article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
the synthesis methods and the use of nanostructures for various applications have been a very lucrative topic in the last decade. these efforts have lead to discoveries of unknown phenomena and/or new approaches to explain with precision the observed experimental and theoretical facts from the macro / micro world. when all is said and done, the issues in nano - sized devices (individual or arrays) and basic impediments in device operation have not been addressed largely due to not having a perception of end - user requirements, leaving the device s operational bottlenecks unaddressed. this is true for two well - researched opto - electronic materials gan- and zno - based devices like light - emitting diodes and photodetectors. in the case of gan, more emphasis was given to high crystal quality growth, epitaxy, and understanding the mg h complex in determining the p - doping that eventually lead a lone scientist, s. nakamura at nichia chemical industries, japan, to invent the first working solid state blue laser. in case of zno, the large part of the investment from university and industry arenas is still devoted to realizing the p - type doping along with some initial success from m. kawasaki s group at tohoku university, japan that recently demonstrated the first zno p zno is emerging as a potential candidate due to its direct wide bandgap and its ability to tailor electronic, magnetic, and optical properties through doping and alloying. one significant property that has brought zno and its alloys with mg to the forefront of a flurry of research activity is the large exciton binding energy (60 mev when compared to 25 mev for gan) for use in uv lasers. zno has been widely reported as a visible - blind uv sensor over a wide range of applications in military and non - military arenas that includes missile plume detection for hostile missile tracking, flame sensors, uv source monitoring, and calibration. however, recent research in nanostructures of zno has proved that the reduced dimensions have the potential to provide more untapped properties if harnessed in a systematic manner. many simple fabrication techniques, devices, and applications have been demonstrated and reproduced. zno nanoscale structures such as one - dimensional nanowires are attracting more attention because of their enormous potential as fundamental building blocks for nanoscale electronic and photonic devices due to the enhanced sensitivity offered by quantum confinement effects. in this work, we address the prominent defect - related property (could be sum or individual defects due to non - crystallinity, surface charge imbalance, or substrate to film interface strains) that affects the electrical properties of the ensuing device. the phenomenon of persistent photoconductivity (ppc) is a situation in which a photo - induced current in the device continues to flow even after the exciting photon source is turned off. ppc is a major issue in device operation that became a topic of intense research interest during development of gan and algan photodetectors. the motivation of the present work is to understand the origin of ppc in zno by employing a simple device configuration consisting of a metal semiconductor metal structure. ppc is very difficult to observe in bulk materials and needs to be measured at very low temperature, which in turn complicates the carrier transport mechanisms, thus limiting the ability to extract and interpret the exact cause of the problem. this phenomenon is observable in both macro and nanostructured films ; however, the effects are more prominent in nanostructured materials due to singularity in their joint density of states, thus allowing a bulk phenomenon to be observable clearly even at room temperature. zno nanowires were synthesized in a horizontal tube furnace that was programmed for a processing temperature of 800 c with heating rate 10 c min. the source material zn (99.9%) in granular form was placed at the center of the furnace. double side - polished al2o3(0001) and si (100) samples were used as substrates for optical characterization. in the initial stage, when the furnace reached 420 c, the zn metal evaporated and o2gas was introduced with a combined ar / o2gas mixture. the evaporated zn metal formed zno nanostructures when the reactants achieved supersaturation and was deposited on substrates and also on the walls of the tube furnace. the process was carried out for 90 min and samples were removed after the furnace was cooled down to room temperature. zno nanostructures were characterized by environmental scanning electron microscope (e - sem) (electro scan) and photo - luminescence (pl) at room temperature (laser science, inc, model vsl-337 nd - s, 337 nm, 6 mw and ocean optics sd5000 spectrometer) measurements to monitor the morphology and the bandgap. the x - ray photoelectron spectroscopy (xps) measurements were performed using kratos axis 165 spectrometer at a vacuum of 4 10 torr with non - monochromatic mgk radiation. sensors were fabricated on a glass plate with linear silver electrodes of dimension 0.1 cm 2 cm with a gap of 80 m as seen in the schematic, fig. zno nanostructures were dissolved in methanol and then applied to an area between the electrodes. the photoresponse measurements were carried out using a xe arc lamp, a thermo oriel monochromator setup, and lock - in - amplifier measurement setup. the experimental setup was calibrated with standard sic and algan uv sensors, and the output power of the xe arc lamp was measured by a newport standard power meter. to study the effect of oxygen on the photoresponse properties of the zno nanostructure uv sensors, the measurements were carried out in situ in a vacuum chamber at different oxygen pressure levels. figure 2 shows a sem image of the as - grown zno nanowires in the form of a network on al2o3 substrate. the dimensions of the nanowires are approximately 3065 nm in diameter and about 5 m in length. figure 3 shows the x - ray diffraction pattern of zno nanowires grown on si (100) substrate. the pattern clearly depicts distinct peaks at 31.6, 34.49, and 36.27 corresponding to (100), (002) and (101) reflections. the high intensity peak at 34.49 corresponding to the (002) reflection indicates that the zno nanowires are highly c - axis oriented and crystalline in nature. the xps results for zn2p and o1s for zno nanowire films are shown in fig. chemical states and the presence of any possible compositions were analyzed after deconvoluting the spectra. 4a, at 1,022.45 and 1,045.47 ev corresponding to the doublet of zn2p 3/2 and 1/2, respectively, as reported for zno. this asymmetric peak is resolved into three components at 531.1, 532.5, and 533.6 ev. the intense peak at 531.1 ev can be attributed to zno oxygen, whereas the shoulder peaks at 532.5 and 533.6 ev have been assigned to the chemisorbed oxygen. the relative concentration of zn / o is calculated to be close to 1 from the photoelectron cross - sections and kinematic factors indicating the near perfect stoichiometry achieved in the present synthesis method. figure 5 shows the pl spectrum of zno nanowires with a main peak at 386 and at 510 nm under laser excitation of 3.6 ev. the dominant peak at 386 nm is attributed to the recombination of free excitons corresponding to 3.2 ev (386 nm), wide direct bandgap transition of zno nanowires at room temperature. the exciton peak has the sharp full width at half maximum (fwhm) width of 10 nm. the narrow width of the dominant emission is expected in the nanowires as a consequence of better quantum efficiency. the green emission at = 510 nm (2.42 ev) corresponds to deep levels because of the transition between the photo - excited holes and singly ionized oxygen vacancies. the weak green band emission (510 nm) indicates the lower concentration of defects. sem of zno nanowires on al2o3substrate x - ray diffraction pattern of zno nanowires grown on si (100) substrate xps spectra of zno nanostructuresazn 2p 3/2 and 1/2,bo1s core levels pl spectrum of zno nanowires on al2o3substrate. the exciton peak is at 386 nm and the defect peak is at 510 nm. laser excitation is at 3.67 ev the current voltage characteristics with and without uv illumination (that corresponds to the bandgap of zno as observed in pl measurements in room conditions) are shown in fig. the dark (without illumination) current of the nanostructure zno uv sensor was 6 10 a at 1 v. the nanostructure zno uv sensor exhibited a photocurrent of 7 10 a, at 1 v under uv illumination (386 nm) at room temperature and pressure conditions. the lower dark current is a clear manifestation of reduced intrinsic defects as well as interfaces and trap states generated during the processing of the material and the device. on the other hand, the uv sensors fabricated from conventional physical vapor deposition methods exhibited huge dark currents in the 10 a range. the lower dark current observed in the present zno nanostructure devices indicates the better crystalline quality of the material. zno homojunctions formed between the p - type (sb - doped zno hole concentration : 1 10 cm, mobility : 10 cm v s, and resistivity : 6 cm) and n - type zno (ga - doped electron concentration : 1 10 cm, mobility : 6 cm v s, and resistivity : 0.9 cm) exhibited large dark current in the order of 0.4 ma at 1 v due to the presence of a large number of growth - related defects between the film and the substrate. the large magnitude of dark current density indicates that there are considerable defects and dislocations in the zno film grown on a si substrate, which is a typical result of heteroepitaxy between largely mismatched materials. current voltage characteristics of nanostructure zno photoconductor at room conditions with and without uv corresponding to the bandgap of zno when a zno surface is exposed to oxygen, oxygen is adsorbed onto its surface. each adsorbed oxygen ties up an electron from the conduction band creating a space charge layer (fig. this reduces the number of electrons available for conduction near the surface, contributing to a lower dark current. this effect is more prominent in nanostructures because of the near crystalline properties, as opposed to bulk films that tend to grow with enough grain boundaries, which trap / retrap the oxygen as a function of temperature giving rise to instability in measuring the dark current. when a photon of energy equal to or higher than the bandgap is incident on the zno surface, an electron the positively charged hole neutralizes the chemisorbed oxygen, thereby releasing the electron back to the conduction band increasing the conductivity of the sample. the deep localized state (dls) and the perturbed host states (phs) as suggested by lany. are also shown it has been reported in the literature that the oxygen pressure surrounding the zno nanostructures significantly affects the photoconductivity. as the oxygen concentration varies, the width of the depletion region caused by the chemisorbed oxygen also varies, thereby creating a channel that widens or contracts. in order to verify this hypothesis, we carried out photoresponse measurements in controlled oxygen atmosphere in a vacuum chamber fitted with an optical port through which light (250900 nm) can be incident on the nano zno sensor as seen in the schematic (fig the vacuum chamber is fitted with a gas inlet manifold to control o2 gas pressure during the photoresponse measurements. first, the chamber was evacuated to 1 10 torr, sufficiently below the measurement pressure of 8 10 torr. the pressure inside the chamber was increased to 8 10 torr by letting in high purity oxygen gas into the chamber through the other inlet valve. after this set of measurements, o2 gas pressure inside the chamber was increased to 4 10 torr, and photoresponse studies were carried out. finally, the oxygen pressure inside the chamber was raised to 7.6 10 torr and held constant throughout the photoresponse measurements. schematic of photoresponse measurements setup, a vacuum chamber fitted with an optical port through which light (250900 nm) can be incident on the nano zno sensor figure 9 shows the i v characteristics of nanostructured zno uv sensor under uv illumination for background oxygen pressure of 7.6 10, 4 10, and 8 10 torr. table 1 summarizes the current values for dark and uv - illuminated conditions. when the oxygen content surrounding the zno nanostructures was reduced, the amount of chemisorbed oxygen decreases. it was also observed that at higher oxygen pressures, the resistance is high due to saturation giving rise to lower currents. because the chemisorbed oxygen is in equilibrium with the background oxygen, there are photocurrent saturation effects which are dominant at room conditions. however, the saturation effects depend on the geometrical shapes (like spheres in network nanowires) of nanostructures 10 for background oxygen pressures of 7.6 10, 4 10, and 8 10 torr. at higher oxygen pressure (7.6 10 torr), the photoresponse signal gives a peak at 397 nm and gradually drops to zero at 310 nm. the onset of photoresponse occurs at 410 nm with a sharp peak at 397 nm and a broad peak at 367 nm. these peaks are deconvoluted using gaussian distribution functions and correspond to the excitonic and band edge peaks in zno. the photoresponse plot for the background oxygen pressure of 7.6 10 torr has a blind response for the incident light in the visible region. however, as the background oxygen pressure reduces, the photoresponse signal starts responding at unusually higher wavelengths between 780 and 800 nm. the mere indication of a weak response in the visible region provides some insight into evolution of defects. when the incident photon energy reaches the uv region, the main peak at 397 nm plateaus and never fades to zero even after the removal of uv incident light. this effect of photoresponse saturation in the absence of excitation leads to persistent photoconductivity, ppc. the photocurrent decay time at 7.6 10 torr was measured to be 58.5 s and is found to increase to 130 s and 182 s for background o2 pressures of 4 10 and 8 10 torr, respectively. similar results have been reported by jun., where the authors have studied the decay time of zno - nanostructured uv sensor at room conditions and at reduced pressures and have observed slower decay time as the pressure was reduced due to re - adsorption of oxidizing gas molecules. current voltage characteristics of nanostructure zno uv sensor for o2pressures of 7.6 10, 4 10, and 8 10 torr dark, photocurrent and their ratios as a function of background oxygen pressure photoresponse plots for nanostructure zno uv sensor for 7.6 10 torr and vacuum levels of 4 10and 8 10 torr. note the ppc trend when the oxygen pressure is reduced.insetphotocurrent decay time with o2pressure the inverse correlation between the background oxygen pressure and the photocurrent decay time clearly demonstrates the effect of oxygen on the sensor performance. ppc is commonly attributed to the existence of defects, which are metastable between shallow and deep levels and dislocations in the materials. one such defect is the deep unknown center (dx, discussed in the following section), which forms when shallow donors convert into deep donors after a large lattice relaxation. when the background oxygen is depleted (4 10 and 8 10 torr conditions), the zno lattice undergoes a dynamic equilibrium between the chemisorbed oxygen and the interstitial oxygen (anion) vacancies. under these circumstances, the space charge regions then modulate the effective conduction cross - section of the device. in an interesting paper, have shown using first - principal electronic structure calculations that the anion vacancies in ii vi semiconductors as a class of intrinsic defects exhibiting metastable behavior and have predicted that ppc is caused by the oxygen vacancy vo in zno, originating from a metastable shallow donor state. in zno, the anion vacancy, vo, undergoes transformation from relaxed neutral vo to the charged oxygen vacancy vo (charged state) between the defect - localized states (dls) situated within the gap, below and above the conduction band minimum (cbm), termed by the authors as and type behavior, respectively. the origin of these states lies in the interaction of impurity atomic orbitals (constructed from the combinations of the dangling bonds) with the states of ideal vacancy. the dls below cbm (type) with localized wavefunctions do not contribute to conductivity, though occupied by electrons and weakly respond to external perturbations such as pressure and temperature. the dls above the cbm (type) are resonant with the conduction band, and electrons will drop to the cbm to occupy a perturbed host state (phs). the energy state of vo is widened by inward relaxation of nearest - neighbor zn atoms toward the vacancy site resulting in an average zn zn inter atomic distance of 3, whereas while forming vo, the zn neighbor atoms relax outward leading to a configuration with larger zn zn inter - atomic distance of 4. the transition from vo to vo state involves intermediate steps as shown below;(a)(b) when the zn zn inter - atomic distance is modified by inward and outward movement, zn vacancies (vzn) are produced which are intrinsic acceptors. the appearance of a level at ~1.5 ev verifies the evolution of vzn when the background oxygen is reduced. the reaction kinetics of vo thus results in metastable configuration change, constituting the ppc in zno. the above explanation follows very well in the present investigation of ppc phenomenon observed under depleted oxygen conditions. to conclude, the phenomenon of ppc is a defect - related issue that depends entirely on the oxygen atmosphere around a nano - zno device. there has been a major thrust in fabricating nanostructured zno devices for gas, piezo, light, and biosensor applications. mostly, these applications require device to be a resistor type that is prone to change by virtue of ambient rather than the stimulants, thereby opening many research opportunities to passivate the device effectively. the technique and the approach described in this paper can be extended to observe similar effects prevalent in any bulk material systems. authors ssh and nvh acknowledge the constant support from buck sharpton, vice chancellor (research), daniel white, director, institute of northern engineering and acknowledge the financial support from the u.s. | the phenomenon of persistent photoconductivity is elusive and has not been addressed to an extent to attract attention both in micro and nanoscale devices due to unavailability of clear material systems and device configurations capable of providing comprehensive information. in this work, we have employed a nanostructured (nanowire diameter 3065 nm and 5 m in length) zno - based metal semiconductor metal photoconductor device in order to study the origin of persistent photoconductivity. the current voltage measurements were carried with and without uv illumination under different oxygen levels. the photoresponse measurements indicated a persistent conductivity trend for depleted oxygen conditions. the persistent conductivity phenomenon is explained on the theoretical model that proposes the change of a neutral anion vacancy to a charged state. |
they produce mature progenies to replace short - lived cells and repair tissue damage while maintaining their numbers through self - renewing divisions (simons and clevers, 2011). many tissue stem cells are relatively quiescent, which delays their attrition and minimizes the accumulation of deleterious mutations (orford and scadden, 2008). the transit of stem cells between quiescent and activated states is not well understood in most systems. elucidating the mechanisms that control the activation of tissue stem cells is an important goal in stem cell biology. a variety of extracellular signals present in stem cell niches have been shown to influence the activity of tissue stem cells (fuchs., 2004 ; goldstein and horsley, 2012 ; kuang., 2008). for example, bmp signaling induces quiescence, while wnts promote proliferation of skin and blood stem cells (blank., 2008 ; fuchs., however, the cell - intrinsic mechanisms that mediate the activity of extrinsic signals and promote stem cell quiescence or proliferation are poorly characterized. niche signals might act by inducing the expression or activity of transcription factors that in turn regulate the large number of genes differentially expressed between quiescent and active stem cells (lien., 2011 ; martynoga., 2013 ; venezia., transcription factors have indeed been shown to regulate stem cell activity in various tissues by controlling their proliferation, survival, or differentiation (akala and clarke, 2006 ; goldstein and horsley, 2012). however, it is not known in most instances how these factors are regulated (niu. mammalian nervous system, neural stem cells (nscs) are found mostly in two regions of the anterior brain, the dentate gyrus (dg) of the hippocampus and the ventricular - subventricular zone (v - svz) lining the lateral ventricles, where stem cells produce new neurons that integrate into neuronal circuits of the hippocampus and olfactory bulb, respectively (fuentealba. most adult nscs are quiescent and rest in g0, with only a small fraction progressing through the cell cycle at any time. nsc divisions result in the generation of transit - amplifying cells or intermediate progenitor cells (ipcs) that undergo a limited number of rapid divisions before they exit the cell cycle and differentiate into neurons (ming and song, 2011 ; ponti., 2013). clonal analysis in the adult mouse hippocampus in vivo has provided evidence that hippocampal nscs, also called radial glia - like cells (rgls), are multipotent and can generate both neurons and astrocytes, and that they use two modes of divisions to self - renew. some rgls divide asymmetrically to generate a new rgl and an ipc or an astrocyte, while others divide symmetrically into two new rgls (bonaguidi., 2011). a particularly important feature of hippocampal neurogenesis is its regulation by a variety of physiological stimuli (ming and song, 2011). neurogenesis in the hippocampus declines sharply with age, due in part to a reduction of the fraction of rgls that divide, and it is suppressed by stress and depression (lee., 2011 ; ming and song, 2011). conversely, an enriched environment, task learning, or seizures stimulate hippocampal neurogenesis, in part by stimulating rgl divisions (kronenberg. some of the extracellular signals that regulate rgl activity have been identified (ming and song, 2011). in particular, the bmp and notch signaling pathways maintain rgls in a quiescent state (ables., 2010 ;, 2010 ; mira., 2010), while the wnt and igf-1 pathways, among others, promote rgl divisions and stimulate neurogenesis (bracko., 2012 ; jang., 2013 ; lie., 2005 ; little is known, however, of how the activity of physiological stimuli or extrinsic signals is transduced inside rgls to control their divisions. the orphan nuclear receptor tlx is required to maintain rgls in proliferation (niu., 2011 ; qu., 2010 ; zhang., 2008), but how tlx expression and activity are regulated has not been addressed. the proneural transcription factor achaete - scute homolog 1 (ascl1/mash1) is an important regulator of neurogenesis in the embryonic nervous system. it is expressed by dividing progenitors and promotes their proliferation, specification, and differentiation into neurons (bertrand., 2002 moreover, ectopic expression of ascl1 can reprogram various cell types into neurons (berninger., 2007 ; yang., 2011). ascl1 is also expressed in the dg and v - svz of the adult rodent brain, but its function there has not been examined. ascl1 adult expression is mostly confined to ipcs (lugert., 2012 ; parras., 2004 ; pastrana., 2009), but recent genetic lineage - tracing experiments have established that it is also present in self - renewing stem cells in both the v - svz and hippocampus (kim., consistent with this finding, ascl1 was found expressed by a small subset of cycling stem cells in both neurogenic zones (breunig. we show that ascl1 expression is rapidly induced by neurogenic signals in hippocampal rgls, and that ascl1 has a crucial role in rgl activation in both dg and v - svz. ascl1 is specifically expressed in activated adult stem cells and is specifically required for the exit of stem cells from quiescence. to study the function of ascl1 in hippocampal neurogenesis, we first characterized its expression in the adult hippocampus. labeling of 2-month - old mouse brains with a monoclonal antibody against ascl1 showed that in the hippocampus, ascl1-expressing cells are restricted to the subgranular zone (sgz) of the dg (figure 1a). double labeling for ascl1 and the cell proliferation marker ki67 showed that most ascl1-expressing cells are proliferating (figure 1a). double labeling for ascl1 and markers of progenitor cells of the dg neurogenic lineage showed that ascl1 is expressed by three distinct progenitor cell populations. it is expressed by a small subset of rgls, identified by their radial morphology and expression of gfap. most ascl1-positive rgls are activated, as 83.3% 16.7% of them express the cell cycle and cell activation marker mcm2 (machida., 2005 ; ascl1-positive rgls represent 35.6% 3.2% of activated (mcm2) rgls and 2.0% 0.7% of all rgls (figure 1c). ascl1 is also expressed by nonradial gfap cells in the sgz, which are also considered to be hippocampal nscs (lugert., 2010 ; suh., 2007), and by ipcs, characterized by their sgz location, proliferative state, and lack of gfap expression (figure 1d). ascl1-positive ipcs represent 13.5% 4.1% of all ipcs and are subdivided into two subsets that differ in the expression of the ipc marker tbr2 (kempermann., 2004 ; ming and song, 2011). ascl1 is not expressed by more mature cells in the lineage, including doublecortin (dcx) neuroblasts and neun granule neurons (figure s1 ; data not shown). together, these data agree with previous reports showing that ascl1 expression is restricted to the earliest stages of the neurogenic lineage of the adult dg, including proliferating rgls (breunig., 2007 ; kim., 2011) and early ipcs (lugert, 2010, 2012), and that it is downregulated before ipcs begin to express neuronal markers and exit the cell cycle. the fact that ascl1 expression is restricted to activated rgls suggested that this factor might be induced by signals that promote rgl activity and neurogenesis in the hippocampus. to address this possibility, we examined ascl1 expression in mice treated with the ionotropic glutamate receptor agonist kainic acid (ka), a neurogenic molecule that induces progenitor divisions in the dg (lugert., 2010). a single injection of ka in 8- to 9-week - old wild - type (wt) mice produced, as expected, a robust increase in the number of mcm2 rgls in the dg, which became detectable 2 days after injection (figure s2). remarkably, ka induced ascl1 expression in rgls with more rapid kinetics, as the number of ascl1 rgls was already increased 24 hr after injection of ka (figure s2). thus, a significant fraction of quiescent (mcm2) rgls expressed ascl1 at 24 hr after injection (7.8% 1.3% ascl1 mcm2 rgls in ka - injected mice and 1.4% 0.9% in saline - injected mice at 24 hr ; figures 2a, 2b, and s2). the number of ascl1 quiescent rgls decreased, while the number of activated rgls increased at 2 days and 4 days (figure s2). together, these data indicate that ka administration induces ascl1 expression in rgls that are still quiescent. therefore, ascl1 induction precedes rgl activation. to determine whether antineurogenic stimuli also regulate ascl1 expression in the dg, we examined notch signaling. deletion of the notch pathway component rbpjk has been shown to transiently induce the proliferation of hippocampal rgls, followed later by a depletion of rgls (ehm., 2010). we deleted rbpjk from rgls by injecting tamoxifen in 3-month - old mice carrying an inducible rbpjk - mutant allele (glast::creert2 ; rbpjk ; rosa26r - stop - yfp mice, called thereafter rbpjk cko mice). examination of the hippocampus 7 days later revealed a dramatic increase in the numbers of mcm2 activated rgls and of ascl1-expressing rgls in rbpjk cko mice compared with control mice, demonstrating that loss of notch signaling stimulates both the proliferation of rgls and the expression of ascl1 (figures 2c and 2d). a fraction of rgls in rbpjk cko dgs expressed ascl1, and not mcm2 (3.60% 1.50% in rbpjk cko versus 0.25% 0.25% in control mice ; figure 2d), suggesting that like ka administration, inactivation of the notch pathway in rgls sequentially promotes ascl1 expression and quiescence exit. we also examined the effect of voluntary exercise on rgl proliferation and expression of ascl1 and found that it did not significantly increase proliferation of hippocampal rgls, but only that of ipcs, as previously reported (klempin., 2013). together, our results demonstrate that neurogenic stimuli rapidly induce ascl1 expression in quiescent rgls, which in turn suggests that this factor might be implicated in rgl activation. to directly address the role of ascl1 in the activation of dg rgls, we generated triple - transgenic mice that were homozygous for a conditional mutant allele of ascl1 (pacary., 2011) and also carried the glast - creert2 allele to delete ascl1 in rgls in a tamoxifen - dependent manner (mori., 2006) and the rosa26-floxed stop - yfp reporter transgene to identify cells having undergone cre - mediated recombination by their expression of yfp (srinivas., 2001). administration of tamoxifen for 5 days to postnatal day 60 (p60) triple - transgenic mice and control mice (carrying glast - creert2 and rosa26-floxed stop - yfp, but wt for ascl1) resulted in widespread induction of yfp in radial gfap, nestin rgls (figures 3a, 3b, and data not shown). however, examination by immunolabeling revealed that a fraction of sgz cells that expressed yfp and had therefore recombined the rosa26-floxed stop - yfp locus also expressed ascl1 and had therefore not recombined the ascl1 locus, indicating that recombination at the two loci was partially uncoupled (vooijs., 2001). we also examined triple - transgenic mice carrying a different conditional mutant allele of ascl1, in which a pgk promoter - neo cassette remained inserted on the 3 side of the ascl1 locus (ascl1 mice ; figures 3c and s3a). interestingly, even without tamoxifen - induced recombination, ascl1 rna and protein expressions were significantly reduced in the dg of these mice compared with wt mice (figures 3d and s3b), suggesting that ascl1 is a hypomorphic allele (nagy., 1998). analysis of ascl1 mice at p10 did not reveal any overt morphological defect of the dg, and the rate of rgl proliferation was similar to that found in wt mice, indicating that the hypomorphic allele of ascl1 does not result in a developmental defect in the dg (figure s3). tamoxifen administration to these mice at p60p64 resulted in undetectable ascl1 expression in the dg at p90 (ascl1cko mice ; figures 3c, 3d, s3a, and s3b). we therefore used ascl1cko mice in the rest of this study to examine the effect of loss of ascl1 on hippocampal neurogenesis, and we used ascl1 mice to examine the effect of a reduced expression of ascl1. to determine whether ascl1 deletion has an impact on dg rgls, we administered tamoxifen at p60p64 and examined ascl1cko mice 1 month later, at p90. double labeling for yfp and for mcm2, ki67, or bromodeoxyuridine (brdu) after a 2 hr pulse revealed a near - complete absence of proliferating yfp cells in the sgz of ascl1cko mice (ascl1cko mice versus wt mice, 19.65 19.65 versus 4,635 921 yfp mcm2 cells ; 0 versus 2,875 815 yfp ki67 cells ; 9.8 4.9 versus 471.6 115.5 yfp brdu cells), while proliferating cells were present in ascl1 mice, albeit in reduced numbers (2,233 632 mcm2 cells ; 1,225 298 ki67 cells ; 142.8 10.2 brdu cells ; figures 3e3h). moreover, triple labeling for yfp, gfap, and mcm2 to mark activated stem cells or ki67 to mark proliferating stem cells demonstrated a complete absence of recombined rgls that were activated or proliferating in ascl1cko mice, while activated and cycling rgls were present, but less numerous, in ascl1 mice than in wt mice (ascl1cko versus ascl1 versus wt mice, 0 versus 126.3 26.3 versus 281.2 70.1 mcm2 cells ; 0 versus 66.0 29.5 versus 161.2 48.5 ki67 cells ; figures 3i3k ; see also figures s3d s3 g for measures of proliferation in the dg of ascl1 and ascl1cko mice). rarely dividing rgls, characterized by their capacity to retain brdu, were labeled in tamoxifen - injected p90 mice by 10 days of brdu administration followed by 20 days of chase (figure 3l). brdu label - retaining cells were present in wt mice and to a lesser extent in ascl1 mice, but were again completely absent in ascl1cko mice (0 cells in ascl1cko mice ; 9.7 4.9 cells in ascl1 mice ; 43.8 6.2 cells in wt mice ; figure 3l). we could thus demonstrate by several independent methods the complete inability of rgls to exit quiescence and divide in the absence of ascl1, and therefore establish that ascl1 is essential for activation of rgls in the adult hippocampus. interestingly, ascl1 deletion had no significant effect on the rate of rgl proliferation in the postnatal dg. when ascl1 was deleted by tamoxifen administration in ascl1cko mice at p7, rgls continued to proliferate at p10 at a rate that was not significantly different from that seen in wt mice (figure s3h). therefore, the absolute requirement of ascl1 for rgl activity is specific to the adult dg. dividing rgls in the adult hippocampus generate ipcs that proliferate before producing postmitotic granule neurons (bonaguidi., 2011 ; since rgls require ascl1 to divide, the production of ipcs and their neuronal progeny might also depend on ascl1 function. the absence of ki67, mcm2, and brdu cells in the sgz of ascl1cko mice (figures 3f3h) already suggested that ipcs are indeed missing in these mice. we further examined neurogenesis by double labeling the hippocampus of ascl1cko mice for yfp and for tbr2 to mark ipcs, for dcx to mark neuroblasts, and for neun to mark granule neurons (kempermann. no yfp cells expressed these markers in the dg of ascl1cko mice at p90, demonstrating that no new ipcs or granule neurons were produced in these mice (figures s3i s3k ; data not shown). ascl1 is therefore absolutely required for the generation of ipcs and for neurogenesis in the hippocampus. we also examined neurogenesis in the v - svz of ascl1cko mice to determine whether the role of ascl1 in adult rgls extends to the other main neurogenic region of the adult rodent brain. analyzing the expression of gfap, dcx, egfr, and gfp in ascl1cko and wt mice showed that deletion of ascl1 results in a severe decrease in the fraction of rgls of the v - svz that are activated (gfap egfr) and proliferate (brdu label retaining), and in a severe reduction in the production of dcx neuroblasts (figures 4 and s4) therefore, ascl1 is essential for nsc activation and proliferation and for neurogenesis in the two main neurogenic regions of the adult brain. ascl1 is expressed in proliferating rgls, and the loss of ascl1 results in an arrest of rgl proliferation, suggesting that this gene is required in rgls to promote their divisions. however, ascl1 is also expressed in some ipcs, raising the alternative possibility that ascl1 is primarily required for the generation and/or division of ipcs, and that the arrest of rgl divisions is a secondary consequence of the loss of ipcs. in particular, a loss of ipcs might disrupt notch signaling in the sgz, resulting in a transient increase in rgl proliferation, followed later by a reduction of proliferation due to rgl exhaustion (ables. rgl proliferation was monitored in ascl1cko mice just 4 days after the beginning of tamoxifen administration at p60. rgls had already stopped dividing in p64 ascl1cko mice, indicating that the effect of ascl1 deletion on rgl proliferation is rapid and therefore likely direct (figures 5a and 5b). moreover, although rgls in the dg of p64 ascl1cko mice are mostly yfp and have therefore recombined (figures 3b and 5a), wt tbr2 ipcs and dcx neuroblasts that were produced by rgls before tamoxifen administration at p60p64 are still present (figure 5c). this suggests that the rgl proliferation defect is not the consequence of a loss of ascl1-mutant ipcs and neuroblasts, i.e., ascl1 is required cell autonomously for rgl divisions. to more rigorously address the cell autonomy or noncell autonomy of ascl1 function, we performed a mosaic analysis. we activated creert2 in a fraction of rgls with only one injection of tamoxifen at p60, resulting 1 month later in an intermingling of recombined yfp - positive rgls and nonrecombined yfp - negative rgls and their progenies (figure 5d). in wt mice that had received a single tamoxifen injection, a fraction of recombined yfp rgls was proliferating (figures 5e and 5f). in contrast, recombined yfp rgls did not proliferate in mosaic ascl1cko and ascl1cko mice, irrespective of the recombination efficiency (figures 5e, 5f, and s5). therefore, the proliferation defect of ascl1-mutant rgls can not be rescued by the presence of nearby wt cells, demonstrating that ascl1 is required cell autonomously in rgls for their divisions. next, we examined the phenotype of the cells remaining in the sgz after ascl1 deletion. antibody labeling of the dg of p90 ascl1cko mice revealed that these cells retain the typical radial morphology of rgls and maintain expression of the rgl markers gfap, nestin, and sox2 and do not express the astrocytic marker s100 or the oligodendrocyte progenitor marker olig2 (figures 6a, 6b, and s6a s6c). rt - pcr analysis showed that expression of p16/cdkn2a was not elevated in the dg of ascl1cko mice, suggesting that rgls in these mice do not become senescent (molofsky., 2006). moreover, rgls in ascl1cko maintained normal levels of the cyclin - dependent kinase inhibitor p57, which is required for quiescence of hippocampal rgls (furutachi., 2013). these data, together with the lack of mcm2 expression in ascl1-deficient rgls (figure 3j), show that ascl1 is not required for the maintenance of rgls, but specifically for their activation, and that loss of ascl1 keeps rgls in an inactive and undifferentiated state. although ascl1-deficient rgls are unable to proliferate when in a steady state, they might still be able to respond to a potent neurogenic stimulus such as ka. we therefore injected tamoxifen in ascl1cko mice at p60 to delete ascl1, then injected ka at p86 and analyzed the dg at p90. ka failed to activate rgls in ascl1cko mice, while it strongly activated them in wt mice (figures 6e and 6f). therefore, loss of ascl1 in rgls results in an inactive state that can not be reversed by ka stimulation. we also confirmed the inactivated state of ascl1-deficient rgls by performing an in vitro neurosphere assay in the presence of mitogens (ehm. the dg was dissected from 7- to 8-week - old mice and dissociated, and single - cell suspensions were cultured at clonal density in the presence of fgf2 and egf. cultures of wt dg cells produced large numbers of primary neurospheres that generated secondary neurospheres when passaged. in contrast, ascl1cko dg cell cultures produced very few neurospheres, and antibody labeling showed that these neurospheres maintained expression of ascl1 and therefore originated from cells that had escaped recombination (figures 6 g, 6h, and s6e). therefore, ascl1-deficient rgls are quiescent and unable to respond to mitogens and divide in vitro. we next examined whether the inactive state of ascl1-deficient rgls was stable over a longer period. analysis of ascl1cko mice 5 months after ascl1 deletion, at p210, showed that rgls retained a radial morphology and gfap expression and remained ki67 negative (figure 6i). interestingly, while the total number of rgls in the dg of wt mice decreased considerably between p65 and p90 and decreased further at p210 (22,116 1,681 at p65, 14,453 1,021 at p90, and 12,516 1,063 at p210), their number in ascl1cko mice did not change between p65 and p90 and decreased only slightly and nonsignificantly at p210 (24,533 1,399 at p65, 26,098 1,913 at p90, and 20,764 395 at p210 ; figure 6j). as the age - related attrition of hippocampal rgls is thought to result from non - self - renewing divisions (bonaguidi. 2011), the maintenance of rgl numbers in older ascl1cko mice supports the finding that rgls do not divide in these mice. to identify target genes that mediate the proliferative role of ascl1 in hippocampal stem cells, we examined the genome - wide binding of ascl1 in adult hippocampus - derived nscs (knobloch., 2013) by chromatin immunoprecipitation - sequencing (chip - seq) with an anti - serum against ascl1 (figures 7 and s7). ascl1 was bound to 7,826 high - confidence sites in the genome of ah - nscs (figure 7a), a majority of which mapped to enhancers previously identified in cultured nscs (figure 7b ; martynoga., 2013). moreover, a large fraction of enhancers active in proliferating nscs featured an ascl1-binding event in ah - nscs (figure 7c). we then established a list of the genes associated with an ascl1-binding event in the ah - nsc genome (table s1) and searched for candidate direct targets of ascl1, i.e., genes that are both bound by ascl1 and misregulated in rgls of ascl1cko. we reasoned that since ascl1 is required for nsc proliferation in both dg and v - svz, it might regulate some of the same genes in the two tissues. we therefore intersected our list of ascl1-bound genes with a recently published list of v - svz genes enriched in activated nscs compared with quiescent nscs (figure s7 ; table s2) (codega., the 250 genes that are both bound by ascl1 in ah - nscs and enriched in activated v - svz nscs include, in addition to known ascl1 targets such as the notch ligands dll1 and dll3 (castro., 2011), several cell - cycle regulators such as e2f1, ccnd2, cdc6, and skp2. to establish whether these genes are regulated by ascl1 in dg rgls, we used fluorescence - activated cell sorting to purify yfp cells from the dg of ascl1cko and wt mice 4 days after tamoxifen treatment, and we analyzed gene expression by qrt - pcr. we found that the cyclin ccnd2 and the ribonucleotide reductase subunit rrm2 were significantly downregulated when ascl1 was deleted in rgls, while e2f1 and cdc6 expression were not detectable in either wt or mutant cells, and expression of skp2 and non - cell - cycle genes such as fbl were not significantly reduced (figure 7e). together, these data demonstrate that ascl1 controls the proliferation of hippocampal rgls by directly activating the expression of ccnd2, rrm2, and possibly additional cell - cycle genes. stem cells in adult tissues respond to environmental signals by adjusting the production of mature cells to the needs of the tissue. deciphering the pathways that link physiological stimuli to nsc we show in this study that signals regulating hippocampal stem cell activity control the expression of ascl1, and that this factor has an essential role in stem cell activation. ascl1 expression in the adult brain has often been described as being restricted to ipcs in the svz and dg (lugert., 2012 ; parras., 2004). we found, however, that ascl1 is already expressed in proliferating rgls in the hippocampus, in agreement with earlier studies (breunig. ascl1 expression is then presumably maintained by the ipcs that are produced when rgls divide. most ascl1 rgls are activated, but only about a third of activated rgls express ascl1 detectably, which might be due to an oscillation of ascl1 expression in activated rgls as in embryonic neural progenitor cells (imayoshi., 2013). the results of our experiments with ka - injected mice suggest that neurogenic stimuli such as neuronal activity promote stem cell activation in the hippocampus by inducing ascl1 expression in quiescent rgls. the essential role of ascl1 in the activation of adult nscs suggests that other neurogenic signals controlling this step, including wnt signals in the hippocampus (jang., 2013 ; qu., 2010, 2013 ; seib., 2013) and vegf in the v - svz (calvo., 2011), might also act by inducing ascl1 expression. our results with rbpjk conditional mutant mice also suggest that antineurogenic stimuli, including the notch pathway, suppress stem cell activity by repressing ascl1 expression in rgls. the mechanism by which the notch - rbpjk pathway represses ascl1 expression can be inferred from studies in the embryonic brain and in cancer cells, which have shown that the notch - induced he s factors directly repress the ascl1 gene (kageyama., 2005). moreover the maintenance of hippocampal stem cell quiescence by bmps (mira., 2010) may involve an inactivation of ascl1 protein by bmp effectors i d proteins, which are known to block ascl1 activity by preventing its dimerization with e proteins (nakashima. foxo3, which acts downstream of the insulin / igf-1 signaling pathway to maintain hippocampal stem cell quiescence, shares many targets with ascl1 and may also function by antagonizing ascl1 function (webb., inactivation of ascl1 protein in rgls that have begun to transcribe the ascl1 gene may be important to slow down the transition to an active state or to accelerate the return of active rgls to quiescence. mice carrying the hypomorphic allele ascl1 express ascl1 in the dg at a reduced level and retain only a small fraction of the proliferating rgls found in wt mice (figure 3). the finding that a change in ascl1 expression level translates into a change in the fraction of rgls that proliferate suggests that extrinsic signals may fine - tune the rate of hippocampal neurogenesis by modulating the expression level of ascl1, as shown for pdk1/akt signaling, which regulates ascl1 protein stability in the embryonic brain (oishi., 2009). a cell that exits quiescence and transits from the g0 to the early g1 phase of the cell cycle assembles a prereplication complex that contains minichromosome maintenance proteins, including mcm2. mcm2 expression therefore marks not only cycling cells, but also activated cells that have exited the quiescent state but not yet re - entered the cell cycle (niu. the glutamate receptor agonist ka induces the expression of ascl1 before that of mcm2, indicating that ascl1 induction is one of the first steps in the pathway through which neuronal activity promotes the activation of quiescent rgls. since mcm2 is not expressed in ascl1-deficient rgls even after ka stimulation, ascl1 is also absolutely required for the quiescence exit of hippocampal rgls. because ascl1-deficient rgls do not exit the quiescent state, it is not possible to ascertain whether ascl1 also regulates the cell - cycle progression of rgls. however, ascl1 promotes the proliferation of progenitor cells in the embryonic brain (which do not enter quiescence), and it directly regulates the expression of cell - cycle regulatory genes in ah - nscs, including ccnd2 and rrm2, suggesting that it promotes the divisions of hippocampal rgls in addition to their activation. ascl1 has previously been shown to promote cell proliferation in cancer cells and in the injured zebrafish retina by regulating wnt - signaling genes (osada., 2008 ; ramachandran., 2011 ; rheinbay., ascl1 has been shown to bind a site near the wnt antagonist gene dkk1, whose regulation mediates ascl1 activity in these cells (rheinbay.,, ascl1 does not bind this site and many other sites bound in gbm cscs, and reciprocally, many ascl1-bound loci were found in ah - nscs, and not in gbm cscs, including sites near the cell - cycle regulators e2f1, ccna1, ccnd2, and skp2 (data not shown), suggesting that ascl1 controls the proliferation of hippocampal rgls by regulating different genes from those regulated in cancer cells and the injured retina. transcriptomic and genetic studies suggest that nscs undergo profound changes in their oxygen and lipid metabolisms and cell adhesion properties when they exit quiescence (knobloch., 2013 ; martynoga., 2013 ; further characterization of ascl1 target genes in rgls should elucidate whether ascl1 directly controls these physiological changes in addition to promoting cell - cycle re - entry and cell - cycle progression. whether ascl1 acts through the same downstream mechanisms in the two adult neurogenic regions remains to be addressed. in contrast with the complete lack of rgl activity in the adult dg in the absence of ascl1, rgl proliferation was not significantly affected by ascl1 deletion in the early postnatal dg, supporting our earlier finding that ascl1 is not required for dg morphogenesis during embryonic development (galichet., 2008). interestingly, cell proliferation in the dg becomes also increasingly dependent on the ascl1 target ccnd2 between early postnatal and adult stages (ansorg., 2012). therefore, a switch in the genetic control of dg rgl proliferation occurs during the first few weeks of life, with the activation of a mitogenic pathway involving ascl1 and ccnd2. ascl1-deficient rgls remain in ascl1cko mice for at least 5 months without dividing, differentiating, or dying. the permanent cell - cycle arrest can be readily explained by the cell - autonomous role of ascl1 in rgl activation. the lack of astrocyte differentiation may also be partially explained by the absence of proliferation, as astrogenesis is normally coupled to rgl divisions (encinas., 2011). however, astrocytes can also be generated by direct differentiation of rgls without cell division (bonaguidi., 2011). in the embryonic brain, activation of notch signaling by ligands presented by ipcs and young neurons switches neurogenic progenitors to an astrocytic fate (namihira., 2009). in the hippocampal sgz, ascl1 deficiency greatly reduces the expression of the notch effectors hes1 and hes5 (figure s6d), likely due to the elimination of notch - ligand - presenting ipcs and young neurons. the resulting decrease in notch activity may thus block the astrocytic differentiation of ascl1-deficient rgls. numerous transcription factors have been shown to stimulate the self - renewal of stem cells in tissues such as the blood and the skin (akala and clarke, 2006 ; goldstein and horsley, 2012). these factors often act by regulating multiple aspects of the biology of the stem cells ; for example, by suppressing their differentiation, senescence, or apoptosis (lieu and reddy, 2009 ; souroullas., 2009). only a few factors, such as gata3 in hematopoietic stem cells (ku., 2012) and runx1 in hair follicle stem cells (osorio., 2008), have been proposed to primarily regulate adult stem cell divisions. in the brain, the orphan nuclear receptor tlx promotes hippocampal nsc proliferation through induction of wnt7a and repression of p21/waf1 (niu., 2011 ; the function of ascl1 of controlling adult stem cell activity in response to environmental signals is therefore so far unique in the adult brain. it is akin to that of myod in muscle satellite stem cells, which is expressed shortly after quiescent satellite cells have been activated, and which in turn induces the expression of the component of the prereplication complex cdc6 (zhang., 2010). identifying the molecular pathways that control ascl1 expression at transcriptional and posttranscriptional levels will be important in order to learn how to manipulate hippocampal neurogenesis for therapeutic purposes. mice were housed, bred, and treated according to the guidelines approved by the home office under the animal (scientific procedures) act 1986. all experimental procedures involving mice have been approved by the animal welfare and ethical review panel of the national institute for medical research. rbpjk animals were generated as previously described (han., 2002) and bred to glast::creert2 bac transgenic mice (slezak., 2007). ascl1 mice, in which exon 1 of the ascl1 gene is flanked by loxp sites (pacary., 2011), were bred with glast - creert2 knockin mice (mori., 2006) and with rosa26-floxed stop - yfp reporter mice (srinivas., 2001) to generate glast - creert2 ; ascl1 ; r26 yfp mice, which are heterozygous for glast - creert2 and homozygous for ascl1 and r26 yfp. both glast::creert2 and glast - creert2 lines target both radial and horizontal astrocytes in the dg. in order to remove the pgk promoter - neo cassette from the ascl1 locus, ascl1 animals were crossed with act-flp mice (the jackson laboratory). for activation of the creert2 recombinase for mosaic experiments, p60 animals received a single tam injection at the same concentration. all animals including wt and ascl1 mice received tam injections. to examine proliferating progenitors, mice received a single i.p. injection of brdu 2 hr prior to tissue collection. to examine slowly dividing rgls, mice received 5 daily brdu injections followed by 5 consecutive days of brdu - containing drinking water. animals that did not display rearing and falling were sacrificed 1, 2, or 4 days later and processed as described below. brains were postfixed with 4% pfa for 2 hr at 4c and sectioned coronally at 40 m with a vibratome. labeled cells were counted in every ninth 40 m section through the entire rostrocaudal length of the dg (0.82 mm to 4.24 mm from bregma). counted cells were divided by the number of z planes counted to obtain the number of cells per 1 m, and then multiplied by the total length of the dg. to count rgls (gfap radial cells), cells were deemed radial if the cell body clearly associated with a dapi - positive nucleus was located in the sgz and had a single radial process extending through at least two - thirds of the granule layer. in all figures, the cell numbers counted in wt and ascl1cko mice are numbers of yfp marker double - labeled cells, while the numbers counted in ascl1 mice are for ki67 cells only, since yfp is not expressed in these mice. coronal sections 14 m long were cut from fresh - frozen brains in oct with a cryostat and placed on slides. the sgz of wt, ascl1, and ascl1cko mice was excised by a plam laser - capture microdissection system (zeiss) and collected in an adhesive cap. rna from microdissected tissue was extracted and purified using arcturus pico pure rna isolation kit (applied biosystems) and reverse transcribed using the high - capacity cdna reverse transcription kit (applied biosystems). statistical analyses were conducted using a two - sample t test with equal variance in prism software. clonal primary and secondary neurosphere cultures were performed from dissociated dg dissected from 7- to 8-week - old mice as described (walker., 2013). the number of neurospheres per well was counted 10 days after plating. for chromatin immunoprecipitation, adult hippocampus - derived nscs were fixed and processed as described (castro., 2011) and immunoprecipitated using a rabbit anti - ascl1 antibody (abcam, ab74065, 4.5 g per chip sample). dna libraries were prepared and sequences analyzed as described (martynoga., 2013). a total of 13.5 million nonredundant reads were used to call peaks, and only peaks with an fdr - corrected q value 1 10 were used for the analysis. p300 and h3k27ac data and active enhancer definitions in nscs were from martynoga.). | summarythe activity of adult stem cells is regulated by signals emanating from the surrounding tissue. many niche signals have been identified, but it is unclear how they influence the choice of stem cells to remain quiescent or divide. here we show that when stem cells of the adult hippocampus receive activating signals, they first induce the expression of the transcription factor ascl1 and only subsequently exit quiescence. moreover, lowering ascl1 expression reduces the proliferation rate of hippocampal stem cells, and inactivating ascl1 blocks quiescence exit completely, rendering them unresponsive to activating stimuli. ascl1 promotes the proliferation of hippocampal stem cells by directly regulating the expression of cell - cycle regulatory genes. ascl1 is similarly required for stem cell activation in the adult subventricular zone. our results support a model whereby ascl1 integrates inputs from both stimulatory and inhibitory signals and converts them into a transcriptional program activating adult neural stem cells. |
methods and any associated references are available in the online version of the paper at http://www.nature.com / naturemedicine/. | t - cell acute lymphoblastic leukemia (t - all) is an immature hematopoietic malignancy driven mainly by oncogenic activation of notch1 signaling1. in this study we report the presence of loss - of - function mutations and deletions of ezh2 and suz12 genes, encoding critical components of the polycomb repressive complex 2 (prc2) complex2,3, in 25% of t - alls. to further study the role of the prc2 complex in t - all, we used notch1-induced animal models of the disease, as well as human t - all samples, and combined locus - specific and global analysis of notch1-driven epigenetic changes. these studies demonstrated that activation of notch1 specifically induces loss of the repressive mark lysine-27 tri - methylation of histone 3 (h3k27me3)4 by antagonizing the activity of the polycomb repressive complex 2 (prc2) complex. these studies demonstrate a tumor suppressor role for the prc2 complex in human leukemia and suggest a hitherto unrecognized dynamic interplay between oncogenic notch1 and prc2 function for the regulation of gene expression and cell transformation. |
elimination of vertical transmission of hiv is a global priority, yet progress remains marred by severe disparities across regions. while it is almost a reality in developed country settings, in many resource - poor settings, only an estimated 15% to 30% of eligible women complete the prevention of mother to child transmission (pmtct) cascade. weak health systems, unreliable infrastructure, breakdowns in supply chains and lack of health staff contribute to insufficient service coverage, but it is increasingly clear that many barriers to achieving universal access for pmtct occur outside of formal health services. each setting will have its own specific mix of barriers to pmtct uptake, adherence and retention that reflect prevailing behavioural norms, cultural beliefs and the policy environment. understanding context - specific barriers is the first step to addressing them, followed by design of interventions that are informed by the evidence base yet tailored to each setting. this paper presents work commissioned by the elizabeth glaser pediatric aids foundation (egpaf) that aimed to identify and synthesize research findings on community - based approaches used in developing country settings to overcome barriers to pmtct enrolment, retention and successful outcomes. the goal was to identify which interventions work, why they may do so and what knowledge gaps remain, focussing on the following four priority outcomes within the egpaf community initiative : increased uptake of hiv care and treatment services among pregnant women and vertically infected children;improved retention of individuals enrolled in prevention for vertical transmission and care and treatment programmes;enhanced adherence of pregnant and lactating women, their partners and children to arv prophylaxis and/or antiretroviral treatment (art) and/or other care regimens;strengthened psychosocial wellbeing of pregnant and lactating women and children enrolled in care and treatment programmes. increased uptake of hiv care and treatment services among pregnant women and vertically infected children ; improved retention of individuals enrolled in prevention for vertical transmission and care and treatment programmes ; enhanced adherence of pregnant and lactating women, their partners and children to arv prophylaxis and/or antiretroviral treatment (art) and/or other care regimens ; strengthened psychosocial wellbeing of pregnant and lactating women and children enrolled in care and treatment programmes. the four priority outcomes indicate progress along a treatment continuum or cascade, commonly used in the literature to depict an individual s trajectory from before hiv diagnosis, through each stage of successful enrolment in treatment and care, to measurable improvements in physical and mental health (fig. the treatment cascade can be made specific to pmtct by defining each stage to reflect who programmatic guidelines. losses at each stage have been well - documented, and as suggested by the concept of a cascade, a consistently diminishing proportion of people transition between each step. there is now an extensive literature on the barriers faced along the cascade, including in developing country settings due to rapid growth in provision of art in recent years. this section summarizes some of the most commonly cited barriers to set the backdrop to our review of intervention approaches used to overcome them. as studies documenting barriers specific to preventing vertical transmission are limited, lessons can be drawn from related programmes, such as hiv counselling and treatment (hct), general provision of arv and efforts to improve rates of skilled attendance at delivery (for all women, regardless of hiv status). the same barriers can operate at more than one stage of the cascade and may interact or reinforce each other at different times, depending on an individual s evolving circumstances, so that even if a person is able to take up treatment early on, she / he may find it difficult to maintain levels of retention and treatment compliance. the identified barriers are as follows : risk perception : while hiv - related knowledge is now widespread, individuals need to perceive themselves to be at risk to seek hct. widespread association of hiv with promiscuity and illicit sex (i.e., with sex workers or extramarital partners) creates a false sense of security for some. women in monogamous marriages, for example, may consider themselves at low risk and may not present for testing early enough in a pregnancy for optimal initiation of pmtct. motivation / self - efficacy : even when pregnant women are concerned about their status, they may lack motivation or self - efficacy to undergo testing, particularly if they need to make complicated logistical arrangements or explain their absence from home. fear of receiving a positive result has been found to be a disincentive to hiv testing during pregnancy. depression has been linked to lower arv adherence while episodes of ill - health compromise ability to maintain appointments. family relationships : household inequities in access to resources can mean women rely on others to decide whether or not they initiate pmtct. male partners play a significant role ; some women refuse hct or do not collect their results, fearing partner disapproval. threats of intimate partner violence (ipv) also reduce enrolment in pmtct and studies have shown that women living with hiv can experience higher levels of ipv than others. where male partners are involved in hiv testing and antenatal care, on the other hand, women are statistically more likely to accept arv prophylaxis [2022 ], deliver in a facility and attend follow - up care. disclosure of hiv status : pregnant women s disclosure to partners is positively associated with service use, while those who keep their status secret find it challenging to store and take medications. disclosure to partners also makes it more likely that hiv - positive mothers will follow infant feeding recommendations. social support : anticipating and receiving social support proves important for programme retention and is associated with drug adherence, while pressure from family members, particularly mothers and mothers - in - law, discourages hiv - positive women from departing from traditional breastfeeding and weaning patterns. travel : distance to facilities and cost of transportation affect testing, collection of results and health - seeking behaviours. hiv stigma : a five - country comparative study found a statistically significant relationship between perceived stigma and neglecting to take all prescribed pills. several other reviews of barriers to treatment confirm the importance of anticipated stigma, as well as perceptions of poor service quality (i.e., unfriendly staff, long waiting times and fear of stock - outs). social networks : qualitative studies examining adherence in botswana and tanzania found that, when clients do not have strong social networks in the community, motivation to remain in treatment is reduced. health and religious beliefs : prevailing norms and traditional world views shape how people engage with services. if hiv is believed to result from bewitchment or spiritual forces, alternative treatments may be sought. traditions related to pregnancy care, delivery and breastfeeding interact with advice received from health professionals, affecting willingness to comply with pmtct requirements [3941 ]. gender roles : accepted power dynamics between men and women determine how scarce resources are allocated and often do not prioritize women s health. gender norms also affect male partners behaviour, and expectations of male and female responsibilities pose barriers to male involvement in pregnancy and infant care. policy environment : provision of social welfare or insurance schemes, health systems functioning and a country s economic and political stability will all affect service use and health outcomes across the continuum. although not an exhaustive list, the barriers summarized above were felt to capture the majority of challenges confronted by on - the - ground pmtct programmes, such as those offered by egpaf and its partner organizations health outcomes are increasingly recognized as being shaped less by individual behaviour and more by the wider environments in which people live and make choices, influenced by family and peers, local beliefs and values, cultural norms and practices and political and economic circumstances [4649 ]. the use of social ecological frameworks illustrates inter - relationships between proximate and distal determinants of health [5053 ] and have been found useful in understanding hiv treatment adherence and programme retention. they demonstrate the way in which an individual s behaviours and health outcomes are nested within different levels of social organization, visually depicted as overlapping concentric circles, through which pathways of influence can take multiple routes. figure 2 illustrates the social ecological framework that we developed to guide our literature review, in keeping with recent approaches used to identify and synthesize available evidence driven by theoretical models rather than specific research questions. each of the barriers to seeking, obtaining and remaining in pmtct care, as summarized previously, has been situated at the level of social influence where it is most likely to operate. individual pregnant women remain at the core of the framework, but their choices are embedded within multiple layers. we used this framework to develop our review strategy for identifying community - based approaches implemented in developing countries to address one or more barriers along the pmtct care continuum. similar conceptually driven reviews have been conducted to understand determinants of access to services for sexual and reproductive health. our aim was to consider interventions at each level, although we chose to focus on the three middle circles of the framework (peer and family influences, community context and the sociocultural environment) as these seemed most amenable to being addressed through existing partnerships between biomedical service providers and civil society organizations, yet went beyond activities targeted at individual knowledge, attitudes and behaviours. extensive consultation with egpaf staff throughout the organization, particularly in country - level programmes, as well as with other stakeholders, for example, partner institutions, civil society organizations, researchers in the field of paediatric hiv / aids care and representatives from donor agencies, led to adoption of the following working definition of community - based approaches to pmtct : strategies and interventions to improve health behaviour and outcomes that are delivered outside of formal health settings including primary, secondary and tertiary medical facilities. these could have a range of aims (e.g., increasing contact with individuals or empowering whole communities) but needed to explicitly target community members, their local civil or traditional authorities / leaders or traditional health providers outside the formal health sector. there was some ambiguity surrounding interventions where clinical services expanded to provide outreach, support or non - medical assistance (such as food supplementation) into the community. we decided to define activities delivered outside facilities as community - based regardless of how they were administered but not those where community members had to attend a clinic or health centre in order to receive the additional support. figure 2 illustrates the social ecological framework that we developed to guide our literature review, in keeping with recent approaches used to identify and synthesize available evidence driven by theoretical models rather than specific research questions. each of the barriers to seeking, obtaining and remaining in pmtct care, as summarized previously, has been situated at the level of social influence where it is most likely to operate. individual pregnant women remain at the core of the framework, but their choices are embedded within multiple layers. we used this framework to develop our review strategy for identifying community - based approaches implemented in developing countries to address one or more barriers along the pmtct care continuum. similar conceptually driven reviews have been conducted to understand determinants of access to services for sexual and reproductive health. our aim was to consider interventions at each level, although we chose to focus on the three middle circles of the framework (peer and family influences, community context and the sociocultural environment) as these seemed most amenable to being addressed through existing partnerships between biomedical service providers and civil society organizations, yet went beyond activities targeted at individual knowledge, attitudes and behaviours. extensive consultation with egpaf staff throughout the organization, particularly in country - level programmes, as well as with other stakeholders, for example, partner institutions, civil society organizations, researchers in the field of paediatric hiv / aids care and representatives from donor agencies, led to adoption of the following working definition of community - based approaches to pmtct : strategies and interventions to improve health behaviour and outcomes that are delivered outside of formal health settings including primary, secondary and tertiary medical facilities. these could have a range of aims (e.g., increasing contact with individuals or empowering whole communities) but needed to explicitly target community members, their local civil or traditional authorities / leaders or traditional health providers outside the formal health sector. there was some ambiguity surrounding interventions where clinical services expanded to provide outreach, support or non - medical assistance (such as food supplementation) into the community. we decided to define activities delivered outside facilities as community - based regardless of how they were administered but not those where community members had to attend a clinic or health centre in order to receive the additional support. as our interests covered four broad health outcomes and a wide range of barriers to achieving them, we considered a systematic literature review inappropriate to our needs. instead, we developed a theory - driven search strategy guided by our social ecological framework to identify and synthesize up - to - date evidence on community - based interventions that work to increase uptake, retention, adherence and positive psychosocial outcomes in pmtct programmes and in other areas of public health with direct relevance to pmtct. a series of literature searches was conducted using databases including pubmed, medline, web of science, clinicaltrials.gov and the cochrane collection. each search was guided by the social constructs in the social ecological framework and the review s four thematic areas. primary search terms included hiv treatment, art, pmtct, retention, adherence, combined with community, intervention and evaluation. a matrix of secondary key terms was established for different outcomes along the care cascade (related to testing, enrolment, initiation, follow - up and psychosocial wellbeing) and their known determinants (social support, stigma and delivery practices). for example, the search for interventions to improve hiv testing rates among pregnant women utilized boolean combinations of full, abbreviated and truncated versions of the following terms : hct, vct, pitc, hiv testing, antenatal care, prenatal care, uptake, pmtct, intervention, evaluation, operations research and systematic review. as agreed with egpaf in advance, studies were included if they were published through a peer - reviewed process and available from scientific journals, databases of trial protocols or systematic reviews and internet - based reports from multilateral research or policy - setting institutions (e.g., who, research consortia and international task forces). a start date of 2000 was applied to reflect the lack of prior availability of routine art provision in most developing country settings (particularly in sub - saharan africa). september 2011 was the last month during which papers could have been published online to have been included in this review. searches prioritized studies on implementation of pmtct programmes ; but where there was scant evidence, evaluations of community - based approaches from the field of hiv / aids treatment more generally, as well as examples from other related health conditions, were included. examples include the use of women s groups and community mobilization to reduce maternal and neonatal mortality, provision of conditional cash transfers to increase facility - based deliveries and peer counselling to extend periods of exclusive breastfeeding. in these cases, both quantitative and qualitative studies were included, although the emphasis was on identifying existing systematic and narrative reviews, and studies with rigorous evaluation designs prioritized in the following order : randomized controlled trials (rcts), quasi - experimental designs, prospective cohort studies with historical controls and before - after comparisons without controls but with multiple - point time - series data to demonstrate trend. analysis consisted of reading eligible studies and determining which level of the social ecological framework the interventions targeted and subsequently extracting information on how the described intervention attempted to facilitate uptake or reduce barriers to retention in care. interventions were then grouped according to shared components or similarities of approach within each of the three community - based levels. searches continued until theoretical saturation was achieved for each of the barriers included in the social ecological framework. this means that, if existing reviews, meta - analyses or rigorously designed evaluation studies were available for a particular barrier, these were reviewed and their findings synthesized, with no subsequent effort to locate weaker study designs when no new findings emerged. if, however, there were barriers on which little research has been conducted, additional search terms were added and attempts made to identify studies with at least a before - after comparison or historical controls in order to fully populate the framework. findings are presented by the level of the social ecological framework of barriers that each community - based intervention attempts to overcome. where an intervention works to address more than one social barrier to uptake and retention in care, such as in multilevel programmes, it is classified at the highest level of social influence targeted. community health workers (chws), for example, may spend much of their time visiting households and working with family members to support health - seeking and adherence, but as they are also often tasked with strengthening support networks, empowering groups and disseminating health - related practices at community level, they are described in the section on community context. there has been an increase in family centred pmtct programmes, based on the observation that hiv is experienced as a family illness and all members can be affected physically, emotionally and economically. activities include offering hct and treatment to partners and other family members alongside pregnant women, involving male partners in antenatal care and breastfeeding guidance, and peer counselling for hiv - positive pregnant women. these interventions aim to increase risk perception and awareness of hiv status, catalyze positive attitudes among male partners and increase social support for pmtct. two models for community - based hct have been evaluated : (1) house - to - house testing and (2) mobile testing sites. a cluster rct in uganda comparing home - based and clinic testing found 93% of community members agreed to test in home sites, and 54.6% of hiv infections were identified compared to 27.3% in villages with clinic - based hct. another rct in tanzania, zimbabwe and thailand analyzed the effect of providing hiv testing through mobile testing outlets on testing uptake. after 3 years, the number of people receiving their first hiv test was three times higher in intervention over control sites in thailand, ten times higher in zimbabwe and four times higher in tanzania. however, pregnant women were more likely to be diagnosed in fixed - site clinics during antenatal appointments, making community - based testing less effective for identifying additional pregnant women, although it seems to be successful for recruiting higher - risk and low - income community members. involving male partners in pregnancy care is based on evidence from studies showing associations between hiv - positive pregnant women s progression through the treatment cascade and their male partners awareness, support and participation. men