18). patients who develop respiratory symptoms such as chronic cough, nocturnal cough, nocturnal wheeze, or symptoms of aspiration should have additional testing performed. these include chest x - ray, and when necessary, high - resolution chest ct. in some cases, such as ours, bronchoscopy with bronchoalveolar lavage and, rarely, lung biopsy may be necessary to rule out interstitial lung disease and malignancy. ideally, when patients develop respiratory symptoms, the band should be loosened. the diameter of the stoma can be adjusted by injecting or aspirating the band contents via the connected port to inflate or deflate the band. removal or partial deflation of the band leads to symptom resolution in most patients ; however, there can be irreversible complications. if the symptoms do not resolve quickly, further investigation with barium swallow should be undertaken. in our patient, despite loosening the band and multiple surgical repairs of the hiatal hernia, symptoms did not resolve, necessitating removal of the band. however, it must be kept in mind that patients may be reluctant to remove the band, especially if they have had positive outcomes from the surgery. in such cases, with the rising prevalence of morbid obesity in the united states, bariatric surgery is becoming increasingly common. lagb is one of the most commonly performed restrictive surgical procedures for the treatment of morbid obesity. prior to lagb, careful consideration should be given to the potential long - term complications of the procedure. appropriate preoperative testing to risk stratify high - risk patients in order to discuss surgical options should be undertaken and is key to the prevention of long - term morbidity in patients undergoing bariatric surgery. in patients with a history of bariatric procedure that present with respiratory complaints, consideration of the long - term complications of bariatric surgery the authors have not received any funding or benefits from industry or elsewhere to conduct this study. | laparoscopic adjustable gastric banding (lagb) is an increasingly common therapeutic option in the management of obesity and certain obesity - related comorbid conditions. as it gains popularity for its advantages of being minimally invasive and reversible, clinicians should be aware of growing evidence of esophageal and pulmonary complications, which may be irreversible and associated with long - term morbidity. we report a case of esophageal and pulmonary complications in a patient with successful weight loss after lap - band surgery necessitating its removal. |
large scale trials with insecticide treated bed nets (itns) have been shown to have a profound impact on reducing malaria transmission in experimental trials in sub - saharan africa and were recommended for large scale operations. however, this tool did not become practical before the first long lasting insecticide nets (llins) were marketed and recommended by world health organization. preliminary who recommendations of llin are based on short term studies on vector impact and wash resistance. however, in sub - saharan african settings, loss of insecticide is not primarily due to washing, but due to handling and evaporation. dabire indicated that, though llins showed good efficacy on mosquitoes under controlled conditions, their effectiveness in the field conditions with respect to actual duration of insecticide protection in the field did not last for five years as indicated on the bed nets. recent research has shown that wear and tear may be more important for bed net durability than wash removal of insecticide. this has led to the development of several hole indexes, and who recently modified the model it recommend. since holes can only be measured on nets still present, it is the most meaningful when attrition rate can be followed, which means that cohorts of nets must be followed. however, the effect of gradually declining insecticide in the net, increasing the number of holes, and net disappearing has not been combined with observations of malaria incidence in field studies, and the effect is thus uncertain. this study was set up to see how an llin with a preliminary who recommendation performs in the field as a vector control tool, combining field observations of mosquito density to net parameters as insecticide load, bioassay performance, and hole index, and to see how the expected decline in efficacy impact malaria incidens. netprotect bed nets were reportedly developed on the advantage of the first two long lasting bed nets using a fine mesh - like polyester net but having the strength and incorporation technology of a polyethylene nets. the bed net is made out of polyethylene mixture in which the insecticide (deltamethrin) is incorporated directly into the fabric at the rate of 1.8 g / kg or 60 mg / m. kanyaboli (figure 1) is one of the villages clustered around the dominion rice farm at the north shores of victoria lake around the yala swamp, about 70 km west of kisumu town in western kenya. the area encompasses about 18.5 km and is adjacent to an oxbow lake of kanyaboli. yala swamp is one of the most important flood plain wetlands around kanyaboli lake and one of the largest swamps in kenya. the swamp forms the mouth of two rivers yala and nzoia and is a freshwater deltaic wetland arising from backflow of water from victoria lake as well as the rivers flood water. the area covers 17500 hectares and contains three freshwater lakes, kanyaboli, sare, and namboyo. part of yala swamp covering about 2300 hectares has been reclaimed for rice production by the dominion group of companies. the total annual rainfall in this region averages 1400 mm with the first peak between march and april and second peak between november and december. most of the inhabitants of kanyaboli village live in traditional houses with mud walls and grass thatched roofs. the eaves of most houses are open allowing for unimpeded entry and exit of mosquitoes, which bite the unprotected humans sleeping in these houses. family compounds, consisting of one or more houses are separated from each other by farmland. apart from working in the rice fields under contract at the dominion farms, the inhabitants also practice subsistence agriculture, growing crops such as maize, millet, and cassava. fishing is carried out on small scale in the lake to be eaten as a source of protein and sold to supplement for monthly family income. the domion farm has cooperated with malaria programs to gradually cover the villages around with bed nets over a time frame of 3 years at the expense of the farm. in cooperation with the net producer, we offered our bed nets at cost price to two steps of this campaign, for the intervention village at start and for the control village 6 months later. cdc in kisumu had previously been interested in this area and found that the malaria vectors in the area are anopheles arabiensis and funestus with a year round transmission recorded at a local clinic (o. skovmand, pers. the dominion farm had established the clinic in a village near the farm building complex and paid the staff and other costs. it receives patients from all the villages around the farm area and the farm staff. our co - operation with the clinic thus allowed for passive detection of malaria cases. a sample size of 150 houses in 150 compounds matched in size was selected through simple random sampling by lottery at the intervention village. long lasting treated mosquito bed nets netprotect were hung in the selected houses in december 2007. two five llins were put up by the study group per household for full coverage of all sleeping places. a compound consisted often of a main house and one or more small cottages for teenagers or elder people. typically, there would be two sleeping places in the main house and one or more in each of the cottages. only the nets in the main house were followed after the first month. to cater for mosquito flight range, another 150 houses were randomly selected 2 km away in the adjacent area to act as control arm where untreated bed nets were distributed. after 6 months, the households of the control area received around 450 llins of the same type. the trial thus fit with the local plan for a gradual expansion of bed net coverage in the villages around the swamp. houses for sampling were selected by two - stage cluster sampling each month upon the consent of their owners. the second stage was random selection of one house and the nearest ten neighboring houses with probability proportional to size within each cluster in the village were then included in the sample. indoor resting adult mosquitoes were monitored with a pyrethrum spray catch (psc) between 7:00 am and 10:00 am. two collectors, one inside the house and one outside, sprayed the selected houses with 0.025% pyrethrum with 0.1% piperonyl butoxide emulsified concentrate. the collector outside sprayed around the eaves, while the one inside the house sprayed the roof and the walls. the house was then closed for 10 minutes, after which knocked - down mosquitoes were collected from the white sheets indoor and put on moist filter paper in petri dishes. each petri dish was labeled as per house identification number and packed in a cool box. the collected mosquitoes were transferred to the laboratory at kenya medical research institute (kemri) in kisumu. funestus were then sorted out based on the abdominal status and characterized as fed, unfed, gravid, or half gravid then stored in vials containing anhydrous calcium sulphate. a record sheet was completed detailing gonotrophic stages, sex, and species identification. all blood fed mosquitoes from each collection were preserved in labeled vials containing anhydrous calcium sulphate. samples of blood fed mosquitoes were cut transversely between the thorax and the abdomen for all posterior portions containing the blood meal. the abdomen of each mosquito was ground in 50 l of phosphate - buffered saline (pbs) ph 7.2 with subsequent addition of 950 l of pbs and then stored at 20c in the refrigerator. blood meals were identified by a direct enzyme - linked immunosorbent assay (elisa) at kemri in kisumu, using anti - host igg conjugates (kirkegaard and perry, gaithersburg, md) against human, bovine, chicken, and goat according to a protocol by beier.. 397 blood fed anopheles mosquitoes were tested by elisa technique for the origin of their blood meal. individual mosquito specimens from field collections were prepared for identification by removing a leg with sterile forceps and placing it into one well of a 96-well pcr tray. each well contained 100 l of grinding buffer (0.10 m nacl, 0.20 m sucrose, 0.30 m trizma base 0.01 m edta, and 100 ml sterile water ph 8.0). trays were covered securely with sterile adhesive foil and placed in water in a sonicator bath (bransonic ultrasonic cleaner, shelton, ct, usa) at 65c for 2040 minutes. to these trays 14 l of 8 m potassium acetate was added, and the mixture was placed in cool ice to precipitate the protein. the mixtures were microfuged, top speed, for 30 minutes, and the resulting supernatants were transferred to new tubes. 200 l cold 95% ethanol was added to samples and placed in a freezer for at least 20 minutes to precipitate the dna. samples were washed with 200 l 70% etoh followed by 200 l 95% etoh, and tubes inverted for complete drying (about 1 hour). 1 l dna samples and controls for an. 14 l master mix (water, taq enzyme specific mosquito primers mgcl2, and 10x buffer) was added to all wells followed by 4 drops of heavy mineral oil to overlay the reaction mixture. the reaction program had an initial step of 80c for 1 min, followed by 30 cycles of denaturation at 94c for 30 seconds, annealing at 50c for 30 seconds, and extension at 72c for 30 seconds, with a final extension at 72c for 4 min. the pcr products were separated by electrophoresis on 2% agarose tbe gels and stained with ethidium bromide. malaria cases were detected passively at the village clinic established by the nearby dominion farm. the two villages of our study were about 2 km away from the clinic. people seeking treatment were compared to the list of people participating in the study either in intervention group or control group but with status blind to the clinic personnel. no other records of malaria cases were used, and self - treatment in households was not followed. malaria was identified using clinical manifestation, and we added rapid diagnostic testing after training the staff. rapid diagnostic tests (rdt : paracheck pf tests kits) were carried out according to the manufacturer 's instructions. children under five years who were clinically identified as malaria positive were treated, irrespective of the results for paracheck test in accordance with the national guidelines. children older than five years and adults were first examined and scored clinically then tested with paracheck but only treated according to moh guidelines in 2007 amodiaquine (10 mg / day) for 3 days if a paracheck result was positive for malaria. the field counting of nets took place 4 days, one month, and 35 months after nets hanging. net hanging above a bed or told to be used were counted as nets in use. for the months from 1 to 9, bioassays were made on nets in the field by placing cones with lab reared, transported mosquitoes on the nets as they were hanging. the collections of nets after years 1, 2, and 3 actually took place after 18, 28, and 38 months, where 3438 nets were collected and brought back to the laboratory for further evaluation. all the nets brought back to the laboratory were examined for damages (see below). removed nets were replaced with new nets, same size but in a different color. for some or all of these, 5 swatches of 30 30 cm were cut according to who guidelines (from the four sides and the roof) and used for biological and/or chemical assays. because bioassay capacity in the laboratory in kisumu showed to be limited, the 18-month samples were sent to a larger bioassay laboratory in chiang mai, thailand. samples collected after two years were sent for chemical analysis only. among the 30 nets collected after 3 years, 10 bed nets were randomly sampled square pieces measuring 30 30 cm were cut from the sides and tested in bioassays in kisumu. chemical analyses were made on 2 of the 5 samples of the nets collected this year. the rest of the samples were stored at room temperature for 3 years and analyzed again in the same laboratory. in 2009, iic established in - house chemical analysis facilities in hanoi, vietnam, that were used for the 3-year samples. standard who cone bioassays were performed on random samples of netprotect monthly from month 3 to 9 after installation using a laboratory colony of susceptible strain of an. a bioassay cone was attached to one side of hanging bed nets in the houses. one hundred mosquitoes in replicates of ten were exposed to each bed net in ten randomly chosen houses using standardized procedures. after 3 minutes of exposure, mosquitoes were transferred to 200 ml labeled paper cups, provided with 10% sucrose solution, brought back to the laboratory, and maintained at 28c 2, rh 80% 10%. knocked down at 60 minutes, kd60 were observed in the field and percentage mortalities after 24 hours were recorded in the lab. the nets swatches from 18 months were sent for bioassay at the university of chiang mai that made standard who cone test with 3 min exposure on 2 of these swatches per net, randomly chosen among nets, but with known position. 50 females, 24 days old anopheles cracens (former dirus b), were used for these bioassays per sample, procedure as described above. kisumu female mosquitoes were exposed to net swatches from year 3, following the procedure described above ; the lower number due to the limited test capacity in kisumu. two criteria for mortality were applied, absolute mortality where the mosquito does not move when touched, and functional morality, where it has lost at least 3 legs or one wing, and therefore will fall to the ground in a house and be eaten by ants. the nets were delivered by the producer bestnet a / s with a chemical analysis made by the singapore laboratory also used by crown agent and unicef. in our analyses, the net swatches analyzed per net were cut to pieces, and a subsample was drawn for extraction in xylen under reflux following the who protocol for deltamethrin incorporated pe nets. hanoi university used the hplc method according to cipac 333/ln, whereas the iic laboratory used gc fid to analyze extracts of the net as recommended by the cipac / who reference laboratory in gembloux, iso 17025. this method is mostly the same as the cipac method except that for the gc fid the xylen is not evaporated followed by a dissolve of the insecticide in injection solvent ; the xylen solution is injected directly. procedures for this method are very close to these of gc-ecd recently published by the same laboratory. 4 days after the initial distribution, 1 month and 36 months later, all households in the first distribution area were revisited to see if the nets were still hanging. if not hanging, the owners were kindly asked where the nets were and if they were still in use. after years 1, 2, and 3, around 60 households were visited, and net presence and state (holes, dirtiness) were recorded. 34 to 38 of these nets were randomly picked (by tossing a coin before entering the house) from the first village and brought back to the laboratory. however, it was found that especially smaller holes were underestimated in the field and only data from the nets collected and brought back to the laboratory are presented below. for each of these houses, the following information was taken : the net user, number of rooms in the house, whether the kitchen was in the same room as the net taken (fire damage), and how often the net was reported to be washed. the nets were suspended on a tube frame borrowed from cdc in kisumu, and holes were counted and sizes estimated in 5 categories : below 1 cm, 1 - 2 cm, 35 cm, 510 cm, and above 10 cm. holes were divided into tear hole and burn holes ; the latter is recognized from the borders of the holes. this scale is different from the one recently introduced guidelines from who on long lasting insecticidal nets since our data were collected before this scale was published. in the who hole index, holes below 0.5 cm are discarded, category n1 holes are 0.52 cm, category n2 are 210 cm, n3 are 1025 cm, and n4 are holes above 25 cm. the number of holes per category is multiplied with an index factor (1, 23, 196, and 576, resp.), and the sum is divided by the numbers of nets. since we had above 10 cm as the largest group, we arbitrarily divided these holes into two groups, (1/2) 1025 cm and (1/2) above 25 cm. the who index is used for relative comparison between products tested and provides no categories for the values found. the net height was measured in the 4 corners of the net suspended on the frame and averaged per net. comparison of proportions between categorical variables was performed by chi - square test at 95% confidence level using sas statistical software version 9. repeated poisson regression using the genmod procedure in sas was used to analyze the effects of the bed nets on human feeding success on blood meal for the anopheles mosquitoes found resting indoors. for each model, the percentage reduction was calculated as one minus the relative risk as estimated by poisson regression. odds ratio was also used to determine the difference between densities of the anopheles mosquito species collected in treatment and control villages. general linear variance analysis was used to estimate parameters influencing efficacy measured in bioassays after 2 years using statistix, version 9. linear regression analysis was used to estimate the impact of reported number washes on deltamethrin loss, epimerization, and net height. the netprotect project was reviewed and approved by kemri and kenyatta university graduate school board. this was done after the explanation of objectives and collection methods through individual discussion and group meetings. a total of 807 indoor resting female adult anopheles mosquitoes were collected from 80 randomly sampled houses during the first 6 months of study. out of these, 82.5% of the mosquitoes collected were from the control houses while 17.5% from the intervention ones. arabiensis found in the control houses compared to the intervention houses (= 22.6, df = 1, and p < 0.001). the probability of finding an. arabiensis in the control area was 2.6 times higher than that in intervention area (or = 2.6, ci : 1.93.9). funestus were collected ; 13.3% of them were from the intervention houses and 86.7% from the control houses. funestus between the two areas (= 22.63, df = 1, and p < 0.0001), and there were 6.5 more chances to catch an an. arabiensis (= 2.99, df = 1, p = 0.084) collected from control than from intervention areas (table 2). funestus were significantly higher in control area compared to the intervention area (= 17.44, df = 1, and p < 0.0001). funestus in the control area was four times more than that of finding a fed an. funestus in the intervention area (or = 4 : 95% ; ci : 2.07.2). a total of 515 blood fed anopheles mosquitoes were tested by elisa technique for the origin of their blood meal. arabiensis (table 3). in the intervention area, 53% of the an. funestus were positive for bovine antibodies, 29% for human antibodies (igg), and 2% had mixed blood meals human / bovine. in the control area, 46% of an. funestus were engorged on human blood meal, 29% were positive for bovine blood meal, and 2.2% engorged on mixed blood meals of either chicken / human or bovine / human, and 23%, blood meals could not be identified with our methods. funestus is highly significant (= 30.7, df = 1, and p < 0.001). arabiensis sampled from houses with llins fed on bovine host, to a lesser extent on mixed human / bovine (5.7%), and none (0%) was positive for human blood meal. in the control villages, 42.3% of the an. arabiensis were positive for bovine blood meal and 4% for human blood meal, 7.7% had mixed blood meal of human / bovine, and 1% had mixed blood meal of bovine / chicken (table 3). bioassay results on 10 randomly sampled bed nets showed a knockdown rate and absolute mortality rate of 80% and 100% respectively, up till seven months of use. however, after 9 months of use, 2 sampled nets showed 24 hr mortality below 80%. around 50% of the mosquitoes exposed to these 2 bed nets were still alive 24 hours later but had lost three or four of their legs, respectively, thus were functionally dead. after 18 months, 38 nets were brought to the laboratory for damage estimates (hole counts), and from 22 of these, 2 among 5 swatches were analyzed in bioassays. using a threshold of 50% mortality as done by lindblade., 13 nets passed in both samples, 6 passed in one and not the other, and 3 failed in both. general linear variance analysis showed that net code was a significant parameter for knockdown for 1 hr (df = 21, f = 3.2, and p = 0.008), whereas swatch position was not significant (df = 4, p = 0.85). for 24 hr mortality, net code was significant (p = 0.006), whereas position was not significant. mean kd1hr was 86%, median was 96%, and mean mortality was 68% with median 67%. three nets (6 swatches) were very dirty when tested and gave lowest mortality recorded, 10 to 40%. the general aov analysis showed that very dirty was a highly significant parameter (p < 0,001) for bioefficacy. these swatches were washed and tested again after 3 days. for 2 of these, this reduced the efficacy to near 0, but for the third, it increased from 10% to 96% mortality. if these very dirty nets were removed from the mean values, kd1hr became 91% and mort 24 hr 76%. after 3 years, bioassays were performed on 10 nets randomly picked from the 34 nets taken to the laboratory and tested for bio - efficacy. eight of them provided 100% killing efficacy, one 85%, and one 76% ; however, kd1hr was 100% for these two nets, so the 10 nets passed. start concentration of deltamethrin was determined by the provider, bestnet a / s, before the nets were sent to kenya and determined to be 1.90 g deltamethrin / kg net. 5 net samples taken after 9 months were sent for chemical analysis after the bioassay. three of these induced mortality samples were between 95, and 100% and two below 80%. the three with high mortality contained 0.999, 1.191, and 1.529 g deltamethrin / kg, whereas the two that gave low mortality had 1.164 and 0.976 twenty - four and 34 nets were sampled for chemical analysis at the end of year, 2 and 3, respectively. these nets were among the nets taken for hole analysis, so a description of each net (general state including loss of color, holes, and dirt) and the chemical analysis are known as the comments of the owners on the nets, including informed date of last washing. average deltamethrin was 0.77 g / kg plus 0.30 g r - isomer / kg net. among the 34 nets taken after 3 years of use, 3 nets had no insecticide content. one of these had no color at all indicating the use as fishing net or outdoor use for long time. one looked as brand new (shiny blue), had no label, and was probably not a netprotect. the data show that deltamethrin content had declined to mean 0.73 g deltamethrin / kg net plus 26% isomer after 2 years use and 0.49 g deltamethrin / kg net with 49% isomer after 3 years (table 4). one net with a value of 0.11 g deltamethrin / kg net had the comment of the owner that then mosquitoes were biting him the fact despite that he used the net. to estimate the impact of net storage after sampling, net swatches from 15 nets collected in year 3 were analyzed 3 years later. a pairwise analysis (analyses of swatches from same nets paired) showed that storage at room temperature for 3 years did not provide a significant decline in insecticide content. the mean content after 3 years of use and 3 years in storage was 0.33 g deltamethrin per kg net compared to 0.44 g from the same nets determined shortly after collection. the frequency of net washing was reported from two questions : how often this net is washed and when this net was washed last time. from the responses, the number of washes over 3 years was estimated per net. among the 34 nets taken to the laboratory for closer examination, 3 came from houses where the response was do not know, therefore, chemical data from these houses are omitted in the correlation study to wash frequency. reported frequency of washes at the end of the third year was contrasted to chemical content and net height, two parameters that might be expected to change in a polyethylene net with the number of washes. number of washes varied from 36 to 0 over the 3 years, with a mean of 5.8 and median 3, meaning once per year. there was no correlation between deltamethrin content and number of washes (p = 0.22). however, when data for r - isomer content was correlated to number of washes, the correlation was highly significant (p = 0.009), though the correlation coefficient was moderate (r = 0.51). nets taken back from the field were inspected for holes when hanging on a frame. the size of holes and their position from the border were noted as summarized in table 5. around 50% of holes were below 1 cm and were caused by burst of a few yarns or by sparkles. including all hole sizes, the number of holes per net varied from 5.48 in the first year, to 4.09 in the second year, and 11.06 in the third year. the number of holes on the lower 30 cm increased from 45% in the first year to around 70% in the second and third year. mean hole index as defined according to the new who bed net hole index was 333, 114 and 381 for the 3 years, respectively, but the standard deviations are much larger than the means. the number of nets with no holes present was nearly constant around 15% (year 1 : 6/38, year 2 : 6/34, year 3 : 5/33, excluding the new looking, hole free, and probably not netprotect net). we examined if burn holes were determined by the number of rooms of the house, based on the hypothesis that, in a one - room house, the net would be together with the kitchen fire. however, this association was not significant (p = 0.30). therefore, in the year 3 it was tabulated if the kitchen fire was in the same room as the net taken back to the laboratory for holes examination. again, this analysis did not reveal the impact of this coexistence on any burn hole found. finally, using the who index for burn holes only and pairing this index per net with the presence of kitchen fire in the same room all households were revisited 4 days after the net hanging campaign and again one month later. after 4 days, the houses of 398 nets were found ; one house with two nets could not be found. twenty nets could not be inspected because the owners were absent. among the rest (378 net) the second most common reason was that the roof leaked where we had hung the net, so it was taken down. after 1 month, 73% of all nets were seen hanging, but we had no access to observe 37 nets because the owners were absent. among 35 nets missing, 21 had been given away or sold, and 5 had moved with the net user ; 4 of these were kids that had gone to a boarding school. after 35 months, the study population was 398 minus the 35 missing after one month. we had removed 38 nets for inspection after 18 months and 34 after 26 months. the remaining nets were thus 291 at the last counting in november 2009. among these, nine had moved with user, 4 with kids going to boarding schools, and 26 were not traceable, either discarded or used for other purposes. attrition rate including nets moved with users was thus (35 + 35)/(398 38 34) or 21 %, excluding nets moved with users, 16%. the average net height after 3 years of use was 140 cm (nets purchased for the study were 150 cm) with a variation from 120 cm (one net) to 150 cm, but there was no correlation to the number of washes. the total number of people living in the compounds was counted as a part of the study preparation. 1350 living in compounds were used for the study in the intervention area, and 1622 in the compounds in the control area of included in this study, total 2972. 1234 inhabitants living in compounds of the study or the control areas came to the clinic and had the diagnosis, malaria based on clinical manifestations between january and july in 2007. from the intervention area, 220 had malaria diagnosis, and 67 of these were confirmed by rapid test kit (rdt, paracheck). from the control area, 670 patients had diagnosis of malaria ; 277 of these were confirmed by rdt. malaria incidence among people seeking the clinic thus was 41.3% in the control area and 16.3% in the intervention area during this period. the overall effect of netprotect on malaria prevalence was significant between the two areas before the bed nets were also distributed in the control area (= 8.28, p = 0.004). the peak outbreak of malaria cases in the control area was recorded in april in the larger rainy season with a total 88 cases (figure 2). however, malaria cases in intervention area remained stable at a low level with a small peak in july. netprotect bed nets were then distributed to the control area at end of july 2007 and malaria incidences followed passively at the local clinic for 2 years. the peak transmission could no longer be seen the second year in any of the areas. in the third year, the clinic became involved in the distribution of nets to pregnant women, and incidence could no longer be attributed to netprotect only. when comparing malaria identification from clinical manifestations and from rapid test kits (paracheck), fewer were confirmed by the rdt in both areas, and the ratio (confirmed by rdt / confirmed by clinic) was the same for the two areas and constant over time. for the first 6 months, clinical manifestation revealed 3.1 more cases in the control area than in the intervention area, rdt 3.7 times more. these differences between intervention and control areas are significant for both methods (p < 0.05). further, overestimation of malaria incidence from clinical manifestations was not influenced by incidence level. the results showed that netprotect had a significant impact on densities of indoor resting an. the number of indoor resting anopheles mosquitoes was significantly lower in the intervention houses compared to control houses (table 1). funestus in the control area was 6.5-fold higher than that in the intervention area, and the probability of collecting an. arabiensis in the intervention area, however, was 2.6 times greater compared to that of the control area. this conforms the results reported in gambia, sierra leone, and kenyan coast studies on itns and curtains which demonstrated decreased indoor resting densities when pyrethrum spray catch (psc) was used as the collection method for anopheles mosquitoes. however, while itns exhibit rapid loss of efficacy unless retreatment is adhered to every six months, this study shows that netprotect efficacy on anopheles mosquito was high without the necessity for re - treatment during the project period. was found to be the predominant vector resting indoors in this area constituting approximately 70% of the total mosquitoes collected indoors ; an. funestus was strongly affected by the net campaign (reduction of 65.5%, p < 0.001) compared to an. similarly, studies conducted by gillies and coetzee demonstrated that this species was highly susceptible to chemical control measures and was slow in recolonizing an area from which it has been controlled. there was increased degree of zoophily in houses where netprotect was in use (table 3). arabiensis is known to be zoophilic but also bite humans and rest indoor, whereas an. funestus is considered very anthropophilic, so this effect is a warning about its flexibility at high bed net coverage. alternatively, a fraction of the an. funestus population feeds on cattle and is not much influenced by the use of bed nets. funestus is a complex species, but it was not tested if the bovine feeding was different from that feeding on humans. three minutes exposure of bioassays on netprotect showed a mortality of 100% during the first seven months of net use and the failure of a few. chemical analysis of the nets that failed to those that did not did not reveal a dose difference. further, bioassays on two samples per nets with known positions and taken from 30 nets did not reveal an effect of net position, not even from the roof. the general idea that the roof is less exposed to handling and that handling is a major reason for insecticide loss can therefore not be confirmed from this study. results after three years of ten randomly sampled bed nets indicated that they were still highly efficacious. bioassay data from the three years were not made with the same anopheles species, and data produced using an. gambiae strain kisumu gave higher mortality than those obtained with an cracens independent of net age. when running the test for insecticide resistance, who use a different thresholds for different species of anopheles ; however, when running these 3 min exposures, the known difference in sensitivity is not considered. for comparison, we sent a net to the who reference laboratory lin in montpellier in 2012 that gave 60% mortality with an cracens, and this gave 100% mortality at lin with an gambiae strain kisumu (data not shown). since the lin is the reference laboratory for these evaluations, the data generated with an gambiae strain kisumu are the most relevant. however, the large amount of bioassays with an cracens relating effect to the position on the net is still valid information. loss of efficacy on other llins has also been cited to be due to external factors such as dirt and fume accumulation on the net fabric. three of 24 nets tested after 9 months were extremely dirty and showed low mortality. they were washed and tested after 3 days, and still two failed, but one jumped to 96% from 10% mortality. impact of dirt is thus not always the same, neither the effect of washing dirty nets. chemical analysis of 30 nets after 2 and 3 years use revealed a decline in deltamethrin from the original 1.9 g deltamethrin to 0.49 g / kg net after 3 years (table 4). loss in deltamethrin was not depending on the number of washes reported but deltamethrin r - isomer content was. the reason might be that the main reason for loss of deltamethrin is evaporation, but the washing process or the drying in the sun after washing causes the epimerization. five series of nets from a test program of test recipes showed that the amount of r - isomer was constant measured after 0, 5, 10, 15, and 20 washes (o. skovmand, prs communication). the reported number of washings is not off course a very solid parameter, but the significant correlation to the degree of epimerization indicates that it has value. a single complaint of net failure from a user showed the net content to be 0.11 g deltamethrin more data are needed to know if this represents the whereabouts of a threshold for field failure. bed net use rate was measured for all 400 nets in the first intervention village after 4 days, one month (table 6), and 3 years. the major reason for not seeing a net hanging was that we could not enter the house where it was supposed to be. if the use rate among these people is estimated to be the same as that in these houses, then 95% of all nets were hanging after 4 days and 90% after a month. the second most common reason for not finding a net was that it was given away or sold, and the third (after 1 month) was that the net had moved with the owner. if these latter nets are supposed to be in use, the use rate after one month is 91%. net gone was explained as the net being sold to generate supplementary income or donated to relatives from other regions. after 35 months, further 35 nets were gone, 9 moved with the owner and 26 were missing, either discarded or used for other purposes. again anticipating that the 14 nets moved with owners were in use with the same frequency as those remaining, around 87% of the nets were still in use after 3 years, which is a high percentage. it should be mentioned that this collection was in november therefore in the smaller rainy season. the number of holes did not increase significantly between years one and two (table 5) but did increase dramatically after three years of use. we examined if burn holes could be correlated to the presence of kitchen fire in the same room, but such a correlation was not found. the use of small open fire oil can lamps is thus probably a better explanation. tear holes were mostly on the lower 30 cm are that mostly tucked under the mattress. tear holes from the lower 30 centimeters increased dramatically the third year as an indication of daily use. the hole index was calculated per net and mean ; standard deviation and median were calculated according to who guidelines (table 5). however, these values were not normal distributed and the standard deviation per year was always much bigger than the mean. bigger holes have a multiplication factor of 576, so a single hole of that size in one net has a dominant effect on the mean. neither of the median values seems to reflect an evolution since it went from 24 to 3 to 61 for the 3 years. contrary to this complex model, simply counting the number of holes showed an increase from year 1 to year 3. that number of holes increased, and the who hole index did not show that nets with big holes were discarded preferentially, which off course make sense. but it may also show that the new who hole index is too sensitive to big holes and shows random variation in values caused by these rarely found nets. however, in the third year, an antenatal program of distributing another polyethylene net started, and the mass effect could no longer be ascribed to the polyethylene net of this study. the study collected morbidity results on passive and clinic - based cases and showed a significant difference in malaria cases during the six months of trials between the original intervention area and the original control area. the incidences rate was higher in the control village (41.3%) compared to intervention area (16.3%). when bed nets were used in both areas, the incidences of malaria cases in the two areas were no longer different. in the second year, malaria incidence as measured here remained low in both areas (figure 2). of interest, the peaks of malaria incidence nearly disappear and what remains is year round background malaria not influenced by the bed nets. preintervention data were not collected from the two parts of the village where the study was carried out. however, during the first 6 months of the trial, no llins were distributed to the control area, and 450 nets were distributed after these 6 months. we thus have pre - intervention data from the control area. when llins were also distributed in the control area after 6 months, the mosquito density and malaria prevalence mirrored these of the of intervention area (figure 2). further, the villages were in the same environment around a swamp with no observed differences in breeding sites and with approximately the same distance of 2 km from the clinic. there was lower human blood feeding index in intervention area compared to the control area. malaria prevalence in the intervention area was at a low, stable level despite seasonal malaria variation observed in the control area. the disappearance of the seasonal peak was observed in both the areas the following year where the llins covered both areas. after 3 years, 84% of nets were still found hanging or being washed, and a further 3.5% had moved with the owner. gambiae kisumu strains showed nets to be effective with kd1hr at 100% mortality after 3 years, use, but a large series of bioassays with an cracens after year 1 showed that 1 net out of 19 nets failed in bioassays from both of two samples collected per net on a 50% mortality acceptance criteria. gambiae strain kisumu, however, is the fully sustainable strain used for whopes evaluation of long lasting nets. chemical analysis showed a decline from 1.9 g to 0.49 g deltamethrin / kg over 3 years of use. | we studied the effect on malaria incidence, mosquito abundance, net efficacy, net use rate, chemical analysis, and holes of a long lasting insecticide treated bed net (netprotect) in western kenya, 20072010. nets were hung in 150 households 6 months before they were hung in a second, 2 km away. indoor resting densities were monitored by pyrethrum spray catch and malaria cases by passive detection using clinical manifestations and rapid diagnostic test. the probability of finding an. arabiensis in the control area was 2.6 times higher than that in intervention area during the first 6 months. human blood feeding index of anopheles funestus declined 17%. after bed nets were hung in the second area, malaria incidence declined 25% down to the level in the first area. incidence remained at this low level for 2 years. 90% of collected nets were efficacious after 3-year use. deltamethrin dosage declined from 1.9 to 0.5 g / kg over 3 years. attrition rate after 3 years was 21%. who hole index changed from 333 to 114 to 381 over the three years. this index summarizes the numbers of holes in size categories and multiplies with the mean hole area per category. it is very sensitive to the impact of big holes in a few nets. |
this lethal variant results from the inheritance of an autosomal recessive gene and causes abnormal development of cartilage and fibrous connective tissues. these features are broad, long - bone metaphyses (dumbbell shaped) and shortened ribs with pear - shaped vertebral bodies. we report a case of fibrochondrogenesis with severe pear - shaped platyspondyly (flattened spine), suspected on antenatal ultrasound examination this case gives a comprehensive pictorial review of the antenatal ultrasound and postnatal radiographic findings, which are not available in current literature. a 20-year - old primipara, underwent a routine antenatal ultrasound checkup in the third trimester, at our institute. ultrasound images showed a molded fetal head, with bilateral temporal bulging and decreased mineralization of the fetal skull vault, with disparity in the fetal limb parameters, bronchopulmonary dysplasia (bpd), and gestational age. a rhizomelic type of dwarfism showing underdeveloped limbs was noted. metaphyseal flaring with irregularity was observed in the long tubular bones of both the upper and lower extremities [figure 1 ]. the metaphyseal ends of the small tubular bones of the hand and foot were normal. the fetal spine demonstrated severe platyspondyly with unossified posterior vertebral elements, suggestive of defective mineralization [figure 3 ]. other additional features were dorsolumbar scoliosis, short and narrow fetal thorax, and mild protuberance of the abdomen. the 3d fetal face sonogram revealed a depressed nasal bridge and a long philtrum [figure 4 ]. after considering all the findings, antenatal ultrasound image showing short femur (white arrow) and humerus (dashed arrow) with mataphyseal flaring. antenatal ultrasound of the fetal spine showing severe platyspondyly (white arrow) with reduced mineralization of most of the posterior vertebral elements). 3d ultrasound image of the fetal face showing depressed nasal bridge (white arrow) and long philtrum (black arrow). the postnatal infant examination [figure 5 ] revealed a flat mid face, with a depressed nasal bridge, flat nose with anteverted nares, long philtrum, short and narrow thorax, scoliosis, deformed extremities, with enlarged joint regions, contractures and restriction of joint movements, and bilateral club foot. clinical photograph of the infant showing flat mid face with depressed nasal bridge, flat nose with anteverted nares, long philtrum, short and narrow thorax, scoliosis, deformed extremities with enlarged joint regions, with contractures and restriction of joint movements, and bilateral club foot. an infantogram showed [figure 6 ] shortening of all the long tubular bones of the extremities predominantly affecting the proximal segments (rhizomelic type of dwarfism). metaphyseal flaring, giving rise to the dumb - bell appearance, with irregularity and peripheral spurs were noted. ribs were short with wide cupped anterior and posterior ends, long and thin clavicles, and small scapulae. metaphyses of small tubular bones of the hands and feet squared off without obvious flaring and appeared normal in length. a lateral radiograph of the spine revealed severe pear - shaped platyspondyly, with increased intervertebral disk spaces [figure 7 ]. short broad iliac bones with caudally bump - like configuration (bordered by spurs) and flattened acetabulae with medial spikes and narrow sacrosciatic notches were observed. short, dumbbell shaped, long, tubular bones with metaphyseal irregularities (white arrows) peripheral spurs (asterisks), rhizomelic dwarfism, ribs are short and thin, and show anterior and posterior cupping, long and thin clavicles, and small scapulae. metaphyses of small tubular bones of the hands and feet, squared off without obvious flaring (black arrow), with normal length. pelvis showing short broad iliac bones noted with caudally bump - like configuration (bordered by spurs) (arrowhead), and flattened acetabulae with medial spikes and narrow sacrosciatic notches (dashed arrow). bodies of the vertebrae appeared small and pear - shaped on lateral view, with more height anteriorly and tapering posteriorly., in an infant who manifested many of the characteristics of thanatophoric dysplasia. however, marked methaphyseal flaring of long bones, clefting of the vertebral bodies, and a distinctive morphological lesion of the growth plate, distinguished fibrochondrogenesis from thanatophoric dysplasia. one of the studies showed prevalence of fibrochondrogenesis in the united arab emirates (uae) was 1.05 : 10,000 births. this ratio appear to be far higher than the rates described in other world populations. high prevalence of this disorder is noted in consanguinous marriages, it affects both sexes, and a concordance of affected male twins has been reported. fibrochondrogenesis is characterized by limb and vertebral deformities including shortened dumbbell shaped metaphyses and pear - shaped vertebral bodies. this is in contrast to dyssegmental dysplasia, which is characterized by micromelia or disproportionate shortening of the entire extremity. a prenatal diagnosis of fibrochondrogenesis can be made if a fetus has short limbs and deficient ossification of the vertebral bodies [table 1 ]. the major postnatal features described radiologically are : defective ossification of the posterior parts of vertebral bodiesshort ribs with splayed endssmall ilia with spurs extending caudally from the acetabular roofshort tubular bones with bulbous ends defective ossification of the posterior parts of vertebral bodies short ribs with splayed ends small ilia with spurs extending caudally from the acetabular roof short tubular bones with bulbous ends antenatal and postnatal radiologic and clinical feature associated with fibrochondrogenesis the vertebral bodies are flat, with increased intervertebral spaces, and coronal clefts separate the diamond - shaped anterior portions of the vertebral bodies from the small dorsal ossification centers. small palpebral fissures with anti - mongoloid obliquity, low - set abnormally formed ears, small mouth, cleft palate, and hypertelorism are seen. a narrow chest, moderately severe micromelia, and markedly enlarged joints the long bones are short and broad (dumb - bell shaped) with irregular metaphyses and peripheral spurs. the vertebral bodies are flat, with increased intervertebral spaces, and the coronal clefts separate the diamond - shaped anterior portions of the vertebral bodies from the small dorsal ossification centers, and project a diagnostic pear - shaped silhouette on lateral view. ossification of the vertebral bodies can be reduced to thin, wafer - like structures. the ischia and pubic bones are short and relatively broad and the fibulae are short.[35 ] hand and foot contractures have also been observed. the medial protrusion of ilia is more pronounced (snail - like appearance) and tubular shortening is less severe, with less bulbous ends, in schneckenbecken dysplasia. skeletal abnormalities in lethal metatrophic dysplasia are similar, but more severe than in fibrochondrogenesis, however, the metacarpals and phalanges are short and dumbbell shaped. the differential diagnosis should include conditions associated with significant metaphyseal flaring, such as, metatropic dysplasia, kniest dysplasia, and spondyloepiphyseal dysplasia congenita. although few of them share radiological findings similar to those of fibrochondrogenesis, none of them show defective ossification of the posterior parts of the vertebral bodies or short ribs with splayed ends. in conclusion, the antenatal and postnatal findings of defective ossification of the posterior parts of vertebral bodies with rhizomelic shortening and flaring of long tubular bone metaphyses, with peripheral spurs, and both anterior and posterior rib cupping, made us reach the diagnosis of fibrochondrogenesis. this rare case of fibrochondrogenesis gives a comprehensive pictorial review of the antenatal ultrasound and postnatal radiographic findings, which have not been shown in the current literature. | fibrochondrogenesis is a rare, neonatally lethal osteochondrodysplasia, with autosomal recessive inheritance. it differs from other lethal dwarfisms in that it leads to broad, long - bone metaphyses (dumb - bell shaped) and pear - shaped vertebral bodies. we report a case of fibrochondrogenesis with severe pear - shaped platyspondyly, suspected antenatally, and give a comprehensive pictorial review of the antenatal ultrasound and postnatal radiographic findings. only few cases of fibrochondrogenesis are diagnosed before the termination of pregnancy. |
matrix metalloproteinases (mmps) are zinc - dependent proteases that are involved not only in the degradation and remodeling of the extracellular matrix but also in processing bioactive molecules, including cell surface receptors, neurotrophic factors, chemokines, and cytokines (kim and joh, 2012). mmps are indispensable enzymes for various physiological processes such as embryogenesis, morphogenesis, tissue reconstruction, and regulation of inflammatory processes under a variety of conditions (nissinen and kahari, 2014). mmps belong to a family of more than 25 enzymes, and each has their own activating cascade with mmp-2 and mmp-9 at the core. among mmps, gelatinases, including mmp-2 and mmp-9, are similar in structure and are able to enzymatically process various substrates of the extracellular matrix, such as gelatin, collagen i and collagen iv (sbardella., 2012). constitutively expressed in most cell types, mmp-2 has a prohomeostatic property, whereas mmp-9 is expressed at low levels in most cell types but is highly responsive to stimulation and has proinflammatory properties (van den steen., 2002 ; these enzymes are also known to be related to pathological processes such as cancer, neurodegenerative disorders, arthritis, and cardiovascular diseases (sbardella., 2012). in the central nervous system, mmps play important roles in synaptogenesis, synaptic plasticity, and long - term potentiation (ethell and ethell, 2007). in contrast, there are limited studies of the role of mmps in psychiatric disorders. the mmps are endogenously inhibited by the tissue inhibitors of mmps (timps). in humans, the c - terminal domain of timp-1 and timp-2 binds to the hemopexin of the proenzymes of mmp-9 and mmp-2, respectively (carlo, 2014). this indicates that timp-1 and timp-2 are major individual inhibitors of mmp-9 and mmp-2 (goldberg., 1992). mood disorders (mds) have been recognized as having a strong association with chronic inflammatory states (rosenblat., 2014). in depression, fatigue and somatic symptoms such as gastrointestinal symptoms, autonomic symptoms, and flu - like malaise are significantly associated with signs of an activated inflammatory pathway (maes., 2012). several studies have reported an association between depressive symptoms and state - dependent elevated levels of inflammatory markers, such as interleukin-1 beta, interleuki-6, and tumor necrosis factor - alpha (felger and lotrich, 2013 ; rosenblat., 2014). mmps process cytokines, which leads to alterations of their activity (van lint and libert, 2007). at the same time, the expression of mmps, mmp-9 in particular, is regulated by cytokines (harkness., 2000). the current study sought to find an association between md and inflammation - related markers. the main mmps, mmp-2 and mmp-9, and their inhibitors, timp-2 and timp-1, were quantified in patients with md. first, serum levels of mmp-2, mmp-9, timp-2, and timp-1 from patients with md who had depressive episodes and were eligible for electroconvulsive therapy (ect) were compared with healthy controls and patients with schizophrenia - spectrum disorders (scz), who also had psychotic episodes and were also eligible for ect. serum levels of mmp and timp were then compared before and after a course of ect in patients with md and scz. finally, an association between serum levels of mmps and timps with clinical symptoms in patients with md and scz was determined. this study was conducted at the department of psychiatry of the national hospital organization kure medical center between january 2011 and april 2013. thirty - four patients (12 men and 22 women, mean age sd=54.116.1) were recruited among inpatients planning to receive ect based on the guidelines of the american psychiatric association (2001). ect is often proscribed when a patient exhibits episodes of severe major depression, psychosis, and catatonia or has shown insufficient improvement with prescribed pharmacotherapy treatment (american psychiatric association, 2001). twenty - one patients were diagnosed as having md, either major depressive disorders (n=11) or bipolar disorders (n=10), with a current episode of major depression. thirteen patients were diagnosed with scz, either schizophrenia (n=10) or schizoaffective disorder (n=3), with symptoms currently exacerbated to psychosis, such as delusions, and catatonia. various types of schizophrenia were diagnosed, including catatonic (n=5), paranoid (n=4), and undifferentiated (n=1). patients with a past or present history of substance abuse, substance dependence, significant neurological illness, or any other significant medical illness were excluded from participation in the current study. a clinical psychiatrist recommended ect to each patient according to standards recommended by the american psychiatric association task force and based on the patient s urgency and severity of illness. forty healthy subjects (14 men and 26 women, mean age 54.213.9 years), with no history of past or current mental disorders were recruited as a control group. after procedures were fully explained, written informed consent was obtained from all subjects to participate in the study. the current study was approved by the ethics committee of national hospital organization kure medical center. ect was performed according to procedures from a previous report (shibasaki., 2015). before undergoing ect, each patient was screened for general health through a physical and neurological examination, blood and urine tests, electrocardiogram, chest x - ray film, and a cerebral computed tomography scan. thiamylal sodium (23mg / kg, i.v.) and suxamethonium chloride (0.51mg / kg, i.v.). the ect device used was the thymatron system iv brief pulse square wave apparatus (somatics inc). only one adequate seizure was required for each session, which was defined as an electroencephalographic seizure lasting more than 25 seconds with a high - amplitude, slow wave, and postictal suppression. the initial stimulus dose was determined using the half - age method (petrides and fink, 1996). if an adequate electroencephalographic seizure occurred in one session, the stimulus energy of the next session remained the same. when a missed or inadequate seizure occurred, the patient was restimulated after a 20- to 30-second pause and the stimulus increased 1.5- to 2.0-fold. if any adverse effects (eg, cognitive dysfunction, delirium) occurred, the frequency of the ect schedule was reduced to once or twice per week. ect continued until the patient was asymptomatic or the attending psychiatrist determined that the patient had obtained the maximum benefit within 3 to 15 sessions. after the purpose and the ect procedure were described in detail, written informed consent was obtained from patients or caregivers of patients prior to initiating ect. most of patients with md (20/21 patients) received antidepressant pharmacotherapy before ect : duloxetine (2060mg / d ; n=8), mirtazapine (1545mg / d ; n=8), paroxetine (2040mg / d ; n=4), sertraline (25100mg / d ; n=2), mianserin (1060mg / d ; n=5), trazodone (2575mg / d ; n=3), imipramine (50mg / d ; n=1), or nortriptyline (100mg / d ; n=2). nine subjects were on a stable dose of antidepressant during ect, 8 subjects had antidepressant dosage decreased during the course of ect, and 3 subjects had antidepressant dosage increased during the course of ect. eleven of 21 patients with md also took an antipsychotic medication (either olanzapine or quetiapine) before the course of ect to control either psychomotor agitation or psychotic symptoms. eleven of 13 patients with scz received antipsychotic pharmacotherapy before the course of ect : risperidone (1.512mg / d ; n=7), olanzapine (1020mg / d ; n=4), quetiapine (300675mg / d ; n=4), zotepine (150400mg / d ; n=3), blonanserin (1224mg / d ; n=2), aripiprazole (24mg / d ; n=1), haloperidol (30mg / d ; n=1), chlorpromazine (450mg / d ; n=1), or i.v. 3 subjects were on a stable dose of antipsychotics, 7 subjects had antipsychotics dosage decreased, and 3 subjects had antipsychotics dosage increased. clinical symptomatic scores were assessed using the 17-item (hamilton rating score for depression [hamd ]) for patients with md and the brief psychiatric rating scale (bprs) for patients with scz. hamd 17-items were assigned to the following 5 subscales : core symptom (items 1, 2, 7, 8, 10, 13) ; sleep (items 4, 5, 6) ; activity (items 7, 8) ; psychic anxiety (items 9, 10) ; and somatic anxiety (items 11, 12, 13) in accordance with a previous report (seretti. each patient s symptoms were assessed prior to the first ect session (baseline, pre - ect) and a day after the last ect session (post - ect) by the same psychiatrist. responders to ect were defined as demonstrating a 50% decrease in hrsd score in md patients or a 30% decrease in bprs score in scz patients. venous blood samples were taken in the morning (between 7:00 and 8:00 am) at pre - ect and post - ect. they were kept at room temperature for 1 hour, and serum was separated by centrifugation at 3000rpm for 15 minutes at 4c. serum levels of mmp-2, mmp-9, timp-1, and timp-2 were measured using elisa (quantikine elisa, r&d systems, minneapolis, mn) according to the manufacturer s instructions. the data are shown as the mean sd. the normal distribution of data was tested by the shapiro - wilk and the kolmogorov - smirnov tests, and statistical analysis was performed by nonparametric tests. a kruskal - wallis test was used to evaluate the significant difference in the parameters (clinical and laboratory values) among the 3 groups (md, scz, and control). significant differences in the parameters between the 2 groups of patients with md and scz were evaluated using the mann - whitney u - test. a wilcoxon signed - rank test was used to evaluate the statistical differences in the parameters between pre - ect and post - ect. the receiver operating characteristic (roc) curves for the assessment of specificity and sensitivity of mmps and timps were calculated to discriminate between the md group and the control group. the areas under the roc curve (auc) were calculated for each mmps and timps as well. statistical significance after logistic regression between the 2 aucs statistical analysis was conducted by logistic regression, analyzing diagnosis value of single and combined detection of mmps. analyses were performed using spss version 22.0 for windows (ibm japan corporation, tokyo, japan). this study was conducted at the department of psychiatry of the national hospital organization kure medical center between january 2011 and april 2013. thirty - four patients (12 men and 22 women, mean age sd=54.116.1) were recruited among inpatients planning to receive ect based on the guidelines of the american psychiatric association (2001). ect is often proscribed when a patient exhibits episodes of severe major depression, psychosis, and catatonia or has shown insufficient improvement with prescribed pharmacotherapy treatment (american psychiatric association, 2001). twenty - one patients were diagnosed as having md, either major depressive disorders (n=11) or bipolar disorders (n=10), with a current episode of major depression. thirteen patients were diagnosed with scz, either schizophrenia (n=10) or schizoaffective disorder (n=3), with symptoms currently exacerbated to psychosis, such as delusions, and catatonia. various types of schizophrenia were diagnosed, including catatonic (n=5), paranoid (n=4), and undifferentiated (n=1). patients with a past or present history of substance abuse, substance dependence, significant neurological illness, or any other significant medical illness were excluded from participation in the current study. a clinical psychiatrist recommended ect to each patient according to standards recommended by the american psychiatric association task force and based on the patient s urgency and severity of illness. forty healthy subjects (14 men and 26 women, mean age 54.213.9 years), with no history of past or current mental disorders were recruited as a control group. after procedures were fully explained, written informed consent was obtained from all subjects to participate in the study. the current study was approved by the ethics committee of national hospital organization kure medical center. ect was performed according to procedures from a previous report (shibasaki., 2015). before undergoing ect, each patient was screened for general health through a physical and neurological examination, blood and urine tests, electrocardiogram, chest x - ray film, and a cerebral computed tomography scan. thiamylal sodium (23mg / kg, i.v.) and suxamethonium chloride (0.51mg / kg, i.v.). the ect device used was the thymatron system iv brief pulse square wave apparatus (somatics inc). only one adequate seizure was required for each session, which was defined as an electroencephalographic seizure lasting more than 25 seconds with a high - amplitude, slow wave, and postictal suppression. the initial stimulus dose was determined using the half - age method (petrides and fink, 1996). if an adequate electroencephalographic seizure occurred in one session, the stimulus energy of the next session remained the same. when a missed or inadequate seizure occurred, the patient was restimulated after a 20- to 30-second pause and the stimulus increased 1.5- to 2.0-fold. if any adverse effects (eg, cognitive dysfunction, delirium) occurred, the frequency of the ect schedule was reduced to once or twice per week. ect continued until the patient was asymptomatic or the attending psychiatrist determined that the patient had obtained the maximum benefit within 3 to 15 sessions. after the purpose and the ect procedure were described in detail, written informed consent was obtained from patients or caregivers of patients prior to initiating ect. most of patients with md (20/21 patients) received antidepressant pharmacotherapy before ect : duloxetine (2060mg / d ; n=8), mirtazapine (1545mg / d ; n=8), paroxetine (2040mg / d ; n=4), sertraline (25100mg / d ; n=2), mianserin (1060mg / d ; n=5), trazodone (2575mg / d ; n=3), imipramine (50mg / d ; n=1), or nortriptyline (100mg / d ; n=2). nine subjects were on a stable dose of antidepressant during ect, 8 subjects had antidepressant dosage decreased during the course of ect, and 3 subjects had antidepressant dosage increased during the course of ect. eleven of 21 patients with md also took an antipsychotic medication (either olanzapine or quetiapine) before the course of ect to control either psychomotor agitation or psychotic symptoms. eleven of 13 patients with scz received antipsychotic pharmacotherapy before the course of ect : risperidone (1.512mg / d ; n=7), olanzapine (1020mg / d ; n=4), quetiapine (300675mg / d ; n=4), zotepine (150400mg / d ; n=3), blonanserin (1224mg / d ; n=2), aripiprazole (24mg / d ; n=1), haloperidol (30mg / d ; n=1), chlorpromazine (450mg / d ; n=1), or i.v. 3 subjects were on a stable dose of antipsychotics, 7 subjects had antipsychotics dosage decreased, and 3 subjects had antipsychotics dosage increased. clinical symptomatic scores were assessed using the 17-item (hamilton rating score for depression [hamd ]) for patients with md and the brief psychiatric rating scale (bprs) for patients with scz. hamd 17-items were assigned to the following 5 subscales : core symptom (items 1, 2, 7, 8, 10, 13) ; sleep (items 4, 5, 6) ; activity (items 7, 8) ; psychic anxiety (items 9, 10) ; and somatic anxiety (items 11, 12, 13) in accordance with a previous report (seretti., 1999). each patient s symptoms were assessed prior to the first ect session (baseline, pre - ect) and a day after the last ect session (post - ect) by the same psychiatrist. responders to ect were defined as demonstrating a 50% decrease in hrsd score in md patients or a 30% decrease in bprs score in scz patients. venous blood samples were taken in the morning (between 7:00 and 8:00 am) at pre - ect and post - ect. they were kept at room temperature for 1 hour, and serum was separated by centrifugation at 3000rpm for 15 minutes at 4c. serum levels of mmp-2, mmp-9, timp-1, and timp-2 were measured using elisa (quantikine elisa, r&d systems, minneapolis, mn) according to the manufacturer s instructions. the data are shown as the mean sd. the normal distribution of data was tested by the shapiro - wilk and the kolmogorov - smirnov tests, and statistical analysis was performed by nonparametric tests. a kruskal - wallis test was used to evaluate the significant difference in the parameters (clinical and laboratory values) among the 3 groups (md, scz, and control). significant differences in the parameters between the 2 groups of patients with md and scz were evaluated using the mann - whitney u - test. a wilcoxon signed - rank test was used to evaluate the statistical differences in the parameters between pre - ect and post - ect. the receiver operating characteristic (roc) curves for the assessment of specificity and sensitivity of mmps and timps were calculated to discriminate between the md group and the control group. the areas under the roc curve (auc) were calculated for each mmps and timps as well. statistical significance after logistic regression between the 2 aucs was determined. statistical analysis was conducted by logistic regression, analyzing diagnosis value of single and combined detection of mmps. analyses were performed using spss version 22.0 for windows (ibm japan corporation, tokyo, japan). the clinical data of the 3 groups (md, scz, and control) are presented in table 1. patients with md were significantly older and their duration of illness was shorter compared with the scz group. duration of current episode, number of ects, and duration of the ect course did not differ between the md and scz groups. there were no differences between the dose equivalence of imipramine of pre - ect and post - ect in the md group and also no differences between the dose equivalence of chlorpromazine of pre - ect and post - ect in the scz group. subject clinical data abbreviations : bprs, brief psychiatric rating scale ; cpz, chlorpromazine ; ect, electroconvulsive therapy ; hamd, hamilton rating score for depression ; imi, imipramine ; md, mood disorder ; scz : schizophrenia - spectrum disorder. comparison between scores at pre - ect and those at post - ect by wilcoxon signed - rank test. serum levels of mmp-2 in the md group with depressive episodes at pre - ect were significantly lower than those of the control group (figure 1a ; p=.023), whereas there were no significant differences for the serum levels of timp-2, mmp-9, and timp-1 between the md group and the control group (figure 1b - d). serum levels of mmp-2, mmp-9, timp-1, and timp-2 in the md group at pre - ect were not significant different compared with those of the scz group with psychotic episodes at pre - ect. additionally, serum levels of mmps and timps were not significantly different between md patients with either md (unipolar) or bipolar disorder (bipolar) at pre - ect (mmp-2, unipolar=165.925.0ng / ml vs bipolar=159.426.8ng / ml, p=.512 ; timp-2, 63.17.6ng / ml vs 66.66.2ng / ml, p=.259 ; mmp-9, 553.9218.8ng / ml vs 604.6310.5ng / ml, p=.668 ; timp-1, 150.539.4ng / ml vs 148.023.2ng / ml, p=.571). scatter plot of serum levels of matrix metalloproteinases (mmps) and tissue inhibitors of mmps (timps). mmp-2 (a), timp-2 (b), mmp-9 (c), and timp-1 (d) in controls (), mood disorders (md) group before a course of ect (pre - ect,) and after a course of ect (post - ect,), and schizophrenia - spectrum disorders (scz) group pre - ect () and post - ect (). the horizontal bars represent the mean values. in the roc curve analysis of diagnosis, the auc of mmp-2, mmp-9, timp-1, and timp-2 at pre - ect between the md and control groups were 0.738, 0.603, 0.674, and 0.675, respectively. the scores for depressive symptoms evaluated by hamd in the md group and the scores of psychotic symptoms evaluated by bprs in the scz group significantly decreased following ect (table 1). both nonresponding scz patients were diagnosed with paranoid - type scz. there was a statistically significant increase in serum levels of mmp-2 in the md group over the course of ect (p=.046) but no significant change observed in the scz group (p=.650) (figure 1a). there were statistically significant decreases in serum levels of mmp-9 in both the md and scz groups following ect (md group, p=.003 ; scz group, p=.019) (figure 1c). among the 2 nonresponders to ect in the scz group, one patient had an increase in serum level of mmp-9 and the other had a decrease in serum level of mmp-9 after the course of ect (data not shown). serum levels of timp-2 and timp-1 did not significantly change over the course of ect in both the md and scz groups (figure 1b, d). no significant correlations were observed in the md group between subject characteristics (gender, age, age of onset, duration of illness, duration of current episode, or dose of medication) and serum levels of mmp-2, mmp-9, timp-1, and timp-2 at either pre - ect or post - ect (data not shown). correlation coefficients were calculated between serum levels of mmps and timps and clinical symptomatic scores evaluated by hamd for md and by bprs for scz, combining results from pre - ect and post - ect (table 2). in the scz group, there was no significant correlation between serum levels of mmps, timps, and total bprs scores (table 2). in the md group, serum levels of timp-1 and timp-2 did not correlate with total hamd score (table 2). furthermore, no significant correlations were observed between timps and subscale hamd scores (table 3). correlation between mmp and timp serum levels and clinical symptomatic scores of md and scz groups abbreviations : bprs : brief psychiatric rating scale ; hamd, hamilton rating score for depression ; md, mood disorder ; mmp, matrix metalloproteinase ; scz, schizophrenia - spectrum disorder ; timp, tissue inhibitor of mmp. correlation between mmp and timp serum levels and subscale hamd scores in md groups abbreviations : hamd, hamilton rating score for depression ; md, mood disorder ; mmp, matrix metalloproteinase ; timp, tissue inhibitor of mmp. however, in the md group, there was a significant negative correlation between serum levels of mmp-2 and total hamd score (p=.041) (table 2 ; figure 2a) and a significant positive correlation between serum levels of mmp-9 and total hamd score (p=.006) (table 2 ; figure 2b). furthermore, negative correlations between serum levels of mmp-2 and subscale hamd scores (core symptom, activity, somatic anxiety) were observed as well as positive correlations between serum levels of mmp-9 and the same subscale hamd scores (core symptom, activity, psychic anxiety, somatic anxiety) as observed with mmp-2 (table 3). a significant negative correlation between serum levels of mmp-2 and mmp-9 was observed in the md group (p=.001, rho=-0.479), but not in the scz group (p=.368, rho=-0.184) or in the control group (p=.592, rho=0.087) (figure 2c). correlation between serum levels of matrix metalloproteinases (mmps) and total hamilton rating scale for depression (hamd) score in patients with mood disorders (md) before and after a course of ect. (a) significant negative correlation between serum levels of mmp-2 and total hamd score. (b) pre - ect values () and post - ect values () ; n=21, p <.05 the clinical data of the 3 groups (md, scz, and control) are presented in table 1. patients with md were significantly older and their duration of illness was shorter compared with the scz group. duration of current episode, number of ects, and duration of the ect course did not differ between the md and scz groups. there were no differences between the dose equivalence of imipramine of pre - ect and post - ect in the md group and also no differences between the dose equivalence of chlorpromazine of pre - ect and post - ect in the scz group. subject clinical data abbreviations : bprs, brief psychiatric rating scale ; cpz, chlorpromazine ; ect, electroconvulsive therapy ; hamd, hamilton rating score for depression ; imi, imipramine ; md, mood disorder ; scz : schizophrenia - spectrum disorder. comparison between scores at pre - ect and those at post - ect by wilcoxon signed - rank test. serum levels of mmp-2 in the md group with depressive episodes at pre - ect were significantly lower than those of the control group (figure 1a ; p=.023), whereas there were no significant differences for the serum levels of timp-2, mmp-9, and timp-1 between the md group and the control group (figure 1b - d). serum levels of mmp-2, mmp-9, timp-1, and timp-2 in the md group at pre - ect were not significant different compared with those of the scz group with psychotic episodes at pre - ect. additionally, serum levels of mmps and timps were not significantly different between md patients with either md (unipolar) or bipolar disorder (bipolar) at pre - ect (mmp-2, unipolar=165.925.0ng / ml vs bipolar=159.426.8ng / ml, p=.512 ; timp-2, 63.17.6ng / ml vs 66.66.2ng / ml, p=.259 ; mmp-9, 553.9218.8ng / ml vs 604.6310.5ng / ml, p=.668 ; timp-1, 150.539.4ng / ml vs 148.023.2ng / ml, p=.571). scatter plot of serum levels of matrix metalloproteinases (mmps) and tissue inhibitors of mmps (timps). mmp-2 (a), timp-2 (b), mmp-9 (c), and timp-1 (d) in controls (), mood disorders (md) group before a course of ect (pre - ect,) and after a course of ect (post - ect,), and schizophrenia - spectrum disorders (scz) group pre - ect () and post - ect (). the horizontal bars represent the mean values. in the roc curve analysis of diagnosis, the auc of mmp-2, mmp-9, timp-1, and timp-2 at pre - ect between the md and control groups were 0.738, 0.603, 0.674, and 0.675, respectively. the scores for depressive symptoms evaluated by hamd in the md group and the scores of psychotic symptoms evaluated by bprs in the scz group significantly decreased following ect (table 1). there was a statistically significant increase in serum levels of mmp-2 in the md group over the course of ect (p=.046) but no significant change observed in the scz group (p=.650) (figure 1a). there were statistically significant decreases in serum levels of mmp-9 in both the md and scz groups following ect (md group, p=.003 ; scz group, p=.019) (figure 1c). among the 2 nonresponders to ect in the scz group, one patient had an increase in serum level of mmp-9 and the other had a decrease in serum level of mmp-9 after the course of ect (data not shown). serum levels of timp-2 and timp-1 did not significantly change over the course of ect in both the md and scz groups (figure 1b, d). no significant correlations were observed in the md group between subject characteristics (gender, age, age of onset, duration of illness, duration of current episode, or dose of medication) and serum levels of mmp-2, mmp-9, timp-1, and timp-2 at either pre - ect or post - ect (data not shown). correlation coefficients were calculated between serum levels of mmps and timps and clinical symptomatic scores evaluated by hamd for md and by bprs for scz, combining results from pre - ect and post - ect (table 2). in the scz group, there was no significant correlation between serum levels of mmps, timps, and total bprs scores (table 2). in the md group, serum levels of timp-1 and timp-2 furthermore, no significant correlations were observed between timps and subscale hamd scores (table 3). correlation between mmp and timp serum levels and clinical symptomatic scores of md and scz groups abbreviations : bprs : brief psychiatric rating scale ; hamd, hamilton rating score for depression ; md, mood disorder ; mmp, matrix metalloproteinase ; scz, schizophrenia - spectrum disorder ; timp, tissue inhibitor of mmp. correlation between mmp and timp serum levels and subscale hamd scores in md groups abbreviations : hamd, hamilton rating score for depression ; md, mood disorder ; mmp, matrix metalloproteinase ; timp, tissue inhibitor of mmp. however, in the md group, there was a significant negative correlation between serum levels of mmp-2 and total hamd score (p=.041) (table 2 ; figure 2a) and a significant positive correlation between serum levels of mmp-9 and total hamd score (p=.006) (table 2 ; figure 2b). furthermore, negative correlations between serum levels of mmp-2 and subscale hamd scores (core symptom, activity, somatic anxiety) were observed as well as positive correlations between serum levels of mmp-9 and the same subscale hamd scores (core symptom, activity, psychic anxiety, somatic anxiety) as observed with mmp-2 (table 3). a significant negative correlation between serum levels of mmp-2 and mmp-9 was observed in the md group (p=.001, rho=-0.479), but not in the scz group (p=.368, rho=-0.184) or in the control group (p=.592, rho=0.087) (figure 2c). correlation between serum levels of matrix metalloproteinases (mmps) and total hamilton rating scale for depression (hamd) score in patients with mood disorders (md) before and after a course of ect. (a) significant negative correlation between serum levels of mmp-2 and total hamd score. (b) pre - ect values () and post - ect values () ; n=21, p <.05 the current study demonstrated that serum levels of mmp-2 were specifically reduced in md patients with depressive symptoms applicable to ect and that serum levels of both mmp-2 and mmp-9 were significantly altered in opposing directions in a depressive state - dependent manner following ect. in addition, alterations of mmp-2 and mmp-9 appear to be associated with certain depressive symptoms such as not only core symptom, but also somatic anxiety and activity. the current study is the first to demonstrate a significant negative association between serum levels of mmp-2 and clinical scores of depressive symptoms during the course of ect in md patients. a previous proteomic study demonstrated that the plasma levels of mmp-2 in depressive patients were significantly lower than those of control subjects, and plasma levels of mmp-2 in schizophrenic patients were the same as those of control subjects (domenici., 2010). the study, however, measured mmps at only one time point, utilized a proteomics method, and did not evaluate patient symptoms. despite these limitations, the previous findings parallel the current findings. it is currently unknown why circulating levels of mmp-2 declined and are associated with levels of mmp-9 in the md patients in a depressive state. mmp-2 is constitutively expressed in almost all human tissues, but mainly by endothelial and epithelial cells and fibroblasts (sbardella., astrocytes are a major source of mmp-2 and presumably drive physiological remodeling of the blood brain barrier (bbb) (del zoppo. mmp-2 is detectable in significant serum concentrations under physiological conditions and is linked to homeostatic functioning (sbardella., 2012). the current study showed a reduction of mmp-2 in md patients before ect and an increase in mmp-2 after a course of ect. a number of studies have demonstrated significant reductions of glia, mainly astrocytes, in the postmortem brain of md patients (ongur., 1998 ; cotter., 2001 ; gittins and harrison, 2011). another postmortem brain study demonstrated that coverage of blood vessels by astrocyte endfeet in the prefrontal cortex was significantly reduced in patients with md (rybakowski., 2013). the decline in glia within brain vasculature areas associated with mood function suggests the possibility of reductions in microenvironmental cellular components of the bbb, which is composed of astrocytes and vascular endothelial cells, in md patients. a clinical finding pointed out that serum levels of mmp-2 were decreased in patients suffering from subarachnoid hemorrhage, in which the bbb is in fact compromised (horstmann., 2006). decreased mmp-2 in the circulation in md patients, then, suggests a small compromise of the bbb compared with a gross compromise observed with subarachnoid hemorrhage. the increase of serum levels of mmp-2 in md patients after the ect course could be associated with the remodeling of gliovascular units, which is supported by previous ect findings showing gliogenesis and angiogenesis (hellsten., 2005 ; wennstrom., 2006 ; bouckaert., 2014 further, this mmp-2-related phenomenon could lead to increased incidences of inflammatory states such as production of mmp-9 through a disruption in the bbb in the brain of md patients, because expression of mmp-9 is regulated not only by immune cells in response to inflammatory events (van den steen., 2002 ; sbardella., 2012) but also directly by mmp-2 activity (dzwonek., 2004 ; romi., thus, future studies will be needed to clearly establish evidence of a mmp-2-related dysregulated bbb and concurrent alteration of mmp-9 in md patients by examining samples from patients such as postmortem brain and cerebrospinal fluid. in the current study, the serum levels of mmp-9 in md patients was not significantly different from that of the control group before ect, but mmp-9 significantly decreased following ect. similar to the current findings, a previous study found that hamd scores and serum levels of mmp-9 were positively correlated and there was no difference between depressed patients and controls in serum levels of mmp-9 (yoshida., 2012). others, however, have found that plasma levels of mmp-9 in depressed patients were significantly higher than those of the controls in a proteomic study (domenici., 2010), and serum levels of mmp-9 in depressed young patients with bipolar disorder were significantly higher than those of the controls, which remained elevated even following drug treatment (rybakowski., 2013). possible reasons for the discrepancy between the current findings and the findings of increased mmp-9 in depressed patients include differences in subject age, severity of symptoms, choice of symptom rating scale, and treatment protocol. it is also possible that circulating mmp-9 is considerably sensitive to psychosocial stress even in healthy individuals (garvin., 2009). an inflammatory state has been proposed as the substrate of md, since circulating proinflammatory cytokines increase with the severity of mood disturbance symptoms (felger and lotrich, 2013 ; rosenblat., it is possible that in a depressive episode, the homeostatic state maintained by the immune system could be altered by changes in expression of proinflammatory cytokines and mmps, and these alterations could be normalized through ect treatment. the decreased mmp-9 levels in both md and scz groups following ect could reflect a common involvement of mmp-9 in psychiatric disorders. fragile x syndrome, psychiatric disorders associated with anxiety, compulsive - repetitive behaviors, and social communication deficits have been associated with changes in mmp-9 levels. knockout of the mmp-9 gene improved symptoms in a mouse model of fragile x syndrome and reduced dendritic spine abnormalities (sidhu., 2014). a clinical trial of the antibiotic minocycline decreased mmp-9 levels and appeared to attenuate the symptoms of fragile x syndrome (dziembowska., 2013). these findings, combined with the current findings, suggest that decreasing mmp-9 alleviates some types of psychiatric disorders. as biomarkers for md, roc analysis in the current study demonstrated that the auc for both mmps and timps prior to ect was found to be 0.745 at its peak, which does not suggest that either ligand would have high diagnostic value as a biomarker. because serum levels of mmp-2 was negatively correlated to certain depressive symptoms, to which mmp-9 was positively correlated, both mmp-2 and mmp-9 could serve as biomarkers for specific depressive states or symptoms with greater accuracy if possibly combined with other inflammatory ligands such as cytokines. to place the current findings into perspective, there are a few limitations that should be mentioned. while the total sample size of the current study was small, significant correlations were nonetheless observed. second, it is unclear if blood concentrations of mmp and timp reflect those in the brain. there are some reports that found no correlation between blood and csf concentrations of mmps (horstmann., 2010 ; niebroj - dobosz., therefore, it is possible that the dynamics of mmps, as well as timp, in the brain are different from those in peripheral tissues. to overcome this issue, direct assessment of mmps in csf from md patients could be highly useful. finally, the effect of medications on serum mmps levels is not well understood. although there were no statistically significantly differences before and after ect on the equivalence of both imipramine and chlorpromazine, patients were allowed to use medication during the course of ect. a future investigation could include drug - nave patients to evaluate the effects of medications on mmp, at least before treatments. serum levels of mmp-2 were significantly decreased in md patients with depressive episodes, and a course of ect in these patients significantly increased mmp-2 but decreased mmp-9. also in md patients, there were significant correlations between depressive symptoms and serum levels of mmp-2 and mmp-9, in opposite directions, in response to ect. the findings suggest that alteration of homeostasis linked to inflammation lead to changes in levels of mmp-2 and mmp-9, which occurs in a disease - specific manner and depend on the severity of depressive symptoms, which are in turn sensitive to ect treatment. shigeto yamawaki md, phd has received donation for research from astellas, pfizer and msd honoraria for lectures from glaxo smith kline, astellas, daiichi sankyo, japan eli lilly, takeda, otsuka, eisai, dai nippon sumitomo, shionogi, meiji seika, mochida, and pfizer. | background : inflammatory processes could underlie mood disorders. matrix metalloproteinases (mmps) and tissue inhibitors of mmps (timp) are inflammation - related molecules. the current study sought an association between mood disorders and systemic levels of mmps and timps.methods:serum was obtained from patients with mood disorders (n=21) and patients with schizophrenia (n=13) scheduled to undergo electroconvulsive therapy. serum was also obtained from healthy controls (n=40). clinical symptoms were assessed by the hamilton rating score for depression and the brief psychiatric rating scale. serum levels of mmps and timps were quantified by elisa.results:the serum levels of mmp-2 in mood disorder patients, but not in schizophrenia patients, prior to the first electroconvulsive therapy session (baseline) was significantly lower than that of healthy controls. at baseline, levels of mmp-9 and timp-2, -1 were not different between patients with mood disorder and schizophrenia and healthy controls. after a course of electroconvulsive therapy, mmp-2 levels were significantly increased in mood disorder patients, but mmp-9 levels were significantly decreased in both mood disorder and schizophrenia patients. in mood disorder patients, there was a significant negative correlation between depressive symptoms and serum levels of mmp-2 and a positive correlation between depressive symptoms and mmp-9. in addition, alterations of serum levels of mmp-2 and mmp-9 were significantly correlated each other and were associated with certain depressive symptoms.conclusion:a change in inflammatory homeostasis, as indicated by mmp-2 and mmp-9, could be related to mood disorders, and these markers appear to be sensitive to electroconvulsive therapy. |
acute subdural hemorrhage requires emergent neurosurgery or close observation because of its high mortality rate. a number of cases who showed rapid resolution of acute subdural hemorrhage with neurological improvements have been reported2,6,7). herein, we present a case who showed rapid resolution of acute subdural hemorrhage spontaneously within 2 days after severe head injury. initially, she was stuporous and measured as glasgow coma scale (gcs) score of 6. brain computed tomography (ct) revealed an acute subdural hematoma with a thickness of 10 mm in the right frontotemporoparietal region. however, an unexpected neurological improvement was noted within 1 hour following the accident. the patient was obeyed and gcs score was 10 even though intubated. a follow - up brain ct showed a decrease in the thickness of hematoma and improvement of the midline shift (fig. following the accident, brain ct showed a remarkable reduction of acute subdural hematoma and mass effect. the hemorrhages of subdural space around falx, tentorium, posterior fossa, and upper cervical spinal canal were not found (fig. usually, it requires emergent neurosurgery for decompression or close observation because of the possibility of irreversible brain damages or abrupt neurological deteriorations. rapid resolution of acute subdural hemorrhage resulting in neurological improvement is uncommon and several reports about that have been documented2,6,7). wen.7) summarized some characteristics in most patients who showed rapid resolution of acute subdural hemorrhages as followings : transitory coma which last no longer than 12 hours, exclusion of cerebral contusion, widely distributed hematoma with thin width, a band of low density between the hematoma and inner table of the skull on images, a minor or moderate head trauma sustained on insults. in our present case, similar clinical findings were found except for minimal contusion of left temporal lobe. flow of cerebrospinal fluid (csf) through the arachnoid membrane tear site and retrograde flow into the subarachnoid space may result in dilution of the hematoma5). a low density band in the subdural hematoma which is seen on the images seems to mean csf that comes from the subarachnoid space through arachnoid membrane tear. redistribution of the hematoma towards another subdural space or extracranial spaces through the skull fracture site can be another acceptable explanation1,4). our present case did not show definite skull fractures or hemorrhages in another subdural space except for minimal cerebral contusion was found. so, it is thought that the dilution of acute subdural hematoma caused by csf flow is more consistent with our case rather than redistribution of hematoma. brain swelling caused by cerebral contusion may contribute the redistribution of hematomas resulting in rapid resolution of subdural hematomas3). however, it is more likely to obstruct csf circulation and would mitigate the dilution and redistribution1). as seen in our case, minimal cerebral contusion dose not seem to influence the obstruction of csf circulation. it is very difficult to predict the rapid resolution of acute subdural hematoma which may undergo prompt neurosurgical treatment. therefore, meticulous observation and concomitant imaging should be required even though some characteristics which may develop rapid resolution of acute subdural hematoma were seen. | acute subdural hematoma is usually a neurological emergency that requires hematoma evacuation or close observation. however, spontaneous resolutions of an acute subdural hematoma without surgical interventions have been reported rarely. we report on a case who showed rapid resolution of an acute subdural hematoma with neurological improvement and review the relevant literatures. |
the study was conducted in 3 communities in ghana : kwamang (population 8,000), forikrom (population 3,800), and buoyem (population 3,900). kwamang is part of the ashanti province ; buoyem and forikrom are in brong ahafo province (figure 1). ethics approval was obtained from the committee for human research, publications and ethics of komfo anokye teaching hospital and school of medical sciences, kwame nkrumah university of science and technology, kumasi. human red circles indicate sources of bush meat. the main techiman market is situated in the techiman municipality (blue circle) ; this market is 15 km from buoyem and is the largest and most economically active market in the brong ahafo region. accra and kumasi, the largest cities in ghana, also receive supplies of bat meat from the techiman market. in each of the 3 communities, buoyem leaders described an activity called the yam festival, a hunting festival during which men took ladders to caves on wednesday evenings and caught bats as they returned from feeding. these bats were described as fruit bats and thus were possibly rousettus aegyptiacus bats, the species most commonly identified in buoyem caves. the night s catch was collected by the women ; menstruating women were excluded from participation in yam activities for reasons explained as cleanliness. in recent years, yam activities had been discontinued because of chieftaincy disputes and conflict over ownership of cave lands. traditional authorities in kwamang and forikrom did not report similar cultural activities in connection with bats. regular human activities were directly observed at all cave sites, including the mprisi (figure 2, panel a) and dwamerewa caves in bouyem, boten cave in forikrom, and mmframabuom and ohene abutia caves in kwamang (figure 2, panel b). the ohene abutia cave served as one of the major water sources in the kwamang community. typical situations in which direct and indirect bat human contact occurred in ghana, 20112012. the liquid poured before entering the cave is liquor. note the number of deposited empty bottles, indicating the frequency of cave entries. c, d) typical examples of roasted bats widely offered and consumed in markets and public places in ghana. structured household survey questionnaires were received back from 1,274 respondents : 32.3% from buoyem, 28.4% from forikrom, and 39.2% from kwamang. contact with bats was reported by 841 (66%) respondents ; bat bites, scratches, or urine exposure was reported by 476 (37.4%) respondents. almost half (594 [46.6% ]) of respondents visited bat caves frequently ; 217 (17%) reported coming into contact with bats only in their normal living or work environment (table). the proportion of respondents who deliberately visited caves was significantly higher than the proportion exposed only in their living and work environments (p 25 years of age (odds ratio 4.14 ; 95% ci 2.915.89) than for those < 25 years of age (technical appendix table 3). a second multivariate analysis, conducted to determine factors that predict visitation of bat caves, indicated that older age and male sex were significantly associated with visitation of bat caves (technical appendix). the association between cave visitation and bat consumption was significant (= 75.6 ; p<0.001) ; odds of eating bat meat were twice as high among respondents who visited bat caves (odds ratio 2.74) than among those who did not. the deliberate entry into bat caves represents a prevalent behavior that could be influenced by community - level education in the aftermath of the ongoing outbreak of ebola virus disease in west africa. further research will be necessary for understanding belief systems and developing acceptable guidance for rural communities exposed to bats because of traditional and spiritual reasons. processing of bat meat in ghana ; factors associated with consumption of bat meat ; and predictors of bat meat consumption and bat cave visitation. | because some bats host viruses with zoonotic potential, we investigated human bat interactions in rural ghana during 20112012. nearly half (46.6%) of respondents regularly visited bat caves ; 37.4% had been bitten, scratched, or exposed to bat urine ; and 45.6% ate bat meat. human bat interactions in rural ghana are frequent and diverse. |
in recent times in some occupations work in static sedentary postures for long hours in order to perform the tasks required of them. this can cause continuous muscle contraction in the neck and shoulders, which subsequently leads most people to adopt a forward head posture (fhp) in which their chins stick out1. when fhp is maintained for prolonged periods the neck flexors and the erector spinae (es) muscles in the upper thoracic region are weakened due to their lengthening, and the scapula is elevated due to tension in the levator scapula, sternocleidomastoid (scm), splenius muscles, and the suboccipitalis, which also causes tension in the upper trapezius (ut)2. therefore, because of an imbalance in the muscles, such as the shortening or lengthening, or straining or loosening of the muscles around the neck, a rounded shoulder posture is exhibited, in which the upper thoracic region is slightly bent while in a sitting posture3, and chronic neck pain results due to mechanical stress1. these changes in muscle activity result from changes in motor strategies to minimize the activities of muscles that are sensing pain and to compensate for these suppressed muscles4. in addition, fhp is known to have a large influence on respiratory function by weakening the respiratory muscles5, 6. the scm, scalene muscles, ut, pectoralis major (pm), and thoracolumbar es muscles are important accessory respiratory muscles involved in inspiration7, 8 and prolonged fhp weakens these muscles, thereby decreasing their respiratory function7. because of this, patients with fhp accompanied by chronic neck pain have been shown to have less respiratory muscle strength than normal individuals9 and their accessory respiratory muscles are shortened, which largely affects their respiratory function10. in addition, a study reported that fhp changes the alignment of the thoracic spine and rib cage due to a slightly bent posture, thereby causing respiratory dysfunction5. however, most previous studies on this topic were conducted on patients with neck pain or on patients with neck pain accompanied by fhp, whereas the number of studies that have identified the specific effects of just fhp on respiration is limited. therefore, this study measured the forced vital capacity (fvc) and the forced expiratory volume in 1 second (fev1) in healthy normal adults and healthy adults with fhp to determine the effects of fhp on respiratory dysfunction. in addition, the present study attempted to determine the relationship between fhp and accessory respiratory muscle activity by measuring the activity of the scm, ut, pm, and thoracolumbar es muscles during deep breathing. twenty - six subjects (14 males, 12 females) participated in this study. because lung capacity and muscle activity differ between the genders11, results between the normal and fhp groups were compared separately for males and females. before participation in this study, all subjects signed an informed consent document that was approved by the institute research board of kyungsung university. fvc, fev1, and accessory respiratory muscle activity during deep breathing were measured for each group. to measure fvc and fev1, the subjects are asked to perform a rapid full inspiration through the mouthpiece and then, without hesitation, perform a full expiration with maximum force, followed by another rapid maximum inspiration. fvc and fev1 were measured using pulmonary function equipment (spiropalm, cosmed, italy) that met the american thoracic society s recommendation for diagnostic spirometry. an electromyography unit (telemyo direct transmission system, noraxon, usa) was used to measure the activity of the following accessory respiratory muscles during deep breathing : scm, ut, pm, and es muscles. data are expressed as percentages of the reference voluntary contraction (% rvc). a mann - whitney test was used to compare the fvc, fev1, and breathing muscle activity between the normal and fhp group. spss software (version 21.0 ; spss, chicago, il, usa) was used to generate the statistics, and p - values less than 0.05 were considered statistically significant. the characteristics of the subjects are shown in table 1table 1.subject characteristics (meansd)variablegroupmale (n=14)female (n=12)normal (n=7)fhp (n=7)normal (n=5)fhp (n=7)age (years)23.32.224.23.622.80.323.22.8height (cm)174.68.5176.78.9161.44.2162.95.4weight (kg)70.18.272.65.554.35.653.94.6cva ()53.12.340.94.055.42.143.12.5sd : standard deviation, fhp : forward head posture, cva : craniovertebral angle. the craniovertebral angle was significantly different between normal and fhp subjects in both males and females (p 0.05) (table 3table 3.comparisons of respiratory muscle activity between normal and fhp subjects (mean sd)variablegroupmale (n=14)female (n=12)normal (n=7)fhp (n=7)normal (n=5)fhp (n=7)scm816.6350.0353.3192.0 1,243.6762.2514.2123.0ut273.2114.3177.539.7596.6350.6244.8103.0pm274.895.7183.639.4 290.868.2200.367.9es197.171.3184.237.4229.082.5171.153.9p 0.05) (table 3). sd : standard deviation, fhp : forward head posture, cva : craniovertebral angle p < 0.05. sd : standard deviation, fhp : forward head posture, fvc : forced vital capacity, fev1 : forced expiratory volume at 1 second p < 0.05. sd : standard deviation, fhp : forward head posture, scm : sternocleidomastoid, ut : upper trapezius, pm : pectoralis major, es : erector spinae the present study measured fvc and fev1, as well as the muscular activity in the scm, ut, pm, and es muscles during inspiration to identify the effects of fhp on vital capacity and the activity of the accessory respiratory muscles. the fhp group showed statistically significantly lower fvc and fev1 levels than the normal group. in terms of the activity of the accessory respiratory muscles, the fhp group also exhibited statistically significant decreases in the activation of the scm, ut, and pm relative to muscle activation in the normal group. while the fhp group did not show a significant decrease in the es muscle s activity, its activity in this group was generally lower than in the normal group. fhp causes shortening and weakening of the accessory respiratory muscles, thereby decreasing the ratio of fev1 to fvc10. kapreli. reported that an increase in fhp resulted in a corresponding increase in respiratory dysfunction6. in addition, even among the subjects without neck pain, an increase in fhp led to a corresponding statistically significant decrease in vital capacity3. dimitriadis. reported that maximal inspiratory and expiratory pressure showed statistically significant decreases for complex reasons, such as weaknesses of the scm, scalene muscles, and the trapezius, which are accessory respiratory muscles, and a reduction in kinetic control of the cervical area9. in addition, wirth. reported that weaknesses of the neck muscles and accessory respiratory muscles in patients with neck pain resulted in a decline in thoracic mobility, thereby decreasing maximal voluntary ventilation, maximal inspiratory pressure, and maximal expiratory pressure, and that these effects were closely related to fhp12. however, some studies reported that an increase in fhp resulted in a corresponding increase in maximal expiratory pressure6, 9. this result may be explained as follows : while fhp represents an abnormal posture, this posture can increase the trunk s internal pressure during expiration and therefore may increase dynamic mechanisms. in the present study, the observed decrease in fev1 may have been due to increased kyphosis in the upper thoracic region, which is characterized by fhp, causing a reduction in the volume of the thoracic cage. this would not only reduce the expiratory reserve volume, but also create resistance to the exhalation. in general, respiration is an activity influenced by complex biomechanical factors and the stability of the cervical and thoracic regions of the spine is of great importance to smooth respiratory function5. however, fhp causes the shortening and weakening of the scm, scalene muscles, trapezius, and es muscles7, and therefore, reduces the endurance and proprioception of these muscles5. in addition, fhp increases muscle tension around the thoracic spine, thereby restricting the range of motion in the upper thoracic spine3. the present study compared normal adults without neck pain based on the presence or absence of fhp. the results were similar to those of a number of previous studies on patients with fhp and neck pain, as well as those of the previous studies on normal adults with fhp but without neck pain3. the results presented here may be important in confirming that fhp without neck pain can still influence respiration. therefore, when treating patients with fhp or lung dysfunction, improvements in respiratory function through the correction of posture and the strengthening of weakened accessory respiratory muscles may be clinically important. | [purpose ] this study investigated the effects of forward head posture on forced vital capacity and deep breathing. [subjects ] twenty - six subjects, divided into the two groups (normal and forward head posture groups), participated in this study. [methods ] forced vital capacity and forced expiratory volume in 1 second were measured using respiratory function instrumentation that met the american thoracic society s recommendation for diagnostic spirometry. accessory respiratory muscle activity during deep breathing was measured by electromyography. a mann - whitney test was used to compare the measure variables between the normal and forward head posture group. [results ] forced vital capacity and forced expiratory volume in 1 second were significantly lower in the forward head posture group than in the normal group. accessory respiratory muscle activity was also lower in the forward head posture group than in the normal group. in particular, the sternocleidomastoid and pectoralis major activity of the forward head posture group was significantly lower than that of normal group. activities of the other muscles were generally decreased with forward head posture, but were not significantly different between the two groups. [conclusion ] these results indicate that forward head posture could reduce vital capacity, possibly because of weakness or disharmony of the accessory respiratory muscles. |
older adults with a range of comorbidities are often prescribed multiple medications, some of which may impact on their function and cognition, and many have a potential for drug interactions.1 studies showing evidence of benefit from pharmacotherapy have mostly been conducted in younger patients, and it is unclear how this translates to frail older patients. these patients are often excluded from drug trials ; yet they are the largest consumers of medications.1 several studies have found current use of five or more drugs in well over a quarter of older community dwelling adults,24 with higher prevalence in frail older populations and in hospitalized patients.5,6 the assessment of frailty using various methods, including the frailty index, is being incorporated in recent studies of older adults and provides an insight into their accumulated deficits and reduced reserve.7,8 the increased number of comorbidities requiring medications makes these patients prone to polypharmacy, yet their frailty status, together with the pharmacokinetic and pharmacodynamic changes that occur with aging, places them at risk of adverse events. the risks of polypharmacy include non - adherence, adverse drug reactions, drug drug interactions, falls, fractures, poor nutrition, and mortality,914 as well as increased exposure to potentially inappropriate medications (pims).5,15 however, few studies have reported on the association of polypharmacy with functional outcomes in older patients. the aims of the study were to explore the extent of polypharmacy in a cohort of older patients discharged from hospital to a home care program ; assess the relationship between polypharmacy and patient characteristics, functional outcomes, and frailty ; and describe the prevalence of the most common medications in this cohort, with particular emphasis on pims. older adults with a range of comorbidities are often prescribed multiple medications, some of which may impact on their function and cognition, and many have a potential for drug interactions.1 studies showing evidence of benefit from pharmacotherapy have mostly been conducted in younger patients, and it is unclear how this translates to frail older patients. these patients are often excluded from drug trials ; yet they are the largest consumers of medications.1 several studies have found current use of five or more drugs in well over a quarter of older community dwelling adults,24 with higher prevalence in frail older populations and in hospitalized patients.5,6 the assessment of frailty using various methods, including the frailty index, is being incorporated in recent studies of older adults and provides an insight into their accumulated deficits and reduced reserve.7,8 the increased number of comorbidities requiring medications makes these patients prone to polypharmacy, yet their frailty status, together with the pharmacokinetic and pharmacodynamic changes that occur with aging, places them at risk of adverse events. the risks of polypharmacy include non - adherence, adverse drug reactions, drug drug interactions, falls, fractures, poor nutrition, and mortality,914 as well as increased exposure to potentially inappropriate medications (pims).5,15 however, few studies have reported on the association of polypharmacy with functional outcomes in older patients. the aims of the study were to explore the extent of polypharmacy in a cohort of older patients discharged from hospital to a home care program ; assess the relationship between polypharmacy and patient characteristics, functional outcomes, and frailty ; and describe the prevalence of the most common medications in this cohort, with particular emphasis on pims. a prospective observational cohort study of older persons discharged from hospital to a community - based transition care program was conducted at six sites in two australian states, queensland and south australia. the transition care program (tcp) is designed to facilitate transitions from hospital to home for older people (aged 70 years and over or 50 years and over for the indigenous population), offering those with high care needs additional support during convalescence.16 the program is therapy focused, providing a package of services which includes home help and personal care, physiotherapy and occupational therapy, nursing care, and case management over a maximum period of 12 weeks (average 7 weeks) post - discharge from hospital.16 the provision of primary medical care to a transition care recipient is undertaken by their general practitioner.16 consecutive patients entering the tcp during the period from november 2009 to september 2010, who gave informed consent to participate, were eligible for the study. recruitment details for the study, originally designed to examine the functional recovery trajectories of patients with high care needs, have previously been published.17 ethics approval was given by the university of queensland human research ethics committee (hrec) as well as hrecs responsible for governance at each of the tcp sites. a comprehensive geriatric assessment using the interrai home care instrument was conducted at tcp admission and discharge. the interrai instruments comprise a suite of assessment tools to support assessment and care planning of persons with chronic illness, frailty, and disability across care settings,18 with substantial reliability on core items in common.19 the interrai home care assessment collects data on multiple domains including sociodemographics, medical conditions, medications, physical and mental function, nutrition, and symptoms and syndromes such as mood, behavior, and continence. a number of scales embedded in the interrai instruments combine single items belonging to a domain, such as activities of daily living (adl), instrumental adl (iadl), and cognition, which can be used to describe the presence and extent of deficits in that domain.17,20,21 trained assessors gathered data from multiple sources including from the patient, carers, medical and allied health staff, and hospital records. medications from hospital discharge summaries were coded by pharmacy students using the world health organization anatomical therapeutic chemical (atc) classification system and reviewed by a pharmacist and a geriatrician. some studies define it as use of five or more medications.24,11 this has been supported in a recent study investigating polypharmacy cutoff points and risks of adverse outcome.22 moreover, recent studies have defined the use of ten or more medications as excessive polypharmacy10,23 or hyperpolypharmacy.24 inclusion of over - the - counter medications and medications not consumed on a regular basis is also variable. in our study, polypharmacy status was categorized into three groups non - polypharmacy (04 drugs), polypharmacy (59 drugs), and hyperpolypharmacy (10 drugs) based on regular medications. drugs, vitamins, and mineral supplements administered on a regular basis through any recognized drug - delivery method were included in the analysis. supplements without atc codes, such as cranberry juice and primrose oil, were excluded. the american geriatrics society 2012 beers criteria was used to identify pims with a recommendation to avoid, regardless of patients comorbidities. we included as pims those medications where the recommendation to avoid was strong and the quality of evidence was classified as moderate or high, also taking into account exposure to drugs above recommended maximum daily dose.25 table s1 lists the pims meeting these criteria. the frailty index (fi) was calculated using a well described methodology,26 based on accumulated health deficits such as symptoms, signs, disabilities, and diseases measured in the interrai home care assessment. disability in adl and iadl, impairments in general cognition and mobility, number of comorbidities, incontinence, and depressed mood were included as deficits. for each patient, deficits were added and divided by the total counted, here 57, to calculate an individual index score. polypharmacy was excluded from the deficit count. the higher the score, the greater the number of deficits, and the more likely the patient is to be frail. in community - dwelling older people, 0.25 has been proposed as the cutoff between fit and frail, with scores of > 0.40 associated with dependence on others for activities of daily living.27 to describe characteristics across polypharmacy groups, comparison of means (analysis of variance) or medians (kruskal wallis test) for continuous variables was used, depending on distribution of the data. for categorical variables, chi - square or fisher s exact test (where cell numbers are less than five) was performed. an exploratory analysis using logistic regression models tested the association between polypharmacy, frailty status, and functional outcomes. for the purpose of interpreting odds ratios, fi was multiplied by 10 so that the per - unit change was 0.1.8 patients with missing data were excluded from the relevant analysis, and percentages were reported as proportions of patients with available data. a prospective observational cohort study of older persons discharged from hospital to a community - based transition care program was conducted at six sites in two australian states, queensland and south australia. the transition care program (tcp) is designed to facilitate transitions from hospital to home for older people (aged 70 years and over or 50 years and over for the indigenous population), offering those with high care needs additional support during convalescence.16 the program is therapy focused, providing a package of services which includes home help and personal care, physiotherapy and occupational therapy, nursing care, and case management over a maximum period of 12 weeks (average 7 weeks) post - discharge from hospital.16 the provision of primary medical care to a transition care recipient is undertaken by their general practitioner.16 consecutive patients entering the tcp during the period from november 2009 to september 2010, who gave informed consent to participate, were eligible for the study. recruitment details for the study, originally designed to examine the functional recovery trajectories of patients with high care needs, have previously been published.17 ethics approval was given by the university of queensland human research ethics committee (hrec) as well as hrecs responsible for governance at each of the tcp sites. a comprehensive geriatric assessment using the interrai home care instrument was conducted at tcp admission and discharge. the interrai instruments comprise a suite of assessment tools to support assessment and care planning of persons with chronic illness, frailty, and disability across care settings,18 with substantial reliability on core items in common.19 the interrai home care assessment collects data on multiple domains including sociodemographics, medical conditions, medications, physical and mental function, nutrition, and symptoms and syndromes such as mood, behavior, and continence. a number of scales embedded in the interrai instruments combine single items belonging to a domain, such as activities of daily living (adl), instrumental adl (iadl), and cognition, which can be used to describe the presence and extent of deficits in that domain.17,20,21 trained assessors gathered data from multiple sources including from the patient, carers, medical and allied health staff, and hospital records. medications from hospital discharge summaries were coded by pharmacy students using the world health organization anatomical therapeutic chemical (atc) classification system and reviewed by a pharmacist and a geriatrician. some studies define it as use of five or more medications.24,11 this has been supported in a recent study investigating polypharmacy cutoff points and risks of adverse outcome.22 moreover, recent studies have defined the use of ten or more medications as excessive polypharmacy10,23 or hyperpolypharmacy.24 inclusion of over - the - counter medications and medications not consumed on a regular basis is also variable. in our study, polypharmacy status was categorized into three groups non - polypharmacy (04 drugs), polypharmacy (59 drugs), and hyperpolypharmacy (10 drugs) based on regular medications. drugs, vitamins, and mineral supplements administered on a regular basis through any recognized drug - delivery method were included in the analysis. supplements without atc codes, such as cranberry juice and primrose oil, were excluded. the american geriatrics society 2012 beers criteria was used to identify pims with a recommendation to avoid, regardless of patients comorbidities. we included as pims those medications where the recommendation to avoid was strong and the quality of evidence was classified as moderate or high, also taking into account exposure to drugs above recommended maximum daily dose.25 table s1 lists the pims meeting these criteria. the frailty index (fi) was calculated using a well described methodology,26 based on accumulated health deficits such as symptoms, signs, disabilities, and diseases measured in the interrai home care assessment. disability in adl and iadl, impairments in general cognition and mobility, number of comorbidities, incontinence, and depressed mood were included as deficits. for each patient, deficits were added and divided by the total counted, here 57, to calculate an individual index score. the higher the score, the greater the number of deficits, and the more likely the patient is to be frail. in community - dwelling older people, 0.25 has been proposed as the cutoff between fit and frail, with scores of > 0.40 associated with dependence on others for activities of daily living.27 some studies define it as use of five or more medications.24,11 this has been supported in a recent study investigating polypharmacy cutoff points and risks of adverse outcome.22 moreover, recent studies have defined the use of ten or more medications as excessive polypharmacy10,23 or hyperpolypharmacy.24 inclusion of over - the - counter medications and medications not consumed on a regular basis is also variable. in our study, polypharmacy status was categorized into three groups non - polypharmacy (04 drugs), polypharmacy (59 drugs), and hyperpolypharmacy (10 drugs) based on regular medications. drugs, vitamins, and mineral supplements administered on a regular basis through any recognized drug - delivery method were included in the analysis. supplements without atc codes, such as cranberry juice and primrose oil, were excluded. the american geriatrics society 2012 beers criteria was used to identify pims with a recommendation to avoid, regardless of patients comorbidities. we included as pims those medications where the recommendation to avoid was strong and the quality of evidence was classified as moderate or high, also taking into account exposure to drugs above recommended maximum daily dose.25 table s1 lists the pims meeting these criteria. the frailty index (fi) was calculated using a well described methodology,26 based on accumulated health deficits such as symptoms, signs, disabilities, and diseases measured in the interrai home care assessment. disability in adl and iadl, impairments in general cognition and mobility, number of comorbidities, incontinence, and depressed mood were included as deficits. for each patient, deficits were added and divided by the total counted, here 57, to calculate an individual index score. the higher the score, the greater the number of deficits, and the more likely the patient is to be frail. in community - dwelling older people, 0.25 has been proposed as the cutoff between fit and frail, with scores of > 0.40 associated with dependence on others for activities of daily living.27 to describe characteristics across polypharmacy groups, comparison of means (analysis of variance) or medians (kruskal wallis test) for continuous variables was used, depending on distribution of the data. for categorical variables, chi - square or fisher s exact test (where cell numbers are less than five) was performed. an exploratory analysis using logistic regression models tested the association between polypharmacy, frailty status, and functional outcomes. for the purpose of interpreting odds ratios, fi was multiplied by 10 so that the per - unit change was 0.1.8 patients with missing data were excluded from the relevant analysis, and percentages were reported as proportions of patients with available data. of the 351 tcp clients enrolled in the study, four cases had missing medication data. the mean age (standard deviation [sd ]) was 78.9 (8.8) years, and 65.7% were females. the majority of patients discharged to the tcp needed ongoing support after hospitalization for orthopedic conditions (50.7%), including fractures (37.5%), medical conditions resulting in deconditioning (23.6%), and stroke (14.6%). the median length of stay in the tcp was 54 days (interquartile range 3773 days). the number of regular medications taken ranged from 0 to 24, with a mean (sd) of 8.5 (3.6). for as needed pro re nata (prn) medications, the mean (sd) was 0.8 (1.1). polypharmacy (59 drugs) was observed in 46.7% and hyperpolypharmacy (10 drugs) in 39.2%. the majority in the hyperpolypharmacy group (n=131 ; 96.3%) were taking between 10 and 15 regular medications, with five taking more than 15 regular medications. table 1 shows the characteristics of patients according to polypharmacy categories at admission to the tcp. patients with polypharmacy and hyperpolypharmacy had more comorbidities than the non - polypharmacy group and were more likely to have diabetes mellitus, coronary heart disease, chronic obstructive pulmonary disease (copd), or depression. they were also more likely to have symptoms of pain, dizziness, and dyspnea. there was no significant association between polypharmacy categories and stroke, congestive heart disease, parkinson s disease, or cancer. considering frailty status and geriatric syndromes (including history of falls in the previous 90 days, impaired cognition, dependence in basic and instrumental adl, and bladder incontinence), only the fi had a significant association with polypharmacy. the majority of patients continued living in the community (85.6%), 12.4% were readmitted to hospital, 0.9% were discharged to residential aged care facilities (racf), and 1.2% died. patients in the polypharmacy and hyperpolypharmacy groups were more likely than the non - polypharmacy group to fail to improve in adl and iadl and were more likely to fall over the duration of the tcp. multivariate models of functional outcomes (failure to improve adl or iadl or falls over the tcp), with fi and polypharmacy groups as covariates, show that frailty status mediates the effects of polypharmacy. the odds ratios of adl and iadl functional decline and falls for a 0.1 increase in fi are shown in table 3. non - opioid drugs were prescribed more frequently than opioids (46.1% and 27.1%, respectively). anti - ulcer drugs (52.7%), statins (44.1%), aspirin, and anti - aggregates (43.2%) followed. beta blockers and angiotensin converting enzyme inhibitors were each prescribed in about a third of patients, while diuretics, calcium channel blockers, and angiotensin receptor blockers were each prescribed in about a quarter of the patients. vitamin d and analogues were prescribed in 27.1%, while anti - resorptives and calcium were taken by 22.5% and 24.5%, respectively. only nine patients were on antipsychotics and four patients on anti - dementia drugs. in all but a few drug categories (anticoagulants, oral hypoglycemics, anti - emetics, anti - parkinson, antipsychotics, and anti - dementia drugs) the prevalence of each drug class increased significantly across the polypharmacy groups, with the hyperpolypharmacy group having the highest prevalence. the number of tcp patients taking at least one pim was 41 (11.8%), with two persons taking two pims. of those taking at least one pim, 2 (4.1%) were in the non - polypharmacy group ; 17 (10.5%) were in the polypharmacy group ; and 22 (16.2%) in the hyperpolypharmacy group. this distribution failed to reach statistical significance (p=0.066 ; fisher s exact test). digoxin at a dose of > 125 g was prescribed in less than 2% of patients. dipyridamol, promethazine, glibenclamide, and oral estrogens were each prescribed in only one or two patients. none of the patients was prescribed potent non - steroidal anti - inflammatory drugs which increase the risk of gastrointestinal bleeding and peptic ulceration. the findings of this study showed that polypharmacy was significantly associated with frailty and poor functional outcomes. however, multivariate models of functional outcomes (failure to improve adl or iadl or falls over the tcp), with fi and polypharmacy groups as covariates, show that frailty status mediates the effects of polypharmacy. this accords with previous findings which indicate that older adults who are frail are more likely to be exposed to multiple medications associated with increases in number of comorbidities. conversely, multiple medications may exacerbate frailty.24 while the association of polypharmacy with frailty and adverse outcomes has been shown in studies of community - dwelling older adults,22,24,28 there have been few studies which have shown this relationship in the post - acute care setting. the majority of patients in our study (86%) were prescribed five or more medications per day. the mean number of drugs of 8.5 is higher than that reported in other studies of nursing home patients, community - dwellers, and day hospital patients, which report values of 3.77.9.4,10,2931 the definition of polypharmacy and inclusion of vitamins, minerals, and over - the - counter medications was variable in these other studies, making comparison difficult. similar to previous reports,23,32 prevalence of diabetes mellitus, coronary heart disease, copd, and depression were lower in the non - polypharmacy group, as were symptoms of dizziness and dyspnea. in contrast to a previous study,23 measures of adl, iadl, and cognition were not associated with polypharmacy at admission to the tcp. however, better functional outcomes in adl and iadl were achieved with tcp rehabilitation for those on fewer medications. this was most likely because of their lower levels of frailty, which is a predictor of functional gain in rehabilitation patients.8 those with fewer medications were less likely to fall over the duration of the tcp, which is consistent with studies showing a relationship between polypharmacy and risk of falls.33 a strong association between cognitive impairment and reduced rates of excessive polypharmacy has recently been described in nursing - home residents.23 in contrast, our study did not find such an association, most likely due to the small number of patients with severe cognitive impairment. analgesics were the most commonly prescribed class of medications, which may reflect the fact that the majority of patients had been hospitalized with fractures or for orthopedic procedures. while fractures were the commonest reason for hospitalization in patients admitted to the tcp, this was not mirrored by the use of anti - resorptives and vitamin d and analogues, which was lower than expected, given the importance of these medications in the prevention of osteoporotic fractures.34,35 though analgesic use was high, no patients were prescribed potent non - steroidal anti - inflamatory drugs, which are listed as pims under the beers criteria,25 due to greater propensity for gastrointestinal side effects. the majority of pims that met beers criteria were not prescribed for any of the patients in our study. the difficulties comparing our study with other published polypharmacy studies, due to different patient selection and polypharmacy definitions, are acknowledged. our study has prospectively collected data on functional outcomes in a cohort of patients often excluded from clinical studies this is an important group of patients in which interventions can delay or avoid institutionalization.17 considerations should be given to enabling regular medication reviews and rationalization in patients enrolled in community rehabilitation and transition care programs, by encouraging regular pharmacist and medical input. these interventions have been shown to improve appropriate prescribing and reduce drug - related adverse events, though results on number of medications prescribed have been variable.6,3639 the strengths of our study are that the cohort is characteristic of older people eligible for post - discharge home - based care and representative of tcp recipients in particular, having been recruited across multiple sites in both rural and metropolitan communities. few studies have explored associations of polypharmacy with functional outcomes after a period of longitudinal follow up. a study limitation is that the medication lists were documented by the interrai assessors who transcribed or photocopied the patients drug charts from hospital discharge summaries. it is acknowledged that this method of collecting medication data is not the current gold standard. to achieve complete medication reconciliation, multiple sources of information (including patient interview, general practitioner s letter, and dispensing history from the pharmacy) a further limitation is that the indications for each medication prescribed could not be determined. efforts should be made to encourage regular medication reviews and rationalization of medications by pharmacists and geriatricians in these frail patients with reduced physiological reserves. use of medications associated with functional decline such as benzodiazepines and anticholinergics as well as other pims should be minimized. | backgroundolder adults with a range of comorbidities are often prescribed multiple medications, which may impact on their function and cognition and increase the potential for drug interactions and adverse events.aimsthis study investigated the extent of polypharmacy and potentially inappropriate medications in patients receiving post - discharge transitional home care and explored the associations of polypharmacy with patient characteristics, functional outcomes, and frailty.methodsa prospective observational study was conducted of 351 patients discharged home from hospital with support from six transition care program (tcp) sites in two states of australia. a comprehensive geriatric assessment was conducted at tcp admission and discharge using the interrai home care assessment tool, with frailty measured using an index of 57 accumulated deficits. medications from hospital discharge summaries were coded using the world health organization anatomical therapeutic chemical classification system.resultspolypharmacy (59 drugs) was observed in 46.7% and hyperpolypharmacy (10 drugs) in 39.2% of patients. increasing numbers of medications were associated with greater number of comorbid conditions, a higher prevalence of diabetes mellitus, coronary heart disease, chronic obstructive pulmonary disease, dizziness, and dyspnea and increased frailty. at discharge from the program, the non - polypharmacy group (< 5 drugs) had improved outcomes in activities of daily living, instrumental activities of daily living and fewer falls, which was mediated because of lower levels of frailty. the commonest drugs were analgesics (56.8%) and antiulcer drugs (52.7%). the commonest potentially inappropriate medications were tertiary tricyclic antidepressants.conclusionpolypharmacy is common in older patients discharged from hospital. it is associated with frailty, falls, and poor functional outcomes. efforts should be made to encourage regular medication reviews and rationalization of medications as part of discharge planning. whether careful deprescribing improves outcomes in frail patients should be the focus of randomized trials. |
oxidative stress tends to occur during the neonatal period because the younger the gestational age, the lower the antioxidant capacity (ac) and a lower ac tends to result in an increase in free radicals (fr) and reactive oxygen species (ros). cell damage due to oxidative stress during the neonatal period has been associated with disease. for example, oxidative stress has been reported in association with necrotizing enterocolitis (nec) if the site of the damage is in the digestive tract, with chronic lung disease (cld) if in the lungs, retinopathy of prematurity (rop) if in the eyes, and periventricular leukomalacia (pvl) and intraventricular hemorrhage (ivh) if in the brain [6, 7 ]. the other is to strengthen ac, which protects the body from cell damage by scavenging fr and ros when they increase. one study of preventing factors that trigger the production of fr and ros reported that using 21% oxygen instead of 100% oxygen during resuscitation can keep oxidative stress low, since oxygen causes an increase in fr and ros. a number of studies of strengthening ac have investigated the oral administration of antioxidants (vitamins a, e, and d), but the studies have not reached a consensus of opinion [912 ]. although based on short - term studies, it is known that breast milk has greater ac than formula milk [13, 14 ]. for example, compared to formula feeding cohorts, breastfeeding cohorts have been reported to show a 1/10 decrease in risk for development of nec, better neurodevelopment, and a decrease in the development of rop. the present study was conducted to elucidate the significance of breastfeeding with a view toward preventing oxidative stress. thus far there have been no reports on long - term total antioxidant capacity (tac) in breast milk. a new method to measure tac was used to compare the ac in formula milk and breast milk and to clarify the relationship between ac in breast milk and the postnatal age in days when collected. at our facility, we put breast milk provided by mothers for their babies into breast milk packs and freeze it at 20c. later, when an opportunity to give it to the babies comes, we slowly thaw the breast milk at 37c and give it to the babies as nourishment. during the current study, we used thawed breast milk instead of fresh breast milk to measure the degree of ac supplied to babies. since breast milk is an important source of neonatal nutrition, we used the excess portion of breast milk in the packs to ensure they have the necessary amount of milk, milk that would normally be destroyed. all samples were taken from breast milk that was thawed within 48 hours after being frozen following collection. before taking measurements the breast milk was centrifuged at low speed (500 g for 25 min) to settle out the suspended cellular components. next, the cellular components were removed and the decelled milk was centrifuged at high speed (5000 g for 30 min) to separate it into defatted milk and fat content. the same method was used to prepare defatted milk using two types of formula milk having a composition similar to the breast milk of japanese women [1820 ], and the measurements taken (table 1). tac levels were determined using the biological anti - oxidant potential (bap) test, which is based on the ability of a colored solution, containing a source of ferric (fe) ions adequately bound to a special chromogenic substrate, to decolour when fe ions are reduced to ferrous ions (fe), as it occurs by adding a reducing / antioxidant system. practically, 50 l of ferric chloride reagent are transferred into the cuvette containing the thiocyanate derivative reagent. the resulting colored solution, after gently mixing by inversion, undergoes 550 nm photometric reading. then, 10 l of sample milk are added in the same cuvette and the obtained solution is gently mixed and incubated into the thermostatic block for 5 min at 37c. bap test, by exploiting the same chemical principle of the well - known ferric reducing ability of plasma (frap) test i. e. the reduction of ferric to ferrous ions provides a reliable measure of biological antioxidant potential of blood plasma and food [22, 23 ]. an unpaired t test was used for comparison of numerical data between the two groups. statistics were compiled using spss10.0j (spss inc, chicago, il) and graph pad prism 4 (graph pad software, inc., san diego, ca). simple linear regression analysis was used to determine the correlation between different postnatal ages in days and tac. the breast milk was centrifuged at low speed (500 g for 25 min) to settle out the suspended cellular components. next, the cellular components were removed and the decelled milk was centrifuged at high speed (5000 g for 30 min) to separate it into defatted milk and fat content. the same method was used to prepare defatted milk using two types of formula milk having a composition similar to the breast milk of japanese women [1820 ], and the measurements taken (table 1). tac levels were determined using the biological anti - oxidant potential (bap) test, which is based on the ability of a colored solution, containing a source of ferric (fe) ions adequately bound to a special chromogenic substrate, to decolour when fe ions are reduced to ferrous ions (fe), as it occurs by adding a reducing / antioxidant system. practically, 50 l of ferric chloride reagent are transferred into the cuvette containing the thiocyanate derivative reagent. the resulting colored solution, after gently mixing by inversion, undergoes 550 nm photometric reading. then, 10 l of sample milk are added in the same cuvette and the obtained solution is gently mixed and incubated into the thermostatic block for 5 min at 37c. bap test, by exploiting the same chemical principle of the well - known ferric reducing ability of plasma (frap) test i. e. the reduction of ferric to ferrous ions provides a reliable measure of biological antioxidant potential of blood plasma and food [22, 23 ]. an unpaired t test was used for comparison of numerical data between the two groups. statistics were compiled using spss10.0j (spss inc, chicago, il) and graph pad prism 4 (graph pad software, inc., san diego, ca). simple linear regression analysis was used to determine the correlation between different postnatal ages in days and tac. the study was performed on 56 samples of breast milk collected from mothers of premature infants born with a mean sd gestational age of 33 4 weeks (range : 2437 weeks) that was collected at postnatal age 39 43 days (range : age 4145 days). the compositions of formula milk a and formula milk b are shown in table 1. no significant difference was observed (p = 0.51) between the tac in formula milk a (n = 6) and formula milk b (n = 6), which were 2739 126.1 the average tac in formula milk (formula milk a and formula milk b) was 2671 96.0 mol / l and the tac (n = 56) in breast milk was 3807 103.5 mol / l, clearly revealing that tac in breast milk is higher than tac in formula milk (p<0.0001). 1 shows the correlation between tac and the postnatal age in days when the breast milk was collected. the tac in breast milk was negatively correlated to the postnatal age in days when collected (r = 0.25, p<0.0001), while significantly higher than the average tac in formula milk. despite the fact that formula milk, which is made to simulate breast milk, has the same level of exogenous antioxidants as breast milk (table 1), the tac of breast milk is higher than that of formula milk. moreover, although the tac in breast milk was observed to decrease with the passage of time after birth, tac in breast milk throughout the period of this study (postnatal days 4145) was continually higher than the average tac in formula milk. a conceivable reason for these results is the action of endogenous antioxidants, such as superoxide desmutase (sod), glutathione peroxidase (gp), and catalase (cat), which are present only in breast milk and not in formula milk [24, 25 ]. there are only two or three reports that measure both the endogenous and exogenous tac in breast milk [13, 14 ]. the values in the common measurement method, which uses 2,2-azino - di-3-ethylbenzthiazolinesulph onate (abts), have a range of less than 1, and so are statistically limited if there are only a few samples and could therefore be biased. in that respect, the bap test, which measures tac using thiocyanate that we used in the present study, can become a very useful method to measure tac in breast milk, since it has a very large range of values. endogenous antioxidants in breast milk such as cat, gp, and sod were thought to increase with the passage of days after birth [24, 25 ]. it was imagined, therefore, that the tac in breast milk would increase as the postnatal age in days increased. however, our results showed that tac tends to decrease with the passage of time. a possible reason why the tacs we measured in this study, which reflect both exogenous and endogenous antioxidants, decreased with the number of days after birth is that the exogenous antioxidants in breast milk decrease with the passage of time, as shown in table 1. accordingly, we feel that measuring the tac in breast milk is useful for comprehensively evaluating the antioxidant capacity of the substances being measured. it has been reported that early breastfeeding is important in a number of respects, including the fact that the earlier breastfeeding begins, the lower mortality is ; the fact that 8-hydroxy-2'-deoxyguanosine in urine, which is a marker of dna damage, is lower at two and four weeks after birth in babies who consume breast milk from early on when compared with those who are fed formula milk ; and the fact that in a comparison of preterm infants of formula milk versus breast milk in a large scale, multi center study, visual development at the chronological age of six months and language development at 14 months were higher in the cohort of babies who were breastfed for a mean period of 135 118 days (the cohort in which babies consumption of milk before hospital discharge was 50% breast milk) than those who were fed only formula milk. the possibility that the higher tac in breast milk in early postnatal age neutralizes oxidative stress for younger babies suggests one reason for these findings. studies to date on the early oral administration of vitamins aimed at protection from ros and fr have not produced a consensus on the efficacy of vitamin administration. this may have resulted from the differences between breastfeeding and formula feeding and differences in when the different types of feedings were started. we learned that tac, which is higher in breast milk than formula milk, decreases with the passage of days. a possible future research topic for improving the prognosis of neonates (i.e. nec, cld, rop, pvl, ivh and neurological development) could be how to prevent the tac in breast milk from decreasing with time, as the current study shows that it does, including supplementation with exogenous antioxidants. breast milk is important to the neonate, who is subjected to a number of fr and ros. in particular, we believe that starting breastfeeding early is extremely important and useful in protecting against oxidative stress. | this study aimed to consider the significance of breast milk in preventing oxidative stress by comparing total antioxidant capacity (tac) in breast milk and formula milk for premature infants, demonstrating the relationship between tac in breast milk and postnatal age in days. we used the biological anti - oxidant potential test, a new method to measure tac in breast milk. breast milk for premature infants were stored at 20c and thawed within 48 h of collection. we measured tac in two types of formula milk in the same way. tac was clearly higher in breast milk than formula milk. although a negative correlation was observed between tac in breast milk and age when collected, tac was always higher than the average tac in formula milk. tac in breast milk is higher than tac in formula milk. we suggest the importance of breast milk for preventing oxidative stress and starting breastfeeding early. |
a 42-year - old man with hcv was referred to our hospital in august 2004 because of diarrhea and bloody stool. ten years before admission, he had been diagnosed with total uc endoscopically and histologically. colonoscopic examination revealed reddish and edematous mucosa with multiple erosions through the entire colon (fig. laboratory data showed thrombocytopenia (57,000/mm3), asparate aminotransferase (ast) 124 iu / l, alanine aminotransferase (alt) 110 iu / l, and hepatitis c virus (hcv) rna (genotype ib) 757 kiu / ml. after informed consent had been obtained, he was treated with peg - ifn--2a (90 g / week) for improving both colonic and liver inflammation. four weeks after initiation of peg - ifn therapy, his abdominal symptoms gradually subsided. we performed intracellular cytokine assay with peripheral cd4 t cells before and after ifn therapy. the ratio of t - helper (th) 1 (ifn-?)/th 2 (interleukin (il)-4) increased (40.2) at 4 weeks after ifn therapy compared to that before (27.4) (fig. however, there was no significant difference of il-10 production from cd4 t cells between before and after ifn therapy. he was uneventfully treated with peg - ifn--2a for one year. when last seen in november 2006, he was still in remission of uc and his laboratory data showed a negative serum hcv - rna, which was suggestive of sustained virological response. inf-, through its immunomodulatory function, could have an impact on pathways in the immune system. therefore, the effect of inf- on the pathophysiology of ibd has been focused, because patients with ibd are characterized by imbalance of the th1/th2 cytokine response. previous reports showed that a treatment with inf- might be a trigger for development of th1-related intestinal disease such as celiac disease and crohn 's disease, because inf- plays an important role in t cell differentiation towards a th1 type of immune response [5, 6 ]. regard, inf- is considered to have beneficial effects in the treatment of diseases characterized by excess th2 cells such as uc. in fact, several clinical trials with ifn seem to be successful in chronic active uc [1, 2 ]. however, the effect of inf- on uc remains controversial, because of some reports on the provoking onset and exacerbation of uc by treatment of inf- [7, 8, 9 ]. in this case, we evaluated the change of th1/th2 ratio of cd4 t cells before and after inf- therapy. the data on intracellular cytokine assay clearly demonstrated that ifn administration increased th1/th2 ratio of peripheral cd4 t cells, which was suggestive of shifting cytokine profile toward th1. in addition, our data showed that administration of peg - ifn--2a did not increase il-10 production from peripheral cd4 t cells. thus, alteration of th1/th2 cytokine balance of peripheral cd4 t cells may be a biomarker for type 1 interferon therapy in patients with uc. in the future, ifn therapy could be useful for patients with uc refractory to other conventional therapies by practical application of this biomarker. | a 42-year - old man with chronic hepatitis c and ulcerative colitis (uc) was referred to our hospital in august 2004 because of bloody diarrhea. he was clinically and endoscopically diagnosed with flare of uc. after informed consent had been obtained, he was treated with peg - ifn--2a. four weeks after initiation of peg - ifn therapy, his abdominal symptoms gradually subsided. intracellular cytokine assay revealed that the ratio of t - helper (th) 1 (ifn-?)/th 2 (il-4) increased after ifn therapy. three months after starting ifn therapy, colonoscopy revealed a normal mucosal pattern. he was uneventfully treated with peg - ifn--2a for one year. when last seen in november 2006, he was still in remission of uc. our intracellular cytokine data suggested that alteration of th1/th2 cytokine balance by ifn is one possible mechanisms of reducing intestinal inflammation in patients with uc. in this regard, ifn therapy could be useful for some patients with uc refractory to other conventional therapies. |
abdominopelvic fluid collection and abscess management and the outcomes have improved in the recent years due to innovation of the image - guided drainage technique and improvement of surgical procedures (1). percutaneous drainage (pcd) of abdominopelvic abscess or fluid collection has become an alternative for surgery in the treatment of abdominal abscess. itallows effective drainage with minimal trauma to the tissues and lower morbidity and mortality rates (1 - 5). pcd also acts as a temporary route in situations like appendicular abscess for drainage before necessary following surgery (6). us provides real - time imaging and it is the method of choice in the relatively supercial and unilocular abscesses, where there is little risk of transgressing a vascular structure, bowel, or pleural cavity. ct is the method of choice when us guidance does not seem safe enough (2, 3). ct fluoroscopy can facilitate percutaneous drainage and can reduce the time of the procedure (7). ct - guided drainage may be used for abscess and collections with various causes such as crohn s disease (9, 10), perforated appendicitis, trauma, post - operative, hematoma, infected pancreatic pseudocyst, lymphocele and urinoma (4, 6, 11). undrained abdominopelvic abscess has a high mortality rate between 45 and 100% (2, 12) that can be reduced by pcd (3). relief of patient symptoms and signs including abdominal pain, distension, and fever, improvement in laboratory tests and follow - up imaging findings are indicators of successful drainage (3). in order to assess the efficacy and complications of this nonoperative percutaneous drainage technique, the authors have reported their experience in the management of abdominal abscess by pcd procedure. the medical records of all patients with abdominopelvic abscess or fluid collection, who were referred to our hospital and had undergone pcd between november 2006 and april 2008, were studied. the details of 47 patients, who had routine preoperative evaluations including cell blood count, urine analysis and culture, renal function and coagulation tests, were available. forty one cases were included in the study for data analysis. to assess the size, location and properties of the abscess, and also the anatomy of adjacent organs, the patients were assessed by abdominopelvic ct scan with iv and oral contrast before performing the procedures. the size of the abscess was defined as the largest diameter reported on ct exam. information such as demographic data including the patient s age and gender as well as the size and location of the abscesswere recorded. the ethics committee of shahid beheshti university of medical sciences approved the study protocol, and informed consents were obtained from all cases. first, a gauge-18 access needle was passed into the abscess to obtain a specimen for culture and gram stain. after achieving the puncture, a 0.035-inch j tipped guide wire was introduced and coiled into the targeted abscess cavity. after tract dilatation, the 8-to 12-french pigtail drainage catheter (gallini ; italy) the cavity content was aspirated and rinsed with sterile normal saline and the catheter was fixed to the skin. all specimens taken from the abscess cavity were sent for biochemical analysis and culture for aerobic and anaerobic organisms. improvement was assessed based on absence of sepsis due to collection, loss of fever, loss of collection size or shrinkage of the abscess wall by follow - up ultrasonography or ct scan. success rate (rate of treatment), hospital stay and the complications were collected. data analysis was performed by spss software for windows ver 15 (spss inc, chicago, il, usa). the data are presented as mean sd (minimum -- maximum) for quantitative variables, and the number of observations, frequencies and percentage for qualitative variables. forty - one patients were included in the study with at least a follow - up of 6 months and their data were analyzed. the average patient age was 54.4 years (12 - 79) including 21 (51%) men and 20 (49%) women. the common signs and symptoms were pain (83%), followed by fever (80.5%), chills and perspiration (56%). liver was the most frequent site of abscess location with 17 (41.5%) cases. previous surgery was the most prevalent etiology for abdominal abscess in 31 cases (75.6%). the diameter of the abscessranged between 5 and 12 (mean, 7.8) cm. as shown in table 2, the most common pathogens obtained from culture media were e. coli (22%) followed by pseudomonas (14.6%). however, no pathogen grew in nearly half of the specimens. thirty - five cases (86%) were successfully treated and six patients needed secondary drainage. complications developed in only one patient as peritonitis, who was conservatively managed with antibiotics and close monitoring. the development of improved imaging modalities together with broad - spectrum antibiotics and new drainage catheters has established pcd as the standard therapy for abdominal and pelvic abscess in the absence of indications for immediate surgery (1 - 5). the main ones are uncorrectable coagulopathy, lack of safe percutaneous access, and inability of the patient to cooperate. in practice, the absence of a safe route is the only factor that inhibits percutaneous drainage. on the other hand, there is a spectrum of procedure complexity that influences outcomes in percutaneous procedures ; for example, multiple or multiloculated abscesses, abscess due to crohn s disease, pancreatic abscesses, a drainage route that traverses the bowel or pleura, an infected clot, and infected tumor (2, 10, 13, 14). one should expect that percutaneous drainage in such cases will have a lower chance of success, be more technically difficult, require longer periods of time for drainage, and have a higher rate of complications. we performed a retrospective study on patients who underwent pcd for abscess or abdominal fluid collection and were followed up for 6 months. pcd was performed under ct guidance because of the local staff expertise and its better resolution and safety. it is in concordance with most of the previous reports (15 - 18). of all specimen cultures, 17 (41.5%) did not show growth that may have been false, in part due to technical problems. inappropriate temperature of the drainage site or culture room, delay in transmission of the specimen, or delay in culture may be the underlying causes. the complication rate was 2.5% (one patient with secondary peritonitis). in older reports, a complication rate of 4 - 29% has been reported for pcd (16, 17), which is reduced in recent studies. the limitation of this study is that data of the internal characteristic of the abscess such as internal septa or gas formation were not mentioned in the medical records in most of the cases and therefore, could not be utilized, since recent studies have suggested that gas formation within the abscess might be an important predictor for pcd failure (15). in concordance with previous studies, we showed that pcd is a safe and effective procedure for the treatment of abdominal abscess and fluid collections. | background : abdominopelvic fluid collection and abscess management and their outcomes have improved in the recent years due to innovation of the image - guided drainage technique and improvement of surgical proceduresobjectives : this study was undertaken to evaluate the efficacy of ct - guided percutaneous drainage in treating abdominopelvic abscesses.patients and methods : in this study, the data of 41 patients who had abdominal abscess or fluid collections, and underwent treatment by percutaneous ct - guided drainage were analyzed. treatment was assessed by reduction of collection size, relief of symptoms and signs including abdominal pain and fever and imaging findings. any morbidity such as wound infection, sepsis, hematoma formation or peritonitis was followed up to six months after the procedure.results:the average age of the patients was 54 years (range 12 to 79), including 21 (51%) men and 20 (49%) women. the common signs and symptoms were pain (83%) and fever (80.5%). the most prevalent abdominal abscess etiology was previous surgery in 31 cases (75.5%). abscess diameter ranged between 5 and 12 cm (mean, 7.8 cm). the average hospital stay was 8 days (4 - 15). thirty five cases (86%) were successfully treated. only one case (2.5%) developed complication (peritonitis) after the procedure.conclusions:according to our findings, ct - guided percutaneous drainage is a safe and effective procedure in the treatment of abdominal abscess and fluid collection. |
presentations at international scientific conferences such as ics and iuga are the most important route for early dissemination and discussion of research findings. indeed for many studies that never reach full text publication, and in many regions where access to health care publications is limited, the conference abstract may be the only easily available record of the research. as if preparing a succinct and accurate summary of one s research is not challenging enough, there is also a certain art to writing an abstract that will appeal to conference scientific committees. over the last decade getting work accepted for oral presentation at either ics or iuga became increasingly difficult (fig. the ics meeting in san francisco received 1,003 abstract submissions and was able to accept only 284 for oral presentation. the iuga meeting was usually more forgiving, with the 2009 como meeting receiving 477 submissions and accepting 200 oral presentations. 1total abstract submissions to the ics meeting 20002009 (data courtesy of dan snowdon) total abstract submissions to the ics meeting 20002009 (data courtesy of dan snowdon) speakers included chairs and members of ics and iuga scientific committees, specialty journal editors and expert methodologists. with the april 1 deadline for submissions to the joint 2010 ics / iuga meeting in toronto looming, this article aims to condense the lectures and discussions from those workshops into practical advice for the novice researcher facing the daunting task of summarising their data for the first time. it is an important principle that abstracts presented at ics or iuga should not have been previously presented internationally, nor should the abstracts have been indexed in a published journal. every year there is some overlap of presentations between the two meetings, as well as with other urological or gynaecological meetings, which wastes the precious resource of podium time. it is a more strictly enforced rule that studies that have been published in full, even as an e - publication, should not be presented. every year some abstracts slip through, despite prior publication [2, 3 ]. the reverse situation occurs when researchers choose to submit an abstract before conducting any analysis, or based on analysis of interim results. reports of interim analyses may be justified on safety grounds, but should ideally be led by an independent data monitoring committee. particularly for randomised trials, conducting interim efficacy analyses before completion of recruitment jeopardises the power calculation of the study and compromises the equipoise of the researchers. even for observational studies, waiting for full recruitment and complete follow - up every year, very large numbers of abstracts are submitted in the final hours before abstract submission closes. the writing of a conference abstract is usually the first chance for multiple authors to synthesise and reflect on complex findings. sufficient time should therefore be allotted for multiple revisions, with a chance for all listed authors to approve the final draft. working right up to the deadline may lead to gaps in the analysis and unnecessary approximations. although we have ourselves each been guilty of last minute submissions, we would recommend leaving as much time as possible for abstract preparation. the classic scientific format of introduction, methods, results, and discussion (imrad) is adapted for abstracts at both meetings, with extra stress placed on stating a clear objective or hypothesis for the study. within the imrad structure more detailed guidance is available for the items that ought to be included in the full report of a trial. implementation of consort has been shown to effectively improve reporting of randomised controlled trials, and it has been formally adopted for reporting of randomised trials at the ics / iuga meeting. a core set of items suitable for inclusion in brief abstracts is also available and should be considered as a minimum requirement. most abstracts submitted to ics and iuga are observational cohort, case control or cross - sectional studies. other guidance relevant to the continence field includes prisma for systematic reviews and meta - analyses and stard for diagnostic accuracy studies. although, with the exception of the consort for abstracts, these guidelines are intended for whole manuscripts, ics and iuga abstracts are relatively long. failing to report these key items prevents full evaluation of the work, and therefore limits the impact of the study. it is strongly advised to read these in detail before starting the process of writing. very few abstracts are rejected outright, unless the authors failed to follow the abstract submission rules. abstracts must be in the correct font, at the correct size, must not be too short or too long and must follow the recommended structure. importantly, and seemingly obviously, abstracts for the ics / iuga meeting should be related to either continence or urogynaecology. the scientific committee insists that abstracts are strictly anonymous, which enhances the perception of fairness, although it has an uncertain effect on the reliability of the scoring system. every year abstracts are rejected because authors disclose their names or their institution within the text of the abstract. describing the country or region and the type of healthcare organisation should provide sufficient information about the setting. although it is acceptable for abstracts to include self - citations, the cited paper should not be referred to in the first person possessive (e.g., our previous work showed) in order to maintain anonymity. drafting a clearly worded, readable abstract is difficult even for native english speakers. while spelling errors and solecisms will not rule out acceptance of high quality science, there is evidence that reviewers are biased in favour of well - written abstracts. non - native english speakers should therefore enlist native english speakers or better still, professional medical writers to review their drafts. abstracts are judged on three criteria : novelty, scientific merit and clinical impact, which are allotted equal importance. each referee will be allocated approximately 300 abstracts to evaluate, with each abstract scored by multiple referees to increase reliability. this amounts to hundreds of thousands of words to be read over a 2-week period. since most committee members also have full - time jobs as clinicians or scientists, the time available to score each abstract is extremely limited. the title is the first, and perhaps main chance to grab the attention of the tired overworked referees. formal guidance, such as strobe, recommends that titles should indicate the study design (e.g., a prospective cohort study of snake oil for stress incontinence). popular alternatives include phrasing the title as a question in order to highlight the novelty and aims (e.g., does snake oil cure stress incontinence?) ; giving a conclusive statement summarising the main finding (e.g., snake oil is ineffective for stress incontinence) ; or some combination of these approaches. after the title, it is important that the title fits with the aim and that the conclusion directly addresses the aim. the reviewers are unlikely to be familiar with the entire world literature on your topic, so the background is a chance to briefly explain the clinical or scientific uncertainties addressed and the rationale for the design. it is helpful to be specific about the main hypothesis. when there are multiple hypotheses and multiple outcome measures it may be tempting to break the study into two or more abstracts, so called salami slicing. the objective should be to present the single strongest abstract, with the best chance of being rewarded with a podium presentation or discussed poster. if one study was conducted, with one sample, then there should be just one abstract reported. the scientific merit of an abstract is in part determined by the study design and in part by the clarity of the results and methods sections. the formal reporting guidance (consort, strobe, stard) appropriate to each study design will help decide what information is necessary in the limited space available. a well - designed table or figure will often be the clearest way to present the actual data. it is important that a table should neither contain too many data, making it unreadable, nor should it repeat the text. many abstracts overstate the importance of their findings, making claims that would not withstand full peer review. it is an egregious error to claim that an intervention tested is safe and effective if it is based on one centre, one surgeon or only a small case series. table 1 summarises the types of information that might be included in each section of an ics / iuga abstract for a clinical trial, adapted from the consort, and strobe statements. table 1summary of suggestions for ics / iuga abstracts of clinical trialsabstract sectionitems to includetitleidentify the study design (e.g., randomised trial, prospective/ retrospective cohort, case control, cross - sectional study)hypothesis / aims of studyexplain the clinical or scientific uncertainties addressedgive the rationale for the designgive a clear statement of the main objectivestudy design, materials and methodsdetail major eligibility criteria for participantsindicate the setting for the study (without breaching anonymity)give the periods of recruitment and follow - upbriefly explain the intervention or exposurebriefly explain how and when outcomes were assessedgive details of efforts to address potential sources of bias (might include details of randomisation, blinding, validation of questionnaires or data sources, training of assessors, follow - up of non - responders, adjustment for confounding)explain the statistical analyses used, and how the sample size was determinedresultsgive the numbers of participants approached, the number recruited, and the number followed up at each timepointspecify if recruitment is ongoingbriefly give the major demographic characteristics of participantsgive a result for each outcome, with a measure of precision (standard deviation, 95% confidence intervals), and indicate the number of participants with missing datareport any harms or adverse eventsinterpretation of resultssummarise the main findingsrealistically assess the importance of the findings, taking into account the limitations of the study, including sources of potential bias or imprecisiongive explicit examples of the clinical or translational relevanceconcluding messageexplain how the study addressed the aimfor each group, where groups are compared summary of suggestions for ics / iuga abstracts of clinical trials for each group, where groups are compared providing abstracts follow the submission rules, they are unlikely to be rejected outright. formal guidance exists for almost all study designs and should help identify the kinds of information that need to be included in each section of the abstract. despite the tips and suggestions made here, podium time is at a premium, and there are no guarantees of acceptance for oral presentation. conversely questions from the floor may be a good indicator of the kinds of queries that will be raised in the peer review process. great abstracts can still make poor presentations, and there is a plethora of good advice for preparing slides [1517 ]. | introductionthis article aims to condense the lectures and discussions from workshops on good reporting at iuga como 2009 and ics san francisco 2009, providing practical advice for the novice researcher summarising their data for the first time.conclusionsdrafting an abstract can be a time consuming process. formal guidance, such as consort and strobe, exists for the kinds of information that should be included regarding almost all designs of clinical trials. follow the abstract submission rules closely to avoid outright rejection. plan to highlight the novelty, scientific merit and clinical impact of the work. try not to overstate the importance of the findings. do not forget to publish the work in a peer reviewed journal. |
developmental dental disorders may be due to abnormalities in the differentiation of the dental lamina and the tooth germs (anomalies in number, size and shape) or to abnormalities in the formation of the dental hard tissues (anomalies in structure). in some, both stages of differentiation are abnormal. developmental dental disorders are not only congenital but they may also be inherited, acquired or idiopathic. the terms double tooth, double formations, joined teeth, or fused teeth are often used to describe gemination and fusion, both of which are primary developmental abnormalities of the teeth.17 in the primary dentition, the frequency of gemination or fusion is about 2.5%. a survey of the literature has revealed prevalence estimates for bilateral double teeth ranging from 0.01 to 0.04% in the primary, and 0.05% in the permanent dentition.1,7 gemination is defined as an attempt to make two teeth from one enamel organ. this results in a structure with two completely or incompletely separated crowns with a single root and root canal. occasionally we see complete cleavage or twinning (two teeth from one enamel organ). the etiology is unknown, but trauma has been suggested as a possible cause, though a familial tendency has been suggested.8 gemination is observed in the deciduous as well as in the permanent dentition.3,4,7 in the anterior region, this anomaly can cause unpleasant esthetic appearance due to irregular morphology. if a deep groove is present, these teeth may be susceptible to caries and periodontal disease and may require endodontic intervention in some cases which may be complicated.1,2 gemination usually present asymptomatically. in fact, the co - operation of practitioners with expertise in multiple areas of dentistry is important to create or achieve functional and esthetic success in these cases. several treatment methods have been described in the literature with respect to the different types and morphological variations of fused teeth, including endodontic, restorative, surgical, periodontal and/or orthodontic treatment.1,2,4,911 in clinical situations, cases of fusion have the appearance of a congenitally missing tooth, while in gemination the number of teeth in the dentition is normal, provided the double tooth is counted as one unit.1,4 this paper reports aesthetic rehabilitation of a rare case ; bilateral gemination of permanent maxillary central incisors utilizing heat - pressed lithium disilicate all ceramic crowns. the patient complained about the large, unsightly maxillary central incisors, lip irritation and incising problems. the patient did not complain of previous painful symptoms in that region and his medical and dental histories were unremarkable. clinical examination revealed the presence of an irregular bilateral morphology of the permanent maxillary central incisors. the maxillary dental arch presented two large central incisors that were abnormally wide and bifid crowns. the incisors showed a buccal and palatal groove from the incisal edge to the cervical portion of the tooth. an initial caries lesion was noted on the labial groove of the right incisor, along with gross plaque accumulation (figure 1). the left central incisor was caries - free, as were all other erupted teeth had no restoration in the panoramic radiographic examination but only first molars had proximal caries which are restored before the prosthetic treatment procedure (figure 3). left and right maxillary central incisors were found to be free from periodontal disease. treatment plans for the patient included all ceramic crowns for the upper incisors and canines. after administering local anesthesia, preparations were made in the incisal, buccal, mesial, distal and palatinal surface of each of the clinical crowns in left and right maxillary central incisors, laterals and canines (figure 4). anatomic preparations were conducted, especially in the distal portions of the maxillary central incisors wider preparations carried out in order to eliminate the amorphous shape of the maxillary central incisors. the impressions of the prepared teeth were obtained utilizing polyether based elastomeric impression material (impregum penta h, duosoft grant l, duosoft, 3 m espe, germany) after casting the model, all ceramic cores manufactured utilizing heat - press ceramic technique (ips empress 2, ivoclar, schaan, liechtenstein) with # 100 lithium disilicate ceramic ingots. after the heat - press procedure completed ceramic cores were ready for try in procedures (figure 5). final restoration conducted by layering technique (empress 2 dentine ivoclar, schaan, liechtenstein). all ceramic crowns were bonded to the prepared abutments using dual cure composite resin luting cement (rely - x arc, 3m - espe, germany). these fixed restoration treatment resulted in marked improvement in the esthetics of the anterior region and also enhanced periodontal health (figure 6). the patient was encouraged to practice strict oral hygiene. after a 3-month period, the patient returned for evaluation. at the 1-year recall appointment, the terminology dental fusion and gemination are used to define two different morphological dental anomalies, characterized by the formation of a clinically wide tooth. despite the considerable number of cases reported in the literature, case history and clinical and radiographic examinations can provide the information required for the diagnosis of such abnormalities.1,36,12 after a judicious evaluation of all information we can report that this case represents bilateral gemination of maxillary incisors. while the literature on the occurrence of double teeth is extensive, there is still much discussion concerning the nomenclature. some authors have tried to differentiate them by counting the teeth or by observing the root morphology : others use fusion and gemination as synonyms. finally, some authors simply call the phenomenon double teeth or connoted teeth to avoid confusion over terminology.9,10 the use of levitas classification to distinguish between cases of fusion and gemination is very practical.9 the differential diagnosis between fusion and gemination, based on the number of teeth present on the dental arch, is not, however, always possible.5 this is because nothing impairs the fusion between a normal and a supernumerary element while the contiguous normal tooth is congenitally absent, resembling clinical cases of gemination.5,6 the phenomenon of gemination arises when two teeth develop from one tooth bud and, as a result, the patient has a larger tooth but a normal number, in contrast to fusion where the patient would appear to be missing one tooth.3,4,6,7 fused teeth arise through union of two normally separated tooth germs, and depending upon the stage of development of the teeth at the time of union, it may be either complete or incomplete. however, fusion can also be the union of a normal tooth bud to a supernumerary tooth germ. in these cases, the number of teeth is also normal and differentiation from gemination may be very difficult, if not impossible. in geminated teeth, division is usually incomplete and results in a large tooth crown that has a single root and a single canal.1,3,5 this anatomic irregularity occurs more often in the deciduous than in the permanent dentition. only a few cases of fusion involving molar and premolar teeth have been reported whereas, in both dentitions, the prevalence is higher in the anterior region.3,4,6,8,9 cases of bilateral fusion are less frequent than unilateral fusion. the anomaly can cause unpleasant esthetic appearance due to irregular morphology. when deep grooves are present, these teeth may be susceptible to caries and periodontal disease and may require endodontic intervention in some cases which may be complicated.3,4,12,13 the main periodontal complication in gemination cases occurs due to the presence of fissures or grooves in the union between the teeth involved. if these defects are very deep and extend subgin - givally, the possibility of bacterial plaque accumulation in this area is quite high. furthermore, gemination may have an adverse effect on occlusion, causing deviation and, sometimes, delaying the eruption of other teeth with aesthetic problems resulting from tooth.2 in this case, despite of the buccal grooves in the maxillary centrals no serious periodontal disease was evident. the double teeth in the cases studied were mostly unilateral, involving two adjacent teeth. no difference was found in the proportion of double teeth in either the maxilla or mandible.1,2,6 in this case bilateral gemination was seen in maxilla which caused esthetic problems. difficult cases include a wide spectrum of problems.912 the best way to manage these difficult cases depends on a number of factors including the knowledge and technical skills of the practitioner.1,913 in this case, restoration of all the six maxillary anterior teeth was preferred due to the wide and amorphous shape of maxillary central incisors. for esthetic satisfaction, wideness of these teeth was divided and distributed and was shared among the lateral incisors and the canines. | geminated teeth are the consequences of developmental anomalies leading to the eruption of joined elements. according to current definitions, gemination occurs when one tooth bud tries to divide, while fusion occurs if two buds unite. clinical experience shows, however that diagnosis can be complicated due to superimposed anomalies. this report describes a unique case of bilateral gemination of permanent maxillary central incisors. the esthetic rehabilitation of the geminated incisors accomplished utilizing all ceramic crowns. it is important that in these types of cases, reaching to the available esthetics and avoiding the complication of caries and periodontal problems with prosthetic application is satisfactory. |
absorption, distribution, metabolism, and elimination (adme) studies in drug discovery have always played a critical role in optimizing the drug - like properties of new chemical entities (nce) and increased their probability of success in subsequent stages of the drug discovery process. in order to provide this valuable information in a timely manner, adme assays have had to conform to high throughput formats, whenever possible, to keep pace with the blazing speed of high throughput medicinal chemistry (htmc). the inherent nature of htmc allows medicinal chemists to synthesize large numbers of nces that are then transferred to the discovery drug metabolism and pharmacokinetics (dmpk) groups to be evaluated for this high volume presents a challenge to discovery dmpk scientists with regard to speed of data turnaround time while maintaining quality and cost. a reasonable discovery adme flowchart employs more facile, actionable, and less expensive assays at the top. such assays should be designed to weed out the inferior compounds as soon as possible while minimizing the rates of false negatives. the first and foremost adme screen that an nce is typically subjected to is the metabolic stability screen. metabolic stability is defined as the percentage of parent compound lost over time in the presence of a metabolically active test system. generally, the concept of in vitro metabolic stability derives its importance from its power to predict liver metabolic clearance in vivo. by understanding the metabolic stability of compounds early in discovery high throughput assays to evaluate metabolic stability provide crucial data to discovery project teams and assist in developing structure - activity relationships (sar). metabolic stability further receives a great deal of attention in early drug discovery for the simple fact that oral dosing is by far the preferred route of administration. when a compound is administered orally, it is subjected to first - pass metabolic effect in enterocytes and more significantly in hepatocytes before it reaches the systemic circulation and eventually its target organ. high throughput in vitro screens for drug metabolism are very effective in guiding lead optimization and preventing selection of candidates with unfavorable properties. the advantage of using these screens include : (1) they allow testing of large quantities of compounds early in drug discovery before conducting animal testing, (2) they are amenable to high throughput screening and automation, and (3) human cells or cell constituents can be used, increasing the relevance to man. according to data collected by pubmed, the total number of publications per year categorized into the in vitro drug metabolism category increased from 10,641 in the year 2000 to 17,212 in the year 2013. however, there still remains a lack of consensus within the industry on the best representative system to use for in vitro drug metabolism screening studies. several systems are currently in use including, recombinant enzymes, liver microsomes (lm), liver s9 fractions, and hepatocytes. each of these systems have their pros and cons, however it is important to select a system that adequately represents both phase i and phase ii metabolic enzymes, offers low cost, ease of use and storage, and is amenable to high throughput screening. liver s9 fractions (the 9000 g supernatent of a liver homogenate) are not only easily obtained during the early stages of liver microsomal preparation [4, 5 ], but they also contain both microsomal and cytosolic fractions that can provide more metabolic information than microsomes alone. homogenization and differential centrifugation of liver tissue enables the concentrated source of enzymes available in the s9 fraction (fig. 1). unlike liver microsomes, which contain only the endoplasmic reticulum subcellular fraction (containing most notably cytochrome p450 s or cyps and uridine 5'-diphospho - glucuronosyltransferase ; ugts), the s9 fractions further contain the cytosolic enzymes such as aldehyde oxidase, xanthine oxidase, sulfotransferases, methyltransferases, n - acetyl transferases and glutathione transferases, which have gained appreciation as major contributors for metabolism of certain chemotypes. the s9 data set is therefore richer in content and provides medicinal chemists with an opportunity to stabilize compounds against both phase i and ii simultaneously. however, this can simply be overcome by adjusting protein levels as presented in this work. unlike hepatocytes, they do require exogenous cofactors such as -nicotinamide adenine dinucleotide phosphate - regenerating system (nadph ; phase i oxidation), uridine 5-diphospho--d - glucuronic acid (udpga ; phase ii glucuronidation), glutathione (gsh ; phase ii), and 3-phosphoadenosine-5-phosphosulphate (paps ; phase ii sulfation) for activity, however they have a significant price benefit, are easy to store and use, and are much more amenable to high throughput screening. furthermore, they do not add an additional layer of complexity (permeability across the hepatocyte cell membrane to gain access to the metabolizing enzymes) and can also be easily used in mechanistic studies with inhibitors. the disadvantages, consistent with any cell - free system, include the potential inactivation or lack of some enzymes during preparations, like flavin - monoxygenases (fmo s), loss of cellular compartmentalization and the need for cofactors to be added during incubation. 7-ethoxycoumarin (7-ec) is metabolized by many cytochrome p450 enzymes and has been used as a prototypic substrate to monitor p450 activity in both hepatic and extrahepatic tissue and can be used as a measure of catalytic activity. the human s9 pools are derived from large numbers of donors with a range of protein concentrations (20 - 30 mg / ml protein content) and with a range of catalytic 7-ethoxycoumarin o - deethylase (ecod) activity (55 - 105 pmol / mg protein / min). these values correlated well with functional p450 activities and those reported in primary cultures of human hepatocytes obtained from liver samples. this is generally referred to as ecod enzyme characterization and can be used to compare lots of s9 fractions in human and most animal species. for about a decade, we have utilized the liver s9 system as our primary in vitro screen to weed out compounds with poor metabolic stability and poor probability of success. in order to further solidify the selection of liver s9 fractions as our system of choice for metabolic stability evaluations, we conducted a retrospective analysis comparing the results from our liver s9 assay to our hepaotocyte assay (the gold standard in representing the in vivo conditions). in addition, for comparison purposes we also calculated in vitro half lives for a subset of compounds using the liver microsomal metabolic stability assay (t1/2) a staple in the phar- maceutical industry. our results demonstrated that liver s9, using our methodology, was a robust in vitro system that provides the same quality of data as hepatocytes but does so in a much more efficient, high throughput, and cost - effective manner. furthermore, the microsomal timecourse assay (t1/2) did not offer any selection advantage over the s9 assay for the compounds tested. also, microsomes were not informative to the medicinal chemists as to the nature of biotransformation and multitude of softspots prone to phase ii metabolism during sar. cryopreserved rat hepatocytes (sprague dawley ; male ; pooled) and human hepatocytes (20-donor & gender pooled) were purchased from bioreclamationivt (baltimore, md., usa). hepatocyte incubations were performed in krebs - henseleit buffer (khb ; sigma aldrich ; cat # k3753), ph 7.4 with 1x10 hepatocytes / ml (viability > 80%), in triplicate for each species, and substrate concentration of 3 m. the incubations were carried out in a 37c, 5% co2 incubator for one hour. cryopreserved hepatocytes were quickly thawed in a 37c water bath and then added to conical tubes containing warm hepatocyte thawing medium. tubes were gently inverted to produce a homogeneous cell suspension before being centrifuged at 60 g for five minutes at room temperature. the reactions were stopped at 0 and 60 minutes with the addition of two volumes of ice cold 50:50 acetonitrile : methanol (acn : meoh). the supernatants were analyzed by liquid chromatography - tandem mass spectrometry (lc - ms / ms) for the amount of parent compound remaining. both human (gender pooled, 10 individuals) and rat (sprague dawley ; male ; pooled) liver s9 fractions were purchased from bd biosciences (san jose, ca., usa)., that several phase i and phase ii enzymes retain their activity, when stored at -70c for up to 10 years and up to 10 freeze / thaw cycles. furthermore, our internal data from several different s9 lots has also demonstrated comparable phase i and phase ii activities (as evaluated using 7-ec as a control) for the lifetime of the lot. the incubation conditions were developed by using four commercial compounds, 7-ec, diclofenac, 4-nitrocatecal, and phenolphthalein with known metabolic profiles (both phase i and ii metabolism). the rat and human s9 protein concentration and the cofactor concentrations were optimized to match the results of hepatocyte stability, quantitatively. the phase i and phase ii metabolites ; 7-hydroxycoumarin (7-hc), 7-hc sulfate, 7-hc glucuronide, 4-hydroxydiclofenac (4-hd), 4-hd glucuronide, diclofenac acyl glucuronide, 4-nitrocatechol sulfate (4-nc sulfate), and phenolphthalein glucuronide were also monitored. the identity of each of the metabolites was assessed by comparison of their retention time and mass spectra with those of authentic standards. each new lot of s9 goes through this optimization process before being used for high throughput compound screening in the discovery dmpk flowchart. a cocktail of four activating cofactors was used in order to stimulate phase i (nadph), and phase ii (udpga, paps, gsh) metabolism. the final concentrations of nadph, udpga, and gsh were 1, 0.5 and 2.5 mm, respectively while that of paps was 0.05 mg / ml. tris buffer was prepared as a 200 mm solution containing 2 mm magnesium chloride (included mgcl2 as a source for mg ions to stimulate cyp activity) in deionized water and adjusted with 1 m naoh to ph 7.4. stock reference solutions (7-ec as the positive control) and test compounds were prepared at 5 mm concentration in dmso, and then diluted to 0.3 mm with acn prior to use. nadph, udpga, and gsh solutions were prepared at 40, 20 and 2 mm, respectively while paps was prepared at 2 mg / ml, all in tris buffer prior to mixing together in a 1:1:1:1 ratio for use. s9 s were preincubated with test compound for 5 minutes at 37c in tris buffer, ph 7.4, and then the reactions were initiated by adding the cofactor mixture. at two time points, zero and sixty minutes, aliquots of the sample mixture were removed and quenched by addition of two volumes of ice cold 50:50 acn : meoh. the plate of quenched samples was then centrifuged at 4000 g for 10 minutes to sediment the precipitated proteins before injection onto lc - ms / ms for analysis of parent compound remaining. percent of the parent compound remaining is calculated by comparing peak areas. both human (gender pooled, 10 individuals) and rat (sprague dawley ; male ; pooled) liver microsomes were purchased from bd biosciences (san jose ca. the incubation mixtures were prepared in 96-well plates and contained 3 m test compound, rat or human liver microsomes at 0.5 mg of microsomal protein / ml, 2 mm mgcl2, and 200 mm tris buffer, ph 7.4, in a final volume of 500 l. reactions were initiated by the addition of nadph (final concentration of 1 mm), and the plates were kept in a dubnoff shaking water bath at 37c. immediately after the addition of nadph, a t = 0 aliquot (100 l) was withdrawn and further samples were withdrawn at 10, 20, 40, and 60 minutes. at each timepoint, the reactions were immediately terminated by adding 200 l of ice cold acn : meoh. the samples were centrifuged for 10 minutes at 4000 g to pellet the precipitated microsomal protein, and the supernatant was analyzed via lc - ms / ms. using the t = 0 peak area as 100% the percentage remaining was calculated. for each compound, the log percentage remaining versus incubation time was plotted and the slope of this linear regression (-k) was converted to an in vitro t1/2 value using the equation listed below. a ready - to - use cell culture system that provides a 21-day cell barrier in integrated hts transwell-24 plates purchased from admecell was used for the caco-2 assay. polarized cultures of caco-2 cells were provided on polycarbonate micro - porous filters in hts transwell plates (6.5 mm diameter, 0.33 cm area and 0.4 m pore diameter). the transport medium used for the permeability studies was hank s balanced salt solution (hbss ; invitrogen ; cat # 14185052) buffer containing 1.1 mm magnesium chloride, 1.3 mm calcium chloride and 5 mm d - glucose. the concentration of test compound in this assay was 10 m and all measurements were performed in duplicate. lucifer yellow served as a quality control check for monolayer integrity of all wells and three control compounds were run with each assay (atenolol, propranolol, and vinblastine). studies were initiated by adding an appropriate volume of buffer containing test compound to either the apical or basolateral side of the monolayer. the monolayers were placed into a standard cell culture incubator (5% co2, 37c) for two hours. samples were taken from both the apical and basolateral compartments at the end of the two hour incubation and compound concentration was analyzed by lc - ms / ms. permeability of compounds was determined as the coefficient of apparent permeability (papp, measured in cm / s) calculated according to the following formula : papp = dq/ (dtac0), where dq / dt is the amount of compound present in the receiver compartment as a function of time ; a is the area of the transwell (cm) ; and c0 is the initial concentration of compound applied in the donor compartment. diluted supernatants from the stability assays were injected onto a c18 ultra high performance liquid chromatography (uplc) column, and test compounds and control were eluted using a generic reverse - phase uplc method. acetonitrile with 0.1% formic acid (organic) and water with 0.1% formic acid (aqueous) were used as the typical mobile phases, where separation was achieved using a gradient from 5% organic to 90% aqeuous. the test compounds and controls were quantified on either a ab sciex 4000 qtrap lc - ms / ms system or a thermo scientific tsq quantum ultra triple quadrupole mass spectrometer by multiple reaction monitoring (mrm) in positive ion electrospray mode using predetermined parent / product mass transition ion pairs. the amount of test compound observed at sixty minutes was divided by that observed in the zero minute sample, and this value was converted to a percentage and reported as cryopreserved rat hepatocytes (sprague dawley ; male ; pooled) and human hepatocytes (20-donor & gender pooled) were purchased from bioreclamationivt (baltimore, md., usa). hepatocyte incubations were performed in krebs - henseleit buffer (khb ; sigma aldrich ; cat # k3753), ph 7.4 with 1x10 hepatocytes / ml (viability > 80%), in triplicate for each species, and substrate concentration of 3 m. the incubations were carried out in a 37c, 5% co2 incubator for one hour. cryopreserved hepatocytes were quickly thawed in a 37c water bath and then added to conical tubes containing warm hepatocyte thawing medium. tubes were gently inverted to produce a homogeneous cell suspension before being centrifuged at 60 g for five minutes at room temperature. the reactions were stopped at 0 and 60 minutes with the addition of two volumes of ice cold 50:50 acetonitrile : methanol (acn : meoh). the supernatants were analyzed by liquid chromatography - tandem mass spectrometry (lc - ms / ms) for the amount of parent compound remaining. both human (gender pooled, 10 individuals) and rat (sprague dawley ; male ; pooled) liver s9 fractions were purchased from bd biosciences (san jose, ca., that several phase i and phase ii enzymes retain their activity, when stored at -70c for up to 10 years and up to 10 freeze / thaw cycles. furthermore, our internal data from several different s9 lots has also demonstrated comparable phase i and phase ii activities (as evaluated using 7-ec as a control) for the lifetime of the lot. the incubation conditions were developed by using four commercial compounds, 7-ec, diclofenac, 4-nitrocatecal, and phenolphthalein with known metabolic profiles (both phase i and ii metabolism). the rat and human s9 protein concentration and the cofactor concentrations were optimized to match the results of hepatocyte stability, quantitatively. the phase i and phase ii metabolites ; 7-hydroxycoumarin (7-hc), 7-hc sulfate, 7-hc glucuronide, 4-hydroxydiclofenac (4-hd), 4-hd glucuronide, diclofenac acyl glucuronide, 4-nitrocatechol sulfate (4-nc sulfate), and phenolphthalein glucuronide were also monitored. the identity of each of the metabolites was assessed by comparison of their retention time and mass spectra with those of authentic standards. each new lot of s9 goes through this optimization process before being used for high throughput compound screening in the discovery dmpk flowchart. a cocktail of four activating cofactors was used in order to stimulate phase i (nadph), and phase ii (udpga, paps, gsh) metabolism. the final concentrations of nadph, udpga, and gsh were 1, 0.5 and 2.5 mm, respectively while that of paps was 0.05 mg / ml. tris buffer was prepared as a 200 mm solution containing 2 mm magnesium chloride (included mgcl2 as a source for mg ions to stimulate cyp activity) in deionized water and adjusted with 1 m naoh to ph 7.4. stock reference solutions (7-ec as the positive control) and test compounds were prepared at 5 mm concentration in dmso, and then diluted to 0.3 mm with acn prior to use. nadph, udpga, and gsh solutions were prepared at 40, 20 and 2 mm, respectively while paps was prepared at 2 mg / ml, all in tris buffer prior to mixing together in a 1:1:1:1 ratio for use. s9 s were preincubated with test compound for 5 minutes at 37c in tris buffer, ph 7.4, and then the reactions were initiated by adding the cofactor mixture. at two time points, zero and sixty minutes, aliquots of the sample mixture were removed and quenched by addition of two volumes of ice cold 50:50 acn : meoh. the plate of quenched samples was then centrifuged at 4000 g for 10 minutes to sediment the precipitated proteins before injection onto lc - ms / ms for analysis of parent compound remaining. both human (gender pooled, 10 individuals) and rat (sprague dawley ; male ; pooled) liver microsomes were purchased from bd biosciences (san jose ca., usa). the incubation mixtures were prepared in 96-well plates and contained 3 m test compound, rat or human liver microsomes at 0.5 mg of microsomal protein / ml, 2 mm mgcl2, and 200 mm tris buffer, ph 7.4, in a final volume of 500 l. reactions were initiated by the addition of nadph (final concentration of 1 mm), and the plates were kept in a dubnoff shaking water bath at 37c. immediately after the addition of nadph, a t = 0 aliquot (100 l) was withdrawn and further samples were withdrawn at 10, 20, 40, and 60 minutes. at each timepoint, the reactions were immediately terminated by adding 200 l of ice cold acn : meoh. the samples were centrifuged for 10 minutes at 4000 g to pellet the precipitated microsomal protein, and the supernatant was analyzed via lc - ms / ms. using the t = 0 peak area as 100% the percentage remaining was calculated. for each compound, the log percentage remaining versus incubation time was plotted and the slope of this linear regression (-k) was converted to an in vitro t1/2 value using the equation listed below. a ready - to - use cell culture system that provides a 21-day cell barrier in integrated hts transwell-24 plates purchased from admecell was used for the caco-2 assay. polarized cultures of caco-2 cells were provided on polycarbonate micro - porous filters in hts transwell plates (6.5 mm diameter, 0.33 cm area and 0.4 m pore diameter). the transport medium used for the permeability studies was hank s balanced salt solution (hbss ; invitrogen ; cat # 14185052) buffer containing 1.1 mm magnesium chloride, 1.3 mm calcium chloride and 5 mm d - glucose. the concentration of test compound in this assay was 10 m and all measurements were performed in duplicate. lucifer yellow served as a quality control check for monolayer integrity of all wells and three control compounds were run with each assay (atenolol, propranolol, and vinblastine). studies were initiated by adding an appropriate volume of buffer containing test compound to either the apical or basolateral side of the monolayer. the monolayers were placed into a standard cell culture incubator (5% co2, 37c) for two hours. samples were taken from both the apical and basolateral compartments at the end of the two hour incubation and compound concentration was analyzed by lc - ms / ms. permeability of compounds was determined as the coefficient of apparent permeability (papp, measured in cm / s) calculated according to the following formula : papp = dq/ (dtac0), where dq / dt is the amount of compound present in the receiver compartment as a function of time ; a is the area of the transwell (cm) ; and c0 is the initial concentration of compound applied in the donor compartment. diluted supernatants from the stability assays were injected onto a c18 ultra high performance liquid chromatography (uplc) column, and test compounds and control were eluted using a generic reverse - phase uplc method. acetonitrile with 0.1% formic acid (organic) and water with 0.1% formic acid (aqueous) were used as the typical mobile phases, where separation was achieved using a gradient from 5% organic to 90% aqeuous. the test compounds and controls were quantified on either a ab sciex 4000 qtrap lc - ms / ms system or a thermo scientific tsq quantum ultra triple quadrupole mass spectrometer by multiple reaction monitoring (mrm) in positive ion electrospray mode using predetermined parent / product mass transition ion pairs. the amount of test compound observed at sixty minutes was divided by that observed in the zero minute sample, and this value was converted to a percentage and reported as since hepatocytes are considered the gold standard and the most physiologically relevant system, we thought it would be more informative to compare the two in vitro systems in question (microsomes and s9) to the gold standard to evaluate which one represents hepatocytes better. comparing microsomes to s9, in our opinion, will not provide any meaningful conclusions as to which system is more similar to hepatocytes. in addition, a graph of s9 data vs microsome data will lack a reference / anchor point to define what is an acceptable value. graphing the two assay results individually against hepatocyte data (gold standard) provides the hepatocyte results as the anchor which the other 2 systems are supposed to emulate. we conducted a head - to - head comparison of the rat and human s9 stability results to the corresponding hepaotocyte stability (the gold standard) results for a test set of 456 internal compounds from several different chemical templates. in doing so 70% remaining at 60 minutes criteria post - incubation as listed in our prior publication. compounds with 70% parent remaining at 60 minutes were labeled as pass and the remaining were labeled as about 70% of cases, the rat s9 and hepatocyte data were in agreement both assays binned the compound in the same category. the compounds that passed s9 but failed in the hepatocyte assay amounted to 11% in rat and 5% in human. on the other hand, the compounds that failed s9 but passed in the hepatocyte assay amounted to 20% in rat and 11% in human. this argues that hepatocytes are significantly more permissive than s9 fractions in allowing compounds to progress into animal studies. upon further investigation, it was determined that one reason for such high rate of acceptance by hepatocytes may have been the poor permeability exhibited by these compounds. poor permeability would potentially lead to higher apparent rates of stability in hepatocytes, owing to their inability to enter the hepatocytes to be exposed to the metabolic enzymes. indeed, we found that 75% of compounds that fell into this category and had caco-2 data, exhibited poor permeability according to the permeability criteria that we have published previously (papp < 8 x 10 cm / s). excluding such compounds from the analysis, the discrepancy between s9 and hepatocyte acceptance rate dropped to 13% in the rat (from 20%) and 7% in the human s9 (from 11%). while one might view the fact that s9 fractions are more prohibitive than hepatocytes in allowing advancement of such compounds, some of the anxiety about this will be off - set by allowing the more promising compounds, as judged by potency and selectivity, to advance into in - vivo studies on a case - by - case basis to ensure that highly desirable compounds are given a fair chance in the drug discovery process. a similar analysis was carried out comparing the liver microsomal assay data (t1/2) and the hepatocyte stability data for a subset of randomly selected compounds (n = 22). we conducted 60 minute time course experiments for these compounds using liver microsomes and binned them based on a 30 minute cut - off criteria (fig. 3). compounds with in vitro microsomal half lives < 30 min were binned as unstable and those with in vitro microsomal half lives 30 min were binned as stable. about 82% of cases, the rat liver microsomes and hepatocyte data were in agreement both assays binned the compounds in the same categories. these percentages were quite similar to those seen in the s9 vs hepatocyte comparison in these two species, arguing that both systems are equally efficient in binning compounds. however, the metabolic profiles obtained with liver microsomes may not be an accurate representation of the metabolism encountered in hepatocytes or in vivo because, as mentioned earlier, s9 fractions account for phase i and phase ii metabolism whereas liver microsomes account only for phase i. we have come across many examples in our laboratory where phase ii conjugations were the predominant metabolic pathway for compounds (structural data not shown). this would have been completely missed if we had used liver microsomes. by using s9 fractions, medicinal chemists were able to optimize compounds against both phase i and phase ii metabolic soft spots. another significant benefit lies in the fact that instead of conducting the entire time course with microsomes (5 timepoints ; an extensively used high throughput assay in the pharmaceutical industry), we reached the same conclusions regarding stability using only 2 timepoints (t = 0 and 60 min) with the s9 fractions. this constitutes a significant saving of time and resources (materials, mass spectrometer time, etc.) when one screens 100 s of compounds per week. next, we analyzed the relevance of s9 fraction and hepatocyte stability assays to in vivo plasma clearance prediction. we have previously reported on our in vivo cut - off criteria in the dmpk workflow. herein, we carried out a retrospective analysis for rat hepaotocyte stability versus rat plasma clearance (fig. 4). using a cut - off value of 70% remaining at 60 minutes for rat hepatocyte stability, the true rate (45% ; true positives + true negatives) was almost identical to what we had seen previously with the rat s9 (43%). the false positive rate (compounds that are stable in the in vitro screen but have rapid plasma clearance) was higher with rat s9 (51%) when compared to rat hepatocytes (41%). however, the false negative rate (compounds that appear unstable in the in vitro screen but in reality have acceptable plasma clearance values) was lower with the rat s9 system (6%) compared to the hepaotocyte system (14%). this suggested that both systems performed equally well when predicting the true rate and even though the s9 system put a slight strain on the resources (due to higher false positives) it prevented a significant number of good compounds from being discarded. a qualitative analysis was performed for comparison of metabolites generated from rat and human hepatocytes versus s9 fractions. under the optimized s9 assay conditions the metabolite profiles (both phase i and ii) for the four commercial control compounds were consistent with the metabolite profiles generated by the hepatocyte system for both species (rat and human). using 7-ec as an example, in the time zero samples only 7-ec is present, however for the 60 minute samples we detected the three expected metabolites of 7-ec, 7-hc, 7-hc glucuronide, and 7-hc sulfate. data for 7-ec and its phase i and phase ii metabolites are shown in (table 1) and (fig. 5). lastly, we did a cost - benefit analysis of the s9 versus the hepaotocyte stability assays. not surprisingly, the rat hepaotocyte assay turned out to be 5-fold more expensive compared to the rat s9 assay. in human, the difference was even more pronounced with the human hepatocyte assay costing 21-fold more when compared to the human s9 assay. of course, hepatocyte assays tend to have slower turnaround time, which is costly to discovery project timelines. combined together, the s9 assays can be performed at a 15-fold savings when compared to the corresponding hepatocyte assays without compromising on the data quality while significantly improving the throughput and efficiency. discovery flow charts utilize effective and decision - making screens with appropriate acceptance criteria for rapid progression of compounds with drug - like properties. a rapid, high throughput and comprehensive metabolic stability screen at the top of a discovery flow chart historically liver microsomes and hepatocytes have been employed as metabolic stability screens but these have their limitations. microsomes have a limited enzymatic make - up whereas hepatocytes are cost - prohibitive, labor extensive and not highly amenable to automation. liver s9 addresses drawbacks associated with microsomes and hepatocytes and offers a more appropriate screening tool. our analysis demonstrates that liver s9 is a robust in vitro system that provides the same quality of data as hepatocytes, the gold standard, and does so in a much more efficient and cost - effective manner. replacing liver microsomal and/or hepatocyte stability assay in discovery dmpk with high throughput liver s9 assay provides a more comprehensive data set, adds to the quality and prevents the high cost of using hepatocytes in drug discovery. we have implemented this s9 assay at the top of our discovery dmpk workflow and it has enabled us to ramp up our metabolic screening throughput greatly without excessively impacting our budget and compromising the data quality. the authors have no conflict of interest and no payment has been received in the preparation of this manuscript. | background : a rapid and comprehensive metabolic stability screen at the top of a drug discovery flow chart serves as an effective gate in eliminating low value compounds. this imparts a significant level of efficiency and saves valuable resources. while microsomes are amenable to high throughput automation and are cost effective, their enzymatic make - up is limited to that which is contained in endoplasmic reticulum, thereby informing only on phase i metabolism. lack of phase ii metabolism data can become a potential liability later in the process, adversely affecting discovery projects timelines and budget. hepatocytes offer a full complement of metabolic enzymes and retain their cellular compartments, better representing liver metabolic function. however, hepatocyte screens are relatively expensive, labor intensive, and not easily automatable. liver s9 fractions include phase i and ii metabolic enzymes, are relatively inexpensive, easy to use, and amenable to automation, making them a more appropriate screening system. we compare the data from the three systems and present the results.results : liver s9 and hepatocyte stability assays binned into the same category 70 - 84% of the time. microsome and hepatocyte data were in agreement 73 - 82% of the time. the true rate for stability versus plasma clearance was 45% for hepatocytes and 43% for s9.conclusion : in our opinion, replacing liver microsome and hepatocyte assays with s9 assay for high throughput metabolic screening purposes provides the combined benefit of comprehensive and high quality data at a reasonable expense for drug discovery programs. |