are invited to hct alongside their partners, provided with couple counselling and given information on pmtct and infant feeding. the first found a strong association between spousal communication and men s acceptance of hct, and furthermore, when male partners test for hiv, pregnant women are more likely to accept pmtct prophylaxis and adhere to breastfeeding guidance. most studies were cross - sectional or prospective cohorts, thus results could be confounded by partnership characteristics (e.g., couples with good spousal communication are likely to differ in several ways that might affect health - seeking behaviour). the second review concluded that issuing letters of invitation to men for couple testing, targeting men with community - based education on hct and using mass media to publicize couple testing are all independently associated with improved pmtct uptake. recently, two rcts have tested methods to increase male engagement in their partner s treatment during pregnancy, delivery and during follow - up. in south africa, 1000 pregnant women were randomly allocated to receive a letter for their male partner that invited him to attend either vct at the woman s next scheduled anc appointment (intervention) or a pregnancy information session, also during anc (control). although all the women agreed to deliver the letters, only 30% returned with a male partner. whose partners were offered vct compared to 26% for those coming for an information session. at the end of the trial, 32% of male partners in the intervention arm received hiv testing compared to 11% in the control arm. results were statistically significant, although no measures were provided for pregnant women s uptake of pmtct. a similar study was conducted in uganda with 1060 pregnant women participating. in this study, women received letters for their partners that either invited the partner to attend anc (intervention) or provided men with basic literature on pregnancy (control). at the end of the trial, there were no significant differences in the proportions of women attending anc with a male partner (16.2% in the intervention group and 14.2% among controls) nor in male hct uptake. however, the authors note that both groups exhibited an increase of over 10% from the baseline rate of 5% male partner attendance in anc, suggesting that receipt of any formal information from anc services has potential impact on male involvement. they also give a possible explanation for the different results between the rcts, pointing out that the intervention in south africa was preceded by information campaigns and community sensitization activities to promote male engagement more widely. peer counselling schemes have been developed to counteract feelings of isolation and provide support and assistance to pregnant women. the use of peers is theorized to be acceptable to people living with hiv, who might prefer advice from others who have undergone similar challenges. peer counselling is often provided in clinics but increasingly incorporates house - to - house visits. a quasi - experimental study of mentor mothers showed reductions in depression, increases in disclosure of hiv status and improvements in coping strategies, clinic attendance and breastfeeding among the intervention group, although there were no differences in women s use of single - dose nevirapine, which was the recommended regimen at the time. a systematic review of peer counselling for infant feeding outcomes concluded that community - based peer counsellors improve breastfeeding initiation, duration and exclusivity. in bangladesh, a rct of peer counsellors promoting exclusive breastfeeding resulted in 70% exclusive breastfeeding in the intervention at 5 months compared to just 6% among the control group. this study was replicated in sub - saharan africa (uganda, burkina faso and south africa) with similar success, although in south africa, some participants did not trust counsellors motivations, feared loss of confidentiality and did not accept them as peers. interventions targeting the community context include strengthening linkages between health facilities and clients, home - based care (hbc) programmes and training community members (including traditional birth attendants (tba)) to promote care initiation and retention. formalized links between clinics and the community try to increase perceived service friendliness and maintain regular contact with clients. approaches include volunteers accompanying clients to health facilities and observing ingestion of pills, hiring meet and greet staff to guide patients through hospital appointments, patient tracking systems to reduce attrition and mobile phone message reminders. there have been few evaluations of formalized linkages, although the use of mobile phones to sustain adherence was tested through an rct in kenya ; weekly text reminders resulted in 53% of the intervention group, compared to 40% of controls, achieving 90% drug adherence. also in kenya, a patient tracing system contacted pmtct clients who did not return for appointments by phone, home visits or through nominated friends / relatives in the community. after 1 year, attempts had been made to contact 269 pmtct clients, resulting in 60.2% returning to the clinic. home - based care programmes were introduced prior to widespread arv availability, and the role of providers has evolved over time to encompass adherence support, hct promotion within families, referrals to other services and, most recently, art itself. a cluster rct in uganda demonstrated that hbc programmes could be as clinically effective as facility - based treatment, measured by virological failure rates. furthermore, health service and patient costs related to transportation, missed time at work and childcare were significantly lower in the hbc group. while expanding hbc to support treatment access and adherence has proved feasible, inadequate attention has been given to operational challenges and threats to sustainability, particularly under pressure for scaling up. community health workers are trained lay persons who conduct health promotion, visit households for prevention and treatment and make referrals to higher levels of care. interest in chw has been reinvigorated in recent years due to the task - shifting agenda. while some schemes are managed through the government s formal health system (as in ethiopia), many are not and have been implemented by community - based organizations (cbo) or evolve out of support groups for people living with hiv. variations on chw include lay health workers (lhws), adherence support workers, lady health workers, health surveillance assistants, health extension workers and community health volunteers or caregivers (if unpaid). in relation to hiv, their tasks are varied and, in some cases, resemble those of hbc providers, while in others, they focus on adherence and peer support. chw have also been used to promote behaviour relevant to pmtct such as facility - based delivery, exclusive breastfeeding and postnatal follow - up. a recent cochrane collection review of lhws delivery of maternal and child health interventions concluded there is moderate quality evidence that lhw s interventions increase breastfeeding (including exclusive breastfeeding over 6 months). another systematic review found that chw could increase facility - based delivery and skilled attendance, reduce maternal mortality through birth preparedness and provide counselling for postnatal depression and psychosocial support. some evidence of chw effectiveness for adherence comes from a pre- and postintervention comparison in zambia, in which peers of hiv - positive clients were trained as adherence support workers to provide home - based counselling on treatment guidelines. after 12 months, responsibilities had shifted from health workers to peer chw without compromising quality ; loss to follow - up decreased. in uganda, peer health workers (community - nominated hiv+ role models with good art adherence) were trained to support new treatment initiators through regular home visits, information and counselling and provide wider psychosocial support through peer networks. the cluster rct results showed no effect on adherence or virologic failure between study arms during the first 18 months, although the intervention did appear to help sustain treatment in the longer term (96 weeks). traditional birth attendants are one type of community health worker, who have considerable influence over local practices. trained tba have been providing pre- and post - test counselling, rapid hiv tests and administering single - dose nevirapine during labour and to the newborn since 2002. in tanzania, tba have promoted vct to pregnant women, observed arv ingestion during home deliveries and referred postnatal mothers to infant hiv care. success depends on levels of remuneration, supervisory structures, training and accreditation and relationship with clinical services. interventions targeting the sociocultural context attempt to change social norms and create an enabling environment. because these activities are removed from individual behaviour and operate through complex pathways of change, attributing impact is difficult, leading to calls for detailed process evaluations. based on theories of empowerment, social action and diffusion, community mobilization builds local ownership of hiv interventions. a wide range of activities comprise community mobilization : engaging traditional leaders, organizing public discussions and theatrical events, peer education and participatory methods to involve community members. the social constructs targeted include social networks, gender relations, behavioural norms and belief systems. such interventions incorporate multiple components that can be difficult to disentangle through conventional evaluation designs, particularly as, by definition, mobilization requires flexibility. a cluster rct of community mobilization (project accept) has been implemented in zimbabwe, south africa, tanzania and thailand. forty - eight communities were randomized to receive the project accept intervention or standard clinic - based hiv testing and care services. intervention sites introduced (1) community working groups, (2) working with peer leaders in social networks as change agents, (3) outreach workers to promote vct, (4) community volunteers encouraging testing and treatment and (5) post - test psychosocial support. preliminary findings from three countries (tanzania, thailand and zimbabwe) show testing uptake to be three times higher in intervention compared to control sites and suggest good levels of adherence among those taking up arv. a second community mobilization evaluation was conducted in south africa, lesotho, namibia and botswana. local organizations underwent participatory planning to identify ways in which they might contribute to comprehensive social support services for people living with hiv and identified local adaptations as required. testing was widely promoted and individuals diagnosed with hiv could opt to receive psychosocial support, a treatment buddy, home - based care, support groups, childcare, treatment literacy education, food supplements and income generation schemes. in the first year, uptake was highest for home - based care (61% of participants) and food supplementation (40%). the study found median cd4 counts increased more quickly and exhibited a significantly greater increase (207 vs 170 cells / mm) among community members who received hbc or food supplements compared to those who did not. after 12 months, adherence to arv was 67.0% in people receiving home - based care or food vs 58.2% among those who did not use support services, a statistically significant difference. as a prospective cohort, however, the study was unable to attribute observed differences in health outcomes to the community - based support activities, as allocation of programme components was not random and reflected different levels of motivation or need. meetings are facilitated in which community members go through an analytical cycle : (1) problem identification and prioritization, (2) strategic planning, (3) strategy implementation and (4) impact assessment. during strategic planning, groups select ways to overcome barriers (such as lack of transportation during an obstetric emergency) and put action plans into place. participatory groups to improve maternal and neonatal health have been rigorously evaluated in trials throughout south and southeast asia, and found to significantly reduce both neonatal mortality and moderate maternal depression [9597 ]. an ongoing cluster randomized trial is underway in malawi that will help determine the applicability of this approach for sub - saharan african contexts. finally, conditional cash transfers address socio - economic inequalities and provide a social safety net. payments are disbursed to individuals or families in return for specific health behaviours or outcomes. for example, payments have been given to girls who remain enrolled in school, to young people who do not contract sti or hiv and to women if they collect test results, attend antenatal appointments or deliver their babies in health facilities. cash transfers can increase use of services ; a malawian study tested the use of financial incentives for collection of hiv test results and found an overall improvement of 27% in return visits compared to controls who received no incentive. although cash transfers have been used to increase skilled attendance at delivery, they have not been explicitly tested for pmtct outcomes. there has been an increase in family centred pmtct programmes, based on the observation that hiv is experienced as a family illness and all members can be affected physically, emotionally and economically. activities include offering hct and treatment to partners and other family members alongside pregnant women, involving male partners in antenatal care and breastfeeding guidance, and peer counselling for hiv - positive pregnant women. these interventions aim to increase risk perception and awareness of hiv status, catalyze positive attitudes among male partners and increase social support for pmtct. two models for community - based hct have been evaluated : (1) house - to - house testing and (2) mobile testing sites. a cluster rct in uganda comparing home - based and clinic testing found 93% of community members agreed to test in home sites, and 54.6% of hiv infections were identified compared to 27.3% in villages with clinic - based hct. another rct in tanzania, zimbabwe and thailand analyzed the effect of providing hiv testing through mobile testing outlets on testing uptake. after 3 years, the number of people receiving their first hiv test was three times higher in intervention over control sites in thailand, ten times higher in zimbabwe and four times higher in tanzania. however, pregnant women were more likely to be diagnosed in fixed - site clinics during antenatal appointments, making community - based testing less effective for identifying additional pregnant women, although it seems to be successful for recruiting higher - risk and low - income community members. involving male partners in pregnancy care is based on evidence from studies showing associations between hiv - positive pregnant women s progression through the treatment cascade and their male partners awareness, support and participation. men are invited to hct alongside their partners, provided with couple counselling and given information on pmtct and infant feeding. the first found a strong association between spousal communication and men s acceptance of hct, and furthermore, when male partners test for hiv, pregnant women are more likely to accept pmtct prophylaxis and adhere to breastfeeding guidance. most studies were cross - sectional or prospective cohorts, thus results could be confounded by partnership characteristics (e.g., couples with good spousal communication are likely to differ in several ways that might affect health - seeking behaviour). the second review concluded that issuing letters of invitation to men for couple testing, targeting men with community - based education on hct and using mass media to publicize couple testing are all independently associated with improved pmtct uptake. recently, two rcts have tested methods to increase male engagement in their partner s treatment during pregnancy, delivery and during follow - up. in south africa, 1000 pregnant women were randomly allocated to receive a letter for their male partner that invited him to attend either vct at the woman s next scheduled anc appointment (intervention) or a pregnancy information session, also during anc (control). although all the women agreed to deliver the letters, only 30% returned with a male partner. however, this was 35% among the women whose partners were offered vct compared to 26% for those coming for an information session. at the end of the trial, 32% of male partners in the intervention arm received hiv testing compared to 11% in the control arm. results were statistically significant, although no measures were provided for pregnant women s uptake of pmtct. a similar study was conducted in uganda with 1060 pregnant women participating. in this study, women received letters for their partners that either invited the partner to attend anc (intervention) or provided men with basic literature on pregnancy (control). at the end of the trial, there were no significant differences in the proportions of women attending anc with a male partner (16.2% in the intervention group and 14.2% among controls) nor in male hct uptake. however, the authors note that both groups exhibited an increase of over 10% from the baseline rate of 5% male partner attendance in anc, suggesting that receipt of any formal information from anc services has potential impact on male involvement. they also give a possible explanation for the different results between the rcts, pointing out that the intervention in south africa was preceded by information campaigns and community sensitization activities to promote male engagement more widely. peer counselling schemes have been developed to counteract feelings of isolation and provide support and assistance to pregnant women. the use of peers is theorized to be acceptable to people living with hiv, who might prefer advice from others who have undergone similar challenges. peer counselling is often provided in clinics but increasingly incorporates house - to - house visits. a quasi - experimental study of mentor mothers showed reductions in depression, increases in disclosure of hiv status and improvements in coping strategies, clinic attendance and breastfeeding among the intervention group, although there were no differences in women s use of single - dose nevirapine, which was the recommended regimen at the time. a systematic review of peer counselling for infant feeding outcomes concluded that community - based peer counsellors improve breastfeeding initiation, duration and exclusivity. in bangladesh, a rct of peer counsellors promoting exclusive breastfeeding resulted in 70% exclusive breastfeeding in the intervention at 5 months compared to just 6% among the control group. this study was replicated in sub - saharan africa (uganda, burkina faso and south africa) with similar success, although in south africa, some participants did not trust counsellors motivations, feared loss of confidentiality and did not accept them as peers. interventions targeting the community context include strengthening linkages between health facilities and clients, home - based care (hbc) programmes and training community members (including traditional birth attendants (tba)) to promote care initiation and retention. formalized links between clinics and the community try to increase perceived service friendliness and maintain regular contact with clients. approaches include volunteers accompanying clients to health facilities and observing ingestion of pills, hiring meet and greet staff to guide patients through hospital appointments, patient tracking systems to reduce attrition and mobile phone message reminders. there have been few evaluations of formalized linkages, although the use of mobile phones to sustain adherence was tested through an rct in kenya ; weekly text reminders resulted in 53% of the intervention group, compared to 40% of controls, achieving 90% drug adherence. also in kenya, a patient tracing system contacted pmtct clients who did not return for appointments by phone, home visits or through nominated friends / relatives in the community. after 1 year, attempts had been made to contact 269 pmtct clients, resulting in 60.2% returning to the clinic. home - based care programmes were introduced prior to widespread arv availability, and the role of providers has evolved over time to encompass adherence support, hct promotion within families, referrals to other services and, most recently, art itself. a cluster rct in uganda demonstrated that hbc programmes could be as clinically effective as facility - based treatment, measured by virological failure rates. furthermore, health service and patient costs related to transportation, missed time at work and childcare were significantly lower in the hbc group. while expanding hbc to support treatment access and adherence has proved feasible, inadequate attention has been given to operational challenges and threats to sustainability, particularly under pressure for scaling up. community health workers are trained lay persons who conduct health promotion, visit households for prevention and treatment and make referrals to higher levels of care. interest in chw has been reinvigorated in recent years due to the task - shifting agenda. while some schemes are managed through the government s formal health system (as in ethiopia), many are not and have been implemented by community - based organizations (cbo) or evolve out of support groups for people living with hiv. variations on chw include lay health workers (lhws), adherence support workers, lady health workers, health surveillance assistants, health extension workers and community health volunteers or caregivers (if unpaid). in relation to hiv, their tasks are varied and, in some cases, resemble those of hbc providers, while in others, they focus on adherence and peer support. chw have also been used to promote behaviour relevant to pmtct such as facility - based delivery, exclusive breastfeeding and postnatal follow - up. a recent cochrane collection review of lhws delivery of maternal and child health interventions concluded there is moderate quality evidence that lhw s interventions increase breastfeeding (including exclusive breastfeeding over 6 months). another systematic review found that chw could increase facility - based delivery and skilled attendance, reduce maternal mortality through birth preparedness and provide counselling for postnatal depression and psychosocial support. some evidence of chw effectiveness for adherence comes from a pre- and postintervention comparison in zambia, in which peers of hiv - positive clients were trained as adherence support workers to provide home - based counselling on treatment guidelines. after 12 months, responsibilities had shifted from health workers to peer chw without compromising quality ; loss to follow - up decreased. in uganda, peer health workers (community - nominated hiv+ role models with good art adherence) were trained to support new treatment initiators through regular home visits, information and counselling and provide wider psychosocial support through peer networks. the cluster rct results showed no effect on adherence or virologic failure between study arms during the first 18 months, although the intervention did appear to help sustain treatment in the longer term (96 weeks). traditional birth attendants are one type of community health worker, who have considerable influence over local practices. trained tba have been providing pre- and post - test counselling, rapid hiv tests and administering single - dose nevirapine during labour and to the newborn since 2002. in tanzania, tba have promoted vct to pregnant women, observed arv ingestion during home deliveries and referred postnatal mothers to infant hiv care. success depends on levels of remuneration, supervisory structures, training and accreditation and relationship with clinical services. interventions targeting the sociocultural context attempt to change social norms and create an enabling environment. because these activities are removed from individual behaviour and operate through complex pathways of change, attributing impact is difficult, leading to calls for detailed process evaluations. based on theories of empowerment, social action and diffusion, community mobilization builds local ownership of hiv interventions. a wide range of activities comprise community mobilization : engaging traditional leaders, organizing public discussions and theatrical events, peer education and participatory methods to involve community members. the social constructs targeted include social networks, gender relations, behavioural norms and belief systems. such interventions incorporate multiple components that can be difficult to disentangle through conventional evaluation designs, particularly as, by definition, mobilization requires flexibility. a cluster rct of community mobilization (project accept) has been implemented in zimbabwe, south africa, tanzania and thailand. forty - eight communities were randomized to receive the project accept intervention or standard clinic - based hiv testing and care services. intervention sites introduced (1) community working groups, (2) working with peer leaders in social networks as change agents, (3) outreach workers to promote vct, (4) community volunteers encouraging testing and treatment and (5) post - test psychosocial support. preliminary findings from three countries (tanzania, thailand and zimbabwe) show testing uptake to be three times higher in intervention compared to control sites and suggest good levels of adherence among those taking up arv. a second community mobilization evaluation was conducted in south africa, lesotho, namibia and botswana. local organizations underwent participatory planning to identify ways in which they might contribute to comprehensive social support services for people living with hiv and identified local adaptations as required. testing was widely promoted and individuals diagnosed with hiv could opt to receive psychosocial support, a treatment buddy, home - based care, support groups, childcare, treatment literacy education, food supplements and income generation schemes. in the first year, uptake was highest for home - based care (61% of participants) and food supplementation (40%). the study found median cd4 counts increased more quickly and exhibited a significantly greater increase (207 vs 170 cells / mm) among community members who received hbc or food supplements compared to those who did not. after 12 months, adherence to arv was 67.0% in people receiving home - based care or food vs 58.2% among those who did not use support services, a statistically significant difference. as a prospective cohort, however, the study was unable to attribute observed differences in health outcomes to the community - based support activities, as allocation of programme components was not random and reflected different levels of motivation or need. meetings are facilitated in which community members go through an analytical cycle : (1) problem identification and prioritization, (2) strategic planning, (3) strategy implementation and (4) impact assessment. during strategic planning, groups select ways to overcome barriers (such as lack of transportation during an obstetric emergency) and put action plans into place. participatory groups to improve maternal and neonatal health have been rigorously evaluated in trials throughout south and southeast asia, and found to significantly reduce both neonatal mortality and moderate maternal depression [9597 ]. an ongoing cluster randomized trial is underway in malawi that will help determine the applicability of this approach for sub - saharan african contexts. finally, conditional cash transfers address socio - economic inequalities and provide a social safety net. payments are disbursed to individuals or families in return for specific health behaviours or outcomes. for example, payments have been given to girls who remain enrolled in school, to young people who do not contract sti or hiv and to women if they collect test results, attend antenatal appointments or deliver their babies in health facilities. cash transfers can increase use of services ; a malawian study tested the use of financial incentives for collection of hiv test results and found an overall improvement of 27% in return visits compared to controls who received no incentive. although cash transfers have been used to increase skilled attendance at delivery, they have not been explicitly tested for pmtct outcomes. barriers to optimal pmtct uptake that occur outside healthcare settings are well documented and seriously hamper current efforts to eliminate vertical transmission of hiv. organizing these barriers within a social ecological framework illustrates how they can work individually or in combination with each other, through multiple pathways across overlapping levels of social influence. to identify ways to overcome these, we used the conceptual framework to guide a review of the literature on community - based approaches that can work at different levels. while some approaches are specific to pmtct, many will need to be adapted from more general hiv testing and treatment programmes or drawn from the maternal and child health field. there is a great deal of evidence that strategies targeting individuals within their families and peer groups, such as providing home - based and family hiv testing, and training peer volunteers to support others, improve outcomes related to testing, treatment uptake and adherence, all of which are relevant to preventing vertical transmission. while efforts to engage male partners are based on data showing the role played by good couple communication and male support in pmtct uptake, to date, interventions to increase their involvement remain limited although show some positive signs. on the other hand, many other family members are likely to be influential in decision making ; but this review was unable to identify interventions targeting parents, in - laws and other household members for pmtct. there is also good evidence that interventions operating at the community level, including provision of home - based care and community health worker schemes, can also increase retention in care and engage family members. these are often not adequately integrated into wider health systems, nor provided with sustained supervision. furthermore, unless effective referral mechanisms are in place, hiv - positive women do not always receive hbc until late in the pregnancy or after delivery. models in which hbc providers or chw extend household testing so as to identify pregnant women early in gestation could be tried to tailor them to the specific needs of pmtct. once women are enrolled in care, linking facilities to community members more proactively, through accompaniment to appointments, mobile phone messaging and household - based contact tracing, appear to be simple ways to support adherence and retention. at the wider sociocultural level, the evidence emerging from participatory community groups that facilitate strategic health - seeking behaviour (e.g., for obstetric emergencies) is of particular interest due to the overlap between the pmtct care cascade and other key maternal and child health services (antenatal care, facility - based deliveries and return for postnatal appointments). participatory community groups have been comprehensively evaluated, although most studies have been conducted in asia, and it is unclear to what extent findings can be applied to african countries. for more upstream approaches, however, evidence is more difficult to interpret, particularly as complex interventions combine multiple strategies. where evidence exists, there is often little information describing implementation, and components such as community mobilization, empowerment and engagement remain poorly defined and vary across settings. lack of consistency in the content of these interventions is inevitable, as local ownership over programme design is part of the approach s theoretical underpinning, making the outcomes of each possible permutation almost impossible to determine through traditional evaluation methods. given scarce resources, it is important to ensure that intervention packages use the most cost - effective combination of activities, which may differ according to setting and target audience (e.g., reaching pregnant women for pmtct vs mobilizing high risk men to reduce sexual risk behaviour). thus, even successful interventions can be difficult to replicate in new settings if they have not been tested for pmtct - related outcomes. this paper summarizes how social factors limit progress across the hiv treatment cascade, many of which are applicable to pmtct, and reviews the emerging body of literature on the different approaches used by programmes to mitigate the causes of attrition at community level. there is now a need to fill gaps in understanding the mechanics of these approaches so that they can be adapted to eliminate new paediatric infections and keep hiv - positive mothers alive in different settings. programme planners could benefit from using a social ecological framework to guide selection of context - specific interventions as well as to identify particular barriers or levels of influence that have not yet been addressed. many interventions have focused on individuals, often ignoring how people s behaviours are embedded within ever - widening social structures. understanding the pathways to health - seeking behaviour can lead to greater appreciation or the need for broader normative and structural change. jb conducted the literature review on which this paper is based and drafted the manuscript. dw and ah conceived the original idea, commissioned the review and commented on all drafts of the text. lk, rs and dm served on the technical advisory group for the research, commented and reviewed the original conceptual framework and early drafts. ag, sl and csp advised on the review s aims and scope and reviewed paper drafts. cbo, community - based organizations ; chws, community health workers ; egpaf, elizabeth glaser pediatric aids foundation ; hbc, home - based care ; hct, hiv counselling and treatment ; ipv, intimate partner violence ; lhws, lay health workers ; pmtct, prevention of mother to child transmission ; rcts, randomized controlled trials ; tba, traditional birth attendants. | introductionnumerous barriers to optimal uptake of prevention of mother to child transmission (pmtct) services occur at community level (i.e., outside the healthcare setting). to achieve elimination of paediatric hiv, therefore, interventions must also work within communities to address these barriers and increase service use and need to be informed by evidence. this paper reviews community - based approaches that have been used in resource - limited settings to increase rates of pmtct enrolment, retention in care and successful treatment outcomes. it aims to identify which interventions work, why they may do so and what knowledge gaps remain.methodsfirst, we identified barriers to pmtct that originate outside the health system. these were used to construct a social ecological framework categorizing barriers to pmtct into the following levels of influence : individual, peer and family, community and sociocultural. we then used this conceptual framework to guide a review of the literature on community - based approaches, defined as interventions delivered outside of formal health settings, with the goal of increasing uptake, retention, adherence and positive psychosocial outcomes in pmtct programmes in resource - poor countries.resultsour review found evidence of effectiveness of strategies targeting individuals and peer / family levels (e.g., providing household hiv testing and training peer counsellors to support exclusive breastfeeding) and at community level (e.g., participatory women s groups and home - based care to support adherence and retention). evidence is more limited for complex interventions combining multiple strategies across different ecological levels. there is often little information describing implementation ; and approaches such as community mobilization remain poorly defined.conclusionsevidence from existing community approaches can be adapted for use in planning pmtct. however, for successful replication of evidence - based interventions to occur, comprehensive process evaluations are needed to elucidate the pathways through which specific interventions achieve desired pmtct outcomes. a social ecological framework can help analyze the complex interplay of facilitators and barriers to pmtct service uptake in each context, thus helping to inform selection of locally relevant community - based interventions. |
restoration of a tooth with extensive destruction may require a post to retain the restorative material securely and promote an even distribution of forces in the root.1234 a post does not strengthen the tooth, thus the decision to use a post is dependent on whether the remaining tooth structure is sufficient to retain the final restoration.5 there are two main types of prefabricated posts, a metal post and a fiber reinforced composite (frc) post. for optimal results, the post material must have physical and mechanical properties similar to dentin (i.e. be able to join dental structures and be biocompatible).15 in addition, the mechanical properties of the different posts can result in the failure of the restoration.2 for example, a flexible post may lead to a loss of marginal integrity, with the risk of marginal discoloration, secondary caries, and possible debonding.6 by contrast, a rigid post can better support a coronal restoration through a more uniform force distribution, but when the tooth is overloaded, due to the post 's rigidity and low plastic deformation, a root fracture can occur.1478 the lower elastic modulus of the post, the greater the probability of a restoration failure, but the higher the probability of a root surviving.9 the frc posts have a modulus of elasticity similar to dentin while the moduli of the metal posts are much higher.10 according to stewardson.,10 the frc posts have a modulus 2 - 6 times, and metal 4 - 10 times, higher than dentin. the frc posts usually consist of a matrix of epoxy resin or derivatives into which fibers are embedded to reinforce the structure and improve its properties.57 through scanning electron microscopy (sem), numerous authors have found that the average diameter, density, orientation, fiber length, fiber - matrix bond, and matrix type in which the fibers are embedded are factors that influence the mechanical properties of posts.111213 the aim of this in vitro study was to assess the mechanical properties (bending strength and hardness) of seven different frc posts, in relation to their microstructural characteristics. 15 posts were subjected to bending strength tests, 15 to hardness tests, and 10 to electron microscopy. the major diameter of the posts ranged from 1.50 mm to 2.20 mm. in order to determine the diameter of the fibers and the percentage of fibers embedded in the matrix, each post sample was metallized with 15 nm of au - pd and studied with a scanning electron microscope (sem) (jeol jsm-6400. an approximation of the volume occupied by fibers was determined by adding the surface occupied by all the fibers and dividing by the total surface of the micrograph.14 the fractured area of the post after being subjected to the bending test was also observed under sem. the bending resistance of the posts was analyzed by submitting them to three - point bending test in a universal testing machine (suzpecar mem-103/5. the load was applied with a loading angle of 90 and a crosshead speed of 0.5 mm / min until fracture. as the investigated posts had different diameters, a central area with a diameter of 1.30 mm was selected as the area of load application. the assessment was made with a digital caliper (absolute coolant proof caliper 500 - 731 - 10. the flexural strength (), in mpa, of the post was computed using the following formula : =8fmld3, where fm is the maximum load applied at break, l is the span length between the supports (in mm), and d is the diameter of the posts (in mm). for the hardness test, posts were placed longitudinally into a sample holder with a resin mixture (bepox 1159. gairesa, a corua, spain) and were left to set for eight hours. the knoop hardness (hk) was measured with a microhardness meter (matsuzawa mxt 50. ten indentations were made on the polished surface of each sample with a pyramidal diamond point with a rhomboidal base, formed by two mutually perpendicular faces with angles of 172 30 ' and 130. the load applied was 50 g for a load time of 5 seconds. the kh is described by the formula : hk = pcpl2, where p is the applied load (in kgf), l is the indentation length along its long axis, and cp is the correction factor related to the shape of the indenter. nonparametric tests were used because data exhibited a non - normal distribution (kolmogorov - smirnov test). to compare the flexural strength according to the type of fiber, matrix, and the hardness of the posts, a kruskal - wallis h test was used. the jonckheere - terpstra test was used to determine if the volume percent of fibers in the post influenced the bending strength. all calculations were performed using the statistical software spss 21 (spss inc., chicago, il, usa). examination of post cross sections with sem revealed different fiber diameters and irregular fiber distributions within the same post (fig. the results of the diameters of the fibers and the fiber - matrix ratio are shown in table 2. the posts with the smallest diameter of fibers were parapost fiber white and carbopost. in the bending test, the posts with higher resistance were parapost fiber lux and parapost taper lux (p.05). between the dimethacrylate matrix and the epoxy resin matrix, there was no statistically significant difference (p =.672). in the analysis of the fracture area with sem, the carbopost presented very clean fibers, indicating a poor fiber - matrix bond. by contrast, in the parapost fiber white, many adhesions between the two components are observed, indicating a better fiber - matrix bond. regarding the kh, the hardest post was snowpost, which was composed of silica - zirconia fibers, and the least hard post was parapost fiber white, with glass fibers. no statistically significant differences with regard to the matrix compound were found (p =.619). however, the post hardness varied depending on the type of fiber (549.2 - 1046.8 mpa), with statistically significant differences among the posts (p <.05), except between carbon fiber posts and glass fiber posts, the two types having lower hardness (p =.673). the values obtained in each test for the different posts are shown in table 3. it has been explained that the mechanical properties of a fiber - reinforced composite post depend on structural characteristics such as the direction of the fibers, the volume ratio of the fibers,7111213 the bonding between the matrix resin and the fibers, and the individual properties of the fibers and the matrix.11121315 related to the results obtained, besides the microstructural characteristics, there are other factors that influence the mechanical properties of the post. the in vitro bending test better simulates and predicts what may happen to materials in vivo.16 usually, the fatigue test used for this purpose is the three - point bending test,17 as used in this study. there have been several studies in which the flexural strengths of fiber posts were analyzed with tests similar to those used in this evaluation, giving variable results.12131418 the discrepancy in flexural strengths reported for similar materials can be attributed to differences in experimental design, method of specimen preparation, and thickness and shape of the posts.719 the results implied that the compound of the matrix did not affect the mechanical properties of the posts. drummond and bapna concluded that the bending force was not affected by the composition of the reinforcing fibers in the posts, as they all had approximately the same elastic modulus.11 however, in this study, the flexural strength of the post showed statistically significant differences depending on the type of fiber. the carbon fiber post and the silica - zirconium fiber post achieved the lowest values of flexural strength, like in another study.18 even though one study showed the quartz - fiber post having greater flexural strength values than the glass fiber post,13 this study 's results showed the highest flexural strength in glass fiber post. taking into account that the primary function of posts is to retain the core,15 a high flexural strength is essential to enhance the durability of the restoration during function. also, a low flexural modulus may avoid stress concentration and effectively prevent root fractures.19 teeth restored with less rigid posts tend to have fewer catastrophic failures,2023 which are more likely to be restorable.24 therefore, according to the results of flexural strength, glass fiber posts should be chosen. no statistically significant difference was found in the flexural strength among different fiber - matrix ratios. it has been published that the higher content of glass fibers in the post contributed to the greater strength displayed.2025 however, other authors argued that the fiber density contributed only partly to mechanical performance15 or that it did not affect flexural strength.19 perhaps in this study, there were not differences among the posts because the analyzed posts differed in more characteristics than the fiber - matrix ratio. one study analyzed only the fiber - matrix ratio, in the same unidirectional glass fiber reinforced composite, finding that it influenced the mechanical properties.26 the khs of the carbon fiber and glass fiber posts are similar, showing the lowest values ; however, glass fiber posts have significantly more resistance to flexion than carbon fiber posts. therefore, the hardness does not seem to influence the bending strength of these posts. the lowest hardness values have also been associated with the smallest diameters of the reinforcing fibers,15 a statement that is corroborated by our results. cross - sectional examination with sem revealed different fiber diameters and irregular fiber - matrix distribution within the same post, a finding which has also been reported by other authors.131519 however, fiber diameters are homogenous, as seen from the value of the standard deviations.15 when comparing different posts with glass fibers, it is observed that the greater the fiber diameter and the fibermatrix ratio, the greater the flexural strength.15 the relationship between the matrix and the fibers in the fracture zone varies depending on the post. carbon and silica - zirconia fibers are separated from the matrix, as noted by plotino.18 the lower flexural strength of a post could be due to deficient bonding between the fiber and the resin matrix121314 because it has been seen that failure begins at the interface between matrix and fibers.26 glass and quartz fibers remain attached to the matrix after fracture, and the posts made of them have higher flexural strength. achieving a good interfacial bonding allows load transfer from the matrix to the fibers.122527 by contrast, an inappropriate adhesion causes voids, increasing water sorption, and reducing the mechanical properties.28 accordingly, the interfacial adhesion between fibers and matrix11192729 or the manufacturing process1213 may contribute to the flexural strength of glass fiber posts. with elastic posts, the tooth, cement, and post will all deform during function.630 failure will appear at the weakest point, which seems to be the adhesive joints at the coredentin and post - cement - dentin interfaces.30 by the factors mentioned above, the most frequent failures of teeth restored with frc posts are post and core debonding.313233 some authors demonstrated that the bond strength between dentin walls, luting resin, and frc post was more affected by the rigidness of frc post than the type of luting agent used.3435 future investigations would determine the influence of fiber - matrix ratio and fiber diameter within the same glass fiber posts on the fatigue resistance, as well as the ideal flexural strength that permit the flexion and avoid debonding of the post - core system. besides the microstructural characteristics, the mechanical properties of the posts are influenced by other factors such as the adhesive interface between the matrix and fibers. the feature that has more influence on the mechanical properties of the posts is the type of fiber. the hardness of the glass fiber post does not affect the bending strength. within the limitations of this in vitro study, the posts with the most adequate properties for the clinical use are the glass fiber posts. | purposethe aim of this in vitro study was to evaluate the mechanical properties (bending strength and hardness) of seven different fiber reinforced composite posts, in relation to their microstructural characteristics.materials and methodstwo hundred eighty posts were divided into seven groups of 40, one group for each type of post analyzed. within each group, 15 posts were subjected to three - point bending strength test, 15 to a microhardess meter for the knoop hardness, and 10 to scanning electron microscope in order to determine the diameter of the fibers and the percentage of fibers embedded in the matrix. to compare the flexural strength in relation to the type of fiber, matrix, and the hardness of the posts, a kruskal - wallis h test was used. the jonckheere - terpstra test was used to determine if the volume percent of fibers in the post influenced the bending strength.resultsthe flexural strength and the hardness depended on the type of fibers that formed the post. the lower flexural strength of a post could be due to deficient bonding between the fiber and the resin matrix.conclusionaccording to the results, other factors, besides the microstructural characteristics, may also influence the mechanical properties of the post. the feature that has more influence on the mechanical properties of the posts is the type of fiber. |
additional -globin genes in sheep might produce extra -globin chains and, consequently, the subject carrying triplicated () or quadruplicated () haplotypes may exhibit different hematological phenotypes when compared to the normal duplicated () homozygotes (nn). both and heterozygous (nd) and and homozygous (dd) individuals were obtained by selection and inbreeding. chromatographic rp - hplc analyses of the globin chains of 65 subjects (15 dd, 20 nd and 30 nn) were performed. a highly significant linear regression (r2 = 0.967) of the / ratio on the number of -globin genes was found, and the / ratio ranged on average from 1.0 in nn individuals to 1.2 in the nd and 1.6 in the dd subjects. values for blood fell within the range of normality but were rather peculiar as a whole. when the erythrocytes of individuals carrying normal arrangements were compared with those of subjects with extra -genes, the latter had fewer erythrocytes that were bigger in size and had a higher hb content and a greater osmotic fragility. this hematological picture is consistent with the existence of an unbalanced / ratio. |
|
diabetes mellitus is a growing health problem worldwide causing severe and costly complications including blindness, cardiac and kidney diseases (1). according to shaw (2010), the world prevalence of diabetes among adults will increase to 7.7%, and affect 439 million adults by 2030. between 2010 and 2030, there will be a 69% increase in number of adults with diabetes in developing countries and a 20% increase in developed countries (2). approaches to the control of blood glucose and prevention of hyperglycemia are central to the treatment of diabetes mellitus. appetite suppressants, inhibitors of digestion, insulin secretagogues, insulin potentiators, insulin mimetics, stimulants of glucose utilization, inhibitors of gluconeogenesis and glucogenolysis are used to balance blood glucose. at present, none of these therapies either alone or in combination can redraw normal blood glucose homeostasis. additionally many limitations exist in the use of anti - diabetic drugs ; medicines available for management of diabetes exert serious side effects such as hepatotoxicity, abdominal pain, flatulence, diarrhea, and hypoglycemia. also after prolonged treatment, drug resistance traditional medicines play an important role as starting material for drug discovery. for documentation of ethnopharmacological knowledge, many comprehensive field surveys have been conducted all over the world for years and many plants used against diabetes have been recorded (710). antidiabetic activities of plants used against diabetes in turkey as folk medicine were studied in detail by our research group. in our research on in vivo antidiabetic activity of traditional medicines from 2000, seven plant species including gentiana olivieri griseb (gentianaceae), helichrysum graveolens (bieb.) austriacum) ] (loranthaceae) were evaluated for their antidiabetic activity (1116). due to their promising antidiabetic effect in in vivo studies the plants used in this study are well known and widely consumed as food and medicine in different regions of anatolia. aerial parts of g. olivieri are used as bitter tonic, appetizer, antidiabetic, antipyretic, stomachic, and for mental disorders. gentians are also used in small amounts as food and beverage flavoring, in antismoking products and even as a substitute for hops in beer making. helichrysum species have been used as diuretics, lithagogues, anti - asthmatics, for stomachache, and against kidney stones. the capitulums of helichrysum species are used to decrease blood glucose levels and aerial parts are also marketed as herbal tea in herbal stores. juniper berries and leaves are used for antidiabetic, diuretic, antiseptic, carminative, stomachic, antirheumatic, antifungal, and disinfectant properties in many folk medicines (13, 14). also, berries are used as spice in european cuisine to impart a sharp, clear flavor to meat dishes, pork, cabbage, and sauerkraut dishes (18). twigs and leaves of v. album (european mistletoe) are used for many therapeutic applications such as diabetes mellitus, chronic cramps, stroke, stomach problems, heart palpitations, hypertension, and breathing difficulties (15). additionally leaves of v. album are used as tea for bracing and fruits are eaten fresh and pickled in turkey (19). the goal of the present study is to determine the inhibitory effects of the selected plants that were found to have in vivo antidiabetic activity on carbohydrate digestion enzymes such as -amylase and -glucosidase. inhibition of these enzymes, involved in the digestion of carbohydrates, can significantly reduce the post - prandial increase of blood glucose. so, plants with inhibitory effects on these enzymes might be beneficial in diabetic patients. oxidative stress, is one of the major problems observed during hyperglycemia and it contributes to severe complications in diabetics (20). plants with both antidiabetic and antioxidant effects could be useful for people suffering from diabetes mellitus. therefore, abts radical scavenging activity and total phenolic contents of the extracts were also determined. voucher specimens are preserved in the herbariums of gazi and ankara universities, faculty of pharmacy, (ankara), turkey. plant names, parts used, collection sites and herbarium numbers of the plants are given in table 1. general information about plants used in the study aef : herbarium of faculty of pharmacy at ankara university, gue : herbarium of faculty of pharmacy at gazi university, ha : hydroalcoholic, aq : aqueous aqueous and hydro - alcoholic extracts of the plants were prepared according to folkloric usage as described in the previous in vivo antidiabetic activity studies (1116). for decoctions, 1 g of air - dried plant material was added to 100 ml of distilled water and boiled on slow heat for 30 min. infusions were prepared by pouring 100 ml of boiling water onto 1 g of dried plant material. hydro - alcoholic extracts were prepared by maceration of 1 g of powdered material with 100 ml of ethanol (80%) at room temperature for 8 hr. the -amylase inhibition method was performed using the chromogenic method of ali (21). porcine pancreatic -amylase (ec 3.2.1.1, type vi, sigma) was dissolved in ice - cold distilled water (4 u / ml). as substrate solution, potato starch (0.5 %, w / v) in 20 mm phosphate buffer (ph 6.9) was used. 40 l of plant extract in dmso, 160 l of distilled water and 400 l of starch were mixed in an eppendorf tube. after that, 200 l of this mixture was added into another tube containing 100 l dns color reagent solution (96 mm 3, 5-dinitrosalicylic acid, 5.31 m sodium potassium tartrate in 2 m naoh) and put into a 85c heater. after 15 min, this mixture was diluted with 900 l distilled water and taken from the heater. tubes were cooled on ice and the absorbance of the mixture was read at 540 nm. the absorbance (a) due to maltose generated was calculated according to following formula : a540 nm control or plant extract = a540 nm testa540 nm blank the amount of maltose generated was calculated by using the maltose standard calibration curve (0 0.1% w / v) and the obtained net absorbance. percent of inhibition was calculated as : % inhibition = [1-(mean maltose in sample / mean maltose in control) ] 100 -glucosidase activity was performed according to the method of lam (22). louis, usa) from b. stearothermophilus was dissolved in 0.5 m phosphate buffer (ph 6.5) (3 u / ml). the enzyme solution (20 l) and test extracts (10 l) dissolved in meoh - h2o (1:9, v / v) were preincubated in a 96-well microtiter plate for 15 min at 37c. after that, the substrate solution [10 l, 20 mm p - nitrophenyl--d - glucopyranoside (npg), sigma ] in the same buffer was added. the increase in the absorption at 405 nm due to the hydrolysis of npg by -glucosidase was measured by an elisa microtiter plate reader. the inhibition percentage (%) was calculated by the equation : inhibition (%) = [1 (a sample / a control) ] 100 ic50 calculations were done by using sigma plot 12.0 software. minimum of eight different concentrations prepared from the stock solutions of extracts were used for calculating the ic50 value. abts radical cation (abts) scavenging assay was achieved by using the spectrophotometric methods of re (23) and meot - duros (24) with slight modifications. abts (7 mm) was dissolved in distilled water and the abts radical cation was generated by adding 2.45 mm potassium per - sulfate. the radical production was completed after incubation for 16 hr in the dark at 20c. absorbance of abts solution was adjusted to 0.7 0.02 at 734 nm by the addition of phosphate buffer solution (pbs) at ph 7.4. 1 ml diluted abts solution was added to 10 l of extract (pbs or trolox). the inhibition percentage was calculated according to the following formula : inhibition percentage= [1-(a extract / a control)]100 the extracts (100 l) were mixed with 0.2 ml folin - ciocalteu reagent, 2 ml of h2o, and 1 ml of 15 % na2co3, respectively. the absorbance of mixture was measured at 765 nm after 2 hr at room temperature. the mean of three readings was used and the total phenol content was expressed in mg of gallic acid equivalents (gae)/g extracts (25). all values are expressed as the meanstandard deviation (sd) ; linear regression analyses and ic50 calculations were done by using sigmaplot 12.0 software. microsoft excel software was used to calculate correlation coefficients to determine the relationship between 2 variables. voucher specimens are preserved in the herbariums of gazi and ankara universities, faculty of pharmacy, (ankara), turkey. plant names, parts used, collection sites and herbarium numbers of the plants are given in table 1. general information about plants used in the study aef : herbarium of faculty of pharmacy at ankara university, gue : herbarium of faculty of pharmacy at gazi university, ha : hydroalcoholic, aq : aqueous aqueous and hydro - alcoholic extracts of the plants were prepared according to folkloric usage as described in the previous in vivo antidiabetic activity studies (1116). for decoctions, 1 g of air - dried plant material was added to 100 ml of distilled water and boiled on slow heat for 30 min. infusions were prepared by pouring 100 ml of boiling water onto 1 g of dried plant material. hydro - alcoholic extracts were prepared by maceration of 1 g of powdered material with 100 ml of ethanol (80%) at room temperature for 8 hr. the -amylase inhibition method was performed using the chromogenic method of ali (21). porcine pancreatic -amylase (ec 3.2.1.1, type vi, sigma) was dissolved in ice - cold distilled water (4 u / ml). as substrate solution, potato starch (0.5 %, w / v) in 20 mm phosphate buffer (ph 6.9) was used. 40 l of plant extract in dmso, 160 l of distilled water and 400 l of starch were mixed in an eppendorf tube. after that, 200 l of this mixture was added into another tube containing 100 l dns color reagent solution (96 mm 3, 5-dinitrosalicylic acid, 5.31 m sodium potassium tartrate in 2 m naoh) and put into a 85c heater. after 15 min, this mixture was diluted with 900 l distilled water and taken from the heater. tubes were cooled on ice and the absorbance of the mixture was read at 540 nm. the absorbance (a) due to maltose generated was calculated according to following formula : a540 nm control or plant extract = a540 nm testa540 nm blank the amount of maltose generated was calculated by using the maltose standard calibration curve (0 0.1% w / v) and the obtained net absorbance. percent of inhibition was calculated as : % inhibition = [1-(mean maltose in sample / mean maltose in control) ] 100 -glucosidase activity was performed according to the method of lam (22). louis, usa) from b. stearothermophilus was dissolved in 0.5 m phosphate buffer (ph 6.5) (3 u / ml). the enzyme solution (20 l) and test extracts (10 l) dissolved in meoh - h2o (1:9, v / v) were preincubated in a 96-well microtiter plate for 15 min at 37c. after that, the substrate solution [10 l, 20 mm p - nitrophenyl--d - glucopyranoside (npg), sigma ] in the same buffer was added. the increase in the absorption at 405 nm due to the hydrolysis of npg by -glucosidase was measured by an elisa microtiter plate reader. the inhibition percentage (%) was calculated by the equation : inhibition (%) = [1 (a sample / a control) ] 100 ic50 calculations were done by using sigma plot 12.0 software. minimum of eight different concentrations prepared from the stock solutions of extracts were used for calculating the ic50 value. abts radical cation (abts) scavenging assay was achieved by using the spectrophotometric methods of re (23) and meot - duros (24) with slight modifications. abts (7 mm) was dissolved in distilled water and the abts radical cation was generated by adding 2.45 mm potassium per - sulfate. the radical production was completed after incubation for 16 hr in the dark at 20c. absorbance of abts solution was adjusted to 0.7 0.02 at 734 nm by the addition of phosphate buffer solution (pbs) at ph 7.4. 1 ml diluted abts solution was added to 10 l of extract (pbs or trolox). the inhibition percentage was calculated according to the following formula : inhibition percentage= [1-(a extract / a control)]100 the extracts (100 l) were mixed with 0.2 ml folin - ciocalteu reagent, 2 ml of h2o, and 1 ml of 15 % na2co3, respectively. the absorbance of mixture was measured at 765 nm after 2 hr at room temperature. the mean of three readings was used and the total phenol content was expressed in mg of gallic acid equivalents (gae)/g extracts (25). all values are expressed as the meanstandard deviation (sd) ; linear regression analyses and ic50 calculations were done by using sigmaplot 12.0 software. microsoft excel software was used to calculate correlation coefficients to determine the relationship between 2 variables. -amylase inhibitory activities of the plant extracts were evaluated at 4 different logarithmic doses (3000, 1000, 300, 100 g / ml) and results were given in table 2. all extracts except h. plicatum aqueous extract, showed a dose dependent inhibitory effect on -amylase enzyme. all the extracts exerted inhibitory activity at tested doses in varying proportions (3.5 55.7 % at 3000 g / ml). h. graveolens hydro - alcoholic extract exhibited the highest inhibitory activity at 3000 g / ml (55.7 %), while the inhibition percentage of the reference drug acarbose was found to be 73.7 %. oxycedrus leaf hydroalcoholic extract possessed a continuous inhibitory effect on -amylase enzyme between 1003000 g / ml (25.051.7%). -amylase inhibitory activity of plant extracts n=3, sd : standard deviation, : no activity, ha : hydro - alcoholic, aq : aqueous a - glucosidase inhibitory activities of the plant extracts were evaluated at 5 different logarithmic doses between 0.310000 g / ml ; the calculated ic50 values are given in table 3. saxatilis fruit hydro - alcoholic extract possessed the highest inhibitory effect and its ic50 value was found to be the lowest (ic50 = 0.0044 mg / ml) among all extracts. plicatum capitulum aqueous extract (ic50 = 5.0933 mg / ml) and v. album ssp. album aerial part aqueous extract (ic50 = 3.7411 mg / ml) exerted the lowest enzyme inhibitory activity. -glucosidase inhibitory activity of plant extracts and total phenol content (tpc) total phenol content data is expressed in mg equivalent of gallic acid (gae) to of extract. sd : standard deviation, nt : not tested, -:no activity, ha : hydro - alcoholic, aq : aqueous abts radical cation decolorization assay is a useful method for determining the antioxidant capacity of hydrogen donating antioxidants. abts is a blue chromophore produced by the reaction between abts salt and potassium per - sulfate (26). after addition of extracts to abts radical cation, a strong reduction was observed and the blue color turned to white immediately in some extracts (h. plicatum capitulum hydro - alcoholic, j. communis var. oxycedrus leaf aqueous and hydro - alcoholic extracts) at 3000 g / ml concentration. trolox used as a positive control, showed abts radical cation scavenging activity at all tested concentrations (1003000 g / ml). abts radical scavenging activities of plant extracts n=3, sd : standard deviation, - : no activity, ha : hydro - alcoholic, aq : aqueous total phenol contents of all the extracts were measured and the results were shown in table 3. saxatilis leaf hydro - alcoholic extract (212.1 9.9 mg gae/1 g extract) while the lowest was found in j. oxycedrus ssp. oxycedrus fruit hydro - alcoholic extract (4.8 2.2 mg gae/1 g extract). results presented in table 3 show that there is a positive correlation between total phenol contents and abts radical scavenging activity of plant extracts (correlation coefficient= r = 0.8875 at 3000 g / ml). however, the extracts with potent antioxidant activity and rich in phenolics did not show high inhibition on digestion enzymes. no correlation was observed between total phenol content and -amylase/-glucosidase inhibitory activity (r = 0.3959 and r = 0.1669 at 3000 g / ml respectively). additionally correlation between radical scavenging and enzyme inhibitory activities of tested plant extracts were examined. no correlation was observed between abts radical scavenging and -amylase/-glucosidase inhibitory activity (r= -0.0876 at 3000 g / ml and r= -0.1175 respectively). -amylase inhibitory activities of the plant extracts were evaluated at 4 different logarithmic doses (3000, 1000, 300, 100 g / ml) and results were given in table 2. all extracts except h. plicatum aqueous extract, showed a dose dependent inhibitory effect on -amylase enzyme. all the extracts exerted inhibitory activity at tested doses in varying proportions (3.5 55.7 % at 3000 g / ml). h. graveolens hydro - alcoholic extract exhibited the highest inhibitory activity at 3000 g / ml (55.7 %), while the inhibition percentage of the reference drug acarbose was found to be 73.7 %. oxycedrus leaf hydroalcoholic extract possessed a continuous inhibitory effect on -amylase enzyme between 1003000 g / ml (25.051.7%). -amylase inhibitory activity of plant extracts n=3, sd : standard deviation, : no activity, ha : hydro - alcoholic, aq : aqueous a - glucosidase inhibitory activities of the plant extracts were evaluated at 5 different logarithmic doses between 0.310000 g / ml ; the calculated ic50 values are given in table 3. saxatilis fruit hydro - alcoholic extract possessed the highest inhibitory effect and its ic50 value was found to be the lowest (ic50 = 0.0044 mg / ml) among all extracts. plicatum capitulum aqueous extract (ic50 = 5.0933 mg / ml) and v. album ssp. album aerial part aqueous extract (ic50 = 3.7411 mg / ml) exerted the lowest enzyme inhibitory activity. -glucosidase inhibitory activity of plant extracts and total phenol content (tpc) total phenol content data is expressed in mg equivalent of gallic acid (gae) to of extract. sd : standard deviation, nt : not tested, -:no activity, ha : hydro - alcoholic, aq : aqueous abts radical cation decolorization assay is a useful method for determining the antioxidant capacity of hydrogen donating antioxidants. abts is a blue chromophore produced by the reaction between abts salt and potassium per - sulfate (26). after addition of extracts to abts radical cation, a strong reduction was observed and the blue color turned to white immediately in some extracts (h. plicatum capitulum hydro - alcoholic, j. communis var. oxycedrus leaf aqueous and hydro - alcoholic extracts) at 3000 g / ml concentration. trolox used as a positive control, showed abts radical cation scavenging activity at all tested concentrations (1003000 g / ml). abts radical scavenging activities of plant extracts n=3, sd : standard deviation, - : no activity, ha : hydro - alcoholic, aq : aqueous total phenol contents of all the extracts were measured and the results were shown in table 3. the highest total phenol content was found in j. communis var. saxatilis leaf hydro - alcoholic extract (212.1 9.9 mg gae/1 g extract) while the lowest was found in j. oxycedrus ssp. oxycedrus fruit hydro - alcoholic extract (4.8 2.2 mg gae/1 g extract). results presented in table 3 show that there is a positive correlation between total phenol contents and abts radical scavenging activity of plant extracts (correlation coefficient= r = 0.8875 at 3000 g / ml). however, the extracts with potent antioxidant activity and rich in phenolics did not show high inhibition on digestion enzymes. no correlation was observed between total phenol content and -amylase/-glucosidase inhibitory activity (r = 0.3959 and r = 0.1669 at 3000 g / ml respectively). additionally correlation between radical scavenging and enzyme inhibitory activities of tested plant extracts were examined. no correlation was observed between abts radical scavenging and -amylase/-glucosidase inhibitory activity (r= -0.0876 at 3000 g / ml and r= -0.1175 respectively). hyperglycemia has been a classical risk factor in the development of diabetes and its complications. therefore, control of blood glucose levels is critical in the early treatment of diabetes mellitus. one of the important therapeutic approaches is the prevention of carbohydrate absorption after food intake, which is facilitated by inhibition of the enteric enzymes including -glucosidase and -amylase present in the intestinal brush border (27, 28). the inhibition of these enzymes has been a strong option in the prevention of diabetes. so, inhibitors like acarbose, voglibose, and miglitol are widely used in type 2 diabetic patients nowadays. moreover, studies are being carried out to find new amylase and glucosidase inhibitors from natural sources (2931). the aim of this study is to clarify the mechanism of action of selected plants on carbohydrate metabolism. for this purpose, the inhibitory effect of 15 extracts obtained from different parts of 7 plants on -glucosidase and -amylase were assessed and compared with the -glucosidase inhibitor, acarbose. also, radical scavenging activity and total phenol content of the extracts were investigated. in our previous studies, we demonstrated significant hypoglycaemic and antidiabetic activities of hydro - alcoholic extracts of h. graveolens capitulums, j. oxycedrus ssp. saxatilis fruits in normoglycaemic, glucose loaded and streptozotocin - induced diabetic rats. in the present study, these extracts which were found to have potent antidiabetic activity, have also shown high inhibitory effect on enzymes that have an important role in carbohydrate metabolism. there was no correlation between total phenol content and a - amylase / a - glucosidase inhibitory activity of these plant extracts. orhan (13, 14) isolated and identified many compounds that are responsible for the antidiabetic activity of j. oxycedrus ssp. bioactivity - guided fractionation processes, shikimic acid, 4-o--d - glucopyranosyl ferulic acid, and oleuropeic acid-8-o--d - glucopyranoside were isolated from the active subfractions of joso fruit hydro - alcoholic extracts as the active components (14). jeong (2012) showed strong inhibitory effects of ferulic acid derivatives on -amylase and -glucosidase enzymes (32). therefore, we propound that -amylase inhibitory effect of joso fruit hydro - alcoholic extract might be produced by the presence of ferulic acid and other chemical constituents. additionally, the major antidiabetic compounds in subfractions of joso leaves were identified as fatty acids such as palmitic, linoleic, and linolenic acid (13). su (2013) investigated the inhibitory mechanisms of fatty acids on key enzymes related to type 2 diabetes. oleic and linoleic acids were found to have potent inhibitory effects on a - glucosidase activity (33). thus, fatty acids might contribute to the -glucosidase enzyme inhibitory effects of other active compounds found in the joso leaf hydro - alcoholic extract. saxatilis contain relatively high amounts of monoterpene hydrocarbons such as -pinene, limonene and -myrcene (34). baak and candan (2013) found that -pinene in laurus nobilis essential oil inhibited -glucosidase (35). on the other hand, j. communis var. saxatilis leaf hydroalcoholic extract showed significantly -amylase inhibitory effect which may be due to the presence of some secondary metabolites such as lignans, coumarins, sterols, aliphatic compounds, and other terpenes in the hydroalcoholic extract (34). results of -amylase inhibitory activity assay showed that h. graveolens hydro - alcoholic extract has in vitro enzyme inhibition in a degree similar to acarbose at 3000 g / ml. flavonoids, acetophenones, phloroglucinol, pyrones, triterpenoids, and sesquiterpenes are secondary metabolites of the genus helichrysum (36). additionally, albayrak (2010) reported the presence of chlorogenic acid, caffeic acid, ferulic acid, syringic acid, apigenin, apigenin-7-glucoside, and hesperidin ; luteolin, naringenin, quercetin, resveratrol in the methanol extracts of h. graveolens, and chlorogenic acid were found to be the major phenolics in the extract (37). narita (2008) reported the strong inhibitory effect of chlorogenic acid and its derivatives on porcine pancreas -amylase (38). it is considered that high phenolic content (143.4 mg gae/1 g extract) of hydro - alcoholic extract of h. graveolens capitulums might support the enzyme inhibitory effect of other constituents like chlorogenic acid and its derivatives. oxycedrus leaf aqueous and hydro - alcoholic extracts have shown strong abts radical cation scavenging activity. antioxidant effects of these plants might cooperate with their antidiabetic activity and these plants might be a better choice for complementary remedies for type 2 diabetic patients. this is the first study on the in vitro antidiabetic activities of these seven plants : g. olivieri, h. graveolens, h. plicatum ssp. these seven plants with previously reported in vivo antidiabetic effect were tested for enzyme inhibitory and radical scavenging activities. among these, h. graveolens hydro - alcoholic extract, j. communis leaf hydro - alcoholic extract and j. oxycedrus leaf and fruit hydro - alcoholic extracts were found to have inhibitory effect on -amylase. on the other hand, hydralcoholic extracts of j. communis (leaf, fruit) j. oxycedrus (leaf) had potent inhibitory activity on -glucosidase. in conclusion, the findings of this investigation indicate that these plants might be ameliorate hyperglycemia in type 2 diabetics by their inhibitory effect on -glucosidase and -amylase. it is concluded that further studies are needed to explain the mechanism of actions of the other extracts and their active constituents. | objective(s):ethnopharmacological field surveys demonstrated that many plants, such as gentiana olivieri, helichrysum graveolens, helichrysum plicatum ssp. plicatum, juniperus oxycedrus ssp. oxycedrus, juniperus communis var. saxatilis, viscum album (ssp. album, ssp. austriacum), are used as traditional medicine for diabetes in different regions of anatolia. the present study was designed to evaluate the in vitro antidiabetic effects of some selected plants, tested in animal models recently.materials and methods:-glucosidase and -amylase enzyme inhibitory effects of the plant extracts were investigated and acarbose was used as a reference drug. additionally, radical scavenging capacities were determined using 2,2-azino - bis(3-ethylbenzothiazoline-6-sulphonic acid) abts radical cation scavenging assay and total phenolic content of the extracts were evaluated using folin ciocalteu method.results:h. graveolens ethanol extract exhibited the highest inhibitory activity (55.7 % 2.2) on -amylase enzyme. additionally, j. oxycedrus hydro - alcoholic leaf extract had potent -amylase inhibitory effect, while the hydro - alcoholic extract of j. communis fruit showed the highest -glucosidase inhibitory activity (ic50 : 4.4 g / ml).conclusion : results indicated that, antidiabetic effect of hydro - alcoholic extracts of h. graveolens capitulums, j. communis fruit and j. oxycedrus leaf might arise from inhibition of digestive enzymes. |