there is a growing interest in using propofol for sedation in endoscopic procedures.14 propofol is commonly used as an anesthetic agent in endoscopic retrograde cholangiopancreatography (ercp). it is a fast - acting drug with a short half - life that results in rapid recovery. it also has a favorable pharmacokinetic profile suitable for the induction and maintenance of intravenous anesthesia. many previous studies have reported that a slower rate of propofol administration for anesthesia results in smaller dose requirements.5,6 hypotension seen during induction is observed to be attenuated by the use of titrated propofol.7 however, level of consciousness can not be reliably judged by somatic or hemodynamic response alone. because depth of sedation can not be reliably judged by clinical assessments alone, a reliable method is needed to measure the hypnotic component of sedation and anesthesia. recently, processed electroencephalography (eeg) variables such as the spectral edge frequency, bispectral index (bis), and narcotrend (monitor technik, hannover medical school, germany) were developed to ease eeg interpretation. these tools have been reported to be more precise in the measurement of sedation level.810 the narcotrend performs a computerized analysis of the raw eeg. the narcotrend has two recording modes : the one - channel mode as the standard for the assessment of the depth of hypnosis during anesthesia and sedation, and the two - channel mode for comparison of signals from the two hemispheres of the brain. after accounting for artifact, a multivariate statistical algorithm is used for analysis, which results in a six - stage classification from a (awake) to f (general anesthesia / coma) and 14 substages.11 in the current version, the narcotrend eeg classification has 15 substages, as described in table 1. in our previous study, we showed that dose requirement and sedation - related complications using diluted propofol for sedation in patients undergoing ercp were significantly less than when using undiluted propofol. however, patients in that study were sedated using only clinical assessment.6 therefore, our aim of this study was to determine and compare the clinical efficacy of propofol deep sedation using either clinical assessment or the narcotrend index as a guide for depth of sedation in patients undergoing ercp. a total of 176 consecutive patients from a tertiary care teaching hospital, siriraj hospital, bangkok, thailand, were eligible for the study. exclusion criteria included any clinical evidence of severe liver disease, and patients who had american society of anesthesiologists (asa) physical status iv or v. this present study was approved by the institutional review board of the faculty of medicine siriraj hospital. all the enrolled patients provided written informed consent to undergo the procedures and to participate in the study. the primary outcome variable of the study was the successful completion of the endoscopic procedure. the secondary outcome variables were the total dose of propofol used during the procedure, recovery time, patient tolerance and satisfaction, endoscopist satisfaction, and complications during and immediately after procedure. the amount of propofol used was compared as total dose, dose / kg, or dose / kg / h. recovery time was defined as the time after the end of procedure to patient awakening., 52 patients were sedated using clinical assessment with depth of sedation assessed with the use of the modified observer s assessment of alertness/ sedation (moaa / s) scale.12 in group n, 48 sedated patients were sedated using the narcotrend system. the anesthetic personnel who sedated the patients relied exclusively on the narcotrend index in determining the propofol dose given to the patients. however, patient observation might have played a role in the decision making if the patient was clinically sedated inadequately. however, all patients in both groups were monitored with the narcotrend system, but the patients in group c were not sedated using the narcotrend. additionally, the anesthetic personnel who sedated the patients in group c did not see the narcotrend index. the procedure was carried out using an olympus video duodenoscope (tjf 160 r, olympus corporation, tokyo, japan). the endoscopists were three staff endoscopists, who had more than 10 years of ercp experience. the procedure was performed with the patient either in a prone or left lateral position. successful completion of the endoscopic procedure was defined as completion of the procedure as intended once the procedure had started, and completion of the procedure without changing anesthetic technique. all sedation was carried out by the anesthetic personnel, who were anesthetic nurses and second - year residents in the anesthesiology residency program, directly supervised by a staff anesthesiologist in the endoscopy room. each patient was monitored for blood pressure, heart rate, eeg, and oxygen saturation (spo2). the patients were sedated with 0.03 mg / kg of midazolam and 1 mcg / kg of fentanyl as well as propofol titrated according to the randomization procedure. all sedations were deep sedation, in accordance with guidelines of the asa.13 in group c, propofol was clinically titrated at 5-minute intervals using the moaa / s scale to assess depth of sedation. in group five minutes before the end of the procedure, continuous intravenous infusion of propofol was stopped. the total amounts of intravenous fluid including crystalloid solution and normal saline used in both groups were comparable. the moaa / s scale was used for clinical assessment of the depth of sedation in group c. the moaa / s score ranges from 1 to 5 (1 = unresponsive to shaking, 2 = responsive to shaking only, 3 = responsive to loud verbal command, 4 = lethargic but responsive to normal verbal command, and 5 = responsive and alert). in group c, the narcotrend system classification of depth of sedation is shown in table 1.14 in group n, sedation was maintained with the narcotrend system at index 4756 to 5764. if the depth of sedation was too light, a bolus dose of propofol (1020 mg) was administered until the target moaa / s scale or the narcotrend stage was reached. additionally, if the patient was sedated too deeply, an intravenous infusion of propofol was held. propofol used, including mean total dose, dose / kg, and dose / kg / h, was compared between the two groups. in addition, the recovery time of these two groups was also evaluated. the complications during and immediately after the ercp were recorded as follows : hypotension (decrease by 20% from baseline), hypertension (increase by 20% from baseline), bradycardia (decrease in heart rate by 20% from baseline), tachycardia (increase in heart rate by 20% from baseline), spo2 (< 90%), and upper airway obstruction. results were expressed as mean standard deviation (sd) or percentage (%) when appropriate. comparisons between clinical assessment and narcotrend system monitoring groups were compared using chi - square tests (for categorical variables), chi - square tests for trend (for ordinal variables), and two - sample independent t - tests (for continuous variables). the statistical software package spss for window version 11 (spss inc., chicago, il, usa) was used to analyze the data. a total of 176 consecutive patients from a tertiary care teaching hospital, siriraj hospital, bangkok, thailand, were eligible for the study. exclusion criteria included any clinical evidence of severe liver disease, and patients who had american society of anesthesiologists (asa) physical status iv or v. this present study was approved by the institutional review board of the faculty of medicine siriraj hospital. all the enrolled patients provided written informed consent to undergo the procedures and to participate in the study. the primary outcome variable of the study was the successful completion of the endoscopic procedure. the secondary outcome variables were the total dose of propofol used during the procedure, recovery time, patient tolerance and satisfaction, endoscopist satisfaction, and complications during and immediately after procedure. the amount of propofol used was compared as total dose, dose / kg, or dose / kg / h. recovery time was defined as the time after the end of procedure to patient awakening. all patients were randomized into two groups using sealed envelopes. in group c, 52 patients were sedated using clinical assessment with depth of sedation assessed with the use of the modified observer s assessment of alertness/ sedation (moaa / s) scale.12 in group n, 48 sedated patients were sedated using the narcotrend system. the anesthetic personnel who sedated the patients relied exclusively on the narcotrend index in determining the propofol dose given to the patients. however, patient observation might have played a role in the decision making if the patient was clinically sedated inadequately. however, all patients in both groups were monitored with the narcotrend system, but the patients in group c were not sedated using the narcotrend. additionally, the anesthetic personnel who sedated the patients in group c did not see the narcotrend index. the procedure was carried out using an olympus video duodenoscope (tjf 160 r, olympus corporation, tokyo, japan). the endoscopists were three staff endoscopists, who had more than 10 years of ercp experience. the procedure was performed with the patient either in a prone or left lateral position. successful completion of the endoscopic procedure was defined as completion of the procedure as intended once the procedure had started, and completion of the procedure without changing anesthetic technique. all sedation was carried out by the anesthetic personnel, who were anesthetic nurses and second - year residents in the anesthesiology residency program, directly supervised by a staff anesthesiologist in the endoscopy room. each patient was monitored for blood pressure, heart rate, eeg, and oxygen saturation (spo2). the patients were sedated with 0.03 mg / kg of midazolam and 1 mcg / kg of fentanyl as well as propofol titrated according to the randomization procedure. all sedations were deep sedation, in accordance with guidelines of the asa.13 in group c, propofol was clinically titrated at 5-minute intervals using the moaa / s scale to assess depth of sedation. in group five minutes before the end of the procedure, continuous intravenous infusion of propofol was stopped. the total amounts of intravenous fluid including crystalloid solution and normal saline used in both groups were comparable. the moaa / s scale was used for clinical assessment of the depth of sedation in group c. the moaa / s score ranges from 1 to 5 (1 = unresponsive to shaking, 2 = responsive to shaking only, 3 = responsive to loud verbal command, 4 = lethargic but responsive to normal verbal command, and 5 = responsive and alert). in group c, the narcotrend system classification of depth of sedation is shown in table 1.14 in group n, sedation was maintained with the narcotrend system at index 4756 to 5764. if the depth of sedation was too light, a bolus dose of propofol (1020 mg) was administered until the target moaa / s scale or the narcotrend stage was reached. additionally, if the patient was sedated too deeply, an intravenous infusion of propofol was held. propofol used, including mean total dose, dose / kg, and dose / kg / h, was compared between the two groups. in addition, the recovery time of these two groups was also evaluated. the complications during and immediately after the ercp were recorded as follows : hypotension (decrease by 20% from baseline), hypertension (increase by 20% from baseline), bradycardia (decrease in heart rate by 20% from baseline), tachycardia (increase in heart rate by 20% from baseline), spo2 (< 90%), and upper airway obstruction. results were expressed as mean standard deviation (sd) or percentage (%) when appropriate. comparisons between clinical assessment and narcotrend system monitoring groups were compared using chi - square tests (for categorical variables), chi - square tests for trend (for ordinal variables), and two - sample independent t - tests (for continuous variables). the statistical software package spss for window version 11 (spss inc., chicago, il, usa) was used to analyze the data. table 2 summarizes the clinical characteristics of all the patients (52 patients in group c ; 48 patients in group n). the mean ages in groups c and n were 58.1 (14.9) years and 60.1 (13.8) years, respectively. patients in both groups were similar with respect to patient age, sex, weight, height, asa physical status, preprocedure volume status, presedation problems, duration of procedure, and indications for ercp. table 3 shows the success rate, mean dose of propofol, recovery time, patient tolerance and satisfaction, and endoscopist satisfaction in the two groups. the total propofol dose in group c was significantly lower than in group n (p = 0.037). however, the mean dose / kg and dose / kg / h of propofol in both groups was not statistically significantly different (p = 0.497 and 0.136). the mean recovery time in the clinical assessment group was relatively shorter than in the narcotrend group (p = 0.241). patient tolerance and satisfaction as well as endoscopist satisfaction in both groups were not statistically significantly different (p = 0.951, 0.993, and 0.871, respectively). hemodynamic parameters, including systolic and diastolic blood pressure, heart rate, and spo2, are shown in table 4. mean systolic blood pressure throughout the study was not statistically different between the two groups except at scope insertion and 5 minutes after the scope insertion. additionally, mean diastolic blood pressure was not statistically different between the two groups except at scope insertion and 5, 10, and 15 minutes after scope insertion. furthermore, there were significant differences in heart rate at scope insertion and 5 and 20 minutes after scope insertion. overall sedation - related adverse events during and immediately after ercp in the clinical assessment group were significantly higher than in the narcotrend monitoring group (p = 0.028). moreover, cardiovascular and respiratory system - related adverse events in group c were relatively greater than those in group n (p = 0.275 and 0.062).. however, more hypotension was observed in group c compared with group n (p = 0.327, table 5). this present clinical study evaluated the clinical efficacy of propofol for deep sedation in ercp patients using clinical assessment compared with narcotrend system monitoring. our results demonstrated that clinical assessment and narcotrend system monitoring can be used successfully to provide deep sedation in patients undergoing ercp without serious adverse events. narcotrend system monitoring compared with clinical assessment monitoring with the moaa / s scale did not result in a reduction in drug dose requirements or recovery time. however, hemodynamic alteration in group c was significantly greater than that in group n. consequently, the use of the narcotrend system for monitoring significantly reduced sedation - related adverse events. eeg - based monitoring was first introduced with bis monitoring in 1996.15 the number shown on the monitor is processed from eeg and has been shown to correlate well with the level of sedation. previous studies had found a sufficient correlation between narcotrend and bis.1618 the correlation between the narcotrend stages and the respective narcotrend index ranges was described by kreuer,16 as shown in table 1. moderate or deep sedation is often used for patients undergoing ercp. in current practice, all sedation for ercp procedures is carried out using propofol by the anesthesiology team.19 clinical assessment alone has been the guide for depth of sedation in titrating propofol dose. in our practice, eeg - guided monitoring devices are not used. serious complications with propofol - based sedation, especially respiratory and cardiovascular adverse events, can occur. although rare, these complications need to be recognized rapidly and appropriately managed to avoid the risk of brain damage, cardiac arrest, or death. given its narrow therapeutic window and short half - life, propofol needs to be carefully titrated to effect., there were large variations in the dosages of propofol given for sedation during endoscopic procedures.24 consequently, there was a great individual variability in drug levels needed to achieve certain desired effects. there is no absolute correlation between administered doses of sedatives and the level of responsiveness. traditional methods of assessing the level of sedation have relied primarily on subjective assessment of the patient and alteration in vital signs. however, the value of hemodynamics to assess depth of anesthesia remains controversial.20 mean arterial pressure can be only an indirect parameter to estimate hypnotic effects. blood pressure was therefore far more likely to predict increasing and decreasing doses of sedative agents rather than any particular stages of depth of sedation. the oaa / s scale relies on speech and facial expression, which are often difficult to assess in patients undergoing ercp.12 the disadvantage of this scale is that repeated verbal or tactile stimulation of the patient is required to elicit a response. given these limitations, monitors that could objectively assess the level of sedation eeg - based monitoring of the level of consciousness, like bis or narcotrend, has added to the armamentarium of tools for monitoring patients undergoing moderate to deep sedation. at present, eeg - guided sedation is being used by anesthesiologists to achieve exact titration of hypnotic agents.16,21,22 these monitoring devices could potentially be cost saving, in that they could potentially reduce the dose of sedative agents used and allow rapid recovery time. in the review of literature comparing the oaa / s scale with eeg - based monitoring, there is good correlation of the respective scores with depth of sedation.2326 the correlation was also demonstrated by bower between the oaa / s scale and bis monitoring in patients who underwent gastrointestinal endoscopic procedures under conscious sedation. narcotrend or bis monitoring in patients undergoing procedures with total intravenous propofol - based anesthesia led to lower propofol consumption, quicker emergence from anesthesia, earlier extubation, and shorter recovery time.17,26,27 however, there are no prior data on the impact of eeg - based monitoring in patients undergoing moderate to deep sedation. our study attempts to assess the impact of narcotrend monitoring compared with the moaa / s scale in patients undergoing ercp with deep sedation with propofol. the findings show that narcotrendguided sedation during ercp does not translate to objective advantages over moaa / s - guided sedation in terms of success rate, propofol consumption, and recovery time. however, the use of narcotrend monitoring is associated with a reduction of hemodynamic changes and sedation - related complications. these complications, mainly hypotension and upper airway obstruction, were mild and readily treated. the lack of observance of a reduction in success rate, propofol consumption, and recovery time in our study may be due to the induction regimen. even though all patients were sedated with propofol, they were all given an induction regimen with fentanyl and midazolam based on their weight. it is possible that this induction regimen may have equalized the need for propofol between the groups and masked the true impact of eeg - based monitoring on propofol consumption. it is logical that because there was no difference in the propofol consumption, the study also did not find a difference in the recovery time. again, the recovery time may have also been impacted by the administration of fentanyl and midazolam. prior to the administration of propofol, an induction regimen consisting of fentanyl and midazolam was given to all patients. this may have affected the success rate, amount of propofol used, recovery time, and perhaps adverse events. however, the mean dose of the induction agents in both groups is comparable. the use of narcotrend system monitoring compared with clinical monitoring with the moaa / s scale in patients undergoing deep sedation with propofol for ercp helped to reduce sedation - related complications but did not increase the success rate, lower propofol consumption, or shorten the recovery time. | introductionmoderate to deep sedation is generally used for endoscopic retrograde cholangiopancreatography (ercp). the depth of sedation is usually judged by clinical assessment and electroencephalography - guided monitoring. the aim of this study was to compare the clinical efficacy of clinical assessment and narcotrendtm monitoring during deep - sedated ercp.methodsone hundred patients who underwent ercp in a single year were randomly assigned to either group c or group n. patients in group c (52) were sedated using the modified observer s assessment of alertness / sedation (moaa / s) scale. patients in group n (48) were sedated using the narcotrendtm system. the moaa / s scale 1 or 2 and the narcotrendtm index 4756 to 5764 were maintained during the procedure. the primary outcome variable of the study was the successful completion of the endoscopic procedure. the secondary outcome variables were the total dose of propofol used during the procedure, complications during and immediately after procedure, and recovery time.resultsall endoscopies were completed successfully. the mean total dose of propofol in group c was significantly lower than that in group n. however, the mean dose of propofol, expressed as dose / kg or dose / kg / h in both groups, was not significantly different (p = 0.497, 0.136). recovery time, patient tolerance and satisfaction, and endoscopist satisfaction were comparable between the two groups. all sedation - related adverse events during and immediately after the procedure, such as hypotension, hypertension, tachycardia, bradycardia, transient hypoxia, and upper airway obstruction, in group c (62.2%) were significantly higher than in group n (37.5%) (p = 0.028).conclusionclinical assessment and narcotrendtm - guided sedation using propofol for deep sedation demonstrated comparable propofol dose and recovery time. both monitoring systems were equally safe and effective. however, the narcotrendtm - guided sedation showed lower hemodynamic changes and fewer complications compared with the clinical assessment - guided sedation. |
sinusoidal obstruction syndrome (sos) is a severe adverse event of long - term chemotherapy in patients with colorectal cancer. in contrast, it sometimes appears as a liver mass occurring with local parenchymal hemorrhaging, and is often misdiagnosed as liver metastasis. a 40-year - old woman with rectal cancer underwent high anterior resection and partial liver resection of segment 7 due to synchronous liver metastasis. she received oxaliplatin - based chemotherapy (mfolfox6) as adjuvant chemotherapy for 6 months. a 13-mm irregular low - echoic mass was detected by ct in segment 3 of the liver 12 months after the operation. the mass was again resected as a liver metastasis because it had increased in size. the pathological diagnosis was focal sos, which showed sinusoidal dilation and congestion by hepatocyte trabeculae in the liver parenchyma. atypical irregular tumors should be considered as sos when the patient has received oxaliplatin - based chemotherapy. a qualitative imaging modality diagnosis, such as with diffusion - weighted mri, is superior to a morphological diagnosis in focal sos. synchronous and metachronous liver metastases are found in 20% - 25% and 35% - 55% of patients with advanced colorectal cancer, respectively (1, 2). liver resection provides a 30% - 40% increase in the 5-year survival rate when metastasis is found only in the liver (3). oxaliplatin - based chemotherapy is effective and is the first treatment choice for advanced colorectal cancer. recently, liver damage from long - term chemotherapy has arisen as a new clinical problem for colorectal cancer treatment. sinusoidal obstruction syndrome (sos) is diffuse liver damage that causes liver congestion (5). however, focal sos mimics metastatic liver tumors and has been ineffectively treated by surgery in three previous reports (6 - 8). we report a case of synchronous colorectal metastasis and metachronous focal sos within one year. we found that a qualitative imaging modality, such as diffusion - weighted mri, can lead to an accurate diagnosis. a 40-year - old woman underwent high anterior resection for rectal cancer, with partial liver resection of segment 7 for synchronous liver metastasis. on ct, a 13-mm irregular tumor was found in segment 3 of the liver 12 months after the operation. the laboratory data showed a slight decrease in the platelet count (12.8 10/mm), with otherwise normal findings (albumin 3.8 g / dl, total bilirubin 0.8 mg / dl, aspartate transaminase 34 iu / l, alanine transaminase 22 all tested tumor markers remained normal after the first operation (carcinoembryonic antigen 1.8 ng / ml, carbohydrate antigen 19 - 9 13 u / ml, and -fetoprotein 1.7 ng / ml). ultrasonography showed a 17-mm isoechoic tumor that was surrounded by a low - echoic area in the liver metastasis at the first operation. the pseudotumor of sos was unclear on conventional ultrasonography (figure 1a), whereas sonazoid contrast - enhanced ultrasonography in the kupffer phase visualized a 13-mm low - echoic mass (figure 1b). enhanced ct at the early phase showed a ring - enhanced tumor in segment 7 (figure 2a), whereas the metachronous pseudotumor presented as an unclear hypodense mass without surrounding enhancement (figure 2b). a, the pseudotumor of sos presented as an unclear isoechoic tumor ; b, the pseudotumor was clearly visualized as a low - echoic mass on the kupffer phase of sonazoid contrast - enhanced ultrasonography. a, enhanced ct in the portal phase clearly visualized a ring - enhanced tumor of primary liver metastasis ; b, the pseudotumor presented as an irregular hypodense mass without any surrounding enhancement. mri revealed that the primary liver metastasis was a low - intensity mass on t1-weighted images and a high - intensity mass on t2-weighted images. the hepatocyte phase of gd - eob mri and diffusion - weighted mri clearly showed the mass to be a tumor. the pseudotumor by sos also presented as a low - intensity mass on t1-weighted images (figure 3a). however, the tumor was not detected by diffusion - weighted mri (figure 3b). therefore, the standardized uptake value of the pseudotumor was approximately equal to that of the liver parenchyma. a, the pseudotumor revealed a low - intensity mass on the hepatocyte phase of gd - eob mri ; b, the pseudotumor was not detected on the diffusion - weighted mr images. during the surgery, therefore, we performed sonazoid contrast - enhanced ultrasonography intraoperatively, and a low - echoic mass in segment 3 was resected. an irregular, non - solid, brown - colored mass was confirmed in the resected specimen (figure 4a). histopathologically, the tumors showed sinusoidal dilation and congestion by hepatocyte trabeculae, compatible with sos (figure 4b). a, an irregular, non - solid, brown - colored mass was confirmed in the resected specimen ; b, a massive hemorrhage in the liver parenchyma was observed (original magnification : 20). morphological imaging modalities, such as ct or us, are not suitable for the diagnosis of a pseudotumor caused by sos, which always mimics liver metastasis and may be misdiagnosed with conventional ct or us alone. consideration of the pathophysiology of sos, which is congestion in the liver parenchyma, can lead to an accurate diagnosis. qualitative imaging modalities, such as diffusion - weighted mri, have diagnostic power superior to that of morphological imaging modalities. the blue liver caused by oxaliplatin - based chemotherapy is a specific adverse event that reflects the peripheral obstruction of hepatic vessels. sos is recognized as sustained sinusoidal endothelial cell injury, which results in centrilobular hemorrhagic necrosis. sos widely affects the liver parenchyma, but the clinical symptoms are nonspecific ; elevated transaminase levels, jaundice, hepatomegaly, splenomegaly, and ascites are characteristic clinical manifestations. moreover, occult parenchymal damage due to chemotherapy results in increased intraoperative blood loss, a high complication rate, and delayed liver regeneration after liver resection (4, 5). all cases had a history of advanced colorectal cancer surgery and adjuvant chemotherapy (table 1). gd - eob mri, which was considered to be the most reliable modality in colorectal liver metastasis, showed a defect in the hepatocyte phase, similar to imaging findings of colorectal liver metastasis. therefore, a qualitative imaging modality, such as diffusion - weighted mri, may be superior because the cellular density is higher in cancer than in pseudotumors (9). additionally, pseudotumors do not show uptake on pet, whereas 90% - 94% of liver metastases are detected with pet / ct (10). abbreviations : crm, colorectal metastasis ; dwi, diffusion - weighted image ; eob, gadoxetic acid - enhanced magnetic resonance imaging ; n.d., not detected. in the present case, two different tumor etiologies were treated within a year in a patient who underwent postoperative chemotherapy. one of the options was to perform a needle biopsy before the operation ; however, due to a fear of tumor - seeding from the biopsy, an inappropriate treatment was performed. | introductionsinusoidal obstruction syndrome (sos) is a severe adverse event of long - term chemotherapy in patients with colorectal cancer. it usually develops as liver congestion due to diffuse microscopic obstruction in liver parenchyma. in contrast, it sometimes appears as a liver mass occurring with local parenchymal hemorrhaging, and is often misdiagnosed as liver metastasis.case presentationa 40-year - old woman with rectal cancer underwent high anterior resection and partial liver resection of segment 7 due to synchronous liver metastasis. she received oxaliplatin - based chemotherapy (mfolfox6) as adjuvant chemotherapy for 6 months. a 13-mm irregular low - echoic mass was detected by ct in segment 3 of the liver 12 months after the operation. the mass was again resected as a liver metastasis because it had increased in size. the pathological diagnosis was focal sos, which showed sinusoidal dilation and congestion by hepatocyte trabeculae in the liver parenchyma.conclusionsatypical irregular tumors should be considered as sos when the patient has received oxaliplatin - based chemotherapy. a qualitative imaging modality diagnosis, such as with diffusion - weighted mri, is superior to a morphological diagnosis in focal sos. this imaging modality can prevent unnecessary operations. |
bladder cancer has a complex etiopathogenesis dependent on various factors : chemical carcinogens (smoking, professional exposure : industry carcinogens), diet (artificial sweeteners, coffee consumption and meat consumption, total fluid intake), previous treatments (pelvic radiation, drug abuse, chronic treatments with analgesics and anti - inflammatory drugs, hormone therapy) or genetic factors (genetic polymorphisms, micrornas). these risk factors are involved in bladder cancer etiopathogenesis, clinical evolution, prognosis, response to specific therapy or survival rates. dietary factors are mentioned also as part of bladder carcinogenesis (meat consumption, total fluid intake, vegetables, artificial sweeteners) and various disorders in the patient s medical history (chronic infections and inflammations of urinary bladder, schistosomiasis, hpv, chronic litiasis, long term catheterization) [4,5,6, ]. we can also mention as important etiological risk factors : the patient s clinical and family history - previous disorders (chronic inflammations and fibrosis, uro - genital malignancies, congenital abnormalities of urinary tract) and various malignancies. the genetic component is very important in bladder carcinogenesis (ccnd1, chek2, cyp1b1, xpc, ercc2 and ercc5, mdm2snp309 genetic variants, nrf2 and nrf2 target genes, p53 and rab oncogene). it will be important to identify and define various mirna and genetic polymorphisms involved in bladder carcinogenesis and use these genetic variants as diagnostic or prognostic biomarkers or as useful non invasive parameters in patients surveillance or screening programs, but also as important parameters in the improvement of the eortc scale (european organization for research and treatment of cancer) in predicting progression and recurrences in bladder cancer. the aim of recent research studies in bladder cancer pathology is to identify novel diagnostic and prognostic biomarkers in bladder cancer using medical genetics and functional genomics technology and provide early diagnosis, precise therapy and improve clinical outcome, life quality and survival rates of patients with bladder cancer. bladder cancer is a highly heterogenous malignancy derived from the urothelium of the urinary bladder with profound genetic valences (genetic polymorphisms, mirna) that could characterize etiopathogenesis, evolution, prognosis, response to specific therapy or survival rates. much interest has been given to urine tests in developing non invasive diagnosis biomarkers for bladder cancer. the usual diagnostic tools, such as cystoscopy, require experience, while histopathological examination represents the golden standard nowadays in bladder cancer positive diagnosis. urine cytology has a high specificity but lack of sensitivity in low - grade urothelial carcinomas. studying non invasive molecular biomarkers (mirna or genetic mutations) in bladder carcinogenesis and harvesting biomarkers from the blood of bladder cancer patients and compare with their tumors and normal tissue profiling could lead to a relatively non - invasive, cost - effective test with equivalent or improved sensitivity and specificity. identifying mirna and genetic polymorphisms involved in bladder cancer ethiopathogenesis using functional genomic technologies, recent research studies aim at : developing new diagnostic and prognostic strategies based on non invasive tumoral biomarkers, novel therapeutic / chemoprevention strategies, improvement of the clinical evolution of these patients and also improved eortc scale for bladder cancergenetic polymorphisms. intra - familial clusters have been reported in bladder cancer and recent studies documented the influence of genetic polymorphisms in bladder carcinogenesis. this hypothesis opens new research ways in finding novel diagnostic biomarker in bladder cancer, but also in predicting bladder cancer evolution, prognosis and develop novel therapeutic strategies according to molecular profile. family history of bladder cancer is a well - known risk factor in bladder cancer ethiopathogenesis and susceptibility, new data emerging under the influence of family history tumors rather than bladder cancer. recent research studies identified tumors in whose case family history influenced survival rates, prognosis and clinical evolution. many genetic polymorphisms are identified in bladder cancer etiopathogenesis which influence tumor susceptibility, prognosis or therapy response. studying genetic polymorphisms involved in bladder cancer has proved that nqo1pro187ser is an important part of bladder carcinogenesis involved in the etiopathogenesis of urinary system malignancies : bladder cancer, prostate cancer or renal cell carcinomas, but also a risk factor for other malignancies like : breast cancer, colorectal cancer or esophageal carcinoma. relevant clinical research studies have shown that nqo1c609 t is involved in bladder cancer and after clinical validation, this genetic polymorphism might represent an important diagnostic or prognostic biomarker in clinical oncology. mdm2snp309 promotes various genetic mutations of p53 involved in bladder carcinogenesis and is correlated with poor prognosis and fast evolution for t1 stage bladder malignancies. mdm2snp309 also represents an important risk factor in developing bladder cancer and might be seriously considered in the oncological evaluation. it may help to develop precise therapy in bladder malignancies according to the molecular profile of the tumour. p53arg72pro genetic polymorphism might be considered an important prognostic tool for invasive tumors versus superficial types of bladder cancer and could represent a useful parameter in bladder cancer surveillance or eortc scale of prediction progression and recurrences of bladder cancer. p53 is well - known as a supressor oncogene responsible for apoptotic processes, cell senescence, proliferation and control. mirnas are non coding small molecules made of 1922 nucleotides involved in gene regulation and part of various malignancies ethiopathogenesis. mirnas might correlate malignancies with clinical evolution, prognosis or survival rates. studying bladder cancer etiopathogenesis has proven that mirna-222 is correlated with the presence of in situ carcinoma, progression rate, fast evolution and poor survival rate. mirna-145 is involved in bladder cancer and might represent an important diagnostic biomarker in low grade, non muscle invasive bladder cancers. mirna-21 is up - regulated in high grade bladder cancer and might represent a trustable diagnosis biomarker which can differentiate high grade bladder cancer from low grade. mirna-137 might represent an important prognostic biomarker in bladder malignancies, which is correlated with cell proliferation, progression, tumor invasion and metastasis. like mirna-137, mirna-10b is a biomarker associated with tumor progression, metastatic processes but also important target in defining precise therapy in bladder cancers. mirna-29c,10b and mirna-210 might also represent diagnostic biomarkers in bladder malignancies and after clinical validation might provide early diagnosis in bladder cancer, improve clinical outcome and survival rates of these patients. being aware of the diagnostic difficulties in bladder cancer due to its long atypical asymptomatic clinical evolution (common genitourinary symptoms : painless hematuria, dysuria, urgency, frequency) and limited values of medical imaging techniques (cystoscopy, ct urography, ultrasonograpy) especially in superficial bladder malignancies, research studies try to define novel diagnostic biomarkers which might provide early diagnosis, precise therapy in bladder cancer, improve clinical outcome, quality of quality and survival rates. nowadays bladder cancer diagnosis is based on : cystoscopic examination mainly, urine cytology and histological examination. except for medical imaging tests and clinical examination, we mention complementary tests used in the positive diagnostic of bladder malignancies : urovysion test (fish), immunocyt, bta (bladder tumor antigen) and nmp22. bta (bladder tumor antigen) is a qualitative, non invasive, easy to perform diagnostic test in bladder cancer which measures complement factor h related protein and might be used along with urine cytology, cystoscopic and histopathological examination in bladder cancer diagnostic evaluation. nmp22 (nuclear matrix protein 22) is an important biomarker and together with urovysion test (fluorescence in situ hybridization) might represent useful non invasive surveillance instrument in bladder malignancies. imunocyt is another non invasive diagnostic tools in bladder cancer which combines immuno- fluorescence technique with urine cytology and its characterized by a high rate of false positive results induced by genitourinary benign disorders. bladder cancer is a highly heterogenous malignancy derived from the urothelium of the urinary bladder with profound genetic valences (genetic polymorphisms, mirna) that could characterize etiopathogenesis, evolution, prognosis, response to specific therapy or survival rates. much interest has been given to urine tests in developing non invasive diagnosis biomarkers for bladder cancer. the usual diagnostic tools, such as cystoscopy, require experience, while histopathological examination represents the golden standard nowadays in bladder cancer positive diagnosis. urine cytology has a high specificity but lack of sensitivity in low - grade urothelial carcinomas. studying non invasive molecular biomarkers (mirna or genetic mutations) in bladder carcinogenesis and harvesting biomarkers from the blood of bladder cancer patients and compare with their tumors and normal tissue profiling could lead to a relatively non - invasive, cost - effective test with equivalent or improved sensitivity and specificity. identifying mirna and genetic polymorphisms involved in bladder cancer ethiopathogenesis using functional genomic technologies, recent research studies aim at : developing new diagnostic and prognostic strategies based on non invasive tumoral biomarkers, novel therapeutic / chemoprevention strategies, improvement of the clinical evolution of these patients and also improved eortc scale for bladder cancergenetic polymorphisms. intra - familial clusters have been reported in bladder cancer and recent studies documented the influence of genetic polymorphisms in bladder carcinogenesis. this hypothesis opens new research ways in finding novel diagnostic biomarker in bladder cancer, but also in predicting bladder cancer evolution, prognosis and develop novel therapeutic strategies according to molecular profile. family history of bladder cancer is a well - known risk factor in bladder cancer ethiopathogenesis and susceptibility, new data emerging under the influence of family history tumors rather than bladder cancer. recent research studies identified tumors in whose case family history influenced survival rates, prognosis and clinical evolution. many genetic polymorphisms are identified in bladder cancer etiopathogenesis which influence tumor susceptibility, prognosis or therapy response. studying genetic polymorphisms involved in bladder cancer has proved that nqo1pro187ser is an important part of bladder carcinogenesis involved in the etiopathogenesis of urinary system malignancies : bladder cancer, prostate cancer or renal cell carcinomas, but also a risk factor for other malignancies like : breast cancer, colorectal cancer or esophageal carcinoma. relevant clinical research studies have shown that nqo1c609 t is involved in bladder cancer and after clinical validation, this genetic polymorphism might represent an important diagnostic or prognostic biomarker in clinical oncology. mdm2snp309 promotes various genetic mutations of p53 involved in bladder carcinogenesis and is correlated with poor prognosis and fast evolution for t1 stage bladder malignancies. mdm2snp309 also represents an important risk factor in developing bladder cancer and might be seriously considered in the oncological evaluation. it may help to develop precise therapy in bladder malignancies according to the molecular profile of the tumour. p53arg72pro genetic polymorphism might be considered an important prognostic tool for invasive tumors versus superficial types of bladder cancer and could represent a useful parameter in bladder cancer surveillance or eortc scale of prediction progression and recurrences of bladder cancer. p53 is well - known as a supressor oncogene responsible for apoptotic processes, cell senescence, proliferation and control. mirnas are non coding small molecules made of 1922 nucleotides involved in gene regulation and part of various malignancies ethiopathogenesis. mirnas might correlate malignancies with clinical evolution, prognosis or survival rates. studying bladder cancer etiopathogenesis has proven that mirna-222 is correlated with the presence of in situ carcinoma, progression rate, fast evolution and poor survival rate. mirna-145 is involved in bladder cancer and might represent an important diagnostic biomarker in low grade, non muscle invasive bladder cancers. mirna-21 is up - regulated in high grade bladder cancer and might represent a trustable diagnosis biomarker which can differentiate high grade bladder cancer from low grade. mirna-137 might represent an important prognostic biomarker in bladder malignancies, which is correlated with cell proliferation, progression, tumor invasion and metastasis. like mirna-137, mirna-10b is a biomarker associated with tumor progression, metastatic processes but also important target in defining precise therapy in bladder cancers. mirna-29c,10b and mirna-210 might also represent diagnostic biomarkers in bladder malignancies and after clinical validation might provide early diagnosis in bladder cancer, improve clinical outcome and survival rates of these patients. being aware of the diagnostic difficulties in bladder cancer due to its long atypical asymptomatic clinical evolution (common genitourinary symptoms : painless hematuria, dysuria, urgency, frequency) and limited values of medical imaging techniques (cystoscopy, ct urography, ultrasonograpy) especially in superficial bladder malignancies, research studies try to define novel diagnostic biomarkers which might provide early diagnosis, precise therapy in bladder cancer, improve clinical outcome, quality of quality and survival rates. nowadays bladder cancer diagnosis is based on : cystoscopic examination mainly, urine cytology and histological examination. except for medical imaging tests and clinical examination, we mention complementary tests used in the positive diagnostic of bladder malignancies : urovysion test (fish), immunocyt, bta (bladder tumor antigen) and nmp22. bta (bladder tumor antigen) is a qualitative, non invasive, easy to perform diagnostic test in bladder cancer which measures complement factor h related protein and might be used along with urine cytology, cystoscopic and histopathological examination in bladder cancer diagnostic evaluation. nmp22 (nuclear matrix protein 22) is an important biomarker and together with urovysion test (fluorescence in situ hybridization) might represent useful non invasive surveillance instrument in bladder malignancies. imunocyt is another non invasive diagnostic tools in bladder cancer which combines immuno- fluorescence technique with urine cytology and its characterized by a high rate of false positive results induced by genitourinary benign disorders. mirnas are non coding small molecules made of 1922 nucleotides involved in gene regulation and part of various malignancies ethiopathogenesis. mirnas might correlate malignancies with clinical evolution, prognosis or survival rates. studying bladder cancer etiopathogenesis has proven that mirna-222 is correlated with the presence of in situ carcinoma, progression rate, fast evolution and poor survival rate. mirna-145 is involved in bladder cancer and might represent an important diagnostic biomarker in low grade, non muscle invasive bladder cancers. mirna-21 is up - regulated in high grade bladder cancer and might represent a trustable diagnosis biomarker which can differentiate high grade bladder cancer from low grade. mirna-137 might represent an important prognostic biomarker in bladder malignancies, which is correlated with cell proliferation, progression, tumor invasion and metastasis. like mirna-137, mirna-10b is a biomarker associated with tumor progression, metastatic processes but also important target in defining precise therapy in bladder cancers. mirna-29c,10b and mirna-210 might also represent diagnostic biomarkers in bladder malignancies and after clinical validation might provide early diagnosis in bladder cancer, improve clinical outcome and survival rates of these patients. being aware of the diagnostic difficulties in bladder cancer due to its long atypical asymptomatic clinical evolution (common genitourinary symptoms : painless hematuria, dysuria, urgency, frequency) and limited values of medical imaging techniques (cystoscopy, ct urography, ultrasonograpy) especially in superficial bladder malignancies, research studies try to define novel diagnostic biomarkers which might provide early diagnosis, precise therapy in bladder cancer, improve clinical outcome, quality of quality and survival rates. nowadays bladder cancer diagnosis is based on : cystoscopic examination mainly, urine cytology and histological examination. except for medical imaging tests and clinical examination, we mention complementary tests used in the positive diagnostic of bladder malignancies : urovysion test (fish), immunocyt, bta (bladder tumor antigen) and nmp22. bta (bladder tumor antigen) is a qualitative, non invasive, easy to perform diagnostic test in bladder cancer which measures complement factor h related protein and might be used along with urine cytology, cystoscopic and histopathological examination in bladder cancer diagnostic evaluation. nmp22 (nuclear matrix protein 22) is an important biomarker and together with urovysion test (fluorescence in situ hybridization) might represent useful non invasive surveillance instrument in bladder malignancies. imunocyt is another non invasive diagnostic tools in bladder cancer which combines immuno- fluorescence technique with urine cytology and its characterized by a high rate of false positive results induced by genitourinary benign disorders. bladder cancer is a real health problem worldwide because of its incidence, prevalence, high recurrence rate, with a long silent clinical evolution, which is diagnosed using medical imaging techniques and histopathological approach. a wide range of non invasive genetic biomarkers have been evaluated that can provide early diagnosis and, above all, may estimate and characterize bladder malignancies evolution, prognosis, survival rate, response to therapy, and can be also included as useful parameters in non invasive screening programs. blood profiling for bladder cancers pathology might represent an interesting non - invasive test, showing accurate information about the tumor grade, therapy response and patients prognosis. using - these molecular biomarkers in clinical practice might provide early diagnosis in bladder malignancies, precise therapy and improve clinical outcome patients. | bladder cancer is one of the most commonly diagnosed malignancies worldwide, derived from the urothelium of the urinary bladder and defined by long asymptomatic and atypical clinical picture. its complex etiopathogenesis is dependent on numerous risk factors that can be divided into three distinct categories : genetic and molecular abnormalities, chemical or environmental exposure and previous genitourinary disorders and family history of different malignancies. various genetic polymorphisms and microrna might represent useful diagnostic or prognostic biomarkers. genetic and molecular abnormalities - risk factors are represented by mirna or genetic polymorphisms proved to be part of bladder carcinogenesis such as : genetic mutations of oncogenes tp53, ras, rb1 or p21 oncoproteins, cyclin d or genetic polymorhisms of xpd, ercc1, cyp1b1, nqo1c609 t, mdm2snp309, chek2, ercc6, nrf2, nqo1pro187ser polymorphism and microrna (mir-143, 145, 222, 210, 10b, 576 - 3p). the aim of our article is to highlight the most recent acquisitions via molecular biomarkers (mirnas and genetic polymorphisms) involved in bladder cancer in order to provide early diagnosis, precise therapy according to the molecular profile of bladder tumors, as well as to improve clinical outcome, survival rates and life quality of oncological patients. these molecular biomarkers play a key role in bladder carcinogenesis, clinical evolution, prognosis and therapeutic response and explain the molecular mechanisms involved in bladder carcinogenesis ; they can also be selected as therapeutic targets in developing novel therapeutic strategies in bladder malignancies. moreover, the purpose in defining these molecular non invasive biomarkers is also to develop non invasive screening programs in bladder malignancies with the result of decreasing bladder cancer incidence in risk population. |
tennis elbow (te) is not an inflammation of the outside portion of the elbow but rather is the degeneration of the extensor tendon of the humeral lateral epicondyle (le) due to microscopic injuries. common symptoms include pain, tenderness over the le, pain upon gripping, and dorsiflexion against resistance of the wrist, middle finger, or both1,2,3,4,5. conservative treatments such as nonsteroidal anti - inflammatory drugs, local steroid injections, strengthening exercises, stretching, taping, ultrasound (us), iontophoresis, laser, acupuncture, and massage are usually used6,7,8,9,10,11. meanwhile, surgical intervention is required for cases of te when conservative management is deemed ineffective12. one non - invasive treatment for te - associated pain is extracorporeal shock wave therapy (eswt). although the underlying mechanism of eswt is not completely clear, it likely involves hyperstimulation analgesia ; it alleviates pain as a result of moderate - to - intense sensory input that is usually applied at the site of greatest discomfort.. however, there is a lack of comparative studies of the analgesic effects of various electrotherapy methods on chronic te. therefore, the present study compared the analgesic effects of eswt and us therapy in patients with chronic te. this study was performed in the department of physiotherapy mining in jaworzno, poland. the exclusion criteria were local soft - tissue infection, malignant disease, pacemaker, epileptic disorders, rheumatoid arthritis, diabetes mellitus, neurological abnormalities, infectious diseases, cardiovascular disease, lung or endocrine disease, skin ulcerations, reduced range of motion at the elbow, previous surgical intervention of the te, previous conservative treatment of the te 6 months before start of the study, and history of local corticosteroid injection 6 months before the study. the inclusion criteria were age > 18 years, pain in the lateral epicondyle of the humerus persisting longer than 12 months (table 1table 1.baseline characteristicscharacteristicseswt groupus grouppatients (n)2525occupation : physical worker / white - collar worker (n)19/715/10age (yr)47.9 4.4 49.0 4.5duration of symptoms (months)14.9 2.1 15.1 1.9dominant arm (right / left)25/025/0treatment side (right / left)25/025/0previous unsuccessful treatment 6 months prioryes yes / no (n)25/025/0values are mean sd including local steroid - injection, cryotherapy, phonophoresis, iontophoresis, laser therapy, kinesiotherapy, taping, massage, or orthoses.). values are mean sd including local steroid - injection, cryotherapy, phonophoresis, iontophoresis, laser therapy, kinesiotherapy, taping, massage, or orthoses. the remaining patients were randomly allocated to receive eswt or us therapy ; randomized was performed by an independent statistician blinded to the baseline characteristics of the participants using a randomization list generated by medcalc statistical software version 15.2.1 (medcalc software byba, ostend, belgium). finally, a total of 50 individuals in 2 groups were analyzed (fig. this study was designed in accordance with the rules for human experimental studies and approved by the bioethical committee of the holycross college in kielce (resolution 1/12/kb). the eswt group received 1,000, 1,500, and 2,000 pulses during the first, second, and third through fifth treatments, respectively (pressure, 2.5 bar ; frequency, 8 hz ; energy density, 0.4 mj / mm). the treatments were performed using a rosetta eswt (cr technology, korea). treatment was administered at the anterior aspect of the le and three points around it at a radius of 1.52 cm. meanwhile, the us group received continuous ultrasound waves : intensity, 0.8 w / cm ; 100% fill ; carrier frequency, 1 mhz. the treatments were performed using a us 13 evo cosmogamma (emildue, italy). the applicator head was applied to the le of the humerus at a right angle in order to maximize energy absorption by the tissue. pain of the affected upper limb during gripping was measured by a martin vigorimeter (nexgen ergonomics inc., canada), which is a dynamometer with a rubber balloon that is compressed by hand ; the air pressure inside the balloon under the influence of compression in kiloponds per square centimeter (kp / cm) was recorded on a manometer. moreover, resting pain, pain felt during palpation of the le of the humerus, and pain during the thomsen test (i.e., wrist extension against resistance) were measured. during the thomsen test, with the shoulder flexed at 60, elbow extended, forearm pronated, and wrist extended to approximately 30, pressure was applied to the dorsum of the second and third metacarpal bones in the direction of flexion and ulnar deviation in order to stress the extensor carpi radialis brevis and longus. finally, pain during the chair test was evaluated ; with the shoulder flexed at 60 and the elbow extended, the subject attempted to lift a chair weighing 3.5 kg. in addition, patients were asked to assess the level of pain immediately and 3 months post - treatment in comparison to that before treatment according to the following criteria : excellent : pain reduction exceeding 70%, full movement, full activity ; good : pain reduction from 5070%, occasional discomfort, full movement, full activity ; acceptable : pain reduction 3050%, some discomfort after longer activities ; poor : pain reduction less than 30%, pain - limiting activity. pain was assessed using the visual analog scale (vas), which is a 10-cm line whose left and right sides correspond to no pain (0) and unbearable pain (10), respectively. pain was evaluated pre - treatment, and immediately and 3 months post - treatment. medcalc statistical software version 15.2.1 (medcalc software byba, ostend, belgium) was used for statistical analysis. all data are expressed as mean standard deviation (sd) and range. one - way anova was used to compare differences in the measured parameters within a group pre - treatment, post - treatment, and 3 months post - treatment. meanwhile, the independent samples t - test was for intergroup comparisons pre - treatment, post - treatment, and 3 months post - treatment. pain in all tests decreased significantly over time within each group, although significantly greater analgesic effects were achieved in the eswt group (table 2table 2.pain scores within groups at different time pointseswt groupmean sd (range)us groupmean sd (range)pain at grip strengthpre treatment2.8 0.2 (2.72.9)2.8 0.1 (2.72.8)post treatment3.9 0.1 (3.94.0)2.8 0.1 (2.82.9)post 3 months5.1 0.2 (4.85.5)2.9 0.1 (2.63.1)resting painpre treatment4.0 0.7 (3.05.0)4.2 0.6 (3.05.0)post treatment1.9 0.9 (0.03.0)4.0 0.6 (3.05.0)post 3 months0.2 0.4 (0.00.1)3.7 0.7 (3.05.0)palpation painpre treatment6.4 0.6 (5.07.0)6.4 0.5 (6.07.0)post treatment3.5 0.6 (2.05.0)6.1 0.6 (5.07.0)post 3 months1.5 0.8 (0.03.0)5.8 0.8 (5.07.0)pain at thomsen testpre treatment5.7 0.5 (5.07.0)5.8 0.7 (4.07.0)post treatment2.9 0.7 (2.04.0)5.5 0.6 (4.06.0)post 3 months1.3 0.4 (0.03.0)5.1 0.8 (3.06.0)pain at chair testpre treatment4.9 0.7 (4.06.0)4.9 0.6 (4.06.0)post treatment4.0 0.8 (2.05.0)4.6 0.6 (3.06.0)post 3 months3.9 0.6 (3.05.0)4.4 0.7 (3.05.0)statistically significant (p 5070% no pain, full movement, full activity10401144good : vas > 5070% occasional discomfort, full movement, full activity12487281352728acceptable : vas reduction > 3050% some discomfort post longer activities3121352141040poor : vas reduction < 30% pain - limiting activity520832. three months post - treatment, in the eswt group, 24 patients had excellent or good results compared to only 7 in the us group. furthermore, 0 and 8 patients in the eswt and us groups had poor outcomes at the end of the study, respectively. therefore, the results indicate eswt was more effective than us for reducing pain, with long - lasting results. statistically significant (p < 0.05) statistically significant (p < 0.05) difference between means although the diagnosis of te is fairly straightforward, its management is often difficult. eswt and us therapy play important roles in the treatment of te - associated pain ; they are used to provoke painful levels of stimulation to relieve pain, which is termed hyperstimulation analgesia. meanwhile, some studies have evaluated the influence of kinesio taping immediately, 12, 24, and/or 72 after application23,24,25,26,27. lemos.28 evaluated the changes in muscle function in healthy subjects induced by kinesio tape application with no or moderate tension to the dominant and non - dominant arms. the subjects, aged 1830 years, received kinesio taping, kinesio taping without tension, or no treatment (control) ; they were assessed before, and 30 minutes, 24 hours, and 48 hours after taping. the results showed the kinesio group exhibited increased grip strength at all time points after application compared to the controls. meanwhile, grip strength was significantly greater in the kinesio groups than the controls after 24 and 48 hours for the right hand and after 48 hours for the left hand. right grip strength improved in the kinesio group compared to that in the kinesio without tension group only 24 hours after application. spacca.13 compared therapeutic effects of active radial shockwave therapy (rswt) with sham rswt. the rswt group received 2,000 impulses (1.2 bar at 4 hz for 500 impulses, and 1 bar at 10 hz for 1,500 impulses). meanwhile, the sham rswt group received 20 impulses (1.2 bar at 4 hz for 5 impulses, and 1 bar at 10 hz for 15 impulses). the rswt group showed a significantly greater decrease of pain and greater increase of pain - free grip strength post - treatment than the sham rswt group. the eswt group received 2,000 pulses (energy flux density, 0.030.17 mj / mm), while the sham eswt group received 2,000 pulses (energy flux density, 0.03 mj / mm). pain decreased and pain - free grip strength increased post - treatment, but the differences were not significant14, 15. moreover, rompe.29 compared the long - term therapeutic effects of eswt with sham eswt. the eswt group received 3,000 impulses (energy flux density, 0.08 mj / mm), while the sham eswt group received 30 impulses (energy flux density, 0.08 mj / mm). pain was significantly lower in the eswt group than the sham eswt group, which persisted up to 24 months post - treatment. in the present study, pain decreased to a significantly greater extent in the eswt group than in the us group. furthermore, the therapeutic effect persisted for 3 months post - treatment, indicating the effectiveness of the eswt treatment protocol. these findings may be valuable for physicians, physiotherapists, and patients with te regarding the selection of the most appropriate treatment on the basis of patients preference and convenience. in summary, the results of this study provide evidence that patients with te can obtain significant health benefits with eswt. | [purpose ] this study compared the analgesic effects of extracorporeal shock wave therapy with those of ultrasound therapy in patients with chronic tennis elbow. [subjects ] fifty patients with tennis elbow were randomized to receive extracorporeal shock wave therapy or ultrasound therapy. [methods ] the extracorporeal shock wave therapy group received 5 treatments once per week. meanwhile, the ultrasound group received 10 treatments 3 times per week. pain was assessed using the visual analogue scale during grip strength evaluation, palpation of the lateral epicondyle, thomsen test, and chair test. resting pain was also recorded. the scores were recorded and compared within and between groups pre - treatment, immediately post - treatment, and 3 months post - treatment. [results ] intra- and intergroup comparisons immediately and 3 months post - treatment showed extracorporeal shock wave therapy decreased pain to a significantly greater extent than ultrasound therapy. [conclusion ] extracorporeal shock wave therapy can significantly reduce pain in patients with chronic tennis elbow. |
chest pain accounts for approximately 56 million emergency department (ed) visits and 1 in every 50 outpatient visits in the united states, ultimately costing more than $ 6 billion dollars in annual healthcare costs. while a majority of presentations for chest pain are ultimately deemed non - cardiac in origin, in light of the substantial morbidity and mortality due to coronary heart disease, most patients undergo non - invasive testing for coronary artery disease (cad) to better define individual cardiovascular risk. in an era of increasing focus on healthcare resource utilization, considerable interest is aimed at reducing the cost and time to provide appropriate care, ultimately identifying the right test, for the right patient, in the right clinical presentation (assuming a test is needed or indicated at all). beyond its role as a well - established screening test for subclinical coronary atherosclerosis in asymptomatic patients, coronary artery calcium (cac) testing has garnered increasing attention as an inexpensive, rapid, reproducible and safe alternative to exclude cad in symptomatic patients at low- intermediate pre - test risk for obstructive coronary atherosclerosis. current national institute for health and clinical excellence (nice) guidelines recommend testing for cac as the first - line examination in lower risk patients with stable chest pain symptoms [2 ]. however, several potential limitations of this approach have curbed the widespread use of cac testing in symptomatic patients and led to discordant recommendations from other professional societies. these include concerns for the presence of obstructive disease in the absence of cac, particularly in patients at higher pre - test risk, the high background prevalence of cac in the general population, and a low - specificity of cac for obstructive disease, necessitating additional testing in a significant percentage of patients with evident cac. the concern for diagnostic inefficiency due to test layering in symptomatic patients with positive cac, as well as the ability to perform coronary computed tomographic angiography (cta), with proven accuracy and prognostic value at radiation doses comparable to cac testing in many patients, are prominent limitations to cac testing in symptomatic patients in our practice. herein, we review the evidence supporting cac testing in symptomatic patients as well as the challenges to its widespread application. in order to understand the rationale for utilizing cac testing in patients with symptoms concerning for angina, one must consider contextually the test performance, cost and current guideline recommendations for standard non - invasive tests for cad (fig. 1). exercise stress electrocardiography (ecg) is commonly performed, relatively inexpensive, can be completed with limited support staff and does not involve ionizing radiation exposure ; though it requires an interpretable electrocardiogram and an ambulatory patient. while exercise capacity remains one of the strongest indicators of long - term mortality, the diagnostic accuracy of exercise ecg is low relative to imaging - based tests for cad. for example, based on pooled summary test performance statistics, exercise ecg has a sensitivity of 68% and specificity of 77% for the detection of obstructive cad on invasive coronary angiography. for this reason, nice guidelines discourage the use of exercise ecg for the evaluation of patients with stable angina symptoms in patients without known cad, despite european society of cardiology and american college of cardiology foundation / american heart association (accf / aha) guidelines to the contrary [2, 4, 5 ]. indeed, exercise ecg confers the only class i indication for the initial evaluation of suspected stable ischemic heart disease in intermediate risk patients with an interpretable ecg who are able to exercise [5].fig. 1comparison of commonly utilized non - invasive tests for coronary artery disease in patients with suspected ischemic heart disease. acs, acute coronary syndrome ; cac, coronary artery calcium ; cta, computed tomographic angiography ; ecg, electrocardiogram ; msv, millisievert ; spect, single - photon emission computed tomography ; u, uncertain. per - patient sensitivity and specificity for obstructive coronary artery disease defined as 50% coronary luminal narrowing confirmed by invasive coronary angiography according to mean values as reported in current american college of cardiology guidelines. cac = 0 derived as the weighted mean from sarwar. # calendar year 2012 final outpatient prospective payment system (opps)applying procedure codes : stress ecg (93306), stress echo (93351), spect (78452), cac (75571), ccta (75574), ica (93458). ^ in patients able to exercise ccta meets class iia indication if patient (a) has continued symptoms with prior normal test findings (b) has inconclusive results from prior exercise or pharmacological stress testing, or (c) is unable to undergo stress with myocardial perfusion imaging or echocardiography comparison of commonly utilized non - invasive tests for coronary artery disease in patients with suspected ischemic heart disease. acs, acute coronary syndrome ; cac, coronary artery calcium ; cta, computed tomographic angiography ; ecg, electrocardiogram ; msv, millisievert ; spect, single - photon emission computed tomography ; u, uncertain. per - patient sensitivity and specificity for obstructive coronary artery disease defined as 50% coronary luminal narrowing confirmed by invasive coronary angiography according to mean values as reported in current american college of cardiology guidelines. cac = 0 derived as the weighted mean from sarwar. # calendar year 2012 final outpatient prospective payment system (opps)applying procedure codes : stress ecg (93306), stress echo (93351), spect (78452), cac (75571), ccta (75574), ica (93458). note the coverage for coronary artery calcium scanning is limited in many regions. ^ in patients able to exercise ccta meets class iia indication if patient (a) has continued symptoms with prior normal test findings (b) has inconclusive results from prior exercise or pharmacological stress testing, or (c) is unable to undergo stress with myocardial perfusion imaging or echocardiography stress echocardiography and single - photon emission computed tomography (spect) both improve diagnostic accuracy for the detection of obstructive coronary artery disease as compared to stress ecg at the expense of time, resource availability and cost. of these, stress echocardiography has greater specificity with lower cost and no radiation, but ultimately relies on experienced technicians and readers and adequate image quality to maintain accuracy and reproducibility. while spect improves sensitivity for detecting significant cad [6, 7 ], it remains more expensive, time consuming and incurs significant radiation, though stress only imaging may limit these drawbacks while providing sufficient negative predictive value (npv) in low - intermediate risk patients. lastly, modern coronary cta has proven to be the most sensitive noninvasive modality to evaluate suspected coronary artery disease in patients with stable or acute chest pain syndromes [9, 10 ]. while ccta exposes patients to ionizing radiation, very low effective doses (0 when compared to blinded ica findings among patients with stable symptoms. within this cohort, overall specificity of cac > 0 was 40% and positive predictive value (ppv) was 68% for obstructive cad. based on such data, a 2007 acc / aha expert consensus statement and recent nice guidelines [2 ] endorsed the use of cac testing for low - risk, stable symptomatic patients, where cac testing is used as a filter for further cardiovascular testing in a binary fashion (cac present or absent). specifically, patients without cac (cac = 0) avoid further cardiovascular testing (cad ruled out) and those with any cac (cac > 0) receive additional testing, such as ccta, spect or ica, an approach also advocated by some expert opinion. subsequent studies utilizing multi - detector computed tomography (mdct) scanners have similarly provided promising data demonstrating generally high, albeit variable, sensitivity and negative predictive values for binary cac testing among symptomatic patients (table 1). recently, investigators from the coronary ct angiography evaluation for clinical outcomes : an international multicenter registry (confirm) evaluated 10,037 symptomatic low - intermediate risk patients undergoing 64 slice ccta and found high sensitivity and npv for the detection of any stenosis 50% (sensitivity 89%, npv 96%) and 70% (sensitivity 92%, npv 99%), respectively [34 ]. within this cohort more than 13% of patients with cac = 0 had non - obstructive cad (purely non - calcified plaque), and 3.5% and 1.4% had a stenosis 50% and 70%, respectively. notably, in both the sarwar analysis and confirm populations, npv remained high (> 95%) despite marked differences in the prevalence of obstructive disease (50% stenosis), 56% and 16%, respectively.table 1diagnostic accuracy of coronary artery calcium using multidetector computed tomography for the detection of obstructive coronary artery disease in symptomatic patientsauthor, year [ref]nstudy type and populationscanner / slice thicknessmen (%) mean agecac prevalence n (%) confirmed by icaprevalence 50% stenosisnpv%lr()cac = 0cac > 0cac = 0cac > 0haberl. 2005 133prospective observational ; chest pain referred for icamdct/1.3 mm626725 (19)108 (81)yes8 (32)45 (42)680.71henneman. 2008 40prospective, observational ; ed patients referred for icamdct655713 (33)28 (67)yes5 (38)21 (78)660.36akram. 2008 134retrospective ; referred for ica and cctamdct/0.6 mm475749 (64)85 (63)yes4 (8)24 (28)920.34gottlieb. 2010 291prospective, randomized ; referred for icamdct/0.6 mm735972 (25)219 (75)yes14 (19)149 (68)810.19fernandez. 2011 225retrospective ; ed patients64 mdct/0.6mm4553133(59)92(41)no (ccta only)2 (1.5)18 (20)990.16villines. 2012 10,037prospective observational registry ; referred for ccta64 mdct56575128 (51)4909 (49)no (ccta only)180 (3.5)1423 (29)960.19yoon. 2012 136prospective observational ; ed patientsmdct/0.6 mm585692 (68)44 (32)no (ccta only)14 (15)28 (64)850.4von ziegler. 2012 351retrospective ; referred for icamdct or dsct/0.6 mm686167 (19)284 (81)yes1 (1.5)132 (47)990.02cac, coronary artery calcium ; ccta, coronary computed tomography angiography ; dsct, dual source computed tomography ; ed, emergency department ; ica, invasive coronary angiography ; lr(), negative likelihood ratio ; mdct, multidetector computed tomography ; npv, negative predictive value diagnostic accuracy of coronary artery calcium using multidetector computed tomography for the detection of obstructive coronary artery disease in symptomatic patients cac, coronary artery calcium ; ccta, coronary computed tomography angiography ; dsct, dual source computed tomography ; ed, emergency department ; ica, invasive coronary angiography ; lr(), negative likelihood ratio ; mdct, multidetector computed tomography ; npv, negative predictive value however, in reviewing other mdct studies, the reported sensitivity and npv of cac scoring in symptomatic patients are highly variable (table 1) [35, 36, 37, 3941 ]. examination of these studies provides a case - study for the effect of pre - test probability on test performance in accordance with bayesian principles. a sub - study of the coronary evaluation using multi - detector spiral computed tomography angiography using 64 detectors (core 64) multi - center trial demonstrated that among 291 high risk symptomatic patients with suspected acs, 19% of those with cac = 0 had at least one segment of 50% stenosis on subsequent ica [37 ]. similarly, henneman and colleagues cautioned against the extension of cac in the ed setting after reporting that among 40 patients presenting with suspected acs, 12.5% (n = 5) had significant cad in the absence of calcification. importantly, these represent smaller studies involving higher - risk patients clinically referred for ica, a scenario where cac scoring would generally be inappropriate ; and neither study excluded patients with known cad. in the henneman paper, for example, 25% and 28% of patients had a prior myocardial infarction and percutaneous coronary intervention, respectively. here, regarding the use of bayes theorem reminds us that as disease prevalence (pretest probability) increases the ability of any non - invasive test to exclude obstructive disease (sensitivity and negative predictive value) is eroded. given the discrepancy among existing heterogeneous data regarding the accuracy of binary cac testing suggests that there is a need for prospective studies assessing the clinical outcomes, cost and safety of this approach prior to widespread clinical adoption of early cac testing in symptomatic patients. noting similar sentiment, in the 2012 accf / aha guideline for the diagnosis of patients with potential stable ischemic heart disease, binary cac testing in symptomatic patients was given a class iib recommendation (level of evidence c : may be considered ; additional studies are needed ; divergence of opinion), with the writing committee stating that additional evidence in sufficiency large cohorts of patients establishing the uncorrected diagnostic accuracy of cac to rule in or rule out high - grade coronary artery stenosis in symptomatic patients [is ] needed beyond its proven prognostic value in screening populations and its diagnostic potential in symptomatic patients to rule - out significant cad as discussed above, the prognostic value of cac testing in symptomatic patients warrants discussion. one of the first studies to evaluate the use of cac scoring in symptomatic patients in the ed was performed by georgiou and colleagues. a total of 192 low - intermediate risk patients with suspected cad underwent calcium scoring in the ed. the treating physician and patient patients with cac = 0 had an annualized event rate of 0.6% for a composite of cardiac death, stroke, myocardial infarction, revascularization and hospitalization for angina. the rule out myocardial infarction using computer assisted tomography (romicat i) study consisted of 368 symptomatic patients undergoing ccta and cac scans for the evaluation of acute chest pain in the ed. of the 14 patients (4%) with purely non - calcified plaque(s), only one (7.1%) developed acs, a npv for binary cac testing of 99%. finally, from among a larger cohort study of more than 1000 patients it was shown that 60% of low - intermediate risk symptomatic patients referred for stress spect had a cac score of zero, prompting the authors to conclude that these patients could have been discharged without additional evaluation. cardiac death and acs occurred in only two (0.3%) of the 625 cac = 0 patients over a 7 month follow - up period, providing a sensitivity and npv of 93.8% and 99.7%, respectively. on the other hand, 12 (1.2%) of 991 patients with a normal spect suffered an event with a sensitivity and npv of 62.5% and 98.8% respectively (p = 0.04 for sensitivity). similar to these findings, a number of other studies attest to the prognostic reassurance provided by the absence of quantifiable cac on non - contrast ct (table 2) [34, 4653].table 2prognosis of symptomatic patients evaluated for coronary artery disease according to the presence or absence of coronary artery calcificationauthor, year [ref]ntype of populationscanner / thicknessmen (%) mean ageprevalence n (%) mean follow - up (months)% lost to follow - updefinition of events (n)events, n (%) npv (%) lr ()cac = 0cac > 0cac = 0cac > 0detrano. 1996 491retrospective, referred for icaebct/3 mm575598 (20)393 (80)3014cardiac death (13), mi (8)1 (1.0)20 (5.1)990.23mclaughlin. 1999 134retrospective, ed for chest painebct/3 mm375348 (36)86 (64)1n / aacs (5), revascularization (2001 192prospective observational study, ed for chest painebct/3 mm545376 (40)116 (60)508cardiac death (11), mi (19), revascularization (13), hospitalizations (11), stroke (4)2 (2.6)56 (48)970.06keelan. 2001 288retrospectiveebct/ 3mm775632 (11)256 (89)849cardiac death (n / a), mi (n / a)1 (3.1)21 (8.2)970.39schmermund. 2004 255retrospective, recent onset of symptomsebct/ 3 mm715862 (24)193 (76)4215cardiac death (3), mi (2), revascularization (35)1 (1.6)39 (20)980.09becker. 2005 924post ica, no significant stenosismdct4859188 (20)736 (80)36n / acardiac death (28), mi (50)0 (0.00)78 (11)1000rozanski. 2007 1153referred primary care and self - referredebct / mdct 3 mm/2.5 mm7458252 (22)901 (78)323cardiac death and mi (3), revascularizations > 60 days (37)1 (0.4)49 (5.4)1000.09schenker. 2008 621referred for stress petmdct/2.5 mm4061213 (34)408 (66)170cardiac death (33), mi (22)11 (5.2)44 (10.8)950.56hoffmann. 2009 368prospective, observational, ed for chest pain64 mdct/ cta 0.6 mm615314 (3.8)354 (86)6.29.5cardiac death (0), mi (12), revascularization (23)1 (7.1)34 (9.6)930.73laudon. 2010 263prospective, observational, ed for chest painebct / 3 mm6048133 (51)130 (49)1, 12, 60 (mean not reported)22 (at 5 years)death (0), acs (15), revascularization (29)1 (0.75)45(35)990.04nabi. 2010 1031prospective observational, ed for chest painmdct/2.5 mm4054625 (61)406 (39)7.41cardiac death (0), acs (32)2 (0.32)30 (7.39)990.1villines. 2011 [34]10,037observational registry referred for ccta64 mdct56575128 (51)4909 (49)2511.26all - cause mortality (95), nonfatal mi (55), revascularization > 90 days (107)44 (0.9)191(4.8)990.36yoon. 2012 136prospective observational, ed for chest painmdct/0.6585692 (68)44 (32)n / an / aacs (45)17 (18)28 (64)810.46totals (mean)15,89356556,961 (44)8,932 (56)307.7383 (0.52)642 (4.04)990.25acs, acute coronary syndrome ; ebct, electron beam computed tomography ; mi, myocardial infarction ; n / a, not applicable ; pet, positron emission tomography ; other abbreviations as in table 1 prognosis of symptomatic patients evaluated for coronary artery disease according to the presence or absence of coronary artery calcification acs, acute coronary syndrome ; ebct, electron beam computed tomography ; mi, myocardial infarction ; n / a, not applicable ; pet, positron emission tomography ; other abbreviations as in table 1 it is important to note that when comparing the prognostic value of cac agatston scores (plaque burden) versus coronary cta, which provides angiographic measures of plaque burden, plaque composition and coronary artery stenosis, cac scoring does not appear to provide significant additional prognostic information among symptomatic patients. data from the confirm registry [34 ] and others have shown that ccta provides superior prognostic information as compared to cac testing among symptomatic patients (fig. 2). additionally, among patients with obstructive (50% stenosis) disease on ccta but with cac = 0 (3.5% of patients with cac = 0) within confirm, there was a significant increase in cardiovascular events related to the presence of obstructive cad (fig., there was no additional prognostic value for ccta as compared to cac scoring in asymptomatic patients. taken together, these observations appear to support current appropriate use criteria and guidelines for the use of ct - based cad tests [4, 5, 16, 18 ], highlighting the importance of patient symptoms in this decision - making process.fig. 2receiver - operator characteristic curves : major adverse events. receiver - operator characteristic curves of four models for predicting composite major adverse events in 8907 patients within the confirm registry over a median of 2.1 years of follow - up. model 2 (morise score + cac score) was superior to model 1 (symptoms and risk factors alone by morise score), p 0) ; revasc, revascularization occurring > 90 days following coronary cta. adapted with permission from villines tc,. receiver - operator characteristic curves of four models for predicting composite major adverse events in 8907 patients within the confirm registry over a median of 2.1 years of follow - up. model 2 (morise score + cac score) was superior to model 1 (symptoms and risk factors alone by morise score), p 0) ; revasc, revascularization occurring > 90 days following coronary cta. adapted with permission from villines tc,. [34 ] based on the data discussed above, when taken in aggregate, cac testing in symptomatic patients performs reasonably well for excluding significant cad in symptomatic patients, based primarily on its high sensitivity and npv. first, unlike comparable testing options, cac scoring is a marker of cad burden and not a direct anatomic or physiologic assessment of stenosis or ischemia, respectively, the primary features that typically guide treatment in symptomatic patients. in addition, based on the fact that calcification occurs relatively late in the atherosclerotic process, cac testing in younger patients, in whom a smaller percentage of atherosclerosis may be calcified, may lead to false negative tests. for example, it has been reported that up to 47% of patients at autopsy during their third decade of life have identifiable coronary plaque but only about 3% of these lesions were calcified. additionally, symptomatic patients with absent cac and significant cad are more likely to be smokers and have a family history of premature cad [34 ]. conversely, performance of cac in older symptomatic patients, a cohort with higher cac prevalence, may lead to the need for additional testing as a larger percentage of patients will have cac > 0. ultimately, the primary issue that should limit the use of cac testing in symptomatic patients is that of diagnostic inefficiency related to the high rate of additional non - invasive testing (test layering) required for patients with positive cac when a for example, from within the confirm registry, a low - intermediate risk cohort that would generally qualify for cac testing according to nice guidelines, 49% of patients had a cac score > 0. hence, the performance of up - front cac scoring would have led to approximately half of all patients requiring an early secondary non - invasive test for further evaluation. in practice, we suspect that subsequent testing would generally be stress imaging tests given the limitations of exercise ecg alone, adding to evaluation costs, time to diagnosis and an increase in radiation exposure associated with radionucleotide imaging. in fact, some authors recommend direct invasive coronary angiography for those with high calcium scores (> 400) despite atypical symptoms and a lack of any testing suggesting ischemia. an additional consideration that favors coronary cta as the preferred ct - based test for symptomatic patients, in addition to the improved prognostic performance and lack of significant test layering, is the fact that the average radiation exposure for patients undergoing coronary cta in most experienced centers is < 5 msv and is often comparable to the effective radiation dose seen in cac scanning. though several peer - reviewed cost comparisons exist for current noninvasive modalities [5967 ], similar data comparing cac to the usual care of symptomatic patients is limited. while recent nice guidelines provide an interesting assessment of potential cost savings of a cac first strategy in low - risk symptomatic patients, it should be cautioned that this cost analysis was primarily aimed toward patients with stable chest pain and, thus, should not be extended to patients with acute symptoms, a touted setting for cac application [2 ]. citing expert opinion, the nice cost analysis assumed a sensitivity for cta of 80% for the detection of stenosis of at least 70%, which is lower than the sensitivites included for both spect (86%) and cac only (89%). this assumption ignores significant literature, including several multi - center studies of the accuracy of coronary cta, reporting coronary cta as the most sensitive non - invasive test for ruling out significant cad. among patients with acute symptoms in whom cac testing has been potentially advocated for use, we recognize that cac testing is attractive based on its relatively low cost, reproducibility, ease of performance and interpretation, and potential use after business hours when other modalities requiring more logistical support such as stress echocardiogram, spect and coronary cta may be unavailable. however, it is important to note that the binary use of cac scanning in symptomatic patients has not been rigorously validated in a large, prospective, multicenter manner. conversely, coronary cta has been recently shown in several recent prospective, multi - center trials to be safe, accurate and cost - efficient when performed early for patients with acute chest pain ; making it, in our opinion, the preferred testing strategy for patients with acute symptoms not at high pre - test risk who are felt to require further testing. coronary artery calcium testing in asymptomatic patients has been shown to significantly improve cardiovascular risk prediction beyond that provided by standard cardiovascular risk variables. among symptomatic patients, cac testing has generally high sensitivity and npv for excluding significant cad and subsequent adverse cardiovascular events when performed in low - intermediate risk patients. however, the widespread clinical application of cac testing in symptomatic patients may be significantly limited by the high prevalence of coronary calcification in the population and low specificity of cac for obstructive cad, requiring high rates of additional testing to exclude significant cad in most symptomatic populations as compared to the use of other standard non - invasive tests. in light of its potential diagnostic inefficiency and the absence of large - scale, prospective studies demonstrating the accuracy, safety and cost - effectiveness of a cac - first approach, and recognizing the progressively lower radiation doses and comparably favorable prognostic information obtained using modern coronary cta, we feel that coronary cta is the preferred ct - based test for symptomatic patients. | the detection and quantification of coronary artery calcification (cac) significantly improves cardiovascular risk prediction in asymptomatic patients. many have advocated for expanded cac testing in symptomatic patients based on data demonstrating that the absence of quantifiable cac in patients with possible angina makes obstructive coronary artery disease (cad) and subsequent adverse events highly unlikely. however, the widespread use of cac testing in symptomatic patients may be limited by the high background prevalence of cac and its low specificity for obstructive cad, necessitating additional testing (test layering) in a large percentage of eligible patients. further, adequately powered prospective studies validating the comparative effectiveness of a cac first approach with regards to cost, safety, accuracy and clinical outcomes are lacking. due to marked reductions in patient radiation exposure and higher comparative accuracy and prognostic value make coronary computed tomographic angiography the preferred ct - based test for appropriately selected symptomatic patients. |
a flow diagram of the algorithm is shown in figure 1. to implement this procedure for a given model it is necessary to define bounds for input parameters and model outputs (e.g., steady states or dynamic behavior). if bounds can not be defined empirically, feasible ranges of parameter values can be asserted from physiological knowledge or theoretical considerations. for example, the tissue concentration of a species may not be known, but typical weight and water content of that tissue may be known, which allows us to put an upper limit on the species concentration. overview of algorithm for efficient generation and prevalencebased selection of virtual patients. to generate virtual patients from a model, the prior information (green boxes) a virtual population is constructed by selecting from this population with probability proportional to the prevalence in the real population relative to the prevalence in the plausible population. this selection is optimized to produce the best virtual population given the patients in the plausible population. we have provided a detailed description of terminology, definitions, and the derivation of this algorithm in table 1 and the supplementary material. we define these patients as a parameter set for which every component of the model (whether it be the parameter values themselves, computed species concentrations, or combinations of these that are experimentally measurable) falls into a biologically plausible range. from this plausible population we can then select the virtual population such that it matches the empirical distribution of interest. this is achieved by calculating a probability of inclusion of a plausible patient into the virtual population. this probability is computed from both the empirical distribution and the density of plausible patients (see supplementary materials for more details). an overview of the terminology used in this article an important prerequisite to this approach is the ability to generate a large number of plausible patients within the region of the empirical data. to accelerate this process we take an initial parameter guess (within the predefined bounds) and optimize this choice until the required outputs are within physiologically plausible ranges. rather than optimize to specific points, it is more efficient to be agnostic as to where in the plausible ranges the optimization routine ends. to implement this we shift the typical cost function f(p) we would use optimizing a model to a new function, g(p), where we consider both as purely dependent on the parameter if we constrain parameters using a number of model outputs mi(p), with data di then f (in the simplest, unweighted case) would be : f(p) = (mi(p)di)2. to generate plausible patients, we modify this sumofsquared errors expression to : g(p) = imax[(mi(p)li+ui2)2(ui2li2)2,0]where ui and li are the predefined plausible upper and lower bounds, respectively, for mi(p). this expression ensures that if mi(p) is in the plausible range then the contribution of the corresponding term in the expression is zero. the effect of replacing f(p) with g(p) is visualized in 2d in figure 2. outputs of the model contribute to the cost function to be minimized by considering the sum of squared errors (sse) from an associated experimental observation. for each observation we define a physiologically plausible range (arrows in a, b) and shift the sse associated with that observation so that it is zero if the model output is in this range (a, b). combining these transformations in each dimension leads to a broader cost function that is minimized by many points, rather than one (black rectangle in c). to test this approach we used a previously published model of cholesterol metabolism.17 we chose this model because we could use publicly available data from the nhanes database16 to establish the empirical multivariate distribution for ldl cholesterol, hdl cholesterol, and total cholesterol (ldlc, hdlc, and tc, respectively). note that the distribution of these variables is well approximated by a multivariate lognormal distribution (supplementary figure 1). for the remainder of the article we will describe these variables, either as model outputs or from nhanes, in log units (prior to taking the logarithm, units are mg / dl for cholesterol measures). the published version of this model does not explicitly calculate ldlc or tc ; instead, the outputs are hdlc and nonhdlc. from these two quantities tc is easily calculated. for full comparison with the nhanes data we introduced a new parameter to the model, input_ranges.m gives details on parameter and output ranges for the van de pas model. also in the supplementary material is the code used in this case, which is easily modifiable for application to other models. as expected, the initial plausible population does not match the populationlevel statistics of the nhanes data (figure 3) but covers the empirical distribution (i.e., where there are likely to be empirical observations there are plausible patients). comparison of the initial plausible population (n = 300,000) with nhanes multivariate distribution ((ac) black dotted lines estimated pdf, supplementary figure 1ac. (df) 2d projection of the 95% confidence surface of the estimated probability density function). once calculated, we established that most of the plausible patients are highly unlikely to be in the final distribution (figure 4). this is due to the relative density of the plausible population to the empirical distribution. with these probabilities, only 2% of the plausible population was selected to be in the virtual population (inset, figure 4). based on examining goodnessoffit of the distributions it appears, in this case, there is no further value in increasing the size of the plausible population (supplementary figure 2). the red histogram (main figure, and figure inset) is a virtual population that matches nhanes data, and is selected from the plausible population (blue histogram) based on displayed probability. the distribution of an example selection fits the nhanes data well (figure 5). the 1d histograms (when normalized for comparison with the nhanes probability density function) are indistinguishable from the data (figure 5 a c) and the correlations between variables also match the data based on visual predictive check. the virtual population (red dots and red histogram) matches the mean, variance, and covariance of the multivariate experimental distribution ((ac) black dotted lines estimated probability density function, supplementary figure 1ac. (df) 2d projection of the 95% confidence surface of the estimated pdf). when selecting a subset of vps from a larger population, one concern is that the selected subset of vps does not reflect the variability of the original ensemble, which was generated from the biologically plausible range of the parameters. analyzing the final fitted population, we found little change in either the distribution of parameters or the correlation structure between the parameters (figure 6 and supplementary figure 3). this also shows that despite the virtual population being constrained against the nhanes data the parameter values of the virtual population (figure 6 b) are only slightly better constrained than those of the plausible population. furthermore, correlations between parameters are only slightly increased in the virtual population (figure 6 d) vs. the plausible population (figure 6 c). at least in this case, constraining all outputs into realistic ranges is a more stringent constraint than selection of a virtual population. violin plots of the plausible and virtual populations (a, b, respectively) parameter values (normalized to each parameter 's upper and lower bounds) and correlation matrix of the plausible and virtual population (c, d, respectively). one of the primary uses for qsp models is to prospectively simulate the effects of a dynamic perturbation (pharmacological or otherwise) in populations of interest. due to the underconstrained nature of these models it would be difficult to have confidence in the simulation results if we simulated a single parameterization of that model, even if that set of parameters is an excellent fit to the available data. for example, imagine creating a single hypercholesterolemia vp to simulate the effect of various anticholesterol therapies. for the baseline characteristics of the vpop, we have good data for the expected mean ldl and hdl (e.g., a prior clinical cohort), but we could still choose to mechanistically represent hypercholesterolemia several ways using the same model. we could increase cholesterol production, decrease clearance, or apply some combination of both. our choice of how to parameterize that vp could have significant consequences for the sensitivity of the followon therapy simulations. having impaired production vs. clearance of ldl could lead to differential responses to statins (production) vs. antiproprotein convertase subtillisin / kexin type 9 (clearance). a better approach is to explore the underconstrained nature of these models and sample the biological uncertainty in the creation of plausible patients by varying mechanistic parameters, such as production and clearance rates, within biologically reasonable ranges. simultaneously, we need to constrain the higherlevel observables of the model based on known population distributions (e.g., the baseline characteristics of a clinical trial cohort). an appealing aspect of the approach we outline is that, since the algorithm is probabilistic, once the plausible patients are generated any number of subpopulations can be selected as long as the generated patients reasonably cover the full range of the (sub)population. additionally, for any particular population, any number of vpops can be reselected to bootstrap the sensitivity of the model predictions to the choice of vpop. achieving an acceptable fit to the data distribution however, if we have higherorder density functions, we will likely require additional gains in efficiency, above and beyond what is presented here, in methods for generating sufficient plausible patients. one potential avenue, for a future iteration of this algorithm, may be to use methods that follow a directed search through the parameter space, such as using markov chain monte carlo (mcmc) algorithms.18, 19, 20 however, it should be noted that the method presented here is in fact a hybrid approach because the simulated annealing step, used to generate a plausible patient is essentially an mcmc method. the advantage of this approach is it generates plausible patients (and hence virtual patients) independently which is critical for the purpose of making a virtual population. also, once the plausible population is established new virtual populations, suitable for new applications, can be selected. however, a limitation of our approach is the computational cost of generating large plausible populations, which may make this method unfeasible in models that are slow to simulate. it should be noted that prior methods13, 14 generated smaller virtual populations in larger models, partly due to the computational cost of running the models. nevertheless, the computational efficiency of a model does not alter the necessity for exploring the parameter space (which in this context equates to larger virtual populations). we therefore advocate for the optimization of large models for speed, such that a fuller exploration of parameter uncertainty is possible (either via the method presented here or alternatives). it is important to remark that the larger the model (specifically, in terms of the number of poorly constrained parameters) the greater the necessity for larger virtual populations to attempt to account for the uncertainty inherent in such a model. an advantage of our technique over prior approaches is that it is relatively unbiased, while still leveraging all available information on possible parameter values. the approach by klinke may overweight spurious model solutions, whereas the approach by schmidt. requires binning of parameter values into mechanistic axis which, for axes containing more than one parameter, requires an assumption about the correlation between parameters in the population of interest that may not be supported by available data. as an introduction to this algorithm, we demonstrated how to generate a vpop that matches the baseline characteristics of a population or clinical cohort ; however, in practice, a dynamic model should be constrained additionally against as many inscope perturbation experiments as possible (determined by available data). for this example, simulating changes in ldlc and tc to standardofcare lipid therapies, such as statins and ezetimibe, would likely be an important step before using the model to predict the response to a novel mechanism. ideally, information would be available detailing the distribution of the data before and after the application of therapy (i.e., not just summary statistics). the therapeutic response can be treated as a baseline constraint for vp selection, just as we used hdlc and tc at baseline. we have applied this approach, without major adaptation, to an unpublished model of chronic kidney disease (42 ordinary differential equations (odes), 200 parameters) and to a model of body weight change6 (8 odes, 50 parameters) ; we have made a brief summary of the results in these cases available.21 one challenge that we foresee, for virtual populations in general (i.e., not specific to this approach), is development of efficient ways to combine populations when merging distinct models. we believe that for two models that have large validated virtual populations, navely combining every possibility will be computationally daunting. quantitative systems pharmacology models are becoming established as a valuable component of the drug discovery and development process. communicating their complexity and uncertainty to an interdisciplinary project team is a critical but challenging component of their utility. virtual populations are one tool that we have found to be successful in exploring mechanistic and parametric uncertainty in an intuitive framework that is easily understandable by most audiences. however, despite their widespread use, there are very few published methods for generating virtual patients and forming virtual populations. here we have contributed an approach to efficiently generate virtual patients and construct a virtual population for which each patient is weighted equally. plausible populations, made up of plausible patients each of which is a candidate to become a virtual patient. because a large plausible population is necessary, models that are slow to integrate (for example, with dynamics across multiple timescales) may not be good candidates for this approach. however, in cases where quantitative predictions are required and the model is amenable to thorough examination of parameter space, we have found this method to be an improvement over previous approaches. supporting information click here for additional data file. supporting information click here for additional data file. supporting information click here for additional data file. supporting information click here for additional data file. | quantitative systems pharmacology models mechanistically describe a biological system and the effect of drug treatment on system behavior. because these models rarely are identifiable from the available data, the uncertainty in physiological parameters may be sampled to create alternative parameterizations of the model, sometimes termed virtual patients. in order to reproduce the statistics of a clinical population, virtual patients are often weighted to form a virtual population that reflects the baseline characteristics of the clinical cohort. here we introduce a novel technique to efficiently generate virtual patients and, from this ensemble, demonstrate how to select a virtual population that matches the observed data without the need for weighting. this approach improves confidence in model predictions by mitigating the risk that spurious virtual patients become overrepresented in virtual populations. |