the incidence of malignant melanoma has been increasing by 2.6% annually over the last decade, with approximately 76,790 new cases resulting in 9,480 deaths in 2013. additionally, melanoma is one of the most common forms of cancer in young adults and represents a significant health concern, particularly in terms of years of life lost. a key prognostic indicator of melanoma is the depth of the lesion in millimeters at the time of diagnosis. melanoma in situ, which is confined to the epidermis, is considered completely curable. however, once melanoma has progressed and metastasized to other parts of the body, effective treatment is limited. therefore, melanoma prognosis and cure rates can be dramatically improved by early diagnosis when the lesion is thinnest. clinical signs of early melanoma are often ambiguous ; even the most experienced dermatologist may have difficulty identifying and differentiating it on a clinical basis from other pigmented lesions, such as atypical nevi. as a result of this clinical need, diagnostic tools have been developed to aid the clinician in deciding whether a lesion is suspicious enough to require biopsy. handheld epiluminescence microscopy or dermoscopy is a common modality used to inspect the pigment network pattern at the epidermodermal junction zone and to evaluate it for indicators of malignant transformation. more recently, the advent of computer - based systems provides sophisticated functionalities allowing for software algorithms to analyze specific features of lesions relevant to predicting malignancy. in addition, diagnostic aids for mole mapping, such as total body photography, improve the ability to longitudinally monitor patients who have too many moles to otherwise track for clinically significant changes. emerging technologies, such as in vivo reflectance confocal microscopy, optical coherence tomography, and even infrared imaging are currently being investigated to determine their utility for noninvasive diagnosis of melanoma. this article summarizes the currently available modalities used to aid in the detection of melanoma in conjunction with full body skin examinations. one of the most frequently used tools, total body photography or mole mapping, is an effective means of monitoring pigmented lesions over time. this method uses high - quality, professional, full - body photographs to document the appearance and location of pigmented lesions on the body. high - resolution photographs of a single lesion under dermoscopy can also be taken, and is frequently used for monitoring suspicious lesions where biopsy is not yet indicated. at each physician visit, pigmented lesions from these photos are compared to those seen on a full body examination to aid in the identification of new and/or changing lesions. however, this method is time consuming and expensive, largely due to the cost of the photographer. analysis of individual, high - risk lesions over time based on comparisons with digital photos has been shown to be effective in detecting new and subtly changing pigmented lesions [4 - 6 ]. one observational trial of 530 high - risk patients with 53 diagnosed melanomas demonstrated increased sensitivity in detection of melanoma when digital dermoscopy photos were available for comparison, compared to lack of photographs. another trial found that total body photography assisted with detecting new or subtly changing melanomas, which did not fit classical clinical features of melanoma. melanomas detected were also thinner, although this could be a reflection of sampling bias since patients who undergo total body photography may also be more likely to follow - up with their dermatologists or employ other sun - protective measures. total body photography seems to be most useful in high - risk patents, including those with a strong history of melanoma or older individuals. in patients younger than 50, less than 1% of new lesions identified on full body skin examination, using their total body photographs as a reference point, were diagnosed as melanoma. in comparison, in the cohort of patients 50 years and older, 30% of new lesions discovered using the same method were diagnosed as melanoma. several other studies have demonstrated the usefulness of total body photography in the detection of melanoma in high - risk populations. despite these documented benefits in detecting melanoma using total body photography, there is still a lack of data to support whether this modality leads to decreased morbidity and/or mortality [11 - 13 ]. total body photography, while effective for tracking clinical change in lesions or the development of new lesions, is time - consuming and laborious. in addition, in the us, health insurance often does not cover the cost of taking the professional photos, which ranges from $ 400-$500. traditional digital total body photography relies on physical photographs, which the patient brings to each appointment, or which the physician stores as part of the paper medical record. molemax (derma medical systems, vienna, austria), fotofinder (fotofinder systems inc, columbia, md, usa), molemap cd (digitalderm inc, columbia, sc, usa), smartscope (midcon distribution inc, overland park, ks, usa), dermspectra (dermspectra, tuscon, az, usa), dermatrak skin imaging centers (canfield scientific, fairfield, nj, usa), and melanoscan (melanoscan inc, stamford, ct, usa) all offer alternatives to traditional full body photography. all of these devices allow for comparison of high - resolution digital images, and some have software that calculates the likelihood of malignancy based on clinical features. while these devices are promising, many lack large - scale clinical trials supporting their efficacy. of published studies in peer - reviewed journals that examined these devices, all of these devices need to be coupled with clinical judgment when examining any patient for melanoma. confocal scanning laser microscopy (cslm) uses the inherent reflective properties of the tissue to distinguish between various skin structures and ultrastructures. this non - invasive technology has a hand - piece that is applied to the skin, with the resulting image showing up on a monitor. reflectance mode is used in clinical practice, while fluorescence mode is still mainly confined to research. under reflective cslm, melanin granules and melanosomes have a higher refractive index than surrounding structures, which can be distinguished on the confocal microscope. cslm can even detect amelanotic melanomas due to the presence of melanosomes in amelanotic lesions. additionally, one study examining 27 melanomas compared to 90 benign nevi found that cslm had a sensitivity and specificity of 88% and 98%, respectively. another study comparing 20 melanomas and 50 benign nevi using cslm found a sensitivity and specificity of 98% and 99%, respectively. positive predictive values have been reported to be as high as 97.5% in diagnosing melanoma using cslm [19 - 21 ]. compared to handheld dermoscopy (in a study of 37 melanomas and 88 benign nevi) advances in cslm technology promise to make this a valuable tool in improving diagnostic accuracy and ease of use. this technology provides visualization to the level of the superficial dermis and has a resolution comparable to that of standard pathology or 5 m permanent sections. in addition, it allows for non - invasive imaging of multiple lesions during the same session. technologic advances have contributed to the development of more portable cslm devices with handheld imaging pieces connected to a monitor. despite the apparent potential of cslm, upfront costs are also considerable, with commercially available cslm equipment costing upwards of $ 50,000. after purchasing the equipment, additional supplies are necessary to evaluate each lesion. multispectral technology uses radiation ranging from 4001000 nm to provide the end - user with a series of digital images. they provide multispectral information in the spatial and spectral domains by capturing radiation intensity at a specific point and as a function of wavelength, respectively. melafind (mela sciences inc, irvington, ny, usa) uses multispectral technology to quantitatively characterize suspicious lesions. this device evaluates the lesion in 10 different spectral bands, which range from 430950 nm. the images are evaluated by proprietary software, which determines the border of the lesion and analyzes its parameters, such as color variation, asymmetry, perimeter and textural changes. clinicians must first use their own clinical judgment in determining which lesions should be evaluated by melafind, as the technology is highly inaccurate if used on lesions known to be benign such as seborrheic keratosis or cherry angiomas [14,22 - 24 ]. this device is designed to aid the physician in determining which lesions to biopsy, providing binary outcomes of positive (biopsy should be considered) or negative (lesion is less suspicious). because of its binary output, user experience is not as essential as it is with other devices, such as cslm, but does assume clinical expertise in diagnosing common dermatologic lesions. in a multicenter study on melafind of 1383 patients, the device detected mostly thin melanomas or borderline lesions (high - grade dysplastic nevi, atypical melanocytic proliferations / hyperplasias). in lesions histologically proven to be melanoma, melafind 's average specificity was 9.9%, which was higher than the 3.7% specificity of dermatologists. of note, this multi - centered study was sponsored by mela sciences, which produces the melafind device. currently, the cost of imaging ranges from $ 25 to $ 175 for evaluation of one lesion and around $ 25 for additional lesions. the siascope (spectrophotometric intracutaneous analysis, made by biocompatibles, farnham, surrey, uk) uses multispectral imaging to detect three chromophores : melanin (in the epidermis and upper dermis), hemoglobin, and collagen. using a handheld device connected to a monitor, the physician is able to evaluate the pattern of each chromophore in clinically suspicious lesions. in a study of 348 pigmented lesions (52 melanomas), sensitivity and specificity for melanoma was 80% and 83%, respectively. in a cohort of primary care providers, siascope 's sensitivity was 94%, with a false negative rate of 4%. another study, examining 881 pigmented lesions (31 melanomas), found no difference in the sensitivity and specificity of siascope use compared to dermsocopy use by dermatologists. thus, it is unclear whether this device provides any more benefits than conventionally used tools (such as dermoscopy) when performing a full body skin examination. the molemate system incorporates the siascope device with a diagnostic algorithm for primary care physicians to use. its efficacy is currently under investigation [30 - 32 ]. for optimal use, additionally, the siascope algorithms use features common to benign lesions, thus classifying benign lesions such as seborrheic keratosis or cherry angiomas as suspicious. infrared spectroscopy, raman spectroscopy, thermographic imaging, tissue elastography, fiber diffraction, electric impedence spectroscopy, and noninvasive genomic detection may all play a role in assisting with the diagnosis of melanoma in the future. mobile smartphone apps also offer an opportunity for patients to monitor their own skin for suspicious lesions, but current apps have, thus far, been shown to be insufficiently accurate. cutaneous imaging modalities can be used to enhance screening for melanoma by primary care physicians as well as the monitoring of high - risk patients by dermatologists. dermoscopy can be an effective tool for trained primary care physicians to screen for melanoma. in several studies involving primary care physicians, dermoscopy increased their sensitivity in detecting malignant lesions, leading to improvements in confidence and accuracy in referring suspicious lesions to dermatologists. however, learning dermoscopy can be a time - consuming process for primary care physicians, with the average general practitioner requiring 30 hours of internet - based learning to acquire adequate skills in interpreting dermoscopy images. for dermatologists, dermoscopy can also serve as a valuable tool in monitoring high - risk patients, leading to improved diagnostic accuracy when compared to naked eye examination. total body photography is an effective tool for detecting new or changing lesions by patients, primary care physicians, and dermatologists. in particular, total body photography can improve self - skin examination accuracy and melanoma detection by patients. mole mapping can also improve patients ' self - confidence and knowledge when conducting skin self - examinations. thus, it can be used for both screening purposes and monitoring of high - risk lesions. cslm requires significant operator experience to interpret images, and the equipment is prohibitively expensive for use in primary care. due to these factors, cslm is typically used only at major academic centers with specialized pigmented lesion programs. melafind 's efficacy in detecting malignancy has only been evaluated in dermatologists, showing increased sensitivity and specificity when diagnosing melanomas. because melafind depends on the clinician 's judgment to first identify a suspicious lesion to evaluate, it can result in inter - user variability. however, melafind 's analysis algorithm of suspicious lesions and binary output does hold potential for use by a primary care physician trained to first identify a clinically worrisome lesion. further studies involving primary care physicians need to be conducted to evaluate its efficacy in this population. siascope holds promise for use by primary care physicians. when used by primary care physicians, siascope has a sensitivity of 94%, with a false negative rate of 4%. in the uk and australia, while recent technological advances in the cutaneous imaging and diagnosis of melanoma are promising, there are still significant barriers to their widespread implementation (for a summary of imaging technologies see table 1). these modalities require time, appropriate training, and experience for proper use. to encourage widespread use, these technologies need to provide accurate information to the clinician in a time - efficient manner. additionally, they need to show improved patient outcomes through decreased morbidity and/or mortality. adoption by primary care physicians will likely enhance the rate of early diagnosis of melanoma and decrease morbidity and mortality in populations at risk. | melanoma is a malignancy of melanocytes or pigment - producing cells located predominantly in the skin. it is less common than other skin cancers but causes the greatest number of skin cancer - related deaths worldwide. the incidence of melanoma continues to increase and early detection is the most promising means of decreasing morbidity and mortality. currently, physicians perform routine skin cancer screenings for melanoma without the benefit of imaging devices more advanced than handheld magnifiers or dermatoscopes. however, it is possible that the diagnosis of melanoma may be improved with technology that provides diagnostic discrimination beyond what is possible on routine inspection. this article reviews current and emerging technologies to aid in the diagnosis of melanoma. ultimately, these advances may enhance the early diagnosis of melanoma. |
amblyopia is a developmental ocular disorder characterized by a unilateral or bilateral visual deficiency that is out of proportion with any structural abnormalities that are present in the eye [14 ]., extensive neuroimaging studies have found decreased gray / white matter volumes [57 ] and reduced functional activation or connectivity [812 ] in the visual cortical areas or in the visual pathway regions in cases of amblyopia. in a previous study, we also found disrupted spontaneous activity patterns of some brain regions, such as the precuneus, the medial prefrontal cortex, and the cerebellum, in anisometropic amblyopic individuals, which suggested that the decreased visuomotor processing ability and compensatory plasticity coexist in amblyopia. the primary visual cortex (also known as v1, anatomically equivalent to brodmann area 17 (ba 17)) is a koniocortex (sensory - type cortex) located in and around the calcarine fissure of the occipital lobe. each hemisphere of the primary visual cortex receives information directly from its ipsilateral lateral geniculate nucleus and transmits information to the dorsal and ventral streams. previous studies have observed functional deficits and morphological alterations in the lateral geniculate nucleus in cases of amblyopia [1315 ], which may suggest that the input pathway could be affected in subjects without normal sight. yu and colleagues have demonstrated that blind subjects show decreased functional connectivity (functional connectivity may refer to any study examining interregional correlations in neuronal variability. here, it is a measurement of the spatiotemporal synchrony or correlations of the blood oxygen level - dependent (bold) fmri signal between anatomically distinct brain regions of cerebral cortex.) between the primary visual area and the somatosensory motor areas. qin. suggested that the development of the dorsal and ventral visual areas depends on different visual experiences ; these findings support the hypothesis that the development of the human brain is modulated by compensatory plasticity and visual loss effects [12, 19 ]. the two - stream (dorsal and ventral) hypothesis is an influential and widely accepted model of visual information processing. it is generally believed that the dorsal stream (the how pathway), which involves areas such as the middle temporal cortex (mt) and the medial superior temporal area, processes spatial location information. the ventral pathway (the what pathway) includes area v4 and the inferior temporal lobe and is associated with the processing of object identification and recognition. interestingly, numerous psychophysical studies have observed that both the ventral and dorsal extrastriate cortical processing functions are disrupted in amblyopia subjects [2023 ]. in particular, the cortical areas extending from v1, including v3a / mt, are implicated in the global motion deficits reported in amblyopia [2426 ]. using an effective connectivity analysis based on task (retinotopic mapping) related functional magnetic resonance imaging (fmri), li and colleagues have found that both the feedforward and feedback interactions are anomalous in amblyopia and that this disrupted connectivity extends throughout the thalamocortical pathway. li and colleagues have also found small but consistent reductions in activation in area v1 when stimulating (spatially broadband) the amblyopic eye compared to that of the fellow fixing eye. however, the functional connectivity pattern of the primary visual cortex in patients with amblyopia remains unclear. the aim of the present study was to investigate the characteristics of the functional connectivity pattern of the primary visual cortex in patients with amblyopia. a group of subjects with amblyopia and their age / gender - matched normal - sighted control subjects were recruited. a correlation analysis was computed between the mean time series of the bilateral primary visual areas and other brain regions. then, two - sample t - tests were accessed in a voxel - wise manner to determine which brain areas showed significant differences between the normal - sighted subjects and the patients with amblyopia for each hemisphere of the primary visual area. parts of the dataset have been used in our previous study to investigate the regional homogeneity of spontaneous activity patterns in amblyopic subjects. to maintain the scientific integrity of the current paper this study was approved by the ethics committee of zhong shan ophthalmic center at sun yat - sen university and followed the tenets of the declaration of helsinki. all participants received detailed eye examinations that included assessments of their visual acuity, intraocular pressure and refraction, slit lamp examination, ophthalmoscopy, binocular alignment, ocular motility, and random - dot butterfly stereograms. in total, fourteen anisometropic amblyopic patients, sixteen mixed (anisometropic and strabismic) amblyopic patients, and twenty - two healthy individuals were enrolled in the study. three participants (one healthy volunteer and two patients with amblyopia) had excessive head motions during the scanning and were excluded, leaving twenty - one healthy volunteers and twenty - eight patients with amblyopia to be included in the analysis. all of the subjects were right - handed and had no history of other ocular diseases, surgery, neurological disorders, or brain abnormalities based on mri scans. the volunteers had normal or corrected - to - normal visual acuity in both eyes. detailed clinical data on the subjects are shown in table s1 in supplementary material available at http://dx.doi.org/10.1155/2013/612086. the mri data were obtained using a 3.0 tesla mr scanner (trio tim system ; siemens, erlangen, germany). resting - state fmri scans were performed with an echo planar imaging sequence with the following scan parameters : repetition time = 2000 ms, echo time = 30 ms, flip angle = 90, matrix = 64 64, field of view = 220 220 mm, slice thickness = 3 mm, and slice gap = 1 mm. each brain volume was composed of 32 axial slices, and each functional run contained 270 volumes. during the scans, all subjects were instructed to keep their eyes closed, relax, and move as little as possible. tight but comfortable foam padding was used to minimize head motion, and earplugs were used to reduce scanner noise. the structural magnetization prepared rapid gradient - echo imaging sequence which was used to acquire structural t1-weighted images in a sagittal orientation. the parameters were as follows : repetition time = 2000 ms, echo time = 2.6 ms, flip angle = 9, acquisition matrix = 512 448, and field of view = 256 224 mm. the scanning time was approximately 5 min, and a total of 192 images with 1 mm thick slices were obtained. the fmri images were conventionally preprocessed using statistical parametric mapping software (spm8, http://www.fil.ion.ucl.ac.uk/spm/). the primary visual cortex of the brain generally refers to brodmann area 17 (ba 17), and the bilateral primary visual cortices were defined using the method used in a previous study. the detailed procedure is as follows : (1) each hemisphere of ba 17 and the gray matter were selected from the td (talairach daemon) brodmann area atlas ; (2) the left ba 17 and the gray matter were intersected to generate the left primary visual cortex ; and (3) in the same way, the right primary visual cortex was generated. a seed reference time series for each hemisphere of the primary visual cortex was obtained by averaging the fmri time series of all voxels within the area. a pearson correlation analysis of the time series was performed between the mean time series and other brain regions in a voxel - wise manner. for further statistical analysis, a fisher r - to - z transformation was performed to improve the normality of the correlation coefficients. in this study, we investigated alterations in the connectivity pattern of the visual cortex and other brain areas in amblyopic subjects. a two - sample, two - tailed t - test was performed to investigate the group differences in the functional connectivity map of the bilateral primary visual cortex between the anisometropic amblyopic subjects and subjects with normal vision after regressing out the effects of age and gender. the statistical threshold for each voxel was set at palpha < 0.01 with a cluster size of at least 130 voxels based on the results of a monte carlo simulation (http://afni.nimh.nih.gov/pub/dist/doc/manual/alphasim.pdf ; alphasim with the following parameters : single voxel p = 0.01, fwhm = 6 mm, with the aal template in the mircron software as a mask). the same statistical analyses were performed between the mixed amblyopic subjects and normal - sighted subjects and between the anisometropic and mixed amblyopic subjects. exactly the same statistical analyses were performed for the right primary visual cortex to obtain functional connectivity maps of the right primary visual area. to evaluate the alterations in the connectivity pattern of the primary visual area in the amblyopic subjects, all of the regions identified from the two comparisons (anisometropic amblyopic subjects versus normal - sighted and mixed amblyopic subjects versus normal - sighted) were overlapped to investigate the impaired regions in the two patient groups. the demographic and psychological characteristics of the two amblyopic groups (anisometropic amblyopia : 5 males, 8 females, mean age : 22.3 7.2 years ; mixed amblyopia : 8 males, 7 females, mean age : 23.4 7.1 years) are summarized in table s1. the 21 normal - sighted volunteer individuals (8 males, 13 females ; mean age : 23.5 2.1 years) were well matched with the amblyopic group in age (p = 0.81, two - sample two - tailed t - test) and gender (p = 0.616, chi - squared test). additionally, an extra evaluation of the differences in movement parameters between subjects with amblyopia and with normal vision was performed according to the procedures described in van dijk. to further evaluate the influence of head motion on the functional connectivity results. no significant differences were found between the three groups (table 1). compared to subjects with normal sight (n = 21), anisometropic amblyopic individuals (n = 13) showed significantly decreased functional connectivity with the left primary visual area in the cerebellum (left cerebellum 1, right cerebellum crus 1/2, 8/9), the conjunction area of the bilateral inferior parietal lobe and the angular lobe (ipl / ang, ba 40) and the conjunction area of the left middle frontal lobe and the precentral gyrus (mfg / precg.l, ba 8/9) (figure 1, table s2). decreased functional connectivity with the right primary visual area was found in the bilateral cerebellum (left cerebellum crus 1/2 / lingual / vermis_6/9, left cerebellum crus 1/8/9, right cerebellum crus 1/6) and the conjunction area of the left inferior parietal lobe and the angular lobe (ipl / ang, ba 40), while increased functional connectivity with the right primary visual area was found in the left postcentral gyrus (postcg.l) and the conjunction area of the left paracentral lobule and the middle frontal gyrus (pcl / mfg, ba 6/31) (figure 1, table s3). compared to the subjects with normal vision (n = 21), subjects with mixed amblyopia (n = 15) showed significantly decreased functional connectivity with the left primary visual area in the cerebellum (cerebellum crus 1, crus 6/8/9, cerebellum crus6/vermis_9), the conjunction area of the bilateral inferior parietal lobe and the angular lobe (ipl / ang, ba 7/40), the medial frontal cortex (mfg, ba 11), the conjunction area of the posterior cingulate cortex and the precuneus (pcc / precun, ba 30), the left middle frontal - precentral gyri (mfg / precg.l, ba 8/9), the left inferior temporal gyrus (itg.l, ba 20), and the bilateral thalamus (figure 2, table s4). decreased functional connectivity with the right primary visual area was found in the conjunction area of the left inferior parietal lobe and the angular lobe (ipl / ang, ba 40), the bilateral conjunction area of the postcentral gyrus and the precentral gyrus (postcg / precg, ba 3/4), the precuneus (ba 31), the conjunction area of the posterior cingulate cortex and the middle cingulate cortex (ba 31), the conjunction area of the left posterior cingulate cortex and the precuneus (pcc / precun.l), the lingual gyrus / vermis_6, the middle occipital cortex (mog, ba 19), and the hippocampus / parahippocampus (hip / phip) (figure 2, table s5). we also found overlapping brain areas with altered functional connectivity with the primary visual area in anisometropic and mixed amblyopic individuals (70 voxels). the overlapping brain regions that showed altered functional connectivity with the left primary visual area were located in the cerebellum (cerebellum tonsil, vermis 9/vermis 7, and cerebellum crus 1/6) and the conjunction area of the bilateral inferior parietal lobe and the angular lobe (ipl / ang) (table 2). the overlapping brain region showing altered functional connectivity with the right primary visual area was restricted to the adjacent region of the lingual and vermis_6 and the left ipl / ang (figure 3, table 2). compared to the patients with anisometropic amblyopia, patients with mixed amblyopia showed increased functional connectivity between the medial / inferior temporal gyri and the left primary visual area and decreased functional connectivity between cerebellar crus 1/6/8 and the right primary visual area (figure 4, table 3). in the present study, we investigated the functional connectivity between the primary visual cortex and other brain areas in amblyopic individuals using a resting - state functional connectivity technique. from our results, we mainly find significant decreases in functional connectivity with the primary visual area in the inferior parietal lobule and the posterior cerebellum in both anisometropic amblyopia and mixed amblyopia. the dorsal stream, sometimes called the where pathway or the how pathway, originates from the v1 area, passes through the v2 and mt (also known as v5) areas, and arrives at the inferior parietal lobule. this pathway primarily participates in the detection of motion, the representation of object locations, and the control of the eyes and arms, especially when visual information is used to guide saccades or reaching behaviors [31, 32 ]. recent neurophysiological studies have demonstrated abnormalities in visuomotor processing in subjects with amblyopia [3336 ]. the decreased connectivity between the primary visual area and the inferior parietal lobule, which plays a special role in the stereo pathway, may also explain the deficit in stereoscopic depth perception observed in subjects with amblyopia. hence, the decreased functional connectivity between the primary visual area and the inferior parietal lobule in amblyopic individuals may reflect functional deficits in the dorsal stream. in one of our previous studies, yan. found that the dorsal visual pathway was abnormal or impaired in patients with comitant exotropia. the present study provides further evidence for deficits in the dorsal stream in subjects with amblyopia. we also found a decrease in the functional connectivity between the primary visual area and the cerebellum (cerebellum tonsil, vermis 9, cerebellum crus 2/vermis 7, and cerebellum crus 1/6). the cerebellum, which functionally interacts with the frontal eye fields [3841 ], is also involved in the control of eye movements [4246 ]. thus, we conclude that the observed decrease in functional connectivity between the primary visual area and the cerebellum might explain the visuomotor processing deficits in amblyopia. in some strabismic subjects, we have found altered functional connectivity between the mtg and the left primary visual cortex and between the cerebellum crus and the right primary cortex in mixed amblyopic subjects compared to anisometropic amblyopic subjects. this might occur because the amblyopic subjects with strabismus would have severely affected gaze judgment and information interaction between the sensory motor and visual areas (table 3). we found increased functional connectivity between the right primary visual area and the left postcg in cases of anisometropic amblyopia. this corresponds to our previous finding of increased spontaneous activity in the postcg and precg, which may reflect the compensatory plasticity that compensates for amblyopia - related deficits. nevertheless, it should be noted that we found decreased functional connectivity between the right primary visual area and the conjunction area of the postcg / precg, the thalamus and the hippocampus / parahippocampus in mixed amblyopia (figure 2). we know that inputs from the retina are sent to the lateral geniculate nucleus of the thalamus, which in turn projects to the primary visual cortex (area v1) in the occipital lobe. previous studies have also observed functional deficits and morphological changes in the lateral geniculate nucleus in anisometropic amblyopic subjects [1315 ] and in some animal studies [48, 49 ]. the alteration of the functional connectivity between the thalamus and the primary visual cortex might suggest that the lateral geniculate nucleus plays a fundamental part in the processing deficit that has been attributed to the visual cortex in amblyopic subjects. to the best of our knowledge, we did not find a possible reason for the altered functional connectivity between the sensory motor regions and the primary visual cortex ; therefore, task - related fmri studies are needed in the future. in the initial experimental design of the present study, we only wanted to determine the alteration of spontaneous activity and the functional connectivity pattern in the amblyopic individuals in the resting state. in fact, stereopsis - related changes may provide deeper insight into the neural substrate of the impaired binocular perception in the patient groups. meanwhile, we did not find a statistically significant correlation between altered functional connectivity and disease severity (visual acuity of bilateral eyes) in the patient groups. furthermore, our results should be interpreted carefully because we did not consider the side of the eye impairments due to the small sample size. in the future, a larger sample neurophysiological and neuroimaging study is required to distinguish the differences among the affected brain regions in the different types of amblyopia. | amblyopia, which usually occurs during early childhood and results in poor or blurred vision, is a disorder of the visual system that is characterized by a deficiency in an otherwise physically normal eye or by a deficiency that is out of proportion with the structural or functional abnormalities of the eye. our previous study demonstrated alterations in the spontaneous activity patterns of some brain regions in individuals with anisometropic amblyopia compared to subjects with normal vision. to date, it remains unknown whether patients with amblyopia show characteristic alterations in the functional connectivity patterns in the visual areas of the brain, particularly the primary visual area. in the present study, we investigated the differences in the functional connectivity of the primary visual area between individuals with amblyopia and normal - sighted subjects using resting functional magnetic resonance imaging. our findings demonstrated that the cerebellum and the inferior parietal lobule showed altered functional connectivity with the primary visual area in individuals with amblyopia, and this finding provides further evidence for the disruption of the dorsal visual pathway in amblyopic subjects. |
to meet the wide variety of consulting needs that undergraduate neuroscience programs and departments have, the pdcs maintains a database of faculty consultants with expertise in a broad range of areas. specific areas include (but are not limited to) : curriculum (evaluation, development, designing / improving special programs or courses, research experiences or honors) ; faculty (writing grant proposals, developing funding sources, writing for publication, promoting professional development and/or mentoring, enhancing and evaluating teacher effectiveness) ; advising (student advising for career planning, graduate school preparation, changing enrollments, minority recruitment and retention) ; research facilities (designing neuroscience labs, designing teaching facilities, computer applications for courses, labs, or administration) ; and departmental program evaluation (self - assessments, program evaluation, department evaluation). undergraduate neuroscience programs and departments in need of consultants to conduct program evaluations and related services are not required to be affiliated with fun as members to make use of the fun pdcs. while consultants do not deal with problems concerning individual faculty members, they can address general personnel issues, such as promoting faculty development. inviting departments are asked to pay an honorarium (to be determined by the department and invited consultant) as well as expenses (transportation, lodging, and meals). all financial arrangements are solely between the institution and the consultants and in no way involve fun. departments with limited finances may request a reduced or waived honorarium, which consultants are free to agree to, but under no obligation to accept. the fun - pdcs will match departments with consultants believed to be suited to the needs of the department, although neither fun nor fun - pdcs makes guarantees or warranties regarding the abilities or suitability of consultants ultimately contracted with by the program or department. programs and departments may initiate a request a consultant by sending a brief email expressing interest in a consultation to : eric wiertelak, director of the pdcs at [email protected]. a consultation request package will be forwarded to interested parties, to be filled out and returned to the fun pdcs for processing. requests for consultants will be matched with the expertise of available consultants and a list of three or more consultants and their qualifications will be generated. the consultation request package provides the director of the pdcs with the information used to develop a consultant recommendation. of central importance are not only determining the area or areas of consultations desired, but also gathering sufficient further detail about the program / department and institution. briefly, the package contains several short forms that when completed, provide demographic information about the program and institution initiating the request, details about the perceived need for a consultancy, including proposed dates of any site visit, specific areas of focus for the consultancy (see table 1), and consent and waiver forms for the consultancy. the package also includes a post - consultancy evaluation form to provide feedback to fun - pdcs about the outcome of the consultancy once completed. fun - pdcs uses these evaluation forms to assess the ongoing effectiveness and range of the services provided as well as the performance of the consultant pool. individuals wishing to become consultants should contact the pdcs director / chair of the committee on education for pdcs consultant application materials. completed applications are returned to the director, who forwards them to the pdcs subcommittee of the committee on education for screening and recommendations. briefly, applicants must submit : a current copy of their cv.a one - paragraph statement, listing their educational and current employment statuses and a summary of their particular skills and qualifications for conducting consultations. this paragraph will be sent to prospective clients as part of the matching process.a cover letter, requesting appointment as a pdcs consultant. the cover letter should provide the committee with an overview of the candidate s particular interests, history of consulting activities, and any other relevant qualifications that can aid in the evaluation of the application for appointment as a consultant. a current copy of their cv. a one - paragraph statement, listing their educational and current employment statuses and a summary of their particular skills and qualifications for conducting consultations. this paragraph will be sent to prospective clients as part of the matching process. a cover letter, requesting appointment as a pdcs consultant. the cover letter should provide the committee with an overview of the candidate s particular interests, history of consulting activities, and any other relevant qualifications that can aid in the evaluation of the application for appointment as a consultant. all materials are subsequently forwarded by the director to the fun committee on education for final review during the fun annual meeting. to be appointed, consultant applicants should have expertise in a number of the areas listed under specialties and specific areas in table 1. since its founding in 2007, the fun - pdcs has grown, receiving more requests for consultation services each year, and the need for such services continues to grow. while the number of fun - pdcs consultations is difficult to track as the service only makes initial recommendations, inquiries to the service have grown almost tenfold, from an annual total in the first year (2007) of three to 28 in 2011. as the many undergraduate neuroscience programs and departments mature, the need for external review teams suited for the needs of ongoing institutional assessments will expand dramatically. with fun - pdcs continuing to provide a no - cost service to match programs and departments with consultants that have the expertise desired consider becoming a fun - pdcs consultant to join fun in the shared mission of promoting undergraduate neuroscience education and research. | in 2007 fun established the fun program and department consultations service, or fun - pdcs. since that founding, the service has provided numerous consultation recommendations to undergraduate programs seeking assistance with external program reviews, designing and improving courses and many other programmatic needs. fun - pdcs, like fun, is primarily a grassroots organization and draws on the expertise of the fun membership to aid programs in their more personalized pursuit of the fun mission : to promote and improve undergraduate neuroscience education and research. |
youth violence is a major international public health concern [1, 2 ]. in nearly every region of the world, adolescents and young adults comprise the majority of violent death victims, resulting in significant losses in the world 's most productive citizens. indeed, global surveillance efforts estimate that an average of 565 youth between the ages of 10 and 29 years old are victims of homicide each day, with an additional 2040 youth violence - related injuries occurring for each homicide. apart from the potential for death or serious injury, youth experiencing violence, namely, physical fighting, are more likely than their nonviolent counterparts to engage in further risk and violence - related behaviors and to suffer from a myriad of negative physical and emotional health outcomes [1, 46 ]. considering the magnitude and severity of these consequences, a growing body of the literature has sought to better understand the prevalence and risk factors for youth involvement in physical fighting both in the usa and internationally [1, 2, 712 ]. most recently, the trends and social correlates of physical fighting among youth in 30 countries were presented. one facet of physical fighting among youth that remains underexamined, however, is the phenomenon of very frequent physical fighting. although a recent us study indicates that frequent physical fighting (at least 12 times per year) is a relatively rare behavior among high school students, the well - being of those youth engaged in frequent fighting is of concern ; adolescents reporting frequent physical fighting are at a heightened risk for suicide and other psychosocial problems when compared to students who engage in less frequent fighting or who do not fight. furthermore, adolescents who are frequent fighters may be more likely to become chronic offenders, a group that accounts for more than half of all the serious crimes committed by juveniles in the usa. stark gender differences in the prevalence of frequent fighting are also of note. among us, comparative studies examining the occurrence of physical fighting among youth are nearly absent from the current literature, and even fewer studies have examined frequent fighting, most of which limit analyses to youth in europe and north america [10, 12, 13 ]. a lack of nationally representative samples of youth has been particularly problematic in producing cross - national comparisons [10, 13 ]. moreover, although some studies have been able to examine cross - national patterns of adolescent physical fighting, especially using the health behaviour in school - aged children survey (hbsc), the measure of frequent fighting has been restricted by survey designs with a maximum value of 3 or more or 4 or more fights per year [10, 12 ]. nevertheless, findings from these studies indicate that more frequent fighting is linked to an increased risk for both injury and additional risk behaviors across different countries and regions of the world [10, 12 ]. prevention and intervention efforts targeted to this specific population may therefore have the potential to maximize limited resources, particularly in low income countries. in order to better inform global youth violence prevention efforts, additional research examining the prevalence of frequent fighting both nationally representative data and surveys that enable participants to report a greater range of fighting frequency will allow for a more detailed examination of youth violence patterns across countries and world regions. furthermore, considering the significant gender differences found in the prevalence of frequent fighting among us adolescents, the assessment of gender patterns in countries with differing cultural practices and gender norms may be particularly informative. accordingly, the current study seeks to determine the prevalence of very frequent physical fighting (at least 12 times per year) among boys and girls in 27 countries and cities using the global school - based student health survey [16, 17 ] and the us youth risk behavior study. the study will also examine the regional differences by categorizing the countries and cities into five world regions : sub - saharan africa, central and south america, asia, eastern mediterranean, and the united states (data were not available from europe). a better understanding of frequent fighting from large, representative cross - national comparisons will inform the development of violence prevention strategies and intervention programs. the current study is based on data from the global school - based student health survey (gshs) [16, 17 ]. the gshs was developed and supported by the world health organization in collaboration with the united nations children 's fund, the united nations educational, scientific, and cultural organization, the joint united nations programme on hiv / aids, and with technical assistance from the centers for disease control and prevention. the goal of the gshs is to provide data on health behaviors and relevant risk and protective factors among students across all regions served by the united nations. country - specific questionnaires, fact sheets, public - use data files, documentation, and reports are publicly available from the centers for disease control and prevention and the world health organization and have been described in more detail elsewhere. briefly, the gshs is comprised of a self - report questionnaire, administered primarily to students aged 13 to 16 years old within the time period of 2003 to 2008. the survey uses a standardized scientific sample selection process, common school - based methodology, and a combination of core questionnaire modules, core - expanded questions, and country - specific questions. this study conducted secondary analyses of the publicly available data files for 25 countries and 2 cities (see table 1 for list). the 25 countries were selected because a complete nationally representative data file was publicly available. two cities (beijing, china and dar es salam, tanzania) were also included to expand the regional comparisons. all selected countries and cities used a two - stage cluster sample design. the first stage selected schools with probability proportional to enrollment size, and the second stage randomly selected classrooms in participating schools. the number of study participants and response rates for each country and the two cities are provided in table 1. as a means of comparison, this study also included information from the biannual, nationally representative youth risk behavior survey (yrbs) of high school students in the united states. for this study, data from the 2009 yrbs (n = 16, 410) were analyzed. the us high school students voluntarily completed the anonymous, self - administered questionnaire in school following local parental permission procedures. all 9th through 12th grades students in public, catholic, or other private schools in the 50 states and district of columbia were included in the sampling frame. approval to conduct these analyses was obtained from the georgia state university institutional review board. the measure of very frequent fighting was based on one survey question which asked students to report the number of times they had been involved in a physical fight during the past 12 months. response options reflected 8 levels ranging from 0 times to 12 or more times. to measure the prevalence of any fighting, the variable was coded dichotomously to indicate either no physical fights or one or more physical fights. to measure very frequent physical fighting, the variable was coded again to indicate no physical fights, 111 physical fights, or 12 or more fights. multinomial regression analyses were conducted to determine gender differences in the frequency of fighting across the selected countries and cities, with girls used as the reference group. to facilitate regional comparisons, the 27 countries and cities were divided into five world regions : sub - saharan africa, central and south america, asia, eastern mediterranean, and the usa. table 1 outlines the countries and cities that are included within each region and an overview of the sample characteristics. although trinidad and tobago is considered to be within the continent of north america, it was included in the central and south america region for the purposes of this study. one - way anova and tukey 's hsd post hoc testing were then used to determine any significant regional differences in the prevalence of physical fighting and very frequent physical fighting. the usa was omitted from anova and post hoc testing due to the lack of multiple data points in that region. the prevalence of any fighting and very frequent fighting for each country is presented in table 2. the prevalence of any fighting among students ranged from 15.9% in myanmar to 57.7% in djibouti. similarly, the prevalence of very frequent fighting varied across countries and cities ranging from 0.53% in myanmar to 7.7% in zambia. statistically significant gender differences among students reporting any fighting were observed in 21 countries and 2 cities ; no gender differences were found among students in kenya, uganda, zambia, or philippines (table 2). among students, boys were significantly more likely to report very frequent physical fighting than girls in 18 countries and 2 cities. six countries and one city demonstrated a relatively strong likelihood for very frequent physical fighting among boys versus girls, with odds ratios ranging from 7.56 to 15.60 (uruguay, myanmar, beijing, jordan, lebanon, libya, and morocco). three countries (trinidad and tobago, united arab emirates, and usa) reported moderate odds ratios for boys versus girls, including the usa in which boys were 5.13 times more likely than girls to report engaging in very frequent fighting (95% ci : 3.467.60). several other countries and one city noted significant, but less marked gender differences, with odds ratios ranging from 1.57 to 4.02 (botswana, kenya, namibia, swaziland, tanzania, argentina, indonesia, sri - lanka, and thailand). seven countries did not demonstrate a significantly higher risk for very frequent fighting among boys versus girls (ghana, uganda, zambia, guyana, philippines, egypt, and oman). these distributions of the prevalence of student involvement in physical fighting by region are based on the number of times students reported fighting in the past year (1, 2 - 3, 4 - 5, 6 - 7, 8 - 9, 10 - 11, 12, or more). the mean prevalence of any fighting (one or more times) by region is presented in figure 2. the eastern mediterranean region demonstrated the highest mean prevalence of any fighting (46.7%), while the usa had the lowest prevalence (31.4%). with the usa excluded, one - way anova determined that the prevalence of any fighting varies significantly by region (f(3,22) = 3.43, p <.05), however, post hoc testing did not find significant differences between individual regions. the mean prevalence of very frequent fighting (12 or more times) by region is presented in figure 3. the eastern mediterranean region had the highest mean prevalence of very frequent fighting (5.1%), while the asian region had the lowest prevalence (2.1%). with the u.s. excluded, one - way anova determined that the prevalence of frequent fighting varies significantly by region (f(3, 22) = 4.78, p =.01). tukey 's hsd post hoc testing showed that the eastern mediterranean region has a significantly higher prevalence of frequent fighting than the asian region (p <.01). this study examines cross - national population - based data on the prevalence of very frequent physical fighting across countries and regions of the world. although involvement in any physical fighting is a common behavior, with over half of students reporting the behavior in some countries, the findings of this study indicate that very frequent physical fighting is a relatively rare behavior. nevertheless, regional differences in the prevalence of very frequent fighting exist ; countries representing the eastern mediterranean region exhibit a significantly higher prevalence of very frequent fighting than countries in the asian region. as smith - khuri and colleagues suggest, regional differences in the prevalence of frequent fighting indicate that frequent fighting may not simply be the product of normal developmental processes among adolescents. instead, certain cultural norms and practices may either buffer against or contribute to the occurrence of very frequent fighting. certain sociopolitical environments, such as political unrest or state of war, may also be a factor. further research should seek to determine those sociocultural factors that may affect youth reports of very frequent fighting and therefore provide a greater understanding to the associated risk factors. providing a methodological example, a recent meta - analysis of cross - national research found that several sociocultural factors, such as age structure and income inequality, are significant predictors of criminal behavior, including homicide. supporting previous research [13, 14 ], the current study found that, in most countries selected for analyses, very frequent fighting was more likely to be reported by boys than girls. the potential influence of gender norms on the report of very frequent fighting should thus be explored. although the relationship context of the fighting reported in this study was not assessed, understanding the contribution of physical dating violence to the prevalence of frequent fighting may offer some important insight into the observed variation in the magnitude of gender differences. previous cross - national research suggests that girls are particularly likely to fight within the context of intimate relationships, while boys more often fight with strangers. whether girls living in countries or cultures with stricter dating practices are less involved in frequent fighting may warrant exploration. an additional aim of future research should be to determine whether higher rates of very frequent fighting among youth are associated with higher injury or death rates among young people in those countries. previous cross - national research has found that youth reporting fighting four or more times a year are typically two to three times more likely than nonfighters to be hospitalized for an injury. in this same study, the risk for injury among us youth was even greater ; frequent fighters were more than 10 times likely than nonfighters to be hospitalized. while differences in health care access may be a factor, these findings suggest that cultural norms and practices may not only influence the frequency of fighting, but perhaps the severity of fighting or use of lethal weapons as well. first, all participants were school - attending youth, and as such, the findings may not reflect the experiences of youth who have dropped out of school or may not be able to attend school. findings from a us study indicate that school attendance may be a protective factor for involvement in violence for both male and female students, thereby indicating a potential for underreporting of violent behaviors among school - attending youth. the status of school attendance as a financial privilege in some countries may further affect these findings. second, involvement in physical fighting may be considered a socially undesirable behavior, for girls in particular, thus potentially affecting the validity of self - report data. third, the gshs uses a single survey item to assess the frequency of physical fighting and, as such, does not assess the context of the fighting. the measure may or may not include incidents of fighting with siblings or other close relatives or friends in which there was no intent to harm. fourth, comparisons across regions may be biased by the countries selected for inclusion, as well as the year for which data were collected. lastly, the analyses and comparisons do not consider other demographic characteristics or societal level factors that may be relevant to frequent fighting. despite these limitations, the findings of this study maintain important implications for expanding and improving future research on frequent fighting among youth. of utmost importance is the need to establish uniform guidelines for assessing involvement in frequent fighting that would allow comparisons across populations and countries. researchers currently use a broad range of classifications to assess frequent fighting (e.g., 4 or more times) [10, 1214 ]. validation studies are thus indicated to determine meaningful fighting frequency benchmarks that are associated with an increased risk for injury or other harmful outcome. standardization of these benchmarks would aid epidemiologic research that may otherwise examine peer violence as a dichotomized construct, dividing youth into those who report no involvement in fighting versus those who report any involvement in fighting, thus ignoring the characteristics, circumstances, and precursors of frequent fighting. it is clear from this study and previous findings that focusing specifically on frequent fighting may elucidate important patterns and differences that may otherwise be missed when describing youth violence more broadly. given the variability in the prevalence of frequent fighting across countries and regions in this study, future research should examine the risk factors for fighting from an international and comparative perspective in order to inform prevention strategies that may have broader global relevance. moreover, given recent cross - national comparisons outlining a decline in fighting across primarily european countries, research examining fighting trends in other countries and regions is also needed. considerable gaps in research regarding the correlates and risk factors of frequent fighting specifically also remain. this study, which employed cross - sectional analyses of recent population - based surveillance data to understand the current prevalence and context of frequent fighting, provides insight for addressing these gaps. furthermore, this study provides a starting point for further research to determine whether youth violence prevention interventions that specifically target frequent fighters present the opportunity for increased impact, particularly in areas with limited resource. | objective. using nationally representative data, this study examined the prevalence of very frequent physical fighting (12 times per year) among youth in 27 countries and cities. frequent physical fighting has rarely been reported in the previous literature despite the implications for research and practice. methods. analyses were based on the global school - based student health survey (20032008) and the 2009 us youth risk behavior survey. multinomial regression analyses were conducted to determine gender differences in frequent fighting. countries were categorized into five regions (sub - saharan africa, central and south america, asia, eastern mediterranean, and the united states), and one - way anova tests were used to determine regional differences. results. the prevalence of frequent fighting was highest in zambia (7.7%) and lowest in myanmar (0.5%). gender differences were found in 20 countries, with boys being more likely to report frequent fighting than girls. the prevalence of frequent fighting varied by region (f(3,22) = 4.78, p =.01), with the eastern mediterranean having a significantly higher prevalence of frequent fighting than asia (p <.01). conclusion. the prevalence of frequent fighting varies by gender in many countries and varies across world regions. more cross - national research is needed to better understand the sociocultural context of frequent fighting and to inform youth violence prevention efforts. |
forty patients with aphakia were randomized and allocated into anterior chamber (group 1) and retropupillary implantation (group 2) group. group one received artisan iris - claw iol (ophtec, groningen, the netherlands) implantation over the iris, and group 2 received retropupillary artisan iol implantation. this study protocol was approved by the local ethics committee and written informed consent form was obtained from all patients. patients who were admitted to adana numune training and research hospital with aphakia and no capsular support between november 2013 and april 2014 were included in this study. inclusion criteria included aphakia which is due to trauma, complicated cataract surgery and lens / iol luxation, integrity of the iris which allows to enclavation of the iol 's claw, normal intraocular pressure (iop) limits, anterior chamber depth > 3.2 mm, endothelial cell density > 900/mm, and normal retinal examination. exclusion criteria were glaucoma, iris defect, uveitis, and any pathology of the retina. clinical and demographic features (such as age, gender, and etiology of aphakia) of the patients were noted. iop which measured with goldmann applanation tonometry, snellen 's corrected distance visual acuity (cdva), slit - lamp biomicroscopy examination, and fundus examination were evaluated preoperatively and at 24 h, 1 week, 1, 3, and 6 month postoperatively by the same examiner. all the data were analyzed using spss 18.0 package (ophtec, groningen, the netherlands) program. if the data have a normal distribution, paired samples t - test was used to compare the preoperatively and postoperatively cdva and iop values. iol power was calculated with an a - constant of 115 for group 1, and 117 for group 2 by ultrasonic biometry (digital a / b scan 5500 ; sonomed inc., since some patients have iol luxation, lens luxation or luxated nigra cataract, operation was combined with pars plana vitrectomy and iol / lens explantation. the surgeon performed iris - claw iol implantation with the same standardized technique. in summary, two vertical side - port at 2 and 10 oclock were performed. artisan iol with a position of convex side up for group 1, convex side down for group 2 was inserted, rotated the iol such that haptics were positioned at 3 and 9 oclock and centralized. thereafter, artisan iol 's optic was holded with its special forceps ; for anterior chamber group iris was enclavated between the iol 's claw haptics using special enclavation needles. after repositioning the iol behind the iris and centralized, a total of forty eyes (group 1 : twenty anterior chamber iris - claw fixation, group 2 : twenty retropupillary iris - claw implantation) of forty different patients (24 males, 16 females) with aphakia of various etiologic reasons were treated with artisan iol. mean age of the patients was 69.2 7.4 (min - max : 4582 years). eleven (55%) patients right eyes, 9 (45%) patients left eyes, 12 (60%) patients right eyes, and 8 (40%) patients left eyes were treated in group 1 and 2, respectively. when evaluating the age range, in each group, there was an accumulation among 7079 age. when comparing the each group the most causative etiologic factor was complicated cataract surgery resulted in aphakia (65% and 65% for group 1 and 2, respectively). there was no statistically significance when indications compared between the two groups (p = 0.434). the demographic features of the patients surgery indications of group 1 surgery indications of group 2 there was no complication intraoperatively and desired anatomic conclusions were achieved [fig no hypotony, uveitis, cystoid macular edema, iol dislocation, hyphema, and vitreous hemorrhage were seen at long - term follow - up (1 week - 6 month) like mentioned about in the other studies. nevertheless, pupillary distortion was seen in one patient in group 1 and in two patients in group 2. since aforementioned detachment was in the inferior retina with a shallow feature, it was just followed with no intervention in a 6 months follow - up. elevated iop were noted in four patients in group 1 and in five patients in group 2 1 week postoperatively. these increases were statistically significant for each group at 1 week (p < 0.05). all patients increased iop values were controlled adequately with a fix combination of hypotensive drop (dorzolamide / timolol 2 times / day). when the treatment stopped just a few weeks later, there was no permanent increase of iop. there was no statistically significance when complications range compared between the two groups (p = 0.067). an implanted anterior chamber artisan intraocular lens when evaluating the cdvas in both groups, there was statistically significant increase when compared the preoperatively and for each 1 week, 1, 3, and 6 month values (p < 0.05). however, these increases were stabilized since 1 month visit. sixteen patients achieved the same final cdva values, four patients achieved poorer cdva values that were measured preoperatively in group 1. eighteen patients achieved the same final cdva values, two patients achieved a poorer cdva that was measured preoperatively in group 2. mean spherical equivalent (se) was 4.98 5.99d in group 1 and 4.87 6.01 in group 2 preoperatively. when evaluated postoperatively, se decreased to 0.25 1.87/0.25 1.75 in group 1 and 2, respectively. p values of the best corrected visual acuity and intraocular pressure values at 6 months follow - up best corrected visual acuity and intraocular pressure values of each group at 6 months follow - up in this study, we aimed to compare the short - term efficiency and complications of anterior chamber and retropupillary implantation of artisan iol, to the best of our knowledge, it is the first time in data. there had been many reported studies that evaluated the angle - supported and scleral fixated iols in case of insufficient capsular support. in contrast to aforementioned surgery procedures ; artisan iol seems to be safer, efficient, and easily applicable way to correct aphakia. in our presented study, we corrected aphakia using artisan iol (model 205) over and behind the iris. artisan iol for aphakia is a single - piece polymethyl methacrylate iol with its 5.4 mm optic body and 8.5 mm overall length. there is a large available diopter range (+ 2.0d to + 30.0d with 1.0d increments and + 14.5d to + 24.5d with 0.5d increments). gell. reported that artisan iol implantation caused approximately 10.9% endothelial cell loss in the 3 years follow - up. anbari and lake reported preoperative manual endothelial cell density mean of 2269 611 cells / mm decreased postoperatively to 2002 532 cells / mm at 2 years (p = 0.0005). in our series, reported that anterior chamber implantation results in more endothelial cell loss than the retropupillary implantation. anyway, since the artisan iol 's haptics probable contact is being prevented to the endothelium ; it should be safer to implant it retropupillary. reported some contraindications for iris - claw lens implantation such as ischemic vitreoretinopathies, such as diabetes or vascular occlusive entities, as well as uveitis. when compared the amounts of patients whose iop values were increased in each group, there was no statistically significance (p = 0.543). pupil distortion was observed in three patients ; however, none of them was permanent. a considerable disadvantage of artisan iol is that it requires a wide corneal incision because of its 5.4 mm width polymethyl methacrylate optic body. another difficulty of retropupillary implantation is the probability of iol dislocation to vitreous due to enclavation fail. although anterior implantation has a risk of endothelial touch in shallow anterior chambers, it is easier than retropupillary implantation. in both ways, accordingly, this article suggests that both anterior and retropupillary implantation of artisan iol are effective in visual improvement, comfortable applicable, and time - saving surgery technique. as regards the limitation of this study was its small sample size and not to count the endothelial cell density. patients could be followed up longer as well. in consideration of our first and preliminary results, both anterior and retropupillary implantation of artisan iol the surgical procedure is dependent to the experience of the surgeon. to assess the safety and efficacy of these two methods, long - term follow - up is needed. further studies are required to compare the anterior and posterior implantation of artisan iol taking into account endothelial cells counting with more sample size and long - term follow - up. | purpose : to compare the outcomes of anterior chamber and retropupillary implantation of iris - claw artisan intraocular lenses (iol).design : prospective, randomized, single - blinded study.patients and methods : forty eyes of forty aphakic patients were enrolled. patients were randomized into two groups. each group includes twenty patients. group 1 received anterior chamber artisan iol implantation. group 2 received retropupillary artisan iol implantation. preoperative and postoperative corrected distance visual acuity (cdva), intraocular pressure (iop), and all complications were noted and compared at 6 months follow-up.results:each two groups obtained a significant improvement in cdva (p < 0.05). four patients in group 1 and five patients in group 2 had significant but nonpermanent increase at iop values. there were one and two pupillary irregularity in group 1 and group 2, respectively. in one patient, a shallow and inferior located retinal detachment were encountered in anterior chamber group.conclusions:the results were not significantly different between the two fixation techniques for iris - claw lens. the surgery procedure is dependent to surgeon experience and eye 's conditions. |
ak is a 61-year - old woman who developed right upper quadrant pain and underwent a laparoscopic cholecystectomy on january 22, 2013. operative findings included a porcelain gallbladder, an apparent liver metastasis, and peritoneal metastases. the gallbladder was removed and one liver lesion was biopsied. immunohistochemical stains were strongly positive for ck7, polyclonal cea, and nuclear cdx-2. based on the histology and immunostaining, chemotherapy was initiated with cisplatinum (25 mg / m, days 1 and 8) and gemcitabine (1,000 mg / m, days 1 and 8) every 21 days. after two cycles, her ca19 - 9 had increased from 1,070 u / ml to 3,769 u / ml (035 u / ml) and a computed tomography (ct) scan of her chest / abdomen / pelvis showed interval progression of her metastatic liver disease (largest liver lesion now 8 5 cm). immunohistochemical staining revealed her-2 immunostain is strongly positive in the majority of tumor cells. the pathologist wrote the clinical significance of this finding in these tumors is unknown. the pathologist noted that the staining would be the equivalent of 3 + by immunohistochemistry for her-2 had this been a breast cancer specimen or a gastric cancer specimen. breast and gastric cancers are the only tumors where her-2 3 + staining is currently defined. the definition of 3 + staining for breast cancer is very strong, complete, circumferential, membrane staining in 10%30% of the tumor cells, and in gastric cancer the definition of 3 + staining is strong, complete, basal lateral, or lateral membranous reactivity that is seen in greater than 10% of tumor cells. on april 9, 2013, therapy was started with weekly paclitaxel (80 mg / m) and trastuzumab (4 mg / kg loading dose followed by 2 mg / m). her ca19 - 9 improved from 4,143 u / ml on april 9, 2013 to 1,370 u / ml on may 21, 2013. a ct scan on may 20, 2013 showed interval decrease in the size of the liver metastases, with the largest lesion having decreased in size from 8.5 5 cm to 5.4 3.8 cm. paclitaxel therapy was discontinued and the patient has remained on single - agent trastuzumab weekly. by june 26, 2013, her ca19 - 9 had improved to 432 u / ml and a repeat ct on july 1, 2013 showed interval decrease in the size of the liver metastases, with the largest lesion having decreased in size from 5.4 3.8 cm to 2.8 2.1 cm. she continued to receive trastuzumab alone, and a repeat ct scan on september 18, 2013 showed a further response of her metastatic disease to trastuzumab alone, with the largest liver lesion having decreased in size from 2.8 2.1 cm to 1.3 0.8 cm. again, there were no enlarging or new lesions. her-2 is an erbb tyrosine kinase family receptor.1,2 in breast cancer, trastuzumab is approved by the us food and drug administration for use as part of adjuvant and metastatic disease therapy in patients with tumors that overexpress her-2 as measured by immunohistochemistry (ie, 3 +) or show her-2 gene amplification by fluorescence in situ hybridization.3,4 trastuzumab is also approved for use in combination with chemotherapy for patients with her2-overexpressing metastatic gastric or gastroesophageal cancers.5 biliary cancers are relatively rare cancers and include adenocarcinomas originating in the gallbladder or bile ducts. patients randomized to receive gemcitabine and cisplatinum showed a small overall survival benefit of 11.7 months compared with 8.1 months for those receiving gemcitabine alone.6 this combination has consequently become a standard first - line therapy for patients with metastatic biliary cancer. the cancer in our patient progressed while she received that combination, and there is no proven efficacy of second - line therapy for metastatic biliary cancer. only about 5% of biliary cancers overexpress her-2.710 ak s gallbladder adenocarcinoma did overexpress her-2. while there is no formal definition of her-2 3 + in biliary cancers, had her tumor been a breast or gastric cancer, it clearly would have met the criteria for her-2 3 + overexpression, as described above. over the time she received trastuzumab alone, her tumor responded both radiographically and biochemically to trastuzumab alone, with her ca19 - 9 improving from 1,370 u / ml to 432 u / ml and her largest liver lesion decreasing in size from 5.5 3.8 cm to 1.3 0.8 cm, as noted in the radiology ct reports. a review of the literature identified a single case report of a patient with biliary cancer responding to paclitaxel in combination with trastuzumab,11 but no previous report could be found of a patient responding to trastuzumab as a single agent. in this case,. in summary, this metastatic gallbladder cancer was continuing to respond biochemically (ie, decreasing ca19 - 9) and radiographically to trastuzumab alone during the interval between may 20, 2013 and september 16, 2013. ideally, a study of patients with her-2-overexpressing biliary cancer might confirm the benefit of using trastuzumab in patients with her-2-overexpressing biliary cancer. | trastuzumab is a monoclonal antibody targeting her-2. her-2 overexpression has been described in gallbladder cancer and in cholangiocarcinoma. this report describes the first case of a patient with her-2 overexpressing metastatic gallbladder adenocarcinoma and responding radiographically and biochemically to trastuzumab alone. |
proper functioning of the central nervous system requires a fine balance between excitatory and inhibitory neurotransmission. cortical inhibitory neurons, classified by their expression of the inhibitory neurotransmitter gamma aminobutyric acid (gaba), comprise 1025% of neurons in the cortex and are the primary source of inhibition. cortical inhibitory neurons play major roles in neural development and are important for processes such as fine - tuning of glutamatergic synapse formation and function and defining the timing of critical periods of experience - dependent neural plasticity in the developing brain [3, 4 ]. cortical inhibitory neurons are also regulators of high frequency gamma oscillations, which are thought to underlie cognitive processes such as working memory and attention [57 ]. there is also abundant evidence that deficits in the development and function of cortical inhibitory neurons are involved in neurodevelopmental disorders such as epilepsy, schizophrenia, and autism spectrum disorders (asds) [1, 813 ]. therefore, understanding the molecular pathways that regulate inhibitory neuron development may shed light on how their function is disrupted in these disorders. in this regard, the morphological development of cortical inhibitory neurons is governed by both extracellular (e.g., neuronal activity and nrg1 [1517 ]) and intracellular signalling molecules (e.g., the distal - less homeobox (dlx) family of transcription factors), which regulate the branching of dendrites and formation of synapses. however, the underlying signalling pathways governing inhibitory neuron development and, consequently, how these processes may be affected in neurodevelopmental disorders are still poorly understood. multiple studies have implicated a crucial role for the neuregulin-1- (nrg1-) erbb4 signalling pathway in the development of cortical inhibitory neurons. furthermore, several linkage and genetic association studies have identified the genes encoding both of these proteins as risk factors for schizophrenia [1923 ]. nrg1 is a neurotrophic factor that binds to and activates the erbb family of receptor tyrosine kinases on target neurons [24, 25 ]. in the mouse cortex, erbb4 is predominantly expressed in gaba - ergic inhibitory neurons, with lower expression levels in excitatory neurons [17, 2628 ]. biological functions of the nrg1-erbb4 signalling pathway in inhibitory neuron development include processes such as neuronal migration, dendrite growth, synapse formation, and neurotransmitter receptor expression [15, 16, 2931 ]. for example, application of nrg1 to cortical neuronal cultures results in increased dendrite growth and excitatory synaptogenesis onto inhibitory neurons [15, 16 ], and inhibitory neuron - specific erbb4 knockout mice display decreased excitatory synaptogenesis onto cortical inhibitory neurons. one of the mechanisms by which nrg1-erbb4 signalling regulates these processes is through activation of kalirin-7, a gene previously implicated in schizophrenia [15, 32, 33 ]. however, there is little known about other signalling molecules downstream of nrg1-erbb4 in this context. disrupted in schizophrenia 1 (disc1) is another putative schizophrenia risk gene [3441 ], and many lines of evidence suggest that it may functionally and/or physically interact with the nrg1-erbb4 signalling pathway [15, 17, 30, 4047 ]. disc1 was first identified as a balanced translocation between chromosomes 1 and 11 (1q42.1 ; 11q14.8) in a scottish pedigree with a high prevalence of schizophrenia and other psychiatric disorders [32, 33 ]. previous studies suggest that it may work as a dominant negative protein [4850 ], while another study suggests the disease mechanism may be haploinsufficiency with the possibility of novel transcripts being generated due to the translocation. the disc1 gene encodes a scaffold protein that is expressed in the developing and adult brain and shares many roles in neurodevelopment with the nrg1-erbb4 pathway [15, 46, 48, 50, 53, 54 ]. conditional inhibitory neuron - specific erbb4 knockout mice and disc1 genetic mouse models display similar morphological deficits in brain development as well as behavioural phenotypes such as abnormal sensorimotor gating, working memory, and sociability [17, 30, 4043, 50 ]. additionally, erbb4 and disc1 share common binding partners at the postsynaptic density of excitatory synapses (e.g., postsynaptic density-95 (psd95) and kalirin-7) suggesting that they may physically or functionally interact [15, 44, 45 ]. a study by seshadri and colleagues demonstrated that treatment of primary mouse cortical neurons with nrg1 increased disc1 expression in the neurites of cortical neurons. however, this effect was primarily mediated by erbb2/3, suggesting that a novel nrg1-erbb2/3 pathway regulates disc1 expression in cortical excitatory neurons. more recently, a study by the sawa laboratory demonstrated that, in the mature mouse cortex, there is a functional relationship between nrg1, erbb4, and disc1 in the regulation of synaptic plasticity in inhibitory neurons. however, whether this relationship is established during inhibitory neuron development and how the scottish disc1 mutation impacts this process have not been experimentally interrogated. here, we show that nrg1 functions through disc1 to regulate the development of dendrite growth and excitatory synapse formation onto inhibitory neurons using inhibitory neuron - specific expression of a dominant negative disc1 mutant that models the scottish mutation. furthermore, we provide evidence that treatment of primary mouse cortical cultures with nrg1 increases disc1 levels and localization to glutamatergic synapses in the primary dendrites of inhibitory neurons. finally, we provide evidence that erbb4 binds to disc1, suggesting that, in developing inhibitory neurons, nrg1-erbb4 signals through disc1. together these results show that two candidate schizophrenia risk pathways functionally interact to regulate the development of cortical inhibitory neuron morphology. the following primary antibodies were used in this study : goat anti - disc1 n - terminus (n-16) (santa cruz biotechnology ; if / pla 1 : 100, wb 1 : 500), rabbit anti - erbb4 c - terminus (c-18) (santa cruz biotechnology ; pla 1 : 100, wb 1 : 100), guinea pig anti - vglut1 (emd millipore ; if 1 : 1000, wb 1 : 3000), anti - gad65&67 (millipore ; 1 : 1000), mouse anti - gfp (santa cruz biotechnology ; ip 1 : 1000), rabbit anti--actin (cell signaling technologies ; ib 1 : 1000), anti - mouse igg (ip 1 : 1000), and chicken anti - gfp (aves labs inc. ; if 1 : 1000). all secondary antibodies (anti - goat cy5, anti - guinea pig cy3, and anti - chicken 488 ; jackson immunoresearch ; if 1 : 500, anti - rabbit - hrp, anti - mouse - hrp ; ge life sciences ; ib 1 : 5000) were raised in donkey. the control shrna, disc1 shrna, and disc1-gfp constructs were created as described previously. the full - length mouse disc1 gene (disc1fl) (refseq nc_000074.6) and a c - terminal truncated mutant in which the c - terminal 257 amino acids are deleted (disc1dn) were assembled from synthetic oligonucleotides and/or pcr products. each fragment was cloned separately into the pg67-gfp vector (kanr) using paci and pmei cloning sites, resulting in constructs containing the promoter of gad67 upstream of the disc1fl or disc1dn coding sequence. the erbb4 plasmid and erbb4 kd plasmid were gifts from yardena samuels (pcdna3.1-erbb4 : addgene plasmid # 29527, pcdna3.1-erbb4 kinase dead : addgene plasmid # 29533). cortices were dissected out of cd1 mouse (charles river) embryonic brains at e16. dissociation was aided by incubation in 0.3 mg / ml papain (worthington biochemical)/400 u / ml dnase i (invitrogen) in 1x hanks buffered saline solution (hbss) for 20 minutes at 37c, followed by light trituration. cells were seeded onto 0.1 mg / ml poly - d - lysine (bd sciences)/3.3 g / ml laminin (sigma)-coated cover slips (matsunami) in 12-well plates at a density of ~0.81 10 cells / well in plating media containing neurobasal medium, 10% fetal bovine serum, 1% penicillin / streptomycin, and 2 mm l - glutamine (invitrogen). after 1.5 hours, media was changed to serum - free feeding media containing neurobasal medium, 2% b27 supplement, 1% penicillin / streptomycin, and 2 mm l - glutamine. at div24, cultures were treated with 1 m cytosine -d - arabinofuranoside hydrochloride (ara - c) (sigma) to inhibit glial cell proliferation. transfections were performed at div7 using lipofectamine ltx and plus reagents (invitrogen) according to the manufacturer 's instructions. hek 293 ft cells were cultured in dulbecco 's modified eagle medium (fisher scientific) supplemented with 10% fbs and 1% glutamax (fisher scientific) and hek 293 ft cell transfections were performed using lipofectamine 2000 (invitrogen) according to the manufacturer 's instructions. primary neurons were treated with 5 nm recombinant human nrg11/hrg11 egf domain (r&d systems) dissolved in phosphate - buffered saline (pbs) on div19 and 20. blotting, primary cortical cultures were treated with 5 nm nrg1 on div3 and 4, and scraped into lysis buffer on div5. for duolink proximity ligation assays, cells were treated with nrg11 or pbs for 5 minutes prior to fixation. hek 293 ft cells were treated with 10 nm human nrg11/hrg11 egf domain for 5 minutes at 37c. following treatment, cells were placed on ice, washed with ice - cold pbs, and scraped into lysis buffer. protein lysates were prepared by cell scraping in lysis buffer (150 mm nacl, 1% triton x-100, 50 mm tris - cl, and complete mini protease inhibitor cocktail (roche). 25 l protein g dynabeads (fisher scientific) were incubated with 5 g primary antibody or igg control antibody for 1 h at 4c. lysates were then incubated with the bead - ab conjugate for 1 h at 4c. the beads were then washed three times with lysis buffer and then boiled in sample buffer for 5 minutes. for western blotting, 20 l of sample was loaded in a 8% tris - glycine gel and run at room temperature, followed by transfer to a pvdf membrane (thermo scientific). membranes were blocked for 1 h in 3% milk in 1x tbst and incubated with primary antibody overnight and then with secondary antibody (donkey anti - mouse or anti - rabbit hrp, ge healthcare) for 1 h at room temperature before exposure using a chemidoc mp system (biorad). on div21, cells on glass cover slips were fixed in 4% formaldehyde in pbs for 20 minutes at room temperature. cells were washed in pbs, followed by blocking in blocking / permeabilization solution consisting of 10% donkey serum (cedarlane) and 0.3% triton x-100 (fisher scientific) in pbs for 1 hour at room temperature. cells were then washed in pbs, followed by incubation with secondary antibodies in 50% blocking / permeabilization solution at room temperature with gentle agitation for 1.5 hours. cells were then washed in pbs and were mounted on vistavision glass microscope slides (vwr) using prolong gold antifade reagent (life technologies). cover slips were allowed to dry overnight before being imaged on a zeiss lsm700 confocal microscope. for puncta analyses, images were manually thresholded using imagej such that each image within an experiment was thresholded to the same value. tool in imagej was used to count the number of individual puncta from the cell body and two to three dendritic sections per cell (1040 m) of primary dendrites adjacent to the cell body. the straight line tool was used to draw a line 200 m in length starting from the centre of the soma. the sholl analysis plugin (http://labs.biology.ucsd.edu/ghosh/software/shollanalysis.pdf) was used to make concentric circles increasing at a constant radius of 10 m and to count the number of intersections. cortical neurons were seeded onto poly - d - lysine / laminin - coated cover slips in 24-well plates (~3.5 10 cells / well) or 12-well plates (~1 10 cells / well). after treatment on div21, the cortical neurons were fixed with 4% formaldehyde in pbs at room temperature for 20 minutes. cells were washed in 1x pbs 3 times, 8 minutes each, followed by blocking in blocking / permeabilization solution consisting of 10% donkey serum (cedarlane) and 0.3% triton x-100 (fisher scientific) in pbs for 1 hour at room temperature. samples were washed in 1x wash buffer a (supplied with the kit) at room temperature 2 times, 5 minutes each, followed by incubation with a mixture containing the two pla probes diluted in 50% blocking / permeabilization solution in a humidified chamber at 37c for 1 hour. the cells were again washed in 1x wash buffer a at room temperature 2 times, for 5 minutes. the ligation reaction was performed in a humidified chamber at 37c for 30 minutes, followed by washing in 1x wash buffer a 2 times, 5 minutes each. the cells were then incubated with the amplification - polymerase solution for 100 minutes at 37c in a darkened humidified chamber. the cells were then washed with 1x buffer b (supplied with the kit) 2 times, 10 minutes each, followed by a 1 minute wash with 0.01x buffer b at room temperature. cover slips were then mounted onto vistavision glass microscope slides (vwr) using mounting media with dapi (supplied with the kit). images were acquired on a zeiss lsm700 confocal microscope using a 63x objective. the pla signal density (identified as red dots) was quantified in the cell body and 3 primary dendrites per cell from manually thresholded maximum intensity projections of three to seven z - stacks (1 m step size) per image using imagej. comparisons between multiple groups were made using one - way analysis of variance (anova), with tukey 's post hoc tests to identify significant differences between groups. we used mixed primary cortical neuron cultures derived from e16/17 mouse embryos as our model system, which contains both excitatory and inhibitory neurons. to label and identify cortical inhibitory neuron, we transfected cultured neurons with a plasmid that expresses green fluorescent protein (gfp) under an enhancer element of the distal - less homeobox (dlx) 5 gene, which is expressed in the majority of forebrain inhibitory neurons. we then cotransfected previously validated control shrna or disc1 shrna plasmids together with dlx5/6-gfp into day in vitro (div) 7 neurons. we treated cultures with nrg1 (or pbs control) for two days beginning at div19 and analyzed cells at div21. we found that knocking down disc1 expression caused no change in the puncta density of the excitatory presynaptic marker, vesicular glutamate transporter 1 (vglut1), in both the cell body and primary dendrites compared to control shrna - treated neurons (supplementary figures 1a c in supplementary material available online at http://dx.doi.org/10.1155/2016/7694385). furthermore, we found that the control shrna - expressing neurons treated with nrg1 showed an increase in vglut1 puncta density in the primary dendrites, in line with a previous report (figures 1(a) and 1(c)). to determine if disc1 plays a role in this process, we knocked down disc1 in neurons treated with nrg1 and discovered that the nrg1-mediated increase in vglut1 puncta density was completely abolished (supplementary figures 1a c). using the same cultures for analysis, we imaged the complete dendritic morphology of individual gfp - labelled cortical inhibitory neurons. using sholl analysis, we determined that knocking down disc1 led to a decrease in dendritic morphology in pbs - treated cells (supplementary figures 1d f). furthermore, we determined that nrg1 treatment for two days led to an increase in dendritic morphology, which was abolished when disc1 expression was decreased using shrna (supplementary figures 1d f). taken together, these results suggest that nrg1 regulates the dendritic and synaptic growth of cortical inhibitory neurons and requires disc1 expression to mediates these effects. the results in supplementary figure 1 suggest that nrg1 regulates cortical inhibitory dendrite and synapse growth ; however, a caveat of these experiments is that disc1 was knocked down nonspecifically in both excitatory and inhibitory neurons since we used cultures. therefore, in our subsequent experiments we specifically manipulated disc1 levels in cortical inhibitory neurons with a construct that uses the glutamic acid decarboxylase (gad67) promoter to drive separate expression of gfp and disc1 (pg67-gfp). gad67 is expressed in all forebrain gaba - ergic neurons as it is the rate - limiting enzyme in the conversion of glutamate to gaba. furthermore, it has been reported that the majority of dlx5-expressing cortical inhibitory neurons also express gad67. immunostaining of cortical cultures transfected with pg67-gfp confirmed that gfp - positive neurons expressed endogenous gad67 (figure 1(a)). given the potential relationship between nrg1 and disc1 we uncovered, we wanted to determine if nrg1 treatment specifically regulates disc1 expression in cortical inhibitory neurons. it has been previously shown that nrg1 treatment of cortical neuron cultures leads to an increase in disc1 levels via an erbb2/3-mediated mechanism, most likely reflecting disc1 levels in excitatory neurons as they make up 8090% of cortical neuron cultures. therefore, we hypothesized that nrg1 also regulates disc1 expression levels and localization specifically within inhibitory neurons. using quantitative immunofluorescence, we first detected that two days of nrg1 treatment (starting at div19) of developing cultures caused a significant increase in disc1 levels in the primary dendrites and the cell body of div21 cortical inhibitory neurons compared to vehicle treatment (pbs) (figures 1(b), 1(c), and 1(f)), suggesting that the growth effects of nrg1 on inhibitory neurons may require disc1. given this result, we next asked whether the nrg1-induced increase in disc1 expression is localized to excitatory synapses on inhibitory neurons by staining for vglut1. the numbers of vglut1 or double - positive disc1/vglut1 puncta on the cell body and primary dendrites of pg67-gfp positive inhibitory neurons were quantified. we found that nrg1 treatment led to a significant increase in the number of vglut1-positive excitatory synapses on both the cell body and primary dendrites (figures 1(b), 1(d), and 1(g)). furthermore, we found a significant increase in double - positive disc1/vglut1 puncta on the cell body and primary dendrites on cortical inhibitory neurons (figures 1(b), 1(e), and 1(h)). these data indicate that nrg1 stimulation is sufficient to increase disc1 levels and localize its expression to excitatory synapses formed on inhibitory neurons. additionally, western blotting of cultured cortical neurons treated with nrg1 on div3 and 4 showed a slight increase in vglut1 and disc1 levels compared to vehicle (pbs) treated cultures, although this was not significant (figure 1(i)). in the mouse brain, the nrg1 receptor erbb4 is primarily localized to gaba - ergic interneurons in the postsynaptic densities receiving glutamatergic input, where it regulates excitatory synapse formation and maturation. to investigate whether disc1 works downstream of nrg1-erbb4 to regulate excitatory synapse formation onto cortical inhibitory neurons, we examined vglut1 immunofluorescence in primary cortical cultures. cortical cultures were transfected with pg67-gfp on div 7 and treated with nrg1 or pbs for two days, starting on div 19. quantification of discrete puncta of vglut1 immunoreactivity in div21 cortical inhibitory neurons expressing pg67-gfp revealed that nrg1 treatment caused a significant increase in puncta density on both the cell body and primary dendrites (figures 2(b)2(d)). coexpression of pg67-gfp with a plasmid expressing full length mouse disc1 under control of the gad67 promoter (pg67-disc1fl) revealed that expression of disc1fl in inhibitory neurons at baseline conditions (pbs) had no effect on vglut1 puncta density compared to pg67-gfp - only controls (figures 2(b)2(d)). to study the scottish disc1 mutation, we used a c - terminal truncated mouse disc1 mutant (disc1dn) (figure 2(a)). the stop codon of this mutant occurs at the orthologous region of the translocation breakpoint found in the human disc1 scottish pedigree. when overexpressed in mice, this mutant has been shown to act in a dominant negative manner by binding to and redistributing wild - type (wt) disc1, causing defects in neural migration, dendrite formation, and reduced cortical parvalbumin levels [50, 53, 54 ]. we cotransfected pg67-gfp with a plasmid expressing disc1dn under control of the gad67 promoter (pg67-disc1dn) and compared its expression to disc1fl in cortical inhibitory neurons and found no gross differences in expression levels (figure 2(c)). in subsequent experiments with the disc1fl and disc1dn plasmids, we found that expression of disc1dn in inhibitory neurons at baseline conditions (pbs) significantly decreased vglut1 puncta on the primary dendrites, but not in the cell body (figures 2(d) and 2(e)), suggesting that the disc1 scottish mutation impairs excitatory synaptogenesis onto cortical inhibitory neurons at baseline conditions. we then performed the same experiment in the presence of nrg1 stimulation for 2 days (starting at div19). we discovered that expression of pg67-disc1dn completely blocked the nrg1-induced increase in vglut1 puncta density on both primary dendrite shafts and the cell body (figures 2(d) and 2(e)). these data indicate that inhibiting disc1 specifically in cortical inhibitory neurons blocks nrg1-induced effects on glutamatergic synaptogenesis. taken together, these results implicate a cell - autonomous role for nrg1-disc1 signalling in developing cortical inhibitory neurons. however, it is important to note that while the truncated disc1 mimics the scottish mutation discovered in patients, our overexpression paradigm does not recapitulate allele heterozygosity as patients have one intact disc1 allele. given our identification of a developmental relationship between nrg1 and disc1 in excitatory synaptogenesis on inhibitory neurons, we examined whether this extends to neuronal morphology. although both nrg1 and disc1 have been found to independently regulate dendrite growth in cortical neurons, it is still unknown whether they regulate this process together [15, 48 ]. therefore, to elucidate a functional interaction between nrg1 and disc1 in cortical inhibitory neurons dendrite growth, we examined the effects of expression of pg67-disc1fl or pg67-disc1dn at baseline (pbs) and nrg1 treatment conditions. cultures were then treated with either nrg1 or pbs on div19 and fixed and analyzed on div21. sholl analysis revealed that, at baseline conditions, expression of pg67-disc1fl had no significant effect on dendrite growth, whereas pg67-disc1dn expression significantly decreased dendrite growth (figures 3(a)3(c)). similar to previous reports, we found that stimulation of cultures with nrg1 increased inhibitory neuron dendrite growth and complexity (figures 3(a)3(c)). sholl analysis revealed that expression of pg67-disc1fl or pg67-disc1dn blocked the nrg1-induced effects on dendrite growth, causing a significant decrease in dendrite growth compared to the pg67 control under nrg1 treatment conditions (figures 3(a)3(c)). these data suggest that the disc1dn mutant affects dendrite growth specifically in cortical inhibitory neurons, implicating a cell - autonomous role of disc1 in regulating dendrite growth in this cell type. in addition, the observation that overexpression of either full - length disc1 or mutant truncated disc1 inhibited nrg1-induced dendrite growth demonstrates the complexities of nrg1 signalling. our data thus far suggest that nrg1 requires disc1 for certain aspects of inhibitory neuron dendrite and glutamatergic synapse growth ; however, we do not know whether disc1 functions directly downstream of erbb4, the receptor for nrg1. disc1 and erbb4 share many binding partners at the postsynaptic density [15, 44, 45 ] ; therefore, we hypothesized that disc1 may physically interact with erbb4. a recent study demonstrated that disc1 plays a role in regulating the interaction between erbb4 and the postsynaptic protein, psd95 particularly in the mature cortex. however, whether disc1 binds the erbb4 receptor specifically within developing inhibitory neurons, and if nrg1 regulates this process, remains unknown. we first took a biochemical approach to test this using a heterologous cell system (hek293 ft cells). we expressed erbb4, kinase dead erbb4 (erbb4 kd), or disc1-gfp alone or disc1-gfp + erbb4 or disc1-gfp + erbb4 kd in hek293 cells, immunoprecipated for gfp, and used an erbb4 antibody to determine binding to disc1. we found that when disc1-gfp and erbb4 were expressed together in hek293 cells, we detected an interaction between the two proteins, demonstrating that they can direct bind one another (figure 4(a), asterisks). interestingly, we found this interaction was reduced when a kinase dead version of erbb4 was expressed, indicating disc1 may require nrg1 activation of erbb4 for intracellular binding (figure 4(a)). however, the interaction between disc1 and erbb4 was not changed in the presence of nrg1 stimulation likely because the overexpressed erbb4 receptor self - dimerizes, causing transactivation. while these experiments indicate erbb4 can bind disc1, these results do not extend to inhibitory neurons. considering that only 1025% of cultured cortical neurons are inhibitory neurons, traditional coimmunoprecipitation experiments would not be able to detect interactions specifically within inhibitory neurons. therefore we used an alternative technique to overcome this problem and examine the interaction specifically in pg67-gfp - positive cultured inhibitory neurons. to do this, we performed a proximity ligation assay (pla) on div21 cortical cultures transfected with pg67-gfp on div7 (figures 4(b)4(d)). pla is a method that allows for visualization of endogenous protein - protein interactions in fixed cells and results in a punctate fluorescent signal where the proteins are within 40 nm of each other. analysis of pla signal density in cortical inhibitory neurons expressing pg67-gfp revealed that nrg1 caused a significant increase in pla signal density compared to pbs - treated controls in both the cell body and primary dendrites (figures 4(b)4(d)). signal density in pbs treated cells was no different than that of the control pla condition, in which primary antibodies were omitted (figures 4(b)4(d)). we also detected pla signal outside of the gfp - inhibitory neuron, which we attribute to disc1 binding to the low levels of erbb4 in excitatory neurons (figure 4(b), lower left panel). taking the biochemical and pla results together, they demonstrate that erbb4 binds to disc1 and that nrg1 stimulation increases this interaction in developing cortical inhibitory neurons. this suggests that disc1 may be recruited to activated erbb4 upon nrg1 binding to erbb4 and is a part of the initial signalling cascade downstream of nrg1-erbb4 during development. the development of cortical inhibitory neurons is crucial for normal cognitive processes, and disrupted development and function of these cells are strongly implicated in neurodevelopmental and psychiatric disorders. however, since their development is not well understood, it is important to gain a better understanding of the signalling mechanisms that regulate inhibitory dendrite and synapse growth. our study reveals that nrg1-erbb4 signalling functions through disc1 to regulate dendrite growth and excitatory synapse formation on cortical inhibitory neurons. specifically, we found that nrg1 stimulation increases disc1 levels and its localization to excitatory synapses in the primary dendrites of cortical inhibitory neurons, a mechanism that may underlie the developmental effects of nrg1 on dendrite growth and excitatory synaptogenesis onto cortical inhibitory neurons. furthermore, we show that nrg1-erbb4 signals through disc1 to developmentally regulate excitatory synaptogenesis onto cortical inhibitory neurons. third, we show that nrg1-erbb4 signals through disc1 to regulate the development of dendrite growth in cortical inhibitory neurons. finally, we show that nrg1 stimulation promotes binding of erbb4 to disc1 in cortical inhibitory neurons. the results from this study are consistent with other in vitro nrg1 studies, which show that nrg1 regulates dendrite growth and excitatory synaptogenesis onto cortical inhibitory interneurons [15, 16 ]. in vivo data from two different conditional neocortical inhibitory neuron - specific erbb4 knockout mouse models displaying decreased vglut1 puncta density on hippocampal interneurons further corroborates our findings [17, 30 ]. the data in the present study provide a potential mechanism mediating the effects of nrg1 signalling in cortical inhibitory neuron development, whereby disc1 functions downstream of nrg1-erbb4 signalling. a previous study by cahill. in 2012 elucidated a mechanism whereby nrg1-erbb4 signalling regulates dendrite growth in cortical inhibitory interneurons by disinhibiting the rac1-gef kalirin-7. interestingly, kalirin-7 is also a binding partner of disc1 at the postsynaptic density (psd), suggesting that erbb4, disc1, and kalirin-7 may form a functional complex in cortical inhibitory neurons to regulate dendrite growth, and provides an avenue for further research into the downstream mechanisms of nrg1 signalling. in this study, we examined a potential mechanism by which disc1 mediates the effects of nrg1-erbb4 signalling, in which nrg1-erbb4 signalling regulates disc1 levels in the primary dendrites of cortical inhibitory neurons. this is consistent with a study by seshadri and colleagues in 2010 which showed that treatment of primary mouse cortical neurons with nrg1 increased the expression of the 130 kda isoform of disc1 in the primary dendrites of cortical neurons. however, this effect was found to be mediated by erbb2/3 heterodimers and likely reflects the large numbers of excitatory neurons from cortical cultures (~8090%) since they did not isolate inhibitory neurons. furthermore, because erbb4 expression is much higher in inhibitory neurons than in excitatory neurons [17, 2628 ], it is not surprising that nrg1 regulation of disc1 levels in excitatory neurons would require erbb2/3 and not erbb4. we have also shown that nrg1 stimulation increases colocalization of disc1 with vglut1 in cortical inhibitory neurons, suggesting that nrg1 stimulation localizes disc1 to developing excitatory synapses contacting inhibitory neurons. therefore, our study provides the first evidence that nrg1 regulates disc1 expression and localization in developing cortical inhibitory neurons. however, whether this is carried out at the transcriptional, translational, or posttranslational level remains to be elucidated in future studies. the role of disc1 in psychiatric disorders remains controversial ; however, many biological studies have shown that disc1 plays important roles in cortical development [44, 46, 50, 55, 56 ]. there have been few studies examining the function of disc1 in cortical inhibitory neurons [61, 62 ] ; therefore what role it plays in their development is still not well understood. our study provides the first report of disc1 regulating dendrite growth and glutamatergic synapse formation specifically in cortical inhibitory neurons during neurodevelopment. we show using a pg67-disc1dn construct, which expresses a dominant negative form of disc1 in gaba - ergic neurons, that disc1 regulates dendrite growth in a cell - autonomous fashion. furthermore, inhibitory - specific expression of a dominant negative disc1 mutant and inhibitory - specific overexpression of full length disc1 were both able to abolish nrg1-induced effects on dendritic arborisation, suggesting that an optimal level of nrg1-erbb4 signalling is necessary for proper dendrite growth. this hypothesis is supported by a study in which two mutant nrg1 mouse strains, one with elevated cysteine - rich domain- (crd-) nrg1 levels in cortical pyramidal neurons and one with reduced crd - nrg1 levels, were both able to disrupt excitatory - inhibitory balance of neurotransmission. in contrast, expression of the dominant negative disc1 mutant, but not full - length disc1, was able to block nrg1-induced effects on glutamatergic synaptogenesis onto cortical inhibitory neurons in the present study. this suggests that nrg1-erbb4-disc1 signalling may mediate its effects on dendrite growth and excitatory synapse development via two different mechanisms in cortical inhibitory neurons. nrg1-erbb4 signalling has been found to mediate synapse maturation and dendrite growth via two distinct mechanisms in hippocampal mouse cultures. specifically, regulation of the maturity of synapses contacting erbb4-positive hippocampal neurons by erbb4 was dependent on the extracellular domain and pdz motif, whereas the tyrosine kinase domain was not required. in contrast, erbb4 regulated dendrite growth via its tyrosine kinase domain and pi3 kinase signalling. disc1 may carry out different functions downstream of nrg1-erbb4 stimulation depending on its interaction with different erbb4 domains (pdz or tyrosine kinase domain) or its interaction with other erbb4 binding proteins that preferentially bind to either the pdz or tyrosine kinase domain. erbb4 and disc1 share common binding partners at the postsynaptic density, including psd95 and kalirin-7 [15, 46, 47 ]. however, a physical interaction between erbb4 and disc1 has not been examined thus far in primary inhibitory neurons due to the difficulty in isolating a large number of purified cells (devoid of excitatory neurons). here, using an alternative technique (proximity ligation assay), we have shown that nrg1 stimulation promotes binding of erbb4 to disc1 in cortical inhibitory neurons. further investigation is needed to determine which protein domains are important for this interaction and for nrg1-induced effects on cortical inhibitory neuron development and whether kalirin-7 is also involved in this complex. additionally, it will be important to understand the potential mechanisms underlying a developmental switch for disc1 regulating erbb4 signalling during development versus the mature cortex, as these roles may be opposite. while our study provides a mechanism for nrg1 function during inhibitory neuron development, it highlights potential differences with nrg1 signalling in the mature cortex. recently reported that disc1 negatively regulates erbb4 signalling, where, upon removal of disc1, there is increased phosphorylation of erbb4 and binding to psd95. these results are in contrast to the results of our study, which suggests that disc1 positively regulates erbb4 signalling. however this can potentially be explained by a difference in the time point examined in brain function, since we examined neurodevelopmental ages while the seshadri. furthermore, the difference in approach to disrupt disc1 function could also explain potential differences. for example, our study used a dominant negative form of disc1 that models the scottish mutation, whereas the seshadri. this also highlights that the scottish mutation may not be accurately modeled by a complete loss of disc1 function. future studies are necessary to tease apart the exact mechanism of nrg1-erbb4 regulation by disc1 across different developmental and adult time points of inhibitory neuron function. in conclusion, this study elucidated the novel convergence of nrg1-erbb4 signalling and disc1 onto a common signalling pathway regulating the development of cortical inhibitory neurons. as nrg1, erbb4, and disc1 are all candidate schizophrenia - associated risk genes [1921, 23, 3441 ], the results of this study not only shed light on the molecular mechanisms governing the normal development of cortical inhibitory neurons but also may provide insight into the aberrant processes underlying psychiatric disorders. | cortical inhibitory neurons play crucial roles in regulating excitatory synaptic networks and cognitive function and aberrant development of these cells have been linked to neurodevelopmental disorders. the secreted neurotrophic factor neuregulin-1 (nrg1) and its receptor erbb4 are established regulators of inhibitory neuron connectivity, but the developmental signalling mechanisms regulating this process remain poorly understood. here, we provide evidence that nrg1-erbb4 signalling functions through the multifunctional scaffold protein, disrupted in schizophrenia 1 (disc1), to regulate the development of cortical inhibitory interneuron dendrite and synaptic growth. we found that nrg1 increases inhibitory neuron dendrite complexity and glutamatergic synapse formation onto inhibitory neurons and that this effect is blocked by expression of a dominant negative disc1 mutant, or disc1 knockdown. we also discovered that nrg1 treatment increases disc1 expression and its localization to glutamatergic synapses being made onto cortical inhibitory neurons. mechanistically, we determined that disc1 binds erbb4 within cortical inhibitory neurons. collectively, these data suggest that a nrg1-erbb4-disc1 signalling pathway regulates the development of cortical inhibitory neuron dendrite and synaptic growth. given that nrg1, erbb4, and disc1 are schizophrenia - linked genes, these findings shed light on how independent risk factors may signal in a common developmental pathway that contributes to neural connectivity defects and disease pathogenesis. |
leishmaniasis is a vector - borne disease caused by obligate intramacrophage protozoan parasites of the genus leishmania [1, 2 ]. the infecting leishmania species determines the clinical presentation of disease, of which there are three dominant clinical forms : cutaneous leishmaniasis (cl), mucocutaneous leishmaniasis (mcl), and visceral leishmaniasis [1, 2 ]. in bolivia, the etiological agent of both, cl and mcl is leishmania (viannia) braziliensis, formerly known as the l. braziliensis complex. while cl is characterized by single or multiple ulcerated dermal lesions, mcl which develops as a complication of l. (v.) braziliensis cl in 5%20% of patients from parasite dissemination to the upper respiratory tract mucosa, involving the nasal, pharyngeal, and laryngeal mucosa, leads to extensive tissue destruction [5, 6 ]. cl either heals spontaneously or promptly responds to antimonial therapy but mcl usually evolves chronically and is difficult to treat. then, amphotericin b (amb) is an alternative for patients who fail to respond to pentavalent antimonial therapy. it has been known that amb potentiates the antimicrobial and tumoricidal activities of macrophages, either directly or via induction of cytokines such as tumor necrosis factor- (tnf-) and interleukin-1 (il-1), as well as generation of a respiratory burst [10, 11 ]. apart from these effects, little is known about the mechanisms associated with the efficacy of this compound in the treatment of mcl. therefore, it was of interest to determine the participation of other soluble factors, apart from tnf-, in amb - treated mucocutaneous leishmaniasis, keeping in mind that activation of the infected macrophages to kill intracellular parasites is carried out through a cell - mediated response that requires the classic features of antigen presentation and production of il-12 by macrophages and activation of th1 lymphocytes with production of interferon- (ifn-) to activate the macrophages. the present study was aimed at elucidating the participation of critical soluble factors associated with amb treatment that could alleviate, in future, the collateral effects of this arduous treatment by combining immunochemotherapy with lower doses of drug. in the present investigation, we present evidence for an exacerbated th1 immune response in mcl treated with amb, manifested by an elevated synthesis of ifn- which directly relates to a great increase in il-12 production. twenty four leishmaniasis patients were included in this study, 12 with cl and 12 with mcl, including male and female, average age 30 years old. all of them acquired the disease in the yungas valley of la paz department, an endemic area for l (v.) braziliensis infection. patients included in the study presented clinical features compatible with cl or mcl, were positive in both the montenegro skin test and the serology for l. (v.) braziliensis antibodies (indirect immunofluorescence). at the moment of taking the blood samples, mcl patients were being treated with amphotericin b, at a dose of 1 mg / kg / day by infusion till a total dose of 1 to 3 grams, and had received mean doses of 7.5 (510 doses). the parasite lysate (alb) utilized for cytokine production was obtained from an l. (v.) braziliensis strain (mhom / br/75/2903). the promastigotes were resuspended in phosphate - buffered saline (pbs) ph 7.2, at a concentration of 1 10 parasites per ml, and soluble antigens were prepared through seven cycles of freezing (70c) and thawing (37c) the parasite suspension. this material was assayed for protein content, aliquoted, and stored at 70c until used. pbmcs were purified by centrifugation (400 g, 20c, 45 minute) over a mixture of ficoll hypaque at a density of 1.077 (sigma, st. after washings with serum free medium, the cells were resuspended at the desired concentration in rpmi medium containing 10% heat - inactivated human ab serum (sigma), 100 iu of penicillin per ml, and 100 g of streptomycin per ml (complete medium). fresh pbmcs were cultured in duplicate in 24 well plates at a final concentration of 1.25 10 cells / ml in 2 ml complete medium for 3days (37c, 5% co2), in the absence or presence of alb, at a final protein concentration of 15 g / ml. aliquots of cell - free supernatants from alb in vitro - stimulated pbmc cultures were assayed for tnf-, ifn-, and il-12 by means of solid phase sandwich enzyme linked immunosorbent assays (elisas) (biosource europe, belgium). all samples were tested in duplicate and cytokine concentrations were determined by comparison to standard curves. the sensitivity of each assay was as follows : tnf-, 3 pg / ml ; ifn-, 0.03 iu / ml ; and il-12, 1.5 pg / ml. statistical analysis was performed by the wilcoxon nonparametric test using the systat software, version 10.2 (systat software inc., the course of mcl has been associated with an unmodulated high production of the proinflammatory cytokines ifn- and tnf-. considering the high activity of amb in the treatment of mcl, we decided to compare specific cytokine production between pbmc from cl and mcl patients, through an in vitro cell culture approach with alb, that would recreate the status of patients ' immune response. cytokine production by pbmcs from cl and mcl patients the response of pbmc induced by alb stimulation was evaluated in terms of tnf-, ifn-, and il-12 production, at 3 days of culture. while a 72-hour culture period has proven sufficient to stimulate production of tnf- and ifn- in patients ' pbmcs stimulated with leishmanial antigens, il-12 production is specifically stimulated as early as 24 hours of pbmc culture from mcl patients. whatever the patient group, tnf-, ifn-, and il-12 were released at similar background levels. therefore, in this study, the levels of cytokine released in unstimulated pbmc cultures did not reflect an activated state from contact in vivo with parasite antigens. figure 1 reveals a nonsignificant slight increase in the production of tnf- in mcl (1104 732 pg / ml), comparing with cl (760 307 pg / ml) patients (p =.1). the reduced liberation of tnf- in the supernatants of mcl patients is surprising considering that amb has been associated with its production but it also reflects the beneficial effect of this drug in mcl as it has been reported that refractory mucosal leishmaniasis can be successfully treated through a combination of pentavalent antimony plus pentoxifylline, an inhibitor of tnf- production. alternatively to the activation of macrophage microbicidal capacity through the induction of proinflammatory cytokines, amb can also exert its effect intracellularly. intracellular accumulation of the drug in monocytes augmented the capacity of the cells to kill ingested candida albicans. however, whether this mechanism of action is in fact operating in mcl treatment remains to be confirmed. contrary to the production of tnf-, samples from mcl patients had the capacity to significantly augment synthesis of ifn- with regard patients with cl (17.1 11.5 versus 4.2 3.2 iu / m) [p <.05 ] (figure 2). furthermore, the observation of background levels of il-4 despite stimulation with alb (not shown) evokes a th1-type immune response. additionally, and in direct correlation to the increased production of ifn-, there was a much higher concentration of il-12 when comparing mcl (175.7 164.8 pg / ml) and cl (26.8 28.2 pg / ml) patient cytokine responses (p <.05) (figure 3). future studies in vitro with amb will seek to verify the cellular source of il-12 considering that, in human, peripheral blood monocyte / macrophages are the main producers of il-12. a previous study reporting suppression of il-12 production by murine macrophages infected with l. mexicana amastigotes on interaction with th1 cells is of particular interest in the context of this study as it adds incentive to unveil through the present experimental system (alb stimulation) the intracellular signals, likely set in motion by amb treatment, to increase production of il-12, one of the two cytokines most clearly needed for protection in leishmaniasis. in general, the present results are reminiscent of a previous investigation on the use of a recombinant leishmanial antigen from leishmania braziliensis. apart from the production of il-2, this antigen elicited also the production of ifn- dependent on il-12, from pbmcs of patients with mucosal and cutaneous leishmaniasis. by analogy to our observations, it could be postulated that amb treatment would favor, preferentially, processing of antigens inducing th1-type immune responses, whereby stimulation of antigen - presenting cells by ifn- leads to il-12 production, potentiating in this manner, a positive feedback loop. even though amb killing of leishmania parasites does not require a host immune response, we reason that similar targeting of the th1-cell mechanism might increase its efficacy and permit lower doses to be used with compatible activities. an important aspect to consider in the present study is that cytokines are being compared in two patients groups differing by two parameters, mcl versus cl and treated versus untreated patients. hence, there would be the possibility that the increase in ifn- and il-12 relates to the different clinical forms rather than to amb treatment. however, it is interesting to note that samples from three mcl patients, not under treatment and excluded from this study, had the capacity to produce lower levels of ifn- compared with treated patients, and this production was not associated with an increased release of il-12. therefore, manipulation of the host 's immune response in favor of the th1-cell - associated mechanism may provide the opportunity to use amb - sparing regimens with lower doses of drug, fewer injections, and/or a shorter treatment duration, avoiding toxicity associated with the cumulative dose. future studies will seek to improve understanding on the mechanisms of action of amb at the cellular level, particularly those associated with increased il-12 production. | in an attempt to investigate the effects of treatment of human leishmaniasis, the cytokines produced by peripheral blood mononuclear cells (pbmcs) of patients with cutaneous leishmaniasis (cl) and mucocutaneous leishmaniasis (mcl) under treatment with amphotericin b were determined during the active disease from cocultures of cells and leishmania (viannia) braziliensis antigens. pbmc of these patients exhibited a nonsignificant marginal increased production of tnf- upon antigen stimulation. however, under the same antigenic stimulus, patients with active mcl presented higher ifn- production compared to patients with cl. this increased ifn- production was accompanied by a drastically augmented il-12 synthesis from cells of mcl patients. the highlighted t cell responses could be relevant for sound control measures of protozoan infections with emphasis on the combined usage of immunoenhancing agents and antiprotozoal drugs. |
the off - label use of drugs in paediatrics, i.e. the prescription of drugs which are not licensed for a specific age or mode of application, is often described as an ethical problem [13, 6, 10 ]. they need long - term antihypertensive therapy with drugs which, however, are not approved for children so far. drugs of first choice are angiotensin - converting enzyme inhibitors : captopril, enalapril and ramipril. since clinical trials involving children do not exist, the applied dosage results from experience with adults. empirical studies show that the off - label use of drugs in paediatrics is connected with a significantly increased risk of an adverse drug reaction [11, 16, 19 ]. this is due to the fact that these drugs are only tested in and licensed for adult patients and the transfer of knowledge to the paediatric population is sometimes doubtful. as collier argues, the validity of such an approach is questionable because there are such great differences between adults and children, and even between children of different ages, with regard for instance to the pharmacodynamic and pharmacokinetic responses to drugs, [], and the effects of drugs on normal growth and development [6 : p. 6 ]. there is a high incidence of off - label use both in out - patient and in - patient settings, which ranges from 10.5% up to 90% [4, 8, 15 ]. off - label use is so commonplace that it is often probably not specifically mentioned when a drug is administered to a patient. at least two ethical problems arise from this : first, if the off - label use of drugs can be understood as a form of unconventional treatment which comprises unknown risks, the question arises whether parents should explicitly be informed about the character of the treatment.1 here, a difficulty arises due to the fact that even some paediatricians are not aware of the practise of off - label prescriptions. in a study of chalumeau french paediatricians were asked to comment whether their prescriptions were off - label or not. in 92% of the cases, the paediatricians did not recognise a drug 's off - label status. secondly, the ethical principle of non - maleficence calls for a reduction of risks in the course of a medical treatment wherever possible. this is particularly important in the case of vulnerable groups like children [13, 14 ]. to minimise the number of off - label treatments, one could either leave patients untreated or increase the number of clinical trials in the paediatric population, either way entailing severe ethical problems involving complex risk benefit analyses. however, so far, no systematic knowledge is available on the preferences of parents in these cases. do they accept off - label use as inevitable or as the lesser of two evils ? would they volunteer their child for clinical trials to reduce the incidence of off - label treatments ? as paediatricians have a reputation for being cautious in relation to burdening their little patients with clinical research, parents ' views would help to evaluate the pros and cons of yet another trial in the paediatric population. to come to know parents ' views on off - label use we assumed that members of both groups differ with regard to knowledge and evaluation of this phenomenon, dependent on the degree of previous clinical experience. while parents of healthy children represent the normal population and their typical level of knowledge and normative judgments, parents of chronically ill children may have achieved a kind of expert status and thus extensive knowledge about medical treatment. we also assumed that parents of ill children differ in weighing risks and benefits in treatment as well as in clinical studies with their children. in a first step, we developed a questionnaire on ethical aspects of off - label use in paediatrics in close collaboration with experienced paediatricians and parents of chronically ill children. the questionnaire comprised three different sections : first, we asked questions concerning the demographic facts, the family 's and children 's actual health condition as well as their experience in clinical studies. in the second part finally, the parents had to assess whether they would volunteer their children for participation in three different study scenarios. we assumed that the answers depended on parental educational status, the health condition of the child and experience with clinical trials. we were particularly eager to know whether the actual knowledge of parents about off - label use has an influence on the overall acceptance of off - label treatment or study participation. fishers ' exact test was used to analyse associations in non - parametric categorical data. parents of children with renal disease (group a) were contacted via the departments for paediatrics at gttingen and hanover university hospitals in lower saxony. according to the studies of conroy. and knppel., one can expect that between 31% and 67% of the prescriptions in such a medical setting will be off - label. we distributed 80 questionnaires to parents visiting out - patient care in the time from june to september 2006 and received back 43 (54%). inclusion criteria were the age of children (6 to 14 years), the length of contact with the hospital (at least a half year) and the chronic state of the treated condition. children had a great variety of renal conditions including milder forms of renal disease, renal insufficiency and renal transplant. during routine hospital visits the parents of healthy children (group b) were contacted at a soccer club meeting in the city of kassel. for the control group, we chose parents from children playing soccer in a club because these children are normally healthy and need only minor health care interventions. in germany, children who play soccer have to pass a health test before joining the club., 80 questionnaires were distributed to this group and 51 (64%) were sent back. fifteen (30%) of the parents from group b reported some common but minor chronic disease conditions (mostly asthma and neurodermitis) in their families (table 1). table 1participants, contact and number of returnsstudy groupparticipantscontactrequested personsnumber of returns, n (%) group aparents of children with renal diseasecontact via gttingen / hanover university hospitals8043 (54)group bparents of healthy childrencontact via soccer club8051 (64) participants, contact and number of returns in group a (chronically ill children), the mean age of the sick children was 9.9 years. asked how often they usually see a doctor, eight parents (19%) reported one or more visits per week and 15 parents (35%) once a month. eleven parents (26%) reported only health care was in most cases delivered by a paediatrician (22/51%) or a university hospital (23/54%). nine children (21%) of group a had already been included in one or more clinical studies. parents ' educational status was comparable to the german population as eight parents (19%) hold a university degree or finished school with the final secondary school examination, 29 parents (67%) with the intermediate secondary school examinations and six parents (14%) with the lower secondary school examinations. in group b (healthy children), the children 's mean age was 9.5 years, and the parents ' educational level was higher than in the group a with 26 parents (51%) holding a university degree or finishing school with the final secondary school examination, 25 parents (49%) with the intermediate secondary school examinations and none with the lower secondary school examinations. in both groups, questionnaires were mainly completed by the children 's mothers (79/84%). the parents in both groups a and b showed great interest in information on the mode of application and on possible side effects of prescribed drugs. none out of group a and only five out of group b (5%, n = 94) answered that they usually do not ask their physician for additional information on the usage, mode of action or possible side effects of prescribed drugs (p = 0.04). in groups a and b, no parent answered that she / he does not read leaflet instructions of a newly prescribed drug. twenty - two (23%, n = 94) answered that they sometimes read the leaflet instruction, the remaining 72 (77%, n = 94) answered that they additionally, 39 parents of group a (91%) and 43 parents (84%) of group b indicated that their physician sometimes or always draws their attention to possible side effects of a prescribed drug. table 2questions concerning the parental knowledge of drug usedo you ask for the mode of application or action and possible side effects when the physician prescribes a drug to your daughter / son ? (never / sometimes / always / remarks :) does your physician draw your attention to possible side effects of a prescribed drug ? (never / sometimes / always / remarks :) questions concerning the parental knowledge of drug use the parents ' wish for information about prescribed drugs stands in stark contrast to their actual knowledge of the practise of off - label use. in group b (healthy children), only 14 parents (28%) were aware that children are sometimes administered drugs which are not tested and licensed for, one third (17/33%) were convinced that this is not the case and 20 parents (39%) admitted that they do not know (fig. 1). one may not be surprised by such a ratio in group b ; however, in contrast to our initial assumption, we found a similar low level of parental awareness in group a. in this group, 15 parents (35%) were aware of the practise of off - label use in contrast to 11 parents (26%) who thought that this was not the case and 16 parents (37%) who answered the results show that only a small additional percentage of parents of ill children compared to the parents of healthy children have acquired knowledge about the off - label use of drugs. no statistically significant difference could be demonstrated between groups a and b concerning the parental knowledge on the off - label use of drugs. table 3questions concerning the knowledge of off - label use of drugsplease judge the following statements concerning drugs for children. do you think they are right or wrong?drugs for children are different from drugs for adults regarding dosage, degree of effectiveness and mode of action in the body. (yes / no / do not know)children sometimes receive drugs which are not tested and licensed for them. (yes / no / do not know) questions concerning the knowledge of off - label use of drugs would knowledge of an off - label use of drugs influence parents ' consent to treatment or would they consider this information as not being important ? in both groups, all of the 94 participants accorded some importance to the fact that a drug is licensed or not. four parents (9%) of group a and ten parents (20%) of group b would even refuse a treatment with off - label drugs. thirty - one parents (72%) of group a and 26 parents (51%) of group b would agree when there is no other possibility. eight parents (19%) of group a and 15 parents (29%) of group b specified conditions of consent like, e.g. a life - threatening condition or only in extreme situations. one parent of a healthy child remarked that such a decision would be very hard and depends on the situation. although the difference between both groups is statistically not significant (p = 0.11), risk aversion, measured as percentage of refusal of off - label use, seems to be higher among the parents of healthy children (group b) than among the parents of ill children (group a) (fig. 2 ; table 4). 1children sometimes receive drugs which are not tested and licensed for them. (group a parents of ill children, group b parents of healthy children)table 4questions regarding the evaluation of off - label use of drugsto which of the following statements would you agree?i would refuse the treatment of my child with a drug which is not licensed, even when there is no other possibility.i would agree to the treatment of my child with a drug which is not licensed, when there is no other possibility.it is not important for me, whether a prescribed drug is licensed or not.remarks : children sometimes receive drugs which are not tested and licensed for them. (group a parents of ill children, group b parents of healthy children) questions regarding the evaluation of off - label use of drugs in the third section of the questionnaire, we presented different research scenarios and asked for parental consent. the scenarios of clinical studies were described in a short, simple and easily comprehensible way. 2i refuse / agree / agree under special circumstances to the treatment of my child with an unlicensed drug when there is no other possibility./it is not important for me, whether a prescribed drug is licensed or not. (group a parents of ill children, group b parents of healthy children)table 5types of clinical studies portrayed in the questionnairetypes of clinical studies(1)randomised, double - armed add - on study (standard therapy vs. standard therapy plus one additional drug) ; additional blood and urine samples for research purposes.(2)randomised, double - armed placebo study (newly tested drug vs. placebo) ; additional blood and urine samples for research purposes.(3)optimization study ; test in a paediatric population of a drug which is already licensed in adult patients ; additional blood and urine samples for research purposes. i refuse / agree / agree under special circumstances to the treatment of my child with an unlicensed drug when there is no other possibility./it is not important for me, whether a prescribed drug is licensed or not. (group a parents of ill children, group b parents of healthy children) types of clinical studies portrayed in the questionnaire to assess whether parents are willing to volunteer their child in case of illness for a clinical study, they had to evaluate three different study scenarios with varying levels of risk. the results show significant differences between groups a and b regarding studies 1 (add - on scenario) and 2 (placebo trial), and a comparable outcome in study 3 (optimization study). whereas almost half of the parents in group a (21 ; 49%) would agree to their child 's participation in study 1 (add - on), this was the case in only 11 (22%) of parents of group b. correspondingly, ten parents (23%) of group a and 20 parents (39%) of group b would refuse participation ; 12 parents (28%) of group a and 20 parents (39%) of group b answered that they did not know how to decide (p = 0.02). the second study scenario (placebo) was evaluated comparably in group a (yes = 20/47% ; no = 11/26% ; do not know = 12/28%). only ten parents (20%) of group b would consent to study participation, while 28 parents (55%) would refuse. one in four (13/26%) of the parents of group b did not know how to decide. the difference between groups a and b was statistically highly significant (p = 0.006). the evaluation of the third study (optimization) showed less remarkable differences. while 17 parents (40%) of group a would volunteer their child, 12 parents (28%) would refuse and 14 parents (33%) did not know how to decide. the results are comparable to those of group b (yes = 19/37% ; no = 20/39% ; do not know = 12/24% ; p = 0.45). thus, in group a, most parents would consent to the add - on scenario, while scenario 3 (optimization) met the least acceptance. parents of healthy children (group b), in contrast, considered the optimization scenario the most acceptable one and were most negative in the case of the placebo scenario (fig. 3). would you volunteer your child for the following study? answers according to decreasing acceptance your child suffers from chronic disease. would you volunteer your child for the following study? answers according to decreasing acceptance parents who would volunteer their child for either study did not significantly differ from their more critical counterparts with regard to educational status or gender. however, although statistically not significant, there are some clues why some parents are less cautious towards study participation. for the sake of analysis, we made up three categories : in the first category (supporters), we subsumed all parents who consented to study participation in at least two scenarios (32 parents) ; in the second category (indifferents), those who answered i do not know in at least two cases (30 parents) ; in the third category (refusers), those who rejected study participation in at least two study scenarios (32 parents). fifteen parents of the supporters (47% ; n = 32) answered that their physician always informs them about a drug 's possible side effects, whereas only eight (27% ; n = 30) of the indifferent parents and nine (28% ; n = 32) of the refusers reported this fact (p = 0.19). fourteen (44% ; n = 32) of the supporters knew that children receive prescribed drugs which are not tested and licensed for them compared to only seven (24% ; n = 30) of the indifferent parents and eight (25% ; n = 32) of the refusers (p = 0.2). moreover, the group of supporters comprised the highest number of parents (30/94 % ; n = 32) who felt that the off - label use of drugs is acceptable when there is no other possibility compared to only 24 (75% ; n = 32) of the refusers (fig. 4information on side effects, knowledge of off - label use and acceptance of off - label use in case of no other treatment possibility in percent of study supporters, indifferent and refusing parents information on side effects, knowledge of off - label use and acceptance of off - label use in case of no other treatment possibility in percent of study supporters, indifferent and refusing parents the parents in both groups a and b showed great interest in information on the mode of application and on possible side effects of prescribed drugs. none out of group a and only five out of group b (5%, n = 94) answered that they usually do not ask their physician for additional information on the usage, mode of action or possible side effects of prescribed drugs (p = 0.04). in groups a and b, no parent answered that she / he does not read leaflet instructions of a newly prescribed drug. twenty - two (23%, n = 94) answered that they sometimes read the leaflet instruction, the remaining 72 (77%, n = 94) answered that they additionally, 39 parents of group a (91%) and 43 parents (84%) of group b indicated that their physician sometimes or table 2questions concerning the parental knowledge of drug usedo you ask for the mode of application or action and possible side effects when the physician prescribes a drug to your daughter / son ? (never / sometimes / always / remarks :) does your physician draw your attention to possible side effects of a prescribed drug ? (never / sometimes / always / remarks :) questions concerning the parental knowledge of drug use the parents ' wish for information about prescribed drugs stands in stark contrast to their actual knowledge of the practise of off - label use. in group b (healthy children), only 14 parents (28%) were aware that children are sometimes administered drugs which are not tested and licensed for, one third (17/33%) were convinced that this is not the case and 20 parents (39%) admitted that they do not know (fig. 1). one may not be surprised by such a ratio in group b ; however, in contrast to our initial assumption, we found a similar low level of parental awareness in group a. in this group, 15 parents (35%) were aware of the practise of off - label use in contrast to 11 parents (26%) who thought that this was not the case and 16 parents (37%) who answered the results show that only a small additional percentage of parents of ill children compared to the parents of healthy children have acquired knowledge about the off - label use of drugs. no statistically significant difference could be demonstrated between groups a and b concerning the parental knowledge on the off - label use of drugs. table 3questions concerning the knowledge of off - label use of drugsplease judge the following statements concerning drugs for children. do you think they are right or wrong?drugs for children are different from drugs for adults regarding dosage, degree of effectiveness and mode of action in the body. (yes / no / do not know)children sometimes receive drugs which are not tested and licensed for them. (yes / no / do not know) questions concerning the knowledge of off - label use of drugs would knowledge of an off - label use of drugs influence parents ' consent to treatment or would they consider this information as not being important ? in both groups, all of the 94 participants accorded some importance to the fact that a drug is licensed or not. four parents (9%) of group a and ten parents (20%) of group b would even refuse a treatment with off - label drugs. thirty - one parents (72%) of group a and 26 parents (51%) of group b would agree when there is no other possibility. eight parents (19%) of group a and 15 parents (29%) of group b specified conditions of consent like, e.g. a life - threatening condition or only in extreme situations. one parent of a healthy child remarked that such a decision would be very hard and depends on the situation. although the difference between both groups is statistically not significant (p = 0.11), risk aversion, measured as percentage of refusal of off - label use, seems to be higher among the parents of healthy children (group b) than among the parents of ill children (group a) (fig. 2 ; table 4). fig. 1children sometimes receive drugs which are not tested and licensed for them. (group a parents of ill children, group b parents of healthy children)table 4questions regarding the evaluation of off - label use of drugsto which of the following statements would you agree?i would refuse the treatment of my child with a drug which is not licensed, even when there is no other possibility.i would agree to the treatment of my child with a drug which is not licensed, when there is no other possibility.it is not important for me, whether a prescribed drug is licensed or not.remarks : children sometimes receive drugs which are not tested and licensed for them. (group a parents of ill children, group b parents of healthy children) questions regarding the evaluation of off - label use of drugs in the third section of the questionnaire, we presented different research scenarios and asked for parental consent. the scenarios of clinical studies were described in a short, simple and easily comprehensible way. 2i refuse / agree / agree under special circumstances to the treatment of my child with an unlicensed drug when there is no other possibility./it is not important for me, whether a prescribed drug is licensed or not. (group a parents of ill children, group b parents of healthy children)table 5types of clinical studies portrayed in the questionnairetypes of clinical studies(1)randomised, double - armed add - on study (standard therapy vs. standard therapy plus one additional drug) ; additional blood and urine samples for research purposes.(2)randomised, double - armed placebo study (newly tested drug vs. placebo) ; additional blood and urine samples for research purposes.(3)optimization study ; test in a paediatric population of a drug which is already licensed in adult patients ; additional blood and urine samples for research purposes. i refuse / agree / agree under special circumstances to the treatment of my child with an unlicensed drug when there is no other possibility./it is not important for me, whether a prescribed drug is licensed or not. (group a parents of ill children, group b parents of healthy children) types of clinical studies portrayed in the questionnaire to assess whether parents are willing to volunteer their child in case of illness for a clinical study, they had to evaluate three different study scenarios with varying levels of risk. the results show significant differences between groups a and b regarding studies 1 (add - on scenario) and 2 (placebo trial), and a comparable outcome in study 3 (optimization study). whereas almost half of the parents in group a (21 ; 49%) would agree to their child 's participation in study 1 (add - on), this was the case in only 11 (22%) of parents of group b. correspondingly, ten parents (23%) of group a and 20 parents (39%) of group b would refuse participation ; 12 parents (28%) of group a and 20 parents (39%) of group b answered that they did not know how to decide (p = 0.02). the second study scenario (placebo) was evaluated comparably in group a (yes = 20/47% ; no = 11/26% ; do not know = 12/28%). only ten parents (20%) of group b would consent to study participation, while 28 parents (55%) would refuse. one in four (13/26%) of the parents of group b did not know how to decide. the difference between groups a and b was statistically highly significant (p = 0.006). the evaluation of the third study (optimization) showed less remarkable differences. while 17 parents (40%) of group a would volunteer their child, 12 parents (28%) would refuse and 14 parents (33%) did not know how to decide. the results are comparable to those of group b (yes = 19/37% ; no = 20/39% ; do not know = 12/24% ; p = 0.45). thus, in group a, most parents would consent to the add - on scenario, while scenario 3 (optimization) met the least acceptance. parents of healthy children (group b), in contrast, considered the optimization scenario the most acceptable one and were most negative in the case of the placebo scenario (fig. 3). would you volunteer your child for the following study? answers according to decreasing acceptance parents who would volunteer their child for either study did not significantly differ from their more critical counterparts with regard to educational status or gender. however, although statistically not significant, there are some clues why some parents are less cautious towards study participation. for the sake of analysis, we made up three categories : in the first category (supporters), we subsumed all parents who consented to study participation in at least two scenarios (32 parents) ; in the second category (indifferents), those who answered i do not know in at least two cases (30 parents) ; in the third category (refusers), those who rejected study participation in at least two study scenarios (32 parents). fifteen parents of the supporters (47% ; n = 32) answered that their physician always informs them about a drug 's possible side effects, whereas only eight (27% ; n = 30) of the indifferent parents and nine (28% ; n = 32) of the refusers reported this fact (p = 0.19). fourteen (44% ; n = 32) of the supporters knew that children receive prescribed drugs which are not tested and licensed for them compared to only seven (24% ; n = 30) of the indifferent parents and eight (25% ; n = 32) of the refusers (p = 0.2). moreover, the group of supporters comprised the highest number of parents (30/94 % ; n = 32) who felt that the off - label use of drugs is acceptable when there is no other possibility compared to only 24 (75% ; n = 32) of the refusers (fig. 4information on side effects, knowledge of off - label use and acceptance of off - label use in case of no other treatment possibility in percent of study supporters, indifferent and refusing parents information on side effects, knowledge of off - label use and acceptance of off - label use in case of no other treatment possibility in percent of study supporters, indifferent and refusing parents the results of our study show that knowledge of the off - label use of drugs in paediatrics is rather limited and astonishingly low regarding the importance of this topic in both groups of parents of chronically ill and healthy children. only 31% of the parents (35% in group a and 28% in group b) knew about the practise of off - label prescriptions whereas 70% were convinced that this was not the case or were at least unsure about the fact. this may in part be due to bad memory ; however, all parents declared to actively seek for information on drugs administered to their child, as all of them stated to read the leaflet instruction and nearly all of them remembered their physician telling them about side effects. it is difficult to explain the low percentage of informed parents particularly in the group of chronically ill children where one would expect the hospital paediatricians to have drawn parents attention to the fact of off - label use. information about off - label use is not legally required but only recommended by lawyers in germany and it is not known how often physicians follow this recommendation [17, 18 ]. paediatricians themselves may get used to the fact, as off - label prescription is so common, and may forget about informing parents explicitly and repeatedly. some paediatricians might themselves not be fully informed about the off - label status of the drugs they prescribe. once given the information, parents have a distinctive view of the off - label use of drugs. a significant percentage of parents of healthy and chronically ill children (15%) would refuse the use of these drugs, even when there is no other possibility, and a large group of parents (25%) would agree to the off - label use of drugs only under certain conditions like a life - threatening disease. given the importance of parents ' values in medical decision making, our results illustrate why the practise of downplaying off - label use in the paediatric population and keeping parents uninformed about the existence of off - label use in paediatrics is ethically problematic. off - label use is the result of a risk benefit analysis and thus depends on value judgments parents are willing and prepared to be involved in. moreover, our study results hint at the fact that the well - informed parent might be more willing to volunteer their child for study participation and thus help to reduce the high incidence of off - label administration of drugs. a large group of parents (52% ; n = 49) of either sick or healthy children in our sample consent to participation in at least one of the described study scenarios. among the parents of chronically ill children in our study, the add - on study scenario received the highest grade of acceptance (49% ; n = 21). the readiness to accept clinical research was associated with parental knowledge of off - label use and a perceived general tendency of the paediatric consultant to inform about the side effect of drugs. if paediatricians want investigators and pharmaceutical companies to provide them with more scientific evidence on drug therapy, they may have to inform parents first. this may well help to find patients for the studies that have to be conducted in the next years. | off - label drug use in paediatrics is associated with an increased risk of adverse drug reactions. any risk benefit analysis has to be based on value judgments that should include parents ' views. however, nothing is known so far about the parents ' perspective on this critical issue. therefore, a quantitative survey with parents of healthy and chronically ill children was carried out (n = 94). knowledge about the practise of off - label use is generally poor in both groups. surprisingly, this is also true for the parents of children with chronic disease. nine percent of the parents of chronically ill children and 20% of the parents of healthy children would refuse treatment with an off - label drug. parents who have poor knowledge about the practise of off - label use tend to refuse to volunteer their child for study participation. therefore, the information of parents on the off - label use of drugs is important to meet ethical standards and to increase the parents ' acceptance of medical studies with children. |