in type 2 diabetes mellitus (t2 dm), a prevalent disease characterized by chronic hyperglycemia, the function of -cells responsible for insulin secretion declines progressively together with increasing insulin resistance in target cells. treatment options for t2 dm include oral antidiabetes drugs (eg, the biguanide metformin, sulfonylureas, meglitinides, thiazolidinediones, dipeptidyl peptidase-4 [dpp-4 ] inhibitors, -glucosidase inhibitors, bromocriptine, and the bile acid sequestrant colesevelam), and noninsulin injectable agents (eg, glucagon - like peptide-1 [glp-1 ] receptor agonists), as well as insulin replacement therapy for patients who do not achieve goals on noninsulin therapy or who experience symptomatic hyperglycemia.1,2 the mechanisms of action vary among the different classes of antidiabetes drugs, allowing for use of agents with different and complementary mechanisms of action in patients with t2 dm who require combination therapy.1,2 colesevelam is a polymeric bile acid sequestrant initially used as a lipid - lowering therapy. it is comprised of a polymer backbone with numerous hydrophobic side chains that were specifically added to enhance the binding of bile acids. these side chains make colesevelam differ structurally from conventional bile acid sequestrants and result in a high - affinity, high - specificity, and high - capacity for binding bile acids.3 colesevelam is not absorbed systemically and is excreted unchanged entirely through the gastrointestinal system.4 colesevelam was later found to have beneficial effects on glycemic control in t2 dm, leading to its approval by the us food and drug administration for this indication. however, its mechanism of action for glucose lowering is not completely understood. a number of studies in animal models have contributed to the current hypotheses regarding the mechanism. colesevelam increased portal levels of the incretin hormone glp-1 in mice and rats with diet - induced obesity (dio).5,6 in mice, this effect was shown to be mediated by activation of tgr5 in the colon by bile acids bound to colesevelam. glp-1 signaling led to suppression of hepatic glycogenolysis and improved hepatic glucose metabolism in dio mice.5 the glycemic effects of colesevelam may also be attributable in part to increased glucose clearance via reduced activity of the farnesoid x receptor (fxr), as observed in obese diabetic mice.7 in a murine model of genetic obesity, colesevelam improved glucose homeostasis, but this effect was not observed in mice with fxr deficiency.8 in addition to these nonclinical studies, a number of clinical studies have also contributed to the current understanding of the glucose - lowering mechanism of colesevelam.9 the purpose of this article is to review the relevant findings of these clinical studies in more detail and consider the putative mechanism of glycemic effects of colesevelam in light of the mechanism of action of other antidiabetes drugs. insulin resistance is a key component of the pathophysiology of t2dm;10 therefore, one approach to treating t2 dm is to increase insulin sensitivity. thiazolidinediones improve insulin resistance by increasing insulin - stimulated glucose disposal in skeletal muscle.11 a number of clinical trials involving colesevelam included assessments that provide insight into whether an effect on insulin sensitivity is relevant to colesevelam. a 16-week study comparing the effects of adding colesevelam, sitagliptin, or rosiglitazone to existing metformin therapy in subjects with t2 dm showed a significant reduction from baseline in index of insulin resistance estimated by homeostatic model assessment (homa - ir) with rosiglitazone (1.305 ; p = 0.0085), but not colesevelam or sitagliptin.12 colesevelam also had no effect on homa - ir in placebo - controlled studies in subjects with t2 dm in which study medication was added to metformin-, sulfonylurea-, or insulin - based therapy (unpublished data).13,14 in additional placebo - controlled studies that measured insulin sensitivity in subjects with t2 dm using the insulin clamp method, colesevelam had no effect on peripheral or hepatic insulin sensitivity.15,16 similarly, colesevelam had no effect on insulin sensitivity measured by an extended glucose tolerance test in a study involving men with the metabolic syndrome.17 in addition to these measurements of insulin resistance / sensitivity, assessments in the placebo - controlled studies of colesevelam when added to metformin-, sulfonylurea-, or insulin - based therapy included parameters with relevance to insulin resistance. in these studies, colesevelam had no effect on fasting insulin level (unpublished data),13,18 which may be used as a marker for insulin resistance,19 levels of adiponectin (unpublished data),13 which decreases insulin resistance,20 or fasting levels of free fatty acids (unpublished data), which induce insulin resistance.21 colesevelam is not associated with weight gain and edema, adverse effects that are known to occur with thiazolidinediones.22,23 together with the findings regarding the lack of effect on insulin sensitivity, these observations suggest that the mechanism(s) of glucose lowering by colesevelam is not similar to those of thiazolidinediones. another key component of the pathophysiology of t2 dm is impaired function of beta cells and reduced secretion of insulin.10 insulin secretagogues such as sulfonylureas and meglitinides treat t2 dm by enhancing insulin release by the pancreas.2 a number of clinical trials included assessments that provide insight into whether colesevelam effects insulin secretion. in two studies in subjects with t2 dm receiving colesevelam or placebo for 8 or 12 weeks, there were no significant differences between treatments in change from baseline in area under the curve for insulin following a meal tolerance test.15,16 administration of colesevelam for 12 weeks also had no effect on insulin secretion, as estimated using the oral minimal model, in subjects with t2dm.24 furthermore, as noted above, colesevelam had no effect on fasting (unpublished data)13,18 or postprandial18 insulin levels in placebo - controlled studies in subjects with t2 dm in which study medication was added to metformin-, sulfonylurea-, or insulin - based therapy. colesevelam is not associated with weight gain or an increased incidence of hypoglycemia, adverse effects that are known to occur with insulin secretagogues.25 together with the findings regarding the lack of an effect on insulin secretion, these observations suggest that the mechanism(s) of glucose lowering by colesevelam is not similar to sulfonylureas and meglitinides. another approach to the treatment of hyperglycemia in t2 dm is to inhibit the absorption of glucose from dietary sources. -glucosidase inhibitors are intestinal absorption inhibitors that delay the digestion and absorption of carbohydrates by competitively binding to -glucosidase enzymes.2,26 a number of clinical trials involving colesevelam included assessments that provide insight into whether an effect on glucose absorption is relevant to colesevelam. long - term administration of colesevelam, compared with placebo, did not affect glucose absorption (as indicated by area under the glucose curve [aucg ]) following an oral glucose or meal tolerance test in studies in subjects with t2dm.15,16 in addition, a study assessing glucose absorption based on appearance rate in subjects with t2 dm showed that colesevelam had no effect on the appearance of meal - derived glucose compared with placebo.14 however, other studies indicate possible effects upon glucose absorption, likely via a mechanism that differs from that of -glucosidase inhibitors. in subjects with impaired fasting glucose, post meal tolerance test incremental aucg was reduced with colesevelam (from 249.3198.8 mmol / l min ; p < 0.01). no gastrointestinal - derived peptides were altered except for cholecystokinin, which showed an increase in incremental auc (from 43.2127.1 pm min ; p < 0.01).27 marina suggested that the increase in cholecystokinin may have been associated with slowed gastric emptying. gastric emptying was not assessed in their study,27 but a previous study showed that colesevelam moderately delayed gastric emptying versus placebo in subjects with diarrhea - predominant irritable bowel syndrome, although the difference was not significant.28 smushkin suggested decreased intestinal absorption or increased hepatic uptake of glucose as the explanation for the reduction in the integrated rate of meal appearance they observed with colesevelam compared with placebo in subjects with t2 dm (5191 vs 5817 mmol / kg/6 h ; p = 0.04). in patients with long - standing t2 dm, diabetic gastroparesis may also affect the postprandial glucose profile.29 while -glucosidase inhibitors are associated with diarrhea as an adverse effect,2 colesevelam is instead associated with constipation. together with the studies assessing the effects of colesevelam on glucose absorption, these observations suggest that while colesevelam may have some effect on glucose absorption, its effects are otherwise not similar to those of -glucosidase inhibitors. in t2 dm, loss of the first phase insulin response to glucose is among the first detectable effects of beta - cell dysfunction,30 while hypersecretion of glucagon contributes to glucose dysregulation.31 dpp-4 inhibitors increase insulin secretion and decrease glucagon secretion (both glucose - dependent).2 a number of clinical trials involving colesevelam included assessments that provide insight into whether an effect on early insulin response or glucagon is relevant to colesevelam. in a placebo - controlled study in subjects with t2 dm, colesevelam did not restore first - phase insulin response or disposition index, a measure of -cell function ; in addition, plasma glucagon levels were unaffected.24 in another study in subjects with impaired fasting glucose, results from a frequently sampled intravenous glucose tolerance test followed by a meal tolerance test showed no effect of colesevelam on insulin sensitivity index (isi), acute insulin (airg), c - peptide, proinsulin responses to glucose, or disposition index (the product of airg and isi). in addition, plasma glucagon levels were unaffected.27 thus, these findings suggest that the mechanism(s) of glucose lowering by colesevelam is not like that of dpp-4 inhibitors. excessive hepatic glucose production contributes to fasting hyperglycemia in t2dm.32 biguanides, including the widely used metformin, decrease hepatic glucose production.2 a number of clinical trials involving colesevelam included assessments that provide insight into whether an effect on hepatic glucose production is relevant to colesevelam. in subjects with t2 dm, administration of colesevelam versus placebo resulted in a reduction of fasting glucose levels (7.0 vs 6.6 mmol / l ; p = 0.004) and a corresponding reduction of postprandial glucose levels (3145 vs 2896 mmol/6 h ; p = 0.01).24 the shape of the postprandial glucose curve did not change, but was shifted down after colesevelam treatment, suggesting an effect on hepatic glucose production. another study in subjects with t2 dm showed that colesevelam had no effect on hepatic gluconeogenesis, and glycogenolysis in the fasting state increased significantly in the placebo group (p = 0.05 vs baseline), but not in the colesevelam group, although the treatment difference was not significant.14 these observations suggest that while there may be certain similar aspects to the mechanisms of colesevelam and metformin with both having hepatic effects, the divergent effects on gluconeogenesis versus glycogenolysis still suggest that the glucose - lowering mechanism(s) of colesevelam differs from that of metformin. the effects of colesevelam described above could potentially be related to an effect on incretins. studies indicate that administration of glp-1 or a glp-1 receptor agonist, or increasing glp-1 levels via dpp-4 inhibition, results in reduced fasting endogenous glucose production, due to a reduction in glycogenolysis, and increased hepatic glucose disposal.3335 a number of studies have explored the effects of colesevelam on incretins. in a study in t2 dm, colesevelam versus placebo showed an increase in fasting total glp-1 (least - squares mean treatment difference 1.0 pm ; p < 0.05) (unpublished data). another study showed a significant increase from baseline in fasting total glp-1 with colesevelam (from 18.321.9 pm ; p = 0.006), although the increase was not significant compared with placebo.24 in a third placebo - controlled study in t2 dm, colesevelam increased fasting total glp-1 (treatment difference 10 pm ; p < 0.05), postprandial total glp-1 auc (8 pm min ; p < 0.01), and total glucose - dependent insulinotropic polypeptide auc (13 pm min ; p < 0.001). the increase in glp-1 may have caused the effect on hepatic glycogenolysis observed with colesevelam in this study.14 although the liver lacks glp-1 receptors, hepatic glycogen synthesis has been shown to be regulated via glp-1 receptors in the brain.36 an increase from baseline in 2-hour postprandial glp-1 levels (from 64 to 72 pm ; p = 0.015), but not preprandial or 1-hour postprandial levels, has also been seen with administration of the bile acid sequestrant colestimide in subjects with t2dm.37 based on the observations discussed, the mechanism of action of colesevelam appears to be unlike that of other antidiabetes medications. since the pharmacological rationale for combination therapy is to use agents from different pharmacological classes and/or with complementary mechanisms, our observations suggest that colesevelam is potentially a good partner for many of the currently available oral antidiabetes drugs and injectable antidiabetes drugs (including insulin and glp-1 agonists). based on both nonclinical and clinical evidence, colesevelam is thought to be a portal glp-1 secretagogue, with effects primarily on the liver. current evidence suggests that bile acid binding by colesevelam results in activation of tgr5, a g protein - coupled receptor for bile acids, leading to the increased secretion of glp-1 or other incretins and inhibition of hepatic glycogenolysis (unpublished data).14,24,38 | colesevelam s glucose - lowering mechanism of action is not completely understood. clinical trials of colesevelam suggest that its mechanism, and often adverse effects, differ from those of other oral antidiabetes drugs. colesevelam does not affect insulin sensitivity (unlike thiazolidinediones), insulin secretion (unlike sulfonylureas and meglitinides), or early insulin response or glucagon (unlike dipeptidyl peptidase-4 inhibitors). colesevelam may have some effect on glucose absorption, but likely via a different mechanism than -glucosidase inhibitors. colesevelam and metformin have similarities regarding hepatic glucose production, but divergent effects on gluconeogenesis versus glycogenolysis, suggesting differing mechanisms of drug action for improving glycemic control. colesevelam is thought to be a portal glucagon - like peptide-1 (glp-1) secretagogue with primarily hepatic effects. bile acid binding by colesevelam leads to tgr5 activation, increased secretion of glp-1 or other incretins, and inhibition of hepatic glycogenolysis. colesevelam s mechanism of action appears to be atypical of other antidiabetes medications, making it a potentially suitable component of many combination regimens in the treatment of type 2 diabetes. |
glaucoma surgery is ripe for innovation. in the last few years, there has been a substantial increase in the number of devices approaching commercialization. while not all that is new is necessarily good, the role of these devices in changing glaucoma surgery is equally important in terms of both success and failure. trabeculectomy, the most commonly performed incisional filtration surgery for glaucoma, is subjective by nature and certainly has risks. as devices aim to standardize glaucoma surgery, specifically subconjunctival filtration surgery, predictability and in turn safety should theoretically improve. this may allow the glaucoma surgeon to intervene earlier in the disease process, prevent more advanced vision loss and potentially decrease the burden of medications. |
|
currently, the combined prevalence of overweight (bmi, body mass index 25 kg / m) and obesity (bmi 30 kg / m), defined by the world health organization (who) [1, 2 ], has ranged from approximately 50 to 65 percent in large samples of persons with ms [35 ]. these estimates may not differ considerably from those of nondiseased adult populations, but weight status may have important consequences for mobility and the accumulation of disability in persons with ms. mobility, assessed by a variety of measures, is compromised in nondiseased persons who carry excess body weight. compared to normal weight persons, those who were obese walked at slower speeds and covered less distance during a 6-minute walk (6mw) test. a higher oxygen cost of walking (cw) has been established in nondiseased obese adults compared to adults of normal weight. altered gait kinematics including slower walking speed, shorter stride length, and more time spent in stance phase and double support during walking have further been observed in obese compared to normal - weight adults. such results in nondiseased populations would support the idea that weight status might similarly be a source of mobility dysfunction seen in persons with ms [1013 ]. our group has recently investigated the prospective relationship between self - reported bmi and disability, assessed by the patient determined disease status (pdds) scale, over a 24-month period in a large sample of persons with ms. interestingly, we observed a progression in disability status over time, but this change was not accompanied by, nor predicted by, a change in self - reported bmi. a comprehensive assessment of mobility may capture different information than that captured by the pdds alone, and may be affected by weight status in persons with ms, as seen in nondiseased obese populations. measures that assess mobility in persons with neurological disorders have been described by pearson.. these include timed walking tests, endurance tests, quantitative movement analysis, energy consumption, self - report questionnaires, and activity monitoring. we examined the effect of weight status on a comprehensive set of mobility outcomes, including ambulatory performance, cw, spatiotemporal parameters of gait, self - reported walking impairment, and free - living activity in persons with ms. based on previous research in healthy controls and mobility impairments in persons with ms, we expected that weight status would negatively impact outcomes of mobility, resulting in greater mobility impairment in persons with a higher bmi. such an examination is important given the prevalence of overweight and obesity in persons with ms and the possible impact this comorbidity may have on health and disease status. if weight status is important to mobility in persons with ms, targeted weight loss interventions may represent alterative and potential adjunct strategies for managing the consequences of this disease. participants were included in this investigation based on four criteria : a clinically definite diagnosis of ms ; free of a relapse in the past 30 days prior to completing testing procedures ; age 18 years ; and ambulatory either with or without the use of an assistive device. height and weight were collected using a calibrated, scale - stadiometer unit (detecto model 3p7044, webb city, mo, usa) while participants were wearing light clothing and athletic shoes. bmi was classified as follows : normal weight, bmi = 18.524.9 kg / m ; overweight, bmi = 25.029.9 kg / m ; obese, classes i and ii, bmi = 30.039.9 kg / m. the timed 25-foot walk (t25fw) and the 6-minute walk (6mw) assessed walking speed and endurance, respectively. the 6mw was performed in a single corridor that was 75 ft in length or in a square hallway with four corridors that were 100 ft in length, depending on the testing location. participants were instructed to walk as fast and far as possible for the duration of 6 minutes according to standardized instructions and were permitted to use an assistive device if necessary. total distance walked in meters was quantified by a member of the research team who followed 1 meter behind the participant with a measuring wheel (stanley ms50, new briton, ct, usa). oxygen consumption (vo2) was assessed during the 6mw by breath - by - breath analysis using a commercially available portable metabolic unit (k4b2, cosmed, italy). the o2 and co2 sensors of the portable metabolic system and the flow meter were calibrated prior to all testing sessions. vo2 (ml / kg / min) values collected over the second 3 minutes of the 6mw were used to generate steady - state vo2. cw (ml / kg / m) was determined by dividing steady state vo2 (ml / kg / min) by walking speed (m / min). participants performed two walking trials at a comfortable pace using a gaitrite (cir systems, inc.) electronic walkway. gait parameters collected included walking velocity (cm / s), cadence (steps / min), step length (cm), step time (s), double support (percentage of gait cycle), single support (percentage of gait cycle), and base of support (cm). the mean value of the two trials was generated for each of the 7 gait parameters. the msws-12 is a 12-item self - report scale that assesses the impact of ms on walking ability. each of the 12 items is rated on a scale ranging from 1 (not at all) to 5 (extremely). total scores on the msws-12 range from 0100, whereby higher scores indicate greater walking impairment. the pdds scale [19, 20 ] was used to determine the level of neurological disability of the participants. the pdds is a patient - reported scale ranging from 0 (normal) to 8 (bedridden), whereby higher scores indicate greater perceived disability. pdds scores have correlated strongly (r =.93) with scores on the physician - administered expanded disability status scale (edss). previous data collected by our research group supports a strong (=.78) association between pdds and edss scores. daily step and movement counts were assessed over a 7-day period using an actigraph accelerometer (model gt3x) (actigraph corporation, pensacola, fl, usa) worn on a belt around the waist. the accelerometer and this location on the body assess vertical bodily movement using a piezoelectric bender element that produces an electric signal proportional to the force acting upon it. data recorded and stored in the accelerometer were downloaded using actilife software and processed using microsoft excel. step counts and movement counts for each minute were summed for each of the 7 days and then averaged across the 7-day period. participants competed testing at one of two locations : the exercise neuroscience laboratory, university of illinois, urbana, il, usa or the illinois neurologic institute, peoria, il, usa. spatial and temporal parameters of gait were collected over two walking trials on an electronic walkway. participants then completed questionnaires assessing the impact of ms on walking impairment and self - reported neurological disability. upon completion of the testing session, participants were given an accelerometer to wear around the waist over the nondominant hip during the waking hours of the day, except while showering, bathing, and swimming, over 7 consecutive days. waking hours were defined as the moment of getting out of bed in the morning through the moment of getting into bed at night. participants were instructed to maintain typical levels of ambulatory activity during this one - week period. participants were provided with a log sheet to record times when the accelerometer was worn each day. the accelerometer was returned through the us postal service in a preaddressed, prestamped envelope provided by the investigators. values in the text are presented as mean (sd), unless otherwise specified. one - way ancova controlling for age, sex, and disease duration was conducted to determine differences between groups based on bmi classification (i.e., normal weight, overweight, and obese) on t25fw and 6mw performance, cw, 7 spatiotemporal gait parameters, msws-12 scores, and daily step and movement counts. the 13 measures included herein have been described by pearson. as outcomes for assessing walking mobility in neurological populations. an adjusted alpha level of p.004 was therefore used to account for the interrelated outcomes so as to avoid type i errors. effect sizes (ess) were calculated to determine the magnitude of the difference in mobility performance between bmi groups expressed as cohen 's d. guidelines of.2,.5, and.8 were used to determine small, moderate, and large effect sizes, respectively. this study included 168 persons (130 women, 38 men) with predominately a relapsing - remitting disease course (134 relapsing remitting ms ; 19 secondary progressive ms ; 11 primary progressive ms ; 4 not reported). mean age of participants was 50.9 (10.6) years (range = 2778 years) with a mean disease duration of 11.9 (9.3) years (range = 143 years). the median (iqr) pdds score was 3.0 (3.0) (i.e., gait disability) and ranged from 0 (i.e., normal) through 6 (i.e., bilateral support). mean bmi was 27.7 (5.1) kg / m (range = 18.639.3 kg / m) consistent with previous research involving bmi in ms [4, 5, 23 ]. the distribution of bmi scores was as follows : 52 (31.0%) participants were classified as normal weight ; 61 (36.3%) participants were classified as overweight ; and 55 (32.7%) participants were classified as obese. bmi distribution in our study was similar to previous ms samples, although the proportion of participants classified as overweight or obese was somewhat higher in the current investigation [35 ]. descriptive characteristics of mobility outcomes and differences along with ess by bmi classification are presented in table 2. mean time to perform the t25fw was 6.7 (4.1) seconds and did not differ significantly by bmi classification, f(2, 160) = 0.93, p =.40. participants in the sample walked a mean of 420.0 (138.5) meters during the 6mw test which was not significantly different based on bmi classification, f(2, 161) = 3.11, p =.05. small ess were observed for the difference between normal and obese groups on t25fw performance (.29), and between normal and overweight groups on 6mw performance (.27). mean cw in the sample was 0.225 (0.119) ml / kg / m. there was no significant difference between groups with respect to cw, f(2,157) = 3.32, p = 0.04, although a moderate es (.62) was observed for the difference in cw between normal weight and obese groups. the magnitude of the difference in cw between normal and overweight groups (.27), and between overweight and obese groups (.20) was small. none of the spatiotemporal gait parameters examined differed based on bmi : walking velocity, f(2, 159) = 2.53, p = 0.08 ; cadence, f(2, 159) = 1.64, p = 0.20 ; step length, f(2, 159) = 1.70, p = 0.19 ; step time, f(2, 159) = 1.00, p = 0.37 ; percentage of gait cycle spent in double support, f(2, 159) =.50, p = 0.61 ; percentage of gait cycle spent in single support, f(2, 159) =.49, p = 0.61 ; base of support, f(2, 159) = 0.37, p = 0.69. the magnitude of the difference between groups on gait parameters ranged from no effect to small (range =.02 to.34). mean msws-12 score for the sample was 42.8 (28.5) and was not significantly different based on bmi classification, f(2, 162) = 1.38, p =.26. mean daily step and movement counts were 4215.5 (2469.6) and 144725.7 (84828.8), respectively. there was no difference between bmi groups in free living mobility assessed by daily step, f(2, 159) = 2.43, p = 0.09, and daily movement counts, f(2, 159) = 1.15, p = 0.32. the magnitude of the difference in daily step counts between groups was small when normal weight and overweight groups were compared (.28), and when overweight and obese groups were compared (.31). this is the first study to provide descriptive and comparative data regarding objectively measured weight status and its association with a comprehensive set of mobility outcomes in a large sample of ambulatory persons with ms. almost 70% of the sample were identified as overweight or obese, classes i and ii (i.e., bmi = 25.039.9) ; however, weight status did not appear to have a consistent, large, or significant impact on mobility outcomes. nevertheless, the high prevalence of overweight and obesity in this sample may still have important health or disease consequences for persons with ms, but these seemingly do not involve mobility dysfunction. further, this emphasizes the importance of identifying and focusing on other factors which may be important to mobility in persons with ms. we did not establish any significant difference between bmi status on t25fw and 6mw performance, cw, spatiotemporal gait parameters, msws-12 scores, and free - living mobility outcomes. this was supported by generally small ess when comparing the magnitude of the difference between groups on mobility outcomes. overall, these findings are contrary to our expectations based on the influence of excess body weight on mobility outcomes established in nondiseased adult populations [79 ]. that body of research suggests superior ambulatory performance in normal - weight individuals without a chronic disease or condition. factors other than weight status might account for ambulatory problems in persons with ms and such factors are different from adults without a disease. factors which may contribute to impaired walking in persons with ms as outlined by pearson. include muscle weakness, spasticity, loss of proprioception and coordination, vestibular and visual dysfunction, cognitive and mood disturbances, and pain. to further evaluate and confirm the relationship between weight status and mobility, we conducted partial correlations between bmi and outcomes of mobility controlling for age, sex, and disease duration (data not presented). there was a mean partial correlation coefficient (sd) of.01 (.12) which ranged from.21 to.16. this further supports the evidence presented herein indicating weak, inconsistent associations between bmi and mobility in persons with ms ; such associations indicate that, at best, less than 4% of variance is shared between bmi and mobility outcomes. our findings are further in accordance with cross - sectional [5, 24 ] and prospective data which do not support a relationship between weight status (determined by bmi and percent body fat) and disability (determined by the edss, pdss, and a self - report functional ability) in persons with ms. the present study further provides a comprehensive assessment of the functional impact of weight status on both clinical and community mobility outcomes in a large sample of persons with ms which may provide different information than that captured by disability measures alone. collectively, this suggests that the effect of weight status on mobility is limited in persons with ms and that this relationship may differ from that established in the general nondiseased population. the lack of an association between weight status and mobility is important in suggesting that we should focus on other factors that may impact mobility in persons with ms. interestingly, a potential role for weight status in the development of ms has been suggested. before the age of 20, a high bmi (> 27.030.0) has been associated with a greater than twofold increase in the risk of developing ms [25, 26 ]. no association, however, was established between adult bmi and risk of ms [25, 26 ]. taken together with our current and previous findings, this suggests that weight status may be more influential during disease development than following disease onset, although this concept requires further investigation. the combined prevalence of overweight and obesity, classes i and ii (i.e., bmi = 25.039.9) in the current sample was 69.0 percent. this percentage is somewhat higher than values that have been observed by other investigators but is comparable to the general nondiseased adult population. for instance, 55.6 percent of individuals were classified as overweight and obese in a large sample of persons with ms (n = 8983). in a sample of veterans with ms, 53.0 percent of women and 63.3 percent of men were classified as overweight and obese. similarly, 53.2 percent of persons with ms were classified as overweight or obese in a previous investigation by our research group. those studies all used self - reported height and weight which may have led to an underestimation of overweight and obesity in these investigations. furthermore, our findings are consistent with those of the general nondiseased adult population in which 68.0 percent of persons were identified as overweight and obese. height and weight were assessed by the investigators using a scale stadiometer, rather than self - reported, in that cross - sectional, nationwide sample of healthy adults without disease. our results suggest bmi may be somewhat higher than previously thought in persons with ms, but similar to estimates in nondiseased adult populations. we observed that weight status does not appear to impact mobility outcomes, but the prevalence of excess body mass may still pose considerable health risks for persons with ms. obesity is a risk factor for a variety of chronic health conditions including diabetes, hypertension, high cholesterol, stroke, heart disease, certain cancers, and arthritis. obesity further is associated with cognitive outcomes in the general population and this might account, in part, for the extensive prevalence and burden of cognitive impairment in ms. persons with ms and health care providers should be aware and address additional health risks imposed by excess body weight. the present study provides comparative information on weight status and its effect on a comprehensive battery of mobility outcomes in a large sample of persons with ms. nevertheless, the generalizability of our conclusions is mainly limited to ambulatory, community - residing persons with ms who have a relapsing - remitting disease course. other outcomes such as waist circumference, body shape and composition, or fat distribution may have had different associations with mobility outcomes than those observed using bmi alone. future studies should include gold standard outcomes for the assessment of body composition, such as dual - energy x - ray absorptiometry (dxa), to further establish the relationship between weight status and mobility in persons with ms. this study might benefit from the inclusion of longitudinal data to determine the possible impact of changes in weight status on mobility outcomes over time, although our previous data using self - report measures would argue against such a prospective association between variables. the inclusion of symptomatic outcomes known to be influenced by obesity, such as pain and fatigue, may further impact mobility and should be included in future investigations. we provide the first evaluation of the effect of bmi on a comprehensive battery of mobility outcomes including ambulatory performance, cw, spatiotemporal parameters of gait, self - reported walking impairment, and free - living activity. there does not appear to be a consistent nor strong pattern of association between weight status and mobility, which differs from results observed in nondiseased adult populations. this highlights the importance of focusing on other factors that may impact mobility in persons with ms. the high proportion of persons with ms classified as overweight or obese in the current sample, nevertheless, remains a considerable health concern that requires better management. | the accumulation of excess body weight may have important health and disease consequences for persons with multiple sclerosis (ms). this study examined the effect of weight status on mobility using a comprehensive set of mobility outcomes including ambulatory performance (timed 25-foot walk, t25fw ; 6-minute walk, 6mw ; oxygen cost of walking, cw ; spatiotemporal parameters of gait ; self - reported walking impairment, multiple sclerosis walking scale-12 (msws-12) ; and free - living activity, accelerometry) in 168 ambulatory persons with ms. mean (sd) bmi was 27.7 (5.1) kg / m2. of the 168 participants, 31.0% were classified as normal weight (bmi = 18.524.9 kg / m2), 36.3% were classified as overweight (bmi = 25.029.9 kg / m2), and 32.7% were classified as obese, classes i and ii (bmi = 3039.9 kg / m2). there were no significant differences among bmi groups on t25fw and 6mw, cw, spatiotemporal gait parameters, msws-12, or daily step and movement counts. the prevalence of overweight and obesity in this sample was almost 70%, but there was not a consistent nor significant impact of bmi on outcomes of mobility. the lack of an effect of weight status on mobility emphasizes the need to focus on and identify other factors which may be important targets of ambulatory performance in persons with ms. |
nonalcoholic fatty liver disease (nafld) is a clinicopathological condition characterised by lipid deposition in the liver and is a common cause of liver dysfunction. the prevalence of nafld in asian population ranges from 9% to 45% and is estimated to be about 30% in western population. apart from an increased risk of liver - related morbidity and mortality, patients of nafld also have higher cardiovascular risk [3, 4 ] especially when present along with type 2 diabetes (t2 dm) [4, 5 ]. a balanced autonomic output to liver is important for maintenance of circadian rhythms of liver metabolic enzymes and glucose level. the autonomic symptom burden assessed by orthostatic grading scale was higher in nondiabetic nafld and the sudomotor dysfunction was also higher in the nafld after accounting for all confounders. a recent systematic review of 27 studies showed an association of nafld with subclinical atherosclerosis independent of traditional risk factors and metabolic syndrome. similar independent association of nafld with subclinical atherosclerosis has been observed in asian indians also. in other clinical settings, it has been shown that arterial stiffness is inversely related to heart rate variability [12, 13 ]. however, there are only a few studies in which heart rate variability has been evaluated in nafld [9, 14, 15 ]. a higher lf : hf ratio (low frequency : high frequency) of hrv was reported in patients (n = 18) with nafld along with a lower baroreflex sensitivity. the independent contribution of diabetes and grade of nafld in development of autonomic dysfunction is not known. the present study was designed to evaluate cardiovascular autonomic status in the patients of nafld with or without diabetes as compared to control population of individuals without either diabetes or nafld. in the present study we evaluated the association of indices of hrv with anthropometric variables, lipid profile, and diabetic status in patients with and without nafld. this was a cross - sectional study approved by the institute ethics committee of the all india institute of medical sciences (aiims), new delhi. informed written consent was obtained after explanation of the purpose, type, and duration of the study. the subjects were grouped into nafld patients without diabetes (n = 25, 13 females and 12 males), nafld patients with diabetes of 140 gm / week, any secondary cause of fatty liver, hereditary disorders, any severe acute or chronic illness, seropositivity for hepatitis b, hepatitis c, and hiv, established coronary heart disease, pregnancy, and lactation were excluded. diagnosis of nafld was made using ultrasonography performed by an experienced sonologist who was blinded to the clinical data of the patients, using a 3.5 mhz convex transducer by subcostal and intercostal approach (volusion, ge). all the subjects underwent anthropometric measurements and body composition analysis by bioelectrical impedance method as described earlier. height and weight were recorded to the nearest 0.1 cm and nearest 0.1 kg with stadiometer and electronic scale. body mass index (bmi) was calculated by weight (kg)/height (m). waist circumference (wc) was measured midway between the iliac crest and the lower most margin of the ribs. body fat and percentage body fat were estimated by foot - to - foot bioelectrical impedance technique (tanita, japan). biochemical measurements included liver function tests, fasting blood glucose (fbg) and postprandial blood glucose (ppbg) levels, and fasting lipid profile using standard methods as described earlier. serum levels of hscrp were measured using a commercially available reagent kit based on the principle of solid phase enzyme - linked immune sorbent assay (biocheck, inc. fasting insulin was measured using a commercially available reagent kit based on the principle of electrochemiluminescence (liaison insulin, diasorin inc. the homa - ir was calculated by using the following formula : homa - ir = fasting insulin (u / ml) fasting blood glucose (mmol / l)/22.5. the cardiovascular autonomic status was estimated in the autonomic function testing laboratory (aft lab), department of physiology, aiims, new delhi. the subject was requested to lie down on the couch where electrodes for lead ii ecg acquisition by labchart pro 7 (ad instruments, australia) were attached. after an initial period of rest of 5 minutes, a 5-minute lead ii ecg (sampling rate 1 khz) was recorded for later offline analysis. the subject was instructed to avoid movement during data acquisition to prevent artefacts in the recording. offline analysis of ecg was done using labchart pro 7 (ad instruments, australia) and hrv was computed using hemolab software (version 8.5, harald stauss scientific, iowa). for time domain analysis the beat - to - beat heart rate series was computed from ecg using labchart pro and was then exported as a.txt file. the file format was converted to.asc as required by the hemolab software for batch processing. the time domain indices of hrv computed were sdnn (standard deviation of all nn intervals), sdsd (standard deviation of differences between adjacent nn intervals), and pnn50% (nn50 count divided by the total number of all nn intervals). for frequency domain analysis rr intervals this was followed by spline interpolation at sampling frequency of 5 hz followed by the power spectral density (psd) calculation using fast fourier transformation (fft). the measurement of low frequency (lf : 0.040.15 hz) and high frequency (hf : 0.150.40 hz) power components was made in absolute values of power (ms). the powers were further normalized to account for changes in the total power of the hrv. quantitative data is expressed as mean sd for normally distributed data, and median with interquartile range (iqr) is used to express skewed data. for parametric data, one - way anova followed by tukey 's test was used and for nonparametric data kruskal wallis h test followed by dunn 's comparison was done. two - way anova was employed to evaluate the relative contribution of the diabetic status and grade of nafld. the anthropometric measures, biochemical investigation, and lead ii ecg recordings were measured in all the subjects. the data of 7 subjects in the nafld without diabetes group was excluded from hrv due to presence of artefacts that prevented computation. patients with nafld and diabetes were older (42.9 7.6 yrs) than patients with nafld without diabetes (41.8 7.3 yrs) and controls (37.9 8.4 yrs). the bmi, fat mass, and fat percentage were higher in nafld with diabetes group as well as nafld without diabetes group as compared to the controls but there was no difference between nafld with and without diabetes. value of whr was higher only in nafld without diabetes as compared to the controls. the fat percentage was the only measure that was higher in the nafld with diabetes as compared to the nafld without diabetes. the esr was higher in nafld with diabetes while hscrp was higher in nafld without diabetes as compared to controls. all the indices of liver function (bilirubin, sgot, sgpt, and alp) were not significantly different among the three groups. as expected, the values of fbg, ppbg, and homa - ir were significantly higher in nafld with diabetes group as compared to the other two groups. serum levels of tc and ldl were higher in nafld with diabetes group as compared to the control group. the time and frequency domain indices of hrv are shown in table 2. the overall variability (time domain : sdnn and frequency domain : total power) was lower in nafld with diabetes group as compared to the control group. even though median values of the overall variability of hrv were lower in nafld group without diabetes as compared to controls, the difference was not statistically significant. similarly, the overall variability of nafld with diabetes was not statistically different from nafld without diabetes even though the median values were lower. the low frequency and high frequency component of hrv and the lf : hf ratio were similar in all three groups. in time domain analysis, the indices of parasympathetic component of hrv (sdsd and pnn50) were lower in nafld with diabetes group as compared to controls as well as nafld without diabetes. the proportional distribution of grade i and grade ii was not different in the nafld groups with or without diabetes. the subjects were regrouped depending upon the grades of nafld irrespective of their diabetic status and statistical analysis was done (table 3). the distribution of diabetics in nafld grade i and grade ii was not statistically different. the indices of overall variability (sdnn and total power) and parasympathetic component (sdsd, pnn50) were lower in grade ii as compared to controls. even though the median values of the same parameters were lower in grade i when compared with controls, it was not statistically significant. in order to delineate the relative contribution of the diabetic status and grade of nafld, the presence of diabetes was found to be significantly associated with decrease in sdsd and total power (table 4). the result of spearman 's correlation performed between the selected indices of hrv (sdnn, sdsd, and total power) and anthropometric and biochemical parameters is shown in table 5. no significant association was found between indices of hrv, parameters of inflammation (esr, hscrp), liver function (serum bilirubin, sgot, sgpt, and alp), or insulin resistance (homa - ir, fasting insulin). a further multivariate stepwise regression analysis was performed between indices of hrv as dependent variable and selected independent variables (with significant association in univariate analysis). of all the parameters that were negatively associated with hrv, only total cholesterol (tc) and fat percentage significantly associated with sdnn and total power after multivariate analysis. the study was done to assess the heart rate variability in patients of nafld with or without diabetes. since diabetes is known to independently cause autonomic dysfunction, the patients of nonalcoholic fatty liver disease were grouped into nafld without diabetes and nafld with diabetes. as expected, the variables related to obesity, lipid profile, and glucose metabolism were higher in nafld with diabetes and those with grade ii nafld as compared to controls [1820 ]. a higher esr in nafld with diabetes and higher hscrp in nafld without diabetes indicate ongoing inflammatory process. similar high hscrp was reported by nigam. and ajmal., even after adjusting for covariates. the time domain and frequency domain indices of overall variability of hrv were lower in the nafld with diabetes group as compared to the control. even though the median values of these parameters were lower in nafld without diabetes, the difference was not significant. the indices of parasympathetic component of hrv (sdnn, pnn50) were lower in nafld with diabetes as compared to controls as well as nafld without diabetes. when the analysis was done on the basis of grades of nafld irrespective of the diabetic status, the indices of overall hrv were found to be lower in grade ii nafld as compared to controls. though the median values of the theses indices were lower in grade i nafld they were not statistically significant. this indicates an independent contribution of diabetic status as well as grade of nafld in development of autonomic dysfunction. within the patients of nafld, the diabetic status had significant main effect in decreasing hrv rather than the grade. similar decrease in indices of overall hrv (ln sdnn) and parasympathetic components (ln rmssd) was noted by liu.. in the present study, no change in normalized low frequency, high frequency, or their ratio was found., however, have reported lower low frequency and high frequency components of hrv [14, 23 ]. this difference is likely due to reporting absolute values rather than normalizing the values to total power of the hrv as was done in the present study. the data of the present study suggests that decrease in total power of hrv results from a decrease in both sympathetic and parasympathetic components. in the presence of diabetes, the decrease in the parasympathetic component jakovljevic. had reported higher values of lf : hf ratio though it had not been compared with any control group. in the present study lf : hf ratio was similar in nafld with or without diabetes as compared to controls. this difference could be due to inclusion of diabetics with less 5 years of history as well as lower bmi of the study subjects in the present study as compared to the report by jakovljevic.. in univariate analysis, the decrease in indices of hrv was significantly and negatively correlated with variables of lipid profile, obesity, and diabetic status. interestingly, the decrease in hrv was not associated either with homa - ir or with fasting insulin but with fasting blood and postprandial glucose level. these observations are in tune with the known role blood glucose level and glycation play in the pathogenesis of diabetic autonomic neuropathy. however, in multivariate stepwise regression analysis, indices of hrv were negatively associated with total cholesterol and fat percentage only. the importance of total serum cholesterol in the development of diabetic autonomic neuropathy has also been reported earlier. these observations are similar to a report by pimenta. where the autonomic control in nafld (measured by heart rate recovery after maximum graded exercise test) correlated with body composition and body fat. in a recent review, importance of hepatic accumulation of fat in a setting of obesity for the development of hepatic / peripheral insulin resistance has been proposed. the observation of importance of diabetic status in decrease in overall hrv is in line with observations of increase prevalence of cardiovascular disease in nafld with diabetes [2830 ]. a recent systematic review of 27 studies showed an association of nafld with subclinical atherosclerosis independent of traditional risk factors and metabolic syndrome. in other clinical settings, it has been shown that arterial stiffness is inversely related to heart rate variability [12, 13 ]. it is probable that increase in stiffness of arteries due to subclinical atherosclerosis leads to decrease in the transducer function of the baroreceptors. a decrease in baroreflex function will decrease the heart rate variability of both sympathetic and parasympathetic components. the result of the present study indicates that the grade of nafld as well as diabetic status contributes to the decrease in the cardiovascular autonomic function with a decrease in overall variability but an unchanged sympathovagal balance. it also shows that once nafld is developed a further decrease is more likely due to diabetes rather than further increase in the grade of nafld and the important role of dyslipidemia and obesity in the cardiac autonomic dysfunction represented by heart rate variability. | aim. the present study was designed to evaluate the heart rate variability (hrv) in nonalcoholic fatty liver disease (nafld) and to assess the effect of grade of nafld and diabetic status on hrv. methods. this cross - sectional study included 75 subjects (25 nafld without diabetes, 25 nafld with diabetes, and 25 controls). measurements included anthropometry, body composition analysis, estimation of plasma glucose, serum lipids, hscrp, and serum insulin. hrv analysis was performed in both time and frequency domains. results. the time and frequency domain indices of overall variability (sdnn, total power) were significantly lower in nafld with diabetes as compared to the controls. however, the lf : hf ratio did not differ among the three groups. the variables related to obesity, lipid profile, and glucose metabolism were also higher in nafld with diabetes and those with grade ii nafld without diabetes, as compared to controls. multivariate stepwise regression analysis showed a negative correlation between hrv and total cholesterol and fat percentage. conclusion. the grade of nafld as well as diabetic status contributes to the decrease in the cardiovascular autonomic function, with diabetic status rather than grade of nafld playing a critical role. serum lipids and adiposity may also contribute to cardiac autonomic dysfunction. |
it is known that male breast cancer is extremely rare and obesity is a strong risk factor of breast cancer in both male and female. in general, the prognosis in breast cancer in males is known to be very poor compared to that in females as it tends to be more advanced stage due to delayed initial diagnosis. therefore, we should be aware of the possibility that breast cancer could be developed even in relatively young males without any specific risk factors especially when the subjects have severe obesity. |
|
gastric cancer is the second leading cause of death due to malignancy worldwide and occurs most frequently in the age group of 5070 years [13 ]. however, over the past half century several studies have reported on the clinical and pathological features of gastric carcinoma in young adults in the range of 2%8% in different series. the incidence of gastric cancer is the highest in japan, china, south america and eastern europe and the lowest in the united states. gastric cancer is the third most common cancer in kashmir only superseded by esophageal and lung cancer. napoleon, his father, his grand father, and several of his siblings died of cancer stomach. inherited or familial gastric cancer and hereditary diffuse gastric cancer (hdgc) are common in patients younger than 40 years of age. patients with hereditary nonpolyposis colorectal cancer (lynch syndrome ii) are at increased risk of stomach cancer. first degree relatives of patients with gastric cancer have a two- to threefold increased risk of developing this disease. diets rich in salted, smoked, or poorly preserved foods are associated with increased risk of cancer stomach, whereas diets rich in fruits and vegetables are associated with decreased risk. foods rich in nitrates, nitrites, and secondary amines can combine with n - nitro compounds which induce gastric tumors in animals. alcoholics have also an increased risk of developing this disease. a near universal finding in young patients has been the high frequency of advanced lesions and undifferentiated tumors at presentation in comparison with older patients ; this has often been attributed to the delay in diagnosis. however, sometimes we do come across the patients with stomach cancer in their third or fourth decade of life. this motivate us to undertake this study of stomach cancer in young patients to see their demographic and clinicopathological profile and their association with p53 gene. the present study was a prospective conducted in the department of general surgery and department of immunology and molecular medicine, sher - i - kashmir institute of medical sciences, srinagar, from january 2005 to december 2009. young patients were defined as less than 40 years of age. a detailed history, every patient underwent abdominal ultrasonography and contrast enhanced computerized tomogram (cect) for proper preoperative staging. fine needle aspiration cytology (fnac) of any extra abdominal enlarged lymph node was carried out to rule out metastasis. all the patients who after clinical and radiological assessment had an operable tumor were subjected to laparotomy for any possible resective or bypass procedure. histological examination of resected specimen was conducted to know the type, grade, and stage of tumor. specimens from 7 young and 16 old patients were taken from normal tissue, tumor tissue, and blood and lymph nodes and were sent to the department of immunology and molecular medicine for the study of p53. pcr amplification technique was standardized to amplify 2nd para exon 5, 6, 7, and 8 of p53 gene from genomic dna. mutation in the amplified exons of p53 was asserted by a single stranded conformational polymorphism (sscp) and restriction fragment length polymorphism. all the cases were discharged after stabilization, followed, and regularly monitored for any complication. data was described in percentages and chi - square, and odds ratio analysis was used for valid inferences. software, microsoft excel, minitab, and spss (11.5 versions) were used for statistical analysis. analysis of 502 patients of stomach cancer admitted in the study period was done. out of these studied patients 50 patients belonged to less than or equivalent to 40 years of age group (figure 1). around 10% of patients were younger than 40 years. male female ratio was 1 : 1.08 in young and 2.5 : 1 in older patients. a positive family history of stomach cancer in the first degree relatives was present in 10% of young and 3% of old patients which was statistically significant (p value 0.006). 44% of patients from young age group had history of smoking whereas 62% from old age group had the same history (p value 0.014 sig). main comparative symptomatology between the 2 groups was weight loss 64% in 40 yrs age groups, anorexia 52% versus 79% (0.000 ; sig), malena 16% versus 6%, constipation 4% versus 32%, and dysphagia 2% versus 22% ; all these findings were statistically significant, whereas rest of the symptoms on comparison were statistically insignificant. amongst the signs, gastric splash (succussion splash) 145 versus 35% had a statistically significant p value (0.003), whereas rest of the signs were not significant statistically. the most common type of lesion in young patients was infiltrative type (38%) while it was polypoid (58%) in older patients and this difference again was statistically significant as the distribution of lesion in various parts of stomach was statistically significant. 71% of young patients had poorly differentiated lesions and 40% older patients had moderately differentiated lesions. 69% young and 33% old patients had diffuse type of lesions, whereas 25% young and 58% old patients had intestinal type of lesions. the most common operation was lower partial gastrectomy in 68% versus 49%. amongst the intraoperative findings peritoneal metastasis 50% young versus 35% old patients presented in stage iv as per ajcc classification (p value 0.004 ; sig). chemoradiotherapy for young versus old patients was 66.5% versus 51% ; only chemotherapy was 27.5 versus 42% ; and only radiotherapy was 6% versus 7% given as adjuvant therapy. most common complication of surgery was wound infection 9% versus 14% followed by ileus 10% versus 11%. out of 33 young patients in prospective study, 16 died during the study period. genetic alterations of p53 gene in gastric cancer are shown in tables 2(a), 2(b), and 2(c). the incidence of gastric cancer is the highest in japan, china, south america and eastern europe and the lowest in the united states. gastric cancer is the third most common cancer in kashmir only superseded by esophageal and lung cancer. the incidence of stomach cancer in young adults in our series was comparable to others [10, 11 ]. however, some authors reported incidence which was lower than what we observed. the apparent increases in the recent few decades may be due to the fact that people are now better educated, more health conscious, and economically better off to seek the medical advice at any earlier stage. male to female sex ratio was 1 : 1.08 amongst young patients and 2.5 : 1 in older patients which corresponds with what was reported by other authors [3, 12, 13 ]. the reason for male preponderance in older patients could be due to more frequent and longer exposure to the environmental carcinogens. the age distribution in our study corresponds with other authors [3, 10 ]. family history of stomach cancer in young patients was statistically significant in our study group (10% versus 3%, p = 0.006) which coincides with other studies, but lesser than what was reported by others [14, 15 ], that is, 17%25%. one of the reasons of lower incidence of family history in our patients may be due to lower rate of literacy than that of japan and most of the patients might not be able to recall the disease of their relatives. the mean duration of symptoms in our series was 5.7 5.0 months, corresponding with the finding of other authors. as observed by other authors polypoid growth was more common than infiltrative growth in our series. resection was possible only in 50% of the young and in 68.6% of old patients, procedures were done as per the indication, which corresponds with other studies. the international comparison reveals that resection rate for gastric cancer is significantly more in japan than the rest of the world ; even our resection rate is far lower than what was reported by japanese in the literature (100% resectability rate) ; the reason is early detection of cancers. majority of our patients had advanced disease at presentation. we had only 9% of patients from older group in stage i. identical observations were made by other authors. seven out of 30 (23.3%) young and 16 out of 30 (53.3%) old patients had harbored mutations in p53. no change was found in p53 gene derived from blood or normal tissues of the same patient. in all 23 tumors, a total of 23 mutations (5 insertions, 17 single base, 1 para5 tandem double base substitution) in p53 were detected, all of which were somatic in nature. mutation pattern data of p53 revealed a high percentage of insertions (6/23, 26%), g : c > a : t (at cpg site) ; (4/23, 17.4%), a : t > g : c, (8/23, 34.8%) transition mutations and g : c > c : g (5/23, 21.8%) transversions respectively. analysis of the mutation spectrum revealed a number of salient and interesting features which included high frequency of a : t to g : c substitutions. the presence of p53 mutations in sporadic gastric cancer patients showed some statistically significant association with older patients (p = 0.034 ; or = 3.8) as compared to young patients. p53 mutations were significantly more frequent in intestinal type than those in diffuse type of tumors in both groups (p = 0.035 ; or = 3.68). our findings are consistent with tolbert. and hsieh., where p53 mutations were also frequent in smokers as compared to nonsmokers (p = 0.003 ; or = 6.07). four patients with stage ii disease showed a mean survival of 17.2 months and amongst them 2 patients after chemotherapy showed a mean survival of 18.6 months. the main cause of death was advanced disease and in older patients it was due to associated comorbid conditions. the overall lower survival rate is like from rest of the world, but less than japan. it can be attributed to the fact that percentage of early gastric cancer patients in our study was very low and can also be attributed to delay in diagnosis and high percentage of poorly differentiated lesions in young patients. thus, we conclude our study with an emphasis that early detection of carcinoma stomach is very important in all patients but in young patients it is of paramount importance. the said entity is, no more, a disease of the old people only, and time and again vague prescriptions of h2 blockers and proton pump inhibitors for dyspeptic symptoms even in young patients might be just a denial to rule out the possibilities of an early lesion and of making it progress to a stage where all medical armamentarium is rendered helpless. | aim. the aim of this study was to see the clinical, pathological, and demographic profile of young patients with stomach carcinoma besides association with p53. patients and methods. prospective study of young patients with stomach carcinoma from january 2005 to december 2009. a total of 50 patients with age less than 40 years were studied. results. male female ratio was 1 : 1.08 in young patients and 2.5 : 1 in older patients. a positive family history of stomach cancer in the first degree relatives was present in 10% of young patients. resection was possible only in 50% young patients. 26% young patients underwent only palliative gastrojejunostomy. the most common operation was lower partial gastrectomy in 68%. amongst the intraoperative findings peritoneal metastasis was seen in 17.4% in young patients. 50% young patients presented in stage iv as per ajcc classification (p value.004 ; sig.). none of the patients presented as stage 1 disease in young group. conclusion. early detection of stomach carcinoma is very important in all patients but in young patients it is of paramount importance. |
although dualenergy xray absorptiometry (dxa), computed tomography and magnetic resonance imaging (mri) are considered reference methods for identifying low skeletal muscle mass in elderly persons and patients with chronic diseases, access to these instruments may be limited in clinical practice. for this reason, bioelectrical impedance analysis (bia) can be a useful tool to assess skeletal muscle mass, and three available consensus statements (european working group on sarcopenia in older people, asian working group for sarcopenia and international consensus for cancer cachexia)1, 2, 3 accept bia as an option for identifying sarcopenia and cachexia. however, bia, differently from the other body composition tools, does not actually measure a specific body component. body composition assessment from bia relies on a calibration equation developed using a reference method such as dxa, computed tomography or mri. early bia systems employed fatfree mass (ffm) prediction equations developed using traditional twocompartment reference methods such as underwater weighing or total body water. more recently, other more sophisticated imaging methods have been used to develop bia prediction formulas, and new equations were developed to identify body components beyond that of ffm and related % fat. within the sarcopenia and cachexia areas, bia is now used to estimate several components that represent muscularity. although these terms are often used as synonymous to ffm, they may not actually represent this component. depending on which body composition technique was used to develop the bia system 's equation, compartments different from ffm are typically estimated. this has led to some confusion in the literature, and we now review some of these measures with the aim of clarifying the role in patient assessment. janssen. 4 validated bia against skeletal muscle mass (sm) obtained from mri, and usually, 7375% of total body sm is located in the limbs and represents appendicular sm. the same authors defined sm index (smi) as a % of total body mass (sm / body weight, %) x 100, and smi is expressed in % units. low smi was defined as a smi below one standard deviation of young adult values according to the data from the third national health and nutrition examination survey (nhanes iii).5 the cutoff values suggested from this study were 5% over past 6 months (in the absence of simple starvation) ; orbody mass index 2% ; orappendicular skeletal muscle index consistent with sarcopenia. weight loss > 5% over past 6 months (in the absence of simple starvation) ; or body mass index 2% ; or appendicular skeletal muscle index consistent with sarcopenia. sarcopenia can be assessed by several techniques, as described in the paper, including bia. the authors used the term whole body ffm index without bone and defined the cutoff as < 14.6 kg / m (men) and < 11.4 kg / m (women).3 the term whole body ffm index without bone is not exactly the same thing as sm, estimated from bia as described in the cited reference.5 there was likely confusion here with the term lean tissue without bone (compartment obtained from dxa). based in the study from janssen., the cutoff values cited by fearon. 3 are much higher than those used to define low muscularity in the sarcopenia consensus. this would lead to a misclassification of subjects according to smi using bia, diagnosing almost everyone as sarcopenic, and consequently, cachectic. appendicular skeletal muscle mass (asmm) is another term given to the assessed soft lean appendicular tissue (the fat and bonemineral free tissue, obtained from dxa) assessed in the four limbs. it should be a little larger than the actual appendicular skeletal muscle mass, because the skin and connective tissue are included in this measurement. this compartment can be estimated when a bia equation is derived from a validation study where asm was assessed from dxa.7, 8, 9, 10 asmm can also be normalized in relation to height, giving the appendicular smi (asmi = assm / height, kg / m). different equations were developed from different populations (adults, elderly, caucasian and asian subjects). only the asian consensus suggests cutoff values of asmi by using bia (7.0 kg / m in men and 5.7 kg / m).1 these values were established from 1719 young healthy japanese volunteers, and asmi was defined as the sum of the muscle mass of the arms and legs divided by height in meters squared, assessed directly by using segmental bia.11, 12 recently, this new term was introduced to describe exactly the same compartment as appendicular sm from dxa : the lean mass without bone and fat assessed by dxa in the four limbs.13 the authors obtained two different equations to estimate appendicular lean mass using bia, depending of the type of dxa systems used in the validation (ge lunar or hologic). although these equations were developed from a sarcopenic population (defined by the previously described janssen 's equation for bia) obtained from a large european multicentre study (provide nutritional intervention study), no cutoff values were shown, and the authors suggested that the reference values from hologic and lunar should be used to characterize sarcopenia. bioelectrical impedance analysis can estimate different compartments that are used to define sarcopenia and cachexia, as described earlier. as they were estimated using different bia equations, they are valid for the same population from the validation study, using the same bia device, and the subjects should be classified according to the adequate suggested cutoff values. for this reason, it is important to standardize not only the terminology employed to define low muscularity and sarcopenia but also the cutoff values for diagnostic purposes in each population. the terms and cutoff values suggested in the cancer cachexia international consensus to diagnose sarcopenia by using bia should be reviewed, as an overestimation of cachexia can result with the actual values. further research may show the need for specific cutoff values to define sarcopenia in different populations. maria cristina gonzalez and steven b. heymsfield declare that they have no conflict of interest. | abstractas reference methods are not available for identifying low skeletal muscle mass in clinical practice, the european group on sarcopenia in older people the asian working group for sarcopenia and the international consensus for cancer cachexia guidelines accept bioelectrical impedance analysis (bia) as an option for sarcopenia and cachexia assessment. using different bia equations, several components that represent muscularity can be assessed. total skeletal muscle mass or appendicular skeletal muscle mass normalized in relation to height (skeletal muscle mass index or appendicular skeletal muscle index, respectively) is the most common term used in the consensus. these terms are similar, but they should not be used as synonymous. both terms can be used to define sarcopenia, but adequate equations and cutoff values should be used according to the studied population. however, there is a disagreement between the sarcopenia definition assessed by using bia from the european group on sarcopenia in older people and cachexia consensus, and this can lead to an overestimation of sarcopenia and, consequently, cachexia. an effort should be made to standardize the terminology employed by the societies to define low muscularity and sarcopenia by using bia. future validation studies may show the need for specific cutoff values for each population using this method. |
neurons can release small molecule neurotransmitters very rapidly in part because synaptic vesicles are docked to the membrane at active zones. docked vesicles can immediately fuse with the plasma membrane (zenisek., 2000) in response to a single action potential (borst and sakmann, 1996 ; sabatini and regehr, 1996). synaptic vesicle docking is defined by morphological criteria : such vesicles can be observed directly contacting the plasma membrane in electron micrographs (couteaux and pecot - dechavassine, 1970 ; harris and sultan, 1995 ; schikorski and stevens, 2001 ; xu - friedman., 2001 ; hammarlund., 2007). in addition to synaptic vesicles, neurons also contain secretory vesicles, called dense core vesicles, that release neuropeptides and catecholamines (burgoyne and morgan, 2003). unlike synaptic vesicles, high - frequency stimulation is required for the release of dense core vesicles (verhage., 1991 ; bruns and jahn, 1995 ; tandon., 1998). one possible explanation for the bashfulness of dense core vesicles is that they are not docked. dense core vesicles are usually found in the cytoplasm and these cytoplasmic vesicles must presumably translocate to the plasma membrane before release (zupanc, 1996). however, in at least two cases, dense core vesicles have been observed docked to the plasma membrane (karhunen., 2001 ; ohnuma., 2001) and, in one case, occupied positions along the synaptic active zone (ohnuma., 2001). furthermore, secretory vesicles in neuroendocrine cells, which are similar to neuronal dense core vesicles, do dock (plattner., 1997 ; steyer., 1997) thus, the delayed release characteristics of neuronal dense core vesicles may not be caused by a requirement for translocation to the plasma membrane. alternatively, the different release characteristics of dense core and synaptic vesicles might be caused by differences in spatial organization or fusion machinery. for example, dense core vesicles and synaptic vesicles might dock at different release sites, where they might experience different calcium stimuli. in this model, dense core and synaptic vesicles must have different mechanisms for docking. at caenorhabditis elegans neuromuscular junctions, synaptic vesicle docking requires syntaxin, the plasma membrane snare protein (hammarlund., 2007). syntaxin is also involved in docking secretory vesicles in two neuroendocrine cell types (de wit. if syntaxin docks both synaptic vesicles and dense core vesicles in neurons, it alone can not be responsible for their different sites of release. additional molecules, perhaps molecules that interact with syntaxin, would be required to distinguish between synaptic and dense core vesicle docking. two such candidates are the mun domain proteins unc13 and calcium - activated protein for secretion (caps). the unc13 family is required for synaptic vesicle exocytosis (aravamudan., 1999 ;, unc-13 is required for synaptic vesicle docking at the active zone (gracheva., 2006 ; weimer., 2006 ; hammarlund., 2007). caps is required for dense core vesicle exocytosis (walent., 1992 ; ann., 1997 ; renden., 2001 ; caps function has not yet been assigned to any specific step of dense core vesicle exocytosis ; in fact, there is some controversy over whether exocytosis should be considered to be its primary function (speidel., 2005). here, we show that dense core vesicle docking is mechanistically distinct from synaptic vesicle docking. in c. elegans motor neurons, dense core vesicles dock at the plasma membrane but are excluded from the active zone. docking of dense core vesicles in neurons, like synaptic vesicle docking, requires syntaxin. however, unlike synaptic vesicles, dense core vesicle docking requires caps / unc-31 and is independent of unc-13. these data support a mechanism for dense core vesicle docking in which caps promotes open syntaxin and open syntaxin docks dense core vesicles. the specialized location and protein requirements for dense core vesicle docking provide a potential mechanism for the independent control of dense core vesicle release. to compare the distribution and molecular requirements for docking of dense core and synaptic vesicles, we analyzed the ventral cord motor neurons, which contain and release both vesicle types. dense core vesicles can be distinguished from synaptic vesicles by their electron - dense appearance (fig. 1, a and b) and are observed in both acetylcholine and -aminobutyric acid (gaba) neurons. these vesicles have a mean diameter of 42.5 nm and their range of diameters appears to be normally distributed around this single mean, which suggests that these vesicles are all of the same type (fig. some of these vesicles are docked, appearing to directly contact the plasma membrane (fig. 1, a and b). the fraction of dense core vesicles docked (4.5%) is roughly similar to that of synaptic vesicles (9.8%). (a) electron micrograph of a portion of the ventral nerve cord from a c. elegans adult hermaphrodite. the blue arrow indicates a docked synaptic vesicle and the red arrow indicates a docked dense core vesicle (b) a schematic depiction of the micrograph in a with some features indicated. (c) all dense core vesicle diameters displayed as a histogram (left) and a semi - log cumulative probability distribution (right). the geography of vesicles at the plasma membrane can be described by their proximity to the dense projection, which marks the center of the active zone. 2 a), as has been observed previously (hammarlund., 2007). to encompass 50% of the dense core vesicles near a synapse, it is necessary to extend 140 nm (five profiles) on either side of the dense projection (fig. furthermore, the density of synaptic vesicles in the cytoplasm is highest in profiles with the dense projection, but the density of dense core vesicles is fairly constant in all sections irrespective of the distance from the neuromuscular junction (fig. thus, dense core vesicles are only slightly enriched at synapses or are evenly distributed along the motor axon and a substantial fraction of dense core vesicles are found quite far from the dense projection. each graph shows the mean number of synaptic or dense core vesicles per neuronal profile at a given number of sections from the dense projection. colored bars show the number of profiles required to include 50% of the total number of vesicles. synaptic vesicles in c. elegans dock to the plasma membrane at the active zone, which flanks the dense projection at synapses (hammarlund., 2007). similar to the total synaptic vesicle population, half of all docked synaptic vesicles are found in profiles that contain a dense projection (fig. this is not simply caused by increased surface area at varicosities ; docked synaptic vesicles are more densely packed near the dense projection (fig. 3 a, blue line). docked dense core vesicles are more evenly distributed along the axon rather than densely clustered near the dense projection. in fact, profiles with a dense projection are somewhat depleted of docked dense core vesicles (fig. 3 b, wide bar). correcting these data for membrane area differences did not affect this trend (fig. 3 b, red line). to further analyze this apparent depletion, we calculated the distance from the dense projection for each individual docked synaptic and dense core vesicle (fig docked dense core vesicles are excluded from the membrane within 150 nm of the dense projection, a region that encompasses the active zone. thus, docking of synaptic and dense core vesicles is partitioned into distinct membrane regions, which suggests that different mechanisms may control these processes. docked dense core vesicles are excluded from active zones. (a and b) each graph shows the mean number of docked synaptic or dense core vesicles per profile at a given number of sections from the dense projection. colored bars show the number of profiles required to include 50% of the total number of docked vesicles. (c) cumulative probability of vesicle docking relative to distance from the dense projection. the active zone where synaptic vesicles dock is roughly 210 nm in radius (hammarlund., 2007). caps / unc-31 is composed of a mun domain, a pleckstrin homology phosphoinositide - binding domain, and a c2 phosphoinositide and calcium - binding motif (ann., 1997 ; speese., 2007). caps primes secretory granules in pc12 cells for calcium - stimulated release (walent., 1992 ; ann., 1997 ; grishanin.,, caps is essential for neuropeptide secretion but not synaptic vesicle secretion (speese., 2007). it is possible that the defect in neuropeptide secretion in caps mutants is caused by a defect in docking of dense core vesicles. the mutation unc-31(e928) completely deletes the coding region for the caps protein (charlie. we found that in the absence of caps, dense core vesicle docking is nearly eliminated (fig. 4 a ; docked dense core vesicles per profile : wild type, 0.057 ; unc-31(e928), 0.005 ; p 40 nm and clear) based on these criteria. because these vesicle types appear somewhat similar, it is possible that a few vesicles may have been miscategorized. but because all scoring was done in parallel and blind to genotype, miscategorizing is not expected to introduce bias into the data. the number of synaptic vesicles and dense - core vesicles in each profile was counted and the diameter of each vesicle was measured. docked vesicles were defined as having a contact zone with the plasma membrane. for the analysis of vesicle distribution in wild - type animals, data were collected from worms prepared in two separate fixations for synaptic vesicles and three for dense core vesicles. the distance of dense core vesicles to the dense projection was calculated by counting the number of sections between each profile and the closest dense projection where each section corresponds to 33 nm. a difficulty arose at the ends of each reconstructed neuron : because a dense projection could lie just outside the reconstruction, the number of sections to the nearest dense projection can not be determined. these profiles were therefore eliminated from our analysis, leaving 717 profiles and 15 synapses for va and vb acetylcholine neuron synaptic vesicle analysis, 1,437 profiles and 27 synapses for va and vb acetylcholine neuron dense core vesicle analysis, 458 profiles and 12 synapses for vd gaba neuron synaptic vesicle analysis, and 813 profiles and 19 synapses for vd gaba neuron dense core vesicle analysis. a total of 9,539 synaptic vesicles and 2,494 dense core vesicles were included in this analysis. for each distance from the dense projection, the mean numbers of total and docked synaptic and dense core vesicles per profile were determined. thus, in figs. 2 and figs.3, the bar at 10 shows the mean number of vesicles per profile for all profiles that are 10 sections away from the nearest dense projection. the bar labeled dense projection shows the mean number of vesicles per profile for all profiles that contain the dense projection. because the mean dense projection encompasses 4.85 sections, this bar is proportionally wider than the rest. + shows the mean number of vesicles per profile for all profiles more than 20 sections away from the dense projection. total vesicle density in fig. 2 was obtained for each distance by dividing the mean number of vesicles at that distance by the mean profile area at that distance. docked vesicle density in fig. 3 was calculated for each distance by dividing the mean number of docked vesicles at that distance by the mean profile plasma membrane length at that distance. 3 c) was determined by calculating the distance between the docked vesicle and the dense projection. thus, these data are calculated distances for each vesicle in nanometers rather than averages of vesicle counts within profiles. for vesicles in profiles with a dense projection, the distance from the dense projection to the vesicle was directly measured. for vesicles in profiles without a dense projection, the measurement (the radial distance) was made to an imaginary extension of the dense projection along the bore of the axon from adjacent sections. the longitudinal distance was estimated as the number of intervening sections multiplied by the section thickness (33 nm) and combined with the radial distance using the pythagorean formula (hammarlund., 2007). a straight line on a semi - log plot of the cumulative probability was consistent with normally distributed data. for dense core vesicles, the mean number of vesicles or docked vesicles per neuronal profile was calculated by dividing the number of such vesicles summed across all profiles by the number of neuronal profiles analyzed. error bars are not given because data are not normally distributed ; p - values were calculated using. because most profiles contain zero docked dense core vesicles, the number of docked dense core vesicles in each profile does not follow a normal distribution. we therefore compared dense core vesicle docking between genotypes using a test with two categories : profiles with zero docked dense core vesicle and profiles with one or more docked dense core vesicles (out of 14,055 profiles, 30 contained two docked dense core vesicles and one contained three). two - tailed p - values were computed using graphpad prism. for synaptic vesicles, vesicles docked in the active zone were defined as those docked within 230 nm of the dense projection (measured linearly from the edge of the vesicle to the nearest edge of the dense projection in profiles containing a dense projection). a mean number of synaptic vesicles docked per active zone profile was determined separately for each synapse by grouping together contiguous profiles that contained a dense projection and dividing by the number of profiles containing a piece of the dense projection. the means determined for each synapse were averaged to generate a genotype mean (thus synapses with larger dense projections were not more heavily weighted). two - tailed p - values and standard errors were computed using graphpad prism (graphpad software, inc.). all strains were obtained from the caenorhabditisgenetics center unless otherwise indicated and maintained at 22c on standard nematode growth medium seeded with hb101. other strains used were : cb928 unc-31(e928) (brenner, 1974 ; speese., 2007), eg3405 unc-31(u280) (speese., 2007), bc168 unc-13(s69) (rose and baillie, 1980), cb1091 unc-13(e1091) (brenner, 1974 ; maruyama and brenner, 1991), eg3817 syntaxin mosaic unc-64(js115) oxis34(open syntaxin ; pmyo-2:gfp) ; unc-31(e928) (this study), eg2812 unc-31 wt syntaxin oxis33[wt syntaxin ; punc-129:gfp ] ; unc-64(js115) ; unc-31(e928) (this study), and eg1985 open syntaxin previous ultrastructural analyses of acetylcholine motor neurons failed to detect dense core vesicles (white., 1986) ; however, these fixations were not optimized for vesicle morphology. here, we used high - pressure freezing followed by low - temperature fixation to better preserve membranes ; we then reconstructed 2030-m segments of the va, vb, and vd motor neurons from serial electron micrographs. nematodes were prepared for transmission electron microscopy as described previously (hammarlund., 2007). in brief, 10 young adult hermaphrodites were placed in a freeze chamber (100-m well of type a specimen carrier) containing space - filling bacteria, covered with a type b specimen carrier flat side down, and frozen instantaneously in a high - pressure freezer (hpm 010 ; bal - tec). frozen animals were fixed in an automatic freeze substitution apparatus (leica) with 1% osmium tetroxide and 0.1% uranyl acetate in anhydrous acetone. temperature was kept at 90c for 2 d, increased at 6c / h to 20c, then kept at 20c for 16 h, and finally increased at 10c / h to 20c. the fixed animals were embedded in araldite resin after the infiltration series 30% araldite / acetone for 4 h, 70% araldite / acetone for 5 h, 90% araldite / acetone overnight, and pure araldite for 8 h. mutant and control blocks were blinded. ribbons of consecutive ultra thin (33-nm) serial sections were collected using an ultracut 6 (leica). images were obtained with an electron microscope (h-7100 ; hitachi) using a digital camera (orius sc1000 ; gatan). serial images of the ventral nerve cord were collected at the level of the reflex of the gonad at 12,000. vb acetylcholine and the vd gaba motor neurons in the ventral nerve cord were analyzed for each animal. with the exception of the syntaxin mosaic genotype, data from each neuron type appeared similar and all data were pooled for final analysis. a neuronal profile is the cross - sectional image of an axon from a single section. because each section is 33-nm thick, a single profile represents data from a 33-nm slice of a particular neuron. the number of worms varied depending on the quality of the fixation and continuity of ribbons. our analysis included strain genotype : cell, number profiles (number worms), respectively. n2 : va, 1027 ; vb, 1028 ; vd, 1119 (6). eg3817 syntaxin mosaic : va, 167 ; vb, 167 ; vd, 166 (1). cb1091 unc-13 : va, 200 ; vb, 200 ; vd, 219 (1). cb928 unc-31 : va, 184 ; vb, 184 ; vd, 184 (1). eg2989 unc-31 open syntaxin : va, 420 ; vb, 420 ; vd ; 420 (3). eg2812 unc-31 wt syntaxin : va, 335 ; vb, 340 ; vd, 341 (2). eg1985 open syntaxin : va, 224 ; vb, 224 ; vd, 249 (1). every vesicle was scored as either a synaptic vesicle (30 nm and grayish), a dense core vesicle (40 nm and black), or a large vesicle (> 40 nm and clear) based on these criteria. because these vesicle types appear somewhat similar but because all scoring was done in parallel and blind to genotype, miscategorizing is not expected to introduce bias into the data. the number of synaptic vesicles and dense - core vesicles in each profile was counted and the diameter of each vesicle was measured. for the analysis of vesicle distribution in wild - type animals, data were collected from worms prepared in two separate fixations for synaptic vesicles and three for dense core vesicles. the distance of dense core vesicles to the dense projection was calculated by counting the number of sections between each profile and the closest dense projection where each section corresponds to 33 nm. a difficulty arose at the ends of each reconstructed neuron : because a dense projection could lie just outside the reconstruction, the number of sections to the nearest dense projection can not be determined. these profiles were therefore eliminated from our analysis, leaving 717 profiles and 15 synapses for va and vb acetylcholine neuron synaptic vesicle analysis, 1,437 profiles and 27 synapses for va and vb acetylcholine neuron dense core vesicle analysis, 458 profiles and 12 synapses for vd gaba neuron synaptic vesicle analysis, and 813 profiles and 19 synapses for vd gaba neuron dense core vesicle analysis. a total of 9,539 synaptic vesicles and 2,494 dense core vesicles were included in this analysis. for each distance from the dense projection, the mean numbers of total and docked synaptic and dense core vesicles per profile were determined. thus, in figs. 2 and figs.3, the bar at 10 shows the mean number of vesicles per profile for all profiles that are 10 sections away from the nearest dense projection. the bar labeled dense projection shows the mean number of vesicles per profile for all profiles that contain the dense projection. because the mean dense projection encompasses 4.85 sections, this bar is proportionally wider than the rest. + shows the mean number of vesicles per profile for all profiles more than 20 sections away from the dense projection. 2 was obtained for each distance by dividing the mean number of vesicles at that distance by the mean profile area at that distance. 3 was calculated for each distance by dividing the mean number of docked vesicles at that distance by the mean profile plasma membrane length at that distance. 3 c) was determined by calculating the distance between the docked vesicle and the dense projection. thus, these data are calculated distances for each vesicle in nanometers rather than averages of vesicle counts within profiles. for vesicles in profiles with a dense projection, the distance from the dense projection to the vesicle was directly measured. for vesicles in profiles without a dense projection, the measurement (the radial distance) was made to an imaginary extension of the dense projection along the bore of the axon from adjacent sections. the longitudinal distance was estimated as the number of intervening sections multiplied by the section thickness (33 nm) and combined with the radial distance using the pythagorean formula (hammarlund., 2007). a straight line on a semi - log plot of the cumulative probability was consistent with normally distributed data. for dense core vesicles, the mean number of vesicles or docked vesicles per neuronal profile was calculated by dividing the number of such vesicles summed across all profiles by the number of neuronal profiles analyzed. error bars are not given because data are not normally distributed ; p - values were calculated using. because most profiles contain zero docked dense core vesicles, the number of docked dense core vesicles in each profile does not follow a normal distribution. we therefore compared dense core vesicle docking between genotypes using a test with two categories : profiles with zero docked dense core vesicle and profiles with one or more docked dense core vesicles (out of 14,055 profiles, 30 contained two docked dense core vesicles and one contained three). two - tailed p - values were computed using graphpad prism. for synaptic vesicles, vesicles docked in the active zone were defined as those docked within 230 nm of the dense projection (measured linearly from the edge of the vesicle to the nearest edge of the dense projection in profiles containing a dense projection). a mean number of synaptic vesicles docked per active zone profile was determined separately for each synapse by grouping together contiguous profiles that contained a dense projection and dividing by the number of profiles containing a piece of the dense projection. the means determined for each synapse were averaged to generate a genotype mean (thus synapses with larger dense projections were not more heavily weighted). two - tailed p - values and standard errors were computed using graphpad prism (graphpad software, inc.). | docking to the plasma membrane prepares vesicles for rapid release. here, we describe a mechanism for dense core vesicle docking in neurons. in caenorhabditis elegans motor neurons, dense core vesicles dock at the plasma membrane but are excluded from active zones at synapses. we have found that the calcium - activated protein for secretion (caps) protein is required for dense core vesicle docking but not synaptic vesicle docking. in contrast, we see that unc-13, a docking factor for synaptic vesicles, is not essential for dense core vesicle docking. both the caps and unc-13 docking pathways converge on syntaxin, a component of the snare (soluble n - ethyl - maleimide sensitive fusion protein attachment receptor) complex. overexpression of open syntaxin can bypass the requirement for caps in dense core vesicle docking. thus, caps likely promotes the open state of syntaxin, which then docks dense core vesicles. caps function in dense core vesicle docking parallels unc-13 in synaptic vesicle docking, which suggests that these related proteins act similarly to promote docking of independent vesicle populations. |
previously, we hypothesized that the development of cognitive processes provided such endowed animals with an additional coping strategy in dealing with stress. this ability depends on a unifying consciousness appearing to control or regulate the many individual processes that potentially summate to make up the mind. without this unifying component, the cognitive mind would also have to develop, by chance within certain contingencies, a strong biological bias leading to belief in a highly organized world, since this is what would have survival value within one lifetime. in this regard, inter subjectivity and not objectivity is the best one can aspire to as a cognitive being. as hundert (1989) has clarified, there is always, in every appraisal we make, a contribution of thoughts to things, which necessarily introduces an illusory potential. as also noted, there is a contribution of things to thoughts. the intersubjective world is not only shaped by our brains, but this very world also plays a role in shaping them. so to some extent, our brains are organized in concert with the world around us. theoretically, our brains would develop differently if they were shaped by existence on another planet. nevertheless, one can surmise that a potential illusory contribution of thoughts to things is the human cognitive appraisal of a highly organized, objectifiable, understandable universe. thus, this sense of unity as a coping strategy is somewhat of a deception or illusion, in that it imposes perceived order. therefore, the biology of deception has been an important evolvement leading to humans as creative cognitive beings. another premise extends this notion and suggests that denial - like processes are at the core of the cognitive coping mechanisms we have evolved as humans. in this regard, with cognitive ability, one associates or assumes that this process occurs by way of a rational mind. that is the ability to evaluate many items of information and finally, come up with a well - thought - out solution to a problem. as is implied, this only occurs after a conflict, with weighing out of all details, considerations, and facts in a situation. however, such a detailed cognitive process as being rational would also lead, counter - intuitively, to inactivity and major delays in conclusion - reaching. thus, for many circumstances an organism exhibiting extended rationality would not or could not survive. from this premise, we surmised that, in part, emotion can be viewed as prompting a short - cut to in reality, our quick decision - making ability, certainly when resulting behavior is largely a product of pre - cognitive functioning, has fewer overt parameters and occurs rapidly. in the present report, we surmise that humans as cognitive beings did not just appear upon the top of the evolutionary tree with cognitive ability. in this regard, we will not extensively review the recent and impressive reports that other animals may have a level of consciousness and limited intelligence [510 ]. instead, we will provide a logical argument for the apparent reluctance of humans, in general, to accept these behavioral attributes as being present in other animals. indeed, this reluctance may be founded once more in the overall concept of the biology of deception ; that is a perceived distortion of reality that favors survival and a sense of superiority. it is widely held that the mammalian nervous system had its origin in invertebrate organisms. indeed, when we examine the fundamental basis of any stimulus response mechanism, even in a single cell, we are left with astounding simplicity, i.e., there are only sensory, integrative and motor components in this loop. presumably, during evolution, making this system work in an appropriate fashion must have taken an equally long time in itself. however, moreover, once the energy - saving advantage of having cells communicate and develop specialized activities was realized, another conservative mechanism became evident. cells were communicating, to a great extent, by chemical means, since this method of signaling reduces the size requirements for the individual communicating components (signal molecule and its corresponding receptor). this method of intra- and intercellular communication allowed for a greater level of sophistication and information transfer compared to a scenario of whole cells touching, using up limited space. the significance of stereoselective chemical communication can be noted today by its presence and actions in diverse organisms. similarly, many of the same intracellular and intercellular signal molecules have been retained during evolution as well as functions associated with them first found in organisms considered primitive [1114 ]. this is manifest, for example, in signal molecules once associated exclusively with the nervous system now being demonstrated in the immune system, and vice versa, e.g., neuropeptides and cytokines, respectively. if we now examine what has evolved to account for human cognitive ability, it would have to be the extent and capacity of the integrative processes. in examining any text in comparative anatomy, we are also led to the conclusion that a single structure can be traced back in time and that its presence today has been modified. the examples of this development process that retains and embellishes information as a function of a changing environment with time are now too numerous to list. since this developmental process of using and modifying existing structures and their activities is ongoing, we are on strong ground in surmising that the same holds true for a host of behaviors, including cognitive ability as noted to be present in animals other than humans by various authors [510,15 ], i.e. animals probably have a limited degree of cognitive ability, displaying critical fragments of the capability that exists more fully in humans. it would be foolish to think that this is the first process that developed fully de novo in humans. this assumption is fully borne out in recent reports concerning animals exhibiting higher behavioral characteristics, i.e. limited cognition. since this appears to be a logical assumption regarding the developmental aspects of cognitive ability during evolution, we are faced with the question of why there is such reluctance to recognize limited cognitive ability for what it is in other animals ? in part, we speculate that this concept has not gained wide acceptance because humans, deceptively, perceive themselves not only as being at the top of the evolutionary tree, but the responsible agents for all other life forms as well, because they are not so endowed. inner behavior, we further exalt ourselves. by placing ourselves on such a high level, we further advance our self - image. this in turn has allowed humans to excel, since humans believe they alone are capable of such higher neural activities. indeed, it is humans who provide the rhyme and reason for all events given the responsibility of their position. this belief can and has been used to place the desires of humans over that of other living forms, which actually may not be tolerated for such a trait. progress as a species is assured by this coping strategy since humans alone are the master of all other life forms by being singly possessed with cognitive ability. moreover, believing we are supreme helped us throughout our history in explaining our position on the planet and in the universe. viewing this from a negative perspective, it would have been difficult to make decisions of survival based on the killing of other cognitive beings, regardless of how limited their abilities in this regard may be. furthermore, recognizing this ability in other animals would have placed limitations on human actions throughout history. in the past, our laboratory, from its perspective, noted that cognition evolved as a coping strategy. this strategy gave survival value to the evolution of a mind capable of purposefully interacting with the environment and building and using information in the novel, e.g., creative endeavors. however, for the mind of an individual to advance (succeed), each had to have the illusion of being both right and superior in its outcome otherwise the mind s motivation would not be present, leading to inactivity since competitive thinking would not exist. additionally, if our brain - based cognitive activities were to be truly rational, each thought would require a thorough reasoning process ; again, this would be time - consuming, leading to inactivity. clearly, cognition carries a negative component with its evolution, namely, superiority and the belief that the individual barrier of the unit cognitive process is always right, imposing their will to induce their conformity. in this regard, cognition required the opposite neural process of rationality to achieve rapid and creative advances. cognition s shortcut, emotion, became that safety factor, offering a way out of long cognitive exercises, as well as justifying novel solutions (on the spot, gut feelings, etc.). while some may be coupled emotionally to motivating behaviors, e.g., rage, sex, pain, etc., it has greater regulatory features that exceed cognition, e.g., unconscious regulatory activities (vasomotor modulation, involuntary responses, etc.). by placing involuntary functions under its sphere of physiological influence, one may surmise emotion regulates more functions, which are also occurring simultaneously, than those under the control of cognition. emotion thus becomes the most dominant physiological process in the brain and occupies a central regulatory position in cognition, allowing it to advance in its creative potential. briefly, validation of the hypothesis, the significance of emotion, comes from animals that have chosen to be our companions, in some cases by preferentially selecting us over their species, e.g., dogs. in general, these animals do not compete with us for intellectual superiority, which would be difficult to allow given our desire for conformity and our minds construct for not tolerating cognitive competition, but would be easy for them to attain emotional ties, which would make the coupling more pleasant while maintaining the superiority component of the interaction. commandeering a foothold in our cognitive mind would be more easily facilitated by way of creating an emotional dependence for them. it would represent the ideal mechanism for ensuring their position as our loyal companions since this event would represent all anthropomorphic manifestations as being human - friendly and supportive. in recent years, our understanding of animal behavior, such as with dogs, has grown in depth so that associations can be made between their cognitive level and their interaction with humans. in this regard the presence of the bonding chemical messenger, oxytocin, in dogs helps explain why deeply imbedded associations in bonding occur between us since they secrete this molecule during bonding, e.g., gazing [1620 ] (figure 1). this level of unconscious communication is based on the assumption that dogs have an inherent ability to build on the evaluation of a human s emotions, using this ability in a unique survival coping strategy. hence, a good part of canine survival occurs because emotions exist in both species, allowing these organisms, especially humans, to interact on the emotional level. for humans, the weight of rationality is, in part, removed because emotion represents a short cut to the lengthy process of rationality as noted earlier. it is widely held that the mammalian nervous system had its origin in invertebrate organisms. indeed, when we examine the fundamental basis of any stimulus response mechanism, even in a single cell, we are left with astounding simplicity, i.e., there are only sensory, integrative and motor components in this loop. presumably, during evolution, making this system work in an appropriate fashion must have taken an equally long time in itself. however, moreover, once the energy - saving advantage of having cells communicate and develop specialized activities was realized, another conservative mechanism became evident. cells were communicating, to a great extent, by chemical means, since this method of signaling reduces the size requirements for the individual communicating components (signal molecule and its corresponding receptor). this method of intra- and intercellular communication allowed for a greater level of sophistication and information transfer compared to a scenario of whole cells touching, using up limited space. the significance of stereoselective chemical communication can be noted today by its presence and actions in diverse organisms. similarly, many of the same intracellular and intercellular signal molecules have been retained during evolution as well as functions associated with them first found in organisms considered primitive [1114 ]. this is manifest, for example, in signal molecules once associated exclusively with the nervous system now being demonstrated in the immune system, and vice versa, e.g., neuropeptides and cytokines, respectively. if we now examine what has evolved to account for human cognitive ability, it would have to be the extent and capacity of the integrative processes. in examining any text in comparative anatomy, we are also led to the conclusion that a single structure can be traced back in time and that its presence today has been modified. the examples of this development process that retains and embellishes information as a function of a changing environment with time are now too numerous to list. since this developmental process of using and modifying existing structures and their activities is ongoing, we are on strong ground in surmising that the same holds true for a host of behaviors, including cognitive ability as noted to be present in animals other than humans by various authors [510,15 ], i.e. animals probably have a limited degree of cognitive ability, displaying critical fragments of the capability that exists more fully in humans. it would be foolish to think that this is the first process that developed fully de novo in humans. this assumption is fully borne out in recent reports concerning animals exhibiting higher behavioral characteristics, i.e. limited cognition. since this appears to be a logical assumption regarding the developmental aspects of cognitive ability during evolution, we are faced with the question of why there is such reluctance to recognize limited cognitive ability for what it is in other animals ? in part, we speculate that this concept has not gained wide acceptance because humans, deceptively, perceive themselves not only as being at the top of the evolutionary tree, but the responsible agents for all other life forms as well, because they are not so endowed. thus, by denying their limited capacity for complex inner behavior, we further exalt ourselves. by placing ourselves on such a high level, we further advance our self - image. this in turn has allowed humans to excel, since humans believe they alone are capable of such higher neural activities. indeed, it is humans who provide the rhyme and reason for all events given the responsibility of their position. this belief can and has been used to place the desires of humans over that of other living forms, which actually may not be tolerated for such a trait. progress as a species is assured by this coping strategy since humans alone are the master of all other life forms by being singly possessed with cognitive ability. moreover, believing we are supreme helped us throughout our history in explaining our position on the planet and in the universe. viewing this from a negative perspective, it would have been difficult to make decisions of survival based on the killing of other cognitive beings, regardless of how limited their abilities in this regard may be. furthermore, recognizing this ability in other animals would have placed limitations on human actions throughout history. in the past, our laboratory, from its perspective, noted that cognition evolved as a coping strategy. this strategy gave survival value to the evolution of a mind capable of purposefully interacting with the environment and building and using information in the novel, e.g., creative endeavors. however, for the mind of an individual to advance (succeed), each had to have the illusion of being both right and superior in its outcome otherwise the mind s motivation would not be present, leading to inactivity since competitive thinking would not exist. additionally, if our brain - based cognitive activities were to be truly rational, each thought would require a thorough reasoning process ; again, this would be time - consuming, leading to inactivity. clearly, cognition carries a negative component with its evolution, namely, superiority and the belief that the individual barrier of the unit cognitive process is always right, imposing their will to induce their conformity. in this regard, cognition required the opposite neural process of rationality to achieve rapid and creative advances. cognition s shortcut, emotion, became that safety factor, offering a way out of long cognitive exercises, as well as justifying novel solutions (on the spot, gut feelings, etc.). while some may be coupled emotionally to motivating behaviors, e.g., rage, sex, pain, etc., it has greater regulatory features that exceed cognition, e.g., unconscious regulatory activities (vasomotor modulation, involuntary responses, etc.). by placing involuntary functions under its sphere of physiological influence, one may surmise emotion regulates more functions, which are also occurring simultaneously, than those under the control of cognition. emotion thus becomes the most dominant physiological process in the brain and occupies a central regulatory position in cognition, allowing it to advance in its creative potential. briefly, validation of the hypothesis, the significance of emotion, comes from animals that have chosen to be our companions, in some cases by preferentially selecting us over their species, e.g., dogs. in general, these animals do not compete with us for intellectual superiority, which would be difficult to allow given our desire for conformity and our minds construct for not tolerating cognitive competition, but would be easy for them to attain emotional ties, which would make the coupling more pleasant while maintaining the superiority component of the interaction. commandeering a foothold in our cognitive mind would be more easily facilitated by way of creating an emotional dependence for them. it would represent the ideal mechanism for ensuring their position as our loyal companions since this event would represent all anthropomorphic manifestations as being human - friendly and supportive. in recent years, our understanding of animal behavior, such as with dogs, has grown in depth so that associations can be made between their cognitive level and their interaction with humans. in this regard the presence of the bonding chemical messenger, oxytocin, in dogs helps explain why deeply imbedded associations in bonding occur between us since they secrete this molecule during bonding, e.g., gazing [1620 ] (figure 1). this level of unconscious communication is based on the assumption that dogs have an inherent ability to build on the evaluation of a human s emotions, using this ability in a unique survival coping strategy. hence, a good part of canine survival occurs because emotions exist in both species, allowing these organisms, especially humans, to interact on the emotional level. for humans, the weight of rationality is, in part, removed because emotion represents a short cut to the lengthy process of rationality as noted earlier. despite our ability to recognize limited cognitive behavioral characteristics in animals, there has been no outcry to proclaim this phenomenon. the image we have of ourselves as solely possessing cognition has taken advantage of the illusory potential in intersubjectivity and has placed us outside of reality. this deception, however, has positive survival value since it is humankind s self - proclaimed responsibility to excel beyond other simple animal species. however, at this point in evolution, we must allow our cognitive ability to reform itself, and in so doing evolve with the benefit of the knowledge that this ability is itself creating. we propose that emotional systems play a large role in modulating mind and body related functions that previously realized themselves in cognitive endowments. emotion induces by its nature many neural regulating processes out of the cognitive sphere of control. interestingly, animals, such as dogs, have tapped into this unconscious integrative control system by appealing to emotional modulation via similar neural anatomy and physiological systems, making themselves a necessity for the human experience. in so doing, they have measurably enhanced the quality of cognitive life, including providing health benefits via emotional bonding. | cognitive ability did not appear de novo in humans. despite our ability to recognize limited cognitive behavioral characteristics in animals, there has been no outcry to proclaim this phenomenon. the notion that humans are the only animals to possess cognition has taken advantage of the illusory potential in inter - subjectivity and placed him outside of reality. this deception, however, has positive survival value due to the fact that it is humankind s self - proclaimed responsibility to excel beyond other simple animal species. however, at this point in evolution, we must allow our cognitive ability to reform itself and, in so doing, evolve with the benefit of the knowledge that this ability is itself creating. by recognizing that animals may have limited cognitive ability, we only enhance our self - esteem, not diminish it. furthermore, cognition, given its limited brain controlling attributes, may mask another more diligent force for action and control, namely, emotion. emotion provides the motivation for action, the mechanism to limit reason in a timely survival related manner and a coping strategy for dealing with other humans and animals while simultaneously modulating involuntary physiological functions in an appropriate manner. |
acute respiratory tract infections (artis) are a leading cause of morbidity and mortality in children worldwide[1, 2 ]. many viruses are associated with respiratory syndromes in all age groups[3, 4 ]. however, inadequate diagnostic methods and unknown viral pathogens limit current understanding of arti etiology. one known viral pathogen, human metapneumovirus (hmpv), is a globally distributed pathogen associated with respiratory infection in children[515 ]. after the pathogen respiratory syncytial virus (rsv), hmpv is the leading cause of respiratory infection in children in influenza off - seasons. one study suggested that, in china, almost all children are exposed to hmpv by 6 years of age. in chongqing, china, these studies suggest that hmpv has significant epidemiological and pathological impacts as a significant respiratory pathogen in children. previous hmpv studies focused on its epidemiological characteristics and compared its viral genetics to those of rsv. however, whether the hmpv viral load is correlated with the severity of respiratory infection remains unknown. compared to conventional methods, such as virus culture and indirect immunofluorescence, real - time reverse transcriptase polymerase chain reaction (real - time pcr) is more sensitive and efficient at quantifying viral load[1820 ]. with real - time rt - pcr, we evaluated the changes in hmpv viral load every - other - day from 18 hospitalized children with lower respiratory tract infections to elucidate the association of hmpv viral load in airway with the disease course and severity. patients'clinical data and npas collection : eighteen children hospitalized in the respiratory medicine division of children 's hospital of chongqing medical university from december 2007 to january 2008 with lrtis were enrolled in the study. besides, all the protocols have been approved by institutional review board, chongqing medical university. for each patient following clinical data were collected : age at sample collection, gender, diagnosis, days since onset of illness, hospitalization duration, co - infection, and outcome of illness (table 1). the scoring system used for respiratory disease severity assessment in children has been reported by wang, nasr, mandelberg and others. clinical characteristics and descriptors for the 18 hmpv - positive cases a severity score was assigned for each of four categories (respiratory rate, retractions, wheeze, and general appearance). a single point was given to patients with a respiratory rate of 31 to 45 breaths / min, or wheezing at terminal expiration or audible only with stethoscope, or intercostal retraction, and normal general condition. two points were given to patients with a respiratory rate of 45 to 60 breaths / min, or wheezing during the entire expiration or audible on expiration without stethoscope, or tracheosternal retractions, and stable general condition. three points were given to patients with a respiratory rate over 60 breaths / min, or inspiratory and expiratory wheezing without stethoscope, or severe retraction with nasal flaring, or disturbance of general condition including irritability, lethargy, and poor feeding. for each patient, the total severity score was calculated by summing the score for each category. oxygen saturation was measured using nellcor oximeter (hemens, sc6002xl). from each patient, each sample was centrifuged twice at 1500 rpm for 10 min. between the two centrifugations, 1 ml of pbs after centrifugation, supernatants of npas were labeled and stored at 70c for future batch detection. rt - pcr for hmpv and rsv detection : the supernatants of npas were used as templates for real - time rt - pcr of the fusion glycoprotein (f) gene from hmpv and for the g glycoprotein (g) gene from rsv. total rna was extracted from each npa sample with the qiaamp viral rna kit (qiagen, hilden, germany) according to the manufacturer 's protocol. approximately 6.5 l of each rna sample was incubated in a solution containing 100 m of random 6-mers and 50 m of oligo - dt primer (primescript rt reagent kit, takara) in a final volume of 10 l at 37c for 15 min followed by 5 s at 85c to synthesize cdna. the f gene from hmpv was amplified using virus specific primers (10 m), (table 2) in a 25 l reaction mixture containing 2 l cdna, 8.5 l ddh2o, 12.5 l 2master mix, and 1 l forward and 1 l reverse primer for hmpv virus ; and 25 l reaction for amplification of g gene from rsv containing 3 l cdna, and 22 l master mixture including 200 m dntps, 1.5 mm mgcl2, 1.5 u taq dna polymerase, and 50 pm of each of the forward and reverse primers for rsv virus. the pcr cycling conditions for hmpv included initial denaturation at 94c for 4 min, followed by 40 cycles of 94c for 1 min, 55c for 1 min, and 72c for 1 min. at the end, 72c for 10 min again ; the pcr cycling conditions for rsv included initial denaturation at 94c for 3 min, followed by 33 cycles of 94c for 1 min, 50c for 1min and 72c for 1.5 min. sequences of primers and probes for detection of hmpv and rsv real - time rt - pcr for hmpv viral load quantification : recombinant plasmids containing hmpv f gene were created as standards with a topo ta cloning kit (invitrogen, usa). after plasmid purification with the plasmid mini kit i (omega, usa), the concentration of the purified plasmid was calculated by absorption spectrophotometry with a thermo nanodrop nd1000 (biometra, germany). ten - fold serial dilutions (1010 copies/l) were used to construct a real - time pcr standard quantitative curve that showed an ideal linear relationship between the log values of initial template concentration and cycle threshold values. the hmpv f gene primers (4 m) and probe sequences (table 2) were designed based on the prototype strain from china (genbank accession number dq336144). the pcr mixture consisted of 12.5 l of 2 probe premix ex taq, 0.5 l of each hmpv primer, 1 l hmpv probe, and 2 l of cdna in a volume of 25 l. the cdna was amplified with premix ex taq kit (perfect real time, takara) according to the manufacturer 's protocol in a lightcycler instrument (cfx96 real - time system, bio - rad). the pcr had the following cycling conditions : an initial rapid increase to 95c for 10 s, followed by 40 cycles of 5 s at 95c, and 34 s at 60c, with continuous fluorescence reading. statistical analyses : viral load was calculated as the initial copy number per rt - pcr reaction. the correlation between course of illness or severity of illness and log10-transformed quantitative viral load was assessed with a general linear model of repeated measurement data with the log viral load as a continuous linear variable. the correlation of age or gender with the log viral load was evaluated by a multivariate stepwise regression analysis. sas version 6.12 (sas institute, cary, nc, usa) was used for all statistical analyses. clinical data analysis : each hmpv - patient 's clinical state was evaluated for respiratory rate, retractions, wheeze, and general appearance. the severity scores were divided into three categories : mild (04.9 points, state of illness=1), moderate (5 - 8.9 points, state of illness=2), and severe (912 points, state of illness=3). among the 18 hmpv - positive children, 6 cases were mild, 8 cases moderate, and 4 cases severe. when sle=0.1 and sls=0.05, multivariate stepwise regression analyses revealed no significant correlation between age or gender (p=0.1, p=0.07). the hmpv - positive patients ranged in age from 1 month to 29 months (median=7.5 months). among the patients, the clinical symptoms were cough (100%), wheezing (72.2%), diarrhea (33.3%), fever (11.1%), hoarseness (5.6%), poor feeding, shortness of breath, and retraction sign of three fossae (22.2%). the clinical diagnoses were bronchiolitis (9 cases), pneumonia (9 cases), and pneumonia combined with asthma (1 case). the complications of the illness were congenital heart disease (1 case), anemia (2 cases), otitis media and laryngitis (1 case), and diarrhea (5 cases). the course of illness in these patients was classified into 3 categories : 5 days or less (5 cases), 611 days (8 cases), and 12 days or more (5 cases) with an average of 7.33 days. of the 18 hmpv - positive patients, 11 were co - infected with another virus and/or bacteria (table 3). distribution of co - infection and single infection of hmpv in 18 hmpv - positive patients this table shows that there were 7 cases infected with hmpv only, and the other 11 cases of hmpv - positive were co - infected with virus and/or bacteria. all 8 cases of bacteria infections were co - infected with virus, and one was dual - infected with bacteria in 8 bacterial infections. viral load : depending on the length of the illness, hmpv viral load was measured 26 times for each patient. the copies of viral load in case5, 7, 11, 14, 15, 16 and 17 were more than 110 copies / rt - pcr reaction, and those in other cases are less than 110 copies / rt - pcr reaction. copies of viral load for each patient decreased with extension of course of disease and the hmpv almost could not be detected on discharge (table 4). viral load was not correlated with disease severity (p=0.5, 0.9, 0.5) but was correlated with days after onset of illness (fig. 1). when the hmpv - positive patients were grouped by the length of the course of illness (group 1:5 days ; group 2 : 611 days ; group 3:>11 days), the viral load was significantly different between groups. group 2 and 3 also had significantly different log10 viral load values (p=0.006). in contrast, group 1 and 3 did not have significantly different log10 viral load values (p=0.4). correlation of log10transformed hmpv viral load and severity of disease or days after onset of the illness. the days after onset of illness are from about one day to thirty - seven days. every - other - day changes in hmpv viral load during the course of the disease. copies / rt - pcr reaction10 this shows the disease severity (mild, moderate or severe) and the length of the illness in 18 patients. depending on the length of illness, hmpv viral load was measured 2 - 6 times for each patient. the copies of viral load in case 5, 7, 11, 14, 15, 16 and 17 are more than 110 copies / rt - pcr reaction and those in other cases are less than 110 copies / rt - pcr reaction. the copies of viral load for each patient decreased with extension of course of the disease. similar to the most common respiratory viral pathogen rsv, the recently identified hmpv was a major cause of lrtis and other wheezing diseases. however, none of the previous hmpv studies had investigated if differences in hmpv viral load were correlated with differences in duration of course or severity of the respiratory duration of course or severity of the respiratory disease. similar to rsv and influenza infections, reported hmpv infections were seasonal, although sporadic infections arose throughout the year[24, 25 ]. because we previously reported that hmpv infections were most common during winter and spring months in chongqing area, we collected specimens in the winter. among the 18 hmpv - positive cases, 11 patients were co - infected with rsv. however, no significant difference was found in disease severity between patients with or without co - infection (p>0.05). these findings are consistent with previous studies which showed that rsv / hmpv dual infection was overrepresented in rsv patients requiring mechanical ventilation, indicating that co - infection of rsv and hmpv did not lead to a more severe rsv infection. however, bosis. found that hmpv viral load was correlated with disease severity and associated with short or long clinical course. in an analysis of bacterial co - infection in patients with community - acquired pneumonia, 32.5% likely had single bacterial infections and 15.2% had co - infections with bacteria and viruses. further studies with this method should investigate whether bacterial and viral co - infection affects severity of other clinical diseases. similar to what we found, mixed viral infections are common, especially for rsv and hmpv. currently, there is conflicting evidence of whether dual infections are related to the disease severity[3033 ] or not[3436 ]. future studies should focus on whether viral load, viral genotype, co - infection, or combinations of these factors are related to the severity of illness. previous studies divided hmpv patients into two categories : low viral load < 110 copies and high viral load 110 copies[37, 38 ]. here, patients in the middle of the course of infection (611 days after onset) had a high viral load while patients at the beginning or end of the course of the illness had a low viral load. the severe clinical symptoms of patients with a low viral load might be attributed to long disease course or co - infection with other viruses and bacteria. regardless, viral load was correlated with the course of the disease, in agreement with previous studies. further studies should investigate whether clinical symptoms, severity, course of illness, and subsequent respiratory are associated with viral load of distinct hmpv subgroups. it is possible that a correlation between viral load and disease severity exists, but it was not identified in our study. first, the npas were not always taken at the peak of acute lrti, some were not collected until development of disease on the 15th day or after 1 month of onset. second, patients often received therapy before hospitalization, especially in the form of steroids and bronchodilators. third, it was not possible to perform a correct follow - up for all patients after discharge. despite these limitations, we obtained hmpv viral loads in 18 hmpv - positive patients collected daily during the hospital visit. our findings revealed that the hmpv load was significantly correlated with the course of illness. the association between hmpv viral load and the course of disease suggested that hmpv is an important pathogen in lower respiratory tract infection in children. | objectivehuman metapneumovirus (hmpv) is a respiratory pathogen responsible for disease and subsequent hospitalizations in young children around the world. the disease pathology, including how viral load correlates with respiratory disease severity, remains unclear. this study investigated the correlation between viral load and clinical characteristics of hmpv infections.methodsnasopharyngeal aspirate (npa) samples collected from 18 infants hospitalized for lower respiratory tract infections (lrtis) in winter were tested for hmpv by reverse transcriptase polymerase chain reaction (rt - pcr) and real - time rt - pcr. their npa samples were collected every - other - day to monitor changes in hmpv viral load during hospitalization. also all these 18 patients were monitored to characterize clinically their illness.findingshmpv load was not correlated with infection severity (p=0.5, 0.9, 0.5). in contrast, the log10 of hmpv viral load was significantly different between those lasted for 611 days and those for less than 5 days (p=0.01), also the significant difference was shown between those of 611 days duration and those of more than 11 days (p=0.006), but there was no significant difference between those lasted for less than 5 days and those for more than 11 days (p=0.4). additionally, high hmpv viral shedding occured between 6 and 11days.conclusionhmpv load was significantly correlated with the course of illness. the association between hmpv viral load and the course of disease suggested that hmpv is an important pathogen in lower respiratory tract infection in children. but hmpv did not always lead to more severe respiratory illness. |
hepatitis c virus (hcv) infection is a major health problem that affects almost 3% of the world 's population with a morbidity and mortality rates. hepatitis c virus is a member of the hepacivirus genus of the flaviviridae family and the viral products (core, e1, e2, ns2, ns3, ns4a, ns4b, ns5a, and ns5b) are processed from a 3000-amino acid (aa) polyprotein expressed from a single open reading frame (1). the e1 and e2 are enveloped proteins, which can elicit neutralizing antibodies against hcv infection in the host and core, e1 and e2 proteins are the major vaccine candidates and enzyme - linked immunosorbent assays (elisa) is one of routine tests in clinical laboratories and different studies to detect the rate of antibody in sera against hcv infection (2, 3). the combination of pegylated interferon and ribavirin is a useful treatment depending on the viral or host factors but needs a prolonged therapy with different side effects (4). virus - like particles are self - assembled in the absence of dna or rna or genetic materials (2, 5). it has been shown that hcv antigens produced in pichia pastoris induce strong immune responses in animals (6 - 10). in this study, post - translational modifications such as proteolytic processing, folding, disulfide bond formation and glycosylation can be done by p. pastoris (11). this system is also faster, easier, and less expensive than expression systems derived from higher eukaryotes, such as insect and mammalian tissue cultures and usually gives higher expression levels (12 - 15). the expression systems can raise error rates in translation due to codon bias, that is, a preferential use of codons for the same amino acid (16, 17). as codon bias differs between the host organism and the organism from which the gene was extracted, substituting synonymous codons can improve translational fidelity and in this study codon optimization has been used for increasing the protein expression efficacy (18). in this study, the p. pastoris expression system was used to express a recombinant hcv coree1e2 protein, which consists of core (269 nt-841nt) e1 (842 nt-1417nt) and e2 (1418 nt-2506nt). the core (269 nt-841nt) e1 (842 nt-1417nt) and e2 (1418 nt-2506nt) were amplified by polymerase chain reaction (pcr) (94c 5 minutes 1cycle, 94c 30 seconds- 58c 30 seconds- 72c 100 seconds 30 cycles, 72c 10 minutes 1 cycle) from infected iranian patient s blood by hcv (genotype 1a) and primers were designed by gene runner software for core forward [5- tt g a a t t c gtc a t g a g c a c g a a t c c t a a a c c t c -3 ], and e2 reverse [5- tt g c g g c c g c c g c c t c c g c t t g g g a t a t -3 ]. the amplified product was ligated into a pmd18-t vector (takara, japan) and cloned into the ppicza vector (invitrogen, carlsbad, ca, usa) to produce ppicza - coree1e2. the clones in e. coli top 10 were obtained by transformation with cacl2 and selected on in low salt lb medium with zeocin (invitrogen, usa) (11). then, the recombinant plasmids were linearized and electro - transformed into the competent p. pastoris cells performing as described by the instruction manual of p. pastoris expression kit (invitrogen, usa). briefly, ppicza - coree1e2 was linearized by pme i and electroporated into p. pastoris strain gs115 ; gs115 (his, mut +) transformants were selected on minimal dextrose (md) medium plate and confirmed on minimal methanol (mm) medium plate. multiple inserted recombinants were isolated on yeast extract peptone dextrose (yepd) medium plate containing zeocin (invitrogen, usa) at final concentration of 2.0 mg / ml. the p. pastoris gs115 strain was also transformed with the empty vectors ppicza for negative control tests. clones were detected by colony pcr using the conditions and primers were provided in the easyselect pichia pastoris expression kit. the control strains of the intracellular (gs115/-galactosidase) and extracellular (gs115/albumin) expression provided by the easyselect p. pastoris expression kit (invitrogen, usa). after choosing the most resistant colon, a single colony of multiple inserted his, mut + gs115 recombinants was inoculated into 25 ml buffered glycerol complex medium (bmgy ; 1% yeast extract, 2% peptone, 100 mm potassium phosphate (ph 6.0), 1.34% yeast nitrogen base (ynb), 4 10 - 5% biotin, 1% glycerol) and cultured at 250 rpm and 30c until the culture medium reached an od600 of 2 - 6. the cells were harvested by centrifuging and re - suspended in buffered methanol complex medium (bmmy ; 1% yeast extract, 2% peptone, 100 mm potassium phosphate, ph 6.0, 1.34% ynb, 4 10 - 5% biotin, and 0.5% methanol) to an od600 of 1.0 and cultured in a 250 ml flask at 250 rpm under 30c. inductive expression was carried out with the addition of methanol (0.5%, v / v) per 24 hours at 30c lasted for 3 days (1, 11). the samples were analyzed by the sodium dodecyl sulfate - polyacrylamide gel electrophoresis (sds - page) and western blotting. for extraction and purification of rcoree1e2, the cells were disrupted by glass beads in a tris / edta / nacl (ten) buffer and then centrifuged. the deposit was re - suspended in a ten buffer with 8 m urea and centrifuged again. the supernatant was dialyzed against 5 mm tris hcl (ph 9.3) overnight at 4c and then clarified by centrifugation. the supernatant was first loaded to a q - sepharose fast flow column with 20 mm tris hcl (ph 9.3). after washing with 0.05 m nacl and 20 mm tris - hcl (ph 9.3), the rcoree1e2 was eluted with 0.5 m nacl and 20 mm tris hcl (ph 9.3).then the eluted was loaded to a phenyl sepharose fast flow column with 20 mm tris hcl (ph 9.3) and 0.1 m nacl. the rcoree1e2 was eluted with 20 mm tris the rcoree1e2 was further purified with sephadex g150 column for removing low molecular weight fractions. the purified rcoree1e2 was dialyzed against 5 mm tris hcl (ph 9.3) and sterilized with 0.45 m filter, and then stored at 4c. briefly, the supernatant was loaded onto ni - nitrilotriacetic acid (ni - nta) agarose (qiagen, germany) in the presence of 0.5% tween 80 and 40 mm imidazole. the column was washed extensively, and the protein was eluted with 1 m imidazole. the rcoree1e2 was purified from the insoluble fraction by using 0.5% n - lauryl sarcosine (sarkosyl). the protein was purified over ni - nta super flow and the sarkosyl was replaced by 0.1% tween 80. the protein was eluted in the presence of 200 mm imidazole and 0.1% tween 80 in phosphate buffer (11). supernatant of culture harvested and the cells were harvested and washed twice in ten buffer. the rcoree1e2 was mixed with sample buffer and boiled for 10 minutes in the presence of dithiothreitol (dtt), and around 200 ng was loaded on a 4 - 12% bis - tris nupage gel (invitrogen, usa). the primary antibodies against core, e1 e2 were (santa cruse, usa) ; the secondary antibody was polyclonal rabbit anti - mouse horse radish peroxidase (hrp) labeled. staining was done and the molecular weight marker was a mix of proteins from sigma (usa) : bovine serum albumin (a-7517), ovalbumin (a-7642), carbonic anhydrase (c-2273), beta lactoglobulin (l-4756) and alpha - lactalbumin (l-6385) or the precision and precision plus protein standards (bio - rad, usa). purified rcoree1e2 was digested with n - glycosidase f (pngase f) and the digested proteins were treated according to the manufacturer s instructions (new england biolabs, uk) and then analyzed by western blotting with mab fore core e1 e2. approximately rcoree1e2 (300 g) diluted in 2 ml sterilized 0.9% nacl was used for immunization. a new zealand rabbits was subcutaneously immunized in multiple sites on the back with 0 g (negative control) or 300 g purified rcoree1e2, respectively. booster injections were given with the same doses at 2, 3, 4, 5 and 13 weeks later. an indirect elisa was used to measure anti - rcoree1e2 antibodies in rabbit s serum. in brief, a recombinant protein (10 mg / ml) diluted in 50 mm carbonate buffer (ph 9.6) was used to coat microtiter plates, overnight at 4c. after blocking with 2% (w / v) skim milk powder (oxoid ltd,) in pbs with 0.05% (v / v), tween 20 (sigma, usa) (pbst), ph 7.2 for 1 hour at room temperature. the serum samples were added in duplicate, either 1/20 in dilution buffer (pbst), containing 1% (w / v) skim milk powder, to test seroconversion or in a double serial starting at 1/50 dilution for titration. a hrp - labeled antirabbit igg (sigma, usa) was added to 1/10,000 in the dilution buffer. after 1 hour of incubation at room temperature (rt) and washing, tetramethylbenzidine substrate (sigma, usa) reactions were stopped with 50 ml of 2.5 m h2so4. absorbance was read at 450 nm in a sensident scan (merck, germany). the cut - off value used to consider a positive antibody response was established as twice the mean of absorbance values of the preimmune sera (19). hcv rcoree1e2 particles were coated at 1 g / ml in carbonate buffer in microtiter plates and were incubated. the plates were washed and incubated with blocking buffer (0.5% casein in pbs). sera of chronically hcv - infected people or sera of healthy persons were added in a dilution of 1/20. the plates were washed and incubated with horse radish peroxidase labelled rabbit anti - human immunoglobulins. the tetramethylbenzidine substrate (sigma, usa) reaction was stopped by addition of 2 n h2so4 and the absorbance was measured at 450 nm. the cut - off value to consider a positive antibody response was established as twice the mean od 450 nm of the negative control sera (19 - 21). total rna was extracted and cdna was synthesized using the improm - ii reverse transcription system (promega, usa). the presence of a heterologous gene mrna in pichia was detected by the real time - polymerase chain reaction (rt - pcr) and real - time pcr with forward primer 5- ttgggacatgatgatgaattgg -3 and reverse primer 5- tgcctgtgggattctaagc -3 and probe 5- acagccgcattggttgtcgcc -3 that anneal in the internal sequence of the coree1e2 genes (21, 22). the codon - optimized gene was designed based on the protein sequence of coree1e2 according to the codon bias of p. pastoris (http://www.kazusa.or.jp/codon). the entire coree1e2 gene with xho i and not i restriction sites at each end was designed and was in frame with -factor of a ppicza vector. our supernatant collected and recombinant coree1e2 was purified and fixed in glutaraldehyde and negatively stained with the uranyl acetate prior to analysis by the transmission electron microscopy. the core (269 nt-841nt) e1 (842 nt-1417nt) and e2 (1418 nt-2506nt) were amplified by polymerase chain reaction (pcr) (94c 5 minutes 1cycle, 94c 30 seconds- 58c 30 seconds- 72c 100 seconds 30 cycles, 72c 10 minutes 1 cycle) from infected iranian patient s blood by hcv (genotype 1a) and primers were designed by gene runner software for core forward [5- tt g a a t t c gtc a t g a g c a c g a a t c c t a a a c c t c -3 ], and e2 reverse [5- tt g c g g c c g c c g c c t c c g c t t g g g a t a t -3 ]. the amplified product was ligated into a pmd18-t vector (takara, japan) and cloned into the ppicza vector (invitrogen, carlsbad, ca, usa) to produce ppicza - coree1e2. the clones in e. coli top 10 were obtained by transformation with cacl2 and selected on in low salt lb medium with zeocin (invitrogen, usa) (11). then, the recombinant plasmids were linearized and electro - transformed into the competent p. pastoris cells performing as described by the instruction manual of p. pastoris expression kit (invitrogen, usa). briefly, ppicza - coree1e2 was linearized by pme i and electroporated into p. pastoris strain gs115 ; gs115 (his, mut +) transformants were selected on minimal dextrose (md) medium plate and confirmed on minimal methanol (mm) medium plate. multiple inserted recombinants were isolated on yeast extract peptone dextrose (yepd) medium plate containing zeocin (invitrogen, usa) at final concentration of 2.0 mg / ml. the p. pastoris gs115 strain was also transformed with the empty vectors ppicza for negative control tests. clones were detected by colony pcr using the conditions and primers were provided in the easyselect pichia pastoris expression kit. the control strains of the intracellular (gs115/-galactosidase) and extracellular (gs115/albumin) expression provided by the easyselect p. pastoris expression kit (invitrogen, usa). after choosing the most resistant colon, a single colony of multiple inserted his, mut + gs115 recombinants was inoculated into 25 ml buffered glycerol complex medium (bmgy ; 1% yeast extract, 2% peptone, 100 mm potassium phosphate (ph 6.0), 1.34% yeast nitrogen base (ynb), 4 10 - 5% biotin, 1% glycerol) and cultured at 250 rpm and 30c until the culture medium reached an od600 of 2 - 6. the cells were harvested by centrifuging and re - suspended in buffered methanol complex medium (bmmy ; 1% yeast extract, 2% peptone, 100 mm potassium phosphate, ph 6.0, 1.34% ynb, 4 10 - 5% biotin, and 0.5% methanol) to an od600 of 1.0 and cultured in a 250 ml flask at 250 rpm under 30c. inductive expression was carried out with the addition of methanol (0.5%, v / v) per 24 hours at 30c lasted for 3 days (1, 11). the samples were analyzed by the sodium dodecyl sulfate - polyacrylamide gel electrophoresis (sds - page) and western blotting. for extraction and purification of rcoree1e2, the cells were disrupted by glass beads in a tris / edta / nacl (ten) buffer and then centrifuged. the deposit was re - suspended in a ten buffer with 8 m urea and centrifuged again. the supernatant was dialyzed against 5 mm tris hcl (ph 9.3) overnight at 4c and then clarified by centrifugation. the supernatant was first loaded to a q - sepharose fast flow column with 20 mm tris after washing with 0.05 m nacl and 20 mm tris - hcl (ph 9.3), the rcoree1e2 was eluted with 0.5 m nacl and 20 mm tris hcl (ph 9.3).then the eluted was loaded to a phenyl sepharose fast flow column with 20 mm tris the rcoree1e2 was further purified with sephadex g150 column for removing low molecular weight fractions. the purified rcoree1e2 was dialyzed against 5 mm tris hcl (ph 9.3) and sterilized with 0.45 m filter, and then stored at 4c. briefly, the supernatant was loaded onto ni - nitrilotriacetic acid (ni - nta) agarose (qiagen, germany) in the presence of 0.5% tween 80 and 40 mm imidazole. the column was washed extensively, and the protein was eluted with 1 m imidazole. the rcoree1e2 was purified from the insoluble fraction by using 0.5% n - lauryl sarcosine (sarkosyl). the protein was purified over ni - nta super flow and the sarkosyl was replaced by 0.1% tween 80. the protein was eluted in the presence of 200 mm imidazole and 0.1% tween 80 in phosphate buffer (11). supernatant of culture harvested and the cells were harvested and washed twice in ten buffer. the rcoree1e2 was mixed with sample buffer and boiled for 10 minutes in the presence of dithiothreitol (dtt), and around 200 ng was loaded on a 4 - 12% bis - tris nupage gel (invitrogen, usa). the primary antibodies against core, e1 e2 were (santa cruse, usa) ; the secondary antibody was polyclonal rabbit anti - mouse horse radish peroxidase (hrp) labeled. staining was done and the molecular weight marker was a mix of proteins from sigma (usa) : bovine serum albumin (a-7517), ovalbumin (a-7642), carbonic anhydrase (c-2273), beta lactoglobulin (l-4756) and alpha - lactalbumin (l-6385) or the precision and precision plus protein standards (bio - rad, usa). purified rcoree1e2 was digested with n - glycosidase f (pngase f) and the digested proteins were treated according to the manufacturer s instructions (new england biolabs, uk) and then analyzed by western blotting with mab fore core e1 e2. approximately rcoree1e2 (300 g) diluted in 2 ml sterilized 0.9% nacl was used for immunization. a new zealand rabbits was subcutaneously immunized in multiple sites on the back with 0 g (negative control) or 300 g purified rcoree1e2, respectively. booster injections were given with the same doses at 2, 3, 4, 5 and 13 weeks later. an indirect elisa was used to measure anti - rcoree1e2 antibodies in rabbit s serum. in brief, a recombinant protein (10 mg / ml) diluted in 50 mm carbonate buffer (ph 9.6) was used to coat microtiter plates, overnight at 4c. after blocking with 2% (w / v) skim milk powder (oxoid ltd,) in pbs with 0.05% (v / v), tween 20 (sigma, usa) (pbst), ph 7.2 for 1 hour at room temperature. the serum samples were added in duplicate, either 1/20 in dilution buffer (pbst), containing 1% (w / v) skim milk powder, to test seroconversion or in a double serial starting at 1/50 dilution for titration. a hrp - labeled antirabbit igg (sigma, usa) was added to 1/10,000 in the dilution buffer. after 1 hour of incubation at room temperature (rt) and washing, tetramethylbenzidine substrate (sigma, usa) reactions were stopped with 50 ml of 2.5 m h2so4. absorbance was read at 450 nm in a sensident scan (merck, germany). the cut - off value used to consider a positive antibody response was established as twice the mean of absorbance values of the preimmune sera (19). hcv rcoree1e2 particles were coated at 1 g / ml in carbonate buffer in microtiter plates and were incubated. the plates were washed and incubated with blocking buffer (0.5% casein in pbs). sera of chronically hcv - infected people or sera of healthy persons were added in a dilution of 1/20. the plates were washed and incubated with horse radish peroxidase labelled rabbit anti - human immunoglobulins. the tetramethylbenzidine substrate (sigma, usa) reaction was stopped by addition of 2 n h2so4 and the absorbance was measured at 450 nm. the cut - off value to consider a positive antibody response was established as twice the mean od 450 nm of the negative control sera (19 - 21). total rna was extracted and cdna was synthesized using the improm - ii reverse transcription system (promega, usa). the presence of a heterologous gene mrna in pichia was detected by the real time - polymerase chain reaction (rt - pcr) and real - time pcr with forward primer 5- ttgggacatgatgatgaattgg -3 and reverse primer 5- tgcctgtgggattctaagc -3 and probe 5- acagccgcattggttgtcgcc -3 that anneal in the internal sequence of the coree1e2 genes (21, 22). the codon - optimized gene was designed based on the protein sequence of coree1e2 according to the codon bias of p. pastoris (http://www.kazusa.or.jp/codon). codon optimization was performed by using the genscript program. the entire coree1e2 gene with xho i and not i restriction sites at each end was designed and was in frame with -factor of a ppicza vector. our supernatant collected and recombinant coree1e2 was purified and fixed in glutaraldehyde and negatively stained with the uranyl acetate prior to analysis by the transmission electron microscopy. the continuous coding regions of core (269 nt-841nt) e1 (842 nt-1417nt) and e2 (1418 nt-2506nt) were amplified by pcr from infected blood by hcv (genotype 1a) and the product (2237 bp) was cloned in a vector. the colony pcr was done to verify the insertion of target gene in vector (figure 1). after that target gene and ppicza digested by xhoi and noti enzymes and ligated into recombinant expression vector the ppicza - coree1e2 was linearized and electroporated into p. pastoris strain gs115 ; gs115 and different colonies in different concentrations of zeocin were evaluated and the most resistant colons, which tolerated 800 and 1600 mic / ml were chosen for a huge expression phase. the rcoree1e2 protein was purified and proteins were studied by sds - page and western blotting (figure 2 and 3). core protein with 20 kda and e1 protein with 40 kda and e2 with 60 kda were shown. the codon optimization was designed based on the protein sequence of coree1e2 according to the codon bias of p. pastoris (http://www.kazusa.or.jp/codon). the virus like particle is shown in our supernatant with electron microscopy (em) negative staining image with 70 nm particles in our sample. the value of codon adaptation index (cai) of 1.0 is considered to be ideal and perfect while a cai of > 0.80 is rated as good for expression in the desired p. pastoris. the percentage distribution of codon frequency distribution (cfd) of 100 is set for the codon with the highest usage frequency for a given amino acid in p. pastoris. codons with values lower than 30 are likely to hamper the expression efficiency and as it shows after codon optimization the value of frequency of optimal codons (fop) in our gene is acceptable and all cordon s distributions are upper than 50%. interestingly, 60 percent of codon frequency distribution is 91 - 100%, 5 percent is 81 - 90%, 8 percent is 71 - 80%, 6 percent is 61 - 70%, 14 percent is 51 - 60% and 3 percent is 41 - 50% and no distribution lower than 40% was detected. as in figure 3 is clearly shown, the thickness of bands in an optimized sample comparing with a not - optimized sample shows that most codons are expressed better in p. pastoris. the presence of target mrna in p. pastoris was detected by rt - pcr and real - time pcr to detect core - e1-e2 and housekeeping genes (data not shown). to digest carbohydrate residues from a recombinant core - e1-e2, pngase f was used to remove unnecessary n - glycan bands (figure 4). as it is clear, before digestion the presence of smear in lane 1 is present but after digestion in lane 2 and also in positive control, all bands are sharp and core with 20 kda and e1 with 40 kda and e2 with 60 kda are illustrated. for evaluation rcoree1e2 particles against patient sera, we compared our homemade kit with international quicktiter hcv core antigen elisa kit (catalog numbers vpk-151) against the sera of some patients (figure 5). from those patients, 8 samples were shown and interestingly in case number 4, 5, 6, 7 the result of our kit is better than a standard kit. number 7 has the highest titer of antibody and in our kit it is 118 ng / ml but in quicktiter kit it is 90 ng / ml and in case 4 the lowest titer was detected and antibody level by our kit shows 38 ng / ml and quicktiter kit shows 22 ng / ml. for in vivo immunization, the new zealand rabbit was subcutaneously immunized in multiple sites and after a last booster injection the titer of antibody was checked. the first serum was collected before immunization and no anti hcv antibody was detected by elisa and this sample was kept as zero in the data chart. after the last injection, every week sample showed the raise of antibody ; for example in week 5 the rate of antibody is 49 ng / ml in week 8 is 100 ng / ml and surprisingly in the week of 10 the antibody titer is 120 ng / ml (figure 6). (1, 2) do not have the gene and in (3) colony 2237 bp target gene amplified ; (4) ladder 1000 bp. (1) molecular weight ladder (2) core (20 kda), e1 (40 kda), e2 (60 kda) proteins. (1) recombinant protein before optimization ; (2) recombinant protein after optimization ; (3) hepatitis c virus proteins as positive control ; (4) negative control ; mw is molecular weight markers. (1) recombinant protein before pngase f and it is smear like and heavy with n - glucan bands ; (2) recombinant protein after pngase f without extra n - glucan linkages and sharp bands ; (3) hcv proteins as positive control ; (4) negative control ; mw is molecular weight markers. the blue bar is the result of antibody of patients antigen elisa kit quicktiter hcv core and another bar is antibody titers of patients with our elisa kit ; in this chart 8 samples are shown and in number 4, 5, 6, 7 the result of homemade kit is better than quicktiter kit ; data were repeated 3 times and results were the same. one of the aims of hcv research is to develop an effective vaccine to produce acceptable immunity in human sera against hcv glycoproteins (2, 6). in our study, the iranian sample of hcv virus (genotype 1a) diagnosed and used as a temple for amplification. although some research showed that it was difficult to express hcv envelope proteins by yeast p. pastoris (11), we could express hcv rcoree1e2 by p. pastoris expression system. the expression vector, which was used in our study is a ppicza vector and this vector has -factor to help us to express and secret recombinant protein in high volume. therefore, western blotting using anti - core / e1/e2 mabs demonstrated a different bands for core 20 kda, e1 40 kda, e 260 kda in yeast - expressed system. using a eukaryotic expression system for hcv envelope glycoproteins can help us to make native shape and function for our recombinant proteins. pichia pastoris can synthesize and process rcoree1e2 carrying glycans, which could be digested by pngase f and this glycozilation is similar to some of original hcv envelope glycoproteins. the truth is that glycans of rcoree1e2 should be different to native coree1e2 because of the difference between yeast and mammalian cells. the pngase f removes all three types of amino - linked glycans, high mannose - type glycans, hybrid - type glycans, and complex - type glycans. in p. pastoris cells, the n - glycosylation pathway is similar to the pathway in human cells except that p. pastoris cells have just high mannose structures. enzymatic deglycosylation with pngase f resulted that the glycosylated smeared band was disappeared and sharp band with less molecular weight, which corresponds to nonglycosylated proteins was remained, indicating that the multiple bands arise by different degrees of n - glycosylation. the yeast expressed rcoree1e2 has all potential n - glycosylation sites occupied (11, 19). we reported that codon optimization leads to increase the expression of recombinant core - e1-e2 in p. pastoris. we designed the core - e1-e2 gene by choosing the most preferred codons, while avoiding the formation of stable secondary structures and our data was similar with other optimization studies, which show an increase of efficacy by codon optimization (16 - 18). the translational hypothesis related to translation initiation and elongation rates has been well- accepted for explaining the codon usage bias in eukaryotes. although the mrna levels were similar between the native and the optimized constructs, suggesting that the increased expression is attributable to the enhancement of posttranscriptional processing (data not shown). as the genes were placed after the -factor secretion peptide, we expect that the increased expression by codon optimization should be mainly due to the enhanced translation elongation instead of translation initiation. it seems that other factors like protein folding within the endoplasmic reticulum and secretion signal processing may be important in secretion ability. moreover, in our study the native gene employs tandem rare codons that can reduce the efficiency of translation or even disengage the translational machinery. we changed the codon usage bias in p. pastoris by optimizing the cai to 0.85. gc content and unfavorable peaks have been optimized to prolong the half - life of the mrna. the stem - loop structures, which impact ribosomal binding and stability of mrna, were broken. in addition, our optimization process has screened and successfully modified those negative cis - acting sites. in other past researches, different parts of hcv glycoproteins were used for immunization in mice, goat, sheep and raising antibody detected (6, 9, 19, 23). in this study, the strategy of inducing broadly neutralizing antibodies is probably successful to produce anti hcv glycoprotein antibody as it succeeds in rabbit and our rcoree1e2 can induce high humeral immune response and it can be one step forward for evaluation of hcv vaccine for in vivo research. the immune reactivity of rcoree1e2 particles was tested by the international elisa kit quicktiter hcv and homemade elisa kit, using sera from chronically hcv - infected persons. indicating the epitopes presented by our particle s conformation is very analogous with the original hcv particle. the evaluation of human sera, showing anti - hcv positive sera against rcoree1e2 proteins demonstrated that anti - hcv positive sera recognized our recombinant peptide by elisa and even in some cases our results were better than the international kit. moreover our data shows that human sera is anti - recombinant protein and can neutralize our protein in elisa system which has better result than other researches and all immunogenic sites are in our recombinant protein, which has not been in other studies (20, 24). the virus like particles have a modal diameter centered about 70 nm and were shown with negative staining by electron microscopy and also because coree1e2 assembled together, the size of particle increased which is similar to other studies base on hcv particles in vivo and in vitro (7, 8, 13). in conclusion, the expression of the hcv structural proteins in p. pastoris would be useful for studying the mechanisms of hcv processing, morphogenesis, immunity and assembly. natural hcv structural proteins are not useful for developing vaccines or specific anti - sera because the virus concentrations in the infectious materials are very low. therefore, recombinant hcv structural proteins are useful as immunogens. for the development of preventive vaccines and therapeutic treatments against hcv, the rcoree1e2 protein might be a crucial element and the results obtained in this work may therefore contribute to this effort. moreover, p. pastoris yeast expression system is an efficient eukaryotic expression system and we believe that the p. pastoris yeast - expressed rcoree1e2 is a promising hcv vaccine candidate for industrial purpose. | background : gradual development of a useful vaccine can be the main point in the control and eradication of hepatitis c virus (hcv) infection. hepatitis c virus envelope glycoproteins are considered as the main hcv vaccine candidate.objectives:in this study, the pichia pastoris expression system was used to express a recombinant hcv coree1e2 protein, which consists of core (269 nt-841nt) e1 (842 nt-1417nt) and e2 (1418 nt-2506nt).materials and methods : by a codon optimization technique based on the p. pastoris expression system, we could increase the rate of recombinant proteins. moreover, the purified protein can efficiently induce anti - coree1e2 antibodies in rabbits, and also by developing a homemade enzyme - linked elisa kit we can detect antibody of hcv iranian patients with genotype 1a.results:in our study, the virus - like particle of rcoree1e2 with 70 nm size, was shown by electron microscopy and proved the self - assembly in vitro in a yeast expression system.conclusions:these findings of the present study indicate that the recombinant coree1e2 glycoprotein is effective in inducing neutralizing antibodies, and is an influential hcv vaccine candidate. |
cd36 is a multifunctional signalling molecule with several known ligands, including thrombospondin-1, long chain fatty acids and both native and atherogenic lipoproteins, including oxidised low - density and high - density lipoproteins (reviewed in thorne.). expressed on a variety of cells and tissues, including platelets, erythrocytes, monocytes, endothelial cells and leucocytes, cd36 is intimately involved in lipid metabolism and homoeostasis and has been strongly implicated in pathological conditions associated with metabolic dysregulation, including obesity, insulin resistance, diabetes, diabetic nephropathy and atherosclerosis. more recently, a circulating form of cd36, termed soluble (s) cd36, was identified in human plasma as a novel biomarker for type 2 diabetes mellitus (t2 dm). further analysis showed that scd36 levels clustered with markers of insulin resistance and elevated scd36 correlated with increased risk of t2 dm. these authors also found that scd36 could be a marker of atherosclerotic plaque instability, a major determinant in the risk of acute coronary syndromes. in addition, scd36 was elevated in pre - diabetic conditions, including polycystic ovary syndrome and was identified as a novel marker of liver injury in patients with altered glucose metabolism. even in a non - diabetic healthy population, plasma scd36 was significantly associated with markers of insulin resistance, atherosclerosis and fatty liver. all of these studies used an enzyme - linked immunosorbent assay (elisa) for cd36 using relative arbitrary units. despite its apparent significance, normal absolute ranges for plasma cd36 protein concentration have not been quantified, and the cellular source(s) of plasma cd36 has not been identified. the cd36 glycoprotein is known to be profoundly resistant to proteolytic cleavage, and this property is thought to result from its heavily n - glycosylated extracellular domain. consequently, we hypothesised that circulating cd36 was unlikely to constitute a cleaved cell - free variant of the receptor. studies from our laboratory confirmed this as scd36 in plasma was shown to be entirely associated with circulating microparticles (mps). corroborating our findings, a report using mass spectrometry confirmed that cd36 was one of 130 core ' proteins of plasma mps in a cohort of patients with a high rate of cardiovascular disease (86%) and diabetes (75%). mps are small (0.11 m in diameter) membranous microvesicles that can be specifically and selectively released from virtually any eukaryotic cell. they retain many features of their cell of origin, so that examination of their antigen expression can reveal their cellular source. greater than 90% of circulating mps are thought to be platelet derived, present in the plasma of normal healthy individuals at an estimated concentration of up to 50 g ml. however, their numbers and cellular source can change dramatically in various pathological states, including t2 dm and cardiovascular disease. importantly, mps are enriched with bioactive proteins and nucleic acids, and there is growing evidence that they form a network of biological vectors able to transfer cellular components to remote areas of the body in order to mediate specific changes in their target cells. thus, rather than being a simple biomarker, cd36 may, in fact, identify a specific subset of mps that act as mediators in the pathogenesis of metabolic disease. the aim of the present study was to quantify the absolute plasma levels of cd36 protein concentration and cd36+mps in healthy and diabetic individuals, to discover their cellular source and ultimately determine whether any differences exist in these parameters relative to obesity and/or t2 dm. cases consisted of a sub - population (n=33) randomly selected from a cohort of 120 patients with poorly controlled t2 dm recruited from the john hunter hospital diabetes clinic, hunter new england area health service, nsw, australia. the median duration (interquartile range) of disease was 10.0 (5.017.0) years. these were age- and gender - matched to plasma samples from 33 lean (body mass index (bmi) 2025 kg m) and 33 obese (bmi>25 kg m) healthy controls sourced from previously collected plasma samples from 400 healthy red cross blood donors. the study was approved by the university of newcastle and hunter new england area human research ethics committees, and informed consent was obtained from all the participants. peripheral blood samples were collected into 3.2% na citrate vacuette containers (greiner bio - one gmbh, frickenhausen, germany) and platelet - free plasma was prepared by serial double centrifugation (15 min at 2100 g) within 2 h of collection. aliquoted samples were stored at 80 c, then thawed at 37 c immediately before analysis. staining and analysis of mps was performed essentially as previously described and according to guidelines established by the international society on thrombosis and haemostasis vascular biology ssc on the standardisation of fmc - based pmp enumeration by flow cytometry incorporating modifications suggested for the bd facs canto (bd biosciences, san jose, ca, usa). to calibrate the cytometer, a blend of 2:1:1 0.5-, 0.9- and 3-m diameter fluorescent beads (megamix, biocytex, marseille, france) was used to ensure adequate fsc resolution and set the lower mps ' detection limit according to the manufacturer 's instructions. a 10-l aliquot of platelet - free plasma was incubated at room temperature for 30 min with an antibody against cd36 (clone 11h5) conjugated to dylight-488 in various combinations with cd41-phycoerythrin (cd41-pe ; clone pl2 - 49, biocytex ; platelet marker), cd14-pe (clone tk4, miltenyi biotec, teterow, germany ; monocyte marker), cd235a - allophycocyanin (cd235a - apc ; clone ga - r2 (hir2), bd pharmingen, san diego, ca, usa ; erythrocyte marker), cd105-pe (clone 1g2, beckman coulter, brea, ca, usa ; endothelial marker) and annexin v - apc (ebioscience, san diego, ca, usa ; to measure phosphatidylserine (ps) exposure as a marker of vesicles derived from activated or apoptotic cells). all assays were diluted in phosphate - buffered saline (pbs ; without ca and mg), with the exception of those containing annexin v, which were diluted in calcium - rich binding buffer as supplied by the manufacturer (ebioscience). trucount counting tubes (bd biosciences) were used to enable absolute mp quantification, and events were collected for 60 s at low flow rate on a bd facs canto (bd biosciences) before analysis using facs diva software (bd biosciences). the absolute number of mps in each plasma sample was calculated using the formula : mps l=(mp count / bead count) (total beads in trucount tube / test volume). the reproducibility of the assay was determined by staining and analysing a series of five different plasma samples in triplicate on five separate occasions. the intra- and interassay variability was thus calculated to be 11.3% and 10.6%, respectively. elisa plates (microlon high - binding ; greiner bio one, west heidelberg, australia) were precoated with anti - cd36 mab (11h5 ; 500 ng per well) overnight at 4 c before blocking with 5% (w / v) skimmed milk powder in pbs buffer containing 0.05% (v / v) tween-20. serial dilutions of platelet - purified cd36 were prepared in pbs for the standard curve, and plasma samples were diluted 1/4 in pbs before being applied to coated wells for 2 h at room temperature. following a further 2 h incubation with a rabbit polyclonal antibody against cd36, immunocomplexes were detected with anti - rabbit igg horseradish peroxidise conjugate (1:5000 (v / v) ; bio - rad, richmond, ca, usa) and developed with sigmafast opd (o - phenylenediamine dihydrochloride, sigma - aldrich, castle hill, nsw, australia). reactions were stopped after 30 min by addition of 3 hcl, and absorbance was measured at 490 nm using a spectramax microplate reader (molecular devices, hawthorne east, australia). sample concentration was determined from a standard curve constructed by linear regression after plotting concentration vs absorbance on logarithmic scales. the minimum level of cd36 protein detection was 78 ng ml. the reproducibility of the elisa was ensured by repeating a subset of samples on different days. the mean intra- and interassay coefficients of variation from these experiments were 14.1% and 9.5%, respectively. variables that were not normally distributed were either analysed using non - parametric tests or log transformed before analysis as indicated. differences in mean levels of normally distributed continuous variables were assessed using the student 's t - test, while the non - parametric mann correlations between continuous variables were assessed by pearson product - moment, while their association with quartiles of plasma cd36 protein concentration was determined by ordinal multinomial logistic regression. frequencies of dichotomous variables were evaluated using fisher 's exact test, and multivariate analysis was performed by unconditional multiple logistic regression. all calculations were performed with statistica v10.0 (statsoft, tulsa, ok, usa) using two - tailed tests, and p - values 25 kg m) healthy controls sourced from previously collected plasma samples from 400 healthy red cross blood donors. the study was approved by the university of newcastle and hunter new england area human research ethics committees, and informed consent was obtained from all the participants. peripheral blood samples were collected into 3.2% na citrate vacuette containers (greiner bio - one gmbh, frickenhausen, germany) and platelet - free plasma was prepared by serial double centrifugation (15 min at 2100 g) within 2 h of collection. aliquoted samples were stored at 80 c, then thawed at 37 c immediately before analysis. staining and analysis of mps was performed essentially as previously described and according to guidelines established by the international society on thrombosis and haemostasis vascular biology ssc on the standardisation of fmc - based pmp enumeration by flow cytometry incorporating modifications suggested for the bd facs canto (bd biosciences, san jose, ca, usa). to calibrate the cytometer, a blend of 2:1:1 0.5-, 0.9- and 3-m diameter fluorescent beads (megamix, biocytex, marseille, france) was used to ensure adequate fsc resolution and set the lower mps ' detection limit according to the manufacturer 's instructions. a 10-l aliquot of platelet - free plasma was incubated at room temperature for 30 min with an antibody against cd36 (clone 11h5) conjugated to dylight-488 in various combinations with cd41-phycoerythrin (cd41-pe ; clone pl2 - 49, biocytex ; platelet marker), cd14-pe (clone tk4, miltenyi biotec, teterow, germany ; monocyte marker), cd235a - allophycocyanin (cd235a - apc ; clone ga - r2 (hir2), bd pharmingen, san diego, ca, usa ; erythrocyte marker), cd105-pe (clone 1g2, beckman coulter, brea, ca, usa ; endothelial marker) and annexin v - apc (ebioscience, san diego, ca, usa ; to measure phosphatidylserine (ps) exposure as a marker of vesicles derived from activated or apoptotic cells). all assays were diluted in phosphate - buffered saline (pbs ; without ca and mg), with the exception of those containing annexin v, which were diluted in calcium - rich binding buffer as supplied by the manufacturer (ebioscience). trucount counting tubes (bd biosciences) were used to enable absolute mp quantification, and events were collected for 60 s at low flow rate on a bd facs canto (bd biosciences) before analysis using facs diva software (bd biosciences). the absolute number of mps in each plasma sample was calculated using the formula : mps l=(mp count / bead count) (total beads in trucount tube / test volume). the reproducibility of the assay was determined by staining and analysing a series of five different plasma samples in triplicate on five separate occasions. the intra- and interassay variability was thus calculated to be 11.3% and 10.6%, respectively. elisa plates (microlon high - binding ; greiner bio one, west heidelberg, australia) were precoated with anti - cd36 mab (11h5 ; 500 ng per well) overnight at 4 c before blocking with 5% (w / v) skimmed milk powder in pbs buffer containing 0.05% (v / v) tween-20. serial dilutions of platelet - purified cd36 were prepared in pbs for the standard curve, and plasma samples were diluted 1/4 in pbs before being applied to coated wells for 2 h at room temperature. following a further 2 h incubation with a rabbit polyclonal antibody against cd36, immunocomplexes were detected with anti - rabbit igg horseradish peroxidise conjugate (1:5000 (v / v) ; bio - rad, richmond, ca, usa) and developed with sigmafast opd (o - phenylenediamine dihydrochloride, sigma - aldrich, castle hill, nsw, australia). reactions were stopped after 30 min by addition of 3 hcl, and absorbance was measured at 490 nm using a spectramax microplate reader (molecular devices, hawthorne east, australia). sample concentration was determined from a standard curve constructed by linear regression after plotting concentration vs absorbance on logarithmic scales. the minimum level of cd36 protein detection was 78 ng ml. the reproducibility of the elisa was ensured by repeating a subset of samples on different days. the mean intra- and interassay coefficients of variation from these experiments were 14.1% and 9.5%, respectively. data for continuous variables were expressed as means.d. or median (interquartile range) where appropriate. variables that were not normally distributed were either analysed using non - parametric tests or log transformed before analysis as indicated. differences in mean levels of normally distributed continuous variables were assessed using the student 's t - test, while the non - parametric mann correlations between continuous variables were assessed by pearson product - moment, while their association with quartiles of plasma cd36 protein concentration was determined by ordinal multinomial logistic regression. frequencies of dichotomous variables were evaluated using fisher 's exact test, and multivariate analysis was performed by unconditional multiple logistic regression. all calculations were performed with statistica v10.0 (statsoft, tulsa, ok, usa) using two - tailed tests, and p - values < 0.05 were considered statistically significant. the cohorts were well matched in terms of gender and age, and differed mainly in terms of bmi. in this regard, the diabetic participants were also significantly more obese than the obese controls (p<0.001). this was reflected by differences in white blood cell count parameters, which are known to be positively associated with obesity and also weakly influenced by plasma insulin levels. flow cytometry was used to detect expression of cd36 as well as other specific cellular markers on circulating mps in plasma samples collected from lean and obese controls together with obese diabetics. as shown in figure 1, a substantial number of mps in plasma from all the cohorts were found to express cd36, with levels corresponding to approximately 50% of those of platelet - derived mps. importantly, cd36+mps were significantly higher in the obese t2 dm cohort (median (interquartile range) per l of plasma=1063 (7851276)) compared with the obese controls (415 (2955020), p<0.00001). similar results were observed for mps expressing markers specific to platelets (cd41), erythrocytes (cd235a) and monocytes (cd14), as well as the general apoptotic / activation marker ps (as detected by annexin v). the proportion of platelet - derived mps that expressed ps was also greatly increased in the diabetic cohort. only the number of mps expressing the endothelial marker (cd105) was found to be similar between all the three cohorts. there was no significant difference in any of the mp subsets between lean and obese controls. correlation analysis of the combined cohorts revealed that the number of mps expressing cd41, cd235a and cd14 were not related to the peripheral blood count of their respective cells of origin (that is, platelets, r=0.19, p=0.073 ; erythrocytes, r=0.03, p=0.727 ; monocytes r=0.19, p=0.054) ; however, there was a strong positive correlation between the total leucocyte count and most mp subsets (cd36+mp, r=0.30, p=0.003 ; cd41+mp, r=0.41, p<0.001 ; cd235a+mp, r=0.34, p=0.001 ; cd14+mp, r=0.16 p=0.113 ; cd105+mp, r=0.17, p=0.092 ; annexin v+mp, r=0.18, p=0.08 ; and cd41+/annexin v+mp, r=0.25, p=0.011). none of the peripheral blood count parameters or mp levels were related to participants ' age (data not shown). during the course of multicolour flow cytometry analysis for individual mp subsets, it became clear that the majority of circulating cd36+mps co - expressed other markers being investigated. in an effort to determine the primary origin of these cd36+mps, the percentage expressing each of the analysed markers was calculated. as illustrated in figure 2, the primary source of cd36+mps in obese t2 dm individuals was from erythrocytes (35.814.6%), occurring at levels that were significantly greater than in obese controls (22.29.0% p<0.00001). by contrast, the main source of cd36+mps in non - diabetic individuals was endothelial cells (40.98.3% and 33.98.3% for lean and obese controls, respectively) followed closely by platelets (16.88.3% and 23.812.0%). overall, only the subset of cd36+mps expressing ps was specifically increased in diabetes, while an increase in the percentage of cd36+mps derived from platelets was specific to obesity and an increase in erythrocyte - derived cd36+mps was common to both conditions, albeit highest in diabetes. there was no correlation between levels of any of the cd36+mp subsets and any of the peripheral blood parameters listed in table 1, with the exception of the percentage of cd41+/cd36+mps, which was weakly associated with platelet counts (r=0.22, p=0.030). we speculated that high levels of glycated haemoglobin (as measured by plasma hba1c) within diabetic erythrocytes may trigger increased apoptosis and/or shedding of this cellular toxin in membrane - bound vesicles. the diabetic cohort was known to have poorly controlled diabetes, with average hba1c levels of 7.71.1%. however, there was no correlation between these values and the overall number of cd235a+mps or the percentage of cd36+mps expressing this marker (figure 3). this was confirmed using an extended cohort (n=44) of obese people with t2 dm (supplementary figure s1). an elisa assay was devised to measure the absolute levels of cd36 protein in the same plasma samples used in the above experiments. these levels were determined to range from undetectable in 31/99 participants to as high as 22.9 g ml. as shown in figure 4, the median levels progressively increased from lean to obese controls to obese diabetic individuals (1.71 vs 2.47 vs 3.90 g ml), with the difference between the latter two cohorts being statistically significant (p=0.036). in order to accurately assess the relationship between protein and mp levels of cd36, the cd36 protein concentrations were log transformed and divided into quartiles to accommodate the large number of data points below the limit of detection for the assay. this was then compared with the normalised cd36+mp levels for each lean, obese and obese diabetic participant, with the results illustrated in figure 5. when all cohorts were combined, it became clear that there was a strong correlation between cd36+mp levels and cd36 protein concentrations (p=0.0006). however, the individual distributions of lean, obese and obese diabetic participants was only weakly correlated with quartiles of plasma cd36 protein concentration (p=0.021), with diabetic patients appearing in all the quartiles. by contrast, none of the diabetic patients had cd36+mp levels in the lower half of the y axis as illustrated on the graph. multivariate analysis confirmed that even when corrected for bmi and blood parameters, cd36+mp levels were a much better marker of diabetes than cd36 protein levels (p=0.009 vs p=0.398, respectively). however, neither parameter was significantly associated with obesity in the control cohorts (p=0.173 for cd36+mp and p=0.906 for quartiles of cd36 protein levels). the cohorts were well matched in terms of gender and age, and differed mainly in terms of bmi. in this regard, the diabetic participants were also significantly more obese than the obese controls (p<0.001). this was reflected by differences in white blood cell count parameters, which are known to be positively associated with obesity and also weakly influenced by plasma insulin levels. flow cytometry was used to detect expression of cd36 as well as other specific cellular markers on circulating mps in plasma samples collected from lean and obese controls together with obese diabetics. as shown in figure 1, a substantial number of mps in plasma from all the cohorts were found to express cd36, with levels corresponding to approximately 50% of those of platelet - derived mps. importantly, cd36+mps were significantly higher in the obese t2 dm cohort (median (interquartile range) per l of plasma=1063 (7851276)) compared with the obese controls (415 (2955020), p<0.00001). similar results were observed for mps expressing markers specific to platelets (cd41), erythrocytes (cd235a) and monocytes (cd14), as well as the general apoptotic / activation marker ps (as detected by annexin v). the proportion of platelet - derived mps that expressed ps was also greatly increased in the diabetic cohort. only the number of mps expressing the endothelial marker (cd105) was found to be similar between all the three cohorts. there was no significant difference in any of the mp subsets between lean and obese controls. correlation analysis of the combined cohorts revealed that the number of mps expressing cd41, cd235a and cd14 were not related to the peripheral blood count of their respective cells of origin (that is, platelets, r=0.19, p=0.073 ; erythrocytes, r=0.03, p=0.727 ; monocytes r=0.19, p=0.054) ; however, there was a strong positive correlation between the total leucocyte count and most mp subsets (cd36+mp, r=0.30, p=0.003 ; cd41+mp, r=0.41, p<0.001 ; cd235a+mp, r=0.34, p=0.001 ; cd14+mp, r=0.16 p=0.113 ; cd105+mp, r=0.17, p=0.092 ; annexin v+mp, r=0.18, p=0.08 ; and cd41+/annexin v+mp, r=0.25, p=0.011). none of the peripheral blood count parameters or mp levels were related to participants ' age (data not shown). during the course of multicolour flow cytometry analysis for individual mp subsets, it became clear that the majority of circulating cd36+mps co - expressed other markers being investigated. in an effort to determine the primary origin of these cd36+mps, the percentage expressing each of the analysed markers was calculated. as illustrated in figure 2, the primary source of cd36+mps in obese t2 dm individuals was from erythrocytes (35.814.6%), occurring at levels that were significantly greater than in obese controls (22.29.0% p<0.00001). by contrast, the main source of cd36+mps in non - diabetic individuals was endothelial cells (40.98.3% and 33.98.3% for lean and obese controls, respectively) followed closely by platelets (16.88.3% and 23.812.0%). overall, only the subset of cd36+mps expressing ps was specifically increased in diabetes, while an increase in the percentage of cd36+mps derived from platelets was specific to obesity and an increase in erythrocyte - derived cd36+mps was common to both conditions, albeit highest in diabetes. there was no correlation between levels of any of the cd36+mp subsets and any of the peripheral blood parameters listed in table 1, with the exception of the percentage of cd41+/cd36+mps, which was weakly associated with platelet counts (r=0.22, p=0.030). we speculated that high levels of glycated haemoglobin (as measured by plasma hba1c) within diabetic erythrocytes may trigger increased apoptosis and/or shedding of this cellular toxin in membrane - bound vesicles. the diabetic cohort was known to have poorly controlled diabetes, with average hba1c levels of 7.71.1%. however, there was no correlation between these values and the overall number of cd235a+mps or the percentage of cd36+mps expressing this marker (figure 3). this was confirmed using an extended cohort (n=44) of obese people with t2 dm (supplementary figure s1). an elisa assay was devised to measure the absolute levels of cd36 protein in the same plasma samples used in the above experiments. these levels were determined to range from undetectable in 31/99 participants to as high as 22.9 g ml. as shown in figure 4, the median levels progressively increased from lean to obese controls to obese diabetic individuals (1.71 vs 2.47 vs 3.90 g ml), with the difference between the latter two cohorts being statistically significant (p=0.036). in order to accurately assess the relationship between protein and mp levels of cd36, the cd36 protein concentrations were log transformed and divided into quartiles to accommodate the large number of data points below the limit of detection for the assay. this was then compared with the normalised cd36+mp levels for each lean, obese and obese diabetic participant, with the results illustrated in figure 5. when all cohorts were combined, it became clear that there was a strong correlation between cd36+mp levels and cd36 protein concentrations (p=0.0006). however, the individual distributions of lean, obese and obese diabetic participants was only weakly correlated with quartiles of plasma cd36 protein concentration (p=0.021), with diabetic patients appearing in all the quartiles. by contrast, none of the diabetic patients had cd36+mp levels in the lower half of the y axis as illustrated on the graph. multivariate analysis confirmed that even when corrected for bmi and blood parameters, cd36+mp levels were a much better marker of diabetes than cd36 protein levels (p=0.009 vs p=0.398, respectively). however, neither parameter was significantly associated with obesity in the control cohorts (p=0.173 for cd36+mp and p=0.906 for quartiles of cd36 protein levels). this study represents the first thorough investigation of the origin of circulating cd36 in human plasma. the results confirm our initial findings, which concluded that the proposed soluble form of cd36 (scd36) is not truly soluble but entirely associated with plasma mps. in the present study, we have gone on to further demonstrate that these cd36+mps are readily detectable in both t2 dm and non - t2 dm individuals, occurring at levels corresponding to approximately half that of platelet mps. importantly, the cellular source for the majority of cd36+mps could be accounted for using markers specific to platelet, endothelial and erythrocyte antigens. however, the relative amounts of each source differed between diabetic individuals and controls, with cd36+mps being mainly derived from erythrocytes in t2 dm as compared with endothelial cells in healthy controls. there have been many reports of increased levels of circulating mps in various pathological states associated with chronic inflammation and hypercoagulation, including obesity, the metabolic syndrome, and t2 dm. indeed, mps are well known to exhibit both pro - coagulant and pro - inflammatory properties. thus, the association of high mp counts with increased leucocyte count, a very basic but widely recognised indication of inflammatory conditions, is not unexpected. the most commonly examined mps are those derived from platelets and endothelial cells and often incorporate various activation markers ; while others target monocyte - derived mps ; and some focus on expression of molecules that may be specific to a particular function, such as tissue factor for its role in atherogenesis. regardless of the mp species, levels are nearly always found to be increased in t2 dm compared with controls. our results are consistent with this trend, showing significantly higher levels of mps expressing ps, cd41, cd235a, cd14 and cd36 in obese t2 dm compared with obese controls. thus, the absolute increase of cd36+mp levels could have simply been due to an overall increase in mp production associated with inflammation. however, analysis of specific subsets of cd36+mps revealed that these were not universally increased but rather particularly derived from erythrocytes. very few investigations of circulating mps have considered erythrocyte - derived mps in any disease context. most of the interest has occurred with respect to blood transfusion and the mechanisms of erythrocyte aging. throughout their short existence, erythrocytes gradually lose 20% of their haemoglobin and corresponding surface area through the shedding of vesicles in a vital mechanism that is postulated to rid the erythrocyte of damaged membrane in order to prolong its lifespan. as a consequence, the favourable surface area - to - volume ratio decreases, rendering old erythrocytes less deformable. in support of increased erythrocyte mp release in diabetes, a recent report has shown that erythrocyte deformability is impaired in patients with coronary artery disease coupled with diabetes, and this was inversely correlated to both glucose concentration and hba1c. furthermore, analysis of mps in stored erythrocyte transfusion bags has revealed that these vesicles are selectively enriched with the major modified haemoglobin species, including hba1c. thus, it would logically follow that high plasma glucose levels in poorly controlled diabetes that lead to increased percentage of hba1c would result in increased shedding of mps from erythrocytes. it was surprising then that we found no correlation between individual hba1c and circulating erythrocyte - derived mp levels in the our diabetic cohort. this unexpected finding clearly warrants further investigation, but nevertheless, there is some evidence to associate the level of diabetes control and the increased erythrocyte mps in diabetes. outside of the current work we know of only two small studies that have previously considered erythrocyte - derived mps in t2 dm, each giving rise to different conclusions. agouni. found that erythrocyte - derived mps were significantly increased in a cohort of 43 patients with metabolic syndrome, a third of whom also had diabetes. by contrast, diamant. showed no difference between cd235a+mps in 18 controls and 16 patients with normal bmi and uncomplicated diabetes of short duration. the differences may lie within the cohorts themselves as diabetic subjects analysed by agouni. 30), respectively, compared with the normal range of 3.55.5%). in the present study, the hba1c levels were even higher (7.71.1% in obese diabetic individuals), thereby providing a rationale to reconcile erythrocyte mps levels with the extent of diabetes control. levels of circulating endothelial cell mps are believed to reflect cellular damage and are increasingly being used as markers of endothelial cell dysfunction in various conditions, such as cardiovascular disease. however, we found no difference in overall endothelial cell - derived mps between t2 dm and controls, consistent with independent reports by sabatier., and tsimerman. this is in contrast to a report of increased total endothelial (cd144 +) mps in the metabolic syndrome, and a case control study by tramontano. who found cd105 + mp levels to be the only independent predictor of diabetes. these conflicting reports may simply reflect the diabetic cohort being analysed, as endothelial mp profiles have been shown to vary specifically with accompanying diabetic vascular complications, which were not considered in the present study. alternatively, medications consumed by the cohort to minimise vascular complications could also affect endothelial mp levels, as suggested by the findings that the latter are reduced by pioglitazone therapy in patients with the metabolic syndrome but increased in response to atorvastatin (statins were prescribed to over 60% of our t2 dm cohort as indicated in supplementary table s1) in patients with peripheral arterial occlusive disease. independent of these considerations, we found that levels of endothelial mps measured by detection of cd105 were unusually high ; even the control cohorts had levels that surpassed that of platelet mps. because cd105 is not specific for endothelial cells (it can also be expressed on activated macrophages, fibroblasts and smooth muscle cells), we have omitted any cd105+mps that co - expressed the leucocyte - specific marker cd45 ; however, this was negligible. others have observed endothelial mp levels of similar enormity in controls using antibodies to comparable non - specific markers such as cd31 (found on platelets, monocytes, granulocytes, and b - cells), even when combined with cd42 to exclude platelets. alternatively, particular species of endothelial mps have been shown to increase after prolonged storage at 80 c. the controls for the present study were collected before the cases and thus may have endothelial mp levels that are artefactually increased due to longer storage times. although all of the samples were processed in identical fashion, there is no consensus on the effects of long - term storage for mp enumeration, and this may also explain why the control endothelial mp levels appeared to be equal to that of the t2 dm patients. these were found to vary widely from undetectable (< 78 ng ml) to as high as 22.9 g ml. these values are relatively high compared with other plasma proteins such as scd40l and sicam (soluble intercellular adhesion molecule), which are in the order of 3 and 300 ng ml, respectively. the only other published study to use a quantitative cd36 elisa was performed by chmielewski., but their assay differed from ours in that they used serum rather than plasma samples. although serum has been reported to contain 10 times more platelet mps than plasma, it is not clear how much cd36 is contributed by these vesicles that have been produced by artificial platelet activation in vitro. in addition, other cd36-expressing mps present before activation may become entangled in the clot that forms. chmielewski. found the median cd36 protein concentration in serum to be a low 25.3 ng ml in non - diabetic patients, suggesting that the latter may be true. the recently released commercial elisa kits for quantification of cd36 in human plasma have a reported sensitivity of 1.0 ng ml (adipo bioscience, santa clara, ca, usa) and should facilitate further studies in this area. the high variability in plasma cd36 protein concentrations detected by elisa may reflect actual individual differences in cellular expression of cd36. protein levels on the surface of monocytes and platelets are largely determined by the inheritance of common cd36 gene polymorphisms, but this expression is also subject to further exogenous modulation. of particular relevance to the present cohort, statins have been shown to decrease cd36 expression on monocytes and have been associated with lower levels of scd36 in diabetic individuals. conversely, cd36 expression can be increased by both fat in the diet and hyperglycaemia. if the number of cd36 molecules on mps is reflective of that of the parent cell, then any analysis of absolute circulating cd36 protein levels will be subject to these various confounders. by contrast, quantification of the number of mps expressing cd36 will be less compromised by individual protein expression levels. for these reasons, it is perhaps not surprising that plasma cd36+mp levels were a much better marker of t2 dm than cd36 protein concentration per se. this is the first study to establish the source of the putative diabetic marker, plasma cd36 (cd36+mps), in t2 dm. compared with plasma cd36 protein concentration, cd36+mps were found to be a better independent marker of t2 dm with the advantage of facilitated measurement by multicolour flow cytometry. the increased percentage of cd36+mps originating from erythrocytes in t2 dm merits further investigation into the mechanism underlying this pathophysiology. future directions will focus on determining whether these specific vesicles have a particular role in contributing to the pathology of this disease. | objective : elevated plasma levels of the fatty acid transporter, cd36, have been shown to constitute a novel biomarker for type 2 diabetes mellitus (t2 dm). we recently reported such circulating cd36 to be entirely associated with cellular microparticles (mps) and aim here to determine the absolute levels and cellular origin(s) of these cd36+mps in persons with t2dm.design:an ex vivo case - control study was conducted using plasma samples from 33 obese individuals with t2 dm (body mass index (bmi)=39.96.4 kg m2 ; age=579 years ; 18 male:15 female) and age- and gender - matched lean and obese non - t2 dm controls (bmi=23.61.8 kg m2 and 33.55.9 kg m2, respectively). flow cytometry was used to analyse surface expression of cd36 together with tissue - specific markers : cd41, cd235a, cd14, cd105 and phosphatidyl serine on plasma mps. an enzyme - linked immunosorbent assay was used to quantify absolute cd36 protein concentrations.results:cd36+mp levels were significantly higher in obese people with t2 dm (p<0.00001) and were primarily derived from erythrocytes (cd235a+=35.814.6%) ; although this did not correlate with haemoglobin a1c. by contrast, the main source of cd36+mps in non - t2 dm individuals was endothelial cells (cd105+=40.98.3% and 33.98.3% for lean and obese controls, respectively). across the entire cohort, plasma cd36 protein concentration varied from undetectable to 22.9 g ml1 and was positively correlated with cd36+mps measured by flow cytometry (p=0.0006) but only weakly associated with the distribution of controls and t2 dm (p=0.021). multivariate analysis confirmed that plasma cd36+mp levels were a much better biomarker for diabetes than cd36 protein concentration (p=0.009 vs p=0.398, respectively).conclusions : both the levels and cellular profile of cd36+mps differ in t2 dm compared with controls, suggesting that these specific vesicles could represent distinct biological vectors contributing to the pathology of the disease. |