this was a cross - sectional questionnaire study conducted on 1514 participants, which included faculty mds and bds and pgs in 40 dental colleges of india selected by multistage random sampling. the list of all dental colleges in india was obtained from the website of dental council of india. the survey instrument was 24-item, investigator developed, self - structured, close - ended, and self - administered questionnaire. permission to carry out the study was obtained from the college authorities, and ethical clearance was obtained from the ethical committee of institutional review board of the jodhpur dental college general hospital, jodhpur, rajasthan, india. principals of selected dental colleges were contacted and were explained about the purpose of the study and also by use of cover letter attached with the packet containing questionnaire. participation in the research was on a voluntary basis, and no incentives were used for the respondents. occupational category information (mds faculty, bds faculty, and pg student) was obtained so that the significance of the responses, barriers pertaining to each occupational category can be understood and analyzed. a total sample of 2000 was targeted and based on that 2000 prints of questionnaire was taken out and distributed, out of which 1514 candidates from 40 dental colleges returned the questionnaire with a response rate of 75.7%. in the respective dental colleges the faculty members and pgs were gathered in the class together and the instructions were given regarding the purpose of the survey and filling of the survey questionnaire. after this, faculty members and pgs were given a format consisting of informed consent, instructions, and questionnaire. the faculty members and pgs were given 1 h to fill the questionnaire and to return it back. perception and attitude of study subjects pertaining to barriers to research in the indian scenario were elicited by questionnaire method. the item generation for this instrument was from four sources : theory, research, observation, and expert opinion. the barriers for initiating and conducting research by faculty and pg students in indian dental schools were identified from 24 questions applicable to the indian dental education, human resource and training, research and academic environment, institutional, infrastructure, resources, funding, time related issues, and other reasons. the attitude was assessed by means of five point likert scale : strongly agree, agree, no opinion, disagree, and strongly disagree. the questions were grouped in four categories that are, institutional / departmental support related barriers, financial and training support related barriers, time - related barriers, and other general barriers. the response for each question was based on selecting between no opinions, strongly agree, agree, disagree, and strongly disagree. later during analysis, strongly agree and agree were combined into one response as percentage respondents agreeing. similarly, disagree and strongly disagree were combined into one response as percentage respondents disagreeing. a pilot study was conducted to test the reliability of the questionnaire, by considering convenience sample of 50 from the faculty of jodhpur dental college general hospital. the results of the pretested questionnaire on 50 faculty members were not included in the main study, only the reliability was assessed. the data were entered into the ms excel (ms office version 2007 developed by microsoft, redmond, wa, usa) and intercooled stata version 9.2 (statacorp, tx, usa) were employed to perform statistical analysis. the data were subjected to chi - square test to check the significance of the difference between different occupational categories. the data were entered into the ms excel (ms office version 2007 developed by microsoft, redmond, wa, usa) and intercooled stata version 9.2 (statacorp, tx, usa) were employed to perform statistical analysis. the data were subjected to chi - square test to check the significance of the difference between different occupational categories. table 1 revealed that 60.24% respondents agreed that their college libraries had enough references to support the research. about 56.47% of respondents believed that they have the good interdepartmental co - ordination to do research. about 47.23% of respondents informed that they are mainly into administrative and educational work rather than research work. about 70.41% of participants get encouragement and motivation to pursue research from my guide / superiors. according to 57.53% of study participants, their college / university does not provide exclusive administrative and technical support for research work. overall 30% reported that their research work or publications suffer due to departmental or interdepartmental politics regarding authorship issues. all the responses with the occupational categories were significant as (p 0.05). institutional / departmental support related barriers the table 2 revealed that a huge majority of respondents, that is, 64.9% said that meager college funding and 58.6% agreed that poor promotional incentives by their universities were the prime reason why they could not do a research work. about 53.76% blamed their college for poor training for applying for grants, 43.4% blamed their college for poor training for statistical, and analytical skills. about 15.1% thought that poor training in english language / grammar was caused of rejection of publication in international journals. financial and training support related barrier the questions related to time - related barriers revealed that while 61.5% respondents thought that they did not have enough time to do research work after clinical and teaching responsibilities, 73.8% respondents wanted that their universities to provide them explicit time to do research work separate from other college responsibilities. about 70.4% respondents believed that due to time constraints, colleges should have employed a separate research team / duties. about 38.71% of participants did not want to compromise their family time because of research and 18.5% thought that research and publication was a waste of time and boring job. all the responses with the occupational categories were significant (p 0.05) [table 3 ]. time related barriers other general barriers revealed that 33.2% respondents thought that the quality of my scientific work and research was good, but it is not accepted in international journals because the editor and editorial board are unfair to indian authors. about 80.25% agreed that, the lack of documentation and record maintenance are an obvious hurdle to research work in india. all the responses with the occupational categories were significant (p 0.05) [table 4 ]. india the largest manufacturer of dental graduates has the least representation at the world dental research platform. this scenario has highlighted the inadequacies of the dental research environment in india. this study was a part of the efforts to explore various issues related to barriers to dental research in dental institutions in india. this is the first attempt that investigates perceived barriers for dental research among faculty members (mds and bds) and pg students in india. this might significantly change the culture of dental school training into a supportive environment for research / scholarship, thereby increasing academic productivity. training in research and the facilities to do research is need of the hour for improved quality of treatments, for the professional contentment of the faculty and ultimately for the betterment of dentistry. this will improve and maintain the liveliness of academics and will prepare successfully, the future generation of academic faculty. the dental associations of india have to understand the fullest scope of dental research in india. the newer opportunities in dental research are development of newer vaccines for the prevention of oral diseases, salivary proteomics in screening of oral cancers, epigenetics, oral health literacy, role of dentists in disaster management, and problem - based learning. because of the consistent attempts of research in the dental field and the painstaking efforts of fdi, oral diseases have successfully gained recognition within the context of global policy on non - communicable diseases. for the growth of science, it is not only important to do research but it 's equally important to publish the findings in the national and international journals for knowledge distribution worldwide. as per the regulations of dental council of india, all pg students have to do mandatory scientific dissertation as a statutory requirement for completion of their degrees. in addition, there are numerous short scientific studies done routinely by undergraduate students and pg students under the guidance of faculty. these pg students do scientific research, but hardly very few students get success to get their work published. it is also important to mention those dental faculties who either supervise graduate or pg students themselves perform research and often fail to get their work published. our study revealed several reasons for this non - research and publication oriented environment in dental schools in india. in the institutional and departmental barrier, the most common reported barrier for research was administrative overload, rather than undertaking research work. the bureaucracy and the administrative burden are so complicated, and energy is draining that research work takes back seat. this could be attributed to the fact that pgs and staff are expected to work for dental inspections, national assessment and accreditation council accreditation, university grants commission recognization, and the usual administrative work for the college round the clock, hence, the research work suffers. reported that maximum productivity can be achieved by the institutions when research is considered as a professional activity at par with other responsibilities in the institute. another important barrier is a lack of exclusive administrative and technical support for research work. the results obtained in our study are similar to the study reported by haden. in most of the dental institutions in india, there is no provision of recruitment of staff that can render technical assistance in collection and analyzing data. usually, research work is carried out by pgs and the junior staff but at the time of publishing the results, it becomes implied that the senior staff will get authorship at important positions. this is an important barrier as it prevents from conducting and publishing the research work. as in our study, comparable findings of overburdening of dental staff with departmental politics were reported by carroll - ann trotman, karl haden, and william hendricson. a concern about finance is a significant factor which can encourage or hamper their search work. interested faculty members should be encouraged by providing funds and infrastructure for research. for multi - centric clinical trials, clinical research of materials and equipment, and fieldwork, necessary funds are required. in an indian scenario, where pgs students and junior staffs are overburdened by the indebtedness of educational loans and inadequate salaries of staff this situation is further complicated by no funding from the educational institutes and poor training and experience for writing grants. has reported the same. and carroll - ann trotman, karl haden and william hendricson. other than the training for writing grant applications successfully, it is also important to highlight that most the indian researcher do not know as how many agencies are there which can provide grant and which agency will grant funds for what kind of study. before one start a research work he / she has to evaluate critically the methodology and the results section of the research paper and try to adopt it in the platform they are working with. many study participants reported that they were not competent enough to critically appraise the research paper, hence become a prominent barrier for quality research. most of the work, which goes in the name of research, is methodologically erroneous. this could be attributed to the fact that dental council of india does not include research methodology in detail as a part of bds curriculum. students are exposed less to research projects during their bds tenure and hence face problems during their masters. from commencement to completion of research projects and publishing the new discoveries, a researcher needs sabbaticals (paid leave for personal and professional development) as a relief from teaching and administrative duties. davidson. reported that sabbaticals are mandatory for the personal and professional growth of the individual. surprisingly, no such concepts exist in any of the dental institutions in india, neither private nor government. if the interested researcher has to go for research work, they have to use their casual leaves or with the loss of pay. another important barrier to mention is what the indian authors think about the international editorial board. it is not that international advisory boards are unfair to indian authors, but they expect a better quality of research and its reporting. the quality of scientific work and research in terms of methodology and clinical trials has to be up to the recent developments. this barrier has to be removed by in - depth training in research methodology, utilization of the available newer materials, equipment. the same has been reported by best and kahn this could be attributed to the fact that presently there are no research jobs in indian dental schools and there is necessity that human resource department should have trained or certified dental research assistants / data analysts in the research team. this could be achieved by framing guidelines for research from the dental council of india and to train indian dentists to keep records, to emphasize it by making it mandatory by law. the present study used self - reported questionnaires ; the data, therefore, may be subjected to report bias. thus, to reduce self - report bias, participants were ensured that all survey responses would be entirely anonymous and would be kept confidential to protect their privacy. likert scales might be subjected to the halo effect, positive skew, and end - aversion bias. the present study highlights certain barriers for research in indian scenario which includes bureaucracy and administrative overburden, lack of adequate and timely secretarial, technical and computerial assistance, frustration from inter and intradepartmental politics, lack of funds and inexperience in grant writing and approval, lack of training in critically appraisal, non - availability of sabbaticals, no provision of jobs as research professionals and lack of documentation of the dental data in the dental institution. the study highlights the need for major interventions from the governing authorities of dentistry in india to make the research non - intensive environment to research - friendly environment. | objective : research in the dental field is progressing at mightier speed worldwide, but an unfortunately representation of india at this platform is negligible. the present study was undertaken to unearth the barriers for dental research among dental professionals in indian scenario.materials and methods : a cross - sectional questionnaire study was conducted on 1514 participant 's (master of dental surgery and bachelor of dental surgery staff) and postgraduates in 40 dental colleges of india selected by multistage random sampling. the response rate was 75.7%. the survey was undertaken from july 2013 to december 2013. the survey instrument was 24-item, investigator developed, self - structured, close - ended, and self - administered questionnaire grouped into four categories that are, institutional / departmental support related barriers, financial / training support related barriers, time - related barriers, and general barriers.results:among all respondents 47.23% informed that they are administrative and educational work rather than research work as (p < 0.001). overall 57.53% of study participants reported lack of administrative and technical support for research work as (p < 0.001). overall 64.9% reported meager college funding was the barrier (p < 0.001). overall 61.5% respondents reported lack of time to do research work due to clinical and teaching responsibilities (p < 0.001) was the barrier for research. largely 80.25% agreed that, the lack of documentation and record maintenance are an obvious barrier for research (p < 0.001).conclusions : present study unearths certain barriers for research in an indian scenario, which includes administrative overburden, lack of funds, and lack of documentation of the dental data. governing authorities of dentistry in india have to make major interventions to make research non - intensive environment to research - friendly environment. |
cervicitis is defined clinically by the presence of either mucopurulent discharge or easily induced bleeding at the endocervical os, more subtle signs include edema of the cervical ectropion (edematous ectopy) and the presence of an elevated number of polymorphonuclear leukocytes, as detected by gram staining of a smear of endocervical secretions under high - power magnification1. other organisms include : herpes simplex virus (hsv), human papillomavirus (hpv) and trichomonas vaginalis. hsv serological testing should be considered for people presenting for a sexually transmitted disease evaluation, especially for those people with multiple sexual partners and people with hiv infection. herpes cervicitis becomes important when observed in a woman of reproductive age group because of the risk of neonatal infections resulting from exposure to hsv in the genital tract during delivery. hsv is shed asymptomatically from multiple anatomical sites and shedding, like exposure, is a significant risk for transmission. non - neoplastic diseases are predominantly inflammatory however there are few publications on the subject compared to neoplastic diseases of the cervix. common causes include chemical irritations secondary to douching or local trauma produced by pessaries and intrauterine contraceptive devices. a 28-year old female trader referred to the special treatment clinic (stc) of the university college hospital (uch) ibadan, nigeria with cervical cytology suggestive of herpes simplex cervicitis. this was detected on routine screening for cervical cancer using pap smear which showed superficial, intermediate, parabasal and endocervical cells. also seen are binucleated epithelial cells, all of which were suggestive of herpes simplex cervicitis (figure 1). she is para 3 + 0, 3 alive ; last child birth was 4 years ago. all her pregnancies were uneventful and delivered per vaginum with no history of delivery of congenitally malformed baby. though with a desire for future pregnancy, she currently has an intra - uterine contraceptive device (iucd) (copper t 380a) which was placed 2 years ago. her last menstrual period was on 20th may 2012 (5 days prior to presentation). she denied a positive history of multiple sexual partner, however she confirmed that her spouse has other sexual partners (number not revealed). she had no complaints referring to presence of a sexually transmitted infection at presentation but affirmed to a history of previous recurrent whitish vaginal discharge with no genital malodor. no dysuria or hematuria. physical examination revealed a healthy looking young lady with major findings in the genital system. the external genitalia appeared normal with no blisters, ulcers, warts or other genital / perianal lesions. speculum examination of the vagina exposed scanty, whitish mucopurulent discharge with no peculiar odor emanating from the cervical os. the ectocervix appeared reddened, edematous, mildly tender on gentle swabbing (no bleeding) with the iucd string protruding from the endocervix (figure 2). elisa for herpes simplex virus 1 and 2 igm screening (diapro diagnostics, milan, italy) was positive. chlamydia and syphillis screening were also negative. the endocervical swab taken yielded normal flora. she was re - assessed at the follow up clinic and examination of the cervix showed a marked improvement in the cervical inflammation earlier observed (figure 3). infections of the cervix represent an important reservoir for the sexual or perinatal transmission of pathogenic microorganisms and the usual source from which upper genital tract infections develop. genital herpes simplex virus infection is common and involves, in the order of frequency, the cervix, vagina, and vulva. the frequency of genital herpes has increased dramatically in the past decades, particularly in teenagers and young women. by the age of 40, about 20% of women are seropositive for antibodies against hsv-2. hsv cervicitis occurs in 70 - 90% of primary hsv-2 infections and about 70% of primary hsv-1 infections. however there are no conclusive data on seroprevalence of herpes simplex cervicitis in most parts of the world, this is partly because the prevalence of this disease is very difficult to ascertain by case reporting, as most of the cases are clinically in apparent. some of the identified risk factors for herpes cervicitis were found to be present in our index case. she had an intra uterine device in situ for over two years, positive history of an apparently asymptomatic spouse with multiple sexual partners and early age at onset of sexual intercourse. however, in the index case, speculum examination of her cervix revealed a hyperemic and friable cervix, with copious creamy white discharge from the endocervical canal, while ulcers / erosions were absent. this is more in keeping with cervicitis caused by trichomonas vaginalis, chlamydia trachomatis or neisseria gonorrhoea which are more common causes of infectious cervicitis and as such are usually considered first as differentials. hence many patients go undiagnosed and untreated for herpes cervicitis. however, culture of the endocervical discharge in this patient yielded normal flora, she was also negative for chlamydia, trichomonas vaginalis and gonorrhoea. the diagnosis of hsv-2 in our patient was done using enzyme - linked immunoabsorbent assay. the sensitivity of these tests for detection of hsv-2 antibody vary from 80% to 98%, while the specificity of these assay is above 96%. we did not have facilities for cell culture which is gold standard for diagnosis of herpes simplex virus infection with a higher specificity of above 99%. we also do not have facility for polymerase chain reaction, which is highly sensitive, even more than viral culture, and highly specific as well. to the best of our knowledge, this is the first case of herpes cervicitis to be reported from this centre. had earlier reported herpes simplex infection among attendees of our special treatment clinic.it has been documented that prompt initiation of anti herpetic treatment shortens the duration of the disease, and may reduce rate of recurrence and virus shedding by inhibiting replication. genital hsv infection has been associated with persistent inflammatory cervical smears in a study done ; the increased cervical cancer risk was associated with a history of chronic cervicitis. in another study focusing on gynecological infections other than hpv as risk determinants of subsequent cervical neoplasia, association with cervical hsv infection gave the highest and statistically most significant increase in risk. studies have shown that prevalent hsv-2 infection is associated with a 2 - 3 fold increased risk of acquiring hiv infection, while incident hsv-2 infection is associated with an even higher risk of acquiring hiv infection. genital hsv-2 infection is thought to facilitate transmission of hiv infection from persons who are coinfected with both viruses. without typical clinical symptoms of hsv infection, the patient is generally not screened for hsv infection thus putting the women at risk. this case was a young woman in the reproductive age group who desired to have more children. this incidental finding and treatment of this index case has probably contributed to preventing the complications of genital hsv infection viz a viz the possibility of sexual transmission of the disease, as well as perinatal transmission with emergence of congenital malformation in infants of infected mothers. this case also illustrates the importance of effective routine pap smear for sexually active women. in conclusion, cervicitis increases the risk of poor pregnancy outcome, predicts upper genital tract disease, and is associated with increased shedding of hiv-1 from the cervix in the absence of chlamydial and gonococcal infection. hence determining the etiology of this condition therefore it should be considered as a differential diagnosis of cervicitis among sexually active women particularly those with intrauterine device. | infection with genital herpes simplex virus (hsv) remains a common viral sexually transmitted disease, often subclinical and a major worldwide problem of women of reproductive age group. herpes cervicitis is an unusual presentation of herpes simplex virus infection in females. the finding of herpes cervicitis on routine pap smear of an asymptomatic woman on intrauterine contraceptive device still further supports the need for increased awareness on the possibility of herpes simplex virus infection among women, particularly those on intrauterine contraceptive device. the index case is a 28 years old nigerian female who was referred to our special treatment clinic on account of an abnormal pap smear cytology which was in keeping with herpes cervicitis. there was no history of genital ulcer in this patient ; however elisa for hsv 2 igm was positive in her. we therefore describe a case of herpes cervicitis in an asymptomatic woman on intrauterine contraceptive device. this case highlights to clinicians the need to be aware of the possibility of this association and to carry out relevant investigations so as to identify and treat these patients appropriately. therefore, there is a need to put in place adequate public health intervention strategy to prevent genital herpes in women of reproductive age group with a view to preventing the possibility of congenital herpes in subsequent pregnancy. |
we developed an ordinary differential equation simulation model for hiv testing and treatment among msm in san francisco extending previous models [1, 4, 5 ]. we tested 3 art expansion strategies : (1) treatment of all individuals currently receiving hiv care with cd4 cell counts 500 cells / mm, cd4 cell count of 350500 cells / mm, cd4 cell count of 200350 cells / mm, and cd4 cell count 30% reduction in the percentage of new hiv infections averted over 20 years. the model was less sensitive to changes in the proportion of individuals who are able to achieve virological suppression, with a 10% decrease in the proportion achieving suppression resulting in a < 10% decrease in the percentage of new infections averted. other model input parameters evaluated in sensitivity analyses (treatment cessation rates, mortality rates, infectiousness with incomplete viral suppression, testing rates, and the proportion in the high - risk group) demonstrated similar relative effects between the strategies over the range of likely values. san francisco is one of the original epicenters of the hiv epidemic and remains the site of one of the largest concentrated epidemics of hiv infection in the united states, with a 24% prevalence among msm, exceeding levels reported in other concentrated epidemics, such as msm in new york city and african - american men in washington, dc. despite advancements in treatment and expanded outreach efforts, 600 incident hiv infections occurred in san francisco in 2008. new strategies of combination prevention that include both behavioral and biomedical interventions are thus needed. our model demonstrates that expansion of art to those already in care with cd4 cell counts < 500 cells / mmor at any cd4 cell count is likely to significantly reduce the number of future hiv infections. further reductions could be gained by the addition of routine annual testing and linkage to care. these findings extend other models of san francisco and vancouver by anchoring the analysis to empirical data regarding engagement in care and the new department of health & human services (dhhs) guidelines for art initiation. it is instructive to contrast our findings to those of a recent modeling analysis of the hiv epidemic in washington, dc. our model predicts greater reductions in new hiv infections, compared with analysis from washington, dc. although the deterministic model with its inherent limitations differed from the stochastic simulation model used by walensky may have contributed to these differences, the critical difference is that only 50% of persons in the dc model are linked to care after a positive hiv test result. indeed, these authors and other modeling reports from south africa emphasize the importance of linkage to care as a limiting factor in art expansion strategies reducing incident hiv infections. when the dc model includes nearly complete linkage to care, results of the models converge. testing and linkage to care are appropriately one of the highest public health priorities in populations with high prevalence worldwide. in san francisco, with the high rates of hiv testing and linkage to care, we have the opportunity to reduce hiv transmission by expanding art to those already receiving care while we determine the most cost - effective approaches to further expand testing. of importance, realization of the prevention benefits of expanded art strategies depend on a number of components. retention in care and expanded financial, clinical, social, and structural adherence and support measures for treatment, including specific support for psychiatric and substance use comorbid conditions, and addressing homelessness and marginal housing all need to be components of the strategy in a city such as san francisco. also of concern is the potential for changes in behavior among msm leading to increased transmission risk, thereby offsetting any potential gains and the specter of drug - resistant strains of hiv. however, these obstacles are not insurmountable, as evidenced by the recent public health commitment and movement to universal art and a comprehensive, multi - level hiv prevention strategy in san francisco. it is possible that such strategies are comparatively cost - effective and should be evaluated as data become available. of note, there is little observed evidence of significant increases in hiv transmission risk behavior, and contrary to recent modeling exercises, transmitted drug resistant hiv strains have remained stable or even decreased in san francisco and in similar cities, such as vancouver, where art has rapidly expanded [1719 ]. modeling of complex phenomena, such as a local hiv epidemic and making cogent predictions about the future, are subject to numerous limitations. in essence, modeling is a thought experiment, informed by data, but subject to the validity and completeness of the model 's internal structures. the model presented here while able to recapitulate the observed hiv epidemic in san francisco from its beginning with high fidelity does not specifically model the impact of acutely hiv - infected persons, which may be a significant driver of new hiv infections or account for perturbations arising from hiv drug resistance which may affect virological suppression rates ; however, the sensitivity analyses performed indirectly address these issues by varying the reach of hiv testing and art effectiveness in producing viral suppression. in conclusion, our projections suggest that ensuring hiv - infected patients in san francisco already receiving care are offered art would significantly reduce the incidence of hiv infection in san francisco. these predictions are supported by recent surveillance data from san francisco and vancouver that show decreasing rates of new hiv infections that correlate with art expansion and lower community viral load [20, 21 ]. with new national and san francisco health department art guidelines supporting treatment for most hiv - infected persons for their individual health, secondary benefits of reducing hiv transmission | modeling of expanding antiretroviral treatment to all hiv infected adults already in care in san francisco predicts reductions in new hiv infections at 5 years of 59% among men who have sex with men (msm). addition of annual hiv testing for msm to universal treatment decreases new infections by 76%. |
the doctors said that it was puerperal fever and that it was ninety - nine chances in a hundred it would end in death. the whole day long there was fever, delirium, and unconsciousness. at midnight leo tolstoy 's anna karenina sepsis syndromes, which account for up to 50% of deaths in intensive care units (icus), are associated with high morbidity and mortality rates.1 early recognition and appropriate therapy of sepsis could alter the impending cascade of hypoperfusion, inflammation and organ dysfunction, thereby reducing the mortality rate.1 most proposed sepsis treatments focus on prompt antibiotic therapy, control of the infectious source, and global hemodynamic goals.2 organ dysfunction is often diagnosed using laboratory parameters rather than on clinical parameters.3 brain dysfunction, or sepsis - associated encephalopathy (sae), has been neglected until recently because there are no precise, well - established clinical or biological markers of damage to the brain during sepsis.4 this narrative review describes the most recent findings in the pathophysiology and diagnosis of sae, as well as advances in the management of patients with sae. because much of the scientific knowledge regarding sae is relatively new, this comprehensive review covers most of the physiological and clinical aspects of this condition. a directed, non - systematic search of the medical literature using pubmed, ovid, and google scholar was performed to identify research and review articles involving the pathophysiology, diagnosis, and treatment of sae. the most relevant studies were selected in the following order : animal models of clinical disease. although delirium is a major component of the clinical presentation of sae, the two conditions are not synonymous. delirium is a fluctuating disorder of consciousness that is associated with a change in cognition or perceptual disturbance ; it can be caused by any general medical condition.5 sae is one of many causes of delirium, but delirium is not the only clinical presentation of sae. kingsmill jones defined febrile delirium as a prejudice of the brain 's higher functions triggered by a febrile infectious disease that could occur during or after fever.6 he asserted that post - febrile insanity was a rare condition that was not merely due to the wasting and exhaustion caused by fever. according to dr. jones ' theory, the condition could not be cured with rest and good nutrition because the specific poison of the fever must be a factor in causing post - febrile insanity. dr. jones was the first author to hypothesize that the same factor that caused fever could be related to brain dysfunction. physicians are now aware that sae is a common condition4,7 that can significantly impact patient outcomes. altered mental status is present in up to 23% of patients with sepsis.7 mental dysfunction may even precede the cardinal findings of sepsis.8 when present, sae is associated with a poor prognosis.7 in the classic report by sprung.,7 the mortality rate of septic patients with altered mental status was 49% compared with a rate of 26% in septic patients with no neurological symptoms. eidelman.9 reported that the severity of neurological symptoms secondary to encephalopathy in patients in the icu, as assessed by the glasgow coma scale, was correlated to prognosis, with a mortality rate of up to 63% in patients who presented with glasgow coma scale scores between 3 and 8. in a recent epidemiological multicentric study with 497 patients, including 76 septic patients, the overall prevalence of delirium was 32.3%.10 icu and hospital mortalities were increased in patients with delirium. no studies to date have evaluated the actual incidence of the various types of sae. therefore, the actual incidence of neurological changes due to sepsis and its associated mortality might be underestimated. sae appears to involve direct cellular damage to the brain, mitochondrial and endothelial dysfunction, neurotransmission disturbances and derangements of calcium homeostasis in brain tissue.12 cerebral blood flow may also be affected.13 because the evaluation of cerebral function during human sepsis is difficult, much of the associated knowledge comes from laboratory studies in animal models of sepsis. neurotransmission : several neurotransmitters appear to be related to sae, including the cholinergic pathway14 and the expression of receptors for -aminobutyric acid,15 norepinephrine, serotonin, and dopamine.16 han. associated the use of anticholinergic drugs with symptoms of delirium.14 comim.17 evaluated the role of rivastigmine, a cholinesterase inhibitor, in the treatment of memory impairment in rats following cecal ligation and puncture (clp). rivastigmine improved performance in an open - field memory test in animals evaluated 10 days after clp, suggesting that acetylcholine deficiency may be prolonged. in vivo measurement of neurotransmitters is difficult, requiring lumbar puncture or the use of brain microdialysis.18 pandharipande.18 postulated that the serum measurement of large neutral amino acids (lnaa) could be related to delirium during critical illness because lnaas are predecessors of many neurotransmitters. tryptophan (trp) is necessary for serotonin synthesis ; phenylalanine (phe), together with tyrosine (tyr), is required for dopamine and norepinephrine production. in fact, the relationship between plasma trp and total lnaa (trp / lnaa ratio) and between plasma tyr and total lnaa (tyr / lnaa ratio) were both statistically related to the diagnosis of brain dysfunction during critical illness.18 reduced levels of branched - chain amino acids (bcaas- leucine, isoleucine and valine), a group of lnaa, could be related to the increase in brain concentrations of aromatic amino acids (aaa). bcaas and aaa compete for the same transporter in the blood - brain barrier (bbb).19 if bcaa levels are low, there will be an increase in brain uptake of aaa and, theoretically, an increase in levels of neurotransmitters associated with sae. berg.20 further explored the relationship between bcaa and aaa in sepsis. after the infusion of e. coli lipopolysaccharide (lps) in 12 healthy individuals, the plasma bcaa / aaa ratio declined, mainly because of increases in serum concentrations of phe and decreases in concentrations of valine and isoleucine. phe is potentially neurotoxic and can generate false neurotransmitters.21 this study confirms that there is an important interplay between bcaas and aaa. supplementation with bcaas has been suggested as a therapeutic approach because of their decreased concentrations during sepsis.22 freund.22 demonstrated that survivors of sepsis had higher levels of bcaas than those who eventually died, suggesting a more adequate energy supply in the surviving patients. in a non - matched interventional group of five patients, however, randomized clinical trials that include the treatment of sae with bcaas are lacking. mitochondrial dysfunction : the complex association between mitochondrial dysfunction and target organ damage in sepsis has been extensively reviewed.23 - 25 the roles of mitochondria reach far beyond energy production and involve diverse metabolic pathways, including cell death.25 sepsis is associated with mitochondrial dysfunction, which can have remarkable consequences for cells and the health of the host. in brief, early sepsis is associated with a decrease in mitochondrial atp generation, which is likely mediated by cytokines, reactive oxygen species (ros), and nitric oxide (no),23 suggesting an energy deficit that could be related to tissue and organ damage. the mitochondria might trigger cellular apoptosis later in the course of the disease by releasing cytochrome c, for example.25 although necrosis and apoptosis are present in sepsis, several concerns regarding tissue damage have been raised. in most situations, organ function improves as sepsis is treated, indicating a lack of massive or irreversible anatomic tissue damage. additionally, one study suggested that apoptosis is a minor feature in the autopsies of septic patients.26 the mitochondria might be associated with an adaptive suspended animation - like state23 in which cells either recover or undergo programmed cell death, depending on the magnitude of the offending event. cytochrome c oxidase may play an important role in mitochondrial dysfunction,23 and replacement therapy with cytochrome c has been proposed as a possible treatment for sepsis.27 a recent study by d'vila.28 evaluated mitochondrial function in brain homogenates of septic mice after clp. the study showed a reduction in the efficiency of oxidative phosphorylation in the mitochondria and reduced levels of cytochrome c oxidase in the brain following clp. the mitochondria are also involved with mechanisms related to neural apoptosis during sepsis, as illustrated by messaris.29 an increase in bax levels was found in neuronal cells in early stages of sepsis after clp in rats, primarily in areas with more permissive bbbs, including the hippocampus, choroid plexus, and purkinje cells. the bax gene is part of the bcl-2 gene family and is associated with regulation of programmed cell death on various biological scenarios.29 increased levels of bax likely induce apoptosis by releasing cytochrome c from the mitochondria into the cell cytoplasm, although cytochrome c release was associated with improved prognosis in this study. therefore, mitochondrial dysfunction may be related to both the induction of neural cell apoptosis and an insufficient energy supply. brain cell death : until recently, it was uncertain whether sae is associated with irreversible brain lesions.30 critical illness independently is associated with long - term cognitive impairment (ltci),31 and a link between severe sepsis and ltci was recently established in a large cohort of patients.32 brain involvement in critical illnesses may be a trigger for ltci or a sign of poor prior brain reserves that is not detectable by screening tests. additionally, ltci might be a consequence of brain cell death.33 brain cell death occurs in sae, as shown by elevated s100 and neuron - specific enolase (nse).34 s100 is a calcium - binding protein that is produced mainly by the central nervous system and is released during neuronal or glial injury. because the normal bbb is impermeable to s100, elevated serum levels of s100 are a marker of neuronal and bbb damage. increases in s100 levels in critically ill patients without apparent brain damage have been reported.36 the increases in s100 were not correlated with the severity of clinical encephalopathy in cases of sepsis.37 therefore, elevations in s100 and nse levels may be related to critical illness per se or may be markers of minor brain damage caused by inflammation and early organ dysfunction that can not be otherwise diagnosed. calcium homeostasis : an increase in intracellular calcium levels is associated with sepsis - induced brain injury.12 zhan. demonstrated that hippocampal intracellular calcium levels were increased after clp in rats.12 this increase could be related to ischemia, the presence of excitatory amino acids or a direct effect of cytokines. altered calcium levels may alter neurotransmitter levels and impair learning, memory and cognitive function in septic patients. endothelial and bbb dysfunction : endothelial dysfunction plays an important role in sae pathogenesis. under normal conditions, the bbb protects the brain from a number of insults and creates a tightly regulated microenvironment for neural cells. important functions of the bbb include the regulation of capillary blood flow and the protection of the brain from circulating noxious substances. the integrity of the bbb is maintained by interactions between astrocytic foot processes, pericytes, and endothelial cells.13 during sepsis, breakdown of the bbb facilitates the passage of neurotoxic factors. disruption of tight junctions in endotoxemia and detachment of brain pericytes in the hippocampus have been reported.38 both mechanisms could account for brain edema and bbb dysfunction in patients with sae. in vitro exposure of mouse brain endothelial cells to the plasma of septic animals induces the production of ros and no, which may be related to sae.39 inflammation is related to increased bbb permeability to cytokines40 and the expression of adhesion molecules. the activation of leukocytes during sepsis causes these cells to adhere to blood vessels and pass to the tissues in a process mediated by adhesion molecules. there is increased expression of intercellular adhesion molecule 1 (icam-1) during septic encephalopathy.41 monocytes that adhere to the endothelium and are transferred to the surrounding tissues can proliferate and expand the population of perivascular macrophages, contributing to cerebral inflammation.13 in addition to experimental models, bbb dysfunction has been demonstrated in septic patients by brain magnetic resonance imaging (mri).42 bbb breakdown is more frequent around the virchow - robin spaces or is diffuse throughout the white matter and posterior lobes. these findings are consistent with posterior reversible encephalopathy syndrome, which is discussed later.4 inflammatory mediators and complement system : of the many inflammatory mediators that are involved in sae, tnf- appears to be one of the most significant.13,40,43 alexander.43 evaluated the role of brain tnf receptor-1 (tnfr1) in lps - treated mice. tnf- induces neutrophil infiltration of the brain tissue, neuronal cell apoptosis, and brain edema (likely by inducing the expression of aquaporin 4). jacob.44 highlighted the effects of the complement cascade during sae in lps - treated mice. genetically modified mice that overexpressed cr1-related y (crry - tg), a potent complement inhibitor, had an attenuated inflammatory response, with less apoptosis and cerebral edema, after lps infusion. in addition, inhibition of complement factor c5a in a clp model was associated with improved bbb function.45 cerebral blood flow : brain ischemia has been described in the autopsy findings of patients following death from septic shock, suggesting that there may be alterations in cerebral blood flow during sae.46 - 48 hypotension and low cardiac output could be related to these findings. because most available data have been obtained from similar autopsy studies, it is uncertain whether cerebral blood flow reduction is universally present in sae or is only found in extremely ill patients who eventually die. a myocardial depression in septic patients could be linked to insufficient blood flow to the organs, including the brain.47 earlier reports also suggest that blood flow may be reduced in the brains of septic patients.49 pfister. evaluated cerebral blood flow using transcranial doppler in a small series of patients.50 there was no association between sae and altered brain perfusion that was reported in the middle cerebral artery. however, the autoregulation of blood flow was disturbed in patients with sae, suggesting that the septic brain is more susceptible to variations in mean arterial pressure. other factors that may influence cerebral perfusion in sepsis have recently been reviewed.47 burkhart.47 proposed that cerebral perfusion in sepsis is related to both macro- and micro - hemodynamic features. concerning microcirculation, flow was dependent on the function of the bbb and the local production of no and ros. explored microcirculation in the septic brain in a sheep model.51 using video microscopy, the authors showed a profound impairment of cerebral microcirculation in sepsis, which was characterized by a reduction in functional capillary density and the proportion of perfused capillaries. neuropathology could supply clues to our understanding of sae.42,46,48 in a series of 23 patients who died from septic shock, all patients had some degree of brain ischemia.46 other reported findings included multifocal necrotizing leukoencephalopathy (9%), micro - abscesses (9%), hemorrhages (26%), and hypercoagulability (9%). another series from the same group evaluated brain imaging resonance in sae and performed autopsies in selected cases42 with varying results. the findings suggested a predominance of white matter lesions, with swelling and dilation of the perivascular spaces and occasional periodic acid - schiff stain (pas) positive fibrin exudates. janz.48 evaluated the autopsy findings of seven patients with delirium who eventually died. hypoxic ischemic injury, which was noted in six patients, was the most common finding. patients with hippocampal lesions spent an average of 5.8 days in delirium and received an average of 2.2 different analgesics and/or sedatives to control their symptoms. as a result, the authors hypothesized that there is a positive correlation between hippocampal injury and symptoms of delirium. this conclusion corroborates the concept that bbb damage is one of the key mechanisms involved in sae. it must be clearly stated that sae is a diagnosis based on exclusion.8 diagnosing sae is challenging, especially in chronic critical illnesses. several medical conditions must be excluded before a diagnosis of sae can be made, including drug use, central nervous system disorders, and electrolyte disturbances. consequently, the brain dysfunction associated with critical illness is often multifactorial.8,52 sae could present with symptoms that range from a few clinical findings to a coma and could entirely bypass the stage of delirium (figure 2).8, therefore, the diagnosis of sae should not be made using the dsm iv5 criteria for delirium or the cam - icu questionnaire.55 to date, no tool is capable of diagnosing the full spectrum of sae. altered consciousness is often a cardinal finding of sae.54 focal motor deficits and seizures have been reported56,57 but are not common and should prompt a detailed investigation with brain imaging and possibly lumbar puncture. electroencephalography (eeg) has been proposed as an important tool in the evaluation of sae.58,59 young.58 studied 69 septic patients, 49 of whom had some degree of encephalopathy that was categorized as either mild or severe. eeg patterns were classified into five categories : normal, theta, delta, triphasic waves (tw), or suppression. the eeg pattern was associated with mortality, but the limited number of patients impeded further analysis. however, none of the eeg findings were pathognomonic. eeg may be useful in aiding the diagnosis of sae because it can exclude non - convulsive status epilepticus. performed brain mri evaluations in nine critically ill septic patients.42 five of these patients had white matter lesions (leukoencephalopathy) that were characterized by hyperintensity on fluid - attenuated inversion recovery (flair) images and predominated around enlarged perivascular spaces, which are likely related to damage to the bbb. the severity of these lesions was correlated to neurologic prognosis, as evaluated by the glasgow outcome scale. posterior reversible encephalopathy (pre) may also be linked to sepsis and infection.62 in a study of 106 patients with pre, 23.6% had infection or sepsis / septic shock. pre was not an early finding, as it occurred up to 30 days after infection. brain imaging may aid in the diagnosis of sae and may exclude other causes of neurologic deterioration. larger case series are necessary to confirm the association between white matter lesions and outcome. treating and diagnosing sae are equally challenging tasks. none of the therapies that aim to treat the pathophysiological mechanisms of sae have been proven effective in humans. the use of anti - c5a antibody reduces bbb damage in a clp model45 in rats, and c5a or c5ar blockade apparently improves mortality in experimental studies.63 the use of drotrecogin alpha has been suggested to reduce neural damage in human sepsis, as evaluated by serum measurements of s100.64 however, it is unclear whether s100 is an actual marker of brain injury. because the study reported no clinical endpoints, it is not advisable to advocate the use of drotrecogin in the treatment of sae. sedatives are often used in the intensive care unit, and the use of benzodiazepines is related to the increased incidence of brain dysfunction, as assessed by symptoms of delirium.65 dexmedetomidine, an alpha-2 agonist, has been associated with less delirium than continuous lorazepam and midazolam in critically ill patients (the mends trial).65 pandharipande. performed an a priori analysis of septic patients,66 including 63 patients that were administered either lorazepam (32 patients) or dexmedetomidine (31 patients). of the two groups, patients who received dexmedetomidine had more delirium / coma - free days (3.2 days ; 95% ic 1.1 - 4.9) and a lower 28-day mortality rate (hazard ratio 0.3 ; ic 0.1 - 0.9). this study had several limitations, including possible randomization issues due to the nature of the subgroup analysis and a small sample size, which made it vulnerable to type ii error. the results of the study could be related to the beneficial effects of dexmedetomidine or the hazardous effects of benzodiazepines. the possible favorable effects of dexmedetomidine include the inhibition of apoptosis and reductions in the sepsis - associated inflammatory response.66 in the brain, dexmedetomidine has been shown to decrease apoptosis by binding to 2-receptors,67 which may explain the reduction in symptoms of delirium in septic individuals. until additional evidence is available, dexmedetomidine is preferred over benzodiazepines when sedation is necessary for patients with sae. although delirium is a major component of the clinical presentation of sae, the two conditions are not synonymous. delirium is a fluctuating disorder of consciousness that is associated with a change in cognition or perceptual disturbance ; it can be caused by any general medical condition.5 sae is one of many causes of delirium, but delirium is not the only clinical presentation of sae. kingsmill jones defined febrile delirium as a prejudice of the brain 's higher functions triggered by a febrile infectious disease that could occur during or after fever.6 he asserted that post - febrile insanity was a rare condition that was not merely due to the wasting and exhaustion caused by fever. according to dr. jones ' theory, the condition could not be cured with rest and good nutrition because the specific poison of the fever must be a factor in causing post - febrile insanity. dr. jones was the first author to hypothesize that the same factor that caused fever could be related to brain dysfunction. physicians are now aware that sae is a common condition4,7 that can significantly impact patient outcomes. altered mental status is present in up to 23% of patients with sepsis.7 mental dysfunction may even precede the cardinal findings of sepsis.8 when present, sae is associated with a poor prognosis.7 in the classic report by sprung.,7 the mortality rate of septic patients with altered mental status was 49% compared with a rate of 26% in septic patients with no neurological symptoms. eidelman.9 reported that the severity of neurological symptoms secondary to encephalopathy in patients in the icu, as assessed by the glasgow coma scale, was correlated to prognosis, with a mortality rate of up to 63% in patients who presented with glasgow coma scale scores between 3 and 8. in a recent epidemiological multicentric study with 497 patients, including 76 septic patients, the overall prevalence of delirium was 32.3%.10 icu and hospital mortalities were increased in patients with delirium. no studies to date have evaluated the actual incidence of the various types of sae. therefore, the actual incidence of neurological changes due to sepsis and its associated mortality might be underestimated. sae appears to involve direct cellular damage to the brain, mitochondrial and endothelial dysfunction, neurotransmission disturbances and derangements of calcium homeostasis in brain tissue.12 cerebral blood flow may also be affected.13 because the evaluation of cerebral function during human sepsis is difficult, much of the associated knowledge comes from laboratory studies in animal models of sepsis. neurotransmission : several neurotransmitters appear to be related to sae, including the cholinergic pathway14 and the expression of receptors for -aminobutyric acid,15 norepinephrine, serotonin, and dopamine.16 han. associated the use of anticholinergic drugs with symptoms of delirium.14 comim.17 evaluated the role of rivastigmine, a cholinesterase inhibitor, in the treatment of memory impairment in rats following cecal ligation and puncture (clp). rivastigmine improved performance in an open - field memory test in animals evaluated 10 days after clp, suggesting that acetylcholine deficiency may be prolonged. in vivo measurement of neurotransmitters is difficult, requiring lumbar puncture or the use of brain microdialysis.18 pandharipande.18 postulated that the serum measurement of large neutral amino acids (lnaa) could be related to delirium during critical illness because lnaas are predecessors of many neurotransmitters. tryptophan (trp) is necessary for serotonin synthesis ; phenylalanine (phe), together with tyrosine (tyr), is required for dopamine and norepinephrine production. in fact, the relationship between plasma trp and total lnaa (trp / lnaa ratio) and between plasma tyr and total lnaa (tyr / lnaa ratio) were both statistically related to the diagnosis of brain dysfunction during critical illness.18 reduced levels of branched - chain amino acids (bcaas- leucine, isoleucine and valine), a group of lnaa, could be related to the increase in brain concentrations of aromatic amino acids (aaa). bcaas and aaa compete for the same transporter in the blood - brain barrier (bbb).19 if bcaa levels are low, there will be an increase in brain uptake of aaa and, theoretically, an increase in levels of neurotransmitters associated with sae. after the infusion of e. coli lipopolysaccharide (lps) in 12 healthy individuals, the plasma bcaa / aaa ratio declined, mainly because of increases in serum concentrations of phe and decreases in concentrations of valine and isoleucine. phe is potentially neurotoxic and can generate false neurotransmitters.21 this study confirms that there is an important interplay between bcaas and aaa. supplementation with bcaas has been suggested as a therapeutic approach because of their decreased concentrations during sepsis.22 freund.22 demonstrated that survivors of sepsis had higher levels of bcaas than those who eventually died, suggesting a more adequate energy supply in the surviving patients. in a non - matched interventional group of five patients, however, randomized clinical trials that include the treatment of sae with bcaas are lacking. mitochondrial dysfunction : the complex association between mitochondrial dysfunction and target organ damage in sepsis has been extensively reviewed.23 - 25 the roles of mitochondria reach far beyond energy production and involve diverse metabolic pathways, including cell death.25 sepsis is associated with mitochondrial dysfunction, which can have remarkable consequences for cells and the health of the host. in brief, early sepsis is associated with a decrease in mitochondrial atp generation, which is likely mediated by cytokines, reactive oxygen species (ros), and nitric oxide (no),23 suggesting an energy deficit that could be related to tissue and organ damage. the mitochondria might trigger cellular apoptosis later in the course of the disease by releasing cytochrome c, for example.25 although necrosis and apoptosis are present in sepsis, several concerns regarding tissue damage have been raised. in most situations, organ function improves as sepsis is treated, indicating a lack of massive or irreversible anatomic tissue damage. additionally, one study suggested that apoptosis is a minor feature in the autopsies of septic patients.26 the mitochondria might be associated with an adaptive suspended animation - like state23 in which cells either recover or undergo programmed cell death, depending on the magnitude of the offending event. cytochrome c oxidase may play an important role in mitochondrial dysfunction,23 and replacement therapy with cytochrome c has been proposed as a possible treatment for sepsis.27 a recent study by d'vila.28 evaluated mitochondrial function in brain homogenates of septic mice after clp. the study showed a reduction in the efficiency of oxidative phosphorylation in the mitochondria and reduced levels of cytochrome c oxidase in the brain following clp. the mitochondria are also involved with mechanisms related to neural apoptosis during sepsis, as illustrated by messaris.29 an increase in bax levels was found in neuronal cells in early stages of sepsis after clp in rats, primarily in areas with more permissive bbbs, including the hippocampus, choroid plexus, and purkinje cells. the bax gene is part of the bcl-2 gene family and is associated with regulation of programmed cell death on various biological scenarios.29 increased levels of bax likely induce apoptosis by releasing cytochrome c from the mitochondria into the cell cytoplasm, although cytochrome c release was associated with improved prognosis in this study. therefore, mitochondrial dysfunction may be related to both the induction of neural cell apoptosis and an insufficient energy supply. brain cell death : until recently, it was uncertain whether sae is associated with irreversible brain lesions.30 critical illness independently is associated with long - term cognitive impairment (ltci),31 and a link between severe sepsis and ltci was recently established in a large cohort of patients.32 brain involvement in critical illnesses may be a trigger for ltci or a sign of poor prior brain reserves that is not detectable by screening tests. additionally, ltci might be a consequence of brain cell death.33 brain cell death occurs in sae, as shown by elevated s100 and neuron - specific enolase (nse).34 s100 is a calcium - binding protein that is produced mainly by the central nervous system and is released during neuronal or glial injury. because the normal bbb is impermeable to s100, elevated serum levels of s100 are a marker of neuronal and bbb damage. increases in s100 levels in critically ill patients without apparent brain damage have been reported.36 the increases in s100 were not correlated with the severity of clinical encephalopathy in cases of sepsis.37 therefore, elevations in s100 and nse levels may be related to critical illness per se or may be markers of minor brain damage caused by inflammation and early organ dysfunction that can not be otherwise diagnosed. calcium homeostasis : an increase in intracellular calcium levels is associated with sepsis - induced brain injury.12 zhan. demonstrated that hippocampal intracellular calcium levels were increased after clp in rats.12 this increase could be related to ischemia, the presence of excitatory amino acids or a direct effect of cytokines. altered calcium levels may alter neurotransmitter levels and impair learning, memory and cognitive function in septic patients. endothelial and bbb dysfunction : endothelial dysfunction plays an important role in sae pathogenesis. under normal conditions, the bbb protects the brain from a number of insults and creates a tightly regulated microenvironment for neural cells. important functions of the bbb include the regulation of capillary blood flow and the protection of the brain from circulating noxious substances. the integrity of the bbb is maintained by interactions between astrocytic foot processes, pericytes, and endothelial cells.13 during sepsis, breakdown of the bbb facilitates the passage of neurotoxic factors. disruption of tight junctions in endotoxemia and detachment of brain pericytes in the hippocampus have been reported.38 both mechanisms could account for brain edema and bbb dysfunction in patients with sae. in vitro exposure of mouse brain endothelial cells to the plasma of septic animals induces the production of ros and no, which may be related to sae.39 inflammation is related to increased bbb permeability to cytokines40 and the expression of adhesion molecules. the activation of leukocytes during sepsis causes these cells to adhere to blood vessels and pass to the tissues in a process mediated by adhesion molecules. there is increased expression of intercellular adhesion molecule 1 (icam-1) during septic encephalopathy.41 monocytes that adhere to the endothelium and are transferred to the surrounding tissues can proliferate and expand the population of perivascular macrophages, contributing to cerebral inflammation.13 in addition to experimental models, bbb dysfunction has been demonstrated in septic patients by brain magnetic resonance imaging (mri).42 bbb breakdown is more frequent around the virchow - robin spaces or is diffuse throughout the white matter and posterior lobes. these findings are consistent with posterior reversible encephalopathy syndrome, which is discussed later.4 inflammatory mediators and complement system : of the many inflammatory mediators that are involved in sae, tnf- appears to be one of the most significant.13,40,43 alexander.43 evaluated the role of brain tnf receptor-1 (tnfr1) in lps - treated mice. tnf- induces neutrophil infiltration of the brain tissue, neuronal cell apoptosis, and brain edema (likely by inducing the expression of aquaporin 4). jacob.44 highlighted the effects of the complement cascade during sae in lps - treated mice. genetically modified mice that overexpressed cr1-related y (crry - tg), a potent complement inhibitor, had an attenuated inflammatory response, with less apoptosis and cerebral edema, after lps infusion. in addition, inhibition of complement factor c5a in a clp model was associated with improved bbb function.45 cerebral blood flow : brain ischemia has been described in the autopsy findings of patients following death from septic shock, suggesting that there may be alterations in cerebral blood flow during sae.46 - 48 hypotension and low cardiac output could be related to these findings. because most available data have been obtained from similar autopsy studies, it is uncertain whether cerebral blood flow reduction is universally present in sae or is only found in extremely ill patients who eventually die. a myocardial depression in septic patients could be linked to insufficient blood flow to the organs, including the brain.47 earlier reports also suggest that blood flow may be reduced in the brains of septic patients.49 pfister. evaluated cerebral blood flow using transcranial doppler in a small series of patients.50 there was no association between sae and altered brain perfusion that was reported in the middle cerebral artery. however, the autoregulation of blood flow was disturbed in patients with sae, suggesting that the septic brain is more susceptible to variations in mean arterial pressure. other factors that may influence cerebral perfusion in sepsis have recently been reviewed.47 burkhart.47 proposed that cerebral perfusion in sepsis is related to both macro- and micro - hemodynamic features. concerning microcirculation, flow was dependent on the function of the bbb and the local production of no and ros. explored microcirculation in the septic brain in a sheep model.51 using video microscopy, the authors showed a profound impairment of cerebral microcirculation in sepsis, which was characterized by a reduction in functional capillary density and the proportion of perfused capillaries. neuropathology could supply clues to our understanding of sae.42,46,48 in a series of 23 patients who died from septic shock, all patients had some degree of brain ischemia.46 other reported findings included multifocal necrotizing leukoencephalopathy (9%), micro - abscesses (9%), hemorrhages (26%), and hypercoagulability (9%). another series from the same group evaluated brain imaging resonance in sae and performed autopsies in selected cases42 with varying results. the findings suggested a predominance of white matter lesions, with swelling and dilation of the perivascular spaces and occasional periodic acid - schiff stain (pas) positive fibrin exudates. janz.48 evaluated the autopsy findings of seven patients with delirium who eventually died. hypoxic ischemic injury, which was noted in six patients, was the most common finding. patients with hippocampal lesions spent an average of 5.8 days in delirium and received an average of 2.2 different analgesics and/or sedatives to control their symptoms. as a result, the authors hypothesized that there is a positive correlation between hippocampal injury and symptoms of delirium. this conclusion corroborates the concept that bbb damage is one of the key mechanisms involved in sae. it must be clearly stated that sae is a diagnosis based on exclusion.8 diagnosing sae is challenging, especially in chronic critical illnesses. several medical conditions must be excluded before a diagnosis of sae can be made, including drug use, central nervous system disorders, and electrolyte disturbances. consequently, the brain dysfunction associated with critical illness is often multifactorial.8,52 sae could present with symptoms that range from a few clinical findings to a coma and could entirely bypass the stage of delirium (figure 2).8, therefore, the diagnosis of sae should not be made using the dsm iv5 criteria for delirium or the cam - icu questionnaire.55 to date, no tool is capable of diagnosing the full spectrum of sae. altered consciousness is often a cardinal finding of sae.54 focal motor deficits and seizures have been reported56,57 but are not common and should prompt a detailed investigation with brain imaging and possibly lumbar puncture. electroencephalography (eeg) has been proposed as an important tool in the evaluation of sae.58,59 young.58 studied 69 septic patients, 49 of whom had some degree of encephalopathy that was categorized as either mild or severe. eeg patterns were classified into five categories : normal, theta, delta, triphasic waves (tw), or suppression. the eeg pattern was associated with mortality, but the limited number of patients impeded further analysis. however, none of the eeg findings were pathognomonic. eeg may be useful in aiding the diagnosis of sae because it can exclude non - convulsive status epilepticus. performed brain mri evaluations in nine critically ill septic patients.42 five of these patients had white matter lesions (leukoencephalopathy) that were characterized by hyperintensity on fluid - attenuated inversion recovery (flair) images and predominated around enlarged perivascular spaces, which are likely related to damage to the bbb. the severity of these lesions was correlated to neurologic prognosis, as evaluated by the glasgow outcome scale. posterior reversible encephalopathy (pre) may also be linked to sepsis and infection.62 in a study of 106 patients with pre, 23.6% had infection or sepsis / septic shock. pre was not an early finding, as it occurred up to 30 days after infection. brain imaging may aid in the diagnosis of sae and may exclude other causes of neurologic deterioration. larger case series are necessary to confirm the association between white matter lesions and outcome. none of the therapies that aim to treat the pathophysiological mechanisms of sae have been proven effective in humans. the use of anti - c5a antibody reduces bbb damage in a clp model45 in rats, and c5a or c5ar blockade apparently improves mortality in experimental studies.63 the use of drotrecogin alpha has been suggested to reduce neural damage in human sepsis, as evaluated by serum measurements of s100.64 however, it is unclear whether s100 is an actual marker of brain injury. because the study reported no clinical endpoints, it is not advisable to advocate the use of drotrecogin in the treatment of sae. sedatives are often used in the intensive care unit, and the use of benzodiazepines is related to the increased incidence of brain dysfunction, as assessed by symptoms of delirium.65 dexmedetomidine, an alpha-2 agonist, has been associated with less delirium than continuous lorazepam and midazolam in critically ill patients (the mends trial).65 pandharipande. performed an a priori analysis of septic patients,66 including 63 patients that were administered either lorazepam (32 patients) or dexmedetomidine (31 patients). of the two groups, patients who received dexmedetomidine had more delirium / coma - free days (3.2 days ; 95% ic 1.1 - 4.9) and a lower 28-day mortality rate (hazard ratio 0.3 ; ic 0.1 - 0.9). this study had several limitations, including possible randomization issues due to the nature of the subgroup analysis and a small sample size, which made it vulnerable to type ii error. the results of the study could be related to the beneficial effects of dexmedetomidine or the hazardous effects of benzodiazepines. the possible favorable effects of dexmedetomidine include the inhibition of apoptosis and reductions in the sepsis - associated inflammatory response.66 in the brain, dexmedetomidine has been shown to decrease apoptosis by binding to 2-receptors,67 which may explain the reduction in symptoms of delirium in septic individuals. until additional evidence is available, dexmedetomidine is preferred over benzodiazepines when sedation is necessary for patients with sae. its pathophysiology is complex and involves hemodynamic and inflammatory features that are not completely understood. therapy choices are limited and are mainly based on symptom control. although therapy with antipsychotics is the mainstay of treatment for symptomatic patients for extended periods of time, there are limited data regarding the efficacy and safety of these drugs when administered to septic patients. the other forms of sae, including pre and leukoencephalopathy, have not been thoroughly studied. furthermore, little is known about the natural history of the disease and the actual impact on quality of life after a critical illness. the brain may be affected in sepsis, similar to any other organ, but with many unique effects. therefore, efforts should be made to understand the multiple clinical presentations and pathophysiology of sae to target therapies toward the mechanistic pathways of the disorder rather than to merely control the symptoms of sae. | sepsis is a major cause of mortality and morbidity in intensive care units. organ dysfunction is triggered by inflammatory insults and tissue hypoperfusion. the brain plays a pivotal role in sepsis, acting as both a mediator of the immune response and a target for the pathologic process. the measurement of brain dysfunction is difficult because there are no specific biomarkers of neuronal injury, and bedside evaluation of cognitive performance is difficult in an intensive care unit. although sepsis - associated encephalopathy was described decades ago, it has only recently been subjected to scientific scrutiny and is not yet completely understood. the pathophysiology of sepsis - associated encephalopathy involves direct cellular damage to the brain, mitochondrial and endothelial dysfunction and disturbances in neurotransmission. this review describes the most recent findings in the pathophysiology, diagnosis, and management of sepsis - associated encephalopathy and focuses on its many presentations. |