cytomegalovirus (cmv) a viral pathogen of herpesviridae, can cause serious disease in immunecompromise patients such as solid organ transplant recipients (sotr). despite our comprehensive knowledge about its management, cmv has been identified as the most frequently occurring complication, which affects mortality and morbidity of sotr. five - fold rise in overall mortality and 11-fold in cmv infection associated death are caused by cmv disease in sotr. cmv induces its effects through direct and indirect mechanism, which contain cmv syndrome, tissue invasive disease, acute and chronic graft rejection, opportunistic infection, posttransplant lymphoproliferative disorder and postliver transplant aggravation of c hepatitis. hence, prevention and treatment of cmv infection and disease is the key in ensuring the success of transplant outcome. monitoring in posttransplant period is performed with pp65 antigenemia and polymerase chain reaction (pcr) assays. in prophylactic method all patients immediately or shortly after transplant receive anti cmv drugs : ganciclovir (gcv), 5 mg / kg / day, po., gcv, 1 g. tid or valganciclovir (vgc), 900 mg po./day. in most studies, late onset cmv disease (disease occurrence after discontinue of prophylaxis), regular weekly monitoring by pcr or antigenemia tests is accomplished 3 months after transplantion and once detectable viremia achieved before symptomatic disease, anti cmv drug (intravenous [iv ] gcv or po. vgc) with therapeutic dose (5 mg / kg bid and 900 mg bid) is initiated till two negative tests are achieved. treatment of symptomatic cmv disease is done with therapeutic doses of above named drugs and duration of treatment determined like preemptive therapy, but should not be 1 publication was considered once. two separate groups of authors extracted data by using information sheets that included : type of study and authors, prophylactic regimen, number and cmv serology of patients, duration of regimens, method of diagnosis and monitoring, duration of posttransplant follow - up, rate of cmv disease, viremia or infection eradication, gcv resistance and overall mortality. discrepancy between two groups was resolved with discussion. for the purpose of this study cmv infection defined as presence of the virus that can be detected by growing it in vitro, pcr or antigenemia assays. cmv disease defined as presence of infection along with symptoms attributable to cmv syndrome or tissue invasive disease. in addition, gcv resistance was regarded as occurrence of known ul97 or ul54 mutations that are usually followed by resistance to gcv and clinical failure of response to anti cmv drugs and finally all - cause mortality as well as death associated with cmv in posttransplant period after receiving therapeutic or preventive regimens were regarded as mortality. in order to produce summary estimate we used inverse variance as the weight for each study. fix effect was used when there was no heterogeneity among the result of studies. in order to check the heterogeneity, we used chi - square test. in addition we assessed heterogeneity by checking t as well as i. we pooled the results of prophylaxis, preemptive and treatment studies separately and where there were available data we run subgroup analysis for each endpoints. all cohorts, randomized and nonrandomized clinical trials plus case - control studies that compared vgc with gcv in prevention (prophylaxis and preemptive) and treatment of cmv infection among sorts were included. the outcomes of interests were : cmv infection, cmv disease, gcv resistance and overall mortality rates. the following studies were excluded : studies on efficacy of vgc without control group, use of vgc and gcv with two different strategies in one study, evaluation of long - term outcome of gcv resistance and late onset cmv disease without pure results of any drug, compare different length of prophylaxis or treatment, compare the combination regimens of gcv and vgc without result of one drug, results of studies with > 1 publication was considered once. all cohorts, randomized and nonrandomized clinical trials plus case - control studies that compared vgc with gcv in prevention (prophylaxis and preemptive) and treatment of cmv infection among sorts were included. the outcomes of interests were : cmv infection, cmv disease, gcv resistance and overall mortality rates. the following studies were excluded : studies on efficacy of vgc without control group, use of vgc and gcv with two different strategies in one study, evaluation of long - term outcome of gcv resistance and late onset cmv disease without pure results of any drug, compare different length of prophylaxis or treatment, compare the combination regimens of gcv and vgc without result of one drug, results of studies with > 1 publication was considered once. two separate groups of authors extracted data by using information sheets that included : type of study and authors, prophylactic regimen, number and cmv serology of patients, duration of regimens, method of diagnosis and monitoring, duration of posttransplant follow - up, rate of cmv disease, viremia or infection eradication, gcv resistance and overall mortality. for the purpose of this study cmv infection defined as presence of the virus that can be detected by growing it in vitro, pcr or antigenemia assays. cmv disease defined as presence of infection along with symptoms attributable to cmv syndrome or tissue invasive disease. in addition, gcv resistance was regarded as occurrence of known ul97 or ul54 mutations that are usually followed by resistance to gcv and clinical failure of response to anti cmv drugs and finally all - cause mortality as well as death associated with cmv in posttransplant period after receiving therapeutic or preventive regimens were regarded as mortality. in order to produce summary estimate we used inverse variance as the weight for each study. fix effect was used when there was no heterogeneity among the result of studies. in order to check the heterogeneity, we used chi - square test. in addition we assessed heterogeneity by checking t as well as i. we pooled the results of prophylaxis, preemptive and treatment studies separately and where there were available data we run subgroup analysis for each endpoints. our sensitive search resulted in capturing 1335 title (including 11 from search in references list) and during the process of study selection 19 articles were included. from total 13 articles compared vgc and gcv in prophylaxis, three during preemptive and three in treatment period. of 13 studies (2368 patients), all except two, used oral gcv 1 g. tid and vgc 900 or 450 mg / day. study population in 7 articles was all patients unrelated to donor / recipient cmv serology and in 6 articles was only d+/r high risk group. in 4 studies patient population were only ltr [table 1 ]. characteristic of prophylaxis studies comparing vgc and gcv after prophylaxis, cmv disease was reported in 11 articles (study by boivin., 2004 was excluded as they used patients participated in pv16000) and using a random model it was 16% more in vgc group compared to gcv (relative risk [rr ] = 1.16, 95% confidence interval [ci ] : 0.91 - 1.49) [figure 2 ]. in d+/r high risk studies the corresponding value was 1.23 (95% ci : 0.70 - 2.13) [figure 3 ]. the subgroup analysis for those using low dose vgc the rr was 1.20 (95% ci : 0.88 - 1.63). when we limited the analysis to the studies of liver transplant the rr was 1.53 (95% ci : 0.86 - 2.70) showing that in vgc group rate of cmv disease was greater compare to gcv group albeit, nonstatisticaly significant. meta - analysis of 12 prophylaxis studies comparing cytomegalovirus disease in valganciclovir and ganciclovir meta - analysis of high risk group prophylaxis studies comparing cytomegalovirus disease in valganciclovir and ganciclovir of four article that reported the viremia eradication, the overall result showed that 5% more in vgc group, with no statistical significance, (1.05, 95% ci. two studies reported that there was an absence of gcv resistance 6 months posttransplant and a pooled analysis showed a 12% more in vgc group with no statistical significance (1.12, 95% ci : 0.89 - 1.35). overall mortality was reported only in study by paya. ; 2% and 1.6% in vgc and gcv. for the purpose of this part from these three, two studies reported that no case of cmv disease was seen in follow - up period. regarding to viremia eradication, while study by singh. reported 94% and 76% in vgc and gcv, two other studies reported mean reduction of viral load that was similar for vgc and gcv in both studies [table 2 ]. efficacy of treatment was evaluated with two different endpoints of viremia eradication at day 21 and treatment success. definition of treatment success in all studies was improvement of cmv disease associated symptoms plus eradication of viremia at day 21 [table 3 ]. meta - analysis of results of two studies reported viremia eradication showed no statistical differences between two treatments (rr of vgc compared to gcv = 0.95, 95% ci : 0.77 - 1.16). in addition, after meta - analysis of three studies, there was no clinically and statistically differences between two groups in terms of treatment success (rr = 0.98, 95% ci : 0.91 - 1.06). of 13 studies (2368 patients), all except two, used oral gcv 1 g. tid and vgc 900 or 450 mg / day. study population in 7 articles was all patients unrelated to donor / recipient cmv serology and in 6 articles was only d+/r high risk group. in 4 studies patient population were only ltr [table 1 ]. characteristic of prophylaxis studies comparing vgc and gcv after prophylaxis, cmv disease was reported in 11 articles (study by boivin., 2004 was excluded as they used patients participated in pv16000) and using a random model it was 16% more in vgc group compared to gcv (relative risk [rr ] = 1.16, 95% confidence interval [ci ] : 0.91 - 1.49) [figure 2 ]. in d+/r high risk studies the corresponding value was 1.23 (95% ci : 0.70 - 2.13) [figure 3 ]. the subgroup analysis for those using low dose vgc the rr was 1.20 (95% ci : 0.88 - 1.63). when we limited the analysis to the studies of liver transplant the rr was 1.53 (95% ci : 0.86 - 2.70) showing that in vgc group rate of cmv disease was greater compare to gcv group albeit, nonstatisticaly significant. meta - analysis of 12 prophylaxis studies comparing cytomegalovirus disease in valganciclovir and ganciclovir meta - analysis of high risk group prophylaxis studies comparing cytomegalovirus disease in valganciclovir and ganciclovir of four article that reported the viremia eradication, the overall result showed that 5% more in vgc group, with no statistical significance, (1.05, 95% ci. two studies reported that there was an absence of gcv resistance 6 months posttransplant and a pooled analysis showed a 12% more in vgc group with no statistical significance (1.12, 95% ci : 0.89 - 1.35). overall mortality was reported only in study by paya. ; 2% and 1.6% in vgc and gcv. for the purpose of this part three studies were included [table 2 ]. from these three, two studies reported that no case of cmv disease was seen in follow - up period. regarding to viremia eradication, while study by singh. reported 94% and 76% in vgc and gcv, two other studies reported mean reduction of viral load that was similar for vgc and gcv in both studies [table 2 ]. efficacy of treatment was evaluated with two different endpoints of viremia eradication at day 21 and treatment success. definition of treatment success in all studies was improvement of cmv disease associated symptoms plus eradication of viremia at day 21 [table 3 ]. meta - analysis of results of two studies reported viremia eradication showed no statistical differences between two treatments (rr of vgc compared to gcv = 0.95, 95% ci : 0.77 - 1.16). in addition, after meta - analysis of three studies, there was no clinically and statistically differences between two groups in terms of treatment success (rr = 0.98, 95% ci : 0.91 - 1.06) in all studies of prophylaxis regardless of type of transplanted organ, d / r serology of cmv and dose of vgc and also in high risk d+/r group studies, we found that vgc has no statistical difference with gcv in regard to cmv disease existence, eradication of infection and gcv resistance. however in only liver transplant studies rate of cmv disease was higher after vgc prophylaxis compare to gcv. therefore with due attention to higher bioavailability of vgc compare to oral gcv, so higher systemic exposure to gcv following vgc administration and delay in viremia occurrence after discontinuation of prophylaxis, we can use oral vgc with ease of administration and more patient acceptance as an alternative of gcv with similar efficacy in all sotr except ltr. in comparison to meta - analysis of 9 studies in 2009 by kalil., we could take the pooled risk of gcv resistance in prophylaxis studies that had no statistical difference between vgc and gcv. for vgc to gcv was 0.98 with 95% ci : 0.67 - 1.43 which was similar to our results in terms of no statistically significance differences between two treatment. however, they found significant neutropenia in vgc compare to gcv and therefore they did not recommended substitution of gcv by vgc in prophylaxis of cmv disease in sotr. in a systematic review of 10 studies in 2008 by sun. prevention and decreasing cmv disease by prophylactic and preemptive oral vgc was successfully performed. in meta - analysis by hodson., neutrophill counts below 1_109/l occurred in 13% of patients received vgc compared with 8% of those received gcv, but the difference was not significant and also vgc and intravenous gcv were as effective as oral gcv. in the present study, we compared vgc and gcv in the treatment of cmv disease in sotr and we did not find significant differences in treatment success and viremia eradication between two drugs the efficacy and clinical complication of vgc and gcv was similar in treatment of cmv disease in sotr., in spite of similar efficacy of vgc and gcv in treatment, they recommended that patients with signs of malabsorption and life - threatening cmv disease should be candidate for iv gcv. although for preemptive studies analysis was not possible, all of them proclaimed that vgc and gcv are similar in decreasing cmv disease and infection, other opportunistic infection and treatment outcome. one of the limitations of our study is that we could not compare the mortality of recipients, because most original studies did not report such outcomes. in order to include higher number of studies, we also included retrospective case - control studies as well as randomized clinical trials. because our primary objective was to compare these two drugs efficacy, so we did not focus on complications such as cytopenia. consider to similar efficacy of vgc and gcv in decreasing cmv infection and disease, we can use vgc as an alternative to gcv in prophylaxis and treatment of cmv disease in sotr except ltr, with ease of administration and less complication. further studies need to be done with more focus on safety profile of two drugs. sv : contributed in the conception of the work, conducting the study, revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work. zp : contributed in the conception of the work, did the data collection, contribution in doing analysis, preparing the first draft, approval of the final version of the manuscript, and agreed for all aspects of the work. bs : contributed in the conception of the work, contribution in data collection, contribution in revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work. fm : contributed in the conception of the work, contribution in data collection, revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work. aj : contributed in the conception of the work, revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work. ma : contributed in the conception of the work, revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work. fn : contributed in the design of the work, doing the analysis, revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work. | background : cytomegalovirus (cmv), a problematic virus in solid organ transplant recipients (sotr) such as liver, can worsen overall mortality and transplant outcome, so its prevention and treatment is a key of success in such patients. this study is aimed to compare the efficacy of ganciclovir (gcv) and valganciclovir (vgc) for prevention and treatment of infection with cmv.materials and methods : after sensitive and systematic search in pubmed, embase, cochrane and other available databases, both prospective and retrospective studies on effect of vgc and gcv in prevention and treatment of cmv disease among sotr, which had our study criteria, were included. the pooled risk estimates were calculated using random - effects models.results:among 1324 title, 19 studies were included. in 11 prophylactic studies (2368 patients), the pooled risk of cmv disease (vgc relative to gcv) was 1.16, 95% confidence interval (ci) : 0.91 - 1.49 and in studies of liver transplant recipients, 1.53, 95% ci : 0.86 - 2.70. rate of viremia eradication in vgc to gcv was 1.05, 95% ci : 0.97 - 1.13. in 3 treatment studies (422 patients), rate of successful treatment in vgc to gcv was 0.98, 95% ci : 0.91 - 1.06 and viremia eradication 0.95, ci 95% 0.77 - 1.16. all these values did not show statistically significantly differences between gcv and vgc.conclusion:it can be concluded that vgc as an alternative to gcv can be used with equal efficacy in prevention and treatment of cmv disease in sotr. |
the presence of pancreatic tissue outside its normal localization and without anatomic and vascular continuity with the normal pancreas is termed heterotopic pancreas (hp) ; pancreatic rests, ectopic, aberrant, or accessory pancreas are the other terms to describe the entity. hp may occur throughout the gastrointestinal tract, but has a propensity to affect the stomach, duodenum, jejunum, meckel 's diverticulum, and ileum. less frequently, it is observed in the liver, gallbladder, bile duct system, and papilla of vater. hp is known to be associated with various associated anomalies like malrotation, small intestinal atresias, biliary atresias, congenital diaphragmatic hernias, meckel 's diverticuli, annular pancreas and esophageal atresias. there have been isolated case reports of the presence of hp within the choledochal cyst (cc). a 9-year - old boy presented with features of gastric outlet obstruction for 1 month. he was operated for cc type 1 at the age of 4 months at the same center ; complete excision of cyst with roux - en - y hepaticojejunostomy was done. magnetic resonance cholangio - pancreaticography (mrcp) done prior to first surgery had shown pancreaticobiliary malunion (pbmu), cc and dilated pancreatic duct, suggestive of chronic pancreatitis [figure 1 ]. no annular pancreas or obvious pancreatic rests were noted at the mrcp or subsequent surgery. upper gastrointestinal (gi) contrast study revealed partial obstruction of the first part of duodenum [figure 2 ]. upper gi endoscopy revealed the lumen of first part of the duodenum completely obliterated by a large polypoidal mass ; the endoscope could not be negotiated beyond the first part of duodenum. magnetic resonance cholangio - pancreaticography showing pancreaticobiliary malunion, type i cc and dilated pancreatic duct upper gastrointestinal contrast study showing near - total obstruction of first part of duodenum on exploration, the first part of duodenum was found to be severely inflamed and thickened with near complete obliteration of its lumen. the roux - en - y loop of the previous hepaticojejunostomy was 5 cm away from the duodenal lesion. excision of 2.5 cm of distal stomach, pylorus and first part of duodenum with gastroduodenostomy akin to billroth i procedure was done. histopathologic examination of the entire excised specimen revealed transmural acute on chronic inflammation and diffuse fibrosis. there were submucosal heterotopic pancreatic rests in the excised duodenum, though there were no abnormal cells in the excised pylorus and the stomach [figure 3 ]. heterotopic pancreatic rests in the submucosa of the duodenal partition (h and e, 40) the proposed theory is that during rotation of foregut in a fetus and fusion of dorsal and ventral parts of pancreas, small islands of pancreatic rests are carried away and continue to develop at this aberrant location. hp is seen in 12% of patients as autopsy findings and 1 in 500 of upper abdominal surgeries. our case was considered to be a type 2 ectopic pancreas, based on heinrich classification. however, they may present with obstruction, lump, gi bleeding, etc., depending on the size and location of hp. correct preoperative diagnosis is usually not possible and the eventual diagnosis is made on surgical exploration and pathological examination. clinically significant lesions are greater than 1.5 cm in maximum diameter and are adjacent to or directly involve the mucosa. but most of the cases of hp causing gastric outlet syndrome have been described in adults. such an occurrence has been occasionally reported in children and rarely reported in infants and neonates too. radiological investigations like computed tomogram (ct) scans, endoscopic ultrasonograms and nuclear scan studies assist in preoperative diagnosis, but with difficulty. upper gi endoscopy, though helpful in certain patients presenting with submucosal nodules, was not helpful in the preoperative diagnosis in our case. therefore, surgery is frequently needed to make a definitive diagnosis and plan further management and also because differential diagnosis includes leiomyomas, lymphomas, carcinoid tumors, gastrointestinal stromal tumors (gist) and other malignancies. on review of available literature on hp, we found that all the pathologies known to affect the pancreas can also be seen in hp. hence, we feel that whenever hp is encountered incidentally or because of complication, it warrants excision. keeping this in mind, we performed the excision of the lesion rather than a simple bypass such as posterior gastrojejunostomy. | a 9-year - old boy presented with duodenal pancreatic rest causing obstruction and required surgical intervention. he had been treated at the age of 4 months for a choledochal cyst. both choledochal cyst and heterotopic pancreas are entities that are commonly encountered in children, but the incidental presence of both the entities in the same child, albeit presenting metachronously, is extremely rare. |
. the prediction of domains from sequence information can improve tertiary structure prediction (1), enhance protein function annotation (2), aid structure determination (3) and guide protein engineering (4) and mutagenesis (5). a number of different methods have been developed to identify domains starting from primary sequences. these methods can be roughly classified into four categories : template - based methods (610), ab initio (template - free) methods (1122), the hybrid approach combining template - based and ab initio methods (23), and meta - domain prediction methods (24). here we describe an accurate, hybrid domain prediction server (domac) that integrates homology modeling, domain parsing and ab initio methods together. the preliminary implementation of the server [under the name : foldpro (25) ] participated in the domain evaluation in the seventh edition of critical assessment of techniques for protein structure prediction (casp7) (26,27). our hybrid approach uses the template - based method to predict domains for proteins having homologous template structures in protein data bank (pdb) (28), and the ab initio method based on neural networks (29) to predict domains for de novo proteins. first, it uses the psi - blast (30) to search the target sequence against ncbi non - redundant sequence database to construct a profile. the profile is used to search a template structure library built from the proteins in pdb to identify templates, similarly as pdb - blast approach (31). second, if some significant templates are identified (e - value 0.001), it generates a structure model for the target using modeller (32) based on the template structures. then it uses an accurate domain parsing tool pdp (33) to parse the model into domains. if the parsed domains do not cover the whole target sequence, domac will assign uncovered regions to adjacent domains. if no significant homologous template is found, domac will invoke the ab initio domain predictor dompro (29) to predict domains. dompro uses neural networks in conjunction with sequence profile, predicted secondary structure, and relative solvent accessibility to predict domain boundary. the secondary structure and relative solvent accessibility are predicted by sspro (34) and accpro (35) in the scratch suite (36). dompro tries to identify domain boundary positions based on the composition bias of sequence and structural features in domain linker regions. the preliminary implementation of domac participated in casp7 and was ranked first among 13 domain prediction servers. since then, we have significantly speeded up the template identification process without sacrificing accuracy and added a module to update the template library weekly to incorporate the newly released proteins in pdb. here we firstly describe the performance of the preliminary implementation of domac in casp7 (under server name : foldpro). we compare it with 12 other server predictors in casp7 using two evaluation metrics : casp evaluation metric (37) and domain number accuracy. casp metric (ndo : normalized domain overlap score) is to compute the overlapping score of domains without explicitly checking domain number and domain boundary (37). it computes the numbers of correctly and wrongly overlapped residues between true domains and predicted domains, respectively. it summarizes the numbers of the overlapping residues into a single score to evaluate domain prediction. the best score for a target is 1 and the worst score is 0. the domain number accuracy is defined as the percentage of targets with correct domain number predictions. the domain number accuracy is computed by comparing the domain number predictions with the official domain definitions released by casp7. in terms of the two evaluation metrics, (%) casp7 scorefoldpro (domac)9593.70.963baker - rosettadom (23)9486.20.940ma - opus - dom9487.20.933robetta - ginzu (23)9484.00.932domssea (7)9478.70.910hhpred3 (38)9575.80.910meta - dp (24)9574.70.907hhpred1 (38)9375.30.902domfold9575.80.898dps(13)9375.30.889chop (22)8356.60.827distill (39)9570.50.819nn_put - lab9258.70.795the second column (target num) lists the number of targets for which a predictor made predictions. the performance of 13 domain prediction servers in casp7 the second column (target num) lists the number of targets for which a predictor made predictions. we also evaluate domac on the three categories of casp7 targets : highly homologous, homologous and analogous / ab initio. the domain number prediction accuracy of domac is 96%, 94% and 88% in the three categories, respectively. however, because the majority (68 out of 95) of casp7 targets is single - domain proteins, the domain prediction accuracy is very likely over - estimated. thus, we evaluate domac on a larger, balanced, high - quality dataset manually curated by holland. the publicly released version of the holland 's benchmark2 dataset has 156 proteins consisting of 54 single - domain proteins, 69 two - domain proteins, 25 three - domain proteins, 4 four - domain proteins, 3 five - domain proteins and 1 six - domain protein. we evaluate both template - based and ab initio methods on the whole dataset, respectively. table 2 reports the specificity and sensitivity of each method in each category in terms of domain numbers. the overall domain number prediction accuracy of the template - based and ab initio methods is 75% and 46%, respectively. table 2.the specificity and sensitivity of domain number prediction on the holland 's dataset using the template - based and ab initio methodsmethodacc. (%) 1-dom2-dom3-dom4-dom5-dom6-domtemplatesens.96.166.756.075.066.7spec.74.288.070.042.933.3ab initiosens.88.531.312.0spec.46.548.830.0 the specificity and sensitivity of domain number prediction on the holland 's dataset using the template - based and ab initio methods moreover, we assess the accuracy of the domain boundary prediction, which is important for generating hypotheses for crystallizing individual protein domains. following the same convention (7,22), a predicted boundary within 20 residues away from a true domain boundary is considered correct. the domain boundary specificity and sensitivity is 50% and 76.5% for the template - based method, and 27% and 14% for the ab initio method. thus, the accuracy are sufficient for guiding the crystallization experiment, whereas the ab initio method is not always reliable enough for the general, practical use. since the reliability assessment of domain predictions is still an open issue, the user is advised to use the accuracy on the holland 's dataset to decide how to use these predictions. the input form requires only three inputs : email address, target name, and protein sequence. domac usually can make predictions within 15 min and send the results back to users through email. domain prediction results include the user - defined target name, the protein sequence, the predicted domain number, the start and end positions of each domain and the method (template - based or ab initio). for template - based prediction, it also reports the pdb codes of the templates. domain 1 has two non - continuous segments, spanning from residues 1 to 16 and residues 82 to 208, respectively. the templates used to make the domain prediction are identified by pdb code + chain i d. domain 1 has two non - continuous segments, spanning from residues 1 to 16 and residues 82 to 208, respectively. the templates used to make the domain prediction are identified by pdb code + chain i d. we have developed a hybrid domain prediction web service integrating template - based and ab initio methods. the template - based method is accurate enough for guiding protein structure prediction, structure determination, function annotation, mutagenesis analysis and protein engineering. however, the ab initio method still needs to be improved for practical use. since protein domain architecture is largely shaped by gene recombination events, such as gene fusion, fission, domain swapping and exon exchange, leveraging the evolutionary gene recombination signals embedded in the multiple sequence alignment of a protein family and exon boundaries (or splicing sites) in its gene structure, may help improve ab initio domain prediction significantly. | protein domain prediction is important for protein structure prediction, structure determination, function annotation, mutagenesis analysis and protein engineering. here we describe an accurate protein domain prediction server (domac) combining both template - based and ab initio methods. the preliminary version of the server was ranked among the top domain prediction servers in the seventh edition of critical assessment of techniques for protein structure prediction (casp7), 2006. domac server and datasets are available at : http://www.bioinfotool.org/domac.html |
strauss syndrome, is a non - inheritable and nontransmissible disease affecting medium and small vessels. it is an autoimmune vasculitis leading to tissue necrosis with eosinophilia and eosinophil tissue infiltration. egpa is accompanied by asthma and involves mainly the blood vessels of the lungs, gastrointestinal system, and peripheral nerves ; however, other organs such as skin, kidneys, and most notably the heart may also be affected [2, 3 ]. over the years, the prognosis for egpa patients has improved tremendously. after the introduction of corticosteroids into therapy, 5-year mortality rates have decreased to 13.9 % from previously reported 3-month rates of approximately 50 % [4, 5 ]. it can be safely said that, over the last decade, egpa has been reduced to a chronic relapsing disease usually requiring indefinite medication and periodic follow - up. the question thus arises whether this improvement has had a proportionally positive impact on the quality of life in these patients. additionally, the understanding of the term health has also changed dramatically during this time and unsurprisingly patients expectations have evolved correspondingly. in fact, many of them expect not only to be physically and emotionally healthy but to also enjoy a quality of life similar to that of people unaffected by disease. quality of life is defined as an individual s perception of their position in life in the context of the culture and value systems in which they live and in relation to their goals, expectations, standards, and concerns. standardized methods such as the health - related quality of life (hrqol) short form 36 (sf-36) have become a useful tool in measuring the quality of life of distinct patient populations and comparing it to healthy populations at one moment in time. it is also used to monitor the impact of novel treatments methods on the quality of life over a prolonged period of time. the additional advantage of using such tools is that they provide a uniform platform which facilitates the comparison of quality of life measurements across similar types of diseases. although sf-36 has been used in patients with many auto - immune diseases such as granulomatosis with polyangitiis disease (gpa, wegener s granulomatosis), systemic lupus erythematosus, newly diagnosed antineutrophil cytoplasmic antibody (anca)-associated vasculitis, there has been no study using this method that focuses solely on patients with eosinophilic granulomatosis with polyangiitis. egpa patients suffer from a unique set of symptoms that affect their daily lives in ways different from other vasculitic diseases. this is partially due to the considerable burden that asthma places on patient s daily living activities, especially before a diagnosis is made. another question that has not been addressed is how patients feel about their perceived future health outlook, an important yet rarely considered outcome measure, and what factors influence this perception. these reasons prompted the investigation of whether current quality of life in egpa patients exerts any influence on their future health outlook. several other significant factors such as gender, employment, and duration of disease were also screened for correlation with future health outlook. medical records from the outpatient allergy and immunology clinic of the jagiellonian university hospital in cracow, poland were searched to identify patients with egpa. as no diagnostic criteria are available for egpa, the american college of rheumatology (acr) classification criteria were used. they distinguish six key features of the disease, among them : asthma, peripheral blood eosinophilia of > 10 %, mono- or polyneuropathy, paranasal sinus abnormality, eosinophilic accumulation in tissues confirmed by a biopsy, and migratory infiltrates in lungs. at least four of the criteria listed above had to be confirmed in order to validate the diagnosis. a custom questionnaire regarding current symptoms, current medication regimen, and employment history, short form 36 health survey (qualitymetrics v. 2) as well as future health outlook were included in the survey package. the short form 36 health survey, a standardized questionnaire, is used to compile two key parameters : a mental component score (mcs) and a physical component score (pcs). an absolute score (0100) was obtained for each parameter. using the rand method, a total of eight hrqol dimensions were measured : general health (gh), physical functioning (pf), emotional role limitations (re), physical role limitations (rp), social functioning (sf), mental health (mh), bodily pain (bp), and vitality (vt). a score of 50 was judged to be equivalent to the general population while scores above or below this threshold indicated that a corresponding difference from the normal population was present. using norm - based scores, we compared the hrqol of patients with a sample from a general population. patients were also asked to assess how they currently perceive their personal future health outlook as one of three options : positive, negative, or unchanged. the available medical documentation and survey data were used to analyze the disease course and evaluate its activity by the birmingham vasculitis activity score (bvas) score (bvas v.3 ; range, 056 patients. patients with bvas 50 years) had positive outlook compared to 47 % of younger patients (50 years (n = 11)4 (36 %) 3 (27 %) 4 (36 %) duration of disease 66 months (n = 10)4 (40 %) 3 (30 %) 3 (30 %) employment employed (n = 13)2 (15 %) 5 (38 %) 6 (46 %) unemployed (n = 13)4 (31 %) 4 (31 %) 5 (38 %) results presented as absolute number of patients and percentage of each category n (%) characteristics of patient subgroups categorized according to differences in perception of future health outlook results presented as absolute number of patients and percentage of each category n (%) the aim of this study was to evaluate the current quality of life in egpa patients and how this factor impacts their future health outlook. the patients overall quality of life was lower than the normal population across all dimensions of the sf-36 survey. this is the first study to directly investigate hrqol in eosinophilic granulomatosis with polyangiitis patients via a standardized method (sf-36) that yields results which allow for direct comparison with other related diseases. although egpa patients have been included as part of larger studies, they made up an insignificant proportion of total study subjects and results may not accurately reflect the quality of life of these patients. when compared to other vasculitic diseases, these results show similar patterns to previously reported studies of diseases such as gpa which revealed a similarly decreased level quality of life, most noticeably in patients who were unemployed [15, 16 ]. a large study of anca - associated vasculitides found significantly decreased hrqol at diagnosis most notably linked with neurologic involvement. finally, a japanese study confirmed that even though quality of life improved over the 18 months the patients were included in a clinical trial, the sf-36 results were still below the population norm. taken together, the level of hrqol decrease across the various vasculitic diseases, including the results of the present study, is similar in nature and in magnitude. a major complaint among egpa patients are symptoms of dyspnea and cough which are typically asthma related. in comparison, a large (n = 586) and very recent analysis of the epidemiological study on the genetics and environment of asthma cohort via sf-36 analysis revealed that hrqol in well - controlled asthma patients remains relatively unaffected by their condition, where patients with uncontrolled asthma are the only ones who have a significant difference in hrqol at time of study when compared to patients with well - controlled asthma. these results are similar to those obtained in this study which shows that asthma symptoms do not significantly influence the hrqol. in fact, we performed a multivariable analysis which revealed that the only significant determinant of hrqol is peripheral nervous system involvement, confirming previous results described by walsh.. other affected organs systems like the cardiovascular system, respiratory system, sinuses, kidneys, as well as long - term immunosuppression did not impact the hrqol at time of study. although asthma and its symptoms were not associated with a significant influence on the hrqol at time of study in our analysis, these symptoms were mentioned as the most bothersome throughout the entire course of the disease (table 3). previous work by our group describing the course of asthma in patients with egpa revealed an atypical course of this disease. this study found that although egpa patients suffer from severe asthma at the moment of diagnosis ; these symptoms gradually subside over time and remain well controlled. also, employment status has been confirmed as an important determinant of hrqol in past studies. interestingly, in our study, employment did not influence either the current hrqol or the future health outlook in a statistically significant manner. other findings include a large proportion of the study population (7/26) requiring to apply for a pension. notably, a novel contribution of this study is the examination of patients perceived future health outlook as an independent factor resulting from current hrqol. the results obtained in this study suggest that the mcs is the most reliable predictor in reference to patients perception of their own health. patients with higher mcs scores felt more optimistic about the future while patients with low pcs were likely not to be more pessimistic about their future health. thus, it seems fair to conclude that mcs carries substantially more weight in shaping patients perceived future health outlook. in other words, patients who feel most positively about their future health outlook, currently exhibit the highest quality of life from a psychological point of view. this result is surprising and should serve to alert physicians that, paradoxically, patients with a positive frame of mind may actually be in a worse physical health state than their counterparts who seem more pessimistic about their future health. the finding that patients with the lowest pcs scores remained positive about their future outlook may be explained by the fact that, at diagnosis, the disease manifested itself in its most severe form. hence, these patients have witnessed a significant improvement over the years and remain hopeful of further improvements to come. in contrast, patients who may have had lighter forms of the disease and whose quality of life remained initially unaffected could account for the fact that these patients have a bleak outlook going forward. arguably, these conclusions could only be considered accurate once a statistically significant correlation is achieved by working with a larger sample group. limitations of this analysis are mainly due to the small number of patients included in this study (n = 26) as egpa is a very rare disease. additionally, a baseline sf-36 result obtained at the time of diagnosis could have been useful to identify expectation bias. establishing this baseline may distinguish if patients who currently suffer from the lowest physical well - being yet perceive their future health positively do so because they are the ones which have improved the most over the years. their improvements could skew their future outlook as they may be looking forward to similar improvements in the future. in the same vein, a follow - up questionnaire at 1 year would likely confirm certain trends and extract new trends which have gone unnoticed within the limited amount of data gathered. finally, an obvious amelioration of the validity of these results would be an expansion of the sample size to include more patients and gain increased statistical power. patients with higher mcs felt more positive about their future health, while patients with low pcs were likely not to feel negatively about their future health. despite being in disease remission, patients with egpa had decreased quality of life, which in turn influenced their perception of their future health outlook. a larger study population with would be required to confirm these findings in a statistically significant manner. | eosinophilic granulomatosis with polyangiitis (egpa) is a rare, autoimmune small and medium vessel vasculitis. egpa is accompanied by asthma and involves mainly the blood vessels of the lungs, gastrointestinal system, and peripheral nerves ; however, the skin, kidneys, and heart may be also affected. to investigate if patients with egpa experience reduced health - related quality of life (hrqol), and the effect of this parameter on their own perception of future health outlook. twenty - six egpa patients are in disease remission and completed a custom - designed questionnaire and the medical outcomes study short form 36 (sf-36). using the rand method, eight hrqol dimensions were calculated : general health, physical functioning, emotional role limitations, physical role limitations, social functioning, mental health, bodily pain, and vitality. using norm - based scores, the hrqol of patients was compared with that of the general population. egpa patients had decreased hrqol across all eight dimensions of the sf-36. patients with higher mental component score felt more positive about their future health, while patients with low physical component score were likely not to feel negatively about their future health. also, 36 % of older patients (> 50 years) had a positive outlook compared to 47 % of younger patients (< 50 years) and patients with a longer disease course were much less likely to have a positive outlook (30 % positive) than those with a shorter course (50 % positive). although not statistically significant, these correlations warrant further investigation with a larger patient population. despite being in disease remission, egpa patients had decreased quality of life, which in turn influenced their perception of their future health outlook. |
diaphragmatic rupture is a very rare injury, which occurs in less than 2% of all blunt injuries to the abdominal area. injury to the diaphragm is most commonly caused by a sudden change in intra - abdominal pressure, most commonly by a blunt blow to the abdominal area. another cause of diaphragmatic rupture is sudden decelaration, when abdominal organs continue movement due to inertia, and tear through the diaphragm. diaphragmatic rupture often manifests itself later than other injuries, after an organ progressively herniates into the pleural cavity. we present a patient with a delayed diagnose of right sided diaphragmatic rupture with a complicated post - operation state. a 11-year - old boy, 35 kg, was involved in a car crash, as the nearside passanger. he was admitted to the intensive care unit, where he was intubated and ventilated. computed tompgraphy (ct) of the chest and abdomen showed a subcapsular liver hematom, right lung contusion and a minor hemothorax. the patient also had a right femur diaphysis fracture, which was resolved by external fixation, and a right acetabulum fracture without dislocation. on the second post - traumatic day, 1 hour after transfering to spontaneous ventilation, the patient underwent a breathing distress. a x - ray and ct of the chest was carried out (figure 1), with the find of thoracicaly herniated liver. a right sided, subcostal laparotomy was carried out, where the liver was found to be completely herniated intrathoracicaly. the liver was herniated into the chest through a 15 cm diaphragm rupture, like a button through a buttonhole (figure 2). a suture of the defect was carried out by seperate matress sutures (30 ethibond). due to dyspnoea, and a fluidothorax in the right pleuric cavity, the patient was tubed again, a pleuric drain was also applied. at the 7 post - traumatic day, the drain was removed. 9 post - traumatic day, a ct was carried out and a thoracoscopic surgery, with the goal of aspirating the fluidothorax and placement of a right side thoracic drain, indicated. after this, the ventilation improved and the patient was extubated on the 14 post - traumatic day. figure 1liver herniation intrathoracicaly (contrast enhanced computed tomography, coronal multi - planar reformatting). (contrast enhanced computed tomography, coronal multi - planar reformatting). figure 2defect in the diaphragma and herniated liver into the thoracic cavity. the edges of the muscle are fuller than the middle area, which is made up from a thin aponeurosis called centrum tendineum. left - sided ruptures of the diaphragm are described in up to 70% of all cases. left - sided ruptures can result in a herniated stomach, small intestine, colon, spleen and omentum. right - sided diaphragm ruptures, occuring in 30% of all cases, result in the herniation of the liver. the reason for this in - equality is that the right side of the diaphragm is, in a way, protected by the liver. however, if a rupture to the right side does occur, it often results in serious or even fatal injury. a right sided diaphragm rupture is often complicated by damage to blood vessels, most commonly vena cava inferion, the hepatic veins can also be damaged. both - sided injury to diaphragm occurs in only 2% of all diaphragm injuries. diaphragm injuries are most commonly accompanied by fractures of the pelvis, damage to the spleen, rib fracture, damage of the liver, contusion or rippage of a lung. our patient, in adition to a ruptured diaphragm, had a brain comotion, right lung contusion, subcapsular liver hematom, dislocated right femur fracture and a right acetabulum fracture, without dislocation. with comparison to adult patients, we find a larger number of isolated diaphragm ruptures amongst children. in larger scales of patients, isolated injury occurs in roughly 50% of all cases of injured children, and in 20% off all cases of injured adults. the injury is diagnosed more in boys than girls, largely due to the fact, that boys have a higher incident rate than girls. most common cause of diaphragm injury is a blunt injury in the abdominal area, often caused by traffic accidents, or falls from heights. in our country, we do not encounter penetrating wounds to the abdomen or chest in children. in north america, the number of stab and shot wounds is larger. at the johns hopkins hospital in baltimore, the number of patients with diaphragm injury was 14 over the span of 15 years, with 11 of these being a penetrating wound. in europe, the rate of diaphragm injury caused by a blunt blow is 80100%. in blunt injuries to the diaphragm, the laceration is of larger scale, in our case, the laceration was 15 cm long. this makes herniation of internal organs easier. in injuries caused by stabbing, the defect in the diaphragm ranges up to 2 cm, in this case, the most common herniation is that of the omentum, not of an internal organ. the danger of herniation into smaller defects in the diaphragm is that of strangulation followed by the perforation of an organ. this danger, which occurs during herniation through smaller defects, is caused by pressure differences between thoracic and abdominal cavities, which is normally 210 mm hg and during the valsalvov manouver increases up to 100 mm hg. a diaphragmatic rupture can present itself immediately after injury, but more commonly, complications occur proggressively. when the patient is tubed, the ventilation pressure does not allow herniation of an organ, which occurs when the patient is extubated. the rupture of the diaphragma was right sided, and the liver herniation occured after extubation of the patient. symptoms, found in patients with diaphragma injury are pain in the epigastrium, shoulder pain, respiratory problems, intestinal obstructions. during an examination of a patient with a small intestine herniation only a very small number of patients manifest symptoms of a ruptured diaphragm relatively longer after the primary injury. these patients have only minor symptoms, which can, nevertheless, result in a herniation of an organ. in the case of chronic herniation with a late diagnose, diagnostical methods, used to diagnose diaphragm ruptures are x - ray, ultrasound and ct. the basic method is x - ray, which shows elevation or decrease in sharpness of the diapghragm conture, occluded hemithorax caused by abdominal organs in the thoracic cavity, hemopneumothorax. sometimes a x - ray of a stomach or colon herniation can be confused with a pneumothorax. another used examination method is ultrasound, the advantages being non - invasivity and easy accesability. hard to diagnose is a diaphragm rupture, that is not accompanied by herniated organs. in this case, the most common access is through laparotomy (in 74%), thoracotomy (18%) and from thoracoabdominal access (8%). the abdominal access is encouraged, because other organs in the abdominal cavity are often damaged too. in our case, we opted for the abdominal access. the liver was herniated into the thoracical cavity through the diaphragma like a button through a buttonhole. post - operational progress was complicated by atelectasis of the bottom right lobe and a fluidothorax, thoracoscopic revision was needed on the 9 post - operational day. in the university department in mansoura, egypt, where 44 patients with diaphragma rupture are placed, the thoracotomy access is prefered in 84%. thoracotomy acces is also encouraged at most departments in cases of older date, due to the possibility of adhesion in the thorax area. now, laparoscopic or thoracoscopic access is gaining popularity and is being encouraged. in our case, during laparoscopic revision, where the access was wide and the defect in the diaphragma well accessible, the reponation was difficult, because of the large difference between the size of the diaphragmatic defect and herniated liver. in this case, laparoscopic treatment would have been very difficult. other complications that can occur during diaphragmatic injury are pneumonia, empyem, subphrenical or intraabdominal absces, especially if a herniated organ is damaged. after injury to the diaphragm, good drainage of the thoracic and abdominal cavity is recommended. during the injury, branches of the phrenical nerv can be damaged, causing partial den - ervation of the diaphragm, and lung complications. therefore, after diaphragmatic injury, it is recommended that long - term follow up is established. traumatic rupture of the diaphragm is rare and diagnosis can be late in some cases. it is important to remember the possibility of this injury and always check the diaphragm for any signs of damage, when dealing with abdomenal injuries. | right - sided traumatic diaphragmatic rupture in childhood is a very rare injury. diaphragmatic rupture often manifests itself later, after an organ progressively herniates into the pleural cavity. when the patient is tubed, the ventilation pressure does not allow herniation of an organ, which occurs when the patient is ex - tubed. we present a patient with a delayed diagnose of right sided diaphragmatic rupture with a complicated post - operation state. |
irritable bowel syndrome (ibs) is traditionally diagnosed using the rome diagnostic criteria, a symptom - based criteria standard, currently revised as the rome iv criteria.1 the rome iii criteria for ibs had a modest diagnostic ability with a sensitivity of 75% in primary care,2 and a sensitivity of 69% and specificity of 80% in secondary care.3 however, validation of the rome criteria is lacking and most of the validations of these criteria compare the criteria to normal subjects and not organic gastrointestinal (gi) illness. in addition, diagnosis based on the rome criteria starts with excluding other organic gi diseases with inevitably expensive investigations. for example, more than 70% of patients with inflammatory bowel disease (ibd) would meet the rome criteria for ibs.4 the indefinite clinical definition of ibs also makes it difficult to determine healthy controls.5 in clinical practice, as well as in research, it is hard to determine normal subjects relative to patients with ibs since the rome criteria does not provide a strict definition of normal or healthy. a biomarker is defined as a characteristic that is objectively measured and evaluated as an indicator of normal biological processes, pathogenic processes, or pharmacologic responses to a therapeutic intervention.6 up - to - date biomarkers for ibs have been developed with several purposes : (1) to improve the diagnosis,79 (2) to differentiate from other organic diseases,9,10 and (3) to discriminate between ibs subtypes.8 though the markers should be associated with a possible pathophysiologic mechanism of ibs, some biomarkers for other diseases such as ibd are used for differentiating ibs from non - ibs.7,9,10 various materials for developing biomarkers have been introduced, including serologic markers,79 fecal markers,10 cellular / molecular markers, breath tests, scintigraphic markers, and colonic mucosal immune markers. the most significant issues when developing biomarkers for ibs are the small population sample size and limiting comparisons between ibs patients and healthy subjects or subjects with other diseases. in this article, we discuss the biomarkers for ibs, including those for specific ibs subtypes, from various materials. one of the common themes in the development of biomarkers for ibs are panels or components that identify ibs based on finding results consistent with other disorders. this type of diagnostic approach which is being suggested to diagnose ibs as a negative test increases the probability that the patient has ibs only. though ibs has a heterogeneous pathophysiology, most researchers recruit all ibs subjects to be in the study population, resulting in decreased sample sizes for subgroup analyses such as diarrhea - predominant ibs (ibs - d) and constipation - predominant ibs (ibs - c). the first attempt to validate serum biomarkers in diagnosing ibs was the use of a 10-biomarker algorithm.7 healthy controls and patients with various gi conditions (256 ibs subjects, 71 normal subjects, 125 ibd subjects, 47 functional gi disorders, and 17 celiac disease) were tested with a biomarker panel (il-1, growth - related oncogene-, brain - derived neutrophic factor, anti - saccharomyces cerevisiae antibody, anti - cbir1, anti - human tissue translutaminase, tnf - like weak inducer of apoptosis, anti - neutrophil cytoplasmic antibody, tissue inhibitor of metalloproteinase-1, and neutrophil gelatinase - associated lipocalin). the sensitivity was 50% and the specificity was 88% for differentiating ibs subjects from non - ibs subjects, and the overall accuracy was 70%. however, these were primarily ibd markers rather than ibs markers, as this study was not designed to confirm ibs, but rather designed to diagnose other diseases and by doing so, establish not ibs. another study presented the performance of a combination of 34 serologic and gene expression markers and psychological measurements in differentiating 168 ibs subjects (60 ibs - c, 57 ibs - d, and 51 mixed) from 76 healthy volunteers (hv).8 ten serological markers including histamine, tryptase, serotonin, and substance p, and 14 gene expression markers from analysis of differentially expressed genes in ibs and hv including cbfa2t2, ccdc147, and znf326 were added to the original 10 biomarker panel. good discrimination was also obtained between ibs subtypes, with the best discrimination being observed for ibs - c vs ibs - d. however, the definition of hv, which was characterized as adults without any illness, active infection, or significant medical condition was vague and excluded any comment on the functional symptoms. it is difficult to think that a test is needed to discriminate ibs from healthy subjects since they have no symptoms and do not seek care. a recent study with 196 ibs subjects and 160 healthy controls (hc) without gi symptoms demonstrated that a panel of 8 biomarkers had a sensitivity of 88.1% and a specificity of 86.5% in discriminating ibs subjects from hc.9 these populations were extracted from the maastricht ibs cohort. validation of this biomarker panel for the discrimination between organic gi disorders was not performed. fecal markers in general have been developed to reflect inflammation of the intestinal mucosa, which means that their primary purpose is to identify ibd and therefore not ibs. calprotectin is a heterodimer of s100a8 and s100a9 and the overexpression of s100a8/a9 is associated with inflammatory and neoplastic disorders.11 recently, pooled analysis demonstrated that fecal calprotectin had a sensitivity of 93% and a specificity of 94% at a cut - off value of 50 g / g in differentiating ibs from ibd.10 the cut - off level is low and calprotectin is not related to the pathogenesis of ibs but is rather a test for ibd. biomarkers in this category use new techniques that might rule in ibs based on comparison to hc. however, testing is limited to ibs and healthy subjects, but not comparisons to other gi organic disorders. fecal short - chain fatty acids (scfa) and granins are biomarkers for the discrimination of ibs from hc. scfa are derived from non - digestible carbohydrates through gut microbial fermentation.12 scfa include acetic acid, propionic acid, butyric acid, iso - butyric acid, valeric acid, and iso - valeric acid. a study with a small population size (25 ibs subjects and 25 hc) aimed to diagnose ibs by measurement of fecal scfa.13 differences in the levels of propionic and butyric acid had the best diagnostic properties, with a sensitivity of 92% and a specificity of 72% at a cut - off value > 0.015 mmol / l. however, diet was not controlled for, and because of the exploratory design of the study, subjects were not consistent. granins (chromogranins [cg ] and secretogranins [sg ]) are proteins distributed ubiquitously in vesicles of secretory cells of the enteric, endocrine, and immune system, and may serve as markers for activity of the enteric neuroendocrine system.14 a separate analysis of fecal cga, cgb, sgii, sgiii, and calprotectin in 82 ibs subjects and 29 hc demonstrated that sgii, sgiii, and cgb had discriminative validity to identify ibs patients.14 sgii had a sensitivity of 80% and a specificity of 79%. both sgiii and cgb however, calprotectin in this research failed to discriminate ibs subjects from hc. to date, the role of granins in the pathophysiology of ibs is not clear and the reason why levels of granins are different in ibs subjects has not been elucidated. a novel non - invasive metabolomic approach in the diagnosis of ibs is the analysis of the breath. in one study, a set of 16 volatile organic compounds (vocs) from 170 ibs patients and 153 hc were analyzed.15 among hundreds of vocs, n - hexane, 1,4-cyclo - hexadiene, n - hepane, and aziridine were elevated in the ibs group. butane, tetradecanol, 6-methyloctadecane, nonadecatetraene, methylcyclohexane, 2-undecene, benzyloleate, 6,10-emethyl-5,9-un - decadine-2-one, and 1-ethyl-2-methyl - cyclohexane were increased in hc. the random forest classification model based on these vocs had a sensitivity of 89.4% and a specificity of 73.3%. these voc biomarkers should be further investigated, as this study represented an initial step in the development of biomarkers and the metabolism of these compounds in the human body and potential relationship to ibs is poorly understood. although studies have divergent reports of the presence of visceral hypersensitivity in ibs, such as one study that showed that 21% of subjects with ibs had increased rectal pain sensations and 17% had decreased,16 studies assessing visceral hypersensitivity by barostat have been conducted.1719 a study (86 ibs patients, 78 non - ibs patients, and 25 normal controls) suggested that rectal barostat testing to discriminate ibs patients from normal subjects and non - ibs patients had a sensitivity of 95.5% and a specificity of 71.8% at the level of 40 mmhg.17 in other study with a total of 126 ibs patients and 30 hc, optimal discrimination between ibs patients and hc at 26 mmhg with a visual analogue scale cutoff of 20 mm had a sensitivity of 63% and a specificity of 90%.19 however, no consensus has been reached regarding the definition of visceral hypersensitivity. in addition to these biomarkers, another study assessed 3 quantitative traits including colonic transit time by scintigraphy, fecal bile acid (ba), and intestinal permeability which sought to discriminate between 64 ibs - d, 30 ibs - c, and 30 hv.20 total 48-hour fecal ba was significantly increased in ibs - d compared to hv (2495 382 vs 957 185 m/48 hr). colonic transit geometric center at 48 hours was significant in discriminating hv from ibs - c (3.86 0.17 vs 3.22 0.17). the model of fecal ba excretion and colonic transit geometric center at 48 hours had a sensitivity of 60% and a specificity of 75% for discrimination between ibs - d and hv. using the same model, ibs - c could be differentiated from hv with a sensitivity of 60% and a specificity of 80%. alteration of colonic transit was only identified in one - third of ibs patients,16 and about one - fourth of patients with lower functional gi disorders and diarrhea had ba malabsorption.21 finally, there have been studies attempting to find colonic mucosal immune markers, but these are still being debated.22 the predominant symptom of diarrhea in ibs should be distinguished from ibd or celiac diseases. moreover, about 10% of patients who have suffered from acute gastroenteritis subsequently develop post - infectious ibs.23 cytolethal distending toxin b (cdtb) is commonly produced by bacterial pathogens that cause gastroenteritis, including campylobacter jejuni, which causes post - infectious phenotypes in a rat model which are similar to those in human ibs subjects.24 the levels of circulating host antibodies to cdtb correlated with levels of small intestine bacterial overgrowth, and these anti - cdtb antibodies cross - reacted with the enteric neural protein, vinculin, likely through molecular mimicry.24 a recent large scale study including a total of 2681 subjects (2375 ibs - d subjects, 43 healthy subjects, 121 celiac, and 142 ibd subjects) demonstrated that anti - cdtb antibodies had a sensitivity of 43.7% and a specificity 91.6% at a cut - off value of 2.80 to discriminate ibs - d from ibd.25 anti - vinculin antibodies had a sensitivity of 32.6% and a specificity of 83.8% at a cut - off value of 1.68 to distinguish ibs - d from ibd. this important finding acknowledges the possibility of ruling in ibs in contrast with previous serum - based biomarkers,7,8 which is a big leap forward in ascertaining an organic basis approach, rather than a symptom - based criteria approach. this test establishes the possibility that ibs is an organic disease with a significant pathophysiology - based biomarker distinct from ibd. another research study distinguished ibs - d from active ibd using fecal volatile organic metabolites (voms).26 thirty ibs - d, 62 active crohn s disease, 48 active ulcerative colitis, and 109 hc participants were recruited. using the 11 key voms lactulose breath testing (lbt) measures methane and hydrogen in breath samples obtained at baseline and every 15 to 20 minutes after ingestion of 10 g lactulose until 2 hours or even later using gas chromatography.27 the definition for a methane - positive test or a methane producer varies in the literatures (table 2).2838 however, a breath methane level 3 ppm at any point during the test has been recently used to define methane producers.34,36 methane production as a diagnostic test has been shown to be very accurate in predicting ibs - c, with a sensitivity of 91% and a specificity of 81.3%.33 two earlier studies support that methane is associated with the severity of ibs - c,33,39 and although methane does not account for all ibs - c patients, a meta - analysis including a total of 1277 subjects (319 methane producers and 958 methane non - producers) showed that methane is significantly associated with ibs - c.40 another study demonstrated that methane - producing ibs subjects had small bowel movements, straining, lactose intolerance, and weight loss.34 furthermore, objective measures of constipation tracking stool habits showed that the degree of methane production on lbt correlated with the severity of constipation.39 the quantity of methane on lbt was directly proportional to the severity of constipation, and moreover, greater methane production correlated with lower stool frequency and a lower bristol stool score. though lbt did not discriminate patients with ibs from healthy controls, methane - producing patients with ibs were significantly more likely than non - methane - producing patients to report constipation, and significantly less likely to report diarrhea as a major symptom.30 however, other studies argue that methane production is not restricted to constipation - predominant diseases.37,41,42 in a study of 1372 subjects with functional gi disorders, including 212 ibs patients, diarrhea was more common than constipation in patients with high methane levels on lbt / fructose breath tests. furthermore, two - thirds of ibs - c patients did not have elevated methane levels after either lactose or fructose.41 another study demonstrated that the amounts of hydrogen and methane gas produced during lbt were not associated with ibs symptoms, except for a weak correlation between total gas amounts and a few ibs symptoms such as bloating, flatulence, and abdominal pain only in lbt - positive patients with ibs.37 a more recent study revealed that ibs - c, which was associated with prolonged gut transit times, did not show an increase in positive testing for breath methane.42 the authors explained the discrepancy with previous studies by variations in the definition of constipation, type of sugar, or proportion of patients with diarrhea. in contrast, measuring breath methane to determine therapeutic response to non - absorbable antibiotics such as neomycin and rifaximin has been well established. since eradication of small intestine bacterial overgrowth was shown to reduce symptoms of ibs,43 double - blind, randomized, placebo - controlled studies using these antibiotics have been conducted (table 3).28,4446 for more than half of a century, ibs has not been considered an organic disease. the multifactorial pathophysiology of ibs made development of a single biomarker difficult (table 4). to date, biomarkers for ibs were disappointing due to small study populations and the challenges of ruling out other organic diseases with only modest accuracy. to introduce accurate biomarkers, it could be necessary to break down ibs into each subtype and these biomarkers should come from the biological and mechanistic findings. changing the current standard concept of ibs, to studies validating biomarkers that identify ibs as a distinct entity, are linked to the pathophysiology of the disease, determine the organic nature of ibs and are important in predicting the type of ibs (constipation or diarrhea) appear to be emerging. | traditionally, irritable bowel syndrome (ibs) has not been regarded as an organic disease, and the pathophysiology of ibs is heterogeneous. currently, the diagnosis of ibs is based upon the rome diagnostic criteria. the performance of these criteria is only modest in predicting ibs, and moreover their validation is lacking. additionally, as functional symptoms are common in the general population, healthy controls or volunteers are difficult to define and there is currently no definition of normal in the rome criteria. due to the weaknesses of the current diagnostic criteria, patients and doctors expect new gold standard diagnostic tools. various etiologic mechanisms result in potential biomarkers. the focus of this research has been to find non - invasive biomarkers from serum, breath gas, and fecal materials. though biomarkers should be based on biological and pathogenic processes, most biomarkers for ibs have been developed to identify organic diseases and therefore eliminate ibs. to date, these types of biomarkers for ibs have been disappointing. the purposes of developing biomarkers include improvement of diagnosis, differentiation from other organic diseases, and discrimination of ibs subtypes. a true mechanistic biomarker would make it possible to rule in ibs, rather than to rule out other organic diseases. new serologic biomarkers for diarrhea - predominant ibs have been introduced based on the pathophysiologic findings from a rat model and validation in a large - scale clinical trial. further investigations of abnormal organic findings from each subtype of ibs would enable the development of new, simple subtype - specific biomarkers. |
the most dreaded complication of kawasaki disease reported in the literature over the years is coronary artery disease, which is considered as the main cause of acquired heart disease. we present a rare, if not unique, case of kawasaki disease associated with group a streptococcus pleural effusion in the english language literature. a search of the pubmed database was carried out, using a combination of the terms kawasaki disease, pneumonia, and the majority of studies conducted in children with kawasaki disease have concentrated on the coronary artery implications. kawasaki disease is considered a self - limiting illness, but can have detrimental consequences if not diagnosed early. when there is a prolonged inflammatory reaction, with no infectious agent identified or remittent fever unresponsive to antibiotics, kawasaki disease should be taken into consideration. elevated v2 + t cells compared with healthy controls suggest possible involvement of a superantigen in the etiology of kawasaki disease, so it is wise that the health care provider concentrates not only on the cardiac consequences, but also on pulmonary associations. kawasaki disease, also known as mucocutaneous lymph node syndrome, is an acute self - limiting vasculitis of childhood.1 kawasaki disease surpassed rheumatic fever as the most common cause of acquired heart disease. if left untreated, 15%20% of patients may develop coronary artery lesions and coronary artery dilatation.2 the majority of the literature focuses on the cardiac implications of kawasaki disease, but little is known about its pulmonary complications or associations. here we report a rare, if not unique, case of kawasaki disease associated with group a streptococcus (gas) pleural effusion and a review of the english language literature. a 3-year - old female patient presented with a 5-day history of fever, sore throat, and cough, but no rash. her vital signs were : temperature 39.5c ; pulse 130 beats per minute ; blood pressure 100/70 mmhg, respiratory rate 50 per minute ; oxygen saturation 90% on oxygen 2/l per minute via nasal cannula ; weight 13.8 kg (50th percentile) ; and length 94 cm (48th percentile). her skin had normal texture, with no rashes, hypopigmentation, or hyperpigmentation, her capillary refill was around 3 seconds, and the oral mucosa was mildly dry. the patient had decreased air entry and coarse crackles in the right lower and middle zones of the lung. initial laboratory results were : white blood cells 24,000/l (neutrophils 60.2%, lymphocytes 35.4%, monocytes 4.3%, basophils 0.1%), hemoglobin 10.3 g / dl, and platelets 206,000/l. c - reactive protein was 100 mg / l, erythrocyte sedimentation rate was 65 mm / hour, albumin was 18 g / l, creatinine was 66 mol / l, aspartate aminotransferase was 100 u / l, and alanine aminotransferase was 60 serum glucose, blood urea nitrogen, calcium, sodium, chloride, and potassium were normal. venous blood gas was ph 7.2, pco2 44 mmhg, po2 29 mmhg, and hco3 17 meq / l, with a base excess of 11. anteroposterior chest radiographs showed a right middle and lower lobar consolidation with moderate pleural effusion. the patient was started on intravenous normal saline 20 ml / kg due to dehydration. she was then transferred to the pediatric intensive care unit due to increased oxygen requirement. a chest tube was inserted and 200 ml of pus was drained. the pleural fluid culture yielded gas. nasopharyngeal and throat swabs, blood culture, and a mantoux skin test were all negative. on the eighth hospital day, there was no clinical response to antibiotics, and fever persisted, with new onset of abdominal pain, diarrhea, and slight tachycardia at a heart rate of 150 beats per minute. a repeat blood count showed a significant white cell count of 30,000/l, hemoglobin 7.7 g / dl, platelets 600,000/l, aspartate aminotransferase 180 u / l, alanine aminotransferase 120 u / l, and albumin 18 g / l, with a rise in erythrocyte sedimentation rate and c - reactive protein. the differential diagnosis included bacterial resistance to antibiotics, nonbacterial etiologies such as a virus or aspiration of a foreign body, bronchiolitis obliterans, hypersensitivity pneumonitis, atypical kawasaki disease, eosinophilic pneumonia, wegener s granulomatosis, pulmonary sequestration, and cystic adenomatoid malformation. since atypical kawasaki disease was in the differential diagnosis, an echocardiogram was ordered which showed a prominent of left anterior descending artery (0.26 cm, z - score 3.2) and left main coronary artery (0.35 cm, z - score 3.2), with no vegetations or pericardial effusion. our team decided to give one dose of intravenous immunoglobulin 2 g / kg, and high - dose aspirin (80 mg / kg / day) was started. the fever resolved in 24 hours and the patient s general condition improved, but desquamation developed on the hands and feet. the patient was discharged home in a stable condition on oral antibiotics for 2 weeks and on an antiplatelet dose of aspirin. she was seen in the outpatient clinic in good condition, and a repeat echocardiogram at 6 weeks was normal. the patient was started on intravenous normal saline 20 ml / kg due to dehydration. she was then transferred to the pediatric intensive care unit due to increased oxygen requirement. a chest tube was inserted and 200 ml of pus was drained. the pleural fluid culture yielded gas. nasopharyngeal and throat swabs, blood culture, and a mantoux skin test were all negative. on the eighth hospital day, there was no clinical response to antibiotics, and fever persisted, with new onset of abdominal pain, diarrhea, and slight tachycardia at a heart rate of 150 beats per minute. a repeat blood count showed a significant white cell count of 30,000/l, hemoglobin 7.7 g / dl, platelets 600,000/l, aspartate aminotransferase 180 u / l, alanine aminotransferase 120 u / l, and albumin 18 g / l, with a rise in erythrocyte sedimentation rate and c - reactive protein. the differential diagnosis included bacterial resistance to antibiotics, nonbacterial etiologies such as a virus or aspiration of a foreign body, bronchiolitis obliterans, hypersensitivity pneumonitis, atypical kawasaki disease, eosinophilic pneumonia, wegener s granulomatosis, pulmonary sequestration, and cystic adenomatoid malformation. since atypical kawasaki disease was in the differential diagnosis, an echocardiogram was ordered which showed a prominent of left anterior descending artery (0.26 cm, z - score 3.2) and left main coronary artery (0.35 cm, z - score 3.2), with no vegetations or pericardial effusion. our team decided to give one dose of intravenous immunoglobulin 2 g / kg, and high - dose aspirin (80 mg / kg / day) was started. the fever resolved in 24 hours and the patient s general condition improved, but desquamation developed on the hands and feet. the patient was discharged home in a stable condition on oral antibiotics for 2 weeks and on an antiplatelet dose of aspirin. she was seen in the outpatient clinic in good condition, and a repeat echocardiogram at 6 weeks was normal. kawasaki disease is common in japan, with an incidence of approximately 112 cases per 100,000 children under the age of 5 years, and there were 4248 cases of kawasaki disease reported in the united states in 2000.3 the culprit in kawasaki disease is not as yet known, so diagnosis might be a challenge for the physician, given that there are no specific tests. however, superantigens might have a role.2 in a recent study, natividad concluded that a superantigen could be the possible cause or trigger for kawasaki disease. the authors based their decision on the elevated levels of v2 + t cells found in patients with kawasaki disease compared with healthy controls.4 another study showed that the inflammation in kawasaki disease could be due to several infectious agents in genetically susceptible persons. staphylococcal and streptococcal superantigens have also been reported as possible culprits.5 the diagnostic criteria for diagnosis of classic kawasaki disease include high fever for at least 5 days, in addition to four or more of the following symptoms : polymorphous rash, cervical lymphadenopathy (more than 1.5 cm), bilateral nonpurulent conjunctivitis, strawberry tongue, swollen hands and feet, erythema of the soles of feet and palms, and red, swollen cracked lips.1 atypical kawasaki disease is the term used to describe patients with incomplete presentation of the disease and usually constitutes up to 36.2% of all cases of the disease. cervical lymphadenopathy and extremity changes are the two most common symptoms not seen in a patient with atypical kawasaki disease.6 since kawasaki disease is considered to be a vasculitis, symptoms like cough, abdominal pain, diarrhea, and vomiting might appear around ten days prior to the diagnosis of the disease.7 in terms of laboratory studies, inflammatory markers that might aid in the diagnosis of kawasaki disease include : elevated platelet count, erythrocyte sedimentation rate, c - reactive protein, leukocyte count, aspartate aminotransferase, alanine aminotransferase, and a high white cell count in urine. however, albumin, sodium, potassium, total cholesterol, lymphocytes, and hemoglobin might be low.8 patients with atypical kawasaki disease have been reported to have a low frequency of pyuria, low frequency of hyponatremia, low levels of gamma glutamyl transferase, and low levels of serum alanine aminotransferase compared with patients with classical kawasaki disease.6 kentsis found that high concentrations of two urine proteomes (flamin c and meprin a) are specific for the diagnosis of kawasaki disease.9 there are few cases of kawasaki disease associated with pulmonary changes, but they were not associated with gas. de maddi and uziel described five patients diagnosed as having atypical kawasaki disease with unspecified pneumonia. other authors also describe pulmonary changes not related to gas.2,1215 in addition, huang reported a case of atypical kawasaki disease associated with mycoplasma pneumoniae and epstein - barr virus infection.16 prompt initiation of therapy in kawasaki disease can decrease the risk of coronary artery lesions and dilatation from 20% to 5%. the initial treatment is a single dose of intravenous immunoglobulin (2 g / kg) and high - dose aspirin (80100 mg / kg / day, divided into four doses). treatment is more effective if started within ten days of onset of fever, but it is also advisable to initiate it even after ten days. the aspirin dose is usually switched from an anti - inflammatory dose to an antiplatelet dose (35 mg / kg / day, given as a single dose) after 4872 hours of defervescence. the antiplatelet dose of aspirin is usually continued for 68 weeks after the child is afebrile and if there are no coronary artery abnormalities.17 retreatment with a second dose of intravenous immunoglobulin (2 g / kg) is recommended if there is persistent fever for 36 hours after completion of the initial intravenous immunoglobulin infusion.18 steroids have been used for refractory cases of kawasaki disease, especially the combination of intravenous methylprednisolone and oral corticosteroids ; however, their use is controversial because of some reports indicating that steroids might cause coronary artery aneurysm and rupture.19 tumor necrosis factor - alpha might play a role in the inflammatory process in acute kawasaki disease, so studies were conducted on the efficacy and safety of anti - tumor necrosis factor - alpha (infliximab) for the treatment of refractory cases of kawasaki disease. hirono reported success using infliximab in eight of 11 patients with refractory kawasaki disease, with success measured by resolution of fever and a decrease in levels of serum interleukin-6, soluble tumor necrosis factor - alpha receptor 1, and c - reactive protein.20 burns reported a complete response to infliximab therapy, with cessation of fever and decrease in c - reactive protein in 14 of 16 patients.21 song also reported a complete response of 80% in patients with refractory kawasaki disease after use of infliximab. kawasaki disease is considered a self - limiting disease, but it can have detrimental consequences if not diagnosed early. when there is a prolonged inflammatory reaction and no infectious agent is identified or there is remittent fever unresponsive to antibiotics, kawasaki disease should be taken into consideration. the finding of elevated v2 + t cells suggests possible involvement of a superantigen in the etiology of kawasaki disease, so it is wise for the health care provider to concentrate not only on the cardiac consequences, but also on pulmonary associations. | backgroundkawasaki disease is an acute self - limiting vasculitis that affects children. the most dreaded complication of kawasaki disease reported in the literature over the years is coronary artery disease, which is considered as the main cause of acquired heart disease. however, pulmonary associations with kawasaki disease have been overlooked. we present a rare, if not unique, case of kawasaki disease associated with group a streptococcus pleural effusion in the english language literature. a search of the pubmed database was carried out, using a combination of the terms kawasaki disease, pneumonia, and group a streptococcus. the majority of studies conducted in children with kawasaki disease have concentrated on the coronary artery implications. kawasaki disease is considered a self - limiting illness, but can have detrimental consequences if not diagnosed early. when there is a prolonged inflammatory reaction, with no infectious agent identified or remittent fever unresponsive to antibiotics, kawasaki disease should be taken into consideration. elevated v2 + t cells compared with healthy controls suggest possible involvement of a superantigen in the etiology of kawasaki disease, so it is wise that the health care provider concentrates not only on the cardiac consequences, but also on pulmonary associations. |
abomasum is one of the most important sites for nematodes, which could be harmful to the health of infected animal and causes economic losses due to reduce weight gain and other production losses. the prevalence of p. skrjabini in iran has been reported 4.2% in goat, 5.43% in sheep (1, 2), and 0.8% in wild sheep (1, 3). researchers could analyze the divergences and genetic distances among taxa in the rdna nucleotide sequences to perform phylogenetic relationships analysis and species identification researches. the rdna secondary structures are predicted from the corresponding primary sequences according to base pairing, containing all the sequence information. although, there are significant variations in rdna sequences across different taxa (4), the corresponding secondary structures of the transcribed rrna are highly conserved during evolution (5), perhaps due to the important role of the rrna folding in holding the structural rna functions (6). in addition, the secondary structures are more conserved than the primary sequences for the semi - compensatory or compensatory mutations, and therefore when the multiple sequence alignments look less reliable due to deletion or insertion, the structures can help to make more reliable assignment of nucleotide homology with important role in the phylogeny (7). in addition, some changes, like expansions and deletions, of a certain helix could be specific to a taxon to help in species identification. so, the secondary structures have drawn a lot of attention from phylogenetic scientists however, the study on secondary structures takes a slower step than that primary sequences because of the limited sequence data in genbank suitable for structure prediction. in this study, the secondary structures of 5.8srrna of p. skrjabini were comprehensively investigated and compared with secondary structure of a p. skrjabini (eu375510.1) and two species of h. muscae (ay251024.1) and h. microstoma (ay251023.1) sequences, which are located in the same family retrieved from ncbi. such case studies are suitable to provision of basic data, both for reconstructing molecular evolution in expansive phylogenetic contexts and for analyzing function in ribosome biogenesis. however, only one study could be derived on parabronema at a molecular level (9). the aim of this study was to analyze the 5.8s rrnagene sequence and to study the possible effect of nucleotide substitutions on the topology of the secondary structure of the 5.8s rrna molecule in p. skrjabini and related habronematidae species. consequently, we studied the 5.8s rrna gene sequence of the members of the family habronematidae and determined the probable secondary structure of the5.8s rrna molecule for the first time. dna extraction from worms was performed using an extraction kit (mbst, iran) according to the manufacturer s instructions. the rrna gene was amplified using the primer pairs based on the r dna genome sequence (9). the forward primer was ps - f : 5-gta ggt gaa cct gcg gaa gg -3 and reverse primer was ps - r : 5-ttagtttcttttcct ccgct -3. the pcr reaction was carried out in a total volume of 100l containing 1pcr buffer, 100 mmol mgcl 2, 100 m dntp mix (cinaclone, iran), 20 mol of each primer (cinaclone co.), 5 unit/l taq dna polymerase (cinaclone) and 1l of template dna (100 ng dna) in an automated thermocycler. the pcr was performed using the following protocol : 5 min incubation at 94 c, 33 cycles of 45 s at 94 c, 45s at 59 c, and 45 s at 72 c, with an additional extension step for 5 min at 72 c. the pcr products were analyzed on 1% agarose gels in 0.5 tbe buffer and visualized using sybersafe staining (cinaclon, iran) and a uv illuminator. the pcr product was purified using a quick pcr product purification kit (mbst, iran) according to the manufacturer s instructions. genomic dna sequencing using the sanger method was performed in both directions on the pcr product by the kawsar biotech co. iran. the sequences were analyzed using the geneious 5.1.6 software and compared against genbank (www.ncbi.nlm.nih.gov/) using the basic local alignment search tool (blast). the probable secondary structure of the 5.8s rrna molecule was constructed using mfold software (http://mfold.rit.albany.edu/). common structural elements were initially recognized with the help of mfold(10, 11) by screening for thermodynamically optimal and suboptimal secondary structures (default settings, with t = 37 c). energy levels of the presumptive secondary structures were then calculated with mfold (10, 11). alignment, analysis of the derived nucleotide sequences, and cluster analysis were performed using mega 6.0 software (12). dna extraction from worms was performed using an extraction kit (mbst, iran) according to the manufacturer s instructions. the rrna gene was amplified using the primer pairs based on the r dna genome sequence (9). the forward primer was ps - f : 5-gta ggt gaa cct gcg gaa gg -3 and reverse primer was ps - r : 5-ttagtttcttttcct ccgct -3. the pcr reaction was carried out in a total volume of 100l containing 1pcr buffer, 100 mmol mgcl 2, 100 m dntp mix (cinaclone, iran), 20 mol of each primer (cinaclone co.), 5 unit/l taq dna polymerase (cinaclone) and 1l of template dna (100 ng dna) in an automated thermocycler. the pcr was performed using the following protocol : 5 min incubation at 94 c, 33 cycles of 45 s at 94 c, 45s at 59 c, and 45 s at 72 c, with an additional extension step for 5 min at 72 c. the pcr products were analyzed on 1% agarose gels in 0.5 tbe buffer and visualized using sybersafe staining (cinaclon, iran) and a uv illuminator. the pcr product was purified using a quick pcr product purification kit (mbst, iran) according to the manufacturer s instructions. genomic dna sequencing using the sanger method was performed in both directions on the pcr product by the kawsar biotech co. iran. the sequences were analyzed using the geneious 5.1.6 software and compared against genbank (www.ncbi.nlm.nih.gov/) using the basic local alignment search tool (blast). the probable secondary structure of the 5.8s rrna molecule was constructed using mfold software (http://mfold.rit.albany.edu/). common structural elements were initially recognized with the help of mfold(10, 11) by screening for thermodynamically optimal and suboptimal secondary structures (default settings, with t = 37 c). energy levels of the presumptive secondary structures were then calculated with mfold (10, 11). alignment, analysis of the derived nucleotide sequences, and cluster analysis were performed using mega 6.0 software (12). the length of 5.8s rrna sequence for p.skrjabini#1, p.skrjabini#2, h. microstoma and h. muscae was 158, 156, 127 and 127bp, and the dg required for the formation of the secondary structure was 70.50, 56.40, 41.50 and 41.40 kcal / mol, respectively. the stem loop structures were folded using the mfold web server (http://mfold.rna.albany.edu/) zuker 2003 (fig. the 5.8s rrna gene sequences in the habronematidae samples analyzed maximization of the hydrogen bonding formed solid stems, and the largest negative delta g value (free energy). we predicted the motifs for 5.8s rdna of p. skrjabini and three other sequences in genebank (p. skrjabini#2, h. muscae and h. microstoma). three motifs were identified for 5.8s of p. skrjabini#1, the first motive- aggggg (6bp), the second motive- taaaaa (6bp) and the third motive- caaaga (6bp). the first motive is repeated in two positions [10 and 148 ]. in addition, the second motive is repeated in two positions [39 and 61 ]. for p. skrjabini#2 three motifs were identified, the first motive gataaatagtgcgaattgca (20bp), the second motive- gtggat (6bp) and the third motive- ccatcggg (8bp). the second motive is repeated in two positions [13 and 29 ]. for h. muscae there are three motifs, the first motive catcccgatggt (12bp), the second motive gtcgat (6bp) and the third motive cagacg (6bp). the second motive is repeated in two positions [3 and 122 ]. for h. microstoma we identified three motifs, the first motive cccgatggt (9bp), the second motive agctgc (6bp) and the third motive cagacg (6bp). the number of different loops, motifs and the dg for formation of the secondary structure is shown in table 1, fig. 2. statistical information of the predicted secondary structure of parabronema skrjabini rrna phylogenetic tree of habronematidae family the secondary structures contain more information than the primary sequences and are the bases of rrna function ; have gained a lot of attention in phylogenetic analysis. in this study, the secondary structure of 5.8s rrna of p. skrjabini was predicted and the structure comparison performed by predicating the secondary structures for a p. skrjabini and two species of habronema (h. muscae and h. microstoma) sequences, which is located in the same family retrieved from ncbi. 5.8s ribosomal rna (5.8s rrna) is a non - coding rna component of the large subunit of the eukaryotic ribosome that plays an important role in protein translation. in this study secondary structure with bulge, hairpins, helices, interior, external and multi loops of 5.8s rrna sequence of p. skrjabini was reconstructed under specific settings for base pairing and compared with secondary structure of a sequence of p. skrjabini, and two species of habronema (h. muscae and h. microstoma) retrieved from ncbi. the predicted ssu rrna secondary structure in the present study was the first model for p. skrjabini. however, the prediction of the secondary structure was impaired due to a few complete sequences of limited species of parabronema. in total, 41 variable sites in the 5.8s rrna gene sequence were detected in the samples analyze (fig. p. skrjabini#2 was more similar to h. muscae and h. microstoma and was more invariable than p. skrjabini#1. there was a 31-nucleotide absence at the beginning of the 5.8s rrna gene of h. muscae and h. microstoma. however, this insertion is present in the p. skrjabini#1and this presence is 30 for p.skrjabini#2. the motive 2a and 2b for p. skrjabini#2 and the motive 2a and 2b for h. muscae are different in only one nucleotide (g - c). the motive 3a in h. muscae and 3a in h. microstoma is common and motive 1a in h. muscae and h. microstoma had only three - nucleotide difference. we isolated p. skrjabini#1 in sheep and from sanandaj (west of iran), but p. skrjabini#2 is in camel and china, h. muscae and h. microstoama are in horse and italy. the phylogenetic tree (fig. d : h. muscae (ay251024.1).the position of motifs is shown on the secondary structures. the nucleotide substitutions are shown by arrows moreover, some changes, such as expansions and deletions, of a certain helix could be specific to a taxon to help a lot in species identification. using mfold software, the probable secondary structure of the 5.8s rrna gene when constructing the secondary structure of the 5.8s rrna gene sequence, the sequence of p. skrjabini was used as a consensus sequence. the secondary structure of the 5.8s rrna gene has not been described for family habronematidae, specially the genus of p. skrjabini. in our study, for the first time we determined the secondary structure of 5.8s rrna in the p. skrjabini and related habronematidae species. we made a multiple alignment and found structural differences among the analyzed samples, parabronema and habronema, which could be further used in the structure modeling across habronematidae. | background : genomic dna was isolated from parabronema skrjabini. rrna region was amplified and sequenced.methods:the rna secondary structure was predicted using mfold software (http://mfold.rit.albany.edu). the secondary structure with bulge, hairpins, helices, interior, external and multi loops was predicted for 5.8srdna of our sequence of p. skrjabini and a sequence of p. skrjabini and two species of habronema (h. microstoma and h. muscae) in genbank. rna motifs were predicted by meme program version 4.10.2.results:the length of 5.8s rrna sequence for p. skrjabini#1, p. skrjabini#2, h. microstoma and h. muscae was 158, 156, 127 and 127bp, and the dg required for the formation of the secondary structure was 70.50, 56.40, 41.50 and 41.40 kcal / mol, respectively. common structural elements were initially recognized with the help of mfold by screening for thermodynamically optimal and suboptimal secondary structures (default settings, with t = 37 c). the energy levels of the presumptive secondary structures were then calculated with mfold at the dna level. both motifs and the sequence of p. skrjabini#1 were completely different from the other analyzed samples. this difference might be due to the differences in host and geographical area.conclusion:this is the first molecular study of p. skrjabini in sheep, which could be further used in the structure modeling across habronematidae. |
pu - erh tea is a special tea species in china and has become one of the most popular beverages in southwestern china and southeast asian, owing to its special flavour properties and potential healthy benefits. it is originated from yunnan province (china) through a special post - fermentative process, using crude green tea prepared from the leaves of c. sinensis var. assamica as original materials. because pu - erh tea has a malty flavour and low - stimulation taste in tea infusions which may fit female appetite, recent years, interest in the flavor and the healthy properties and the related scientific investigations were increasing [3, 4 ]. up to now, a little information on the relationship of the chemical composition to the flavor is available. volatile flavor component is one of the most important factors to influence the flavor, taste, and quality of pu - erh tea, in which the contents are different from the green and black tea because of different processing procedure and variety of species and cultivar. investigation on the components in green and black tea are reported elsewhere, yet few on those in pu - erh teas. in order to explore the influence of those components to flavor, taste, and quality, quantitative analysis of main volatile flavor components in pu - erh tea for analysis of volatile components or essential oils, several extraction techniques, including soxhlet extraction, liquid - liquid extraction (lle), simutaneous distillation - solvent extraction (sde), solid phase microextraction (spme), and headspace microextraction (hsme) and so forth, had been used to diferent matices. soxhlet extraction is a classical method for decades in extraction of organic compounds from solid sample, and this apparatus has been developed to several types for special use. thorough extraction method because the organic phase cooled from condensation tube continuously passes through the target solid sample for hours. however, poor recovery commonly occurred for extraction of high - volatile or heat - labile compounds. lle is a conventional method for isolation of all boiling range volatile compounds, based on the compatibility of compounds with organic phase selected. the main disadvantage is solvent - consuming, tedious and, low - recovery for some target compounds. sde, proposed by godefroot and so forth, has been widely applied to analysis of volatile components in tea samples. although low recovery has been found for extracting the most volatile or heat - labile components, this technique has achieved higher recoveries and greater repeatability of volatile or semi - volatile and heat - stable components than other isolation technique such as spme or hsme when low water temperature in the circulating system was used. spme and hsme are relatively new techniques that are able to address the need for concentrating the components in the headspace [10, 11 ]. both of them use a small piece of fused silica, on which a liquid or solid phase, similar to a gc stationary phase, has been coated to absorb the desired components and concentrate them on the fibre. thus the two techniques are more sensitive for the isolation of high volatile components than sde, while less sensitive and lower repeatability for the low volatiles than sde. conventionally, pu - erh tea is condensed to a pie - like tea - biscuit in the final processing procedure. extraction of the volatile flavor components will be different from the green and black tea. in order to select the best extraction technique for studying the volatile flavor components of pu - erh tea, a modified sde was evaluated for quantitative determination of the analytes using ethyl decylate as internal standard, and the two classical techniques, steam distillation - liquid / liquid extraction and soxhlet extraction, pu - erh tea samples were obtained from dayi limited incorporation (menghai, yunnan, china). the sample was dried at 40c in electric oven for 6 h, ground to 3060 mesh, and sealed for use. the reference volatile chemicals were purchased from sigma (st. louis, mo, usa). the stock solution was prepared by dissolving single solid / liquid standard in dichloromethane to an appropriate concentration depending on the content in pu - erh tea. ultra - pure water was obtained from a milli - q water purification system (pall co, il, usa). the other solvents used in the test were all of analytical - grade and disdillated before use. dichloromethane and ethyl decylate were employed as solvent and internal standards, respectively. for each extraction, 15 g of tea sample, 10 g sodium sulphate, 100 l internal standard solution and 300 ml ultra - pure water were placed in a 1 l flask, 50 ml dichloromethane was in a 100 ml flask, and temperature of the circulating water system was operated at 8c. stream distillation was stopped after 2 h, while the solvent extraction was continued for a further 15 min. the extract was concentrated to 1 ml at 10c by a nitrogen - purge apparatus (shanghai anpel scientific instrument co. ltd). the concentated solution was dehydrated with anhydrous sodium sulphate for at least 12 h, of which 2 l was injected to gc or gc - ms system for analysis. for sd - lle, 15 g of tea sample, 10 g sodium sulphate, 100 l internal standard solution and 500 ml ultra - pure water were placed in a 1 l distillation flask, respectively. the liquid was transferred to a 500 ml of separation funnel and then extracted three times (30 ml 3) using dichloromethane. the extracted organic phase was combined and concentrated to 1 ml at 30c by a nitrogen - purge apparatus after internal standard was added. 15 g of tea sample containing 100 l internal standard solution were placed in soxhlet 's apparatus and 50 ml of dichloromethane in an 150 ml distillation flask. at both ends of the sample in soxhlet 's apparatus, there are 2 cm - height of celite to help fix the sample. extraction was carried out at 50c for 2 hours, and extraction was concentrated to 1 ml at 30c by a nitrogen - purge apparatus after internal standard was added. the concentrated extracts were chromtographed by an hp 6890 series gc system (agilent, usa). a 30 m 0.25 mm db-5 quartz capillary column (supelco, bellefonte, pa, usa) with 0.25 m film thickness was used to resolve the volatiles. temperature programming was as follows : initial oven temperature was set at 60c and kept for 3 min, then raised to 200c at a ramp of 4c / min and kept for 2 min ; to 210c at of 1c / min and kept for 2 min ; and finally, it was raised to 270c and kept for 7 min. nitrogen was used as carrier gas with column head pressure at 12.26 kpa in constant pressure mode. programming split / splitless injection temperature was set at 260c with split ratio of 10 : 1 and fid detector at 280c. auto system shimaszu qp 2010 gc - ms was employed for qualitative analysis to confirm the target components. the oven temperature was set at 50c and kept for 2 min, then raised to 60c at a ramp of 1c / min and kept for 2 min, to 200c at of 4c / min and kept for 2 min, and finally, to 270c at 10c / min and kept for 5 min. the mass spectrometry was operated at 200c in the electron impact mode (70 ev), scanning from m / z 40 to 600 in 0.3 s with an 0.2 s interval time of the scan ; the temperature of the gc - ms interface was 280c ; the voltage of the photoelectric multiplier tube (pmt) was 200 v. the mass spectral identifications of the target components were carried out by comparing to the nist 107 (national institute of standards and technology, gaithersburg, usa) mass spectral library as well as to wiley 6.0 (wiley, new york, ny, usa) mass spectral library. for gc separation of volatile components in tea samples, bp-20 sge column (polar column, 30 m 0.25 mm i.d. film thickness 0.25 m) was commonly used for quantitative analysis. in this work, film thickness 0.25 m) was employed to separate the target components with temperature programming described above, and the chromatograms of standard compounds by gc - fid and gc - ms was shown in figures 1(a) and 2(a). from the chromatograms, it can be seen each peak of the target compounds was baseline separated, and separating degree between two vicinity peaks was beyond 2, confirming weak - polar capillary column can be used to separate the target components if gc separation condition was well optimized. according to gc - fid chromatogram, we calculated the relative factor of each of the standard compounds, it was shown in table 1, and the relative factor was used to determination of the corresponding components in real pu - erh teas. figures 1(b) and 2(b) show the chromatograms of pu - erh raw tea that was obtained from gc - fid and gc - ms determination, in which the target peaks of real sample could be easily discerned and accurately quantified. the mass spectra of each target peaks in figure 2(b) was checked by nist or wiley mass spectral library respectively, and campared with those in figure 2(a), confirming that each mass spectra of the components was the same as those of the corresponding standard compound, and no interference was appeared in the target peaks. comparing figures 1(b) and 2(b), we found that both gc - fid and gc - ms separation methods can be applied to quantitative analysis of volatile flavor components in pu - erh teas. nevertheless, quantitative determination of the target components using gc - fid was more cost - saving than doing gc - ms, so the rest determinations for all of the samples were carried out in gc - fid. during sde operation, dichloromethane and diethylether are the most suitable extraction solvents for extraction of volatile components because of their weakly polar characteristics [15, 17 ]. in this experimental, we select dichloromethane as extraction solvent for sde, due to its property of low combustion, and higher boiling point (40c) than diethylether (35c) thus liable to storage. zhu. had applied sde to extract volatile constitutes in green tea, confirming of 2 h was adequate to extract all the target compounds. initially, we operated sde apparatus as zhu. done, and found that there are about 6% of target components dwelling on the tea residue. this is because pu - erh tea was condensed to a pie - like shape, and the components were more difficult to release from tea matrix although the teas had been ground to 3060 mesh. then we modified this method by adding 10 g of sodium sulphate to the 1 l of steam flask containing 300 ml of water, and then operating sde device. after 2 h of sde and a further 15 min of the solvent extraction, the tea residue was re - extracted by sde, we found the area of the target peaks were less than 2% of the total. obviously, boiling point of water in steam flask was enhanced by adding sodium sulphate, accelerating the releasing velocity of target compounds. to confirm the repeatability, parallel the relative standard deviations (rsd) were in range of 1.44%12.6%, which were shown in table 3. to check accuracy of sde for volatile flavor components, a known amount of standard solutions were added to aliquot of pu - erh tea. the adding level and corresponding recoveries were listed in table 3. for quantitative extraction of volatile flavor components from complex matrices, common technique used is sde. because both liquid / liquid extraction and soxhlet extraction are classical techniques [8, 10 ], in this test, the modified classical techniques were compared with sde in extraction of the volatile flavor components from pu - erh tea in order to select the best one for sample preparation. the results were shown in table 2. generally, sde was the best one among them, because the amounts of the components extracted were greater than those by employing sd - llc or soxhlet for the high - volatile components such as benzyl alcohol, linalool oxide, and linalool. this may attributes to the fact that sde was a closed and continuous extraction system, in which the target components can be furthermore, the temperature of the circulating water in sde was set at 8c, reducing the lose of the high - volatile components. as for extraction of the low - volatile components in pu - erh tea, such as 1,2,4-trimethoxylbenzene, sde is less poor compared with soxhlet extraction, probably due to the characteristics of high - boiling point and incompatibility with water steam. although sd - lle shares a same extraction principle with sde, the limitation of the technique is clear in table 2. this is due to its open steam distillation system and following step - liquid - liquid extraction. during this procedure, not only high - volatile components such as benzyl alcohol, linalool oxide, and linalool and so forth had a chance to escape from the distillation system, but the analytes hardly transferred to organic phase. we could not confirm whether isomerization reaction was happened between the two compounds during extraction, and further investigation was beyond the work. table 2 shows that it can almost exhaustively extract all the 1,2,3- and 1,2,4-trimethoxylbenzene from pu - erh tea compared with sde, nevertheless it is very poor for benzyl alcohol, linalool oxide, linalool, phenethyl alcohol, and geraniol. these findings indicate soxhlet was suitable for high - boiling point (low - volatile) compounds such as essential oil. as for the trace high - volatile component,, we analyzed several tea samples, including four pu - erh ripe tea, four pu - erh raw tea, one green tea (huangshan, anhui) and one black tea (qimen, anhui), and the contents of the target volatile components were shown in table 4. it can be seen that the content of high volatile components, such as benzyl alcohol, linalool oxide, linalool in raw teas are higher than those in ripe teas, these findings are mainly due to the high temperature (4555c) during the pile - fermentation process of ripe pu - erh teas, leading to the lose of these components. however, in raw teas, the content of 1,2,3- and 1,2,4-trimethoxylbenzene are much lower than those in ripe teas, this is because microbes play an important role in the synthesis of the two compounds during the pile - fermentation process of ripe pu - erh teas, which promote reaction procedure of methylation. generally, the contents of the volatile components in the green and the black teas are higher than those in pu - erh teas, except for 1,2,3- and 1,2,4-trimethoxylbenzene, which are not found in both of teas, probably due to lack of post - pile - fermentation process in manufacture, and linalool, lower than those in pu - erh raw teas due to different cultivar, variety of species and processing procedure. sde combined gc method was constructed for determination of volatile flavor components in pu - erh tea samples. 10 of volatile flavor components were quantitatively determined, and the recoveries and rsds were in the range of 66.4%109% and 1.44%12.6%, respectively. the method was compared with sd - lle and soxhlet extraction, comfirming sde was suitable for pu - erh teas among them. pu - erh raw tea and ripe tea samples were analyzed by the method, indicating the high - volatile components, such as benzyl alcohol, linalool oxide, and linalool, were rich in pu - erh raw teas, while the contents of 1,2,3- and 1,2,4-trimethoxylbenzene were much high in pu - erh ripe teas. | a simutaneous distillation extraction (sde) combined gc method was constructed for determination of volatile flavor components in pu - erh tea samples. dichloromethane and ethyl decylate was employed as organic phase in sde and internal standard in determination, respectively. weakly polar db-5 column was used to separate the volatile flavor components in gc, 10 of the components were quantitatively analyzed, and further confirmed by gc - ms. the recovery covered from 66.4%109%, and repeatability expressed as rsd was in range of 1.44%12.6%. sde was most suitable for the extraction of the anlytes by comparing with steam distillation - liquid / liquid extraction and soxhlet extraction. commercially available pu - erh tea samples, including pu - erh raw tea and ripe tea, were analyzed by the constructed method. the high - volatile components, such as benzyl alcohol, linalool oxide, and linalool, were greatly rich in pu - erh raw teas, while the contents of 1,2,3-trimethoxylbenzene and 1,2,4-trimethoxylbenzene were much high in pu - erh ripe teas. |
the local inflammatory response and the anatomical features of the herniated disc and spinal canal determine the resultant clinical syndrome which may include low back pain, and sciatica with or without neurological deficit. it has been estimated that about 80% of the western population would suffer some back pain in their lifetime. ten million people per year are affected in the united states alone, costing roughly around $ 20 billion, in addition to loss of manpower due the absence from work.[24 ] mainstay of treatment for patients with radicular pain due to lumbar disc herniation involves open lumbar discectomy, and has provided excellent outcome in over six decades.[58 ] surgery (discectomy), aims to alleviate pain ahead of the natural history. almost all patients report significant pain relief in the early post - operative period. given the current trend of minimal access surgery which transcends all aspects of surgical practice, nucleoplasty has been described recently as a minimal - access procedure with good outcome. it utilizes coblation technology that dissolves the soft tissue of nucleus pulposus, and therefore causes disc decompression and symptom improvement. to evaluate the effectiveness of nucleoplasty in the management of radicular pain due to small lumbar disc herniation. data collected include : age, gender, presence and duration of radicular symptoms or signs, previous procedures (e.g. epidural injection), the level of disc herniation as seen on magnetic resonance imaging (mri), and clinical assessment (by the same assessor) pre - procedure and at 1 and 3 months following the procedure. clinical inclusion criteria : radicular symptoms and signs for 6 months or more, and failing to respond to conservative management (e.g. physiotherapy, analgesia, epidural injection, and selective nerve root blocks). table 1 ] inclusion and exclusion criteria radiological inclusion criteria : single - level, small - size, contained lumbar disc herniation (that is clinically relevant) with neural compression as seen on a lumbosacral spine mri, preservation of disc trilaminar appearance, preservation of at least 50% of the disc height when compared to adjacent discs. [table 1 ] exclusion criteria : previous lumbar disc procedure (surgery, intradiscal electrothermal therapy idet, nucleoplasty), history of uncontrolled psychological disorder, radiological evidence of annular tear and disc sequestration (i.e. uncontained herniation), multilevel disc herniation, spinal stenosis, other pathologies (e.g. tumor) that explain the clinical presentation. the procedure was performed by the same surgeon as a day case under local anesthesia in prone position. annular integrity was confirmed by non - passage of the contrast into the epidural space. the disc was penetrated from the symptomatic side. the surgical probe (perc - dle spine wand, arthrocare corp. austin, texas) was placed into the assess cannula and advanced until the tip of the catheter was approximately 5 mm beyond the tip of the spinal needle, till it came into contact with the annulus on the contralateral side. the process of disc decompression involved advancing the catheter, in ablation mode, at a speed of 0.5 cm / s and withdrawing the wand in coagulation mode at a speed of 0.5 cm / s. since this was a retrospective study, the outcome measures employed in this study were patient satisfaction with symptoms and self - reported improvement. the procedure was performed by the same surgeon as a day case under local anesthesia in prone position. annular integrity was confirmed by non - passage of the contrast into the epidural space. the disc was penetrated from the symptomatic side. the surgical probe (perc - dle spine wand, arthrocare corp. austin, texas) was placed into the assess cannula and advanced until the tip of the catheter was approximately 5 mm beyond the tip of the spinal needle, till it came into contact with the annulus on the contralateral side. the process of disc decompression involved advancing the catheter, in ablation mode, at a speed of 0.5 cm / s and withdrawing the wand in coagulation mode at a speed of 0.5 cm / s. since this was a retrospective study, the outcome measures employed in this study were patient satisfaction with symptoms and self - reported improvement. twenty - seven patients had undergone the procedure with no complications and six procedures were abandoned due to anatomical reasons. the mean age of the 27 patients was 37 years (range 19 - 83, median 31). there were 16 males and 11 females, with a mean duration of symptoms of 16 months (range 6 - 72, median 8). at 1-month follow - up, 13 patients reported significant improvement in symptoms, and in 14, the symptoms remained the same. chronic back pain is fast becoming one of the major debilitating ailments in modern society, with its attendant social and financial consequences. initial management for patient with this condition is conservative, by way of analgesia, anti - inflammatory medications, physiotherapy, and bed rest. those who do not respond to the above can go a step further to have epidural injections or specific nerve blocks. in most cases, patients improve in a few weeks with these measures, reflecting the natural history of discogenic radicular pain. in some patients who do not improve with conservative measures or those who present at first contact with large, uncontained disc herniation, surgery by way of open lumbar microdiscectomy is offered and has remained the mainstay for over six decades [figure 1 ]. sagittal view of mri lumbar spine showing disc herniation at l5/s1 level however, in view of the changing trends in surgical practice toward achieving much, however, doing so little, the so - called minimalization, it is a minimally invasive technique for treating patients with contained herniated disc (see the technique described above). however, in 40% of patients, the symptoms remained 2 weeks post - procedure. there was no correlation between outcome and the level of disc herniation, gender, or duration of symptoms. the median age of patients who improved following nucleoplasty and of those in whom the symptoms remained was 29 and 35 years, respectively. eight of the 11 patients (73%) aged 29 years or less improved following the procedure. however, the statistical significance of this finding remains weak due to the small sample size. all, except one, of those who remained symptomatic following nucleoplasty underwent discectomy at a later date and improved at 1-month follow - up thereafter. we tend to offer surgery to patients with moderate or large herniation with neural compression and when significant symptoms persist beyond 2 months despite conservative management. in patients with small herniation, a conservative approach is adopted for a longer period of time before surgery is considered. as much as 60 - 80% of patients with radicular pain due to small herniated disc showed remarkable improvement overtime with conservative treatment. in this study, various clinical and radiological studies have shown that in the majority of patients with symptomatic herniated disc, symptoms and disc herniation subside over a period of time without intervention (surgery or nucleoplasty). although nucleoplasty is a safe minimal - access procedure, it is no longer recommended for this group of patients for two reasons. first, outcome at 1 month is more predictable and a greater proportion of patients improve following surgery than nucleoplasty. second, at further follow - up, outcome following nucleoplasty is not significantly different than the history or surgery. | background : nucleoplasty (percutaneous lumbar disc decompression) is a minimally invasive procedure that utilizes radiofrequency energy as a treatment for symptomatic lumbar disc herniation, against open microdiscectomy, which would be the mainstay treatment modality. the literature reports a favorable outcome in up to 77% of patients at 6 months.aim:to evaluate the effectiveness of nucleoplasty in the management of discogenic radicular pain.materials and methods : the medical notes of 33 patients, admitted for nucleoplasty between june 2006 and september 2007, were reviewed retrospectively. all had radicular pain, and contained herniated disc as seen on magnetic resonance imaging (mri) of lumbosacral spine. patients were followed up at 1 and 3 months post - procedure. the outcome measures employed in this study were satisfaction with symptoms and self - reported improvement.results:thirty-three cases were examined (18 males and 15 females). twenty - seven procedures were performed with no complications and six were abandoned due to anatomical reasons. there were 18 and 15 cases of disc herniation at l5/s1 and l4/5 levels, respectively. four weeks following the procedure, 13 patients reported improvement in symptoms, and 14 remained symptomatically the same and subsequently had open microdiscectomy.conclusion:nucleoplasty has been shown to be a safe and minimal - access procedure. less than half of our selected cohort of patients reported symptomatic improvement at 1-month follow - up. we no longer offer this procedure to our patients. possible reasons are discussed. |
although psa was once described as a variant of rheumatoid arthritis (ra), it has been included in the group of spondyloarthropathies. psa was first defined by moll and wright in 1973 in patients who were seronegative for rheumatoid factor (rf) with positive history of psoriasis, current skin or nail psoriasis, and inflammatory joints of axial disease. the exact estimation of psa prevalence among psoriasis patients is difficult because several epidemiologic studies on psa have not used validated criteria. psa incidence has increased from 5% to 40% among patients with psoriasis [25 ]. because psa might be as common as psoriasis approximately 40% to 60% of psa patients develop erosive arthropathy, and 17% have five or more deformed joints. a delay in diagnosis and treatment dermatologists who lack expertise in psa might miss an opportunity for early treatment that could prevent functional joint disability. unfortunately, many dermatologists are indifferent to psoriatic arthritis with any degree of severity and instead search for signs of hidden arthritis or skin disorders. the association between arthritis and psoriasis was first described by alibert in 1818 and was designated psoriasis arthritique by bazin in 1860. at that point, distinctive arthritis associated with psoriasis became widely accepted. however, in the 1950s, psa was grouped with ra as a rheumatoid variant or rheumatoid spondylitis. subsequently, the distinct nature of psa was emphasized using clinical criteria. in 1973, moll and wright defined psa and classified it into five subsets of distal interphalangeal arthritis, asymmetrical oligoarthritis, symmetrical polyarthritis, spondylitis, and arthritis mutilans. although several diagnostic and classification criteria have been developed, they have not been commonly accepted. physicians usually make a diagnosis of psa based on characteristic arthritis patterns together with the absence of rheumatoid factor and the presence of psoriasis skin and nail lesions. since there are no specific serologic tests to confirm psa diagnosis, radiographs can be helpful. in 2006, these criteria, called the classification criteria for psoriatic arthritis (caspar), provide better sensitivity (91.4%) than all previous criteria while maintaining high specificity (98.7%). to diagnose psa according to caspar, patients should have inflammatory joint disease (peripheral, axial, or enthesitis) with at least three points from the five categories. caspar criteria can be modified for dermatologists who screen for psa among patients with skin psoriasis, as shown in table 1. the detection of psa requires detailed joint examination, which in not usually performed in a routine dermatologic clinic. every psoriasis patient with musculoskeletal symptoms should ideally be referred to a rheumatologist, but this is impractical. a simple screening tool that identifies psoriasis patients who are more likely to have psa would be tremendously valuable to dermatologists and other healthcare providers. a screening tool would also raise awareness in patients with psoriasis who are unaware of the relationship between psoriasis and musculoskeletal symptoms. several appropriate psa screening tools have been developed and are used worldwide, including pest (psoriasis epidemiology project), topas (toronto psoriatic arthritis screening tool), and pase (psoriatic arthritis screening and evaluation tool) [1012 ]. psa is a polygenic autoimmune disorder of unknown etiology in which genetic susceptibility, environmental factors, and immune mechanisms play crucial roles. human leukocyte antigen (hla)-c within the major histocompatibility complex (mhc) region is the strongest genetic association for psa. other class i hla antigens associated with psa include hla - b13, b27, b38, b39, and b57. hla - b27 is present in 20% to 60% of psa patients, with increased incidence in the axial or spondylitic forms. regarding hla class ii molecules, dr4 is more commonly found in the erosive form, while dr7 is more commonly found in peripheral involvement. hla - b27 prevalence is much lower in axial psa than in ankylosing spondylitis (as), and it is strongly influenced by ethnicity. regarding immunopathogenesis, there is prominent lymphocytic infiltrate in both the skin and joints that is localized to dermal papillae in the skin and the sublining layer stroma in joint and inflammatory entheses. t lymphocytes, particularly cd4 + cells, are the most common inflammatory cells, with a cd4+/cd8 + ratio of 2:1 in the synovial fluid and peripheral blood. the inflammatory mechanism of psa involves autoproliferation of t cells as well as production of cytokines from type 1 helper t cells (th1) and type 17 helper t cells (th17). these include tumor necrosis factor (tnf)-, interferon (ifn)-, interleukin (il)-1, il-6, il-8, il-17, il-22, il-23, and intercellular adhesion molecule (icam)-1. high levels of tnf-, il-6, il-8, il-10, and matrix metalloproteinases (mmp) are present in the joint fluid, psoriatic plaque, and serum of patients with early psa. psa onset age is in the range of 30 to 50 years, and the condition affects men and women almost equally. in approximately 70% of cases, psoriasis precedes the development of psa by an average of 10 years. in approximately 15% of cases, psa precedes the onset of psoriasis by more than 1 year, and in approximately 15% of cases the two conditions occur within 12 months of each other. there are two major patterns of arthritis with psa : peripheral joint disease, which can be oligoarticular (4 involved joints) or polyarticular (5 involved joint), and skeletal or axial disease with or without peripheral arthritis. approximately 95% of patients with psa have involvement of the peripheral joints, predominantly the polyarticular form, while a minority has the oligoarticular form. about 5% of patients have exclusively axial involvement, whereas 20% to 50% of patients have involvement of both the spine and peripheral joints, with peripheral joint involvement having predominance. several other recent studies confirm that asymmetric oligoarthritis is the most common pattern in early phase psa. involved joints in psa are usually less tender, less swollen, and less symmetric than in ra. as mentioned above, there might be ethnic differences in the pattern of joint involvement. in a korean study, patients with oligoarticular peripheral psa seem to have a shorter disease duration than patients with polyarthritis. dip arthritis and arthritis mutilans represent distinctive features of psa. in the largest clinical series, dip arthritis was reported in 1% to 59% of patients with psa. in this series, dystrophic nail changes, including pitting, subungal hyperkeratosis, and transverse grooves, are more frequent in psa than psoriasis. in roughly 5% of patients with longstanding disease, this leads to characteristic clinical features of falling joints or opera glass fingers, which is termed arthritis mutilans. classical psa affects the distal interphalangeal (dip) joints, whereas ra affects the proximal interphalangeal (pip) joint more frequently. another important differential diagnosis to consider in patients with psa is osteoarthritis (oa). however, the classic heberden s nodules in oa are bony spurs whereas the dip involvement in psa is merely joint inflammation. morning stiffness and stiffness after prolonged inactivity are common in psa whereas stiffness tends to occur with joint activity in oa. although psa occurs equally in males and females, oa of the hands and feet is more frequent in females. dactylitis, enthesitis, and sacroiliitis are common in psa but are generally not present in ra and oa. there are a wide variety of clinical manifestations and peripheral arthritic symptoms in axial psa that may overshadow those related to spinal inflammatory involvement. however, asymptomatic involvement of the spine and sacroiliac joints may occur more often in psa than as. furthermore, patients with axial psa have asymmetric disease that tends to be less severe. while the radiologic features vary, they can be helpful in detecting asymptomatic disease and differentiating axial psa from as. however, bilateral fusion of the sacroiliac joint may occur with disease progression. in axial psa, spondylitis may affect any spinal level in a skip fashion or it may affect only the cervical spine while sparing other tracts of the axial skeleton. axial psa is characterized by a better prognosis than as, and patients with psa seldom progress to ankylosis. enthesitis is usually defined by the presence of tenderness and swelling on palpation or pressure in the insertion sites of tendons, ligaments, or capsules. enthesitis represents a hallmark of the clinical features of psa and is now regarded as the primary lesion. achilles tendon enthesitis usually coexists with tenosynovitis and contributes to the bomb - shaped tendon. 1). it may occur in one or more digits concomitantly with the typical signs of inflammation, such as swelling, redness, pain, warmth, and limited range of motion. it is an expression of active psa and will respond well to anti - tnf- therapy. skin lesions such as psoriasis can be localized, diffuse, guttate, or pustular (fig 2). thus, patients with any pattern and degree of arthritis can develop psoriasis vulgaris, severe generalized pustular psoriasis, or erythrodermic psoriasis. iridocyclitis represents the most frequent extra - articular feature, with an estimated prevalence of 2% to 25% of cases. iridocyclitis is characterized by an acute onset over 12 days, eye pain, redness, miosis, photophobia, and vision blurring. what is the role of dermatologists in the field of psa screening, diagnosis, or management ? some assert that if the primary problem is skin psoriasis, psa can be managed by a dermatologist. if the chief complaint is a joint symptom, rheumatologists should primarily manage the patient with dermatologists assisting in the diagnosis of skin psoriasis. dermatologists can conduct a full screening and confirm psa in psoriasis patients who are visiting a dermatologic department. when managing psa, oligo- and dip arthritis can be managed by dermatologists, whereas polyarthritis, spondylitis, and arthritis multilans should be referred to rheumatologists (fig. more physicians have become aware of the relationship between psa, artherosclerosis, and increased cardiovascular risk in patients with psa. psoriasis and psa should no longer be regarded as diseases limited to joint or skin. clinical dermatologists should be thoroughly aware of the nature of psa, and an interdisciplinary approach is needed. | psoriatic arthritis is a chronic inflammatory arthropathy associated with skin psoriasis. it is considered a unique arthropathy with distinct clinical and radiologic features. up to 40% of patients with psoriasis may develop psoriatic arthritis. psoriasis usually precedes psoriatic arthritis, so dermatologists are in a critical position for screening patients of psoriatic arthritis early in the disease course. psoriatic arthritis may be challenging to diagnose, especially for dermatologists, because it has an insidious disease course, non - specific symptoms, and no specific biomarkers. psoriatic arthritis is a polygenic autoimmune disorder of unknown etiology, but immunologic roles have recently been validated. in recent years, treatment modalities have rapidly advanced in the fields of psoriasis and psoriatic arthritis. biologic agents, including tnf- inhibitors and anti - il12/23 agents, have shown dramatic improvement. |
chronic obstructive pulmonary disease (copd) is a disabling disease, of which the prevalence increases with age and causes significant morbidity and mortality.1 it is the ninth leading cause of years of life lost according to world health organization global health observatory data (http://www.who.int/gho/en/). in the previous version of the global initiative for chronic obstructive lung disease (gold) guidelines, classification of copd was based only on the forced expiratory volume in 1 second (fev1). in 2011, the gold guidelines emphasized the use of a combined copd assessment based on exacerbation risk and patient symptoms, and a new classification of gold groups was suggested (http://www.goldcopd.com/). in recent studies, the capacity of this new copd classification for predicting the clinical course of copd has varied.24 as the numbers of copd patients increase with longer life expectancy, more surgeons encounter surgical patients with underlying copd. it is known that copd is an independent risk factor for increased postoperative morbidity, mortality, and length of hospital stay.5 it has been reported previously that such morbidities not only include postoperative pulmonary complications, but also wound dehiscence, sepsis, and cardiac and renal complications. therefore, accurate assessment of the status of copd patients is important for guiding appropriate perioperative management. to the best of our knowledge, the relationship between the copd gold group and postoperative complications has not yet been studied. the aim of this study was to evaluate whether the copd gold group classification is associated with the rate and type of postoperative complications. we reviewed the medical records of copd patients detected by preoperative spirometry at seoul national university hospital, between april 2013 and august 2013. this study was conducted in accordance with the amended declaration of helsinki, and was reviewed by the institutional review board at seoul national university hospital (protocol number h-1403 - 102 - 567, approval date april 22, 2014). during this period, self - administered questionnaires were collected in the pulmonary function test room of the hospital. informed consent requirement was waived due to the retrospective study design, but patient records and information was anonymized and deidentified prior to analysis. questions included those on comorbidities and the level of dyspnea (assessed using the copd assessment test [cat ] and modified medical research scale [mmrc ]). details of the collection of copd diagnostics have been described in our previous report in which we evaluated the prevalence of copd among surgical candidates.6 the data collected included demographic characteristics, comorbidities, spirometry results, operative conditions such as anesthesia time and estimated blood loss (ebl), and type of postoperative complications that occurred. we defined copd as a postbronchodilator fev1/fvc (forced vital capacity) ratio of 0.999 ; table 4). on the basis of multivariate analysis, we observed a significant association between postoperative complications and patients in high - risk group (gold groups c or d ; odds ratio [or ] = 4.023, 95% confidence interval [ci ] = 1.31212.335, p=0.015). in addition, a larger amount of ebl (l) (or = 1.788, 95% ci = 1.0762.972, p=0.025), and longer anesthesia time (hours) (or = 1.445, 95% ci = 1.2051.732, p0.999 ; table 4). on the basis of multivariate analysis, we observed a significant association between postoperative complications and patients in high - risk group (gold groups c or d ; odds ratio [or ] = 4.023, 95% confidence interval [ci ] = 1.31212.335, p=0.015). in addition, a larger amount of ebl (l) (or = 1.788, 95% ci = 1.0762.972, p=0.025), and longer anesthesia time (hours) (or = 1.445, 95% ci = 1.2051.732, p<0.001) were related to postoperative complications (table 5). we analyzed each type of postoperative complications to evaluate if the gold group was significantly associated with any particular one. higher - risk group (gold groups c or d) was significantly associated with postoperative infection (or = 3.755, 95% ci = 1.05313.387, p=0.041) or wound complications (or = 5.883, 95% ci = 1.64221.082, p=0.007) compared to a lower - risk group (gold groups a or b) based on multivariate binary logistic regression analysis. on the other hand, higher - risk group was not significantly associated with postoperative pulmonary complications (or = 1.103, 95% ci = 0.1876.510, p=0.914). upper abdominal surgery and a larger amount of ebl during surgery were related to an increased risk of postoperative pulmonary complications, while lower bmi and larger ebl were related to increased risk of postoperative infection. larger ebl, smoking history, and upper abdominal surgery increased the risk of wound complications in copd patients in high - risk group (table s1). of the 405 copd patients who underwent surgery, 70 patients (17.3%) experienced postoperative complications, similar to those previously reported,5,10,11 high - risk gold groups (gold groups c or d) were significantly associated with postoperative complications, as compared to low - risk gold groups (gold groups a or b). most common postoperative problems included infection, wound, and pulmonary complications. because of the increased life expectancy associated with various comorbidities, surgeons, anesthesiologists, and respiratory physicians need to deal with large numbers of high - risk respiratory patients. copd is considered as an independent risk factor for postoperative mortality and cardiopulmonary complications.12 it is now believed that copd is also a risk factor for various postoperative morbidities, such as stroke, acute kidney injury, ascites, and wound dehiscence, in cardiopulmonary surgery, as well as genitourinary, orthopedic, plastic surgery, and others.5 in this study, the high - risk gold groups (gold groups c or d) and postoperative complications were significantly associated. the level of airflow limitation (fev1% predicted) had a significant influence on postoperative complications ; this was compatible with previous findings that severe airflow limitation leads to increased risk of postoperative respiratory complications after upper abdominal and thoracic surgery.1315 on the other hand, severe dyspnea (gold groups b or d) was not related to postoperative complications. we further analyzed the results based on mmrc and cat scores because classification of the patients could differ depending on the scoring system used (table s2), given that the mmrc is a one - dimensional measurement for quantifying dyspnea only, while the cat score is a multidimensional method that assesses eight categories.16 neither the mmrc nor the cat scores showed a significant relationship between postoperative complications. very few reports are available about the relationship between the level of dyspnea and postoperative complications. a previous study of 269 copd patients undergoing total aortic arch replacement showed that the patient s subjective dyspnea was significantly related to postoperative pulmonary complications.17 however, this report only included aortic arch replacement surgery and related pulmonary complications, which differs from our study. in addition to the high - risk gold groups (gold groups c or d), male sex, lower bmi, underlying malignancy, thoracic and upper abdominal surgery, general anesthesia, longer anesthesia time, and a larger ebl during surgery were also related to an increased risk of postoperative complications. a lower bmi represents a poor nutritional status, which could affect postoperative outcomes.18,19 thoracic and upper abdominal surgeries, longer anesthesia time, and general anesthesia have previously been reported to be related to postoperative complications.12,17,20 anesthetic agents and muscle relaxants, as well as mechanical ventilation during general anesthesia, interfere with the respiratory system and therefore affect postoperative recovery.12 in our study, age was not related to postoperative morbidities. several previous studies have shown advanced age as a risk factor for selected types of complications in limited circumstances.21,22 however, opposite results do exist suggesting that advanced age is not directly related to, or even protective against postoperative events.23,24 the aforementioned studies were based on specific types of surgeries and complications, which lack various postoperative morbidities such as wound dehiscence, renal failure, delirium, and so on. our study focused on a variety of surgery types and postoperative events, which leads to the current result that age has no significant impact on all - cause postoperative complications. high - risk groups (gold groups c or d) were significantly associated with an increased risk of postoperative infection and wound complications. copd patients have lower partial pressure of oxygen in arterial blood than non - copd patients as reported in our previous study.6 such limited oxygen within the healing tissues leads to impaired wound healing, susceptibility to bacterial infections, and dehiscence of surgical anastomosis. this is also exacerbated by the antiproliferative effects of nicotine on red blood cells, fibroblasts, and macrophages in smokers with copd.12,25 decreased oxygen delivery can also delay wound - healing processes such as re - epithelialization as proven in animal studies.26 a previous study of patients undergoing abdominal surgery reported that the major independent risk factors for wound dehiscence include chronic pulmonary disease and postoperative coughing, which can lead to delayed wound healing due to the mechanical movement at the site of surgery.27 to the best of our knowledge, this is the first study evaluating the relationship between the copd gold group and postoperative complications. second, the small number of patients in gold groups c and d affected the statistical power of the comparisons in this study. gold groups a and b comprised 251 and 130 patients each, while gold groups c and d comprised only eleven and 13 patients, respectively. third, study population was outpatient based, with relatively good performance status ; therefore, caution is needed to generalize this result on other populations. in conclusion, 17.3% of copd patients experienced postoperative complications. using the gold definition, high - risk groups (gold groups c or d) were more significantly associated with postoperative complications than low - risk groups (gold groups a or b). while the severity of dyspnea does not show significant correlation with postoperative complications, lower value of fev1 has much influence on increased risk of surgical complications. multivariate analysis of postoperative pulmonary complications, infection, and wound complications adjusted for underlying heart disease, underlying malignancy, upper abdominal surgery, ebl, and general anesthesia ; adjusted for bmi, underlying malignancy, upper abdominal surgery, ebl, and general anesthesia ; adjusted for bmi, underlying malignancy, smoking history, upper abdominal surgery, ebl, and general anesthesia. abbreviations : or, odds ratio ; ci, confidence interval ; bmi, body mass index ; ebl, estimated blood loss. relationship between dyspnea and postoperative complications note : data are presented as numbers (%). | purposechronic obstructive pulmonary disease (copd) is associated with increased postoperative complications. recently, the global initiative for chronic obstructive lung disease (gold) classified copd patients into four groups based on spirometry results and the severity of symptoms. the objective of this study was to evaluate the impact of gold groups on postoperative complications.patients and methodswe reviewed the medical records of copd patients who underwent preoperative spirometry between april and august 2013 at a tertiary hospital in korea. we divided the patients into gold groups according to the results of spirometry and self - administered questionnaires that assessed the symptom severity and exacerbation history. gold groups, demographic characteristics, and operative conditions were analyzed.resultsamong a total of 405 copd patients, 70 (17.3%) patients experienced various postoperative complications, including infection, wound, or pulmonary complications. thoracic surgery, upper abdominal surgery, general anesthesia, large estimated blood loss during surgery, and longer anesthesia time were significant risk factors for postoperative complications. patients in high - risk group (gold groups c or d) had an increased risk of postoperative complications compared to those in low - risk group (gold groups a or b).conclusioncopd patients in gold groups representing a high exacerbation risk have an increased risk of postoperative complications compared to those with low risk. |
the prevalence of diabetes is increasing rapidly worldwide with the influence of expanding economy, abrupt transition of living styles, and social aging. in 2014, there were 387 million people living with diabetes worldwide. the number is predicted to reach 592 million by 2035 of which 46% will still be un - diagnosed. throughout the world, there exists a large amount of diversity with respect to diabetes prevalence, deaths, and health expenditure. according to the 6th edition (2014 update) of the international diabetes federation (idf) diabetes atlas, the western pacific (wp) has the largest population with diabetes (137.8 million), which means that 7.9% of the population in this region has diabetes. the region with the second highest prevelance is southeast asia (sea) with 75.0 million patients (table 1). another fact of spatial distribution is that the prevalence rate of diabetes in developing countries is higher. more than 80% of diabetic patients live in low- and middle - income countries. globally, 90% of diabetic patients have type 2 diabetes, of which 77% live in developing countries [4, 5 ]. in china, the number of diabetes patients in china was 96.3 million, 29.5 million more compared to india, in 2014. the prevalence rate of diabetes had reached 9.3%.table 1regional estimates for diabetes (2079 years old) in 2014idf regionpopulation (millions)number of people with diabetes (millions)comparative diabetes prevalence (%) afr407.921.55.9eur658.752.06.2mena374.536.811.3nac334.938.89.9saca300.524.88.2sea883.275.08.8wp1,613.2137.87.9world4,572.9386.78.2 idf international diabetes federation, afr africa, eur europe, mena middle east and north africa, nac north america and caribbean, saca south and central america, sea southeast asia, wp western pacific regional estimates for diabetes (2079 years old) in 2014 idf international diabetes federation, afr africa, eur europe, mena middle east and north africa, nac north america and caribbean, saca south and central america, sea southeast asia, wp western pacific china carried out five large - scale epidemiological surveys to understand better the prevalence of type 2 diabetes. the prevalence rate of diabetes has been increasing in china from 0.67% in 1980, 2.51% in 19941995, 3.21% in 1996, 3.31% in 2002, and 9.7% in 20072008. according to these survey results, the morbidity rate of type 2 diabetes mellitus accounted for 93.70% of all types of diabetes in china where socioeconomic status seems to have influenced the prevalence rate. the prevalence of pre - diabetes among the rural population (16.6%) is far greater compared to urban (13.6%). in addition, the high mortality of diabetes and related complications is also a huge challenge. the premature mortality of patients with diabetes is mostly attributable to related complications, not uniquely related to the condition. it was recorded in the global burden of disease : 2004 update that 508,000 men and 633,000 women died from direct diabetes - related causes, accounting for 1.6% and 2.3% of all deaths in the world, respectively. the international diabetes federation in 2007 reported diabetes - related deaths to be 6% of total global mortality in the population aged 2079 years. statistics from 2013 assessed 5,096,955 diabetes - related deaths in 2079 year - olds in the world, of which 1,271,003 were recorded in china. the mortality of diabetes is strongly related to age. in patients with type 2 diabetes under 35 years this rate decreases to 59% among 3564 year - olds, and 29% at 64 years or older. given the high prevalence rate and mortality rate, understanding the disease burden of diabetes is the first step when formulating an effective control strategy for governments and international organizations. data from 2013 estimates that worldwide diabetes will contribute $ 548 billion in health expenditures (11% of the total health expenditure) and $ 1,437 per person on treating and managing the disease. the estimated health expenditure was $ 5,621 per person in high - income countries, compared to $ 356 in low- and middle - income countries. in 2013, the usa spent $ 239 billion on diabetes, or 36% of global health expenditure, meanwhile, china spent just $ 38 billion, less than 7% of the global total in the same year. the direct burden deals with health resource consumption, such as drug cost, outpatient cost, inpatient cost, and inspection cost. the indirect burden encompasses monetary losses resulting from opportunity costs caused by death, disability, and incapacitation. the indirect burden also includes the transportation expenses incurred by patients and their families, accommodation expenses, nutrition costs of patients, social productivity losses, income losses, and housework labor force losses (non - market productivity losses). as we know thus, the objective of this study is to synthesize and analyze the costs of type 2 diabetes. it aims to answer two key questions : (1) document economic burden of type 2 diabetes in china. (2) identify main factors affecting the economic burden of type 2 diabetes in china. this is a systematic review study. the main english databases, including pubmed and ebsco, and the chinese databases, including wanfang data, china national knowledge infrastructure (cnki), and the china science and technology journal database, were explored for relevant articles with the following combination of keywords : (diabetes mellitus and type 2) and (cost of illness or illness burden or cost of disease or economic burden of disease). the last search was conducted on june 30, 2013. in the searching, studies considered for this review were english- and chinese - language articles from peer - reviewed publications which focused on the evaluation of the direct economic burden of type 2 diabetes in china and on the comparison between china and other developed countries. inclusion criteria : estimation of the direct and indirect medical cost, hospitalization cost, and outpatient fee for type 2 diabetes patients in china;evaluation of factors influencing direct and indirect medical cost, hospitalization costs, and outpatient fee in china. estimation of the direct and indirect medical cost, hospitalization cost, and outpatient fee for type 2 diabetes patients in china ; evaluation of factors influencing direct and indirect medical cost, hospitalization costs, and outpatient fee in china. exclusion criteria : articles that focused on the effectiveness evaluation of the diabetic drugs were ineligible for this review. a total of 377 original citations were identified that the inclusion and exclusion criteria. after further review and elimination of duplicates, 39 studies (full text) were included for final analysis. this review article is based on previously conducted studies and does not involve any new studies of human or animal subjects performed by any of the authors. the main english databases, including pubmed and ebsco, and the chinese databases, including wanfang data, china national knowledge infrastructure (cnki), and the china science and technology journal database, were explored for relevant articles with the following combination of keywords : (diabetes mellitus and type 2) and (cost of illness or illness burden or cost of disease or economic burden of disease). the last search was conducted on june 30, 2013. in the searching, studies considered for this review were english- and chinese - language articles from peer - reviewed publications which focused on the evaluation of the direct economic burden of type 2 diabetes in china and on the comparison between china and other developed countries. inclusion criteria : estimation of the direct and indirect medical cost, hospitalization cost, and outpatient fee for type 2 diabetes patients in china;evaluation of factors influencing direct and indirect medical cost, hospitalization costs, and outpatient fee in china. estimation of the direct and indirect medical cost, hospitalization cost, and outpatient fee for type 2 diabetes patients in china ; evaluation of factors influencing direct and indirect medical cost, hospitalization costs, and outpatient fee in china. exclusion criteria : articles that focused on the effectiveness evaluation of the diabetic drugs were ineligible for this review. a total of 377 original citations were identified that the inclusion and exclusion criteria. after further review and elimination of duplicates, 39 studies (full text) were included for final analysis. this review article is based on previously conducted studies and does not involve any new studies of human or animal subjects performed by any of the authors. according to table 2, in china, the direct medical cost of type 2 diabetes in proportion to the gross domestic product (gdp) increased gradually year by year. in 1993, it was reported that direct medical cost was $ 0.25 billion, accounting for 0.07% of the gdp. in 2002, a national survey in 11 major cities indicated that the direct medical cost had increased $ 2.27 billion, and the percentage of direct medical cost in the gdp was 0.18%. some studies concluded, after comparing several national surveys, that the average annual growth rate of the direct medical cost of type 2 diabetes was 19.90% which was more than the average annual growth rate of the gdp (12.77%) and the national health expenditure (12.88%) from 1993 to 2003. more alarmingly, when it came to 2008, the direct medical cost already increased to $ 8.65 billion, accounting for 0.21% of the gdp.table 2the medical cost of type 2 diabetes in chinareferencesdataout - patient costin - patient costdirect medical cost (billion dollars)direct medical cost over the gdp (%) shen hongbin 1st national health service survey ; multi - stage cluster random samplingthe annual total outpatient cost was $ 0.22 billion ; the average outpatient expense at a visit was $ 12.41 the annual total in - patient cost was $ 0.03 billion ; the average inpatient expense at a visit was $ 248.97 0.250.07tang ling nationwide survey in 11 major citiesthe average out - patient expense at a visit was $ 31.5670.25 (according to whether or not it has complications)the average in - patient expense at a visit was $ 595.411999.76 (according to whether or not it has complications)2.270.18hu jianping 3rd national health service survey ; multi - stage cluster random samplingthe annual total out - patient cost was $ 1.06 billion the annual total in - patient cost was $ 0.89 billion 2.130.15wang jiansheng 3rd national health service survey ; multi - stage cluster random samplingthe annual total out - patient cost was $ 0.86 billion the annual total in - patient cost was $ 0.44 billion 1.300.10li lina 4th national health service survey ; multi - stage cluster random samplingthe annual total out - patient cost was $ 5.53 billion the annual total in - patient cost was $ 3.13 billion 8.650.21 the medical cost of type 2 diabetes in china the direct medical cost included outpatient cost and inpatient cost (hospitalization cost). referring back to table 2, the annual total outpatient and inpatient costs were $ 0.22 billion and $ 0.03 billion, respectively, in 1993. and in 2008, they had risen to $ 5.53 billion and $ 3.13 billion, respectively. according to a national survey on the economic burden of type 2 diabetes in china from 2007 to 2008, the average outpatient cost per person at a visit was $ 46.22 in urban areas. in rural areas, the average outpatient cost per person at a visit was $ 54.73. the average inpatient cost per person at a visit was $ 2,222.77 in urban areas, $ 1,420.30 more than the normal population. in rural areas, the annual inpatient cost per person at a visit was $ 499.73. although the annul total outpatient cost was more than the total inpatient cost, the average inpatient cost per person at a visit was much more than the average outpatient cost per person at a visit. thus, most studies focusing on the economic burden of diabetes highlight the proportion of hospitalization cost in direct medical cost as the highest. in recent years, the prevalence of type 2 diabetes in china has also risen rapidly, leading to higher hospitalization cost in direct medical cost, from 12.91% in 1993 to 44.74% in 2003. the direct non - medical cost has also been increasing in recent years, including transportation of patients and their families, accommodation expenses, and nutrition costs of patients. the average direct non - medical cost per inpatient in urban and rural areas was $ 0.73 and 0.48, respectively in 1998. by 2003 in 2008, the same cost escalated to $ 2.74 and 2.04 in urban and rural areas, respectively. inpatient average direct non - medical cost per patient in urban areas jumped from $ 81.02 to 96.84 from 1998 to 2008, and from $ 39.18 to 71.74 in rural areas [2426 ]. the direct medical cost accounts for the majority of the economic burden. in recent years, there has been a rapid increase in hospitalization, which has contributed to the high overall direct medical cost. factors influencing hospitalization cost include hospital stay, income level, types of medical insurance, level of hospital, and type and number of complications. hospitalization stay for diabetes patients is two times longer than non - diabetics [27, 28 ], and the length of hospital stay for diabetics has been increasing in the last 5 years. in shangdong province, the hospitalization stay increased from 10.43 days in 2005 to 16.79 days in 2010. according to a national survey on the economic burden of type 2 diabetes in china in 20072008, the hospitalization stay of diabetic patients was double the normal population. patients with high income tend to accept a more expensive and longer - term therapy strategy., patients mainly have four types of medical insurance, including new rural cooperative medical system (ncms), medical insurance for urban workers, medical insurance for urban residents, and out - of - pocket payment. the average hospitalization cost per patient with medical insurance for urban workers ($ 1,094.53) was more than that with medical insurance of urban residents ($ 1,065.50), ncms ($ 558.01), and out - of - pocket payments ($ 609.65) in 20052010. in china, the hospitals are mainly divided into three levels including the tertiary hospital, the secondary hospital, and the primary hospital, based on their function, mission, facility, technology, quality of medical services, and scientific management. comparing the medical expenditure in the three levels of hospital, the higher the level that patients stayed, the more money patients paid. the hospitalization cost increases with the number of complications. of patients with a diagnosis of diabetes, treatment cost of patients with complications shows a linear relationship where cost was 3.36 times higher for patients with complications compared to those without complications. the complications resulting in a severe state of illness thus also increase the frequency of physical examinations and laboratory tests. to deal with these situations better, doctors prescribe use of better drugs or increase the doses for quick relief of associated symptoms, which has led to a difference in hospitalization costs among patients with different conditions. medical expenditure of patients with microvascular or macrovascular disease or with both was higher than for those without, with an increase of 1.46, 1.75, and 2.38 times, respectively. the average hospitalization cost of a patient with diabetic nephropathy was the highest followed by diabetic foot, and then cerebral infarction or cerebral hemorrhage. the average hospitalization cost per patient with diabetic nephropathy (dialysis patients), diabetic nephropathy (non - dialysis patients), and diabetic foot was $ 2,446.6, 1,672.5, and 2,305.5, respectively. according to table 2, in china, the direct medical cost of type 2 diabetes in proportion to the gross domestic product (gdp) increased gradually year by year. in 1993, it was reported that direct medical cost was $ 0.25 billion, accounting for 0.07% of the gdp. in 2002, a national survey in 11 major cities indicated that the direct medical cost had increased $ 2.27 billion, and the percentage of direct medical cost in the gdp was 0.18%. some studies concluded, after comparing several national surveys, that the average annual growth rate of the direct medical cost of type 2 diabetes was 19.90% which was more than the average annual growth rate of the gdp (12.77%) and the national health expenditure (12.88%) from 1993 to 2003. more alarmingly, when it came to 2008, the direct medical cost already increased to $ 8.65 billion, accounting for 0.21% of the gdp.table 2the medical cost of type 2 diabetes in chinareferencesdataout - patient costin - patient costdirect medical cost (billion dollars)direct medical cost over the gdp (%) shen hongbin 1st national health service survey ; multi - stage cluster random samplingthe annual total outpatient cost was $ 0.22 billion ; the average outpatient expense at a visit was $ 12.41 the annual total in - patient cost was $ 0.03 billion ; the average inpatient expense at a visit was $ 248.97 0.250.07tang ling nationwide survey in 11 major citiesthe average out - patient expense at a visit was $ 31.5670.25 (according to whether or not it has complications)the average in - patient expense at a visit was $ 595.411999.76 (according to whether or not it has complications)2.270.18hu jianping 3rd national health service survey ; multi - stage cluster random samplingthe annual total out - patient cost was $ 1.06 billion the annual total in - patient cost was $ 0.89 billion 2.130.15wang jiansheng 3rd national health service survey ; multi - stage cluster random samplingthe annual total out - patient cost was $ 0.86 billion the annual total in - patient cost was $ 0.44 billion 1.300.10li lina 4th national health service survey ; multi - stage cluster random samplingthe annual total out - patient cost was $ 5.53 billion the annual total in - patient cost was $ 3.13 billion 8.650.21 the medical cost of type 2 diabetes in china the direct medical cost included outpatient cost and inpatient cost (hospitalization cost). referring back to table 2, the annual total outpatient and inpatient costs were $ 0.22 billion and $ 0.03 billion, respectively, in 1993. and in 2008, they had risen to $ 5.53 billion and $ 3.13 billion, respectively. according to a national survey on the economic burden of type 2 diabetes in china from 2007 to 2008, the average outpatient cost per person at a visit was $ 46.22 in urban areas. in rural areas, the average outpatient cost per person at a visit was $ 54.73. the average inpatient cost per person at a visit was $ 2,222.77 in urban areas, $ 1,420.30 more than the normal population. in rural areas, the annual inpatient cost per person at a visit was $ 499.73. although the annul total outpatient cost was more than the total inpatient cost, the average inpatient cost per person at a visit was much more than the average outpatient cost per person at a visit. thus, most studies focusing on the economic burden of diabetes highlight the proportion of hospitalization cost in direct medical cost as the highest. in recent years, the prevalence of type 2 diabetes in china has also risen rapidly, leading to higher hospitalization cost in direct medical cost, from 12.91% in 1993 to 44.74% in 2003. the direct non - medical cost has also been increasing in recent years, including transportation of patients and their families, accommodation expenses, and nutrition costs of patients. the average direct non - medical cost per inpatient in urban and rural areas was $ 0.73 and 0.48, respectively in 1998. by 2003, it increased to $ 0.97, for both urban and rural areas. in 2008, the same cost escalated to $ 2.74 and 2.04 in urban and rural areas, respectively. inpatient average direct non - medical cost per patient in urban areas jumped from $ 81.02 to 96.84 from 1998 to 2008, and from $ 39.18 to 71.74 in rural areas [2426 ]. the direct medical cost accounts for the majority of the economic burden. in recent years, there has been a rapid increase in hospitalization, which has contributed to the high overall direct medical cost. factors influencing hospitalization cost include hospital stay, income level, types of medical insurance, level of hospital, and type and number of complications. hospitalization stay for diabetes patients is two times longer than non - diabetics [27, 28 ], and the length of hospital stay for diabetics has been increasing in the last 5 years. in shangdong province, the hospitalization stay increased from 10.43 days in 2005 to 16.79 days in 2010. this increase leads to an increase in hospitalization expenditure. according to a national survey on the economic burden of type 2 diabetes in china in 20072008, patients with high income tend to accept a more expensive and longer - term therapy strategy., patients mainly have four types of medical insurance, including new rural cooperative medical system (ncms), medical insurance for urban workers, medical insurance for urban residents, and out - of - pocket payment. the average hospitalization cost per patient with medical insurance for urban workers ($ 1,094.53) was more than that with medical insurance of urban residents ($ 1,065.50), ncms ($ 558.01), and out - of - pocket payments ($ 609.65) in 20052010. the level of hospital also had an important influence on hospitalization costs. in china, the hospitals are mainly divided into three levels including the tertiary hospital, the secondary hospital, and the primary hospital, based on their function, mission, facility, technology, quality of medical services, and scientific management. comparing the medical expenditure in the three levels of hospital, the higher the level that patients stayed, the more money patients paid. the hospitalization cost increases with the number of complications. of patients with a diagnosis of diabetes, treatment cost of patients with complications shows a linear relationship where cost was 3.36 times higher for patients with complications compared to those without complications. the complications resulting in a severe state of illness thus also increase the frequency of physical examinations and laboratory tests. to deal with these situations better, doctors prescribe use of better drugs or increase the doses for quick relief of associated symptoms, which has led to a difference in hospitalization costs among patients with different conditions. medical expenditure of patients with microvascular or macrovascular disease or with both was higher than for those without, with an increase of 1.46, 1.75, and 2.38 times, respectively. the average hospitalization cost of a patient with diabetic nephropathy was the highest followed by diabetic foot, and then cerebral infarction or cerebral hemorrhage. the average hospitalization cost per patient with diabetic nephropathy (dialysis patients), diabetic nephropathy (non - dialysis patients), and diabetic foot was $ 2,446.6, 1,672.5, and 2,305.5, respectively. most of them are 4060 years old, and the prevalence rate increases gradually after 40 years old. the direct economic burden of type 2 diabetes is increasing over time, with the yearly increment affecting the direct medical costs to gdp ratio. the average annual growth rate of the direct medical cost of type 2 diabetes is proportionately more than the average annual growth rate of the gdp and the national health expenditure. the direct medical cost of diabetes in china has approached, or in some instances even exceeded, some developed countries. thus, we focused on the direct economic burden of type 2 diabetes. as was mentioned above, hospitalization cost plays a decisive role in direct medical costs. the factors affecting hospitalization cost are income level, type of medical insurance, level of hospital, and related complications. but the relationship between the hospitalization cost and the hospital level needed a further explanation. the tertiary hospitals provide high - level specialist medical services, teaching and research. the secondary one has a full complement of services including pediatrics, obstetrics, general medicine, gynecology, and various branches of surgery and psychiatry. the high level hospitals often charge more for examination services and drugs than the low level hospitals. in addition, based on the essential drug system, the doctors in different level hospitals had different prescription privileges in china. the doctor in primary hospitals can just prescribe limited drugs which were included in the essential drug list. it is known that drugs are the main form of treatment for controlling blood glucose and glycosylated hemoglobin and is a significant contributor of costs for diabetes and related causes. because of the economic growth and more purchasing power, patients are willing to choose more expensive medications primarily because they think the price of the drug is associated with its effectiveness. changes in living environment and corresponding lifestyle are major reasons for the increase in prevalence of type 2 diabetes patients. more and more people tend to enjoy unhealthy foods and with reduced engagement in physical activities ; most people are subjected to regular intake of high - calorie, high - fat, and high - protein foods. incorporating measures related to health education can help reduce the prevalence of diabetes. designing and implementing cost - effective diagnosis and treatment tools can help to deal with hospitalization and drug costs better. type 2 diabetes is presently a major contributor of overall health care cost mainly due to poor knowledge about the disease among populations and the time difference between the onset of disease and treatment. the sooner the disease can be diagnosed, the less expensive the treatment and the cost for associated complications, which will further result in efficiency in providing simpler treatments, thus reducing the overall cost [41, 42 ]. therefore, the methods for early screening, early diagnosis, and early treatment are necessary for follow - up, management, and monitoring in communities. in this study, we mainly focus on the direct costs related to diabetes, but not the indirect costs because literature is lacking. in addition, diabetes can also result in big disease burdens for people in the form of disability - adjusted life years (dalys), thus both indirect economic burden and disease burden need further study. the direct medical burden of type 2 diabetes is a grave economic problem in china. measures need to be taken to reduce prevalence rate, hospitalization cost, and drug cost in order to reduce the resulting economic burden. because of the higher economic burden associated with rural areas of china, more rigorous interventions should be considered in these areas. huimei hu, monika sawhney, lizheng shi, shengnanduan, yunxian yu, zhihong wu, guixingqiu, hengjin dong declare they have no conflict of interest. this review is based on previously conducted studies, and does not involve any new studies of human or animal subjects performed by any of the authors. this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited. | backgroundtype 2 diabetes is associated with acute and chronic complications and poses a large economic, social, and medical burden on patients and their families as well as society.objectivethis study aims to evaluate the direct economic burden of type 2 diabetes in china. data source : systematic review on cost of illness, health care costs, direct service costs, drug costs, and health expenditures in relation to type 2 diabetes was conducted up to 2014 using databases such as pubmed ; ebsco ; elsevier sciencedirect, web of science ; and a series of chinese databases, including wanfang data, china national knowledge infrastructure (cnki), and the china science and technology journal database. factors influencing hospitalization and drug fees were also identified. study eligibility criteria : (1) estimation of the direct economic burden including hospitalization and outpatient cost of type 2 diabetes patients in china ; (2) evaluation of the factors influencing the direct economic burden. articles only focusing on the cost - effectiveness analysis of diabetes drugs were excluded.resultsthe direct economic burden of type 2 diabetes has increased over time in china, and in 2008, the direct medical cost reached $ 9.1 billion, both outpatient and inpatient costs have increased. income level, type of medical insurance, the level of hospital care, and type and number of complications are primary factors influencing diabetes related hospitalization costs. compared to urban areas, the direct non - medical cost of type 2 diabetes in rural areas is significantly greater.conclusionsthe direct economic burden of type 2 diabetes poses a significant challenge to china. to address the economic burden associated with type 2 diabetes, measures need to be taken to reduce prevalence rate and severity of diabetes and hospitalization cost. |
eccrine angiomatous hamartoma (eah) is a benign enlargement of eccrine components, accompanied by abundance of vascular channels. the anomaly is usually asymptomatic, but pain, hypertrichosis, and hyperhidrosis have been reported in a few patients. a 26-year - old female presented with a 2.5 cm 1.5 cm blue - colored, ill - defined swelling over the dorsum of her left hand near the last intertriginous space encroaching over the ring finger. the surface was irregular in texture and she could demonstrate small beads of perspiration on patting the lesion [figure 1 ]. this swelling was present for the last 2 years and she had sought medical aid as it was painful to touch. the adjoining skin over the 3 metacarpophalangeal joint and proximal interphalangeal joint of the 3 finger showed a skin - colored swelling and it represented an area of similar tumor which had grown slowly since birth. a 4 mm punch biopsy was performed and the histopathology revealed lobulated, unencapsulated structure composed of mature, numerous eccrine glands enmeshed in loose connective tissue [figure 2 ]. blood vessels could not be demonstrated with the eccrine coils in the specimen [figure 3 ]. beads of perspiration on eccrine angiomatous hamartoma lobulated structures in the dermis showing eccrine glands (h and e, 100) plentiful eccrine coils without blood vessels (h and e, 400) such angioma was first described by lotzbeck in 1859 and termed as eah by hymann and colleagues in 1968. clinically, the lesion presents as solitary, bluish, or skin - colored nodules or plaques usually over the extremities as trauma may be an inciting factor. numerous lesions in the same individual can be the result of mosaicism of a gene mutation occurring in the early developmental stage. the tumor is painless, but involvement of nerve fibers by the enlarging eccrine elements can result in tenderness. sudoriparous angiomas, as they are also known as, can display increased eccrine sweat production on exercise or when lightly stroked. it has been suggested that as yet an unclear chemical interaction between the differentiating epithelium and the mesenchyme leads to the abnormal proliferation of eccrine structures. the tumor has to be differentiated from other structures like tufted angiomas, capillary hemangiomas, smooth muscle hamartomas, and dermatofibromas. dilatation of eccrine coils is a constant feature with amplification in their numbers, but associated enlargement of vascular channels may not be present. this modification has been termed apart from closely entwined pilar structures and infiltration of adipose tissue, profuse deposition of mucin in the connective tissue has been detailed in the literature. carcinoembryonic antigen (cea) and s-100 protein, which are commonly found in the eccrine sweat apparatus, are found to be diminished. simple surgical procedures like excision have produced excellent results where it was sought for pain or for cosmetic reasons. associations of such eccrine hamartomas are not common. a case with cowden 's syndrome, who had developed a thyroid adenoma, and another with neurofibromatosis are the only two such reports. eah are rare malformations presenting diverse clinical and histological deviations which need differentiation from other complex tumors. they carry a good prognosis and treatment is simple, often providing complete gratification for the sufferer. | hamartomatous, circumscribed swellings of the extremities make an interesting study. presentations are manifold and the naevi are not always present from birth. excessive growth of hairs leads to remarkable appearance of such swellings. a young woman presented to the dermatology department, complaining of tenderness over 4th finger of her left hand. the defect was present for the last couple of years and was typified by visible hyperhidrosis on gentle tapping. counseling of the affected lady made her agree for a skin biopsy. the histopathology revealed it to be of the nature of eccrine angiomatous hamartoma. blood vessels were scarce. eccrine ducts were plentiful without other associated anomalies. the deformity was removed by simple excision with good result. |
more time is required for extraction cases, such as for adult patients, which is a great concern and poses high risk of caries, external root resorption. thus, accelerating orthodontic tooth movement and the resulting shortening of the treatment duration would be beneficial. many researchers have utilized different biochemical methods involving medications to improve the speed and quality of orthodontic treatment, but the systemic influence on the body 's metabolism makes this difficult to apply in orthodontics. recently, investigators have begun studying local techniques for stimulating better orthodontic tooth movement. surgically aided rapid tooth movement has become one of the novel techniques for accelerating canine retraction. for premolar extraction cases, biologic tooth movement can be achievedwith conventional orthodontic treatment techniques, but the canine retraction phase usually lasts for 6 to 8 months. extraoral or intraoral anchorage mechanics are required to maintain the space obtained during canine distalization, particularly when maximum anchorage is required. to date, several novel surgical modalities and techniques for rapid canine retraction have been reported to accelerate canine distalization. these attempts fall mainly into two categories : the first, dentoalveolar distraction osteogenesis, evolved from distraction osteogenesis. osteotomies surrounding the canines are created to achieve rapid movement of the canines in the dentoalveolar segment, in compliance with the principles of distraction osteogenesis. the second technique is periodontal distraction aided by surgical undermining of the interseptal bone. nevertheless, the question remains regarding which of the above techniques is more effective for rapid canine retraction. until now, these research modalities and techniques for accelerating canine retraction have been applied in animal experiments and clinical case reports. after the application of an inappropriate external force to the oral environment, the development of a stress field in the supporting tissues typically leads to an unsuccessful outcome. finite element analysis has become a powerful tool for dental biomechanical research due to its increased availability, capacity, and ease of use of computer software in biologic modeling. what is the status of stress in the maxillary teeth, the periodontal ligament (pdl), and alveolar bone during rapid canine retraction ? how does the biomechanics differ between dentoalveolar distraction osteogenesis and periodontal distraction aided by surgical undermining of the interseptal bone ? will it produce side - effects in addition to tooth movement ? to address these questions via the finite element (fe) method, in this study we constructed a three - dimensional (3d) finite element model of the maxillary teeth, the periodontal ligament (pdl), and alveolar bone after extracting the first premolars. for better simulation of the movement of canine retraction during orthodontic treatment with different auxiliary surgical methods, a patient with bimaxillary protrusion was selected from the orthodontic department of first affiliated hospital of xinjiang medical university. after the maxillary teeth were aligned and leveled by means of an invisible aligner, images of the patient 's teeth and alveolar bone were obtained in a dicom (digital imaging and communication in medicine) data format via 64-slice (a slice thickness of 0.5 mm) spiral computed tomography (ct). the geometric shapes of the maxillary teeth and alveolar bone (cancellous and cortical bone) were reconstructed by mimics (version 15.0 ; materialise, leuven, belgium), then exported to geomagic studio (2013, raindrop inc., rock hill, south carolina, u.s.a.), and modified by unigraphics nx (version 8.5, siemens, mnich, germany). the initial 3d finite element model of the maxilla and the maxillary teeth was established with 416,931 nodes and 227,784 solid elements (figure 1), and analyzed by ansys workbench (version 13.0 ; ansys inc., canonsburg, pennsylvania, u.s.a.). the initial 3d finite element model of the maxilla and the maxillary teeth although periodontal ligament thicknesses differ according to age, position, and individual variations, the thickness of the periodontal ligament was considered to be consistently 0.25 mm. the 3d finite element models of the alveolar bone were fabricated to fit the teeth and the periodontal ligament, and the thickness of cortical bone was considered to be 2 mm. in this study, we defined the non - surgically - aided canine retraction model as model 1. the numbers of nodes and elements of the initial model are shown in figure 2. according to the two types of auxiliary surgical methods for accelerating canine retraction, we simulated the same surgical process in the initial 3d finite element model, and two 3d fems were generated based on the two different surgeries for comparison with the initial model (model 1). pdl = periodontal ligament we defined the fem of periodontal distraction aided by surgical undermining of the interseptal bone as model 2 (pd). after the first premolar was removed, the interseptal bone mesial to the extraction socket was undermined. the bone in the premolar socket was eliminated vertically along the buccal and lingual sides, extending obliquely toward the base of the interseptal bone to weaken resistance. the interseptal bone was not cut through mesio - distally toward the canine (figure 3). the depth of the undermining grooves was dependent on the thickness of the interseptal bone. note depths and positions of undermining grooves the final model (model 3) was the fem model of dentoalveolar distraction osteogenesis (ddo). the first premolar was extracted, and the buccal cortical bone of the extraction socket was removed. an osteotomy line was determined between the buccal root apex of the first premolar and canine apex (figure 4).the root of the upper canine tooth was outlined mesially and distally, with the dentoalveolar segment to be used as a transport disc at the apical region. the cortical bone, especially at the level of the apical region, was also eliminated for maximal bodily movement during distraction. surgical techniques for dentoalveolar distraction osteogenesis the mechanical properties of the teeth, pdl, and cortical and cancellous bone were defined as isotropic, homogenous, and linearly elastic. young 's modulus and poisson 's ratio for all materials were calculated according to previously described methods (figure 5). pdl = periodontal ligament the coordinate system and directions of forces and loads are shown in figure 6. a simulated retraction force of 1.5 n (approximately 150 g) was loaded bilaterally to the center of the crown between the first molar and the canine, and stress distribution and its magnitude were analyzed by ansys workbench, a 3d finite element analysis program. an assessment of the stress on the bone elements was performed by von mises equivalent stress and maximum shear stress, and we used the total deformation value to assess the initial displacement of the teeth and the pdl. a mesiodistal simulated retraction force of 1.5 n was loaded bilaterally to the center of the crown between the first molar and the canine for better simulation of the movement of canine retraction during orthodontic treatment with different auxiliary surgical methods, a patient with bimaxillary protrusion was selected from the orthodontic department of first affiliated hospital of xinjiang medical university. after the maxillary teeth were aligned and leveled by means of an invisible aligner, images of the patient 's teeth and alveolar bone were obtained in a dicom (digital imaging and communication in medicine) data format via 64-slice (a slice thickness of 0.5 mm) spiral computed tomography (ct). the geometric shapes of the maxillary teeth and alveolar bone (cancellous and cortical bone) were reconstructed by mimics (version 15.0 ; materialise, leuven, belgium), then exported to geomagic studio (2013, raindrop inc., rock hill, south carolina, u.s.a.), and modified by unigraphics nx (version 8.5, siemens, mnich, germany). the initial 3d finite element model of the maxilla and the maxillary teeth was established with 416,931 nodes and 227,784 solid elements (figure 1), and analyzed by ansys workbench (version 13.0 ; ansys inc., canonsburg, pennsylvania, u.s.a.). the initial 3d finite element model of the maxilla and the maxillary teeth although periodontal ligament thicknesses differ according to age, position, and individual variations, the thickness of the periodontal ligament was considered to be consistently 0.25 mm. the 3d finite element models of the alveolar bone were fabricated to fit the teeth and the periodontal ligament, and the thickness of cortical bone was considered to be 2 mm. in this study, we defined the non - surgically - aided canine retraction model as model 1. the numbers of nodes and elements of the initial model are shown in figure 2. according to the two types of auxiliary surgical methods for accelerating canine retraction, we simulated the same surgical process in the initial 3d finite element model, and two 3d fems were generated based on the two different surgeries for comparison with the initial model (model 1). pdl = periodontal ligament we defined the fem of periodontal distraction aided by surgical undermining of the interseptal bone as model 2 (pd). after the first premolar was removed, the interseptal bone mesial to the extraction socket was undermined. the bone in the premolar socket was eliminated vertically along the buccal and lingual sides, extending obliquely toward the base of the interseptal bone to weaken resistance. the interseptal bone was not cut through mesio - distally toward the canine (figure 3). the depth of the undermining grooves was dependent on the thickness of the interseptal bone. note depths and positions of undermining grooves the final model (model 3) was the fem model of dentoalveolar distraction osteogenesis (ddo). the first premolar was extracted, and the buccal cortical bone of the extraction socket was removed. an osteotomy line was determined between the buccal root apex of the first premolar and canine apex (figure 4).the root of the upper canine tooth was outlined mesially and distally, with the dentoalveolar segment to be used as a transport disc at the apical region. the cortical bone, especially at the level of the apical region, was also eliminated for maximal bodily movement during distraction. the mechanical properties of the teeth, pdl, and cortical and cancellous bone were defined as isotropic, homogenous, and linearly elastic. young 's modulus and poisson 's ratio for all materials were calculated according to previously described methods (figure 5). a simulated retraction force of 1.5 n (approximately 150 g) was loaded bilaterally to the center of the crown between the first molar and the canine, and stress distribution and its magnitude were analyzed by ansys workbench, a 3d finite element analysis program. an assessment of the stress on the bone elements was performed by von mises equivalent stress and maximum shear stress, and we used the total deformation value to assess the initial displacement of the teeth and the pdl. the coordinate system. a mesiodistal simulated retraction force of 1.5 n was loaded bilaterally to the center of the crown between the first molar and the canine immediately after loading of the retraction forces of 1.5 n (approximately 150 g) bilaterally between the crown of the first molar and the canine, the initial displacement of the canine was highly concentrated in the distal area of the crown in all three models. compared with the total deformation of the canine in model 1 (non - surgical) and model 3 (ddo), the canine in model 2 had the maximum value of total deformation of 1.9812 mm (table 1, figure 7). total deformation values induced in three models pd = periodontal distraction ; pdl= periodontal ligament ddo = dentoalveolar distraction osteogenesis total deformation values induced in different parts of three models. pdl= periodontal ligament compared with the maximum value of equivalent (von mises) stress on the canine in models 1 and 3 (ddo), the canine in model 2 (pd) had the lowest equivalent (von mises) stress value of 0.35494 mpa (table 2, figure 8). likewise, compared with model 1 (non - surgical) and model 3 (ddo), the value of maximum shear stress of the canine in model 2 (pd) was the lowest (table 3). equivalent (von mises) stress values induced in three models pd = periodontal distraction ; pdl= periodontal ligament ddo = dentoalveolar distraction osteogenesis equivalent (von mises) stress values induced in different parts of three models. pdl= periodontal ligament maximum shear stress values induced in three models pd = periodontal distraction ; pdl= periodontal ligament ddo = dentoalveolar distraction osteogenesis as the anchor tooth, the value of total deformation on the first molar in model 2 was 0.12674 mm, which is the lowest in comparison with that of the molar in model 1 (non - surgical) and model 3 (ddo) (table 1). distribution of maximum equivalent (von mises) stress on the root and in the pdl of the first molar in all three models was concentrated in the root furcation of the molar, and the value of maximum equivalent (von mises) stress of the first molar in model 2 (pd) was the lowest (table 2). the value and distribution of maximum shear stress on the root and in the pdl of the first molar in all three models showed the same tendency as the maximum equivalent (von mises) stress, although the values differed. compared with cancellous bone, the buccal side of cortical bone around the canine root was the most stressed area. the value of maximum equivalent (von mises) stress on the cortical bone around the canine root in model 2 (pd) and model 3 (ddo) was lower than that in model 1 (non - surgical) (table 2). the value of maximum shear stress on the buccal side of cortical bone around the canine root in model 2 (pd) was the lowest (table 3). immediately after loading of the retraction forces of 1.5 n (approximately 150 g) bilaterally between the crown of the first molar and the canine, the initial displacement of the canine was highly concentrated in the distal area of the crown in all three models. compared with the total deformation of the canine in model 1 (non - surgical) and model 3 (ddo), the canine in model 2 had the maximum value of total deformation of 1.9812 mm (table 1, figure 7). total deformation values induced in three models pd = periodontal distraction ; pdl= periodontal ligament ddo = dentoalveolar distraction osteogenesis total deformation values induced in different parts of three models. pdl= periodontal ligament compared with the maximum value of equivalent (von mises) stress on the canine in models 1 and 3 (ddo), the canine in model 2 (pd) had the lowest equivalent (von mises) stress value of 0.35494 mpa (table 2, figure 8). likewise, compared with model 1 (non - surgical) and model 3 (ddo), the value of maximum shear stress of the canine in model 2 (pd) was the lowest (table 3). equivalent (von mises) stress values induced in three models pd = periodontal distraction ; pdl= periodontal ligament ddo = dentoalveolar distraction osteogenesis equivalent (von mises) stress values induced in different parts of three models. pdl= periodontal ligament maximum shear stress values induced in three models pd = periodontal distraction ; pdl= periodontal ligament ddo = dentoalveolar distraction osteogenesis as the anchor tooth, the value of total deformation on the first molar in model 2 was 0.12674 mm, which is the lowest in comparison with that of the molar in model 1 (non - surgical) and model 3 (ddo) (table 1). distribution of maximum equivalent (von mises) stress on the root and in the pdl of the first molar in all three models was concentrated in the root furcation of the molar, and the value of maximum equivalent (von mises) stress of the first molar in model 2 (pd) was the lowest (table 2). the value and distribution of maximum shear stress on the root and in the pdl of the first molar in all three models showed the same tendency as the maximum equivalent (von mises) stress, although the values differed. compared with cancellous bone, the buccal side of cortical bone around the canine root was the most stressed area. the value of maximum equivalent (von mises) stress on the cortical bone around the canine root in model 2 (pd) and model 3 (ddo) was lower than that in model 1 (non - surgical) (table 2). the value of maximum shear stress on the buccal side of cortical bone around the canine root in model 2 (pd) was the lowest (table 3). in this study, orthodontic force was applied to three fems which simulated two different surgical interventions and conventional treatment for canine retraction. stress distribution and deformation on the root, pdl, and cortical bone were evaluated. the stress patterns in the pdl, root, and bone were displayed in separate illustrations, so that the complex responses of these tissues to different types of surgical interventions could be readily compared. the forces were applied to the surfaces of the teeth, mesio - distally, as in normal clinical practice. the results of this study, which showed stress distribution along the root, pdl, and alveolar bone, provided insight into clinical observations. orthodontic tooth movement is a biological process characterized by sequential reactions of periodontal tissue against a biomechanical force system. it is also a process in which the application of a mechanical force induces alveolar bone resorption on the pressure side and alveolar bone deposition on the tension side. the orthodontic force system is a complicated three - dimensional system which is difficult to evaluate in clinical conditions and orthodontic force plays an important role in the entire biomechanical process during tooth movement. in our study, it was found that the effects of force application would be changed when the force - loading environment was changed. for accelerating canine retraction speed, periodontal tissue, especially hard tissue such as alveolar bone around the canine, is the most important source of resistance. compared with the conventional method of canine retraction, we found that ddo (dentoalveolar distraction osteogenesis) and pd (periodontal distraction aided by surgical undermining of the interseptal bone) could reduce resistance during canine retraction in this finite element analysis. this finding was consistent with those of previous clinical reportsand animal experimentswith rapid orthodontic tooth movement. compared with ddo, it was noteworthy, from the mechanical analysis in this study, that pd had more advantages in reducing resistance and accelerating canine movement. it also showed that the stress along the distal side of the canine root was reduced more significantly in model 2 (pd) (figures 8, 9), with more obvious canine displacement than in model 3 (ddo) (figure 7). the main pathway of canine movement was via the cancellous bone and the interseptal bone, since the main portion of cancellous bone in the pathway of canine distalization was removed by pd. as a result, it is more effective to accelerate canine retraction through periodontal distraction aided by surgical undermining of the interseptal bone. pdl= periodontal ligament on the basis of previous studies, resistance to tooth movement is increased when the roots are torqued lingually or buccally. this principle was used by rickets (1979) and is called cortical anchorage. generally, cortical bone offers more resistance to resorption. the cortical bone could also block tooth movement in most cases in orthodontic treatment. in this study, we observed the distribution of stress on the buccal side of cortical bone around the canine root, which implied that the cortical bone on the buccal side of the canine was also the source of resistance to canine movement. that explained the principle of surgical procedures for ddo, which was designed with the dentoalveolus as a bone transport segment for posterior movement. however, based on our results, pd was more effective in canine retraction. furthermore, in clinical applications, the interseptal bone distal to the canine was undermined to weaken its resistance immediately after dental extraction, and a tooth - borne appliance was used for rapid tooth retraction. in addition to proper orthodontic force, the center of resistance (cr) of a tooth is also a critical factor in predicting and planning the esthetic movement of anterior teeth. ideally, force should be applied as closely as possible to the cr of a tooth, to achieve movement of the tooth in orthodontic treatment. although we can not apply the force on the cr, we could change the conditions around the cr. the concentration point of stress on the pressure side of the canine root tended to move closely to the crown after surgical undermining of the interseptal bone in the pd model. in that case, the canine cr became closer to the crown through resistance - reducing surgery, especially in the pd model, and this would lead to possible canine body movement. otherwise, the lowest maximum equivalent (von mises) stress value on the distal side of the root surface in model 2 (pd) implied that reducing the resistance around the canine cr in that model would reduce the stress value. the lower and more uniform stress on the root indicated that translational tooth movement may be achieved, which made it more effective in accelerating canine retraction speed. however, it should be pointed out that the concentrated point of force loading at the distal side of the canine cervix for the pdl and alveolar bone shifted to the lingual side in the pd model, and, conversely, in the ddo model, this point shifted to the buccal side. this indicated to us that the canine had a tendency to rotate lingually in the pd model and buccally in the ddo model after resistance was reduced. the reason for this might be that after the different positions of resistance source were reduced by surgery, the canine would move to the position with the lowest resistance. therefore, we should avoid this side - effect when using pd or ddo during orthodontic treatment. an obvious strategy for anchorage control would be to concentrate the force needed to produce tooth movement where it was desired, and then to dissipate the retraction force in the pdl of anchor teeth as much as possible. in this study, the value of maximum equivalent (von mises) stress in the pdl of the first molar in two models was surgical reduction of resistance to a level lower than in the canine. further, the value of total deformation of the first molar in the ddo and pd models was far below that of the canine at the initial stage of force loading. this indicated that reducing resistance by ddo or pd to accelerate canine retraction was a safe way to protect anchorage and would not reduce anchorage during canine retraction. furthermore, the pattern of force distribution in the pdl and root of the first molar showed that high stress concentration is observed on the root surface at the furcation level, which is in contrast to the canine, which displayed a greater apical concentration. this may explain the high incidence of apical root resorptionthat appears to occur in the maxillary molar on the root surface at the furcation level, which is difficult to see radiographically in orthodontic treatment. this study and others have demonstrated that fem provides a solid, workable foundation for modeling a system of orthodontic tooth movement. the chief advantage of fem is that it can be magnified nearly infinitely, in terms of both the actual volumetric construction itself and the mathematical variability of its material parameters. however, as with any theoretical model of a biological system, there are limitations. the mechanical behavior of the materials was assumed to be linear elastic (homogeneous and isotropic), and the value of each material was inferred from previous reports. cortical bone thickness and cancellous bone quality were not incorporated into the analysis, to prevent bone stress from being dominated by bone quality and potentially confounding the outcomes related to other relevant factors. in addition, the stress analysis of soft tissues was not considered in this study. the soft tissues, such as gingival and facial muscles, are also sources of resistance for blocking rapid tooth movement. regardless of these limitations, we integrated a finite element approach with variable analysis to investigate the comparative influences of resistance source, the pathway of canine movement, and different types of surgeries for rapid canine retraction by reducing resistance. in this study, compared with dento - alveolar distraction osteogenesis, periodontal distraction aided by surgical undermining of the interseptal bone would reduce the resistance in the pathway of canine movement more effectively to accelerate canine retraction speed in rapid canine movement during orthodontic treatment. the results indicated that rapid canine retraction aided by the surgical reduction of resistance might create side effect : 1) it might lead to canine rotation during distalization, 2) the geometry of the root of maxillary first molar makes it less prone to apical stress concentration, therefore, resorption on the root surface at the furcation level of the molars is more easily caused. | objectivethe aims of this study were to compare different surgical approaches to rapid canine retraction by designing and selecting the most effective method of reducing resistance by a three - dimensional finite element analysis. material and methodsthree - dimensional finite element models of different approaches to rapid canine retraction by reducing resistance and distraction were established, including maxillary teeth, periodontal ligament, and alveolar. the models were designed to dissect the periodontal ligament, root, and alveolar separately. a 1.5 n force vector was loaded bilaterally to the center of the crown between first molar and canine, to retract the canine distally. the value of total deformation was used to assess the initial displacement of the canine and molar at the beginning of force loading. stress intensity and force distribution were analyzed and evaluated by ansys 13.0 through comparison of equivalent (von mises) stress and maximum shear stress. resultsthe maximum value of total deformation with the three kinds of models occurred in the distal part of the canine crown and gradually reduced from the crown to the apex of the canine ; compared with the canines in model 3 and model 1, the canine in model 2 had the maximum value of displacement, up to 1.9812 mm. the lowest equivalent (von mises) stress and the lowest maximum shear stress were concentrated mainly on the distal side of the canine root in model 2. the distribution of equivalent (von mises) stress and maximum shear stress on the pdl of the canine in the three models was highly concentrated on the distal edge of the canine cervix.conclusionsremoval of the bone in the pathway of canine retraction results in low stress intensity for canine movement. periodontal distraction aided by surgical undermining of the interseptal bone would reduce resistance and effectively accelerate the speed of canine retraction. |
the burgeoning atrial fibrillation (af) epidemic which currently affects over five million americans is expected to reach a prevalence of nearly 16 million in the united states by 2050. another established public health problem with far reaching health consequences is obesity, which has been identified as an independent risk factor for af. together, these two global diseases significantly impact cardiovascular outcomes, and pose an immense economic burden. as a result, a significant amount of research has been conducted to elucidate the association between obesity and af. three prior studies inform the design of the legacy study [long - term effect of goal - directed weight management in an atrial fibrillation cohort : a long - term follow - up study ] to a large extent. in the women 's health study, with a follow - up duration of nearly 13 years additionally, the authors also found that dynamic changes in body - mass index were associated with short - term increased risk of af. to further investigate the causal relationship between obesity and af, authors at the centre for heart rhythm disorders (chrd) at the university of adelaide in australia conducted a randomized controlled study where patients were randomized to weight management vs. general lifestyle advice and found that patients in the weight management group had significantly greater weight loss (wl) and lower af symptom burden using the atrial fibrillation severity scale (afss) instrument after follow - up of approximately 15 months. the chrd investigators further studied the impact of risk factor management, including wl, in a cohort of obese af patients undergoing catheter ablation. the arrest - af study [aggressive risk factor reduction study for atrial fibrillation ] concluded that patients receiving risk factor management (n = 61) fared much better than patients in the control group (n = 88) in terms of wl, blood pressure control, glycemic control, lipid profile as well af symptom burden (using the afss instrument). in the legacy study, authors from the chrd sought to further characterize the benefit of aggressive weight management in af patients. specifically, they studied the impact of long - term wl and wf on rhythm control in obese patients with af. the legacy study, conducted by pathak., was a prospective cohort study that consisted of obese patients (body mass index 27 kg / m) who were consecutively referred to the chrd with symptomatic af (paroxysmal or persistent). patients were excluded based on pre - defined criteria (n = 293) or if they lived out of state (n = 177), and the remaining 355 patients were included in the analysis. additionally, everyone was given the option of participating in a physician - led dedicated weight management program. irrespective of the type of weight management strategy, the initial goal for everyone was to reduce weight by 10%. the next goal was to achieve a body mass index of 25 kg / m with maintenance of wl. for the purposes of analyses, the authors categorized wl into 3 groups group 1 (10% wl), group 2 (39% wl) and group 3 (5%), average (2 5%) or stable (5% wf maintained rhythm control, which was much lower than the percentage of patients maintaining rhythm control in the 2 - 5% wf (59%) and those with 5% wf is poor and on par with those who gained weight (44.2% and 38% respectively). this observational study is an important contribution to the growing body of literature on the influence of wl on af burden and rhythm control in obese patients. the strengths of the study include its meticulous design and standardized data collection over a five - year period. however, it is important to note that despite the detailed study design, it is still a small, observational study consisting of 355 patients which limits generalizability. additionally, the study findings need to be interpreted in the context of the known biases and confounding which limit all observational data. despite the fact that the 3 groups appeared to have similar baseline characteristics, confounding remains an issue in this study. it is important to note that the wl goals for all people attending the chrd was > 10% reduction in body weight, followed by the next target of achieving a body mass index 25 kg / m, irrespective of enrollment in the weight management clinic. therefore, the 3 wl groups (10% wl, 39% wl and 3%), then they received very - low - calorie meal replacement sachets (12 times / day). participants were also asked to exercise (starting with low intensity exercise for 20 minutes three times a day which was increased to moderate intensity exercise 200 minutes weekly). in addition, all participants were also asked to maintain a journal to record daily food intake, exercise duration, weight and blood pressure. for patients attending the wl clinic, all other risk factors such as hypertension, diabetes, dyslipidemia, sleep - disordered breathing, tobacco and alcohol use were managed according to acc / aha guidelines every 3 months. in reality, global risk factor management may have been the element of the weight management clinic that truly impacted af - related primary and secondary outcomes. the weight management clinic is the real success behind the stunning findings from the legacy study. it is easy to envision the heightened level of care that patients attending the wl clinic received, which is much more attention than real world patients receive. not only did they receive motivation and guidance for wl, they also received counseling regarding most other risk factors for af, which ultimately translated to better clinical outcomes in the long - term. this is akin to the dramatic benefits of a cardiac rehabilitation program in post - myocardial infarction patients. benefits accrue from the exercise programs as well the ancillary support such as pharmacy counseling, lifestyle counseling, nutritional counseling, emotional support etc. therefore, the weight management clinic offers a holistic approach to disease management, rather than isolated wl. the take - home point of the legacy study is that a concerted effort at risk factor management (including obesity management) is vital for achieving better outcomes with af. while there is a strong signal that suggests that wl itself may be independently associated with prolonged rhythm control, it is nearly impossible to estimate the relative importance of wl as compared to co - management of other contributory risk factors. the more recently published cardio - fit study [impact of cardiorespiratory fitness on arrhythmia recurrence in obese individuals with atrial fibrillation : the cardio - fit study ], conducted in the same australian cohort, by the same group of investigators highlights this point. in this study, the authors provide further details of the graded exercise program in the weight management clinic. using exercise treadmill tests to assess gender - specific metabolic equivalents (mets) at baseline and study conclusion, the authors reported that af burden and symptom severity decreased significantly in the group with cardiorespiratory fitness gain 2 mets over the study period as compared to < 2 mets. this raises the question of how much of the benefits in af symptom improvement accrue from graded exercise and improved oxygenation and how much is the result of the ensuing wl ? in conclusion, it is important to understand that af burden has multifactorial inputs and the overall process of risk factor management is the key for af management, just like any other cardiovascular disease. the editorial accompanying the legacy study points out that the the 3 pillars for treatment of af include anticoagulation, rhythm control, and rate control. in addition to these classic tenets that we address in all af patients, based on the legacy study findings, we ought to consider multi - faceted obesity / cardiovascular risk factor management as the fourth pillar of af management. | as the global burden of atrial fibrillation (af) and its attendant economic impact on the healthcare system surges, there is increasing interest in the secondary prevention of af with various therapies. of the several identified risk factors for af, obesity is an important contributor that may be managed with intensive lifestyle modification. prior studies have demonstrated the short - term and long - term benefits of weight loss in reduction of af symptoms. in the legacy study [long - term effect of goal - directed weight management in an atrial fibrillation cohort : a long - term follow - up study ], the investigators evaluated the long - term effects of a weight management program on af symptoms. of the 355 patients included in this cohort, outcomes such as af symptom burden, arrhythmia - free survival, inflammatory markers and structural cardiac changes all appear to have improved in the intense weight loss group as compared to the 2 other groups. further, the benefits of weight loss appear to be lost when > 5% weight fluctuation (wf) occurred over the 5-year follow - up period. in this review, we discuss the design of the weight management clinic and its impact on the management of af in the legacy study. given that weight management appears to be an effective intervention that will not have the marketing and financial push that pharmaceutical and device based therapies enjoy, it behooves administrators of af clinics to develop innovative funding strategies to incorporate weight management programs in order to improve patient - centered outcomes. |