dipeptidyl peptidase4 (dpp4) inhibitors belong to a novel class of antidiabetic agents that increase the incretin hormones, glucagonlike peptide1 (glp1) and glucosedependent insulinotropic polypeptide (gip). sitagliptin is the first dpp4 inhibitor in japan, where it has been available for approximately 2 years. the oral diabetes drugs that were available for clinical use before this were sulfonylureas, biguanides, thiazolidines, glucosidase inhibitors (gi) and glinides. however, blood glucose can not actually be well controlled in many type 2 diabetes patients with these drugs, and improved glycemic control in a greater number of diabetic patients is anticipated with sitagliptin, given its novel mechanism of action. japanese people have genetically low insulin secretory capacity, and sulfonylurea drugs are the most commonly used drug therapy for type 2 diabetes. in monotherapy, sitagliptin is expected to be effective for a wide range of diabetes patients, as well as cases of secondary sulfonylurea failure, but there are currently no reported results on the efficacy and safety of sitagliptin in large numbers of patients in actual clinical practice. the study group of the diabetes committee has carried out several observational studies in kanagawa, such as looking at the prevalence of diabetic complications (neuropathy and nephropathy). our committee carried out a retrospective, observational study of sitagliptin, which was given to type 2 diabetes patients in the community by the diabetes specialists of our committee. a largescale analysis of the efficacy and safety of sitagliptin monotherapy and combination therapy for 12 weeks in actual clinical practice, in which the primary outcome was glycated hemoglobin (hba1c), is reported. the survey participants were type 2 diabetes patients receiving outpatient treatment at 28 hospitals or clinics specializing in diabetes belonging to the diabetes committee of the kanagawa physicians association from december 2009 to august 2010. oral consent for participation in the present study was obtained from type 2 diabetes patients who were using diet and exercise therapy, and from patients with insufficient glycemic control despite the use of hypoglycemic agents. sitagliptin monotherapy or sitagliptin in addition to other drugs was then given, starting at a dose of 25 mg or 50 mg. if good glycemic control was not obtained after this, the sitagliptin dose could be increased to 100 mg. the monotherapy group (n = 110) enrolled drugnaive patients who were given sitagliptin when glycemic control was inadequate on diet and exercise therapy, and the combination therapy group (n = 631) enrolled patients who were given sitagliptin in addition to the previously prescribed medications when other oral medications were insufficient. in order to evaluate the efficacy of sitagliptin without the effects of discontinuation of conventional drugs, those in whom one or more conventional antidiabetes drugs were discontinued at the start of sitagliptin were not enrolled. the present study was an observational study that aimed to evaluate the efficacy and adverse events of sitagliptin, and approval was obtained from the ethics review board of the kanagawa physicians association. the patients baseline characteristics were as follows : monotherapy group, n = 110 (64 men, 46 women), mean age 63.4 11.8 years, duration of diabetes 8.2 6.4 years and body mass index (bmi) 23.84 4.36 kg / m ; and combination therapy group n = 631 (360 men, 271 women), mean age 63.4 11.2 years, duration of diabetes 12.8 8.2 years and bmi 24.85 4.35 kg / m. in these combined 741 patients (424 men, 317 women, mean age 63.4 11.3 years, duration of diabetes 12.1 8.1 years, bmi 24.70 4.37 kg / m), hba1c, the primary outcome measure, was measured at the start, and after 4 and 12 weeks of sitagliptin therapy. hba1c, expressed in national glycohemoglobin standardization program (ngsp) unitsequivalent value, was measured by highperformance liquid chromatography. coadministered drugs in the combination therapy group were analyzed (figure 1), and the numbers of patients taking sulfonylureas, biguanides, pioglitazone, gi and glinides were 508, 379, 179, 73 and 37, respectively. of 508 patients (297 men, 211 women, mean age 64.3 10.7 years, duration of diabetes 13.8 8.2 years, bmi 24.50 4.30 kg / m) using sulfonylureas, the dose of sulfonylurea was reduced at the start of sitagliptin in 66 patients and not reduced in 442 patients. in both the reduced and nonreduced sulfonylurea dose groups, hba1c was analyzed at baseline and after 4 and 12 weeks, and bodyweight was analyzed at baseline and after 12 weeks. to identify factors contributing to the achievement of hba1c < 7.0% and factors contributing to responsiveness to sitagliptin treatment after administration of sitagliptin for 12 weeks, logistic regression analyses were carried out for age at baseline, sex, duration of diabetes, baseline bmi, baseline hba1c and whether hba1c < 7.0% was reached after 12 weeks or whether hba1c after12 weeks was decreased from the baseline value. unresponsiveness to sitagliptin treatment was defined as hba1c after 12 weeks equal to or higher than baseline hba1c. all analyses were carried out using spss version 19 for windows (spss, chicago, il, usa). statistical analysis comparing the baseline characteristics of the responsive and unresponsive groups was carried out using the mann the patients baseline characteristics were as follows : monotherapy group, n = 110 (64 men, 46 women), mean age 63.4 11.8 years, duration of diabetes 8.2 6.4 years and body mass index (bmi) 23.84 4.36 kg / m ; and combination therapy group n = 631 (360 men, 271 women), mean age 63.4 11.2 years, duration of diabetes 12.8 8.2 years and bmi 24.85 4.35 kg / m. in these combined 741 patients (424 men, 317 women, mean age 63.4 11.3 years, duration of diabetes 12.1 8.1 years, bmi 24.70 4.37 kg / m), hba1c, the primary outcome measure, was measured at the start, and after 4 and 12 weeks of sitagliptin therapy. hba1c, expressed in national glycohemoglobin standardization program (ngsp) unitsequivalent value, was measured by highperformance liquid chromatography. coadministered drugs in the combination therapy group were analyzed (figure 1), and the numbers of patients taking sulfonylureas, biguanides, pioglitazone, gi and glinides were 508, 379, 179, 73 and 37, respectively. of 508 patients (297 men, 211 women, mean age 64.3 10.7 years, duration of diabetes 13.8 8.2 years, bmi 24.50 4.30 kg / m) using sulfonylureas, the dose of sulfonylurea was reduced at the start of sitagliptin in 66 patients and not reduced in 442 patients. in both the reduced and nonreduced sulfonylurea dose groups, hba1c was analyzed at baseline and after 4 and 12 weeks, and bodyweight was analyzed at baseline and after 12 weeks. to identify factors contributing to the achievement of hba1c < 7.0% and factors contributing to responsiveness to sitagliptin treatment after administration of sitagliptin for 12 weeks, logistic regression analyses were carried out for age at baseline, sex, duration of diabetes, baseline bmi, baseline hba1c and whether hba1c < 7.0% was reached after 12 weeks or whether hba1c after12 weeks was decreased from the baseline value. unresponsiveness to sitagliptin treatment was defined as hba1c after 12 weeks equal to or higher than baseline hba1c. all analyses were carried out using spss version 19 for windows (spss, chicago, il, usa). statistical analysis comparing the baseline characteristics of the responsive and unresponsive groups was carried out using the mann the analysis included 741 patients, 110 patients who received sitagliptin monotherapy and 631 patients who received combination therapy. most patients in the combination therapy group had either two coadministered drugs (33.9%) or one coadministered drug (33.6%), followed by three (15.5%) and four coadministered drugs (2.2%). the most common coadministered drugs were sulfonylureas (80.5% of the combination therapy group). more than half (60.1%) also used biguanides, followed by pioglitazone (28.4%), gi (11.6%) and glinides (5.9%). in the monotherapy and combination therapy groups, hba1c was 7.88 1.54% and 8.07 1.06%, respectively, at the start of sitagliptin, decreasing significantly to 7.59 1.20% (p < 0.01 vs baseline) and 7.71 0.97% (p < 0.01 vs baseline) after 4 weeks and 7.09 0.71% (p < 0.01 vs baseline or 4 weeks) and 7.31 0.88% (p < 0.01 vs baseline or 4 weeks) after 12 weeks (table 1). the decrease in hba1c from baseline to 12 weeks (hba1c 012 weeks) was 0.79 1.33% points and 0.76 0.77% points, respectively. the results of an analysis that was stratified on the basis of the baseline hba1c showed that hba1c 012 weeks was 1.45 1.21% points in the 8.5% group, 0.65 0.52% points in the 7.5% to < 8.5% group, and 0.34 0.44% points in the < 7.5% group. hba1c 012 weeks was larger in patients with higher baseline hba1c (figure 2a). anova : vs baseline p < 0.01, vs 4 weeks p < 0.01. (a) change in hba1c between 0 and 12 weeks ; (b) proportion of patients with hba1c < 7.0% at 12 weeks. in all patients, the monotherapy group and the combination therapy group, the blood glucose treatment target of hba1c < 7% was achieved at rates of 39.1, 44.5 and 38.2%, respectively. in all groups, a logistic regression analysis of all patients was carried out to identify factors that affect the achievement of hba1c < 7%. the results showed that the strongest factor was hba1c at the start of sitagliptin therapy, whereas baseline bmi and duration of diabetes were also significant (higher rates of patients with lower basal bmi or with shorter duration of diabetes are expected to achieve the target ; table 2). no correlation was seen for age, sex or whether the therapy was monotherapy or combination therapy. individual differences in the glucoselowering effects of sitagliptin were observed in the present study, and 82 patients (11%) were unresponsive to 12 weeks treatment with this drug. the characteristics of the two groups (659 patients who responded and 82 patients who did not respond to sitagliptin) are shown in table 3. the baseline bmi was significantly higher (p < 0.05) and the baseline hba1c was significantly lower (p < 0.01) in unresponsive patients than in patients who responded to sitagliptin. a logistic regression analysis was also carried out to identify factors contributing to responsiveness to sitagliptin. the results show that baseline hba1c (odds ratio [or ] 2.24, 95% confidence interval [ci ] 1.573.20, p < 0.01) and baseline bmi (or 0.91, 95% ci 0.860.97, p < 0.05) were significant factors. bmi, body mass index ; hba1c, glycated hemoglobin ; ns, not significant. sulfonylurea dosage was analyzed in the 508 combination therapy group patients, and the dosage trends for each sulfonylurea drug are shown in table 4. it was found that the dose decreased with time, even during the treatment course of up to 12 weeks. administration of sulfonylurea drugs was discontinued in 18 patients during the 12 weeks (glimepiride 12 patients, glibenclamide 4 patients and gliclazide 2 patients). it was found that the sulfonylurea dose was reduced at the start of sitagliptin therapy in 66 patients (13.0%). both the 66 patients in the reduced dose group and the other 442 patients in the nonreduced dose group showed significantly lower hba1c levels, from 7.97 0.77% to 8.11 1.08% at baseline to 7.31 0.76% (p < 0.01) and 7.38 0.92% (p < 0.01) at 12 weeks, respectively. the respective hba1c 012 weeks values were 0.65 0.67% points and 0.73 0.77% points. no significant difference in bodyweight was seen between baseline and 12 weeks in the nonreduced dose group, but a significant difference (p < 0.05) was seen between bodyweight at baseline (62.15 15.00 kg) and after 12 weeks (61.75 14.86 kg) in the reduced dose group (table 5). hypoglycemia occurred in 24 patients using sulfonylureas (glimepiride 16 patients, glibenclamide 8 patients and gliclazide 0 patients). all cases were mild, and the dose of sulfonylurea drugs was decreased after the occurrence of hypoglycemia in 20 patients, but there were no cases in which the administration of sitagliptin was discontinued. gastrointestinal adverse events included constipation (n = 3) and abdominal bloating (n = 1) ; dizziness (n = 4), eczema (n = 1) and edema (n = 1) were also reported. four patients dropped out because of adverse events : constipation (n = 1), eczema (n = 1) and dizziness (n = 2). in these patients, all symptoms improved after sitagliptin was discontinued. dpp4 inhibitors have a novel mechanism of action, and their efficacy and safety in monotherapy or combination therapy with conventional oral diabetes drugs have not yet been reported in large numbers of patients in actual clinical settings. in the present observational study of japanese type 2 diabetes patients receiving sitagliptin, a very large number of patients (741 patients) was enrolled. the analyses included 110 monotherapy patients and 631 combination therapy patients at 3 months after the start of sitagliptin. it was found that, in the combination therapy group, sitagliptin was used together with a wide range of 14 other drugs. sulfonylurea drugs were the most common coadministered drugs, used in approximately 80% of cases. in recent results for type 2 diabetes patients being treated by diabetes specialists in japan, sulfonylurea was used in more than 60% of patients treated with oral drugs. the accumulated results for coadministered drugs in the present study are thought to reflect this state of oral drug use in japan. in the current patient group, hba1c decreased significantly in both the sitagliptin monotherapy and combination therapy groups after administration for 12 weeks, whereas hba1c 012 weeks was 0.79 1.33% points and 0.76 0.77% points, respectively. the glycemic control target is a hba1c of < 7% to prevent diabetic complications, and with the administration of sitagliptin, this target was achieved in 39.1% of all 741 patients after administration for 12 weeks. in a metaanalysis of sitagliptin, the hba1c < 7% achievement rate was reported to be approximately 40%, similar to the results in the present study. in actual clinical practice, glycemic control is attempted with various drug combinations depending on the patient s condition and other factors, and sitagliptin was shown to be efficacious even in these various combinations. the effect of sitagliptin is also known to vary greatly among individuals. in the present study, therefore, with the aim of identifying factors that contribute to achieving the target of hba1c < 7%, a regression analysis was carried out in which the dependent variable was whether the target hba1c of < 7% had been reached at 12 weeks, and the explanatory variables were patient background and baseline hba1c. three factors were found to have significant effects : (i) baseline hba1c ; (ii) baseline bmi ; and (iii) duration of diabetes. similar to earlier reports, it was also found that patients with a low baseline hba1c were more likely to reach the target hba1c. however, this is the first report to show that patients with low baseline bmi and patients with short duration of diabetes have a higher rate of achieving the target hba1c. the two factors of baseline bmi and duration of diabetes were much weaker than baseline hba1c, but they were identified as significant factors. because these two factors have been shown to affect the hypoglycemic action of sitagliptin, the hypoglycemic characteristics of sitagliptin might also affect the target achievement rate. the characteristics of the glucoselowering effects of sitagliptin were also examined in the patients who were responsive and those who were unresponsive to sitagliptin treatment. overall, 11% of patients were unresponsive to sitagliptin, and the baseline bmi was significantly higher and the baseline hba1c was significantly lower in the unresponsive group than in the responsive group. the subsequent logistic regression analysis showed that these two factors, baseline bmi and hba1c, were significantly related to responsiveness to sitagliptin therapy. although the regulation of incretin systems and the actions of dpp4 inhibitors have been under intensive investigation, they are not fully understood. therefore, the mechanisms by which baseline bmi and duration of diabetes contribute to the efficacy of dpp4 inhibitors are still unknown. interestingly, given that it has been reported that people with low bmi secrete a large amount of glp1, at least some of the contribution of bmi to the efficacy of dpp4 inhibitors can be explained by differences in glp1 secretion. japanese people have genetically low insulin secretion, and sulfonylurea drugs are the most commonly used drugs for the treatment of type 2 diabetes in japan. as the glycemic control of many such patients has not reached the target level, there is much interest in the efficacy of sulfonylurea drugs combined with sitagliptin. the results of the present study show that significant glycemic control improvement was achieved in patients whose glycemic control was inadequate even with therapy centered on sulfonylurea drugs. in addition, an analysis of the trends in sulfonylurea dosage showed that the sulfonylurea dose was greatly decreased compared with before the administration of sitagliptin. thus, it was shown that good glycemic control could be achieved with lower sulfonylurea doses by administering sitagliptin. these results suggest that cell function is actually well activated with combined use of sulfonylurea drugs and dpp4 inhibitors, although the effect of sitagliptin to lower glucagon might also contribute to the reduced sulfonylurea doses. it is coming to be understood that incretin not only promotes the insulin release reaction in cells, but it also stimulates the insulin secretion response through multiple actions, such as promoting adenosine triphosphate generation in mitochondria, and both sulfonylurea and incretin act on exchange protein directly activated by cyclic adenosine monophosphate 2a in cells. therefore, incretin and sulfonylurea are supposed to stimulate insulin secretion in coordinated and synergistic manners, and the present results appear to reflect these stimulatory effects of incretin and sulfonylureas on pancreatic cells. of particular note is that bodyweight was also significantly, even in the short observation period of 12 weeks when the sulfonylurea dose was decreased at the start of sitagliptin therapy. it was shown in the present study that, by reducing the dose of sulfonylurea drugs, with which bodyweight is known to increase over time, and adding dpp4 inhibitors, which have been shown to be neutral with regard to bodyweight, bodyweight decreased in actual treatment cases. as weight gain is an undesirable effect of sulfonylurea therapy, weight loss is thought to be a positive characteristic of the combined use of sulfonylurea drugs and sitagliptin. in an investigation of the safety of combination therapy with sitagliptin and sulfonylurea drugs, the most common adverse event was hypoglycemia, although it was mild in all cases. the dose of sulfonylurea drugs was decreased after the occurrence of hypoglycemia in 20 patients, but there were no cases in which the administration of sitagliptin was discontinued. the present paper has presented the results of an analysis of a very large number of patients receiving sitagliptin monotherapy and combination therapy in actual clinical settings. however, because this was an observational study without control, the results of the present study could include some limitations, such as bias in selecting patients. in addition, because the observational period of the present study was 12 weeks, longerterm investigation about the durability of the efficacy and about the safety of sitagliptin treatment will be required, which is now being carried out. the analysis showed that sitagliptin is widely used in actual treatment, and its efficacy in both monotherapy and combination therapy was shown. in particular, with the addition of sitagliptin in cases when an insufficient effect is obtained with sulfonylurea drug therapy, we can expect not only improved glycemic control, but also a reduction in sulfonylurea dose and decreased bodyweight. this is thought to be a desirable characteristic of dpp4 inhibitor combination therapy, and it will be important to take advantage of this characteristic in diabetes therapy. these results showing the efficacy and safety of sitagliptin will surely be of value to clinical practitioners. | abstract (j diabetes invest, doi : 10.1111/j.20401124.2012.00221.x, 2012) aims / introduction : to determine the efficacy and safety of sitagliptin monotherapy and combination therapy in japanese type 2 diabetes patients after 3 months therapy.materials and methods : a retrospective, observational study of 741 type 2 diabetes patients was carried out ; 110 received sitagliptin monotherapy, and 631 received combination therapy with sitagliptin when other oral medications were insufficient. the primary outcome measure was glycated hemoglobin (hba1c) measured at 0, 4 and 12 weeks of sitagliptin therapy.results : in the monotherapy and combination therapy groups, hba1c decreased significantly after 12 weeks. target hba1c (< 7%) was achieved in 39.1% overall. on logistic regression analysis, baseline hba1c was the strongest contributing factor for achieving target hba1c ; baseline body mass index and duration of diabetes were also significant factors. a total of 82 patients (11%) were unresponsive to sitagliptin. these patients baseline body mass index was significantly higher and their baseline hba1c was significantly lower than those of patients who responded to sitagliptin. the most commonly coadministered drugs were sulfonylureas (508 patients). in these patients, the dose of sulfonylurea decreased with time. in 66 patients whose sulfonylurea dosage was reduced when sitagliptin was started, hba1c and bodyweight decreased significantly after 12 weeks. a total of 24 patients receiving sulfonylureas had mild hypoglycemia, but none discontinued sitagliptin.conclusions : sitagliptin was effective and safe as both monotherapy and combination therapy in japanese type 2 diabetes patients. when sulfonylureas were ineffective, sitagliptin improved glycemic control. in patients whose sulfonylurea dose was reduced at the start of sitagliptin, blood glucose improved and bodyweight decreased after 12 weeks. |
complete decompression and reconstruction of the anterior and middle portions of the spine column are facilitated via anterior surgery, which is important for neurological recovery and reestablishing immediate and permanent spine stability. after subtotal corpectomy, spinal canal could be thoroughly decompressed, and static or expandable cage was then applied for restoration of vertebral height and correction of angular deformity. as anterior surgery became popular, complications were also observed during followups. high rate of cage subsidence was one of the major concerns of this technique, which was reported from 19.6% to 75% in treating thoracolumbar and lumbar pathology, with average usbsidence of 410 mm.12345 it would lead to postoperative pain,6 loss of angular deformity correction7 which caused treatment failure. one of the reasons was higher contact pressure between cage and endplate.8 as healed vertebral body was helpful in sharing load,9 fast healing of burst vertebral body may reduce subsidence rate. although the anterior fusion rate reached about 8090% at final followup, late healing of burst vertebral body still exist.10 this may be due to the destruction of a large portion of vertebral body structure and blood supply during subtotal corpectomy. in the current study, we try to minimize the corpectomy extent and evaluated if a selective corpectomy could improve early fusion rate while avoiding cage subsidence. a biomechanical stable gate - like rectangular cage11 [independent r and d, figure 1 ] was applied for reconstruction after selective corpectomy. the safety of the device has been evaluated and approved by china food and drug administration, and its biomechanical stability also has been proved previously.11 the ability of spinal canal decompression and angular deformity correction was also discussed in this study. photograph showing different sizes of u - cage for reconstructing fractured vertebral bodies along with instrumentation 130 patients of thoracolumbar burst fractures treated by minimal corpectomy, decompression and u cage between january 2009 and december 2010 were included in this study. the hospital ethical committee approved the protocols, and all patients read and signed the consent form. the thoracolumbar injury classification and severity (tlics) system12 was applied at admission to identify eligible patients. plain radiographs, computed tomography (ct) scans, and magnetic resonance images (mris) were done in all cases. the american spinal injury association (asia) impairment scale was used to classify neurological status. inclusion criteria included : (1) one level burst fracture in lumbar region, (2) tlics severity score > 5 points and without disruption of the posterior ligament complex (plc), and (3) neurological deficit due to compression from the anterior direction. exclusion criteria included : (1) age > 60 years, (2) spine deformity or previous fracture or spine surgery, (3) multilevel fracture, (4) compression fracture with intact neurological function, (5) tlics score 0.05). the average height from one level above the fractured vertebrae and below was 85.1 8.4 mm, 100.2 8.4 mm, and 99.8 8.2 mm for preoperative, postoperative, and final followup measurements, respectively. height was significantly recovered immediately after surgery (p 0.05) about 83.3% (100/120) patients had achieved grade i and ii fusion at the 3-month followup, which increased to 98.3% (with 110 achieving grade i fusion) at the 6-month followup. at the end of the followup, 119 patients had grade i fusion, and the other one patient achieved grade ii fusion. no grade iii or iv fusion was observed during the followup period [table 2 ]. ct scan also demonstrated the consistency of bone density and the continuity of the bone trabeculae in and around the cage at the implant - endplate surface and the fractured vertebral body. mri showed no signs of spinal cord edema or hematoma [figure 3 ]. the fusion grade evaluated by x - ray in 3, 6, and 12 months x - ray of dorsolumbar spine anteroposterior (a) and lateral (b) views showing an l1 burst fracture and kyphosis (c) axial ct scan showing retropulsed fragment of l1 burst fracture (d) t2w mid sagittal mri of dorsolumbar spine showing l1 burst fracture and spinal canal compression (e and f) x - ray anteroposterior and lateral views showing cage and implant in situ (g) axial ct scan showing decompression and implant in situ (h) t1w mid sagittal mri showing decompression (i) reconstructed ct image at burst level showing adjacent vertebral bodies, cage and implant device - related complications were not observed at the end of the followup period. one patient developed a superficial postoperative wound infection and was treated by drainage and antibiotics. another patient developed deep venous thrombosis and received thrombolytic therapy to release the pain in her left leg. the mean preoperative, postoperative, and 24-month followup vas values (mean standard deviation) were 78.7 9.9, 56.5 11.7, and 9.4 8.9, respectively, which showed a continuing decline (p 0.05). the average height from one level above the fractured vertebrae and below was 85.1 8.4 mm, 100.2 8.4 mm, and 99.8 8.2 mm for preoperative, postoperative, and final followup measurements, respectively. height was significantly recovered immediately after surgery (p 0.05) about 83.3% (100/120) patients had achieved grade i and ii fusion at the 3-month followup, which increased to 98.3% (with 110 achieving grade i fusion) at the 6-month followup. at the end of the followup, 119 patients had grade i fusion, and the other one patient achieved grade ii fusion. no grade iii or iv fusion was observed during the followup period [table 2 ]. ct scan also demonstrated the consistency of bone density and the continuity of the bone trabeculae in and around the cage at the implant - endplate surface and the fractured vertebral body. the fusion grade evaluated by x - ray in 3, 6, and 12 months x - ray of dorsolumbar spine anteroposterior (a) and lateral (b) views showing an l1 burst fracture and kyphosis (c) axial ct scan showing retropulsed fragment of l1 burst fracture (d) t2w mid sagittal mri of dorsolumbar spine showing l1 burst fracture and spinal canal compression (e and f) x - ray anteroposterior and lateral views showing cage and implant in situ (g) axial ct scan showing decompression and implant in situ (h) t1w mid sagittal mri showing decompression (i) reconstructed ct image at burst level showing adjacent vertebral bodies, cage and implant one patient developed a superficial postoperative wound infection and was treated by drainage and antibiotics. another patient developed deep venous thrombosis and received thrombolytic therapy to release the pain in her left leg. the current study demonstrated satisfactory results of selective corpectomy when treating lumbar burst fractures. compared to the subtotal corpectomy, the decompression effectiveness was same while the fusion effectiveness improved. the lka was significantly corrected from 19.2 13.4 preoperatively to 2.2 11.4 postoperatively, with average of 17 correction, which was similar to previous reports (average correction angle ranged from 5.4 to 20.7).21617 although the basic procedure of selective corpectomy was similar as previous subtotal corpectomy, the section of vertebral body in selective corpectomy was smaller. only one - third part of posterior vertebral body was destroyed during the anterior decompression procedure, which may lead to different treatment effect of anterior surgery. the previous study has proved the biomechanical stability of the u - cage.11 after the u - cage reconstruction, the burst vertebral body was found to be equivalent to intact bone in all directions except for left rotation. all 6 specimens could withstand the 200 cyclic tests in all directions, and no subsidence or loosening of the device was detected. average peak load for the instrumented specimens was 4137.5 n. in the current study, burst level fusion reached 83.3% at 3 months after surgery and 98.3% at 6 months, which is suggestive of early and excellent fusion. according to the previous anterior surgery study,1318 the average fusion time was about 4.5 months. however, they have not clearly mentioned the exact fusion rate during their followup period which made it hard to compare with our results. burst level stability is one of the predominant influences for effective fusion.19 apart from stable fixation, the corpectomy extent also influences its biomechanical stability. in the study of schmoelz.,20 partial corpectomy achieved better biomechanical stability compared to the complete corpectomy, which could explain current results. as more vertebral body was reserved, a more stable environment for bone fusion was achieved in the selective corpectomy, which may lead to the better fusion effect. second, the selective corpectomy provided more bone structure and blood supply for fusion. those saved burst vertebral body could act as an autograft with endogenous blood supply, which promotes a better and faster vertebral body healing. in the meantime, as bone defect became smaller with selective corpectomy, less healing time was needed, which has been proved by the previous research.21 the gate - like rectangular cage used in the selective corpectomy is also beneficial to fusion. previous studies have shown the average subsidence was 410 mm,45 whereas in our study, the subsidence was < 1 mm. compared to the round titanium cage, it allowed not only bone implant inside the cage but also in front of the cage. in the current study, the amount of bone implantation in the burst vertebral body and adjacent disc spaces was larger. this was considered to be safe as the gate - like design could help avoid grafted bone dropping into spinal canal. solid fusion was supposed to occur both inside and outside the rectangular cage, which would provide better fusion effect observed in the selective corpectomy. early fusion has been proved to reduce cage subsidence in selective corpectomy in the current study. a previous study has confirmed that successful bony fusion could achieve near physiologic stress distribution pattern in the lumbar interbody fusion,9 and we hypothesize that bony fusion also affects the load transfer between cage and endplate. the fused vertebral body may become dominant in sharing axial loads again at an early stage and reducing the cage - endplate contact stress, which leads to the lower subsidence rate in the current study. the cage design may be another reason to explain lower subsidence rate.22 recently, rectangular footplate designed cage has been observed to have more subsidence resistance,2324 and biomechanical studies have confirmed that peripheral part of endplate could afford more load compression than central.2425 similar to these researches, the rectangular cage applied in the study also rested more on the stronger peripheral area, which could be another reason for a less subsidence rate. besides better fusion effect and less subsidence rate, selective corpectomy, and rectangular cage reconstruction can achieve satisfactory decompression and kyphosis correction. by conducting selective corpectomy, the operation time was saved, and neurological recovery was similar as traditional subtotal corpectomy. this indicates that the extent of corpectomy has no relationship with decompression effect. by resecting posterior one - third part of the vertebral body, the surgeons could gain enough space for removing the compressed bone fragments and in the meantime, minimizing the trauma during operation. the kyphosis was corrected and maintained in the last followup, which has further verified the effectiveness of rectangular cage reconstruction. although the selective corpectomy may have some advantage than subtotal corpectomy, we noticed that it could only be used in treating burst fractures. diseases such as spinal tumors or tuberculosis were not suitable for selective corpectomy, as preservation of the vertebral body may facilitate disease recurrence. selective corpectomy and rectangular cage reconstruction may be a good option for treating lumbar burst fracture as it could improve effective fusion and decrease cage subsidence rate. | background : subsidence and late fusion are commonly observed in anterior subtotal corpectomy and reconstruction for treating thoracolumbar burst fractures. the subsidence rate of this surgical method was reported from 19.6% to 75% in the literatures, which would cause treatment failure. thus, an improvement of anterior surgery technique should be studied to reduce these complications.materials and methods:130 patients of thoracolumbar burst fractures treated by minimal corpectomy, decompression and u cage, between january 2009 and december 2010 were included in this study. the hospital ethical committee approved the protocols. the american spinal injury association (asia) scale, visual analog scales, and oswestry disability index (odi) scores were used for clinical evaluation. the local kyphosis angle, vertebral height (one level above the fractured vertebral to one level below), canal stenosis, and fusion status were used to assess radiological outcome. all complications and demographic data such as number of male / female patients, average age, mode of trauma, burst level involved, mean surgery time and blood lost were reported.results:120 patients were followed up for 24 months. most patients had improvement of at least 1 asia grade, and all experienced pain reduction. the mean odi score steadily decreased after the surgery (p 0.05). the average canal stenosis index was increased from 39% to 99% after surgery. no cage subsidence or implant failure was observed.conclusions:the clinical outcomes described here suggest that the selective corpectomy and rectangular cage reconstruction can effectively promote solid fusion and eliminate complications related to subsidence or implant failure. |
abdominal obesity, characterized by preferential accumulation of intra - abdominal adipose tissue (iat), contributes to cardiovascular and metabolic risk beyond the risk defined by body mass index [1, 2 ] thus, prevention of abdominal obesity is key to reducing cardiometabolic risk. preferential iat accumulation, as measured by iat adjusted for percent body fat or iat to subcutaneous abdominal adipose tissue (sat) ratio, depends on genetic factors (e.g., ethnicity or gender), smoking, and the hormonal milieu (e.g., postmenopausal status) [5, 6 ]. the iat compartment is highly active during changes in balance between energy intake (food consumption) and energy expenditure (physical activity). rapid iat accumulation occurs in acute overfeeding experiments, and preferential reduction of iat volume is characteristic of immediate and acute weight loss, but mitigated after 1214 weeks of intervention. we have shown that lack of regular moderate physical activity (not meeting physical activity guidelines for healthy adults) is associated with preferential iat accumulation in midlife women, independent of age, menopausal status, income, smoking, and percent body fat, suggesting that a sustained change in lifestyle may affect preferential iat accumulation. however, physical activity may not be the only lifestyle target for preventing iat accumulation. although energy intake is linked to iat in laboratory studies, no population - based studies have been conducted and no studies have determined whether or not energy intake is associated with preferential iat accumulation, independently of physical activity. moreover, there have been no studies that examined whether these relationships are moderated by ethnicity or menopausal status in midlife women. answers to these questions are important because they can inform the design of lifestyle interventions aimed at decreasing cardiometabolic risk by decreasing preferential accumulation of iat in midlife women. participants were women who enrolled in an ancillary study of the study of women 's health across the nation (swan) at the chicago site. this ancillary study, the swan fat patterning study, was designed to investigate the impact of the menopausal transition on iat accumulation. swan is a seven - site, multiethnic longitudinal study of women transitioning through menopause, featuring ongoing annual evaluations. at enrollment into the swan, between 1996 and 1997, eligible women were 4252 years old, reported a menstrual period within the past 3 months, did not use medications known to affect pituitary or ovarian function, and did not use exogenous hormones within the 3 months preceding the baseline interview. a unique feature of the chicago swan site was that it used a population - based recruitment strategy, drawing on a complete community census, to recruit a representative sample of caucasian and african american women in which the confound between ethnicity and socioeconomic status was minimized. women enrolled in the chicago swan fat patterning study between august 2002 and december 2005, coincident with annual swan follow - up visits 4 through 9. eligible women did not have diabetes, chronic liver or kidney disease, substance abuse or eating disorders, were not pregnant, had no breast or joint implants, and weighed less than 300 pounds. of the 386 eligible chicago swan participants, 297 (77%) enrolled in this swan fat patterning study, and they did not differ from the remaining women in any of the baseline characteristics. four were excluded from analytical sample because of hysterectomy (due to difficulty assessing natural menopause), four were excluded due to diabetes (as diabetes and treatment for diabetes contribute to iat accumulation), two were excluded because they did not have an iat measurement, and 30 (10%) were excluded because they were receiving menopausal hormone therapy (as estrogen and progesterone use may potentially affect appetite, adipose tissue accumulation, and distribution). the final analytic cohort of eligible women, which consisted of 257 women, represented 86% of the original 297 participants. iat and subcutaneous abdominal adipose tissue (sat) were assessed by a computerized tomography (ct) scan of the abdomen using a general electric lightspeed vct scanner (general electric medical systems, milwaukee, wi) at the l4-l5 intervertebral space in a single 10 mm thick image. scanned images were analyzed at the university of colorado health sciences center using their software (rsi, boulder, co), as described previously [5, 6 ]. a relative index of iat accumulation was calculated as a ratio of iat to sat. percent body fat (%) was calculated as total body fat mass/(total body fat mass + total lean body mass) 100. total body fat mass (in kilograms) was assessed the same day as iat by dual - energy x - ray absorptiometry, using a general electric lunar prodigy scanner (ge - lunar, madison, wi), and analyzed using encore software (ge - lunar), as described previously. energy intake was self - reported. at baseline, year 5, and year 9 annual visits, women completed a modified version of the 1995 block interviewer - assisted semiquantitative food frequency questionnaire. individual energy intake per day was calculated using dietsys software (http://appliedresearch.cancer.gov/dietsys/software.html). pearson correlations between initial measures with repeated measures of ffq energy intake were 0.70, and the coefficient of variation was 2.7%. measurement error that occurs when assessing person 's usual diet with a food frequency questionnaire generally involves bias related to true intake in addition to random variation. bias related to true intake often occurs as the flattened - slope phenomenon (consumers with high levels of intake tend to underreport and low - level consumers tend to overreport), which biases the beta - coefficient upward. energy intake is derived from the food frequency questionnaire, and thus subject to measurement error. because biomarker validation studies were not performed in swan, we adjusted energy intake, using factors previously shown in other studies using biomarkers to correct for measurement error : income, ethnicity, age, physical activity, and a measure of body size. we did not use exact regression coefficients derived from other studies, as the patient population and food frequency questionnaire differed in our study. it was administered at the swan follow - up visits 3, 5, 6, and 9. the assessment selected for analysis was the one that was closest to the adipose tissue assessment, as described previously. a total activity score was created by summing across kaiser physical activity survey (kpas) domains (sports / exercise, active living habits, housework / caregiving), with a higher score indicating higher activity, as described previously. the women were grouped into (a) pre-/perimenopausal (pre-, early peri-, and late perimenopause) and (b) postmenopausal groups. the postmenopausal women had their final menstrual period more than 12 months prior to the iat assessment. height, weight, and waist girth were measured using a standard anthropometric measurement protocol. weight was measured to the nearest 0.1 kg at each annual examination on digital scale while participants stood in stocking feet and light clothing. waist girth was measured annually to the nearest 0.1 cm with a measuring tape placed horizontally around the participant at the narrowest part of the torso, and an average of two measurements was reported. self - administered and interviewer - administered questionnaires were used to assess social, economic, behavioral, psychological, health, and lifestyle characteristics. age (in years) was a variable created as the difference between iat assessment date and self - reported date of birth and modeled continuously in all analyses. participant 's annual household income was classified into three levels : less than $ 50,000, $ 50,000 to $ 75,000, or greater than $ 75,000. data for the principal outcome (iat area) were collected at the baseline of the ancillary swan fat patterning study, which corresponded to swan annual visit 4, 5, or 6, dependent on the timing of recruitment. however, data for the primary predictor variable (energy intake) were collected only at the swan study baseline, visit 5, and visit 9. to handle differences in the timing of assessments of iat and energy intake, we used an interpolation technique for the energy intake variable [18, 19 ]. after checking for linearity of energy intake trends over time, we used a random effects model with random intercept and slope to estimate energy intake over time in the swan study (between baseline, year 5 and year 9). these models yielded participant - specific intercepts and slopes, which were weighted averages of the regression coefficients for the full sample and the regression coefficients from each participant 's data. these slopes were used to estimate energy intake at the time of iat assessment. to assess the performance of these interpolation models, we compared fitted values with observed values from baseline, visit 5, and we ran the pearson correlations between fitted and observed values which produced r = 0.89 (p < 0.0001), indicating a strong agreement. in addition, linear regressions of observed values on fitted values indicated no systematic bias, as intercepts were close to 0 and slopes were close to 1. descriptive statistics were used to summarize the participants ' energy intake, age, ethnicity, income, education, menopausal status, physical activity, smoking, body mass index, waist girth, and other adipose tissue measurements. logarithmic transformation of iat area was used in linear regression models, as this primary outcome did not follow a normal distribution. we employed a series of linear regression models using log - transformed iat as a dependent variable and interpolated energy intake as our primary predictor with adjustments for ethnicity, age, income, percent body fat, menopausal status, smoking, and physical activity. the energy intake was reported in 500 kcal increments and percent body fat was reported in 5% increments in body fat. to adjust for possible nonlinear association between (i) iat and percent body fat and (ii) iat and age, these covariates were entered in the model as both linear and centered quadratic terms. the continuous variables in the model were iat area, percent body fat (and its centered quadratic transformation), age (and its centered quadratic transformation), and physical activity. the categorical variables in the models were income, ethnicity, smoking, and menopausal status. reference groups for these variables were caucasian for ethnicity ; pre-/perimenopause for menopausal status ; and nonsmokers for smoking status. the high - income group was the reference group for the categorical (trichotomous) income variable. model 1 was constructed to evaluate the relationship between energy intake and iat after adjustment for (i) confounders (ethnicity and menopausal status), and (ii) correction factors (age, percent body fat, smoking, and income). model 2 was constructed to evaluate the relationship between energy intake and iat after adjustment for (i) physical activity in addition to covariates used in the first model. model 3 was designed to explore interactions of energy intake with ethnicity and menopausal status, adjusting for the factors in model 2. analogous models 1 through 3 were constructed using iat : sat ratio as a dependent variable to assess the predictors of iat per quantity of sat. to interpret the coefficients from the linear model, we estimated the percentage change in the average value of iat area per unit increase in energy intake multiplied by 100 (100). all analyses were conducted using sas, pc version 9.2 (sas institute inc., cary, nc). 48% (n = 123) were african american and 52% (n = 134) were caucasian. fifty - three percent had an annual household income above $ 75,000, and 61% had a college education or higher degree. at the time of iat assessments, women were on average 52 years old (ranging from 47 to 61), 46% were obese (body mass index (bmi) 30.0 kg / m), and 30% were overweight (bmi = 25.029.9 kg/ m). forty - nine percent (n = 125) were postmenopausal, and the remaining participants were pre- or perimenopausal. participants ' self - reported energy intake corresponding to the respective swan fat patterning study visit was an average of 1608 470 kcal/24 h. table 2, model 1 shows that self - reported energy intake was associated with preferential iat accumulation : every 500 calories of energy intake were related to a 6% higher iat (p = 0.025), after adjustment for ethnicity, menopausal status, smoking, income, age, and percent body fat. table 2, model 2 shows that both energy intake and physical activity contributed independently to iat. the addition of physical activity into the model did not weaken the association between energy intake and iat. table 2, model 3 shows a significant interaction between self - reported energy intake and ethnicity (p = 0.02). as depicted in figure 1, the association between energy intake and preferential iat accumulation was considerably stronger in caucasian women compared to african american women. the relationship between energy intake and iat was not significantly moderated by physical activity or menopausal status. an alternative approach to explore preferential iat accumulation is to use the ratio iat : sat as the outcome. this is a relative index of iat accumulation, which is associated with higher cardiometabolic risk. table 3 contains models 1, 2, and 3 with iat : sat ratio as a dependent variable. the results are virtually identical to those obtained using iat as the outcome. however, the model for iat : sat ratio explains less of the variance, as indicated by r. in models with sat as a dependent variable (not shown), energy intake did not have an independent contribution to sat accumulation beyond that explained by percent body fat. this finding is not surprising, as sat correlated very closely with percent body fat (pearson correlation r = 0.88, p <.0001). our principal finding was that self - reported energy intake was associated with higher iat in this diverse and well - defined, naturalistic, community - based cohort of women undergoing the menopausal transition. this relationship of energy intake and iat was independent of self - reported physical activity and menopausal status and was stronger in caucasian than in african american women. however, further studies are needed to explore the allometric relationships between iat and body size in weight gain. however, during positive energy balance iat is hypothesized to be a secondary fat storage pool that accumulates only after subcutaneous stores are full. our cross - sectional data suggest preferential iat accumulation at higher self - reported caloric intake in mid - life women. this finding should be confirmed in longitudinal explorations of the allometric relationship between iat and body fat. to our knowledge, this is the first study in a naturalistic community - based cohort to analyze the joint associations of self - reported energy intake and physical activity with preferential iat accumulation. our current findings extend the previous work conducted by our group demonstrating that that regular moderate physical activity (meeting physical activity guidelines for healthy adults) was associated with lower iat area in midlife women, independent of total adiposity. although exercise has been regarded as a specific therapy to reduce iat accumulation, our findings suggest that lower energy intake also has significant independent protective effects on preferential iat deposition beyond those of physical activity, and these effects are independent of total adiposity. higher self - reported energy intake is related to iat to sat ratio higher at all body sizes in mid - life women. thus, excess energy appears to be preferentially partitioned into intra - abdominal rather than subcutaneous abdominal area at all body sizes. although, caucasian women have more iat adjusted for percent body fat than african american women [20, 2628 ], over the past 10 years, the largest increase in abdominal obesity occurred in the african american population. the association between self - reported energy intake and iat appears stronger in caucasian than in african american women. during energy intake restriction, caucasian women tend to lose more iat than african american women, however, the differences disappear after adjustment for baseline iat or the amount of total fat lost [30, 31 ]. the quantitative differences in energy intake do not explain why african american women partition proportionally less fat into the iat compartment. these ethnic differences in the association between self - reported energy intake and iat can be a result of differential reporting bias among caucasian and african american women. since the problem of abdominal obesity may be growing more extreme for african american women, it is urgent to determine factors associated with this increasing risk. the findings in our study are congruent with a recently published small longitudinal study suggesting preferential iat increase related to menopause in caucasian women. however, longitudinal study of african american women suggested that the greatest iat accumulation occurs during young adulthood ; no significant 5-year iat change was observed in women between ages 50 to 69. the strength of our study is that the women were studied in their naturalistic, community - based environment, they were demographically similar, and their menopausal status was well defined. unlike the majority of previous studies exploring correlates of iat distribution [26, 27, 3437 ], we adjusted our multivariable models for income. a limitation of our study is the lack of longitudinal followup of iat, which would clarify the effects of menopause on iat accumulation and factors associated with iat gain during the menopausal transition. measurement error, a result of self - reporting energy intake without biomarker validation for the food frequency questionnaire, may have affected the association between energy intake and iat. we made our best effort to adjust the energy intake, derived from the food frequency questionnaire, using factors previously shown to correct for the measurement error : relative body fat mass, ethnicity, age, physical activity, smoking, and annual income. since measurements error biases toward the null hypothesis, and since these data show strong and significant associations for energy intake, measurement error is unlikely to be a serious problem in this report. in summary, higher self - reported energy intake in mid - life women was associated with preferential compartmentalization of fat into the iat depot, particularly for caucasian women. a longitudinal follow - up study is needed to explore the allometric relationship between iat and body fat, as well as the effects of diet quality (such as macronutrient composition), socioeconomic and lifestyle risk factors, menopause, insulin resistance, and other atherosclerosis risk markers on increases in iat, particularly in african american women. | we have previously shown that physical activity predicts intra - abdominal adipose tissue (iat), but it is unknown whether energy intake predicts iat independently of physical activity in a community - based, naturalistic environment. the association of energy intake with iat was explored cross - sectionally in women, recruited between 2002 and 2005 for a study of fat patterning in midlife. iat at l4-l5 vertebral interspace was assessed by computed tomography, energy intake by the block food frequency questionnaire, and physical activity by the kaiser physical activity survey. linear regression models were used for the principal analyses. among the 257 women, 48% were african american and 52% were caucasian. women were 52 3 years old, and 49% were postmenopausal. every 500 kcal increase in energy intake was associated with a 6% higher iat (p = 0.02), independent of physical activity (p = 0.02), after adjustment for ethnicity, menopausal status, age, smoking, income, and dxa - assessed percent body fat. energy intake had a significant interaction with ethnicity (p = 0.02), but not with physical activity. models using the iat to subcutaneous abdominal adipose tissue ratio as an outcome had similar associations. in conclusion, self - reported ei was associated with preferential iat accumulation in midlife women, independent of physical activity. this association was significantly stronger in caucasian than african american women. future longitudinal studies are needed to explore lifestyle predictors of iat accumulation during the menopausal transition. |
primary carcinoma of the extrahepatic bile duct is a rare tumor that represents less than 1.0% of all malignant neoplasms and less than 3.0% of all the tumors of the gastrointestinal system1). most malignant tumors generated in the biliary tract are adenocarcinomas, and adenosquamous carcinoma is rare (3.0~4.7%). adenosquamous carcinoma consists of two malignant components : one is glandular and the other squamous2, 3). in one previous report on patients with extrahepatic adenosquamous carcinoma of the biliary tract, patients were treated with surgical resection. the overall 1-year, 3-year and 5-year survival rates were 57%, 26% and 16%, respectively, and the median survival was 13 months2). when used for the management of advanced cholangiocarcinoma, adjuvant external beam radiotherapy (ebrt) followed by surgical resection with or without intraluminal radiotherapy (ilrt) is feasible, but the effect of radio - therapy alone has not been established4). in korea, adenosquamous carcinoma of the papilla of vater and the liver has been reported, but there have been no previous reports on adenosquamous carcinoma of klatskin 's tumor5, 6). we report here on a case of a patient with adenosquamous carcinoma of klatskin 's tumor, and this was confirmed by endoscopic biopsy. an 83-yr - old man was admitted to eulji university hospital because of jaundice he had experienced for the past 4 days, and this was preceded by chills and myalgia for the previous week. six months previously, he was operated on for laparascopic cholecystectomy due to acute acalculous cholecystitis with empyema. on admission, his blood pressure was 100/60 mmhg, the heart rate was 66/min, the respiration rate was 20/min and the body temperature was 36.5. he looked acutely ill and showed an alert mentality. his sclera was icteric and he complained of abdominal pain. on physical examination, there was no abdominal tenderness, rebound tenderness or guarding of the abdomen. on the biochemical analysis, the complete blood count was as follows : the white blood cell count was 9,740/l, the hemoglobin level was 13.8 g / dl and the platelet count was 225,000/l. the laboratory data included the following : total serum bilirubin : 11.5 mg / dl, serum glutamic oxaloacetic transaminase : 276 iu / l, serum glutamic pyruvic transaminase : 299 iu / l, alkaline phosphatase : 487 iu / l, serum gamma guanosine triphosphate : 640 iu / l, amylase : 64 u / l, lipase : 61 iu / l, alpha - fetoprotein : 5.1 ng / ml, carcinoembrionic antigen : 1.59 ng / ml and carbohydrate antigen 19 - 9 : 120.62 u / ml. the abdominal computed tomography (ct) revealed enhanced wall thickening of the intrahepatic duct (ihd), the confluent portion and the common hepatic duct (chd), and this was all compatible with klatskin 's tumor. the magnetic resonance cholangiopancreatography (mrcp) revealed luminal stenosis of both the ihd confluent portion and the chd, and dilatation of both ihds. this was again compatible with klatskin 's tumor, bismuth type iiia (figure 2, 3). after percutaneous transhepatic biliary drainage (ptbd) for achieving bile drainage, biopsy was performed via percutaneous transhepatic cholangioscopy (ptcs). an endobiliary y - type stent was inserted via the ptbd of the left ihd (figure 4, 5). the histopathologic findings showed adenosquamous carcinoma that was a mix of adenocarcinoma and squamous cell carcinoma (figure 6, 7). external radiotherapy (22 cycles, total dose : 3,960 cgy) and intraluminal brachytherapy (2 cycles, total dose : 2,000 cgy) were performed through an endobiliary y - type stent. this revealed a dilated internal lumen by the endobiliary y - type stent and superficial necrotized yellowish tissue on the tumor (figure 8). during the monthly follow - up nine months after the radiotherapy, the abdominal ct revealed biliary obstruction and progressive hepatic metastasis. most malignant tumors originating from the biliary tract are adenocarcinomas, but adenosqamous carcinoma is a rare finding, representing less than 5% of all biliary tumors. its clinical characteristics, pathogenesis and the effect of radiotherapy without surgical resection are unknown1). several theories have explained that adenosquamous carcinoma is a mix of adenocarcinoma and squamous cell carcinoma, and this is a malignant epithelial tumor that 's derived from initially benign metaplasia as a result of some chronic inflammatory process. further, squamous cell carcinoma in these unusual sites is more likely to be due to squamous metaplasia of a tumor itself rather than being due to malignant transformation of previously benign metaplastic epithelium1). histologic alteration from adenocarcinoma to squamous cell carcinoma shows that adeno - squamous carcinoma might be a transitional form from adenocarcinoma to squamous cell carcinoma. in addition, some of the primary hepatic squamous cell carcinomas might originate from adenocarcinomas, and this supports the theory of an origin from adenocarcinoma7, 8). although adenosquamous carcinoma of the common bile duct has a different etiology and biologic features compared with adenocarcinoma, the patients with adenosquamous carcinoma are treated in the same manner as that for patients with adenocarcinoma. the median survival is only thirteen months and no optimal postoperative adjuvant therapy has been established. in one previous study on treating patients with inoperable carcinoma of the extrahepatic bile ducts, group 1 underwent ebrt alone and group 2 was treated with ebrt in combination with high - dose - rate ilbt ; the results were then compared. no statistically significant difference was found in the recurrence rates between those who did and did not receive ilbt (53% for group 1 vs. 36% for group 2 ; p>0.05). however, a prolongation of the median time to tumor recurrence was observed for the group 2 patients (5 months for group 1 vs. 9 months for group 2 ; p=0.06)9). on the other hand, reports exist that performing brachytherapy boost was not superior to treatment with external beam irradiation alone10). in another study, there did not seem to be any difference in survival or complications between the low- and high - dose rate brachytherapy11). reported that combined - modality therapy, including external beam radiotherapy, intraluminal irradiation and biliary stenting for extrahepatic bile duct carcinoma provided reasonable local control and improved the quality of life for the patients with extrahepatic bile duct carcinoma. the median survival was twelve months, with 1-, 3- and 5-year actuarial survival rates of 50%, 10% and 4%, respectively12). therefore, the outcomes and survival rate related to radiotherapy have not been established for cases of inoperable extrahepatic bile duct carcinoma with obstructive jaundice. yet it has been recently reported that ilbt with metallic stenting improves the quality of life of extrahepatic bile duct carcinoma patients with obstructive jaundice. the reported mean time of stent patency was 421 days in the group of patient with proximal malignant biliary stricture and mean time of stent patency was 168 days for the group of patients with distal stricture that was impossible to operate on or the patients refused an operation13). so, we expected the period of stent patency to be more than six months for our case of adenosquamous carcinoma. nine months after the therapy, the abdominal ct and laboratory findings showed recurred biliary obstruction. any inoperable cases that were diagnosed by endoscopic biopsy have not yet been reported on because endoscopic biopsy is not generally performed before a treatment decision. thus, the response to radiotherapy, including brachytherapy, and the patency rate of stents in inoperable adenosquamous carcinoma have not been reported. in the future, a reasonable management plan for adenosquamous carcinoma will be established if a sufficiently large number of cases of inoperable adeno - squamous carcinomas are diagnosed by endoscopic biopsy. | most malignant tumors originating from the biliary tract are adenocarcinomas, and adenosqamous carcinoma of klatskin 's tumor is a very rare finding. an 83-yr - old man was admitted to our hospital because of jaundice. the abdominal computed tomography and magnetic resonance cholangiopancreatography revealed wall thickening and luminal stenosis of both the intrahepatic duct confluent portion and the common hepatic duct. these findings were compatible with klatskin 's tumor, bismuth type iii. considering the patient 's old age, palliative combined modality therapy was performed. after percutaneous transhepatic biliary drainage, biopsy was performed via percutaneous transhepatic cholangioscopy. the histopathologic findings showed adenosquamous carcinoma. external radiotherapy and intraluminal brachytherapy through the endobiliary y - type stent were then done. nine months after the radiotherapy, the laboratory findings and the abdominal computed tomography revealed biliary obstruction and progressive hepatic metastasis. the combined modality therapy of external radiotherapy, intraluminal brachytherapy and stenting assisted him to live a normal life until he finally experienced biliary obstruction. |
microwave imaging has received significant attention in the research community during the last couple of decades as a modality that potentially could improve the diagnostics of, for example, breast cancer tumors. today the research has come to the stage where early clinical trials have been and are being performed, [36 ]. the results from the clinical work are promising, but further development of the measurement systems as well as of the image reconstruction algorithms remains before the technique can be considered for daily clinical practice. when performing microwave tomography the aim is to quantitatively reconstruct the dielectric parameters in the region under test. the image reconstruction algorithm utilizes measured data that are compared against a corresponding numerical simulation of the system, and the dielectric profile is iteratively updated based on the difference between the simulation and the measurement. even though this comparison requires a realistic numerical model for the best accuracy, most of the published works have used 2d models together with a calibration procedure to enable the comparison with experimental data. largely, this can be attributed to a significant increase in the computational load when moving from 2d to three - dimensional (3d) modeling. furthermore it is usually not possible to create realistic antenna models in 2d, except for line source antennas. by using a 2d model to solve the inverse scattering problem inaccuracies this problem has been identified by the research community, and, with the ever increasing computational resources available these days, the focus is now more and more turning to solving the full 3d problem. recent works using 3d algorithm have been reported in [711 ]. in this paper we show several examples where images have been reconstructed from scattering data in order to discuss and illustrate the need for accurate modeling of the antenna system and its geometry to enable robust image reconstruction. the aim is also to get an understanding of what accuracy we could realistically expect in the reconstruction and how it is affected by various modeling errors. examples of targets placed in a surrounding of air are studied, and in an effort to approach more biologically relevant settings we have studied examples where the antenna system was entirely immersed in water. our reconstruction algorithm, described in, is based on fdtd modeling to solve the forward scattering problem and the adjoint maxwell 's equations to compute gradients used in an iterative optimization procedure. the theoretical background of our work is described including fdtd methods with the minimization procedure., the forward modeling is investigated, and the corresponding imaging results originating from experimental data are presented and discussed. and finally the conclusions are drawn in section 5. an iterative electromagnetic time - domain inversion algorithm has been used and applied in estimating the dielectric parameters of different test objects. the foundation of the algorithm is an electromagnetic solver based on the fdtd method,, is used to numerically model the antennas and to simulate the field propagation inside the system. the same solver is used to compute the adjoint maxwell problem which is required for the gradient computation in the optimization algorithm. the adjoint field is used extensively elsewhere in various types of inverse problems see, for example, [14, 15 ]. a correspoding 2d version has also been described in detail in [16, 17 ]. our basic idea for solving the inverse electromagnetic problem is to use scattering measurements of wideband pulses for several transmitter / receiver combinations surrounding a region of interest and thereafter to compare the measured data in the time domain with a corresponding numerical simulation of the system. in the first iteration one starts with comparing the measurement with a simulation of an empty antenna system. thus there is a difference between the measured and the simulated data, and this difference is used to update the dielectric properties inside the region of interest. in this way the dielectric distribution is iteratively refined until the desired agreement between the simulated and measured signals has been achieved. the underlying assumption for this approach is that as the difference between the simulated and measured data is decreasing, the reconstruction is also converging. in other words, the aim of the reconstruction procedure is to minimize the objective functional, f, defined as (1)f(,)=0tm=1 m n=1n|emn(,,t)emnm(t)|2dt, where emn(,, t) is the calculated field from the computational model and emn(t) is the corresponding measured data when antenna number m has been used as transmitter and antenna n as receiver. m is the number of transmitters, n is the number of receivers, and t is the duration of the pulse. in a 2d tm - mode formulation only one spatial field component is used in (1), but for the 3d formulation it is necessary to include all three spatial components. in search for the minimum of the objective functional it is differentiated with respect to the dielectric components by a first order perturbation analysis. in this way the frchet derivatives with respect to the conductivity and the permittivity of the functional are used to define gradients, in every grid point, inside the region. the gradients are used with the conjugate - gradient method together with the successive parabolic interpolation line search to minimize the objective functional. the reconstruction procedure is then iterated with the objective functional as a measure to monitor the convergence and to determine when the reconstruction is completed. usually the minimization procedure converges within 1020 iterations. in the 2d simulations it is not possible to construct a realistic antenna model, but the transmitter is only modeled with a hard point source, in which the field strength is prescribed at the source position. at the receiver locations the field values are sampled directly from the corresponding e - field component in the grid. we are using the thin - wire approximation to model the monopoles,, and the rvs with 50 impedance to model the feed at the transmitting, receiving, and inactive antennas, [19, 20 ]. furthermore the ground plane in our experimental system is modeled as a perfect electric conductor ; that is, the corresponding field components in the fdtd grid are set to zero. the walls of the tank have dielectric properties close to those of air and are therefore neglected in the numerical model. outside the antenna system the computational grid is truncated by the cpml absorbing boundary condition implying that the region outside the antenna array is treated as open empty space. in the case where the tank is filled with a liquid it has been modeled as a cubic volume with side lengths equal to the inner measures of the tank and a height equal to the level of the liquid. even in this case we have not modeled the tank material but instead treated everything outside as empty space and terminated the computation domain with cpml. a more detailed discussion and validation of the fdtd antenna array model with a comparison against experimental data measured with the antennas in air can be found in our previous work. as already mentioned the solution of the inverse problem heavily relies on the comparison between the measured and the simulated scattering data. to compensate for systematic modeling errors a calibration procedure of the measured data is used such that (2)ecalm(f)=sscatm(f)srefm(f) erefs(f).sscat is the measured reflection and transmission coefficients of the test object, sref(f) is a reference measurement of an empty system, and eref(f) is a corresponding reference simulation. finally ecal(f) is the calibrated data used for comparing the fdtd simulations in the reconstruction process. this calibration procedure has been applied to the measured data for both the 2d and the 3d imaging examples in this paper. in our experimental prototype the possibility to accurately reconstruct out - of - plane objects is thus very limited : to do so it would be necessary also to make additional measurements outside the antenna plane. to allow imaging with the 3d algorithm of a test object with finite height, we implemented a heuristic pseudo-3d technique that assumed constant properties of the test object as a function of height, z, above the ground plane. the gradients computed in the grid cell plane immediately above the ground plane were copied upwards to the height of the test object. since the reconstruction problem is both nonlinear and ill - posed, the resulting image strongly depends on the adopted regularization technique, the initialization of the reconstruction, and also the spectral content of the pulse. the measurement strategy is to measure the multistatic scattering matrix at a large number of frequencies and to use that data to generate a time - domain pulse via an inverse fourier transformation. in the experimental system 20 monopole antennas, each of length 19.5 mm and diameter 0.8 mm, are arranged evenly distributed on a circle with radius 100 mm. the circle of antennas is centered on a square ground plane with side length 250 mm mounted at the bottom of a tank, made of 1 cm thick perspex sheets with inner measures 350 350 mm. to measure the multistatic matrix each antenna the microwave measurements are made with network analyzer agilent e8362 b pna which is a two - port network analyzer. to fully control the experiment a 2:32 switch multiplexer module, cytec cxm/128-s - w, is used to automatically connect and disconnect the different combinations of antenna pairs to the network analyzer. in our previous publication,, a detailed study was made of the fdtd modeling compared to measured data of an empty system, and the accuracy of the modeling was verified. one of the aims of the present paper is to study how errors in the antenna model, for example, the monopole length, of the fdtd model impact the reconstruction. to do so we study the antenna modeling and image reconstruction both when the tank is empty and when it is filled with water. the reason why it is interesting to study the antenna system immersed in water is that water is a good model for the matching medium that has to be used when applying microwave tomography to imaging the interior of the human body. without a matching medium the majority of the irradiated energy would be reflected from the skin, thereby never penetrating into the body and producing useful data. to enable a quantitative evaluation of the accuracy of the reconstructed images we have adopted the relative squared error of the image, and for the permittivity image it is defined in (3), and analogously for the conductivity image. the integration of the relative squared error is made over the reconstruction domain where r < rrd, (3)=|originalreconstructed|2ds|originalbackground|2ds. with the purpose to study how the reconstructed image is affected by errors in the length of the monopole antenna model, we first studied a single dielectric target in an otherwise empty antenna array. the imaging situation was the same as in our previous publication,, that is, a single target made of sunflower oil surrounded by air. the dielectric properties of the target were r = 2.7 and = 0.015 s / m at 2.3 ghz. it was shaped like a cylinder with diameter 56 mm and height 20 mm and was placed at 14 mm offset in the y direction from the center of the antenna array. it had constant properties along its height in the z direction, and thus it is only necessary to show a cross - sectional slice of the dielectric profile. a cylindrical volume of height 20 mm and radius rrd = 90 mm centered in the antenna array was used as the reconstruction domain together with the pseudo-3d approach described earlier. to investigate the accuracy of the reconstructed image with respect to the modeling the length of the monopoles in the antenna system is 19.5 mm, but images were reconstructed modeling the length as 16, 18, 20, 22, and 24 mm, respectively. this resulted in a change in the computed resonance frequency and the associated signal strength. the reconstruction results together with an illustration of the original dielectric distribution are shown in figure 2. the results obtained with 20 mm monopole length in figures 2(d) and 2(j) are identical to what was published earlier and represent a scenario where the numerical modeling at the given grid size is as close as possible to the experimental system. as a measure of reconstruction accuracy the relative error as defined in (3) has been calculated for each reconstructed image, and it is shown in the figure below the respective reconstruction. the reconstructed object permittivities are on average about r = 2.1, 2.2, 2.4, 2.7, 3.0, respectively, for the various monopole lengths. the minimum value is 12.5% smaller and the maximum value is 25% larger than what was obtained for the 20 mm monopole length. the recontructions of the conductivity are, however, not accurate, but it is clearly evident that the artifacts increase the more the monopole lengths deviate from the real value. the reason why the reconstruction is less accurate is that the difference in the imaginary part of the complex dielectric permittivity between the object and background is only a fraction in comparison with the difference in the real part. reconstruction errors in the real part therefore overwhelm attempts to reconstruct the imaginary part, and consequently the accuracy is reduced. compared to the original dielectric profile, however, the most accurate reconstruction of the permittivity is obtained for the 18 mm monopole. this reflects the deviaton of half a grid cell between the 20 mm antenna model and the precise length of the monopole with the real length being 19.5 mm. but also there is a tolerance in the cutting of the monopoles of about 0.5 mm. numerical uncertainties in the fdtd solution and errors in the dielectric measurement of the sunflower oil are other reasons. in figure 3 the functional values of the reconstructions have been plotted. in all cases firstly these plots illustrate the convergence of the reconstruction process, but it also shows that the lowest functional value was obtained for the reconstruction with the 20 mm monopole. a nice illustration of the ill - posedness of the problem is that the difference between the 20 mm and the 22 mm case is on the verge of being negligible even if the difference in the reconstructed image is certainly not. another conclusion from this result is that a model error in the antenna length of only one grid cell resulted in a considerable change in the reconstructed image. in summary these results clearly show the need of using an accurate antenna length in order to maximize the accuracy of the reconstructed image. in this section we study the situation when the antenna array tank was filled with tap water, having dielectric properties r = 77.5, = 0.05 s / m at 0.5 ghz. we also present a comparison between measured data and corresponding computed reflection and transmission coefficients. by replacing the air in the tank with water we further approach biologically relevant imaging scenarios. with the aim to study how modeling errors affect the reconstructed images we first studied how the forward modeling of the antenna system was affected by different antenna modeling errors. the experimental situation was such that the tank was filled with ordinary tap water up to a level of 50 mm above the ground plane. in the fdtd model measured dielectric values of the water at 0.5 ghz were used as this was in the center of the frequency spectrum used for the imaging. in the fdtd modeling care was also taken to represent the physical reality as accurately as possible, and the corresponding settings are summarized in table 2. unfortunately it is not viable to show scattering data for all antenna combinations, but instead only a few representative cases are shown. measured and simulated reflection and transmission coefficients between two adjacent antennas using the model parameters from table 2 are shown in figure 4. as can be seen the calculated resonant frequency is 0.70 ghz compared with the measured resonant frequency of 0.67 ghz. there are ripples with approximately the same magnitude both in calculated and measured data and where some ripples agree with each other and some do not. the measured transmission coefficients are on average below 15 db compared to the calculated transmission coefficient below 12 db. due to its simplicity, the hard source model is very appealing to use in fdtd simulations. however, it is not as accurate as the rvs when modeling the monopole feed. to quantify the errors associated with a hard source we investigate its applicability to model the monopole feed. in the first example, we replaced the rvs feed model with a hard source. in the second example, we used the hard source and completely removed the modeling of the rest of the monopole. the use of a hard source also implied that we could not use the transmitting antenna in the gradient computation as we do not calculate the reflection coefficient with the hard source model. calculation of the reflection coefficient requires knowledge of the reflected wave, but since the e - field is directly set in the source cell, no update of the field will be made due to reflected waves. as an illustration of the impact of the hard source on the simulated scattering data s21 for adjacent antennas has been plotted in figure 5. for convenience the same measured and simulated data for the full 3d model as in figure 4 has also been replotted in the same graph. as can be seen, in the first example, the rvs feed model improves the transmission coefficient data over the hard source model, and, in the second example, the system becomes very lossy due to the inaccurate model, and therefore the deviation from the measured data increases. solving the reconstruction problem is a computationally very demanding problem, and one strategy to reduce the simulation time is to reduce the size of the computational domain. therefore we have investigated the need for modeling the exact volume of the water in the tank and instead modeled the water as a background directly terminated by cpml. the cpml is absorbing any outgoing wave and the result inside the computation domain is the same as if the simulation was made in an infinitely large space. in this fdtd simulation the entire computational grid was therefore assigned the properties of water, and as there were no need to model the water - air interface in the computational domain, the cpml could be moved closer to the antennas and thus the computational domain reduced. in figure 6 the corresponding reflection, s11, and transmission, s21, coefficients have been plotted. for comparison the figures also contain the measured data and the data simulated with the full 3d fdtd model from figure 4. the s11 data show how the computed resonance frequency has increased about 0.5 ghz, and we can also see how the fast varying ripple due to the water - air interface reflections has vanished. the reason is that the computation time is significantly reduced compared to the 3d case. therefore a good understanding is desired of when the 2d approximation is applicable for imaging. in this section we show computed transmission data obtained with a 2d model, and also here two examples are considered. the first is the modeling of the volume of water in the tank as a 350 350 mm square in the 2d fdtd grid. in table 3 the corresponding fdtd model parameters are summarized. in analogy with the 3d open water background model the second example was a 2d homogeneous background of water terminated with cpml. in figure 7 transmission data is plotted for these two cases and again the measured data and the full 3d model data are shown. for the simulation data with the 2d square tank model the deviation from the measured data is of similar magnitude as for the case as with the hard source feed in figure 5, at least around the center frequency 0.5 ghz. however, the amplitude of the ripple is larger and the deviation is much more significant. the fast varying ripple is clearly seen and is primarily due to the reflections from the water - air interface in the model. for the simulation in the homogeneous background this ripple is vanished, but in this case the computed data do not show much resemblance at all to the measured data. in the following section, two different target models were used and reconstructed using the various antenna array models discussed above. the aim was to investigate the impact on the reconstruction caused by the different modeling introduced in section 4.2. we have performed image reconstruction of targets immersed into ordinary tap water. in comparison to air a fdtd simulation of water is more time consuming due to the higher permittivity and the corresponding need for shorter time stepping in the fdtd algorithm. to save some computation time the reconstructions were therefore made using a multigrid technique where 10 iterations where performed on a (90 90 16) computational domain with grid size length 4 mm. the final reconstruction of the 10th iteration was then taken as a starting point for 10 additional iterations on a (179 179 31) domain with grid size length 2 mm. the electromagnetic pulse had center frequency 0.5 ghz and fwhm bandwidth 0.5 ghz. the same pseudo-3d approach as previously described was used in a reconstruction domain of height 50 mm and radius rrd = 80 mm. the first was made of a mixture of deionized water and ethanol resulting in permittivity r = 57 and conductivity = 0.11 s / m at the frequency 0.5 ghz. the mixture was filled up to height 50 mm in a thin - walled plastic cup with diameter 42 mm and immersed into the water for the measurement. the second target was a plastic rod with permittivity r 2.5, conductivity 0 s / m, and diameter 15 mm. two different scenarios were reconstructed, the first with the center of the water / ethanol target positioned 39 mm from the center point of the antenna array. in figure 8 an illustration of the original target is shown together with the reconstructed images. the second scenario that was reconstructed included both targets, the water / ethanol mixture and the plastic target, and these results are shown in figure 9. in both cases we see that in the permittivity both size and position of the targets have been accurately reconstructed. the relative error for this second example with the two targets we can perhaps see an indication of a target in the appropriate positions, but the image region is also cluttered with other artifacts, and comparison with the relative error is not meaningful. furthermore the absolute values of the permittivity are not in total agreement with the original values, especially not for the small plastic target. with the same arguments as for the previous object in air where the conductivity also was badly reconstructed, the difference between the background and the target made of water / ethanol mixture is about {r } = 20 in the real part but for the imaginary part only {r } = 2. for the plastic rod the difference is {r } = 75 and {r } = 2. to assess the question of how the reconstructed image is affected by inaccuracies in the forward modeling we have taken the example with the two targets, the plastic rod, and the water / ethanol mixture and performed reconstructions with distorted electromagnetic models. using the two altered antenna models with hard source feed new images of the original targets from figures 9(a) and 9(b) have been reconstructed and shown in figure 10. in (a) and (b) in this figure the rvs was replaced with the hard source feed, and in (c) and (d) the model of the monopole wire was completely removed and only the hard source was used as transmitter model. the relative errors in the permittivity images were computed to be = 0.54 and = 0.58, respectively. one can clearly see that, for the case where only the hard source was used to model the transmitter, the distortions of the reconstructed images are also the largest. this also corresponds to the case where the s - parameter data deviate the most from the measured data in figure 5. however one should not believe that there exists a simple relation between the deviation between the measured and simulated data on one hand and the errors in the reconstructed images on the other hand. it is instead a highly nonlinear relation and a balance between the measurement, the reconstruction algorithm, the regularization, the modeling accuracy, and the calibration procedure. to summarize, so far the results shown indicate that the accuracy of the reconstructed image is highly influenced by the details in the antenna models and in the propagation model. so far we have also modeled the volume of water according to measurements of the level in the tank. we have investigated the need of actually modeling the exact extent of the water volume in the tank. for this experiment we used the rvs feed thin - wire monopole model, and the algorithmic settings were otherwise identical to the previous examples but with the dielectric properties of water assigned to all the grid cells in the computational domain which was then terminated by seven layers of cpml. interestingly the results are improved over the reconstructions made with the tank model, and, for example, the absolute values of the objects are better estimated with the 3d algorithm. the improvement is confirmed by the relative error which was calculated to be = 0.36 for the permittivity image, a decrease of about 14% compared to the reconstruction with the full 3d model in figure 9. these results might be a bit surprising and contradictory to the idea that the better the forward model the better the reconstruction. if we examine the scattering data in figure 6 carefully, we see that even if the data simulated with the numerical tank model contains a similar ripple of the same magnitude as the measured data, the agreement in the details is not perfect. on average one can however approximately estimate the modeling errors in the two cases to be of similar magnitude in comparison to the measured data. even if we have carefully created the model, the numerical grid is ultimately limiting the resolution and causing simulation errors. a refined grid should improve the modeling accuracy but that would also imply that the problem size increases beyond what can be practically handled by our computer cluster due to memory and simulation time requirements. these results suggest that we in this situation are better off by using the simpler open water model and relying on the calibration to resolve the remaining discrepancy between the simulated and the measured data. this is not a result that is obvious to predict but instead a result of the nonlinear property of the problem. in practice the optimal numerical model would thus have to be determined from case to case in different imaging situations and with different imaging systems. for comparison we have also performed image reconstruction of the same targets using a 2d version of the algorithm. the first reconstruction made with the water tank modeled as a square of the single target as shown in figures 8(a) and 8(b), and the corresponding reconstruction of the scenario with two objects as shown in figures 9(a) and 9(b) is shown in figures 12(c) and 12(d). in these reconstructions previous reconstructions made in air of sunflower oil targets with the 2d algorithm published in showed a serious distortion of the size and dielectric values of the targets but a qualitatively correct image could usually be obtained. the reason for the distortion of the reconstructed objects could be attributed to 2d approximation errors as the targets only had the same height as the monopoles. it is a bit surprising that the reconstructed images shown in this paper of targets immersed in water hardly shows anything at all as the electromagnetic waves now in fact should be better confined inside the layer constituted by the water and therefore better conforming to the 2d approximation. enclosure is provided by the ground plane on the bottom and the impedance step in the water - air interface. however these images are representative for our results showing that robust image reconstruction is not possible to achieve in water using this 2d algorithm. the situation can be somewhat improved by employing the open water modeling also in 2d ; that is, we replace the square water tank model in the background of air with a modeling of a homogeneous background of water to simulate an open domain. we clearly see the two objects appearing, where the large object contains a spurious hole and the dielectric values are not quite close to the original values. a similar spurious hole in the reconstruction can be seen also in the reconstructions from short monopole lengths in figure 2 and arises due to the modeling errors of the antenna. furthermore associated with every target object is an optimal spectral content that will produce an optimal image, and holes usually appear when the spectral content is moved towards higher frequencies. with these two causes for the inaccuracy in the image we have not been able to improve the outcome any further by tuning the parameters in the reconstruction algorithm. we have shown successful reconstruction of single and multiple targets immersed in water using a fdtd - based 3d reconstruction algorithm. by investigating various imaging scenarios we have also assessed the question of how the accuracy in the numerical forward model affects the reconstructed image. the results show that a realistic model of the antennas is necessary to achieve robust and reliable imaging. the same results also indicate that small modeling errors, such as in the length of the monopole, can have a clearly evident impact on the resulting image. for a simple antenna such as a monopole the modeling is very simple, and it is not difficult to produce a reasonably accurate numerical model using the thin - wire approximation and the rvs. however there is always an inherent limitation due to the finite grid size, and, when moving to more advanced antennas, such as patch antennas, modeling accuracy will become a more challenging task. accurate antenna modeling requires a fine fdtd grid, but at the same time we must keep the grid as coarse as possible to lower the simulation time and memory requirement. furthermore we have seen that when filling the tank containing the antenna system with normal tap water, the water - air interface causes significant reflections that are clearly identified in the scattering data. despite this effect the accuracy of the reconstructed results is in fact improved when we instead use an open water model. this result shows that an apparent improvement in the antenna modeling and the corresponding computed scattering data is in fact not beneficial when it comes to imaging. one possible explanation could be that when comparing different models with similar modeling errors the nonlinearity of the reconstruction problem makes it impossible to predict the outcome. instead the result will be strongly case dependent and to fully predict the result one would have to perform detailed studies of the particular imaging scenario. | nonlinear microwave imaging heavily relies on an accurate numerical electromagnetic model of the antenna system. the model is used to simulate scattering data that is compared to its measured counterpart in order to reconstruct the image. in this paper an antenna system immersed in water is used to image different canonical objects in order to investigate the implication of modeling errors on the final reconstruction using a time domain - based iterative inverse reconstruction algorithm and three - dimensional fdtd modeling. with the test objects immersed in a background of air and tap water, respectively, we have studied the impact of antenna modeling errors, errors in the modeling of the background media, and made a comparison with a two - dimensional version of the algorithm. in conclusion even small modeling errors in the antennas can significantly alter the reconstructed image. since the image reconstruction procedure is highly nonlinear general conclusions are very difficult to make. in our case it means that with the antenna system immersed in water and using our present fdtd - based electromagnetic model the imaging results are improved if refraining from modeling the water - wall - air interface and instead just use a homogeneous background of water in the model. |
imagine that you were asked to evaluate whether a new medicine produces an allergic reaction as a side effect. to accomplish this task, you are shown the individual medical records of a number of patients where you can find out whether each patient took the medicine and whether he / she suffered an allergic reaction. how should you assess the relation between taking the medicine and suffering the allergy ? as shown in figure 1a, to make this judgment you would need four pieces of information that can be summarized in a 2 2 contingency table. you would need to know how many patients took the medicine and suffered an allergy (cell a), how many patients took the medicine and did not suffer an allergy (cell b), how many patients did not take the medicine but suffered an allergy nevertheless (cell c), and, finally, how many patients did not take the medicine and did not suffer an allergy (cell d). based on this information, you could compute some measure of contingency and estimate whether or not that level of contingency is substantially different from zero. although there are alternative ways to measure contingency, the p rule is usually considered a valid normative index (allan, 1980 ; cheng & novick, 1992 ; jenkins & ward, 1965). according to this rule, if you want to assess the degree of contingency between a cue (e.g., taking a medicine) and an outcome (e.g., an allergy), then you need to compute(1)where p(o|c) is the probability of the outcome given the cue and p(o|~c) is the probability of the outcome in the absence of the cue. as shown in figure 1a, these two probabilities can be easily computed from the information contained in a contingency table. positive values of p indicate that the probability of the outcome is higher when the cue is present than when it is absent (see, e.g., figure 1b). in contrast, negative values indicate that the probability of the outcome is reduced when the cue is present (e.g., figure 1c). finally, if the probability of the outcome is the same in the presence as in the absence of the cue, the value of p is always 0 (e.g., figure 1d). in these latter cases, there is no contingency between cue and outcome. when laypeople are asked to estimate the contingency between two events, do their judgments agree with this normative rule ? as we will see, the answer is both yes and no. to study how people detect contingency, researchers typically rely on a very simple task that has become a standard procedure in contingency - learning research. during the task, participants are exposed to a series of trials in which a cue and an outcome may be either present or absent, and they are instructed to discover the relationship between both. as in our previous example, the cue can be a fictitious medicine taken by some patients and the outcome can be an allergic reaction. on each trial, participants are first shown information about whether a patient took the drug on a specific day and they are asked to predict whether or not they think that this patient will develop an allergic reaction. after entering a yes / no response, they receive feedback and they proceed to the next trial. once they have seen the whole sequence of trials in random order, the participants are asked to rate their perceived strength of the relationship between the medicine and the allergic reaction. the usual result is that participants judgments tend to covary with the objective drug - allergy contingency as measured by p (e.g., lpez., 1998 ; shanks & dickinson, 1987 ; wasserman, 1990). therefore, to some extent participants seem to be able to track the actual cue - outcome contingency. for instance, participants judgments tend to be biased by the marginal probability of the outcome, defined as the proportion of trials in which the outcome is present, that is, p(outcome) = (a + c)/(a + b + c + d). figure 1e depicts an example where there is no contingency between cue and outcome, but the outcome tends to appear very frequently. in situations like this, participants tend to overestimate contingency (allan & jenkins, 1983 ; allan., 2005 ; buehner, cheng, & clifford, 2003 ; lpez., 1998 ; musca, vadillo, blanco, & matute, 2010 ; wasserman., 1996). similarly, other things being equal, participants judgments tend to covary with the marginal probability of the cue, defined as the proportion of trials in which the cue is present ; that is, p(cue) = (a + b)/(a + b + c + d). figure 1f represents an example where the probability of the cue is high, but there is no contingency between cue and outcome. again, participants tend to overestimate contingency in situations like this (allan & jenkins, 1983 ; matute., 2011 ; perales., 2005 ; vadillo, musca, blanco, & matute, 2011 ; wasserman., 1996). the biasing effects of the probability of the outcome and the probability of the cue are typically known as outcome- and cue - density biases. as the astute reader might guess, the most problematic situation is that in which both the probability of the outcome and the probability of the cue are large (figure 1 g). participants seem to find particularly difficult to detect the lack of contingency in these cases (blanco, matute, & vadillo, 2013). it is interesting to note that biases akin to these have also been found in the social psychology literature on illusory correlations in stereotype formation (hamilton & gifford, 1976 ; kutzner & fiedler, 2015 ; murphy, schmeer, valle - tourangeau, mondragn, & hilton, 2011). in these experiments, participants are shown information about the personality traits of members of two social groups. across trials, participants see more information about one of the groups than about the other and they also see more people with positive traits than people with negative traits. most importantly, the proportion of positive and negative traits is identical in both social groups. therefore, there is no correlation between membership to the majority or the minority group and the quality (positive vs. negative) of personality traits. as can be seen, if one assumes that social groups play the role of cues and that positive and negative traits play the role of outcomes, this situation is identical to the one represented in figure 1 g. although there is no correlation between groups and traits, when participants are asked to rate the traits of both groups, they systematically tend to judge the majority group more favorably than the minority group. in other words, despite the absence of a real correlation, participants tend to associate the majority group with the most frequent (positive) personality traits and the minority group with the least frequent (negative) personality traits. the interesting point, for our current purposes, is that we can interpret illusory correlations as a combination of cue- and outcome - density biases, which means that this effect may be explained as a contingency - learning phenomenon. traditionally, demonstrations of cue / outcome - density biases and illusory correlations have been explained in terms of simple associative processes analogous to those assumed to account for classical and instrumental conditioning (e.g., alloy & abramson, 1979 ; lpez., 1998 ; matute, 1996 ; murphy., 2011 ; shanks, 1995 ; sherman., 2009 ; van rooy, van overwalle, vanhoomissen, labiouse, & french, 2003). the associative learning rule proposed by rescorla and wagner (1972) provides the simplest example of this family of models. according to the rescorla - wagner model, when a cue is followed by an outcome, an association or link is formed between the representations of both stimuli. after each pairing, the strength of the association is assumed to increase or decrease according to the formula:(2)where vc - o is the increase in the strength of the cue - outcome association after that trial, and are learning rate parameters depending on the salience of the cue and the salience of the outcome, respectively, is a dummy variable coding whether the outcome was present or absent in that trial, and vtotal is the sum of the associative strengths of all the potential cues of the outcome present in that trial. in addition to the target cue, a contextual cue is assumed to remain present in all trials. the association of the contextual cue with the outcome is also updated according to equation 2. to illustrate how this simple model accounts for cue- and outcome - density biases, in figure 2 we show the predictions of the model when given as input the six contingencies depicted in figures 1b1 g. the top panel shows the predictions of the model when the contingency is positive (1b), negative (1c), or zero (1d). as can be seen, eventually the strength of the cue - outcome association tends to converge to the true contingency, as defined by p. by the end of training, the model learns a positive association when the cue - outcome contingency is positive and a negative association when the cue - outcome contingency is negative. when the cue - outcome contingency is exactly zero, the associative strength of the cue also tends to move toward this value. therefore, the model does a good job at explaining why people are good at detecting contingencies (see chapman & robbins, 1990 ; danks, 2003 ; wasserman, elek, chatlosh, & baker, 1993). however, the model also predicts some systematic deviations from the true contingency. in the four conditions where the contingency is zero, depicted in the bottom panel, these overestimations are larger when the outcome (1e) or the cue (1f) is very frequent, and even larger when both of them are very frequent (1 g). therefore, the model also provides a nice explanation for cue- and outcome - density biases (matute, vadillo, blanco, & musca, 2007 ; shanks, 1995 ; vadillo & luque, 2013). regardless of the merits and limits of associative models (mitchell, de houwer, & lovibond, 2009 ; shanks, 2010), for our present purposes, their most important feature is that, according to them, the same mechanism explains (1) why people are sensitive to contingency and (2) why their judgments are also biased under some conditions. a single process accounts for accurate and biased contingency detection. as we will discuss below, this is the key feature of single - process models that distinguishes them from their dual - process counterparts. it is interesting to note that this property is also shared by other early models of biased contingency detection that do not rely on associative learning algorithms. for example, instance - based models assume that each cue - outcome trial is stored in a separate memory trace in long - term memory (fiedler, 1996, 2000 ; meiser & hewstone, 2006 ; smith, 1991). parts of these memory traces may be lost during the encoding process. in a situation like the one represented in figure 1 g, the loss of information has very little impact on the encoding of cell a events, because there are many redundant memory traces representing the same type of event. however, information loss can have a severe impact on the encoding of cells c and d events because there are fewer traces representing them. as a result, the information encoded in memory contains more (or better) information about frequent events (cells a) than about infrequent events (cells c and d). therefore, information loss explains why participants tend to perceive a positive contingency whenever type a events are more frequent than other events in the contingency table. most importantly, according to these models we do not need to invoke different mechanisms to explain the cases in which participants are sensitive to the actual contingency and the instances in which their judgments are biased. accurate and biased contingency detection are supposed to arise from the same operating mechanisms. therefore, from our point of view, instance - based theories also belong to the category of single - process models. for our present purposes, propositional models can be considered yet another case of single - process models. in a thought - provoking series of papers, de houwer and colleagues (de houwer, 2009, 2014 ; mitchell., 2009) have suggested that all instances of human contingency learning might depend exclusively on the formation and truth evaluation of propositions. in contrast to simple associations, propositions do not just represent that events in the environment are related to each other : they also qualify how they are related (lagnado, waldmann, hagmayer, & sloman, 2007). however, the difference between them can not be represented in terms of a simple association. although propositional models do not necessarily exclude the contribution of associative processes (see moors, 2014), the representational power of propositions allows these models to explain aspects of learning that fall beyond the scope of simple associative models (de houwer, beckers, & glautier, 2002 ; gast & de houwer, 2012 ; zanon, de houwer, & gast, 2012). these ideas have not been formalized in a mathematical model, but nothing in their current formulation suggests that separate mechanisms would be needed to account for accurate and biased contingency detection. for our present purposes, the idea that all learning depends on the evaluation of propositions represents yet another example of a single - process model. during the last decade, some researchers have abandoned these explanations in favor of more complex dual - process theories (allan., 2005, 2007 ; perales., 2005 ; ratliff & nosek, 2010). although differing in the detail, the core idea of these proposals is that they call upon one mechanism to explain how people (correctly) track contingencies and a different mechanism to explain why their judgments are sometimes biased by cue and outcome density. this proposal is based on the results of several experiments showing what appear to be systematic dissociations between different dependent measures. cue / outcome density biases and illusory correlations are typically assessed with a numerical causal or contingency rating that participants provide at the end of the experiment. as explained, these judgments show sensitivity to both actual contingency and to the biasing effects of cue and outcome density. however, according to these authors (allan., 2005, 2007 ; perales., 2005 ; ratliff & nosek, 2010), other dependent measures seem to be sensitive only to the actual contingency, showing no trace of cue- or outcome - density biases. these alternative measures are assumed to be relatively uninfluenced by higher - order reasoning processes, or at least, less influenced by them than the numerical judgments typically used as dependent variables. from this point of view, it follows naturally that there must be a very basic learning mechanism that explains how people accurately track contingencies and whose output can be directly observed in these dependent variables. in contrast, judgments are affected both by contingency and by cue / outcome density biases. because measures that address directly the learning mechanism do not seem to be sensitive to biases, these must be operating through a different mechanism that influences judgments but not the original encoding of information. this is the reason why these models incorporate different processes to account for accurate and biased contingency detection. a schematic representation of the role of learning and judgment processes of biased contingency detection is offered in figure 3. therefore, in dual - process models two different and successively operating mechanisms are invoked to explain why people are sensitive to contingency but they are also biased by the marginal probabilities of the cue and the outcome. the first mechanism would include basic encoding and retrieval processes that are highly sensitive to the objective contingency. the information gathered by this mechanism would then feed forward to other mechanisms involved in judgment and decision - making processes. these findings are certainly challenging for the theories of contingency detection discussed in the previous section, which in the absence of additional assumptions would typically anticipate similar effects in all dependent measures of contingency learning. note, however, that dissociations are not a perfect basis to draw inferences about the presence of one or multiple systems. borrowing an example from chater (2003), following the logic of dissociations one might conclude that human beings must have different digestive systems, because some people are allergic to prawns, while others are allergic to peanuts. tiny differences in the way a single mechanism tackles similar problems might create the illusion that several mechanisms are involved in an operation that is actually best described in terms of a single - system process. in spite of these concerns about the interpretation of dissociations, in the following sections we do not question this logic, but the reliability of the findings that support dual - process models of contingency learning. the evidence for these models stems from three papers published during the last decade (allan., 2005 ; perales. although their theoretical conclusions are quite consistent, the empirical findings reported in each of them are noticeably different. in the following sections we review each of them in turn and discuss their merits and shortcomings. to overview our criticisms, we argue that some of these findings seem to be poorly replicable or generalizable, while others are based on possibly faulty dependent measures. the first piece of evidence suggesting that these biases are not observed in all dependent variables comes from an interesting experiment conducted by allan. two groups of participants were instructed to discover the effect of a series of fictitious chemicals (playing the role of the cue) on the survival of a sample of bacteria in a petri dish (playing the role of the outcome). in each trial, participants saw whether or not the chemical was present in a sample and they were asked to predict whether or not the bacteria would survive. immediately after entering their responses, they were informed of the outcome of the trial (i.e., whether the bacteria survived) and they proceeded to the next trial. at the end of training, participants were asked to rate to what extent the chemicals had a positive or a negative impact on the survival of bacteria, using a numerical scale from 100 (negative impact) to 100 (positive impact). for one of them, the contingency was moderately positive (p =.467), while for the other one the contingency was always null (p =.000). each participant was asked to complete three of these contingency - detection problems, all of them with the same overall contingency, but with different probabilities of the outcome. therefore, the experiment relies on a 2 3 factorial design with contingency as a between - groups manipulation and probability of the outcome as a within - participant factor. as the reader might expect, the first finding of allan. (2005) was that the numerical ratings that participants provided at the end of each problem were influenced both by contingency and outcome - probability. that is to say, participants were able, in general, to track the objective degree of contingency between each of the chemicals and the survival of bacteria ; however, their ratings were also biased by the probability of the outcome. this is a replication of the well - known outcome - density bias discussed in previous sections. (2005) found that other dependent measures seemed to be unaffected by outcome density, although they were sensitive to the overall cue - outcome contingency. specifically, allan. used the discrete yes / no predictions made by participants in every trial to compute an alternative measure of their sensitivity to contingency. if the participant believes that there is a statistical connection between the chemicals and the survival of bacteria, then he or she should predict the survival (i.e., respond yes to the question of whether the bacteria would survive in the current trial) more frequently when the chemicals are present than when they are not. following this reasoning, it would be possible to measure the extent to which a participant believes that there is a relationship between the cue and the outcome using the formula:(3) note that this index is based on the same logic that underlies the computation of p in equation 1, only that the real occurrence of the outcome is replaced by the outcome predictions made by the participant (see collins & shanks, 2002). therefore, ppred does not measure the objective contingency between cue and outcome, but it aims at measuring the subjective contingency that the participant perceives, as revealed by the trial - by - trial predictions made during training. when using ppred as their dependent variable, allan. (2005) found that this measure was sensitive to cue - outcome contingency. however, it was absolutely unaffected by manipulations of the probability of the outcome. this result led them to conclude that there must be a stage of processing in which the contingency between cue and outcome or the target conditional probabilities have already been encoded but the outcome - density bias is still absent. then, ppred would provide an insight into this basic mechanism that encodes contingency in a format that is not yet influenced by the outcome - density bias. given that the numerical judgments are influenced by both contingency and outcome - probability, this must mean that judgments are affected not only by the original encoding of information (sensitive to contingency but free from bias) but also by processes that take place after encoding (see figure 3). in other words, the outcome - density bias is not due to learning or encoding, but to more sophisticated processes related to judgment and decision making. (2005) explored only the outcome - density bias, they suggested that a similar approach might explain the complementary cue - density bias as well. if they proved to be reliable, they would pose insurmountable problems for single - process models that aim to explain cue- and outcome - density biases as learning effects. but, how strong is this evidence ? to answer this question, we decided to reanalyze data from our own laboratory using the strategy followed by allan. specifically, we reanalyzed data from nine experimental conditions exploring the cue - density bias (originally published in blanco., 2013 ; matute., 2011 ; vadillo., 2011 ; yarritu & matute, 2015 ; yarritu, matute, & vadillo, 2014) and three experimental conditions exploring the outcome - density bias (originally published in musca., 2010 ; vadillo, miller, & matute, 2005). all these experiments were conducted using the standard experimental paradigm outlined above. in the original reports of those experiments we only analyzed the judgments that participants reported at the end of the training phase. however, we also collected trial - by - trial predictive responses to maintain participants attention and to make sure that they were following the experiment. this allows us to compare the size of the bias observed in the ppred scores with the size of the bias that we observed in judgments. cue- and outcome - density biases should have an effect on judgments, but not on ppred. in the following analyses, we included data from 848 participants tested in 12 conditions included in the articles mentioned in the previous paragraph.figure 4 plots the effect size (cohen s d) of density biases on the ppred index against the effect size of the same manipulation on judgments collected at the end of the experiment. as can be seen, overall, most experiments found clear evidence for density biases in ppred. a random - effects meta - analysis yielded a statistically significant effect of size d = 0.49, 95% ci [0.08, 0.90 ], z = 2.37, p =.018. therefore, overall our results do not replicate the original findings of allan. (2005) : cue and outcome density do have an effect on ppred scores. however, the confidence intervals plotted in figure 4 show that the effect of density bias did not reach statistical significance in some experimental conditions. in two cases,. a closer look at the data shows that in the rare occasions when biases were not observed in ppred, they also tended to be absent or smaller than usual in judgments. a meta - regression confirmed that the effect size of biases on ppred was moderated by the effect size of biases on judgments, q(1) = 5.54, p =.019. these analyses suggest that cue- and outcome - density biases can be observed in ppred and that, when they are absent, it is not due to a dissociation between judgments and ppred, but to any other factor that affects both measures. to show that these results are robust, we also analyzed the individual data of the participants tested in all the experimental conditions shown in figure 4. across all conditions, the cue-/outcome - density manipulation had an effect on ppred, t(846) = 6.20, p <.001, d = 0.43. this result also held when data from experiments exploring cue- and outcome - density biases were analyzed separately : t(659) = 4.97, p <.001, d = 0.37, and t(185) = 4.01, p <.001, d = 0.59, respectively. not surprisingly, the two dependent measures, judgments and ppred, were significantly correlated, r =.27, p <.001, and this correlation remained significant when data from cue- and outcome - density biases were analyzed independently : r =.28, p <.001, and r =.24, p <.001, respectively. overall the data shown in figure 4 and these additional analyses are inconsistent with the hypothesis that trial - by - trial predictions are unbiased by the probability of the cue / outcome or that radically different results are observed with judgments and trial - by - trial predictions. thus, there is no need to postulate different mechanisms to account for judgments and for trial - by - trial predictions. this being said, figure 4 also reveals that some of our studies failed to find a significant effect of the cue / outcome density manipulation on ppred. to some extent, this feature of our results can be considered a replication of allan. but as seen in figure 4 and in the previous analyses, this can hardly be considered strong evidence for a dissociation between judgments and ppred. the fact that sometimes ppred fails to yield significant results may be due to its reduced reliability compared to judgments. there are many situations where the use of unreliable or insensitive measures can produce patterns of results that look like dissociations but do not require a dual - process account (shanks & st. consistent with this interpretation, there are good reasons why ppred might be an imperfect index of contingency learning, as we discuss in subsequent sections. (2005, experiment 1) found a dissociation strikingly similar to the one reported by allan.., two groups of participants were exposed to several contingency - learning problems where they had to learn the relationship between the activation of a fictitious minefield and the explosion of enemy tanks. in each trial, participants were first presented with information about whether the minefield was active and were asked to predict by means of a yes / no response whether or not they thought that the tanks would explode in that trial. after entering their predictions, they were given feedback and they proceeded to the next trial. for one of the groups, the contingency between the minefield and the explosions was always positive, p =.50, while the contingency was always zero for all the problems presented to the other group of participants. within participants, the probability of the cue was manipulated with two levels, high (.75) and low (.25). at the end of each problem, participants were asked to rate the strength of the causal relation between the activation of the minefield and the explosion of tanks. consistent with previous reports, perales. found that these numerical judgments were sensitive not only to the contingency manipulation, but also to the cue - density manipulation. that is to say, for a specific level of contingency, judgments tended to vary with the probability of the cue, replicating the well - known cue - density bias. perales. found that other dependent measures, also computed from participants trial - by - trial responses, were sensitive only to contingency and were largely immune to the cue - density bias. unlike allan. (2005, experiment 1) did not convert trial - by - trial predictions to ppred but, instead, they computed two alternative measures inspired in signal detection theory (sdt) analyses. one of them, the criterion for responding, was a measure of participants overall tendency to predict that the outcome will occur. the second one, d, was the discriminability index of sdt analyses and aimed at measuring participants ability to discriminate when the outcome was more likely to appear and when it was less likely to appear. for reasons that will become obvious later, only this second measure is relevant for the present discussion. to compute the d index, perales. registered the hit rate of each participant (i.e., the proportion of trials in which they correctly predicted that the outcome would occur, among all trials where the outcome was present) and their false alarm rate (i.e., the proportion of trials in which they incorrectly predicted the outcome, among all trials where the outcome was absent). based on these two measures, d can be easily computed as(4)where z is the inverse of the normal cumulative density function. crucially, this equation ignores completely whether participants made their predictions on cue - present or on cue - absent trials. the only important thing is whether they correctly predicted the outcome when it was going to happen and whether they incorrectly predicted the outcome when it was not going to happen. in other words, the d index measures to what extent participants are good at discriminating when the outcome will be presented and when it will not. the rationale for using this index as a measure of participants sensitivity to contingency is that, in principle, if participants have learned the correct cue - outcome contingency, they should be able to make more accurate predictions, and this should yield a higher d. the key finding of perales. (2005, experiment 1) was that participants d scores turned out to be sensitive just to the contingency manipulation, but not to the cue - density manipulation. this parallels allan.s (2005) finding that ppred was affected by manipulations of contingency, but not by manipulations of the probability of the outcome. taken collectively, both experiments converged on the same idea : there are some dependent measures that reflect that participants have learned the cue - outcome contingency, but which nevertheless show no trace of cue- or outcome - density bias. this stands in stark contrast with the patterns of results found in numerical judgments, which are sensitive to both contingency and density biases. perales. discussed several dual - process accounts that could explain these dissociations. although differing in the detail, all of them dovetailed with the idea that there is a basic encoding mechanism that tracks cue - outcome contingency in a format free from any cue- or outcome - density bias. the density biases observed in judgments must then be attributed to other mechanisms that intervene in later stages of processing. a first striking feature of the results is that the manipulation of the probability of the cue did in fact seem to have an effect on d, although this effect was only marginally significant (p =.09, p =.067). the authors argued that this effect was far too small to account for the significant effect of cause - density [i.e., cue - density ] on judgments. however, this argumentation is only valid if one assumes that the validity, reliability, and sensitivity of d as a dependent measure are comparable to those of judgments. if d turned out to be less sensitive, then the smaller effect size of the cue - density effect found of d would be very poor evidence for a dissociation. are there any reasons to suspect that d is not a sensitive measure for cue- or outcome - density biases ?. the problems of d as a measure of learning are particularly obvious in the two null - contingency conditions of perales. the probability of the outcome was always.50, no matter whether the cue was present or not. in this situation, there was nothing participants could do to predict the outcome successfully. the outcome and its absence were equally likely and the cue did not offer any information to make the outcome more predictable. furthermore, this was the case in both the high cue - density and the low cue - density conditions : the probability of the cue was higher in one condition than in the other, but this did not change the fact that the outcome was equally unpredictable in both conditions. therefore, it is not surprising that participants in both conditions got d values indistinguishable from zero. note that this does not mean that participants had the same perception of contingency in those two conditions. it only means that in those particular conditions, nothing participants learn can help them make better outcome predictions as measured by d. but crucially, if all participants produce a d of zero regardless of their predictions, then their score can not be used as a measure of their perception of contingency. a computer simulation provides a simple means to illustrate the problems of d as a measure of contingency learning. in the following simulation we computed d for a large number of simulated participants exposed to the same contingencies used in perales the labels pc - hd, pc - ld, nc - hd, and nc - ld shown in figure 5 refer to the four experimental conditions tested by perales. these labels denote whether contingency was positive (pc) or null (nc) and whether the density of the cue was high (hd) or low (ld). for each experimental condition, we computed how many correct and incorrect responses a simulated participant would get. then, we used this information to compute the d of that simulated participant using equation 4. for each condition, we simulated 1,000 participants with nine different response distributions. the rationale for simulating a wide variety of response strategies is that, if d is a valid measure of learning, this index should adopt different values when participants behave differently. imagine that one participant learns that there is positive contingency between the cue and the outcome. yes very frequently when asked whether the outcome will follow the cue and he / she should say no very frequently when asked whether the outcome will appear in a trial in which the cue was absent. now imagine a second participant who learns that there is no contingency between cue and outcome. this participant will be just as likely to predict the outcome in cue - present and in cue - absent trials. if d is a good measure of contingency learning, these two participants should get different d scores. in contrast, if participants who act on the basis of different beliefs about the cue - outcome contingency obtain the same d score, this would imply that d is not a valid measure of contingency detection. to minimize the impact of sampling error on the exact number of hits and false alarms, we run 1,000 simulations for each combination of experimental condition and response distribution. each of the nine series of data shown in figure 5 refers to a different response distribution (e.g., 25/75, 50/50,). the first number (25, 50, or 75) refers to the probability of predicting the outcome in the presence of the cue and the second number (also 25, 50, or 75) refers to the probability of predicting the outcome in the absence of the cue. for instance, a simulated participant with response strategy 75/25 would predict the outcome with probability.75 if the cue was present and with probability.25 if the cue was absent (which is consistent with the belief in a positive contingency). similarly, a simulated participant with response strategy 75/75 would predict the outcome with probability.75 regardless of whether the cue is present or absent (which is consistent with the belief in a null contingency). consistent with our previous discussion, figure 5 shows that all simulated participants got almost identical d scores in the null - contingency conditions (right - most half of the figure). in other words, the d scores obtained by those participants reveal absolutely nothing about their pattern of performance. in these null - contingency conditions, a participant who acted as if there were a positive cue - outcome contingency (e.g., 75/25) would receive virtually the same score as a participant who acted as if contingency were negative (e.g., 25/75). similarly, a participant who was very prone to predicting the outcome (e.g., 75/75) and a participant who was very reluctant to predict the outcome (e.g., 25/25) would obtain similar d scores. (2005, experiment 1) in the nc conditions tell us nothing about the participants performance, about their beliefs regarding the cue - outcome contingency or their outcome expectancies. in contrast, the left - hand side of figure 5 shows that d can be a sensitive measure of the perception of contingency in the positive contingency (pc) conditions tested by perales. in these conditions, different patterns of responding do give rise to different d scores, suggesting that d can reveal something about participants beliefs or about their response strategies. therefore, it is only in these conditions with positive contingencies that one can expect to measure differences in performance with d. it is interesting to note that visual inspection of the data reported by perales. (2005) confirms that the trend towards a cue - density bias was stronger in the pc condition than in the nc condition. when one takes into account that one half of the experiment (the two nc conditions) is affected by a methodological artifact, it becomes less surprising that the cue - density manipulation only had a marginally significant effect on d. this being said, we note that in the pc conditions the cue - density effect observed in d still looks relatively small, compared to the large effect found in participants judgments. going back to the reanalysis of our own studies presented in our previous section, we also found there that, in some occasions, cue / outcome density manipulations seemed to have a stronger effect on judgments than on ppred. based on this evidence, it appears that, in general, all the dependent measures computed from trial - by - trial predictions (either ppred or d) are less sensitive than numerical judgments. is there any reason why these dependent measures should be less reliable ? as we will show below, we suspect that the data reported by allan. imagine that two participants, a and b, have been exposed to exactly the same sequence of trials and that, as a result, they end up having the same beliefs about the relationship between a cue and an outcome. for instance, imagine that both of them have learned that the probability of the outcome given the cue is.75 and that the probability of the outcome given the absence of the cue is.25. this means that both of them would believe, implicitly or explicitly, that there is a moderate positive contingency between cue and outcome (i.e., that the outcome is more likely to appear in the presence of the cue than in its absence). now, let us assume that both participants are presented again with a series of trials where the cue is present or absent and they are asked to predict whether or not the outcome will be presented in each trial. participant a might consider that, because the probability of the outcome given the cue is.75, he should predict the outcome in roughly 75% of the trials where the cue is present. and, similarly, because the probability of the outcome given the absence of the cue is.25, he predicts the outcome in approximately 25% of the trials where the cue is absent. the behavior of this participant would show what researchers call probability matching (nies, 1962 ; shanks, tunney, & mccarthy, 2002 ; tversky & edwards, 1966), that is, his predictions would match the probabilities seen (or perceived) in the environment. participant b has a different goal in mind : he wants to be right as many times as possible. if the outcome appears 75% of the times when the cue is present, then predicting the outcome on 75% of the trials is not a perfect strategy. if he did that, on average, he would be right on 56.25% of the trials (i.e.,.75.75). in contrast, if he always predicts the outcome when the cue is present, he will be correct 75% of the times (i.e., 1.00.75). if he wants to maximize the number of correct outcome predictions, this is a much more rational strategy. following the same logic, if the probability of the outcome in the absence of the cue is.25, it makes sense to always predict the absence of the outcome. our point is that if a participant wants to maximize the number of correct predictions, he will predict the outcome whenever he thinks that its probability is higher than.50 and he will predict the absence of the outcome in any other case. not surprisingly, research with human and nonhuman animals shows that maximization is a typical response strategy in many situations (e.g., unturbe & coromias, 2007). interestingly, although both participants, a and b, base their responses on the same beliefs, their behavior is radically different because they pursue different goals. this has important implications for our review of the results reported by allan. if trial - by - trial predictions do not only depend on the perceived contingency but also on response strategies like probability matching or maximization, then any dependent variable computed from them (like ppred or d) will be necessarily noisy and unreliable. for instance, if we computed ppred for participant a in our previous example, that would yield an approximate value of.50, which reflects quite well his beliefs about the contingency between cue and outcome. however, if we computed ppred for participant b, this would yield a value of 1.00, which is a gross overestimation of his true beliefs. these two participants would also receive different d scores. in the case of perales. (2005, experiment 1), there is clear evidence of probability maximization. the data reported in the appendix of perales. confirm that participants in the pc group predicted the outcome in around 9293% of cue - present trials and in 1213% of cue - absent trials. in the case of allan. (2005) there is no obvious evidence for maximization in their noncontingent condition, but there appears to be such a trend in the contingent condition. their figure 5 suggests that although the actual probability of the outcome given the cue varied from.567 to.900, participants predicted the outcome in 7090% of cue - present trials. similarly, although the probability of the outcome in the absence of the cue ranged from.100 to.667, participants predicted the outcome in 1030% of cue - absent trials. this pattern is perhaps less extreme than the one found in perales. (2005), but it does nevertheless suggest that many of their participants must have used a maximization strategy. in either case, this strategy makes ppred and d less sensitive to any manipulation. the lack of sensitivity might explain why they failed to find any effect of cue and outcome density on these dependent variables. it is interesting to note that participants are more likely to become maximizers in relatively long experiments, which provide more opportunities to develop optimal response strategies (shanks., 2002) cue and outcome density were manipulated within - participants. to accomplish this, all participants had to complete the contingency learning several times. in contrast, in our experiments all the manipulations were conducted between groups, reducing substantially the length of the experiment and, consequently, the opportunities to develop sophisticated response strategies like maximization. dissociations between judgments and trial - by - trial predictions are not the only piece of evidence in favor of dual - process models of biased contingency detection. this approach received convergent support from a recent study by ratliff and nosek (2010) that found a similar dissociation between different measures of illusory correlations in stereotype formation, suggesting that two or more processes might also be involved in this effect. as explained in previous sections, most experiments on illusory correlations in stereotype formation rely on a fairly standard procedure (hamilton & gifford, 1976). participants are presented with positive and negative traits of members of two different social groups on a trial - by - trial basis. crucially, there are more members of one group (majority) than of the other (minority) and, regardless of group, most of the members show positive traits. although the proportion of positive and negative traits is identical for the majority and the minority groups, people tend to make more positive evaluations of the majority group when asked to judge both groups at the end of training. illusory correlations in stereotypes and cue / outcome density biases have been explored in quite different literatures, but both effects are clearly related and can be explained by the same or very similar models (murphy., 2011 ; sherman., 2009 ; van rooy., 2003). illusory correlations are typically assessed by means of numerical ratings (similar to judgments in contingency - detection experiments) or by asking participants to recall which positive or negative traits were observed in the majority or the minority group. however, ratliff and nosek (2010) wondered whether the same illusory - correlation effects would be found in an alternative test that is supposed to provide a cleaner measure of the underlying attitudes of participants : the implicit association test (iat ; greenwald, mcghee, & schwartz, 1998). unlike traditional questionnaires, the iat is a reaction - time test that is traditionally assumed to measure implicit attitudes with little interference from higher - order cognitive processes (de houwer, teige - mocigmba, spruyt, & moors, 2009 ; gawronski, lebel, & peters, 2007 ; nosek, hawkins, & frazier, 2011). following this idea, if illusory correlations require the operation of reasoning or inferential processes, then they should not be observed in the iat. in contrast, if only very elemental associative processes are responsible for illusory correlations, then the iat should be able to detect them. ratliff and nosek (2010) found the standard illusory - correlation effect in the responses to the explicit questionnaire. however, there was no hint of the effect in the iat scores in any of their two experiments. most importantly, the absence of effects can not be attributed to the lack of validity of the iat : the iat was sensitive to the valence of the majority and the minority groups when there was a correlation between membership to one of them and the positive or negative personality traits. nor can they be attributed to a lack of statistical power, given that the results were replicated in an online experiment with almost 900 participants. ratliff and nosek (2010) interpreted these results in terms of a dual - process model (gawronski & bodenhausen, 2006) surprisingly similar to that invoked by allan. according to them, the iat would be only sensitive to the original encoding of associations in memory. from this point of view, the fact that performance in the iat was unaffected by the illusory - correlation manipulation indicates that participants in their experiment correctly learned that there was no correlation between belonging to one group or the other and having positive or negative personality traits. therefore, the illusory - correlation effect observed in explicit judgments must have been due to additional higher - order cognitive processes that took place on a later stage, and not to the original learning mechanism responsible for the initial encoding of the information (see figure 3). as in the case of the results reported by allan. and perales., these results pose problems for any single - process model that assumes that illusory correlations are the product of the same mechanisms responsible for the detection of contingency. if a single process were responsible for both sensitivity to contingency and for density biases, why should an iat be sensitive to one of these manipulations (contingency) but not to the other (density) ? before drawing any conclusion, it is convenient to review all the available evidence regarding this dissociation. until recently, the study conducted by ratliff and nosek (2010) was the only experimental work that had tried to detect illusory correlations with the iat. however, the latest attempt to replicate this result using a similar methodology has failed to find any dissociation between explicit measures and the iat. using a very similar procedure to ratliff and nosek, carraro, negri, castelli, and pastore (2014) did find an illusory correlation on the iat, showing that the original dissociation was either not reliable or, more likely, not generalizable to similar but not identical conditions. in a similar vein, a recent experiment conducted in our laboratory (vadillo, de houwer, de schryver, ortega - castro, & matute, 2013) found an outcome - density effect using the iat. the divergences with ratliff and nosek are less surprising in this case, because vadillo. used a radically different design and procedure. however, this discrepancy converges to the idea that the failure of the iat to detect illusory correlations might not be a generalizable result. to better illustrate the results found with the iat, figure 6 depicts a forest plot with the divergent results of these studies. as can be seen, the only firm conclusion that can be drawn on the basis of this evidence is that the results are strikingly variable. in fact, the meta - analysis of these studies yielded an unusually large heterogeneity, q(4) = 134.18, p <.001. (2014) reported in their general discussion yielded results notably distant from those of their main study, although both of them were statistically significant. this variability suggests that whether or not illusory correlations are observed in the iat probably depends on a number of moderators that we still ignore. as shown in figure 6, the 95% confidence interval of the random - effects model includes zero. an advocate of dual - process models might claim that this null result of the meta - analysis supports the claim that illusory correlations are not found in implicit measures like the iat. however, the confidence interval does not just include zero : it extends over a large number of positive effect sizes. on the basis of the collective evidence, any value from 0.13 to a massive 1.16 could be an accurate estimate of the average cohen s d. we doubt that this evidence is clear or robust enough to abandon single - process models of illusory correlations, which offer a simple and parsimonious explanation for a large body of data (allan, 1993 ; fiedler, 2000 ; lpez. even more so, if we keep in mind that the only converging evidence from allan. in the previous sections we have reviewed the studies that have found dissociations in cue- and outcome - density effects across dependent variables (allan., 2005 ; perales. a common result of these experiments is that there are some dependent measures that only show sensitivity to contingency (e.g., ppred, d, or iat scores), while other dependent measures (e.g., contingency judgments) show sensitivity to both contingency and cue / outcome density. on the basis of this evidence, it has been suggested that two separate mechanisms are needed to explain (1) why people are able to learn the correct cue - outcome contingencies and (2) why their judgments are influenced not only by contingency but also by the overall probabilities of the cue and the outcome. however, on closer inspection, it appears that this evidence might not be reliable enough to justify this theoretical interpretation. a review of the available evidence from our laboratory and from other research groups shows that some of these results do not seem to be replicable or do not generalize easily to similar experimental settings. in our experiments, cue- and outcome - density manipulations seem to have a significant impact on all dependent measures. similarly, our simulations show that some of the dissociations previously reported in the literature might be due to simple methodological artifacts resulting from aspects of the design and the computation of the dependent variable. given the lack of strong evidence in favor of these dual - process accounts, we think that it is premature to abandon the idea that sensitivity to contingency and density biases are both attributable to the operation of a single mechanism. as mentioned in the introduction, this idea is an essential feature of many associative models that were originally invoked to account for cue- and outcome - density effects (lpez., 1998 ; shanks, 1995 ; it is also a central feature of alternative models of biased contingency detection, such as instance - based models (fiedler, 1996 ; meiser & hewstone, 2006 ; smith, 1991). beyond the specific details of these models, their common feature is that they all share the assumption that the same mechanism that is responsible for detecting and encoding the relationship between cues and outcomes is also responsible for density biases. in other words, there is no level of representation in the cognitive system where contingency information is represented in a format that is free from cue- or outcome - density biases. note that, although we favor single - process models of biased contingency detection, we do not ignore the fact that different processes might contribute to each of the dependent variables used in this kind of research. we do not question the idea that there are manipulations that might affect one dependent variable without affecting others. in fact, part of our own research has been directed at showing that judgments of contingency can vary considerably depending on seemingly minor procedural details like the wording of the test question (matute, vegas, & de marez, 2002 ; vadillo & matute, 2007 ; vadillo., 2005 ; see also crocker, 1982 ; de houwer. (2005) relies on the idea that participants sometimes adopt response strategies that might mask their true perception of contingency. what we are suggesting here is that there are no strong reasons to assume that there are two different levels of representation of contingency information, one that closely mirrors objective contingencies and one where that information is biased by factors like the probability of the cue or the probability of the outcome. in the absence of stronger evidence, it appears more parsimonious to assume that a single representation is learned during contingency - learning experiments and that this representation is biased by cue and outcome density at the encoding level. dual - process models of biased contingency detection share some ideas with other dichotomist models of cognition (evans & over, 1996 ; kahneman, 2011 ; osman, 2004 ; sloman, 1996 ; stanovich & west, 2000). there is a crucial difference, though, between the dual models reviewed in this article and other dual - process models. traditionally, dual models have tended to explain biases and cognitive illusions attributing them to very simple cognitive mechanisms that operate effortlessly and in a relatively automatic manner, usually related to simple encoding or retrieval processes. more complex cognitive mechanisms, usually strategic processes related to judgment and decision making, have been invoked to explain why people are sometimes able to overcome the harmful effect of these biases and intuitive reactions (e.g., kahneman, 2011). interestingly, the dual - process models of biased contingency detection that we review here make the opposite interpretation : correct contingency detection is attributed to the operation of basic encoding and retrieval processes, while biased judgments are attributed to more sophisticated judgment and decision - making processes. we might even say that these models present a benign view of biases in contingency detection : although people might show a bias in their judgments, deep inside their cognitive system there is some level of representation where information is represented accurately (a similar perspective can be found in de neys, 2012). the question of whether biases in contingency detection are due to basic encoding and retrieval processes or whether they reflect the operation of judgment and decision - making processes is not only important from a theoretical point of view. as mentioned above, it has been suggested that these biases might contribute to the development of superstitious and pseudoscientific thinking (gilovich, 1991 ; lindeman & svedholm, 2012 ; matute., 2011, 2015 ; redelmeier & tversky, 1996 ; vyse, 1997). given the societal costs of these and other biases, cognitive psychologists have started to develop a number of interventions and guidelines for protecting people from cognitive biases (barbera., 2013 ; lewandowsky, ecker, seifer, schwarz, & cook, 2012 ; lilienfeld, ammirati, & landfield, 2009 ; schmaltz & lilienfeld, 2014). interventions designed to reduce biases can only be successful to the extent that they are based on an accurate view of their underlying mechanisms. if the underlying information was somehow encoded in a bias - free format, as suggested by dual - process models of contingency learning, these beliefs should be relatively easy to modify. teaching people how to use more rationally the information and intuitions they already have should suffice to overcome these biases. this prediction stands in stark contrast with the well - known fact that superstitions are difficult to modify or eradicate (arkes, 1991 ; lilienfeld., 2009 ; nyhan, reifler, richey, & freed, 2014 ; pronin, gilovich, & ross, 2004 ; smith & slack, 2015). we think that the persisting effect of biases is more consistent with the view that these beliefs are hardwired in the way people encode information about the relationship between events, as suggested by single - process models. based on the evidence we have discussed so far, it seems safe to suggest that attempts to debias superstitions and misperceptions of contingency should include teaching people to look for unbiased information. | abstract. decades of research in causal and contingency learning show that people s estimations of the degree of contingency between two events are easily biased by the relative probabilities of those two events. if two events co - occur frequently, then people tend to overestimate the strength of the contingency between them. traditionally, these biases have been explained in terms of relatively simple single - process models of learning and reasoning. however, more recently some authors have found that these biases do not appear in all dependent variables and have proposed dual - process models to explain these dissociations between variables. in the present paper we review the evidence for dissociations supporting dual - process models and we point out important shortcomings of this literature. some dissociations seem to be difficult to replicate or poorly generalizable and others can be attributed to methodological artifacts. overall, we conclude that support for dual - process models of biased contingency detection is scarce and inconclusive. |