epidemiological data have demonstrated that low levels of highdensity lipoprotein cholesterol (hdlc) are a strong and independent predictor of cardiovascular disease. however, the clinical interaction between hdlc and lowdensity lipoprotein cholesterol (ldlc) level, especially the predictive value of hdlc in patients treated with statins or with low ldlc levels, is not well characterized. because hdlc may be a potential therapeutic target for considerable residual risk in patients who reached a very low ldlc level, it is important to evaluate the association between hdlc and cardiovascular risk among patients with low ldlc levels. percutaneous coronary intervention (pci) is frequently accompanied by cardiac marker elevation after the procedure (also known as periprocedural myocardial injury), especially with the use of highsensitivity troponin. a large body of data demonstrated that postprocedural troponin elevation was associated with a worse clinical outcome. the study by sattler showed that high hdlc was associated with reduced risk for periprocedural myocardial infarction, which is defined as elevation of postprocedural cardiac troponin above 3 times upper limit of normal (uln). no data exist about the association of hdlc with periprocedural myocardial infarction or injury following elective pci across a range of ldlc levels. therefore, the objective of this study was to assess the association of hdlc with periprocedural myocardial injury following elective pci across a range of ldlc levels, especially in patients with ldlc 3uln, which was the diagnosis criteria of periprocedural myocardial infarction published in 2007, and postprocedural ctni > 5uln, which was a requirement in the arbitrarily revised diagnosis criteria published in 2012, were also examined in this study. this study was approved by the ethics committee of fuwai hospital, complied with the declaration of helsinki, and all patients gave their informed consent for participation in this study. the indication for pci was based on the american college of cardiology / american heart association recommendations and was performed by experienced interventional cardiologists. before the procedure, all patients without contraindications received aspirin 100 mg daily or a loading dose of 300 mg, depending on whether daily aspirin therapy was already taken, and received clopidogrel 75 mg daily or a loading dose of 300 mg, depending on whether daily longterm clopidogrel therapy was already taken prior to intervention. all patients received either 5000 u or 70 u / kg bolus of unfractionated heparin just before the procedure, and an additional bolus of 2000 to 3000 u was given every hour if the procedure lasted for > 1 hour. vascular access and pci type (angioplasty only, angioplasty and stenting, or primary stenting) were determined by the interventional cardiologist according to the patient characteristics. total balloon inflation times and inflation pressures were determined by the interventional cardiologist according to the technical properties of the balloon and the stent. after the procedure, all patients continued with aspirin and clopidogrel therapy daily. use of glycoprotein iib / iiia receptor antagonists or anticoagulants was at the discretion of the interventional cardiologist. in all patients, a 12lead ecg was recorded before, immediately after pci, and in the case of the occurrence of symptoms that were interpreted as a postprocedural ischemic event. the hdlc concentration was determined by a homogeneous method (determiner l hdl, kyowa medex, tokyo) with a coefficient of variation of 3uln, which was the diagnosis criteria of periprocedural myocardial infarction published in 2007, and postprocedural ctni > 5uln, which was a requirement in the arbitrarily revised diagnosis criteria published in 2012, were also examined in this study. this study was approved by the ethics committee of fuwai hospital, complied with the declaration of helsinki, and all patients gave their informed consent for participation in this study. the indication for pci was based on the american college of cardiology / american heart association recommendations and was performed by experienced interventional cardiologists. before the procedure, all patients without contraindications received aspirin 100 mg daily or a loading dose of 300 mg, depending on whether daily aspirin therapy was already taken, and received clopidogrel 75 mg daily or a loading dose of 300 mg, depending on whether daily longterm clopidogrel therapy was already taken prior to intervention. all patients received either 5000 u or 70 u / kg bolus of unfractionated heparin just before the procedure, and an additional bolus of 2000 to 3000 u was given every hour if the procedure lasted for > 1 hour. vascular access and pci type (angioplasty only, angioplasty and stenting, or primary stenting) were determined by the interventional cardiologist according to the patient characteristics. total balloon inflation times and inflation pressures were determined by the interventional cardiologist according to the technical properties of the balloon and the stent. after the procedure, all patients continued with aspirin and clopidogrel therapy daily. use of glycoprotein iib / iiia receptor antagonists or anticoagulants was at the discretion of the interventional cardiologist. in all patients, a 12lead ecg was recorded before, immediately after pci, and in the case of the occurrence of symptoms that were interpreted as a postprocedural ischemic event. the hdlc concentration was determined by a homogeneous method (determiner l hdl, kyowa medex, tokyo) with a coefficient of variation of 1uln, > 3uln, and > 5uln were detected in 1455 (57.5%), 866 (34.2%), and 646 (25.5%), respectively. stepwise multivariable analysis demonstrated that factors independently associated with postprocedural ctni (logtransformed) were age, prior myocardial infarction, unstable angina, family history of coronary artery disease (cad), ldlc, nterminal probrain natriuretic peptide, preprocedural ctni, hemoglobin, glycated hemoglobin, number of target vessels, number of type b2/c lesions, number of bifurcation lesions, number of postdilation, and number of stents. the risk of postprocedural ctni elevation was determined for each quintile of hdlc level across the entire cohort. the quintiles of hdlc showed no significant association with postprocedural ctni elevation above 1uln, 3uln, and 5uln. there was also no significant association after adjusting for variables that were independently associated with postprocedural ctni levels (table 3). odds ratio (or) for postprocedural ctni elevation according to quintiles of hdlc adjusted model included age, prior myocardial infarction, family history of cad, ldlc, ntprobnp, preprocedural ctni, number of target vessels, number of type b2/c lesions, number of bifurcation lesions, number of postdilation, number of stents, unstable angina, hemoglobin, and glycated hemoglobin. cad indicates coronary artery disease ; ctni, cardiac troponin i ; hdlc, highdensity lipoprotein cholesterol ; ldlc, lowdensity lipoprotein cholesterol ; ntprobnp, nterminal probrain natriuretic peptide ; or, odds ratio ; pci, percutaneous coronary intervention ; uln, upper limit of normal. calculating hdlc as a continuous variable, each increment of 1 mg / dl in the hdlc level was not significantly associated with postprocedural ctni elevation above 1uln, 3uln, and 5uln. there was also no significant association after adjusting for variables that were independently associated with postprocedural ctni levels (table 4). additionally, after adjusting for variables that were clearly different among hdlc quintiles, there was also no significant association of hdlc levels or quintiles with postprocedural ctni elevation above 1uln, 3uln, and 5uln (tables 5 and 6). odds ratio (or) for postprocedural ctni elevation associated with 1 mg / dl increment in hdlc adjusted model included age, prior myocardial infarction, family history of cad, ldlc, ntprobnp, preprocedural ctni, number of target vessels, number of type b2/c lesions, number of bifurcation lesions, number of postdilation, number of stents, unstable angina, hemoglobin and glycated hemoglobin. cad indicates coronary artery disease ; ctni, cardiac troponin i ; hdlc, highdensity lipoprotein cholesterol ; ldlc, lowdensity lipoprotein cholesterol ; ntprobnp, nterminal probrain natriuretic peptide ; pci, percutaneous coronary intervention ; uln, upper limit of normal. odds ratio (or) for postprocedural ctni elevation according to quintiles of hdlc adjusted model included age, sex, bmi, diabetes, current smoking, prior myocardial infarction, prior pci, ldlc, triglyceride, hscrp, ntprobnp, hba1c, hemoglobin, occlusion lesions, number of stents implanted, total stent length, and number of predilations. bmi indicates body mass index ; ctni, cardiac troponin i ; hba1c, glycosylated hemoglobin ; hdlc, highdensity lipoprotein cholesterol ; hscrp, highsensitivity creactive protein ; ldlc, lowdensity lipoprotein cholesterol ; ntprobnp, nterminal probrain natriuretic peptide ; pci, percutaneous coronary intervention ; uln, upper limit of normal. odds ratio (or) for postprocedural ctni elevation associated with 1 mg / dl increment in hdlc adjusted model included age, sex, bmi, diabetes, current smoking, prior myocardial infarction, prior pci, ldlc, triglyceride, hscrp, ntprobnp, hba1c, hemoglobin, occlusion lesions, number of stents implanted, total stent length, and number of predilations. bmi indicates body mass index ; ctni, cardiac troponin i ; hba1c, glycosylated hemoglobin ; hdlc, highdensity lipoprotein cholesterol ; hscrp, highsensitivity creactive protein ; ldlc, lowdensity lipoprotein cholesterol ; ntprobnp, nterminal probrain natriuretic peptide ; pci, percutaneous coronary intervention ; uln, upper limit of normal. we performed a stratified regression analysis using prespecified ldlc categories (0.05). figures 2 through 4 show the stratified regression analysis results using specific ldlc cutoff points. in patients with ldlc 0.05 and all fdr q values > 0.20). additionally, after adjusting for variables that are clearly different among hdlc quintiles, the results were similar (table 8). the relation between plasma hdlc level and risk of postprocedural ctni elevation above 1uln, 3uln, and 5uln was modified by ldlc level (p for interaction = 0.008, 0.005, 0.012, respectively). odds ratio (or) for postprocedural ctni elevation associated with 1 mg / dl increment in the hdlc stratified by ldlc level adjusted model included age, prior myocardial infarction, family history of cad, ldlc, ntprobnp, preprocedural ctni, number of target vessels, number of type b2/c lesions, number of bifurcation lesions, number of postdilation, number of stents, unstable angina, hemoglobin, and glycated hemoglobin. cad indicates coronary artery disease ; ctni, cardiac troponin i ; hdlc, highdensity lipoprotein cholesterol ; ldlc, lowdensity lipoprotein cholesterol ; ntprobnp, nterminal probrain natriuretic peptide ; pci, percutaneous coronary intervention ; uln, upper limit of normal. odds ratio (or) for postprocedural ctni elevation associated with 1 mg / dl increment in the hdlc stratified by ldlc level adjusted model included age, sex, bmi, diabetes, current smoking, prior myocardial infarction, prior pci, ldlc, triglyceride, hscrp, ntprobnp, hba1c, hemoglobin, occlusion lesions, number of stents implanted, total stent length, and number of predilations. bmi indicates body mass index ; ctni, cardiac troponin i ; hba1c, glycosylated hemoglobin ; hdlc, highdensity lipoprotein cholesterol ; hscrp, highsensitivity creactive protein ; ldlc, lowdensity lipoprotein cholesterol ; ntprobnp, nterminal probrain natriuretic peptide ; pci, percutaneous coronary intervention ; uln, upper limit of normal. association of hdlc quintile with the risk of postprocedural ctni > 1uln by ldlc subgroup. odds ratios were adjusted for age, prior myocardial infarction, family history of cad, ldlc, ntprobnp, preprocedural ctni, number of target vessels, number of type b2/c lesions, number of bifurcation lesions, number of postdilation, number of stents, unstable angina, hemoglobin, and glycated hemoglobin. cad indicates coronary artery disease ; ctni, cardiac troponin i ; hdlc, highdensity lipoprotein cholesterol ; ldlc, lowdensity lipoprotein cholesterol ; ntprobnp, nterminal probrain natriuretic peptide ; uln, upper limit of normal. association of hdlc quintile with the risk of postprocedural ctni > 3uln by ldlc subgroup. odds ratios were adjusted for age, prior myocardial infarction, family history of cad, ldlc, ntprobnp, preprocedural ctni, number of target vessels, number of type b2/c lesions, number of bifurcation lesions, number of postdilation, number of stents, unstable angina, hemoglobin, and glycated hemoglobin. cad indicates coronary artery disease ; ctni, cardiac troponin i ; hdlc, highdensity lipoprotein cholesterol ; ldlc, lowdensity lipoprotein cholesterol ; ntprobnp, nterminal probrain natriuretic peptide ; uln, upper limit of normal. association of hdlc quintile with the risk of postprocedural ctni > 5uln by ldlc subgroup. odds ratios were adjusted for age, prior myocardial infarction, family history of cad, ldlc, ntprobnp, preprocedural ctni, number of target vessels, number of type b2/c lesions, number of bifurcation lesions, number of postdilation, number of stents, unstable angina, hemoglobin and glycated hemoglobin. cad indicates coronary artery disease ; ctni, cardiac troponin i ; hdlc, highdensity lipoprotein cholesterol ; ldlc, lowdensity lipoprotein cholesterol ; ntprobnp, nterminal probrain natriuretic peptide ; uln, upper limit of normal. the hdlc ranged from 18.6 to 109.8 mg / dl (median 39.8 mg / dl, interquartile range 34.4 to 47.1 mg / dl, mean 41.610.3 mg / dl) (figure 1). the baseline clinical characteristics of the subjects in each of the quartiles of hdlc level are shown in table 1. subjects with lower hdlc levels were younger, more likely to be male and current smokers, and had higher body mass index than those with higher hdlc levels. diabetes mellitus and a history of myocardial infarction were more common in the lower quartiles of hdlc levels. subjects with lower hdlc levels had higher highsensitivity creactive protein, triglyceride, and glycated hemoglobin. baseline clinical characteristics values are expressed as meansd, median with interquartile range or n (%). ace indicates angiotensinconverting enzyme ; arbs, angiotensin receptor blockers ; bmi, body mass index ; cabg, coronary artery bypass graft ; ccbs, calcium channel blockers ; ctni, cardiac troponin family history i ; fh, ; hba1c, glycosylated hemoglobin ; hdlc, highdensity lipoprotein cholesterol ; hscrp, highsensitivity creactive protein ; ldlc, lowdensity lipoprotein cholesterol ; mi, myocardial infarction ; ntprobnp, nterminal probrain natriuretic peptide ; pci, percutaneous coronary intervention ; ua, unstable angina. the procedural characteristics of the subjects within quartiles of hdlc are shown in table 2. subjects with higher hdlc levels were likely to receive fewer stents and shorter total stent length implanted with less predilation times. there were no significant differences in vascular access, target vessel, target lesion site, and target lesion type among groups. there were also no significant differences in maximum inflation pressure, maximum inflation time, and postdilation times among quartiles of hdlc. procedural characteristics values are expressed as n (%), meansd, or median with interquartile range. acc / aha indicates american college of cardiology / american heart association ; gpi, glycoprotein inhibitor ; hdlc, highdensity lipoprotein cholesterol ; lad, left anterior descending ; lcx, left circumflex ; lima, left internal mammary artery ; lm, left main ; lmwh, lowmolecularweight heparin ; rca, right coronary artery ; svg, saphenous vein graft. peak postprocedural ctni > 1uln, > 3uln, and > 5uln were detected in 1455 (57.5%), 866 (34.2%), and 646 (25.5%), respectively. stepwise multivariable analysis demonstrated that factors independently associated with postprocedural ctni (logtransformed) were age, prior myocardial infarction, unstable angina, family history of coronary artery disease (cad), ldlc, nterminal probrain natriuretic peptide, preprocedural ctni, hemoglobin, glycated hemoglobin, number of target vessels, number of type b2/c lesions, number of bifurcation lesions, number of postdilation, and number of stents. the risk of postprocedural ctni elevation was determined for each quintile of hdlc level across the entire cohort. the quintiles of hdlc showed no significant association with postprocedural ctni elevation above 1uln, 3uln, and 5uln. there was also no significant association after adjusting for variables that were independently associated with postprocedural ctni levels (table 3). odds ratio (or) for postprocedural ctni elevation according to quintiles of hdlc adjusted model included age, prior myocardial infarction, family history of cad, ldlc, ntprobnp, preprocedural ctni, number of target vessels, number of type b2/c lesions, number of bifurcation lesions, number of postdilation, number of stents, unstable angina, hemoglobin, and glycated hemoglobin. cad indicates coronary artery disease ; ctni, cardiac troponin i ; hdlc, highdensity lipoprotein cholesterol ; ldlc, lowdensity lipoprotein cholesterol ; ntprobnp, nterminal probrain natriuretic peptide ; or, odds ratio ; pci, percutaneous coronary intervention ; uln, upper limit of normal. calculating hdlc as a continuous variable, each increment of 1 mg / dl in the hdlc level was not significantly associated with postprocedural ctni elevation above 1uln, 3uln, and 5uln. there was also no significant association after adjusting for variables that were independently associated with postprocedural ctni levels (table 4). additionally, after adjusting for variables that were clearly different among hdlc quintiles, there was also no significant association of hdlc levels or quintiles with postprocedural ctni elevation above 1uln, 3uln, and 5uln (tables 5 and 6). odds ratio (or) for postprocedural ctni elevation associated with 1 mg / dl increment in hdlc adjusted model included age, prior myocardial infarction, family history of cad, ldlc, ntprobnp, preprocedural ctni, number of target vessels, number of type b2/c lesions, number of bifurcation lesions, number of postdilation, number of stents, unstable angina, hemoglobin and glycated hemoglobin. cad indicates coronary artery disease ; ctni, cardiac troponin i ; hdlc, highdensity lipoprotein cholesterol ; ldlc, lowdensity lipoprotein cholesterol ; ntprobnp, nterminal probrain natriuretic peptide ; pci, percutaneous coronary intervention ; uln, upper limit of normal. odds ratio (or) for postprocedural ctni elevation according to quintiles of hdlc adjusted model included age, sex, bmi, diabetes, current smoking, prior myocardial infarction, prior pci, ldlc, triglyceride, hscrp, ntprobnp, hba1c, hemoglobin, occlusion lesions, number of stents implanted, total stent length, and number of predilations. bmi indicates body mass index ; ctni, cardiac troponin i ; hba1c, glycosylated hemoglobin ; hdlc, highdensity lipoprotein cholesterol ; hscrp, highsensitivity creactive protein ; ldlc, lowdensity lipoprotein cholesterol ; ntprobnp, nterminal probrain natriuretic peptide ; pci, percutaneous coronary intervention ; uln, upper limit of normal. odds ratio (or) for postprocedural ctni elevation associated with 1 mg / dl increment in hdlc adjusted model included age, sex, bmi, diabetes, current smoking, prior myocardial infarction, prior pci, ldlc, triglyceride, hscrp, ntprobnp, hba1c, hemoglobin, occlusion lesions, number of stents implanted, total stent length, and number of predilations. bmi indicates body mass index ; ctni, cardiac troponin i ; hba1c, glycosylated hemoglobin ; hdlc, highdensity lipoprotein cholesterol ; hscrp, highsensitivity creactive protein ; ldlc, lowdensity lipoprotein cholesterol ; ntprobnp, nterminal probrain natriuretic peptide ; pci, percutaneous coronary intervention ; uln, upper limit of normal. we performed a stratified regression analysis using prespecified ldlc categories (0.05). figures 2 through 4 show the stratified regression analysis results using specific ldlc cutoff points. in patients with ldlc 0.05 and all fdr q values > 0.20). additionally, after adjusting for variables that are clearly different among hdlc quintiles, the results were similar (table 8). the relation between plasma hdlc level and risk of postprocedural ctni elevation above 1uln, 3uln, and 5uln was modified by ldlc level (p for interaction = 0.008, 0.005, 0.012, respectively). odds ratio (or) for postprocedural ctni elevation associated with 1 mg / dl increment in the hdlc stratified by ldlc level adjusted model included age, prior myocardial infarction, family history of cad, ldlc, ntprobnp, preprocedural ctni, number of target vessels, number of type b2/c lesions, number of bifurcation lesions, number of postdilation, number of stents, unstable angina, hemoglobin, and glycated hemoglobin. cad indicates coronary artery disease ; ctni, cardiac troponin i ; hdlc, highdensity lipoprotein cholesterol ; ldlc, lowdensity lipoprotein cholesterol ; ntprobnp, nterminal probrain natriuretic peptide ; pci, percutaneous coronary intervention ; uln, upper limit of normal. odds ratio (or) for postprocedural ctni elevation associated with 1 mg / dl increment in the hdlc stratified by ldlc level adjusted model included age, sex, bmi, diabetes, current smoking, prior myocardial infarction, prior pci, ldlc, triglyceride, hscrp, ntprobnp, hba1c, hemoglobin, occlusion lesions, number of stents implanted, total stent length, and number of predilations. bmi indicates body mass index ; ctni, cardiac troponin i ; hba1c, glycosylated hemoglobin ; hdlc, highdensity lipoprotein cholesterol ; hscrp, highsensitivity creactive protein ; ldlc, lowdensity lipoprotein cholesterol ; ntprobnp, nterminal probrain natriuretic peptide ; pci, percutaneous coronary intervention ; uln, upper limit of normal. association of hdlc quintile with the risk of postprocedural ctni > 1uln by ldlc subgroup. odds ratios were adjusted for age, prior myocardial infarction, family history of cad, ldlc, ntprobnp, preprocedural ctni, number of target vessels, number of type b2/c lesions, number of bifurcation lesions, number of postdilation, number of stents, unstable angina, hemoglobin, and glycated hemoglobin. cad indicates coronary artery disease ; ctni, cardiac troponin i ; hdlc, highdensity lipoprotein cholesterol ; ldlc, lowdensity lipoprotein cholesterol ; ntprobnp, nterminal probrain natriuretic peptide ; uln, upper limit of normal. association of hdlc quintile with the risk of postprocedural ctni > 3uln by ldlc subgroup. odds ratios were adjusted for age, prior myocardial infarction, family history of cad, ldlc, ntprobnp, preprocedural ctni, number of target vessels, number of type b2/c lesions, number of bifurcation lesions, number of postdilation, number of stents, unstable angina, hemoglobin, and glycated hemoglobin. cad indicates coronary artery disease ; ctni, cardiac troponin i ; hdlc, highdensity lipoprotein cholesterol ; ldlc, lowdensity lipoprotein cholesterol ; ntprobnp, nterminal probrain natriuretic peptide ; uln, upper limit of normal. association of hdlc quintile with the risk of postprocedural ctni > 5uln by ldlc subgroup. odds ratios were adjusted for age, prior myocardial infarction, family history of cad, ldlc, ntprobnp, preprocedural ctni, number of target vessels, number of type b2/c lesions, number of bifurcation lesions, number of postdilation, number of stents, unstable angina, hemoglobin and glycated hemoglobin. cad indicates coronary artery disease ; ctni, cardiac troponin i ; hdlc, highdensity lipoprotein cholesterol ; ldlc, lowdensity lipoprotein cholesterol ; ntprobnp, nterminal probrain natriuretic peptide ; uln, upper limit of normal. the present study demonstrates that low hdlc was associated with an increased risk of periprocedural myocardial injury only in patients with ldlc < 70 mg / dl, but not in patients with ldlc 70 to 100 mg / dl and in patients with ldlc 100 mg / dl. gordon found a consistent inverse relation of hdlc levels with cad event rates by using the same analytic approach in 4 prospective studies, and 1 mg / dl increment in hdlc levels was associated with decreased risk of cad by 2% to 3%. however, a low level of hdlc does not necessarily mean increased risk of cardiovascular events or mortality. decreased hdlc levels due to rare and common genetic variants were both not associated with increased risk of cardiovascular diseases. a strong inverse association between hdlc and cardiovascular risk has led to intensive research seeking to raise plasma levels of hdlc. however, several studies have not shown reduced cardiovascular risk with therapeutic agents that raised hdlc significantly such as niacin, fibrates, and cholesteryl ester transfer protein inhibitors. the results of these trials have challenged this concept that hdlc was inversely associated with cardiovascular risk. moreover, higher hdlc even changed into a significant major cardiac event risk factor following adjustment for apoai and apob. whether low hdlc is a cause or is merely a biomarker of cardiovascular disease remains controversial. it has been suggested that hdl protects against atherosclerosis through reverse cholesterol transport and antiinflammatory and antioxidant properties. hdlc levels were a poor surrogate for cholesterol efflux capacity of hdl, which plays a key role in reverse cholesterol transport. though experimental observations showed these atheroprotective functions of hdl isolated from healthy subjects, hdl isolated from patients with cad was shown to lose these properties. hdl has been shown to undergo a loss of functions in several pathophysiological states, such as smoking, diabetes mellitus, dyslipidemia, and inflammation. khera demonstrated that cholesterol efflux capacity of hdl was a stronger and independent inverse predictor of cad than hdlc levels, supporting the argument that measures of hdl function may be more useful than hdlc levels in cardiovascular risk prediction.silbernagel and colleagues investigated the relation of hdlc with cardiovascular mortality in 3141 participants with or without cad, and found that hdlc was inversely associated with cardiovascular mortality in people without cad, but not in patients with cad. a recent study demonstrated that higher hdlc levels were not associated with a reduced risk of vascular events in 1548 patients with cad undergoing elective bypass surgery with a median followup time of 32 months. our study demonstrated that hdlc was not associated with the risk of periprocedural myocardial injury in the entire cohort. there were multiple studies assessing the associations of hdlc with cardiovascular risk across the range of ldlc levels. as early as 1991, a prospective study has demonstrated that the benefit of a higher hdl cholesterol level was most pronounced among those with lower total cholesterol levels. in a combined analysis of 2 secondary prevention trials with pravastatin that included 13 173 participants with cad, hdlc was a significantly stronger predictor of recurrent cad events in participants with ldlc < 125 than in those with 125 mg / dl during a 5.8year followup. in a posthoc analysis of 2193 patients with stable cad from the clinical outcomes utilizing revascularization and aggressive drug evaluation (courage) trial, the inverse association of hdlc with cardiovascular risk was the most prominent in patients with ldlc levels < 70 mg / dl. among 2661 participants with ldlc levels < 70 mg / dl in the treating to new targets (tnt) trial, higher hdlc levels were associated with less risk of major cardiovascular events. the present study demonstrates that higher hdlc was associated with less risk of periprocedural myocardial injury only in patients with ldlc < 70 mg / dl. our study complements the evidence already given for the greater predictive value of hdlc for cardiovascular risk in patients with low ldlc. these studies may suggest that hdlc levels correlated more with hdl functions in patients with low ldlc levels. in our study, patients with ldlc levels 70 mg / dl have levels of higher triglyceride and creactive protein, which might lead to dysfunction of hdl. in contrast to our data, sattler found that small increases in hdlc in patients undergoing elective pci converted into a substantial reduction of risk for pcirelated myocardial infarction in the entire cohort. another possible explanation is that hdlc levels correlate well with hdl function in the study population. however, there was an inconsistent pattern when comparing the associations of hdlc with cardiovascular risk among patients with different intensities of statin therapy. in the justification for the use of statins in primary prevention : an intervention trial evaluating rosuvastatin (jupiter) trial, the inverse association between hdlc and vascular events was not observed in patients on rosuvastatin 20 mg / day, whereas it did exist in patients on placebo. the treating to new targets (tnt) trial showed that the association of hdlc with cardiovascular risk was markedly attenuated in patients randomized to atorvastatin 80 mg / day. similarly, the pravastatin or atorvastatin evaluation and infection therapythrombolysis in myocardial infarction 22 (prove ittimi 22) trial found no predictive value for hdlc in patients on atorvastatin 80 mg / day. in a metaanalysis of 8 statin trials, hdlc increase during statin therapy was not associated with a reduced risk of major cardiovascular events. the hdlcincreasing effect of statins is caused by inhibition of cholesteryl ester transfer protein activity, and is unrelated to changes in ldlc by statins. whether the loss of relation of hdlc and cardiovascular risk in intensive statin therapy can be explained by functional changes in hdl during intensive statin therapy, or whether reverse cholesterol transport, antiinflammatory, and antioxidant properties of hdlc are less relevant than highdose statin therapy is unclear. whether hdl alteration during statin therapy contributes to considerable residual risk in primary and secondary prevention trials with statins is unknown. instead of just focusing on the dose, type, and duration of statin treatment, we used the target levels of ldlc lowering recommended by the national cholesterol education program adult treatment panel iii guidelines, an ideal approach that was close to clinical practice. the inconsistent results about the relation of hdlc with cardiovascular risk between patients with < 70 mg / dl and those with intense statin therapy might suggest that intense statin therapy was not identical to achieving an ldlc level < 70 mg / dl. it might also suggest that achieving an ldlc level < 70 mg / dl recommended by guidelines was more important than intensive statin therapy. regardless, those with higher levels of hdlc experienced reduced risk of periprocedural myocardial injury when ldlc was reduced to < 70 mg / dl in patients undergoing elective pci. despite the detailed data collection and the large number of patients in this study, several limitations of this study should be noted. first, although we attempted to adjust for potential confounders, we can not exclude the possibility that unmeasured variables may have confounded results. the subgroup analysis might be a result from the small number of patients in some groups. third, it has been suggested that ckmb might have a better predictive value than troponins, but we did not measure the ckmb levels after the procedure. however, troponins are more sensitive and specific biomarkers for myocardium than ckmb, and the third universal definition of myocardial infarction has recommended use of troponin for diagnosis of pcirelated myocardial infarction and injury. thus, we just measured the ckmb activity before the procedure and did not measure the ckmb mass after the procedure due to insurance cost. fourth, some recent studies have shown that hdlc may not be cardioprotective mediators, which may diminish the significance in this subgroup analysis. fifth, although we applied the fdr method to correct for multiple testing and used a threshold of q<0.2 to determine statistical significance as in previous studies, we can not exclude the possibilities of reporting false positives through performing many hypothesis tests. the present study showed that only higher hdlc levels were associated with reduced risk of periprocedural myocardial injury in patients with ldlc < 70 mg / dl. our findings suggested that hdlc might be a potential therapeutic target only when ldlc is reduced to optimal levels. the authors thank the staff of the cardiac catheterization laboratory at fu wai hospital for their assistance in performing the studies. | backgroundrecent data showed inconsistent association of highdensity lipoprotein cholesterol (hdlc) with cardiovascular risk in patients with different levels of lowdensity lipoprotein cholesterol (ldlc) or intensive statin therapy. this study sought to determine the relationship of hdlc with periprocedural myocardial injury following elective percutaneous coronary intervention (pci) across a range of ldlc levels, especially in patients with ldlc < 70 mg / dl.methods and resultswe enrolled 2529 consecutive patients with normal preprocedural cardiac troponin i (ctni) who underwent elective pci. the association between preprocedural hdlc and periprocedural myocardial injury was evaluated across ldlc levels, especially in patients with ldlc < 70 mg / dl. the hdlc level was not predictive of periprocedural myocardial injury across the entire study cohort. however, among patients with ldlc < 70 mg / dl, a 1 mg / dl increase in hdlc was associated with a 3% reduced risk for postprocedural ctni above 1upper limit of normal (uln) (odds ratio : 0.97 ; 95% ci : 0.95 to 0.99 ; p=0.004), a 3% reduced risk for postprocedural ctni above 3uln odds ratio : 0.97 ; 95% ci : 0.95 to 0.99 ; p=0.022), and a 3% reduced risk for postprocedural ctni above 5uln (odds ratio : 0.97 ; 95% ci : 0.95 to 0.99 ; p=0.017). the relation between plasma hdlc level and risk of postprocedural ctni elevation above 1uln, 3uln, and 5uln was modified by ldlc level (all p for interaction < 0.05).conclusionshigher hdlc levels were associated with reduced risk of periprocedural myocardial injury only in patients with ldlc < 70 mg / dl. |
a 45-year - old female visited the hospital with a palpable mass on the medial aspect of her thigh. the mass was observed by the patient 3 months previously and the size was perceived to be rapidly increasing. computed tomography of the site showed an 11 cm - sized well - circumscribed mass with heterogeneous intensity, calcification and septation (fig. 1). a diagnostic incisional biopsy was performed, and the tissue that was biopsied showed cartilage with atypical cytological features and focal necrosis. analysis determined that myxoid stroma surrounded the cartilage, with the presence of some scattered lipoblasts within the myxoid stroma. based on these findings, the biopsy was diagnosed as a malignant cartilage - forming tumor, and wide excision was performed on the entire mass. 2), and each lobulated area was found to have different appearances that ranged from a solid gray fibrotic firm lobule, to a brown fibrotic soft lobule with a focal hemorrhage and cystic change, to a solid gray lobule with a focal glistening translucent myxoid appearance and a bluish firm resilient area with a focal calcification. microscopic analysis revealed that the solid gray fibrotic area showed diffuse proliferation of bland fusiform cells with ovoid elongated nuclei and a moderate to abundant cytoplasm, and fine, delicate capillary vessel networks were noted within the fibrotic area (fig. the brown fibrotic and hemorrhagic area contained coagulative necrosis of bland fusiform cells with hemorrhage, and a previous biopsy was proposed as the cause for the change in tissue. the myxoid area was characterized by a prominent basophilic myxoid matrix with scattered bland fusiform cells and lipoblasts (fig. the lipoblasts had eccentrically located, small, elongated nuclei that were pushed to the periphery of the cell by clear, abundant intracytoplasmic vacuoles. the bluish resilient areas, which accounted for about 10% of the tumor volume, were characterized by cartilage with enchondral ossification, which showed mature bone without osteoid (fig. based on the immunohistochemistry, some of the fusiform cells and the lipoblasts were determined to be s-100 protein positive (1:300, thermo fisher scientific, waltham, ma, usa) (fig. 4a), but were negative for smooth muscle actin (1:500, dako, glostrup, denmark), desmin (1:1,000, dako), and myogenin (1:100, dako). less than 5% of the cells were determined to be p53 positive (1:1,000, dako) (fig. 4b), and the ki-67 (1:100, dako) labeling index was also less than 5%. based on these findings, a diagnosis of myxoid liposarcoma was considered. molecular evaluation was performed on both the typical myxoid liposarcomatous and the cartilaginous areas, to confirm the proposed diagnosis. the final diagnosis was determined to be myxoid liposarcoma with cartilaginous differentiation, and the patient was scheduled for radiation therapy because the tumor was very close to the resection margin. currently, after 6 months of follow - up, the patient has not presented with any evidence of metastasis or reoccurrence. typical myxoid liposarcomatous and cartilaginous areas were marked on a paraffin block after the hematoxylin and eosin slides were reviewed. five 10 m sections of each area were cut from the resection specimen blocks and placed into eppendorf tubes. the total rna was extracted from the formalin - fixed, paraffin embedded samples using an rneasy mini kit (qiagen, valencia, ca, usa) following the manufacturer 's instructions. after preparation, 1 g of each of the total rna samples were reverse transcribed using a revertaid first strand cdna synthesis kit (thermo fisher scientific), and a nested polymerase chain reaction (pcr) was performed using outer and inner primer sets that were based on a previous report.10 the outer primer set was tls - chop outer forward (5'-agcaaagctataatccccctcag-3 ') and tls - chop outer reverse (5'-gaaggagaaaggcaatgactca-3 '), and inner primer set consisted of tls - chop inner forward (5'-gacagcagaaccagtacaacagcag-3 ') and tls - chop inner reverse (5'-gctttcaggtgtggtgatgtatgaag-3 '). the expected size of the nested pcr products for the three common types of fusion transcripts were 379 bp, 103 bp, and 412 bp for type i (exons 7 - 2), type ii (exons 5 - 2), and type iii (exons 8 - 2), respectively. the results of the nested pcr for this study exhibited type ii fusion transcripts in both the typical myxoid liposarcomatous and cartilaginous areas (fig. 5). typical myxoid liposarcomatous and cartilaginous areas were marked on a paraffin block after the hematoxylin and eosin slides were reviewed. five 10 m sections of each area were cut from the resection specimen blocks and placed into eppendorf tubes. the total rna was extracted from the formalin - fixed, paraffin embedded samples using an rneasy mini kit (qiagen, valencia, ca, usa) following the manufacturer 's instructions. after preparation, 1 g of each of the total rna samples were reverse transcribed using a revertaid first strand cdna synthesis kit (thermo fisher scientific), and a nested polymerase chain reaction (pcr) was performed using outer and inner primer sets that were based on a previous report.10 the outer primer set was tls - chop outer forward (5'-agcaaagctataatccccctcag-3 ') and tls - chop outer reverse (5'-gaaggagaaaggcaatgactca-3 '), and inner primer set consisted of tls - chop inner forward (5'-gacagcagaaccagtacaacagcag-3 ') and tls - chop inner reverse (5'-gctttcaggtgtggtgatgtatgaag-3 '). the expected size of the nested pcr products for the three common types of fusion transcripts were 379 bp, 103 bp, and 412 bp for type i (exons 7 - 2), type ii (exons 5 - 2), and type iii (exons 8 - 2), respectively. the results of the nested pcr for this study exhibited type ii fusion transcripts in both the typical myxoid liposarcomatous and cartilaginous areas (fig. 5). myxoid liposarcomas tend to occur in the lower extremities of young adults, and have a peak incidence in the 4th and 5th decades.3,12 myxoid liposarcomas can be grossly identified as well - circumscribed, multinodular, intramuscular tumors with a gelatinous cut surface and occasional hemorrhage.2,12 histologically, most of the tumors show bland fusiform cells and lipoblasts with varying degrees of cytoplasmic fat formation in the myxoid background with a prominent capillary vascular network.1,2 the fat vacuoles differ in regards to the size and number and tumor cells with a single vacuole have been described as signet ring - type lipogenic cells.1 this study observed cells with characteristics that were similar to typical myxoid liposarcoma with the exception of focal cartilaginous differentiation. the distinct differences between cartilaginous, leiomyomatous and osseous differentiation in myxoid liposarcoma has been described in a previous study.2 previous studies have reported that five cases of similar myxoid liposarcomas have occurred, however there are a total of seven cases if the earlier reports by enzinger and winslow4 and evans1 are counted,5,7,9 although the cartilaginous differentiation in the subtype was briefly described as metaplasia in the early reports by enzinger and winslow4 and evans.1 the distribution of both cartilaginous and myxoid liposarcomatous areas has been reported in some cases to be distinct and different, but other cases have indicated that there was gradual transition between the two.1,4,5,7,9 siebert.7 was the only author that described detailed histology of the cartilaginous area, and he also indicated that one of his three cases presented with cytological atypia, while the other two cases did not. this report did not discuss these specific details about the cartilaginous area, however, the image of the area indicated that there was cytological atypia of the chondrocytes.9 as siebert.7 discussed, the appearance of the cartilaginous area can cause confusion with other benign or malignant soft tissue tumors. in this case, the situation could potentially be more problematic based on the biopsied material because a differential diagnosis of the myxoid chondrosarcoma from this tumor could be difficult to categorize accurately.2 but myxoid chondrosarcomas rarely show areas of mature cartilage.2 and even if the mature cartilage is noted, cytogenetical analysis of the spindle cell area and the cartilaginous area can be used to support an accurate diagnosis of the tumor.9 follow - up studies of the t(12;16) in myxoid liposarcoma have indicated that the translocation is a distinct characteristic feature of the tumor.10,13 - 16 the translocation occurrence percentage was consistently high throughout various studies and many reports showed that over 90% of the myxoid liposarcomas exhibited the cytogenetic abnormality.10,13 - 16 the specific translocation results in the fusion of chop (also known as gadd153 and ddit3) on chromosome 12 and tls (also referred to as fus) on chromosome 16.14 - 16 to date, twelve different kinds of tls - chop fusion transcripts have been detected.17 the portions of the genes that fuse can range from almost the entire chop gene to varying lengths of the tls gene, which differs according to the type of fusion transcripts.17 the differences are caused by varied break points within each gene, but generally,18 three types of transcripts are commonly observed and the remaining transcripts are rare.10 previous studies have not identified any specific correlation between the types of fusion transcript and a prognosis.11 however, this study demonstrated a correlation between the type ii fusion transcript and p53 overexpression, and although the tls - chop fusion is found in a high percentage of the myxoid liposarcomas, there are reports of other cytogenetic aberrations. for example, a small number of myxoid liposarcoma cases with an ews - chop fusion have been reported.11 in addition, one study detected an aberration of the p53 gene in about 30% of the myxoid liposarcomas.19 previous studies have determined several prognostic factors of myxoid liposarcoma, which include the percentage of round cell components, tumor necrosis, and p53 overexpression.1,3,11,20 the prognostic importance of round cell components was first identified by enzinger and winslow4 and has been confirmed in follow - up studies.1,3,20 in addition, the overexpression of p53, determined by a 5% cut off value, was reported to be significantly associated with poor rates of survival.11 this study is the second report of a myxoid liposarcoma with cartilaginous differentiation that was determined to have a type ii tls - chop fusion transcript in both the typical myxoid liposarcoma area and the cartilaginous differentiation area. currently only a small number of cases discuss the histological aspects of the cartilaginous area, and because the chondrocytes do not present with apparent malignant or benign features, the cartilaginous area has not yet been designated into malignant or benign components. however, the study identified areas of ossification that were adjacent to cartilaginous areas. because of the abrupt transition between the two areas and the absence of osteoid formation by the tumor cells, enchondral ossification was considered as the pathophysiological bone formation mechanism instead of osteosarcomatous differentiation. authors of previous case reports have speculated that the heterologous component could be derived from common progenitor cells.9 however, additional follow - up studies are needed to investigate whether the cartilaginous component is created by proliferating mesenchymal cells or by metaplasia. | myxoid liposarcoma is a subtype of liposarcoma. this specific subtype can be identified based on its characteristic histological and cytogenetical features. the tumor has a fusion transcript of the chop and tls genes, which is caused by t(12;16)(q13;p11). most of the fusion transcripts that have been identified fall into three categories, specifically type i (exons 7 - 2), type ii (exons 5 - 2), and type iii (exons 8 - 2). a total of seven myxoid liposarcomas associated with the rare phenomenon of cartilaginous differentiation have been documented in the literature. currently, only one of these cases has been cytogenetically analyzed, and the analysis indicated that it was a type ii tls - chop fusion transcript in both the typical myxoid liposarcoma and cartilaginous areas. this study presents a second report of myxoid liposarcoma with cartilaginous differentiation, and includes a cytogenetical analysis of both the myxoid and cartilaginous areas. |
although medical progress including new imaging modalities and technical support has been widely gained, controversy still continues in management of ureteroceles regarding classification, diagnosis, and treatment. the incidence of ureterocele is variable with the highest rate of 1 in 500 and it is generally found in females with duplex system association (95%)[1, 2 ]. though there is a female dominance, the nature of the anomaly is more complex in boys. beginning from the prenatal stage, this anomaly causes different clinical presentations, such as antenatal hydronephrosis, vesicoureteral reflux (vur), urinary tract infection (uti), bladder outlet obstruction, prolapsed urethral mass, etc. an ureterocele related with the upper pole of the kidney is generally named as ectopic or pediatric type. dysplastic upper pole renal units in association with duplex system ureteroceles can also cause some management problems. hydronephrosis and ureteral dilatation are also evidences for the impairment of nephro - urinary system. a sonogram and voiding cystourethrography are essential initial procedures for a child suspected of having ureteral anomaly[1, 3 4 ]. today, endoscopic incision is an initial procedure for management. even though it is the simplest and least invasive form of treatment particularly for single system ureteroceles, some urologists prefer ureterocele excision and ureteral reimplantation because of the risk of inducing reflux. reconstructive surgery is still a preferred method particularly for the duplex system ureteroceles and in the presence of vesicoureteral reflux. upper pole nephrectomy and ureterectomy is one of the treatment options for ureteroceles particularly in the absence of reflux ; some excised specimens show only obstructive or inflammatory changes[2, 5 ]. we planned to evaluate our patients with ureterocele diagnosis particularly by giving emphasis to these points of interest to discuss different management options. data of the patients treated for ureterocele from the pediatric surgical departments of the two hospitals (izmir behcet uz children 's hospital and celal bayar university hospital manisa) during 1996 - 2009 were retrospectively evaluated. the patient records were reviewed regarding sex, age, antenatal diagnosis, symptoms related with ureterocele, pathological type and localization of the anomaly, radiological diagnosis, dimercapto - succinic acid scinti - graphy, ureterocele - urinary system interaction, surgical treatment of ureteroceles and outcome. three patients with antenatal diagnosis were documented as bilateral hydronephrosis, ' unilateral hydronephrosis and left renal cyst. symptoms and diagnostic reasons for the patients are summarized in table 1. ureterocele localizations were right in 9 patients, left in 9 patients and bilateral in 1 patient. association of duplex systems was detected in 11 patients (6 at the same side, 3 bilateral and 2 contralateral). voiding - cystourethrography (vcug) : we performed vcug in 14 patients and vur was diagnosed in 4 (33%). four - year old girl presented with urinary tract infection and left hydronephrosis treated by endoscopic incision. symptomatology and other diagnostic reasons for the patients with ureteroceles ultrasonography (us) : ureterocele was defined by us showing cystic lesion in the urinary bladder in 13 out of 17 patients (fig. duplex systems were diagnosed in 5, and dilated urinary systems with varying degrees were detected in 15 patients. intravenous urography (ivu) : ivu showed ureterocele in 8 of the 12 patients. grade34 hydroureteronephrosis of a 1.5-year old boy with antenatal diagnosis of bilateral hydronephrosis in ivu. ureterocele - urinary system interaction : in general 15 out of 19 patients were ascertained as having varying degrees of dilated urinary systems - either unilateral or bilateral - depending on the radiological diagnostic methods. dimercaptosuccinic acid scintigraphy (dmsa) : ipsilaterally localized renal scarring and non - functioning upper pole images were taken in 7 of the 13 patients (fig. ureterocele excision and bilateral ureteral reimplantation was performed for right ureterocele and double collecting systems. 3a : wide hypoactive area, dilated and tortuous ureter at the right ; hypoactive area at the lateral middle pole of the left kidney with differential functions of 65% right and 35% left in the dmsa scintigraphy (left). computed tomography and mag 3 scintigraphy were used in one of our patients for differential diagnosis of hydronephrotic mass and obstruction (fig. cystoscopy was used for complementary diagnostic reasons in patients who underwent open surgery and for all patients who were endoscopically treated. surgery for ureteroceles : surgical therapies that we performed in patients are summarized in table 2. type of the surgical procedures applied combined with ureterectomy eight duplex systems + four single systems ureteroceles were totally excised, defective bladder muscles were repaired and ureteral tapering was not performed all patients but one had single system ureteroceles and bladder level reconstruction was needed for one patient subsequently pathological evaluation : tissue specimens of 11 patients were investigated. chronic pyelo - nephritis was diagnosed in resected upper pole kidneys of 3 patients and ureteritis (in association with acute or chronic inflammation) detected in the samples of excised ureterocele tissues of the other 8 patients. patients ' surveillance : one patient died from a probable neurological intracranial lesion. we saw postoperative urinary tract infection in three (two boys, one girl) of the six endoscopically treated patients. postoperative reflux was seen in two patients, one of them had been endoscopically treated. one patient was followed for micturating troubles with bladder dysfunction that became symptomatic postoperatively and lost renal function. none of the patients showed recurrence of the disease except one patient who was recently learned to be reoperated in another center for ureterocele. ratio of gender distribution in our series was 1:7 (female / male) and the average age of our patients was calculated as 5 years. according to literature, 90 % of the patients with ureterocele are diagnosed before the age of 3 years. though there is an increasing number of antenatally diagnosed patients with urological anomalies, toddler age is still the most common period that we treat the patients with ureterocele[4, 5 ]. boys are known as more problematic during the newborn or infancy periods, but symptomatic female infants have been treated who also showed management difficulties. most of the patients with ureterocele are classically diagnosed during the investigation for uti, asymptomatic hydronephrosis and loin mass. although the age of diagnosis is decreasing, uti is still the most common clinical presentation of ureterocele in 50% of the patients promoting physician to make the thorough evaluation of the urinary system[1, 8 ]. depending on the pathological findings such as ureteritis and inflammatory changes detected in the excised tissue specimens, it is suggested that uti helps destruction of urinary tissues as these findings are rarely primary when there is any associated abnormality such as ureterocele, megaloureter, etc. though single system ureteroceles are known as relatively simple abnormalities, they also can show management challenges and damage nephrourinary system like we encountered in our patients. ultrasonography is an easy to perform, non - invasive and probably the best imaging modality for making the diagnosis. we found it as the most successful procedure (76% in the series) in ureterocele diagnosis and for the evaluation of hydro - ureteronephrosis. reflux can occur into the ipsilateral lower pole in almost half of the patients, but contralateral system is also affected with a rate of 25%[13, 5 ]. although lower grades (grade 1 - 2) of vur were detected in our patients, we strongly recommend therapy for reflux in complicating urinary tract infections. in our opinion, those refluxes in association with ureteroceles should not be managed as if vur were the only underlying pathology causing uti. vcug is also beneficial for following up patients with preoperative vur diagnosis or to detect newly forming refluxes after endoscopic interventions. although ivu is not the currently preferred method, it helps to determine the management protocol of the surgical procedure by showing ureterocele (in 66% of our patients), displaying anatomical pathology characteristics and the non - functioning upper poles. dmsa scintigraphy should be undertaken routinely to assess the distribution of function in the duplex kidney and for detecting and follow up of scarred tissue and non - functioning upper poles[1, 4, 6, 10 ]. we found renal scarring in nearly 55% of our patients which is a point of attraction during the management of ureteroceles. scarring indicates parenchymal disruption by ways of dysplastic changes, uti and vur. in current era of endoscopy,. currently we agree with some authors who suggest that upper poles with lower function could be left in their places after bladder level treatment (either endoscopically or surgically) of the ureterocele as these lesions were not progressive or reversible and inflammatory tubulointerstitial nephropathy was the most common pathology encountered in the dysplastic kidneys[5, 1114 ]. chronic inflammatory findings (chronic pyelonephritis) could be the result of or related with recurrent or chronic utis. there is no one report showing the development of malignancy based on this remnant tissue. as we experienced, attention should be paid to diverticular misdiagnosis because a different type of management protocol could be needed. with voiding therefore, ureterocele diagnosis should be confirmed by other diagnostic tools[1, 2, 5 ] (figure 1a). ureterocele and associated pathologies cause dilatation of the pelvi - calyceal systems and ureter by different ways, such as obstruction, vur or primary dysmorphism (figures 2 and 3b)[1, 6 ]. ureterocele is an important pathology causing dilated systems at the time of diagnosis as we detected in 14 (84%) of our patients. dilated urinary systems may play a role in insisting utis during the postendoscopic intervention period by causing improper peristaltic activity and deficiency of urine propulsion. this simple and safe procedure is recommended as the first line treatment of complete duplex system with intravesical ureterocele, particularly for newborns or septic states before the age of one year[15, 16 ]. although ureterocele incision is a good alternative to other surgical methods, all patients need to be followed up for vur, uti and hypertension. individualization in the therapy is still important ; there is not only one surgical method suitable for every type of the anomaly and challenges on this subject still continue [3, 4 ]. in our opinion bladder level surgery ectopic ureteroceles in association with vur particularly are best treated by excision of ureterocele and ureteral reimplantation[14, 18 ]. although low grade (grade 1 - 2) refluxes tend to resolve spontaneously in time, most are symptomatic when associated with ureteroceles. for many patients a staged approach with initial trans - urethral incision, followed by excision and reimplantation can be radical for treating much of the patients. the type of lower urinary tract reconstruction -- whether total or partial excision of ureterocele -- does not seem to affect results19. we made total excision and repaired the defective bladder muscle in patients whom we performed ureterocele excision as bladder level surgery (table 2). regular follow - up of the patients in outpatient departments for longer periods can not be economically efficient. the more important issue is that patients can suffer from morbidity when they fail to comply with doing regular visits. beyond any doubt, reflux nephropathy is an important and premium cause of chronic renal failure and renal transplantation in many countries. individualization in therapy due to different pathological and clinical characteristics of the disease is important and often there is no single solution for the patients ; therefore, family opinion should be added to the management protocol[1, 14, 20 ]. we are still making the diagnosis of ureteroceles in relatively older ages, more often during investigation for uti and vur. although uti caused some problems in the postoperative period, and time was limited to our follow - up periods, none of the patients needed a second operation because of recurrence of the disease or from other complications after radical surgery except one patient mentioned above. | objectivethe aim of the study was to evaluate clinical characteristics of ureteroceles particularly for diagnostic and treatment challenges.methodsdata about patients treated for ureterocele in the two hospital clinics during 1996- 2009 are retrospectively evaluated.findingsthere were 12 girls and 7 boys. symptomatic urinary tract infection was found in twelve cases. ureterocele was associated with duplex systems in eleven cases. vesicoureteral reflux was detected in 4 patients. bladder diverticulum complicated with ureterocele in 1 patient. ultrasonography diagnosed ureterocele in 12 patients. renal scarring was detected in 6 patients at the side of ureterocele. fifteen patients showed varying degrees of hydro - ureteronephrosis. surgical therapy included upper pole nephrectomy in 3 cases. bladder level reconstruction was performed in 11 cases. five patients were treated only by endoscopic incision. in the follow up period 4 patients showed long term urinary tract infections whereas 3 of them were treated endoscopically. postoperative reflux was still present in two patients who were treated by endoscopic incision.conclusionureterocele diagnosis and treatment show challenges. urinary tract infection is important marker for urinary system evaluation. preoperative management generally depends on a combination of diagnostic methods. endoscopic incision needs serious follow up for postoperative problems. |
when recruited from the cytosol to the membrane, many signaling proteins are activated in response to binding lipid activators with their membrane - binding domains. as a paradigmatic class of membrane - binding domains, c1 domains play vital regulatory roles in a large number of signaling proteins such as protein kinase c (pkc), protein kinase d (pkd), diacylglycerol kinase (dagk), and chimerin. each c1 domain contains about 5 short interlacing strands and a c - terminal helix, which are organized around two integral zn ions (figure 1a). in the sequences of c1 domains, a characteristic motif, hx1012cx2cx915cx2cx4hx24cx68c, has been identified, where h and c represent the conserved histidine and cysteine residues to coordinate the zn ions, and x can be any amino acid. it is believed that the hydrophobic half of a c1 domain, comprised primarily of the 12 and 34 loops, penetrates into the hydrocarbon core of the membrane, while the hydrophilic half with zn ions and several ionic residues on the surface is exposed to the cytosol (figure 1b d). despite high sequence homology and structural similarities, the c1 domains of different proteins exhibit wide - ranging binding affinities to anionic lipid coactivators like 1,2-sn - phosphatidyl - l - serine (ps), as well as to neutral lipid activators like 1,2-sn - diacylglycerol (dag) and phorbol-12-myristate-13-acetate (pma). in particular, many typical c1 domains of pkcs bind dag or pma preferentially, while others have comparable affinities to both activators. there also exist atypical c1 domains that bind neither dag nor pma. these differences in binding affinities and preferences are challenging to explain on the basis of the currently available, limited structural data alone. at present merely 13 distinct c1 domains have been deposited to the protein data bank (pdb), and thus there is no three - dimensional (3d) information for over 90% of the c1 domains with known sequences. furthermore, only a single structure in complex with any lipid activator has been solved with x - ray crystallography. as a result, key structural details of c1 domains, for instance, interactions with anionic lipids and dag as well as the protein orientation and degree of membrane penetration, have not been elucidated fully. given the experimental challenges of studying c1 domains in membrane - bound environments, computer modeling and atomistic simulations provide a useful means to explore the detailed interactions and conformations involved in membrane binding and recognition of lipid activators, which will likely enhance our understanding of the c1 domain roles for the function and regulation of signaling proteins. (a) superimposed structures of the pkc c1a domain (a homology model ; red), the pkc c1b domain (pdb code : 2eli ; green), and the ligand - bound pkc c1b domain (pdb code : 1ptr ; gray). the c rmsd is 0.1 between the pkc c1a model and the pkc c1b structure, and 0.7 between the pkc and pkc c1b structures. surface representations of (b) the pkc c1a domain, (c) the pkc c1a domain, and (d) the ligand - bound pkc c1b domain are also shown. in panels b, c, and d, basic, acidic, and neutral polar residues are shown in blue, red, and green, respectively. a combined computational and experimental study is presented in this work with the aim of investigating the interactions between the c1 domains in the pkc alpha isoform (pkc) and their lipid partners (ps, dag, and pma). implicated in a large number of human diseases including cancers, cardiovascular diseases, diabetes and complications, as well as bipolar disorder, pkc is widely studied as a model for conventional pkcs (cpkcs :, i, ii, and isoforms) for understanding how c1 domains regulate signaling proteins. similar to other cpkcs, pkc possesses two tandem c1 domains, namely, c1a and c1b, in addition to a c2 targeting domain and a c - terminal kinase domain. the evidence shows that a mature pkc in its compact inactive state is activated via sequential binding of individual domains to the plasma membrane surface. at first, calcium triggers c2 domain binding to anionic lipids and the entire pkc protein is directed to the membrane. dissociating from the kinase domain, the inhibitory c1a and c1b domains are then recruited to the membrane to bind lipid coactivators (such as ps) and activators (such as dag and pma). this process results in an activated pkc, which catalyzes the phosphorylation of substrate proteins. significant recent progress highlights the importance of the two c1 domains in the activation mechanism, and the need for further computational and experimental efforts are required to better understand the membrane interactions of these domains. a growing body of experimental evidence suggests that the two c1 domains in cpkcs are not equivalent, but the molecular basis for this nonequivalence is only partly understood. for example, although both c1 domains are thought to interact with membranes, some evidence suggests that only one of the two cpkc c1 domains can bind to a lipid activator. other results suggest that, in the case of pkc, both domains bind to activators yet with opposite affinities. it is generally believed that the pkc c1a domain has a higher affinity for dag than the c1b domain, while the latter has a higher affinity for pma. regarding mutations of equivalent or ionic residues, more pronounced impacts appeared in the c1a domain than in the c1b domain on pkc membrane binding and activation. lastly, in the cpkc activation mechanism, recent work indicate that c1a stabilizes the predominant activation intermediate by binding first to the membrane, even in the absence of activating lipid. in this model, recruitment of c1b to the membrane by activating lipid is the key step in kinase activation. to further elucidate the roles of the c1a and c1b domains in pkc activation, it is essential to understand their detailed molecular interactions with membranes. therefore, we have combined computational and experimental approaches in this work to characterize the interactions of the pkc c1a and c1b domains with various lipids in different membrane environments. because of the shortage of experimentally determined structures and membrane - docking geometries of the cpkc c1 domains, it is a challenge to employ computer simulations to compare the two c1 domains from the same cpkc in membrane - bound environments. while most prior docking and simulation studies focused on the c1b domains of pkc and pkc in solution, only the pkc c1b domain has been simulated in a lipid bilayer. to the best of our knowledge, a comparative study of both c1a and c1b domains in membranes has never been reported. given our recent computational and experimental progress in pkc research, it has now become viable to employ a combined approach to reveal and compare details of the two pkc c1 domains in membranes. as presented in this work, we have built the atomistic pkc c1a and c1b models in different membrane - bound environments and performed a systematic investigation combining findings from simulations and experiments. synergy between simulations and experiments enabled us to access structural and dynamic details of the c1 domain - lipid complexes at various spatial and temporal scales. our combined study aimed to help understand the atomistic details of the pkc c1 domain - lipid interactions that have not been fully described before, and to provide valuable new insight about the roles of the c1 domains in pkc regulation and activation. since ps lipid is an essential coactivator for cpkc binding to membranes, we first performed atomistic molecular dynamics (md) simulations with an individual c1a or c1b domain in the 3:1 pc : ps membrane, to examine the interactions between the proteins and ps. in both cases, the c rmsds rise over the first 2026 ns, and then stabilize between 1.5 and 2.0 for the rest of the simulations, which demonstrates structural stability of our membrane - bound protein models. the major deviation from the reference, the pkc c1b structure in solution (pdb code : 2eli), is the increased separation between the 12 and 34 loop tips, defined as the c distance between q46 and f60 in the c1a domain or s111 and l125 in the c1b domain. the increased loop separation leads to opening of the activator - binding groove, albeit to different extents in these two domains (see supporting information (si), figure s1a). the c1b domain shows a slight increase in the loop - tip distance from 11.5 to an average value of 12.2, with a broad distribution from 9 to 16. the conformations sampled in our simulations agree well with the open - loop conformations (12.5) that were observed in an earlier simulation study with the same c1b domain. compared to the c1b domain, the c1a domain appears to possess a wider activator - binding groove, presumably due to the presence of more flexible 12 and 34 loops. the loop - tip distance is generally 23 longer, compared to the corresponding distance of the c1b domain, with a distribution centered at 15.3 (figure s1a (si)). overall, in the absence of activators, the increased separation of the loop tips as well as the resulting open activator - binding groove in the pkc c1 domains, suggests that interactions with pc : ps membrane stabilizes the open - loop conformations and may facilitate activator interactions. ps headgroup density maps of the pkc c1a domain (left panel) and the c1b domain (right panel). the blue contours show the surface density of ps lipid head groups in the lower membrane leaflet based on the 300 ns simulations. with a viewpoint from the bottom of the simulation box, the protein backbones are shown as ribbons and the c atoms of ionic residues as beads. while association with the pc : ps membrane induces conformational changes of the c1 domains, the proteins also shape the local ps distribution. the lateral distributions of the ps head groups are shown in figure 2, which reveals the similarities and differences between the c1a and c1b domains in terms of interactions with the ps lipids. on one hand, given no detectable density in the protein - occupied regions, the ps head groups only associate at the periphery of the c1 domains, remaining excluded from the activator - binding grooves in both cases. it is likely that, in their roles as coactivators, anionic lipids such as ps hardly interfere with activator binding. on the other hand, as shown by the distinct high - density regions, the ps lipids interact with the two c1 domains at very different sites. the pkc c1a domain has a number of basic residues (i.e., r42, k45, k62, k76 and r77) on one face, corresponding to a semiannular region with a high ps density. the other face adjacent to the low - density region is made up mainly of several aromatic residues (i.e., f49, f56, w58, and f72) and an acidic residue d55. in contrast, the pkc c1b domain has high ps density only near two basic residues, k105 and k141. most of the membrane region around the c1b domain shows a much lower ps density than observed around the c1a domain periphery. this phenomenon can not be attributed simply to fewer basic and more acidic residues in the pkc c1b domain than in the c1a domain. our further analysis of ionic residues reveals a stable salt - bridge network in the c1b domain, which leads to the following explanation : two sets of charged residues that are consistently interacting, k103-d133-k105 and k131-d136, form a salt - bridge network in the c1b domain (figure 3). such a salt - bridge network (i) reduces the number of free basic residues and (ii) weakens the protein - ps contacts, so that the c1b domain is less able to attract ps lipids. by contrast, a similar network is not observed in the case of the c1a domain : there are varying electrostatic contacts between residues k76-e80-r77, but the basic residues are still allowed to bind ps lipids (figures 3 and 4). therefore, our simulations suggest that distinct electrostatic detailed interactions are responsible for the observed different association of the pkc c1a and c1b domains with ps lipids. (a) time evolution of intramolecular salt bridges in the 300 ns simulations of the pkc c1a (top panel) and c1b domains (bottom panel) in the pc : ps membrane. the raw and smoothed data are illustrated as thin and thick lines, respectively. (b) structural representations of the salt - bridge network at 290 ns of the apo c1a simulation (pink backbone) and at 293 ns of the apo c1b simulation (green backbone). zn ions are shown as silver spheres. to illustrate the membrane insertion, a shadow box is used to indicate the membrane as a guide for the eyes. the ligand binding sites are open in both conformations. even though transiently in our simulations the pkc c1a domain can bind as many as 45 ps lipids while the pkc c1b domain can bind as many as 23 ps lipids (figure 4), the ps binding stoichiometry (time averaged) is only 1.2 1.0 and 0.3 0.6, respectively. the large uncertainties of those values highlight the dynamic nature of the c1 domain - ps association. each line in the eventplot represents the occurrence of the basic residue with a bound ps lipid. subsequent to these md studies, further evidence consistent with the higher positive charge and ps stoichiometry of the c1a domain relative to the c1b domain has been obtained experimentally by single molecule tirf microscopy (sm - tirfm) studies. illustrated in figure 5, these experiments have revealed that the membrane binding affinity of the c1a domain is much more sensitive to the ps density than the c1b domain. as expected, both proteins bind bilayers more efficiently (relative to pure pc bilayers) when ps lipids are present. interestingly, our sm - tirfm experiments found that the c1a domain has significantly higher affinity for ps - containing membranes than the c1b domain, a finding that follows the trend of their relative ps binding stoichiometry suggested by our md simulations. dependence of c1a and c1b bilayer binding on phosphatidylserine (ps) density. c1a or c1b concentration was fixed at 5 pm and added to supported phosphatidylcholine (pc) bilayers containing (a) increasing amounts of ps lipid or (b) increasing amounts of ps lipid where total anionic lipid was kept at 40% using phosphatidylglycerol (pg) lipid. after a brief incubation to ensure steady state binding, the density of fluorescent, membrane bound proteins was measured for 5 temporally isolated frames from three separate movie streams in three separate titration experiments. in order to remove purely electrostatic binding due to pg lipid, the additional binding signal measured from 0 to 40% ps lipid was removed. the resulting binding is thus due to specific protein interactions with ps since nonspecific electrostatic recruitment has been removed. closer examination of the ps binding events in our simulations shows that none of the identified interacting sites were persistently bound to ps (figure 4). for example, each one of the residues r42, k45, k62, and k76 in the pkc c1a domain was found associated with ps lipids for 2630% of the time and with r77 for 17% of the time, while k105 and k141 in the c1b domain showed association with ps lipids for only about 10 and 18% of the time, respectively. these results indicate that the c1 domain - ps association is not saturated, and thus is not high affinity. however, as depicted by the snapshots from our simulations (figure 4), at least some of the ps binding sites provide multiple headgroup contacts. given the basic residues in the pkc c1 domains, the ps enantiomer (1,2-sn - phosphatidyl - l - serine) appears to be highly suitable to bind more than one of the basic residues, presumably due to the two separated negatively charged centers as well as the stereochemistry. we estimate that 8090% of the c1-ps multivalent contacts in our simulations are better enabled by the physiological enantiomer 1,2-sn - phosphatidyl - l - serine than by the nonphysiological enantiomer 2,3-sn - phosphatidyl - d - serine. this is consistent with the findings of newton and co - workers, which show that the nonphysiological enantiomer 2,3-sn - phosphatidyl - d - serine exhibits significantly lower affinity for pkcs. in addition, our simulations also provide structural evidence to support earlier experiments which discovered that cpkc has higher affinity for ps than for other lipids (like pc, pa, and pe). thus, although there is no high affinity ps - binding site observed in the pkc c1 domains, the multivalent c1-ps interactions can explain the observed stereospecificity of c1 for the ps enantiomer. taken together, the findings of our md simulations and sm - tirfm experiments suggest a simple mechanism for the positive cooperativity observed in experimental c1 domain binding measurements when the bilayer ps density is varied and a fixed bilayer negative charge is maintained (figure 5). in this model, the c1 domain first associates with the bilayer by interacting with a single ps molecule, then subsequently interacts with one or more additional ps molecules. in such a system, the initial ps association will increase the affinities of subsequent ps binding events, leading to positive cooperativity. to explore the detailed c1 domain - activator interactions, we simulated the activator - bound c1 complexes in the pc : ps membrane with additional unbound activators. in the absence of structural information for ligand - bound pkc c1 domains, we tested different activator - bound poses and obtained only one pose for each complex that is stable for the entire 300 ns membrane - bound simulation, with the protein c rmsd mainly fluctuating between 1.0 to 2.6. compared to the activator - free cases, dag binding induced 1.8 and 1.6 decreases on average in the loop - tip distance for c1a and c1b respectively, while pma binding induced 3.0 and 0.5 decreases, respectively, with all ligand - bound states yielding much narrower distributions (see figure s1 (si)). these observations suggest that activator binding leads to closing of the groove and a higher degree of protein rigidity. (a1) structural representations of superimposed dag - bound c1a and c1b conformations. cartoon illustrations of (a2,3) hydrogen bonds between dag and the c1a domain, and (a4,5) hydrogen bonds between dag and the c1b domain. (b1) structural representations of superimposed pma - bound c1a and c1b conformations. (c1,2) illustration of the hydrogen bonds between the activators and the proteins. the association of ps with the pkc c1 domains is not altered significantly in our simulations by the presence of lipid activators. it is estimated that the average number of bound ps lipids for the c1a and c1b domains are 1.0 1.0 and 0.2 0.4 with dag and 0.9 1.0 and 0.4 0.6 with pma, suggesting that the interaction of the c1 domains with ps is still highly dynamic. major sites of ps interaction are identical to the activator - free cases : r42, k45, k62, k76 and r77 in the c1a domain and k105 and k141 in the c1b domain. these results again support the notion that binding of the c1 domains to lipid activators has little direct impact on their association with ps lipids. in order to further examine why the pkc c1a and c1b domains might have opposite affinities to bind dag and pma, surprisingly, a highly conserved hydrogen - bonding pattern is observed, although this pattern does not appear sufficient to account for the different activating lipid preferences of the two domains. the backbone of conserved residues, including t48, i57, and g59 of the c1a domain and t113, l122, and g124 of the c1b domain, form consistent hydrogen bonds with dag and pma (figure 6). the 1-hydroxyl of dag or the 20-hydroxyl of pma, serving as both a donor and an acceptor of hydrogen bonds, connects backbone atoms of i57 and t48 in the c1a domain or l122 and t113 in the c1b domain (figure 6c1,c2). the i57/l22 backbone nh donates a hydrogen bond to the t48/t113 backbone carbonyl, so that the 12 and 34 loops are bridged (figure 6c1,c2). this hydrogen - bonding triangle likely determines the activator orientation in the binding groove. additionally dag and pma also form hydrogen bonds with backbone atoms of g59 and g124 to further anchor the complex conformations. in the absence of water, this hydrogen - bonding network plays a key role for activators to access the binding groove, as well as to stabilize the c1 domains in their membrane - bound states. it is noteworthy that the raf-1 c1 domain, an atypical c1 domain lacking binding to dag, is incapable of forming these hydrogen bonds due to a much shorter 34 loop (see figure s2 (si)), which highlights the importance of these specific hydrogen bonds. while the hydrogen - bonding network involving the protein backbone seems to be conserved among the pkc c1 and the pkc c1b domains, the side - chain polar contacts appear as an obvious difference between dag and pma. in our simulations, the side chains of q63 of the c1a domain and q128 of the c1b domains are hydrogen bonded to not only the backbone of both 12 and 34 loops but also with dag (figure 6a3,a5). no such contact is observed, however, between q63/q128 and pma, since in this case the glutamine side chain is less stretched and can not reach to provide the contacts. our results show further, general evidence to support an earlier finding regarding q128 of the pkc c1b domain, which suggests that this conserved glutamine residue plays a key role to modulate the shape and the contacts of the activator - binding groove. while the conserved hydrogen - bonding network still does not explain the opposite activator lipid preference of the pkc c1a and c1b domains, our analysis of nonpolar contacts does provide a plausible explanation of this disparity. in figure 6d, the number of nonpolar contacts between the activators and the c1 domains are plotted against increasing cutoffs in the definition of the contact distances. dag always has more nonpolar contacts with the c1a domain than with the c1b domain, regardless of the cutoffs employed. the opposite behavior is observed for pma, which always has more nonpolar contacts with the c1b domain. when changing from dag to pma, the number of nonpolar contacts decreases for c1a but increases for c1b. estimates of the pisa interfacial energies show that the c1a - dag complex is more stable than the c1a - pma complex by 2.1 kcal / mol, while the c1b - pma complex more stable than the c1b - dag complex only by 0.8 kcal / mol. these results therefore provide semiqualitative evidence for the binding preferences of c1 domains. moreover, our simulations are also able to identify the most relevant residues (with over 2 activator contacts on average), which include f43, p47, w58, f60, and l63 in the c1a domain when bound to dag, and p112, y123, l125, q128 in the c1b domain when bound to pma. these findings are in agreement with prior mutagenesis experiments, which showed that some of these residues (in particular w58 and f60) are essential for dag activator binding. in addition to dag / pma interactions, we also monitor the unbound ligands in each simulation (see figure s3 (si)). even though the unbound dag or pma molecules are close enough to the c1 domain in our starting conformations, they do not dwell near the proteins. at the end of the 300 ns simulations, all unbound dag and pma ligands move away from the protein, exhibiting a separation of over 10 from the closest protein heavy atom. in line with previous experimental observations, our simulations does not show a secondary site in the c1 domains for dag or pma binding, suggesting a binding stoichiometry of 1:1 for activators binding to each pkc c1 domain. we did not observe obvious tilting of the membrane - bound pkc c1 domains in simulations, as demonstrated by the small values and narrow distributions of the angles between the longest protein principal axis and the z - axis. these angles are 17 8 for the c1a domain and 16 8 degrees for the c1b domain in the pc : ps membrane, while they reach values of 16 8 for the c1a domain and 12 7 degrees for the c1b domain in pc : ps+dag membrane as well as 14 8 (c1a) and 13 9 (c1b) degrees in pc : ps+pma. these results show a consistent orientation of the pkc c1 domains inserted in membranes and confirm once more the overall stability of the models employed in our simulations. furthermore, we examined the membrane penetration of the pkc c1 domains. our simulations show that these two domains are not fixed in the membranes. defined as the distance from the domain center of mass to the n - plane of dopc, the membrane insertion depth of the c1a and c1b domains can vary continuously from the deep state (2) to the shallow state (10), with the distributions shown in figure s4 (si). in the deep state the hydrophobic half of the c1 domains is embedded in the membrane, while in the shallow state the tips of the loops barely touch the membrane. these results confirm, at the molecular level, the two states of the membrane - bound pkc c1 domains identified in our earlier experiments, although the md simulations may not be long enough to fully define the ratio of time spent in the deep and shallow states. the average membrane insertion depth is 3.94.0 for all our constructs except for the pma - bound c1b domain, which has a mean value of 4.4 (see figure s4 (si)). it is suggested that dag or pma binding does not generally modify membrane penetration for the c1 domains except that pma induces the c1b domain to move to more shallow positions. in addition to the orientation and membrane penetration, we have also measured protein diffusion coefficients via simulations as well as by experiments. while such calculations in membranes are very difficult to converge and their results should be viewed with caution, we note that our atomistic simulations compare reasonably well to earlier coarse - grained ones of membrane proteins in free - standing lipid bilayers. although the absolute diffusion coefficients from our atomistic simulations are about 1 order of magnitude larger than the experimental values, we achieve qualitative agreement between simulations and experiments (table 1). in spite of the different membrane constructs (simulations with free - standing bilayers versus experiments with supported bilayers), both simulations and experiments agree that the pkc c1 domains have very similar diffusion coefficients (dl) in membranes with and without activators, except that the pma - bound c1b domain has a much higher dl than other assemblies. as suggested in prior work it is likely that the shallow insertion depths of the pma - bound c1b domain observed in our simulations is related to the increased diffusion coefficient measured in both simulations and experiments. a unique finding from simulations for the pma - c1b complex is that its membrane insertion depth becomes shallower by about 2.8 from 150 to 300 ns. in fact, the fraction of the conformations with insertion depth shallower than 4.4 increases for 20% every 50 ns only for the pma - bound c1b domain, while no obvious increase is observed for other constructs. additionally, unique to the pma - bound c1b domain, the activator tail - to - tail contacts to the pc or ps lipids decrease for 50% from 200 to 300 ns in our long simulation. we therefore hypothesize that the joint effect of weak interactions with the ps head groups and reduced contacts to the membrane hydrophobic core results in a higher occurrence of the shallow state, which could be responsible for the comparatively fast diffusion of the pma - bound c1b domain. the relatively larger effect of pma on the experimental diffusion coefficient of c1b may arise from the longer time scale and spatial dimension of the diffusion measurement. error bars of simulation data were calculated from 2 trajectories of the same construct. error bars of experimental data were calculated from 5 experiments of the same construct, each containing at least 300 trajectories. connecting the evidence from our systematic combined study, we propose the possible detailed membrane - binding mechanism of the pkc c1 domains. compared to the pkc c2 domain, which has been studied in our previous work, we found that the interactions of ps with c1 are weaker than with c2. in line with the previously proposed activation mechanism, the c2 domain rather than for the subsequent activation steps, although the solvent exposure of these two c1 domains in the full - length pkc might differ, our study supports the notion that the c1a domain is recruited to the membrane before the c1b domain due to its much stronger interactions with anionic ps lipids. once it is bound to the membrane, the c1a or c1b domain likely undergoes conformational changes to open the activator - binding groove, while at the same time the entire domain fluctuates between the shallow and deep states of membrane insertion. deep membrane insertion enhances the stability of the open groove conformations, which may relate to the searching mechanism for activators. when a pkc c1 domain binds an activator, the activator - binding groove likely becomes closed, and the entire domain turns more rigid. the conserved hydrogen bonds are important for activator recognition and binding orientation in the membrane - bound environment. however, it is the nonpolar contacts between the c1 domains and the activators that lead to the opposite activator - binding preference. finally, pma binding appears to favor the shallow binding state of the c1b domain, as observed in the md simulations and suggested by experimental diffusion coefficients. the findings of strong nonpolar contacts between pkc c1b and pma, reduced contacts between the membrane and the c1b - pma complex, and abnormally fast diffusion of the pma - bound c1b domain may be relevant to the molecular mechanism of tumor promotion induced by pma and other phorbol esters. we have combined modeling, simulations, and experiments to study the c1a and c1b domains of pkc in membranes, a difficult task with a single approach alone. our findings of previous and current work suggest the following detailed mechanism involving the c1a and c1b domains during pkc activation : after the entire pkc is associated with the membrane, both c1 domains can bind to the membrane during activation. the c1a domain is recruited first with strong interactions to lipid coactivator ps and activator dag, and the c1b domain is recruited later with a preference to bind activator pma. the two pkc c1 domains are encoded in their sequences to play different roles, via the distinct surface electrostatic contacts with coactivors as well as nonpolar contacts with activators. our study has provided evidence to support the notion that c1b binding to the membrane by activating lipids could likely be the key step in the pkc activation model. in addition, corroborating evidence is obtained from simulations and experiments in terms of lipid binding and protein diffusion. simulations and experiments complement each other and enable us to connect evidence in multiple spatial and temporal scales of the c1 domains interacting with membranes. our combined approach will be useful in exploring the roles of the c1 domains in many signaling proteins, even in the absence of detailed structural information, and help to further understand their molecular mechanisms in normal cellular function and disease development. given the approach of atomistic md simulations used here, it is important to be aware of the difference between our simulations and experiments in time and length scales. future efforts will be to develop accurate coarse - grained lipid and protein models to better explain and predict protein dynamics on experimental time scales. in order to gain further information on pkc activation, we are also simulating a full - length model with the knowledge gained from the individual domains in our pkc studies as well as from this work. we have modeled and simulated the individual c1a and c1b domains in membranes and buffers that mimic the experimental conditions. in many experiments, an engineered c1 domain is fused with a 300-residue maltose - binding protein (mbp), which serves to enhance the solubility of the c1 domains. as shown in the supporting information, we confirmed that both the mbp and the peptide linkers have negligible impact on the interactions between the c1 domains and membranes (see figure s5 (si)). it is, therefore, reasonable to only model individual c1 domains in order to understand the detailed protein lipid interactions. at the beginning, the 3:1 pc : ps symmetric bilayer model, containing 120 dopc and 40 dops lipids, was set up with the charmm - gui membrane builder and pre - equilibrated in a water box (containing 150 mm nacl solution) for 20 ns using the charmm36 force field and the desmond 3.0 simulation package. the membrane model was then aligned to the x y plane, perpendicular to the z - axis. the pkc c1b model (residue 102151) was based on the coordinates of the solution structure from residue 1867 (pdb code : 2eli). the pkc c1a model (residue 3786, figure 1) was generated by the homology - modeling server swiss - model, with 42% sequence identity to the template (pdb code : 1ptr). to examine the protonation states of the ionic residues, the protein preparation wizard implemented in maestro (version 9.3, schrdinger, llc, 2012) was used. each zn ion was ligated by three cysteine residues in the thiolate form and one histidine residue singly protonated on the -nitrogen atom in our starting protein conformations. the pkc c1a and c1b models were then combined with the pc : ps membrane. each c1a or c1b structure was aligned, rotated, and moved below the membrane model, so that the long axes of the protein was almost parallel to the z - axis and the tip of the 12 and 34 loops could point toward the lower leaflets of the membranes. as suggested by preliminary experimental data, the protein center was set 6 below the n - plane of dopc in the lower leaflet to insert the protein model into the membrane model. almost half of the c1a / c1b domain was in the lower leaflet, but did not reach the upper leaflet. with system builder in maestro, a water box containing 140 mm nacl and 10 mm kcl was created in each construct, whose boundary was at least 15 from the closest protein or lipid atoms in the z direction. since trapping water between a c1 domain and the membrane is generally unfavorable, water molecules were excluded near the protein membrane interface. dag and pma molecules were inserted to the membrane, in order to model the c1 domains in the presence of activators. the pma - bound models were built according to alignment of the ligand - bound pkc c1b structure (pdb code : 1ptr) to the protein structure in the above - mentioned models, followed by modification of the phorbol ester ligand to pma. since dag has been found to compete with pma for the same binding site, we aligned selected oxygen atoms of dag to the ones of the phorbol compound in the crystal structure, and thus several dag - bound c1a and c1b constructs were built and tested in our search for stable complexes. in addition to the bound activator, two dag or pma molecules were inserted adjacent to the proteins to examine any secondary binding or interacting sites. in short, three membrane compositions (pc : ps, pc : ps+dag, and pc : ps+pma) for the pkc c1a and c1b domains were used to build 6 constructs. each construct contains about 52 000 atoms in a 85 85 85 box with periodic boundary conditions. we applied the tool viparr in desmond to assign all - atom force field parameters. the protein parameters were obtained from the charmm27 cmap force field, except that the thiolate parameters were adopted from a prior report. the charmm36 parameters were used for dopc and dops, and the charmm general force field for dag and pma. after parameter assignment, the starting models were minimized to remove steric clashes and relaxed with the standard protocol in the maestro - desmond package. we used a script in the package with the m - shake algorithm to constrain the bond length of all bonds involving hydrogen atoms, as well as the angle in all water molecules. our production simulations were conducted with desmond 3.0 with a 2 fs time step. the bonded and near interactions were updated every step, while the far interactions were updated every three steps. these semi - isotopic simulations were performed at constant temperature (296 k) and constant pressure (1 bar). the nos the long - range coulombic interactions were treated with the smooth particle mesh ewald method. two replica simulations were run for each construct : a short one for 150 ns and a long one for 300 ns. consistence of our short and long simulations suggests that our simulation time scale is sufficient to remove starting conformation bias. conformational analyses were performed with vmd and pymol (schrdinger, llc). in this work, root - mean - square deviations (rmsds) of protein conformations were computed on c atom pairs with alignment to the reference pkc c1b structure (residue 1867, pdb code : 2eli). a salt bridge or a charged contact is defined when two polar atoms with opposite charges are within 4.0. bound lipids are defined as those which have heavy atoms within 4.0 of the closest protein heavy atom with the opposite charge. a hydrophobic contact is defined when two nonpolar atoms (partial charge < 0.3 unit) are within the cutoff distance. the protein orientation in the membrane is measured as the angle between the protein s longest principal axis and the z - axis. the peripheral diffusion coefficient (dl) of the pkc c1 domains was calculated from the mean - square displacement (msd) over time according to eq 1:1where r is the center of mass vector of the c1a or c1b domain. the overall drift of the lower leaflet was removed from the protein diffusion, and only the second half of each trajectory was used during our msd calculation. the angle between the longest protein principal axis and the z - axis was measured to examine the protein orientation in membranes. to quantify membrane penetration, the membrane insertion depth of the pkc c1 domains was defined as the distance from the protein s center of mass to the closest nitrogen plane of the dopc lipids. reagents and experimental protocols are consistent with previously described work and will be described briefly. bacterial expression constructs of human pkc c1a and c1b regulatory domains were constructed by inserting dna sequences encoding c1a domain (residues 26100) and c1b domain (90165) into a pmal - c2 g expression vector. for each protein, primers were designed to incorporate an n - terminal 11-amino acid recognition sequence for sfp phospho - pantethienyl - transferase to enable sequence - specific enzymatic labeling with a coa - linked fluorophore. the c1a and c1b domains were expressed in escherichia coli rosetta 2(de3) cells (novagen). overnight expression at 20 c was followed by purification on amylose resin (neb) and eluted with excess maltose. the n - terminal sfp labeling tag was covalently modified with an alexa fluor 555-coa by the sfp enzyme, and excess fluorophore was removed using vivaspin concentrators (sartorius stedim, gttingen, germany). to generate supported bilayers, sonicated unilammelar vesicles (suvs) comprised of synthetic dioleolyl phospholipids pc (phosphatidylcholine ; 1,2-dioleoyl - sn - glycero-3-phosphocholine), ps (phosphatidylserine ; 1,2-dioleoyl - sn - glycero-3-phospho - l - serine), dag (diacylglycerol ; 1,2-dioleoyl - sn - glycerol), pg (1,2-dioleoyl - sn - glycero-3-phospho-(1-rac - glycerol)) [all from avanti polar lipids (alabaster, al) ] and pma (phorbol-12-myristate-13-acetate) [from sigma - aldrich (st. tirf microscopy measurements were carried out at 22 c 0.5 c on a home - built, objective - based instrument as previously described. supported bilayers were imaged before and after the addition of physiological buffer (140 mm kcl, 15 mm nacl, 0.5 mm mgcl, 26 m cacl2, 20 m egta, 5 mm reduced l - glutathione, 25 mm hepes, ph 7.4) and a blocking step with bsa in order to account for fluorescent contaminants, which typically were few. after a 5 min incubation with protein, samples were bleached at high laser powers to minimize contributions from immobile fluorescent particles followed by a 60 s recovery. for each sample, multiple movie streams were acquired at a frame rate of 20 frames / s and a spatial resolution of 4.2 pixels/m. particle tracking analysis and fitting were carried out using imagej, graphpad prism 5 and mathematica. | protein kinase c- (pkc) has been studied widely as a paradigm for conventional pkcs, with two c1 domains (c1a and c1b) being important for the regulation and function of the kinase. however, it is challenging to explore these domains in membrane - bound environments with either simulations or experiments alone. in this work, we have combined modeling, simulations, and experiments to understand the molecular basis of the pkc c1a and c1b domain interactions with membranes. our atomistic simulations of the pkc c1 domains reveal the dynamic interactions of the proteins with anionic lipids, as well as the conserved hydrogen bonds and the distinct nonpolar contacts formed with lipid activators. corroborating evidence is obtained from additional simulations and experiments in terms of lipid binding and protein diffusion. overall, our study, for the first time, explains with atomistic detail how the pkc c1a and c1b domains interact differently with various lipids. on the molecular level, the information provided by our study helps to shed light on pkc regulation and activation mechanism. the combined computational / experimental approach demonstrated in this work is anticipated to enable further studies to explore the roles of c1 domains in many signaling proteins and to better understand their molecular mechanisms in normal cellular function and disease development. |
Subsets and Splits