the incidence of occupational disease in mo has increased during the past decade, after a downwards trend during the preceding years. the incidence in 2006 was twice that in 1999, passing the level in rf. the most common causes (36.6%) of occupational disease were noise and vibration (8). musculoskeletal problems and diseases secondary to mechanical vibration have been identified as the most frequent health problems in kola mine workers. only 12% of miners working underground and 13.6% of miners working in open mines had never been diagnosed with some form of medical condition (9). an improved understanding of how occupational health and risk is assessed in mo is crucial in order to explain mine workers health in the region and to be able to compare different regions within the circumpolar north in terms of occupational health and overall morbidity. the aim of this study was to describe how occupational health and work exposure is assessed for mine workers in mo. information and data were obtained starting from search on pubmed for scientific publications, using combinations of the search words occupational health, russia, north, kola and assessment. of the articles available on pubmed, the majority were in russian language, with english abstracts only, and not available in full text online. some 20 were published in occupational medicine and industrial ecology / meditsina truda i promyshlennaya ecologiya. the articles were collected in full text in analog libraries at occupational health institutions in russia and, working together with russian colleges, their relevant content was translated to english language. in addition, we carried out a manual search for relevant publications issued during the last 5 years (20062010) in human ecology / ekologiya cheloveka, which is another major journal for occupational health in northwest russia, but not indexed in pubmed. in addition to information from scientific journals, search was carried out in other online sources for reports, available regional and federal statistics and legal documents governing the assessment of workers exposure and occupational health in the rf (laws, orders, standards and regulations). information was also obtained at the central institution for occupational health in mo from documents and reports that are not online but are central to this topic. information on workplace condition evaluation and assessment was also obtained from onsite inspections in the mines together with those russian occupational health specialists who are carrying out the assessment of occupational health in mine workers in this region. we describe the system and principles for diagnosis and assessment of occupational disease and the principles for workplace risk assessment and hazard grading. however, a full description of the procedures for diagnosing occupational diseases and calculating hazard grades is beyond the scope of this study. no ethical approval was needed for this study since no observation of individuals was included in the material. apatity and kirovsk have a combined population of 110,000 ; a decrease of 20% since 1990 (2). the apatite - nepheline mining and processing enterprise jsc apatit operates 4 mines, transportation lines and 2 concentrate plants in the area. jsc apatit employs 13,500 workers (20% of all industrial workers in mo), of which some 4,000 are directly employed in mining (table ii). women constitute 5.5% of the employees and 85% are ethnic russians (10). mines and number of mine workers in kirovsk joint stock company apatit also runs public transport, several leisure and sports complexes and a sanatorium for recreation and rehabilitation of its workers. there is also an education program for future miners at the khibiny technical college in kirovsk. in contrast to the early years of this mining community, kirovsk is now a more demographically diverse community. apatity and kirovsk have a combined population of 110,000 ; a decrease of 20% since 1990 (2). the apatite - nepheline mining and processing enterprise jsc apatit operates 4 mines, transportation lines and 2 concentrate plants in the area. jsc apatit employs 13,500 workers (20% of all industrial workers in mo), of which some 4,000 are directly employed in mining (table ii). women constitute 5.5% of the employees and 85% are ethnic russians (10). mines and number of mine workers in kirovsk joint stock company apatit also runs public transport, several leisure and sports complexes and a sanatorium for recreation and rehabilitation of its workers. there is also an education program for future miners at the khibiny technical college in kirovsk. in contrast to the early years of this mining community, kirovsk is now a more demographically diverse community. work exposure risk assessment, disease prevention, diagnosis of occupational disease and adjudication of compensation issues are central elements in the health care system for workers in mo. several institutions are involved. the mine workers undergo an annual health examination with thorough anamnesis and clinical investigations and tests involving physicians specialized on various organ systems. a committee of doctors concludes whether a medical condition should be classed as a confirmed occupational disease, a suspected occupational disease (person in an at risk group), or a non - occupational disease. for the worker, this can lead to relocation, compensation or coverage of medical treatment. these health and workplace assessments are performed on both a local and regional level and involve the institutions described below. this is the regional body of the russian board of health supervision and has the authority to intervene to improve conditions in a workplace and to shut it down (11). these centers exist on local and regional levels (located in kirovsk, monchegorsk and murmansk) and assess risk factors in workplaces. the findings are used in the characterization of workplace environment and then related to health conditions (details follow below). the krloh is the kola peninsula branch of the northwest public health research center in st. petersburg and is the central institution for competence and assessment regarding workers conditions and health in mo. the krloh also runs out- and in - patient clinics, a research department and a clinical chemical laboratory. it is funded through the budget of the federal northwest public health research center and by payments from the enterprises that make use of the specialist services. the krloh receives workers from several mines in the region : the 4 apatite mines in kirovsk (table ii), the kaula kotselvaara mine in nikel, the severny mines in zapoljarny and from mines in kovdor. the examination includes laboratory tests and clinical examination by organ specialists and specialists in occupational medicine ; data are recorded on a standardized chart and entered into an electronic database. information on the exposure characteristics of each type of workplace is also available at krloh. krloh cooperates closely with specialists at the municipal hospital in kirovsk in diagnostics and treatment and can refer workers to the local sanatorium. krloh also sends specialized staff and equipment to carry out periodical medical examination in nearby industrial towns (so - called komandirovka). krloh 's access to the industry, the workplaces and the workers is regulated through federal law (12), and it reports occupational health statistics to the federal state statistics service (goskomstat) and to rospotrebnadzor. in addition to krloh, the municipal hospitals in monchegorsk, zapoljarny and olenegorsk are authorized to perform regular medical examinations of workers. however, no miners are examined in the monchegorsk hospital (as no miners live and work in the monchegorsk area). the assessment of workers health consists of both an initial medical examination and periodic check - ups. these are conducted according to federal laws (12,13) and decree (14). potential new employees undergo pre - employment examinations to check if whether they fill the medical requirements. the assessed risk in the work environment determines the frequency of later periodic examinations : every year or every fifth year. if municipal hospitals do not have the full team of specialists to fulfill the legal requirements miners who have their check - ups at municipal hospitals are also examined by specialists from krloh every fifth year, as a minimum requirement (14). approved institutions outside mo can also compete for the contract to conduct periodic medical examinations. although this has not yet happened, rospotrebnadzor has expressed concerns over the possibility that such examinations might be of lower quality (11). note that a guideline has been developed for the assessment of occupational health in a regional context. the main regulations governing the occupational health issues in russian federation the center for epidemiology and hygienic surveillance carries out characterization of working conditions. for each profession and workplace, there is a list of factors (physical, biological, chemical and psychosocial) that are measured or quantified. the weighted sum of the factors is used to calculate hazard grades from 0 to 4 (15). additional details concerning hazard grades in the mining industry have been presented by chaschin and askarova (16). grading system for assessment of health hazard calculated hazard grade for wbv has been 3.13.2 for load - haul - dump vehicle drivers in an underground mine in kirovsk (17). for other groups of underground mine workers, the hazard grades do not correspond directly with the european limit and action values. however, yet unpublished comparative studies indicate that the whole body vibration exposure levels classed as hazard grade 3.2 in load - haul - dump vehicles are similar to the limit value in the european system (19). the order 90 (14) states which hazard grades can be allowed for various professions and workplaces. hazard grades are also part of the basis for calculation of salary, with higher hazard grades rendering higher pay. work at hazard grade 4 is only allowed for short time periods, as in emergency situations. all categories of workplaces are listed in the order 90 with corresponding medical recommendations and conditions that disqualify for employment (14). as mentioned, all workplaces are characterized in terms of hazard grades, and these grades are compared with the medical profile of the person seeking employment. the order 90 also specifies which clinical and laboratory tests and specialist examinations are required. the document follows the worker throughout his or her career and is updated at later medical examinations. all workers have to undergo periodic medical check - ups to renew their work certificates at a frequency that depends on the hazard grade of the individual 's workplace. employees with an overall hazard grade of 3.1 or more undergo medical examination annually, while employees with hazard grade 2 or below have an examination every fifth year. the order 90 lists the examinations, equipment, clinical and laboratory tests and specialists required for these check - ups (14). krloh has assembled and published the methodical recommendations for medical examinations, how to interpret the results of the periodic medical examinations and how to prepare individual medical advice (20). the purpose of the check - up is to identify possible occupational disease during the period of employment. there are 3 possible outcomes (recommendations) from this periodic check - up : (a) if no work - related health problems are found, the employee can continue to work, (b) if the check - up suggest that the employee may be developing occupational disease, the employee can not continue to work in the current work environment and should be relocated and (c) if a condition is diagnosed and approved as being occupational disease, the employee should be relocated and can apply for compensation. these final decisions are based on a wide set of information, evaluated by a consultative group of 8 doctors. the group consists of the chief and deputy physician and physicians in several specialties, as specified in the order 90. their main tasks are to identify pathological conditions at an early stage and to prevent a condition from progressing through advice and relocation. the examining institution receives payment from the workers employer for the work (14). for a medical condition to be approved as occupational disease, 4 conditions must be present : (a) the condition must be among the diseases that may qualify, as listed in the order 90, (b) the exposure must be known to be present in the work environment, (c) this exposure must have a recognized causal link to the disease in question and finally, (d) the exposure must precede the onset of disease by a reasonable amount of time. these conditions must be considered and assessed in institutions that are specialized in occupational medicine (14), such as krloh in the case of mine workers in mo. if the condition is considered to meet the criteria and is approved as an occupational disease, the worker must apply for occupational disease compensation from the government. workers who have private insurance may apply for compensation as well, but such insurance is not mandatory. the decision whether to grant compensation is made by the local special medical social committee msek (russian abbreviation mck). a negative local ruling can be reassessed at the regional level in mo or appealed to the msek committees in st. the level of disability is graded as : (a) disability that precludes work, (b) disability that does not preclude work and (c) reversible disability that does not preclude work but necessitates relocation. doctors may be subject to compensation claims if a worker who is exposed to hazardous factors at the workplace is not relocated due to mistakes or negligence on the part of the doctors and goes on to develop an occupational disease. hazard grades of 3.1 and above can motivate relocation of persons at particular risk of developing an occupational disease to a workplace where exposure to the harmful factor is lower. if relocation or loss of job leads to a reduction or loss of salary, this is partly compensated by monthly payments (14). being diagnosed with an occupational disease will also lead to a lower retirement age and a higher pension. however, the pension is less than the salary of a mine worker, especially if the workplace environment has high hazard grades. the diagnosis will qualify the worker for free treatment of the occupational disease, also in sanatoriums (12,13). workers with an occupational disease that is considered to be in an early stage can be referred for early intervention to prevent further progress or to reverse a pathological process. this is the regional body of the russian board of health supervision and has the authority to intervene to improve conditions in a workplace and to shut it down (11). these centers exist on local and regional levels (located in kirovsk, monchegorsk and murmansk) and assess risk factors in workplaces. the findings are used in the characterization of workplace environment and then related to health conditions (details follow below). the krloh is the kola peninsula branch of the northwest public health research center in st. petersburg and is the central institution for competence and assessment regarding workers conditions and health in mo. the krloh also runs out- and in - patient clinics, a research department and a clinical chemical laboratory. it is funded through the budget of the federal northwest public health research center and by payments from the enterprises that make use of the specialist services. the krloh receives workers from several mines in the region : the 4 apatite mines in kirovsk (table ii), the kaula kotselvaara mine in nikel, the severny mines in zapoljarny and from mines in kovdor. the examination includes laboratory tests and clinical examination by organ specialists and specialists in occupational medicine ; data are recorded on a standardized chart and entered into an electronic database. information on the exposure characteristics of each type of workplace is also available at krloh. krloh cooperates closely with specialists at the municipal hospital in kirovsk in diagnostics and treatment and can refer workers to the local sanatorium. krloh also sends specialized staff and equipment to carry out periodical medical examination in nearby industrial towns (so - called komandirovka). krloh 's access to the industry, the workplaces and the workers is regulated through federal law (12), and it reports occupational health statistics to the federal state statistics service (goskomstat) and to rospotrebnadzor. in addition to krloh, the municipal hospitals in monchegorsk, zapoljarny and olenegorsk are authorized to perform regular medical examinations of workers. however, no miners are examined in the monchegorsk hospital (as no miners live and work in the monchegorsk area). the assessment of workers health consists of both an initial medical examination and periodic check - ups. these are conducted according to federal laws (12,13) and decree (14). potential new employees undergo pre - employment examinations to check if whether they fill the medical requirements. the assessed risk in the work environment determines the frequency of later periodic examinations : every year or every fifth year. if municipal hospitals do not have the full team of specialists to fulfill the legal requirements miners who have their check - ups at municipal hospitals are also examined by specialists from krloh every fifth year, as a minimum requirement (14). approved institutions outside mo can also compete for the contract to conduct periodic medical examinations. although this has not yet happened, rospotrebnadzor has expressed concerns over the possibility that such examinations might be of lower quality (11). note that a guideline has been developed for the assessment of occupational health in a regional context. the center for epidemiology and hygienic surveillance carries out characterization of working conditions. for each profession and workplace, there is a list of factors (physical, biological, chemical and psychosocial) that are measured or quantified. the weighted sum of the factors is used to calculate hazard grades from 0 to 4 (15). additional details concerning hazard grades in the mining industry have been presented by chaschin and askarova (16). grading system for assessment of health hazard calculated hazard grade for wbv has been 3.13.2 for load - haul - dump vehicle drivers in an underground mine in kirovsk (17). for other groups of underground mine workers, however, yet unpublished comparative studies indicate that the whole body vibration exposure levels classed as hazard grade 3.2 in load - haul - dump vehicles are similar to the limit value in the european system (19). the order 90 (14) states which hazard grades can be allowed for various professions and workplaces. hazard grades are also part of the basis for calculation of salary, with higher hazard grades rendering higher pay. work at hazard grade 4 is only allowed for short time periods, as in emergency situations. all categories of workplaces are listed in the order 90 with corresponding medical recommendations and conditions that disqualify for employment (14). as mentioned, all workplaces are characterized in terms of hazard grades, and these grades are compared with the medical profile of the person seeking employment. the order 90 also specifies which clinical and laboratory tests and specialist examinations are required. the document follows the worker throughout his or her career and is updated at later medical examinations. all workers have to undergo periodic medical check - ups to renew their work certificates at a frequency that depends on the hazard grade of the individual 's workplace. employees with an overall hazard grade of 3.1 or more undergo medical examination annually, while employees with hazard grade 2 or below have an examination every fifth year. the order 90 lists the examinations, equipment, clinical and laboratory tests and specialists required for these check - ups (14). krloh has assembled and published the methodical recommendations for medical examinations, how to interpret the results of the periodic medical examinations and how to prepare individual medical advice (20). the purpose of the check - up is to identify possible occupational disease during the period of employment. the findings may affect the worker 's possibility to continue in the work position. there are 3 possible outcomes (recommendations) from this periodic check - up : (a) if no work - related health problems are found, the employee can continue to work, (b) if the check - up suggest that the employee may be developing occupational disease, the employee can not continue to work in the current work environment and should be relocated and (c) if a condition is diagnosed and approved as being occupational disease, the employee should be relocated and can apply for compensation. these final decisions are based on a wide set of information, evaluated by a consultative group of 8 doctors. the group consists of the chief and deputy physician and physicians in several specialties, as specified in the order 90. their main tasks are to identify pathological conditions at an early stage and to prevent a condition from progressing through advice and relocation. the examining institution receives payment from the workers employer for the work (14). for a medical condition to be approved as occupational disease, 4 conditions must be present : (a) the condition must be among the diseases that may qualify, as listed in the order 90, (b) the exposure must be known to be present in the work environment, (c) this exposure must have a recognized causal link to the disease in question and finally, (d) the exposure must precede the onset of disease by a reasonable amount of time. these conditions must be considered and assessed in institutions that are specialized in occupational medicine (14), such as krloh in the case of mine workers in mo. if the condition is considered to meet the criteria and is approved as an occupational disease, the worker must apply for occupational disease compensation from the government. workers who have private insurance may apply for compensation as well, but such insurance is not mandatory. the decision whether to grant compensation is made by the local special medical social committee msek (russian abbreviation mck). a negative local ruling can be reassessed at the regional level in mo or appealed to the msek committees in st. the level of disability is graded as : (a) disability that precludes work, (b) disability that does not preclude work and (c) reversible disability that does not preclude work but necessitates relocation. doctors may be subject to compensation claims if a worker who is exposed to hazardous factors at the workplace is not relocated due to mistakes or negligence on the part of the doctors and goes on to develop an occupational disease. hazard grades of 3.1 and above can motivate relocation of persons at particular risk of developing an occupational disease to a workplace where exposure to the harmful factor is lower. if relocation or loss of job leads to a reduction or loss of salary, this is partly compensated by monthly payments (14). being diagnosed with an occupational disease will also lead to a lower retirement age and a higher pension. however, the pension is less than the salary of a mine worker, especially if the workplace environment has high hazard grades. the diagnosis will qualify the worker for free treatment of the occupational disease, also in sanatoriums (12,13). workers with an occupational disease that is considered to be in an early stage can be referred for early intervention to prevent further progress or to reverse a pathological process. all categories of workplaces are listed in the order 90 with corresponding medical recommendations and conditions that disqualify for employment (14). as mentioned, all workplaces are characterized in terms of hazard grades, and these grades are compared with the medical profile of the person seeking employment. the order 90 also specifies which clinical and laboratory tests and specialist examinations are required. the document follows the worker throughout his or her career and is updated at later medical examinations. all workers have to undergo periodic medical check - ups to renew their work certificates at a frequency that depends on the hazard grade of the individual 's workplace. employees with an overall hazard grade of 3.1 or more undergo medical examination annually, while employees with hazard grade 2 or below have an examination every fifth year. the order 90 lists the examinations, equipment, clinical and laboratory tests and specialists required for these check - ups (14). krloh has assembled and published the methodical recommendations for medical examinations, how to interpret the results of the periodic medical examinations and how to prepare individual medical advice (20). the purpose of the check - up is to identify possible occupational disease during the period of employment. there are 3 possible outcomes (recommendations) from this periodic check - up : (a) if no work - related health problems are found, the employee can continue to work, (b) if the check - up suggest that the employee may be developing occupational disease, the employee can not continue to work in the current work environment and should be relocated and (c) if a condition is diagnosed and approved as being occupational disease, the employee should be relocated and can apply for compensation. these final decisions are based on a wide set of information, evaluated by a consultative group of 8 doctors. the group consists of the chief and deputy physician and physicians in several specialties, as specified in the order 90. their main tasks are to identify pathological conditions at an early stage and to prevent a condition from progressing through advice and relocation. the examining institution receives payment from the workers employer for the work (14). for a medical condition to be approved as occupational disease, 4 conditions must be present : (a) the condition must be among the diseases that may qualify, as listed in the order 90, (b) the exposure must be known to be present in the work environment, (c) this exposure must have a recognized causal link to the disease in question and finally, (d) the exposure must precede the onset of disease by a reasonable amount of time. these conditions must be considered and assessed in institutions that are specialized in occupational medicine (14), such as krloh in the case of mine workers in mo. if the condition is considered to meet the criteria and is approved as an occupational disease, the worker must apply for occupational disease compensation from the government. workers who have private insurance may apply for compensation as well, but such insurance is not mandatory. the decision whether to grant compensation is made by the local special medical social committee msek (russian abbreviation mck). a negative local ruling can be reassessed at the regional level in mo or appealed to the msek committees in st. the level of disability is graded as : (a) disability that precludes work, (b) disability that does not preclude work and (c) reversible disability that does not preclude work but necessitates relocation. doctors may be subject to compensation claims if a worker who is exposed to hazardous factors at the workplace is not relocated due to mistakes or negligence on the part of the doctors and goes on to develop an occupational disease. hazard grades of 3.1 and above can motivate relocation of persons at particular risk of developing an occupational disease to a workplace where exposure to the harmful factor is lower. if relocation or loss of job leads to a reduction or loss of salary, this is partly compensated by monthly payments (14). being diagnosed with an occupational disease will also lead to a lower retirement age and a higher pension. however, the pension is less than the salary of a mine worker, especially if the workplace environment has high hazard grades. the diagnosis will qualify the worker for free treatment of the occupational disease, also in sanatoriums (12,13). workers with an occupational disease that is considered to be in an early stage can be referred for early intervention to prevent further progress or to reverse a pathological process. this study provides insight into how occupational health is organized and assessed in mo, both in general and in mine workers specifically, and how the official figures on occupational health are collected. given the large and growing number of mine workers in the region, this is a topic of high relevance when studying health issues and interpreting health indicators in this population. occupational health of mine workers in mo is investigated through a battery of tests and examinations of individual health and workplace. these systematic procedures can affect the mine workers medically and economically, as there are both advantages and disadvantages to being diagnosed with occupational disease or working in an environment with a health hazard. if a work environment is declared hazardous to health, this would increase the worker 's salary or cause relocation, rather than obliging the employer to reduce the exposure to safe levels, as in most other european countries. relocation might be an expression of a greater focus on recuperation from than on prevention of health problems. since relocation to a work environment with lower hazard grades leads to lower salary, the system could make the workers prone to conceal their health problems by under - reporting or even taking medication prior to the examination to improve test results. this applies especially to medical conditions for which the diagnosis is based on information from the employees themselves and not on objective tests. to what degree the built - in mechanisms in the system have led to under - ascertainment of disease and injury would be difficult to evaluate. the character of the periodic medical examinations is control based and mandatory rather than based on trust. the system does provide employees with extensive health assessments, which may be regarded as a fringe benefit. still, this check - up activity might also take place at the expense of prophylactic approaches (21). some employers, feeling they have little to gain from the annual examination, might have made little effort to facilitate the examination. in practice, many smaller firms have not been offering the medical examinations as legislated (11). in the mine industry in the mo, however, the medical examinations have been a part of the workplace routine and the participation rates of both employers and employees have been high. in krloh, the mo appears to have a well - qualified center to perform periodic medical examinations of mine workers and diagnose occupational disease, as the staff at krloh has the required skills and experience. however, since the occupational health institutions receive payment for these examinations from the employer, there is a risk of financial dependency in this relationship. thus, the free and independent status of the medical institutions performing the medical assessment of workers could be undermined. the number of workers diagnosed with occupational disease might therefore depend not only on hazardous exposure levels in the workplaces but also on factors arising from the relationships between the enterprise, employees and the medical institutions (18). despite the past decade 's improvements in work conditions due to more modern technology, the russian norms for exposure levels were exceeded in mo for 39% of male and 25% of female workers (9). in addition, methodological factors (improvements in diagnosis, occupational health care systems and registration regimes at krloh) might explain the observed increase in number of cases of approved occupational disease in this mining population (7). however, the fact that the medical examinations of most mine workers in mo have been performed by a single institution implies stable quality and continuity of the work and gives added value to the numbers. mo adheres to the same legal framework as all of the rf, so our findings concerning requirements, procedures and standards can be generalized to the rest of the country. internationally published information is very scarce, and material published in russia is not readily located through databases and usually not accessible electronically. our findings concerning the regulations, procedures and institutions involved in the assessment of occupational health and work places in mo show the importance of understanding this framework when studying the health of working populations and interpreting official health statistics in the circumpolar regions and countries. our study disclosed the existence of thorough regulations and well - established systems to protect and follow up the health of workers in mines and industry in russia. however, the system appears to emphasise control and repair more than prevention of occupational disease and injury. the economic incentives for the workers and the close economic ties between the medical institutions that provide the check - ups and the mining enterprises in mo may not be optimal for protection of health of this population of workers. two of the authors (siurin and talykova) are employed in one of the institutions presented in the study. | objectiveswe aimed to describe how work exposure and occupational health is assessed for mine workers in murmansk oblast, russia.study designa descriptive study based on current practice, laws and available literature.methodsthe information and data were obtained from scientific publications, reports, regional and federal statistics, legal documents, through personal visits and onsite inspections.resultsseveral institutions are involved in these assessments, but all mine workers have been examined by specialists at one institution, which helps to ensure that the work is of stable quality and adds reliability value to the numbers. workplace risks are assigned hazard grades, which influence the frequency of periodic medical examinations and salary levels. the examinations are aimed to diagnose latent or manifest occupational disease. this may lead to relocation to a workplace with lower exposure levels, free medical treatment, compensation and a lower pension age.conclusionsregulations and systems to protect the health of mine workers have more emphasis on control and repair than on prevention. since relocation can lower the salary, some workers may under - report medical problems. to what degree this happens is unknown. the mining enterprises pay the medical service provider for periodic medical examinations, which could potentially weaken their independent role. this framework is important to understand when studying and assessing the health of working populations in the circumpolar region. |
healthy volunteers were recruited from the general population of the delaware valley (10). the protocol was approved by the institutional review board of the university of pennsylvania, and subjects gave written informed consent. briefly, criteria included healthy men or nonpregnant / lactating women, aged 1840 years, with bmi of 1830 kg / m. twenty subjects were recruited, equally divided by sex, to the university of pennsylvania 's clinical translational research center for three visits : visit 1 for screening ; visit 2, 2 weeks later, for frequently sampled intravenous glucose tolerance (fsigt) testing and dietary counseling ; and visit 3, consisting of an overnight acclimatization phase, a 24-h saline control phase, and a 24-h post - lipopolysaccharide (lps) study phase (60-h total). lps (u.s. cc - re - lot-1 + 2 ; clinical center, pharmacy department, national institutes of health) was given intravenously as a 3 ng / kg bolus at 0600 h on day 2. blood samples (nine before and nine after lps) and subcutaneous gluteal adipose aspiration - biopsy samples (before and 4, 12, and 24 h after lps) were collected (in n = 17 participants ; 621.4 253.1 mg average weight per sample). two weeks prior to lps and 24 h following lps, the insulin sensitivity index (si) was derived from an fsigt test. we chose the 24-h post - lps because we expected ir to be established by this time point based on human and animal experimental and observational data (8,1012) and because of practical considerations given the experimental design. we chose fsigt as the method for determining insulin sensitivity because the test also provides a measure of pancreatic -cell function, the acute insulin response to glucose (airg), and so allows assessment of endotoxemia effects on the -cell. the fsigt test was conducted using the insulin - modified approach as previously described (13). si was derived from bergman 's minimal model (14) using minmod millennium software (15). airg was calculated as the incremental area under the curve for insulin from t = 0 to 10 min (12). complementary estimates of ir and -cell function, the homeostasis model assessment for ir (homa - ir) index [glucose (mmol / l) insulin (u / ml)/22.5 ], and the homa for -cell function (homa - b) index [insulin (u / ml) 20/glucose (mmol / l) 3.5 ] were calculated using fasting glucose and insulin values at 24 h and 5 min before and 24 h after lps. plasma biomarkers and lipoprotein measurement was described previously (10) and is outlined in the online appendix. rna isolation, real - time pcr quantification of mrnas, and adipose protein isolation for western blotting are described in detail in the online appendix. rna extraction was performed for measurement of mrna levels of interleukin (il)-6, tumor necrosis factor (tnf)-, tnf - induced protein 3 (a20), resistin, socs-1, socs-2, socs-3, socs-6, insulin receptor, irs-1, irs-2, irs-3, irs-4, glut4, and chemokines monocyte chemoattractant protein-1 (mcp-1) and c - x - c motif ligand 10 (cxcl10) (online appendix table 1). macrophage marker human epidermal growth factor module containing mucin - like receptor 1 (emr1-f4/80) mrna also was assayed in adipose. data are reported as means se for continuous variables and as proportions for categorical variables. in general, the effect of endotoxemia on plasma biomarkers, metabolic measures, blood and adipose mrnas, and adipose protein levels were tested by mixed - effects modeling or repeated - measures anova. for plasma data, we considered the time - matched difference (after minus before for matched time points prior to and following lps) in biomarker responses and used a mixed - effects model to consider the effect due to lps. a variety of models including linear, quadratic, and cubic polynomial were fit, and the best fit for each variable was used for final analyses (e.g., quadratic models for tnf, il-6, and resistin). a similar time - matched mixed - effect modeling approach was applied to whole - blood mrna data. repeated - measures anova was applied to fsigt data (si and airg), homa data (homa - ir and homa - b), and adipose mrna data. when significant global differences were found in anova, analyses were performed using the freeware statistical package r (version 2.4.1 ; the r foundation for statistical computing). two weeks prior to lps and 24 h following lps, the insulin sensitivity index (si) was derived from an fsigt test. we chose the 24-h post - lps because we expected ir to be established by this time point based on human and animal experimental and observational data (8,1012) and because of practical considerations given the experimental design. we chose fsigt as the method for determining insulin sensitivity because the test also provides a measure of pancreatic -cell function, the acute insulin response to glucose (airg), and so allows assessment of endotoxemia effects on the -cell. the fsigt test was conducted using the insulin - modified approach as previously described (13). si was derived from bergman 's minimal model (14) using minmod millennium software (15). airg was calculated as the incremental area under the curve for insulin from t = 0 to 10 min (12). complementary estimates of ir and -cell function, the homeostasis model assessment for ir (homa - ir) index [glucose (mmol / l) insulin (u / ml)/22.5 ], and the homa for -cell function (homa - b) index [insulin (u / ml) 20/glucose (mmol / l) 3.5 ] were calculated using fasting glucose and insulin values at 24 h and 5 min before and 24 h after lps. plasma biomarkers and lipoprotein measurement was described previously (10) and is outlined in the online appendix. rna isolation, real - time pcr quantification of mrnas, and adipose protein isolation for western blotting are described in detail in the online appendix. rna extraction was performed for measurement of mrna levels of interleukin (il)-6, tumor necrosis factor (tnf)-, tnf - induced protein 3 (a20), resistin, socs-1, socs-2, socs-3, socs-6, insulin receptor, irs-1, irs-2, irs-3, irs-4, glut4, and chemokines monocyte chemoattractant protein-1 (mcp-1) and c - x - c motif ligand 10 (cxcl10) (online appendix table 1). macrophage marker human epidermal growth factor module containing mucin - like receptor 1 (emr1-f4/80) mrna also was assayed in adipose. data are reported as means se for continuous variables and as proportions for categorical variables. in general, the effect of endotoxemia on plasma biomarkers, metabolic measures, blood and adipose mrnas, and adipose protein levels were tested by mixed - effects modeling or repeated - measures anova. for plasma data, we considered the time - matched difference (after minus before for matched time points prior to and following lps) in biomarker responses and used a mixed - effects model to consider the effect due to lps. a variety of models including linear, quadratic, and cubic polynomial were fit, and the best fit for each variable was used for final analyses (e.g., quadratic models for tnf, il-6, and resistin). a similar time - matched mixed - effect modeling approach was applied to whole - blood mrna data. repeated - measures anova was applied to fsigt data (si and airg), homa data (homa - ir and homa - b), and adipose mrna data. when significant global differences were found in anova, post hoc paired t tests were used to compare time points. analyses were performed using the freeware statistical package r (version 2.4.1 ; the r foundation for statistical computing). participants were healthy adults volunteers (n = 20, 50% male, 80% caucasian, aged 25.7 3.9 years). they had normal blood pressure, plasma lipoproteins, bmi, and body fat distribution (table 1), and baseline si and homa - ir were consistent with data from healthy subjects published by our group (13). endotoxemia produced a transient febrile illness in all subjects with increases in temperature, heart rate, and white blood cell count largely resolving by 812 h following lps (table 2). baseline characteristics of study participants peak clinical and systemic inflammatory responses during endotoxemia clinical parameters and plasma levels of cytokines are presented as means sd. briefly, endotoxemia induced a marked, rapid, and transient induction of plasma tnf and il-6 (table 2), followed by a robust increase in circulating resistin and a delayed but significant increase in leptin and leptin - soluble leptin ratio in plasma. we now report significant increases in additional circulating inflammatory markers including mcp-1 and high - sensitivity c - reactive protein (hscrp) (fig. 1a) as well as plasma cortisol and free fatty acids, with a trend toward increased growth hormone (gh) (p = 0.08) levels (fig. overall, these findings confirm a transient inflammatory response during human endotoxemia with modulation of several inflammatory, adipokine, and hormonal cascades that are known to impact insulin sensitivity. b : plasma cortisol and free fatty acids increased significantly with a trend for increase in gh (p = 0.08). we hypothesized that these inflammatory and metabolic perturbations would induce ir without altering pancreatic -cell function. insulin sensitivity, measured as si, declined by over 30% from 2 weeks prior to 24 h after lps (3.17 1.66 to 2.06 10 [u ml min ], p < 0.005) (fig. in contrast, airg, a measure of pancreatic -cell function, showed no change following lps (711 418 to 744 488 u ml min, p = 0.7) (fig. consistent with the fsigt data, homa - ir was 39 and 46% higher at 24 h after lps (2.17 0.83) than 24 h (1.56 0.62 ; p < 0.001) and 5 min (1.49 0.63 ; p < 0.001) prior to lps (fig. 2c), while homa - b, an estimate of pancreatic -cell function, was not influenced by the endotoxemia state (p = 0.81) (fig. we observed a modest negative correlation (spearman r = 0.51) between homa - ir and si consistent with prior work highlighting the differences in fasting versus evoked physiology captured by these indexes (16). endotoxemia suppressed the insulin sensitivity index (si) at fsigt testing (a), whereas there was no change in the fsigt test - derived acute insulin response to glucose (airg) (b), a measure of pancreatic -cell function. consistent with this, the homa of ir fell following lps (c), while the homa - b estimate of -cell function was unchanged (d). we explored whether peak levels of inflammatory and metabolic biomarkers (tnf, il-6, mcp-1, hscrp, resistin, cortisol, gh, or free fatty acids) correlated with the degree of induced ir. we found that peak hscrp (spearman r = 0.57, p < 0.03) and resistin (r = 0.47, p = 0.08) tended to correlate with change in homa - ir, a measure of hepatic ir, while the peak ffa levels were inversely correlated (r = 0.81, p = 0.004) with si, a measure of peripheral insulin sensitivity. endotoxemia induced a robust innate inflammatory response in adipose with increases in mrna levels of il-6 (peak 110-fold, anova f = 64.5, p < 0.001), tnf (peak 6-fold, f = 4.9, p < 0.001), and a20 (peak 11-fold, f = 79.7, p < 0.001) (fig. adipose mrna levels of mcp-1 (peak 30-fold, f = 3.49, p = 0.03), a chemokine implicated in adipose macrophage recruitment (3,4), and cxcl10 (peak 15-fold, f = 8.5, p < 0.005), a t - cell chemokine, were markedly induced during endotoxemia (fig. 3b). supporting these mrna changes, protein levels of both a20 and mcp-1 were significantly increased in adipose at western blotting (fig. remarkably, adipose mrna levels of resistin (fourfold, f = 6.9, p < 0.001), a leukocyte - derived cytokine in humans, and emr1-f4/80 (peak 13-fold, f = 13.8, p < 0.001), a macrophage marker, were increased, suggesting recruitment of leukocytes to adipose during endotoxemia. a : endotoxemia increased adipose il-6, tnf-, and tnf - induced protein 3 (a20) mrna levels. b : in parallel, mrna levels of mcp-1 and cxcl10, monocyte, and t - cell chemokines were induced. c : western blotting confirmed increases in adipose a20 and mcp-1 proteins (representative blot shown ; densitometry n = 3 ; anova p < 0.05). we sought evidence that adipose inflammation modulated insulin signaling pathways in adipose. prior to lps, socs-3, socs-6, and socs-2 mrnas were the most abundant in human adipose with evidence of differential expression compared with whole blood (supplementary table 2). following endotoxin, adipose socs-1 (10-fold) and socs-3 (20-fold), but not socs-2 or socs-6, mrnas increased markedly (fig. there were similar striking changes in whole - blood socs-1 and socs-3 (3-fold and 30-fold, respectively), but endotoxin actually reduced socs-2 and socs-6 mrna in blood (fig. endotoxemia induced (a) adipose and (b) whole - blood mrna levels of socs-1 and socs-3, but not socs-2 and socs-6. p < 0.0001 in anova (adipose) or mixed - effects model (blood). prior to lps, we detected mrna for irs-1 and irs-2 but not irs-3 or irs-4 in adipose with differential expression compared with whole blood (supplementary table 2). irs-1 mrna levels also fell (by 53%), but irs-2 mrna increased (2.3-fold increase) (table 3). in parallel, insulin receptor mrna levels decreased significantly in blood but not in adipose, and there was no significant change in glut4 mrna in adipose or whole blood (table 3). western blotting of adipose proteins generally supported mrna data with reduction in irs-1 but no change in insulin receptor ; however, glut4 protein levels tended to fall (fig. furthermore, enhanced serine phosphoryation of akt, with no change in total akt (fig. 5), was observed consistent with previous findings of tnf - induced serine phosphorylation of akt in adipocytes (17). overall, endotoxemia induced specific socs proteins and modulated several components of the insulin signaling pathway in adipose. insulin signaling proteins are modulated in adipose and whole blood during endotoxemia western blot of insulin signaling proteins in adipose tissue. relative to -actin, endotoxin reduced protein levels of irs-1 and glut4, increased phosphorylated - akt (p - akt), and had no effect on insulin receptor expression (representative blot shown ; densitometry for irs-1 and p - akt n = 3 ; anova p < 0.01). participants were healthy adults volunteers (n = 20, 50% male, 80% caucasian, aged 25.7 3.9 years). they had normal blood pressure, plasma lipoproteins, bmi, and body fat distribution (table 1), and baseline si and homa - ir were consistent with data from healthy subjects published by our group (13). endotoxemia produced a transient febrile illness in all subjects with increases in temperature, heart rate, and white blood cell count largely resolving by 812 h following lps (table 2). baseline characteristics of study participants peak clinical and systemic inflammatory responses during endotoxemia clinical parameters and plasma levels of cytokines are presented as means sd. briefly, endotoxemia induced a marked, rapid, and transient induction of plasma tnf and il-6 (table 2), followed by a robust increase in circulating resistin and a delayed but significant increase in leptin and leptin - soluble leptin ratio in plasma. we now report significant increases in additional circulating inflammatory markers including mcp-1 and high - sensitivity c - reactive protein (hscrp) (fig. 1a) as well as plasma cortisol and free fatty acids, with a trend toward increased growth hormone (gh) (p = 0.08) levels (fig. overall, these findings confirm a transient inflammatory response during human endotoxemia with modulation of several inflammatory, adipokine, and hormonal cascades that are known to impact insulin sensitivity. b : plasma cortisol and free fatty acids increased significantly with a trend for increase in gh (p = 0.08). we hypothesized that these inflammatory and metabolic perturbations would induce ir without altering pancreatic -cell function. insulin sensitivity, measured as si, declined by over 30% from 2 weeks prior to 24 h after lps (3.17 1.66 to 2.06 10 [u ml min ], p < 0.005) (fig. in contrast, airg, a measure of pancreatic -cell function, showed no change following lps (711 418 to 744 488 u ml min, p = 0.7) (fig. consistent with the fsigt data, homa - ir was 39 and 46% higher at 24 h after lps (2.17 0.83) than 24 h (1.56 0.62 ; p < 0.001) and 5 min (1.49 0.63 ; p < 0.001) prior to lps (fig. 2c), while homa - b, an estimate of pancreatic -cell function, was not influenced by the endotoxemia state (p = 0.81) (fig. 2d). we observed a modest negative correlation (spearman r = 0.51) between homa - ir and si consistent with prior work highlighting the differences in fasting versus evoked physiology captured by these indexes (16). endotoxemia suppressed the insulin sensitivity index (si) at fsigt testing (a), whereas there was no change in the fsigt test - derived acute insulin response to glucose (airg) (b), a measure of pancreatic -cell function. consistent with this, the homa of ir fell following lps (c), while the homa - b estimate of -cell function was unchanged (d). we explored whether peak levels of inflammatory and metabolic biomarkers (tnf, il-6, mcp-1, hscrp, resistin, cortisol, gh, or free fatty acids) correlated with the degree of induced ir. we found that peak hscrp (spearman r = 0.57, p < 0.03) and resistin (r = 0.47, p = 0.08) tended to correlate with change in homa - ir, a measure of hepatic ir, while the peak ffa levels were inversely correlated (r = 0.81, p = 0.004) with si, a measure of peripheral insulin sensitivity. endotoxemia induced a robust innate inflammatory response in adipose with increases in mrna levels of il-6 (peak 110-fold, anova f = 64.5, p < 0.001), tnf (peak 6-fold, f = 4.9, p < 0.001), and a20 (peak 11-fold, f = 79.7, p < 0.001) (fig. adipose mrna levels of mcp-1 (peak 30-fold, f = 3.49, p = 0.03), a chemokine implicated in adipose macrophage recruitment (3,4), and cxcl10 (peak 15-fold, f = 8.5, p < 0.005), a t - cell chemokine, were markedly induced during endotoxemia (fig. 3b). supporting these mrna changes, protein levels of both a20 and mcp-1 were significantly increased in adipose at western blotting (fig. remarkably, adipose mrna levels of resistin (fourfold, f = 6.9, p < 0.001), a leukocyte - derived cytokine in humans, and emr1-f4/80 (peak 13-fold, f = 13.8, p < 0.001), a macrophage marker, were increased, suggesting recruitment of leukocytes to adipose during endotoxemia. a : endotoxemia increased adipose il-6, tnf-, and tnf - induced protein 3 (a20) mrna levels. b : in parallel, mrna levels of mcp-1 and cxcl10, monocyte, and t - cell chemokines were induced. c : western blotting confirmed increases in adipose a20 and mcp-1 proteins (representative blot shown ; densitometry n = 3 ; anova p < 0.05). socs family proteins inhibit tyrosine kinase receptor signaling including the insulin receptor. at baseline prior to lps, socs-3, socs-6, and socs-2 mrnas were the most abundant in human adipose with evidence of differential expression compared with whole blood (supplementary table 2). following endotoxin, adipose socs-1 (10-fold) and socs-3 (20-fold), but not socs-2 or socs-6, mrnas increased markedly (fig. there were similar striking changes in whole - blood socs-1 and socs-3 (3-fold and 30-fold, respectively), but endotoxin actually reduced socs-2 and socs-6 mrna in blood (fig. endotoxemia induced (a) adipose and (b) whole - blood mrna levels of socs-1 and socs-3, but not socs-2 and socs-6. p < 0.0001 in anova (adipose) or mixed - effects model (blood). prior to lps, we detected mrna for irs-1 and irs-2 but not irs-3 or irs-4 in adipose with differential expression compared with whole blood (supplementary table 2). endotoxin reduced irs-1 (by 47%) mrna in adipose. in whole blood, irs-1 mrna levels also fell (by 53%), but irs-2 mrna increased (2.3-fold increase) (table 3). in parallel, insulin receptor mrna levels decreased significantly in blood but not in adipose, and there was no significant change in glut4 mrna in adipose or whole blood (table 3). western blotting of adipose proteins generally supported mrna data with reduction in irs-1 but no change in insulin receptor ; however, glut4 protein levels tended to fall (fig. furthermore, enhanced serine phosphoryation of akt, with no change in total akt (fig. 5), was observed consistent with previous findings of tnf - induced serine phosphorylation of akt in adipocytes (17). overall, endotoxemia induced specific socs proteins and modulated several components of the insulin signaling pathway in adipose. insulin signaling proteins are modulated in adipose and whole blood during endotoxemia western blot of insulin signaling proteins in adipose tissue. relative to -actin, endotoxin reduced protein levels of irs-1 and glut4, increased phosphorylated - akt (p - akt), and had no effect on insulin receptor expression (representative blot shown ; densitometry for irs-1 and p - akt inflammation, particularly in adipose tissue, has been implicated in diet- and obesity - related ir in experimental models. however, the specific mechanisms and the potential for therapeutic targeting in humans are poorly understood. in this work, we found that endotoxemia induced systemic ir but not pancreatic -cell dysfunction in humans. further, ir measured at 24 h post - lps was preceded by specific modulation of adipose inflammatory and insulin signaling pathways. this work defines specific targets for inflammatory modulation of insulin signaling in humans and also provides a human model for proof - of - concept studies of novel therapeutics in ir and its complications. epidemiological studies (18,19) suggest causal links between chronic inflammation, ir, and incident type 2 diabetes, while observational data demonstrate that ir and overt type 2 diabetes may emerge during human infections and sepsis (11). (8) were the first to show impaired insulin sensitivity 67 h following lps administration utilizing euglycemic clamp studies. our study goes beyond the findings of agwunobi. by demonstrating persistence of ir at 24 h after endotoxin in the absence of any effect on pancreatic -cell function while also identifying adipose tissue inflammatory responses and modulation of specific adipose insulin signaling proteins that precede systemic ir. interestingly, agwunobi. also noted enhanced insulin sensitivity 2 h after lps as determined by a significant increase in the glucose infusion rate required during the clamp. a recent elegant study (20) using isotope tracers with a euglycemic clamp showed that this acute and transient increase in insulin sensitivity at 12 h after lps was due to increases in both hepatic and peripheral insulin sensitivity. experimental models support an important role for innate and adaptive immunity in diet- and obesity - induced ir (1,35,21). deficiency of tlr-4, the innate antigen / lps receptor, protects against diet - induced obesity and ir in rodents (2). tnf impairs insulin - mediated glucose disposal, and functional tnf deficiency in mice protects from obesity - induced ir (21). however, the relevance to human pathophysiology of individual signaling pathways implicated in rodent models remains unknown. in fact, species heterogeneity in inflammatory modulation (22) and of insulin signaling has been documented (9,23). thus, use of human models of inflammation can provide unique insight into clinically relevant mechanisms and therapeutic targets for ir and type 2 diabetes. our study is the first to demonstrate loss of insulin sensitivity without any apparent effect on pancreatic -cell function during acute human inflammation. because fasting - based homa - ir estimates have been shown to correlate best with measures of hepatic insulin sensitivity and fsigt si with measures of peripheral insulin sensitivity (24), endotoxemia appears to trigger both hepatic and peripheral ir. further, we describe several inflammatory perturbations that may impact tissue and systemic insulin sensitivity, induction of inflammatory cytokines and chemokines, modulation of adipokine signaling (10), activation of the hypothalamic - pituitary - adrenal axis (25), and altered flux of plasma free fatty acids (26). indeed, the degree of evoked change in several inflammatory and metabolic markers, including free fatty acids, hscrp, resistin, and gh tended to precede and correlate with the degree of ir. taken together, therefore, these data support a model of both hepatic and peripheral ir during endotoxemia, with peripheral ir likely to be occurring at the level of skeletal muscle as well as adipose tissue. recent experimental studies in rodents demonstrated that adipose recruitment of t - cell and macrophages in obesity promotes adipocyte inflammation leading to local and systemic ir (27). we hypothesized that adipose inflammation would be a consequence of human endotoxemia that might contribute to local and systemic ir. there was also a marked induction of adipose mcp-1, which is known to recruit chemokine cc motif receptor (ccr)-2expressing monocytes, increase inflammatory - m1 adipose tissue macrophage (atm), and promote ir (27). recent studies of diet - induced obesity suggest that upregulation of t - cell chemokines in adipose and recruitment of inflammatory th1 cells precedes recruitment of monocytes and the development of systemic ir. remarkably, we found that endotoxemia induced cxcl10, a potent t - cell chemokine. the emergence of resistin mrna in adipose suggests leukocyte recruitment because expression of this adipokine is restricted to myeloid lineage in humans (23). in addition, we found increased mrna levels of the macrophage marker emr1-f4/80 (28) in adipose, further supporting that endotoxemia may promote adipose recruitment of macrophages. overall, these data suggest that endotoxemia induces human adipose inflammatory responses similar to those observed in models of diet- and obesity - related ir (14,21,27). whether inflammation attenuates adipose insulin signaling in humans and which signaling pathways are involved has not been defined. several inflammatory adipokines such as tnf, il-6, and resistin, as well as endotoxin itself, induce socs proteins that inhibit insulin receptor signaling and target irs proteins for ubiquitination and proteosomal degradation (29,30). the socs family, consisting of eight members, is recognized as a general negative feedback mechanism for receptor tyrosine kinase signaling including the insulin receptor. using the yeast two - hybrid system, socs-1, socs-3, and socs-6 have been shown to bind to the insulin receptor (31), and cells from socs-1deficient mice exhibit enhanced insulin sensitivity (30). conversely, in obesity, socs-1 and socs-3 are increased in liver, muscle, and fat coincident with reduced tyrosine phosphorylation of irs proteins. we report for the first time the pattern of socs family mrna expression in human adipose and a marked and selective induction of adipose socs proteins during endotoxemia ; socs-1 and socs-3 were increased with no effect of socs-2 and socs-6. our findings suggest that induction of socs-3 in adipose may be an important molecular mechanism of ir in human inflammatory states (31). the in vivo effect of inflammation on insulin receptor signaling in human adipose is unknown. the insulin receptor, a transmembrane dimeric protein with intrinsic kinase activity, recruits irs proteins upon insulin binding. tyrosine phosphorylation of irs proteins activates phosphatidylinositol-3-kinase, leading to akt phosphorylation and glut4 mobilization (32). inflammatory kinases including ikk (5,33), jnk (5), pkcs (6), and jak - stats attenuate insulin signaling in adipocytes and in rodent models. these kinases induce serine phosphorylation of irs-1, which inhibits irs-1 tyrosine phosphorylation during insulin signaling (32). we found tissue - specific irs expression and downregulation of adipose irs-1 protein coincident with reduced irs-1 mrna. our data also suggest species heterogeneity in the pattern of adipose irs expression with more abundant irs-2 in human adipose compared with that reported in rodents (32). the effect of endotoxemia on irs-1 protein levels is one of several mechanisms by which endotoxemia may impair insulin signaling in human adipose. remarkably, changes in several mrnas in whole blood paralleled that in adipose (e.g., il-6, mcp1, socs-1, and socs-3). however, inflammation appears to modulate specific insulin signaling related proteins (insulin receptor, socs-2 and socs-6, and irs-2) in a tissue - specific manner. this should prompt caution in extrapolating tissue - specific effects from global characterization of whole - blood mrnas. overall, endotoxemia induces ir in humans following modulation of adipose tissue inflammatory and insulin signal pathways in vivo. while adipose dysfunction in genetically and environmentally susceptible patients may increase inflammation, experimental endotoxemia may also induce adipose inflammation and subsequent adipocyte dysfunction, which then leads to ir. while we have not definitively proven that adipose inflammation is causal in systemic ir during endotoxemia, our work provides proof of principle that inflammation - induced systemic ir emerges after inflammatory modulation of adipose insulin signaling in humans. we emphasize the need for specific study of the chronic low - grade human inflammation observed in obesity, metabolic syndrome, and type 2 diabetes. our approach to study insulin sensitivity using the fsigt - derived si at 24 h post - lps is limited in that we can not differentiate various contributions of changes in hepatic and peripheral insulin sensitivity versus the total body change and can not define the kinetics of the development and resolution of ir. however, we utilized the fsigt si as a sensitive measure of peripheral ir and combined this with the homa - ir that correlates best with measures of hepatic insulin sensitivity (24). furthermore, fsigt enabled examination of whether pancreatic -cell function changes during inflammation - induced ir, while the hyperinsulinemic - eugylemic clamp does not. we acknowledge that inflammatory effects are likely to occur in liver and in skeletal muscle during endotoxemia and that these could impact systemic ir. indeed, our homa - ir data and our fsigt data support both hepatic and peripheral ir consistent with published euglycemic clamp studies. detailed examination of changes in skeletal muscle and greater study of adipose tissue inflammation and function in relationship to the kinetics of ir is warranted in future studies. despite these limitations, our study provides the first tissue level data on evoked inflammatory pathways in human ir. finally, endotoxemia may not represent accurately the pathophysiology of chronic inflammatory, insulin - resistant disease states. several lines of evidence, however, support its relevance to the pathophysiology of ir in humans. first, an inflammatory ir and metabolic dyslipidemia emerges clinically during acute sepsis (11) and chronic infections (34). second, we and others have shown that cytokine / adipokine (10,23,35), acute - phase reactant responses, and lipoprotein changes (36,37) observed acutely during experimental endotoxemia resemble those chronically observed in the metabolic syndrome. third, gene manipulation and drug targeting of the tlr-4 (2,38) and nuclear factor b (5,39) have provided proof of concept that modulation of innate immune signaling attenuates ir and type 2 diabetes in dietary and obesity models. last, and directly relevant to the effect on adipose, we recently demonstrated that endotoxemia induces gene expression responses in subcutaneous adipose (40) that are remarkably similar to the changes observed in visceral adipose in insulin - resistant states (4143). remarkably, evoked adipose inflammation and modulation of adipose insulin signal pathways, similar to some of those described in rodent models of diet - induced obesity and ir, precede the emergence of systemic ir in humans. for example, induction of specific socs proteins and downregulation of irs-1 are likely to play roles in the inflammatory induction of adipose and systemic ir in humans. this work also provides a human experimental model for studies of novel therapeutics targeting systemic and adipose inflammation in ir and its metabolic consequences. remarkably, evoked adipose inflammation and modulation of adipose insulin signal pathways, similar to some of those described in rodent models of diet - induced obesity and ir, precede the emergence of systemic ir in humans. for example, induction of specific socs proteins and downregulation of irs-1 are likely to play roles in the inflammatory induction of adipose and systemic ir in humans. this work also provides a human experimental model for studies of novel therapeutics targeting systemic and adipose inflammation in ir and its metabolic consequences. | objectivean emerging model of metabolic syndrome and type 2 diabetes is of adipose dysfunction with leukocyte recruitment into adipose leading to chronic inflammation and insulin resistance (ir). this study sought to explore potential mechanisms of inflammatory - induced ir in humans with a focus on adipose tissue.research design and methodswe performed a 60-h endotoxemia protocol (3 ng / kg intravenous bolus) in healthy adults (n = 20, 50% male, 80% caucasian, aged 27.3 4.8 years). before and after endotoxin, whole - blood sampling, subcutaneous adipose biopsies, and frequently sampled intravenous glucose tolerance (fsigt) testing were performed. the primary outcome was the fsigt insulin sensitivity index (si). secondary measures included inflammatory and metabolic markers and whole - blood and adipose mrna and protein expression.resultsendotoxemia induced systemic ir as demonstrated by a 35% decrease in si (3.17 1.66 to 2.06 0.73 104 [u ml1 min1 ], p < 0.005), while there was no effect on pancreatic -cell function. in adipose, endotoxemia suppressed insulin receptor substrate-1 and markedly induced suppressor of cytokine signaling proteins (1 and 3) coincident with local activation of innate (interleukin-6, tumor necrosis factor) and adaptive (monocyte chemoattractant protein-1 and cxcl10 chemokines) inflammation. these changes are known to attenuate insulin receptor signaling in model systems.conclusionswe demonstrate, for the first time in humans, that acute inflammation induces systemic ir following modulation of specific adipose inflammatory and insulin signaling pathways. it also provides a rationale for focused mechanistic studies and a model for human proof - of - concept trials of novel therapeutics targeting adipose inflammation in ir and related consequences in humans. |
the surveyed races were flat races on turf and dirt tracks held by the jra from january 1st, 2002, to december 31st, 2010. the race lengths were 1,200, 1,400, 1,600, 1,800 and 2,000 m on turf and 1,000, 1,200, 1,400, 1,700 and 1,800 m on dirt. these were the respective top 5 races in terms of their number of starters. the base of a dirt track is a layer of mountain sand packed firmly and then covered with loose sand (9 cm) to absorb the touchdown impact. only the final time data from firm or standard condition tracks were used in this study because track condition affects the final time and the firm and standard conditions had the most data. the final time is that officially recorded by the jra, which is measured on video in time increments of one - tenth of a second. the horses were divided by gender, with one group being females and the other being males & geldings ; male horses and geldings were grouped together because of the relatively low number of geldings belonging to the jra. the racing speed of each horse was calculated by dividing the race distance (m) by the horse s final time (sec). average speeds per month for each age and distance condition were calculated for each gender group when there were 30 or more starters per month for each age and distance condition in each gender group. the average weight carried per month by each age group was calculated for each gender group when there were 30 or more starters per month for each age group in each gender group. in descending order, the greatest number of turf race starters were found in the 1,200 m, 1,800 m, 2,000 m, 1,600 m and 1,400 m races (table 1table 1.distribution of gender and distance for starters on flat turf racesdistance (m)gender1,2001,4001,6001,8002,000males & geldings22,0248,76116,00621,51422,013females24,2278,31011,00913,1008,962total46,25117,07127,01534,61430,975). the greatest number of starters for dirt races, in descending order, were found in the 1,200 m, 1,800 m, 1,700 m, 1,400 m and 1,000 m events (table 2table 2.distribution of gender and distance for starters on flat dirt racesdistance (m)gender1,0001,2001,4001,7001,800males & geldings6,21718,01713,56020,91223,431females6,26413,8357,0369,8488,245total12,48131,85220,59630,76031,676). the ratio of males & geldings to females was equal across shorter distances in both turf and dirt races but increased with distance ; the ratio was almost 2:1 for 2,000 m races on turf (table 1) and 1,800 m races on dirt (table 2). therefore, the effect of geldings on the data of the males & geldings is believed to be very small. the common characteristic change observed across all distances on both turf and dirt was that the average speed increased slowly up until february of the age of 3 years old (figs. 1.average speed for each race distance in males & geldings (a) and females (b), the average weight carried (c) and the number of starters (c) on turf races.fig. 2.average speed for each race distance in males & geldings (a) and females (b), the average weight carried (c) and the number of starters (c) on dirt races.). subsequently, from march to september of the age of 3 years old, speed showed a continual increase and then increased rapidly in october and november. thereafter, their average speed increased continuously until the first half of the age of 4 years old, after which it remained almost constant, with little variation. average speed for each race distance in males & geldings (a) and females (b), the average weight carried (c) and the number of starters (c) on turf races. average speed for each race distance in males & geldings (a) and females (b), the average weight carried (c) and the number of starters (c) on dirt races. the average weight carried increased in males & geldings at approximately 3.5 years of age (figs. 1c and 2c). the average weight carried decreased in both males & geldings and females in june of the age of 3 years old. from december of the same year, the weight carried increased and then peaked in june to august of the following year (at the age of 4 years old). the number of starters in each gender group, and each type of race, increased at 2 years old. in october of the age of 3 years old, this number decreased rapidly (figs. the average speed of thoroughbreds surveyed on turf and dirt races increased slowly up until february of the age of 3 years old (figs. one of the reasons why the average speed increase during this period was slower than in subsequent periods might be that increases in carried weight inhibited the average speed increases associated with growth. in the jra races, the weight carried increased with growth in the males & geldings group (table 3table 3.weight carried and age of horse2 years old3 years oldgender / ageuntilseptemberoctober todecemberuntilseptemberoctober todecembermales & geldings54 kg55 kg56 kg57 kgfemales54 kg55 kg). as a result, the average weight carried increased in almost the same period as the relatively slow speed increases (figs. however, this explanation is unlikely because the increase in average speed was also slow in females of the same age, whose carried weight had not increased (table 3, figs. another possible cause was the change in the group composition of starters during the study period because of many horses debuting in a newcomer or maiden race. because the starters that debuted during this period included more horses that were novices and therefore less trained than horses that had already debuted, which were well trained and faster, the average speed could be expected to increase slowly. subsequently, from march to september of the age of 3 years old, the average speed for all race lengths showed a continued increase (figs. average weight carried decreased in both males & geldings and females from june of the same year because races between 3-year - old horses and those over 4 years old had started ; there was a weight allowance for 3-year - old horses in these races. however, the average speed for each track and length increased gradually, not rapidly. therefore, it appears that running performance increases related to growth have a more significant impact than decreases in weight carried. the average speed for most race lengths and track surfaces increased rapidly in october and november of the age of 3 years old (figs. maiden races also ended at this time, at the age of 3 years old ; therefore, almost all maiden horses that showed less impressive running performance retired from racing in the jra. as a result, the total number of starters decreased significantly for both turf and dirt track races after october of the age of 3 years old (figs. therefore, as only horses with higher running performance than maiden horses were left, the average speed seemed to increase rapidly. with regard to subsequent increases, the average speed thereafter increased continuously to the first half of the age of 4 years old. during this period, the weight carried increased, as the weight allowance for 3-year - old horses in races with those over 4 years old decreased in incremental steps (figs. however, no inhibition of the increase in average speed by weight carried was observed ; it appears that growth is a stronger factor for average speed than inhibition by such weight. after this period, average speed remained at an almost constant level, with little variation (figs. in a previous study on geldings, performance peaked at a real age of 4.25 to 4.75 years evaluated by the beyer speed figures in the united states. because a horse generally gives birth between march and april in the northern hemisphere, a real age of 4.25 to 4.75 years would occur between june and december, which is consistent with this result. the fastest average speed was recorded at age 4 in thoroughbreds in brazil, at 4 to 6 years old in trotters in germany and at 5 years old in thoroughbreds in japan. these results also agree with the result of the present study. under the rules of the jra, the weight allowance in a special weight race is removed between january and march of the age of 4 years old, as a function of race length. the average speed did not decrease with aging after the peak at the first half of the age of 4 years old (figs. however, it has previously been reported that performance evaluated by beyer speed figures decreased gradually after the peak. in that study, only horses that had records spanning several years were selected. however, the present study targeted all horses that started in the intended period and races. the average speed might not have decreased in this study because horses whose performance decreased with aging were retired from racing and the remaining horses retained their performance. furthermore, the average weight carried by the horses in our study decreased gradually in both males & geldings and females from the latter half of the age of 4 years old, at which time their performance peaked. weight adjustments like this might inhibit the decrease in average speed with aging. the average speed after the latter half of the age of 4 years old for each race length on turf tracks was fastest in the shortest (1,200 m) race and slowest in the longest (2,000 m) race for both genders in most months. on the other hand, on dirt tracks, although the average speed after the latter half of the age of 4 years old in the 1,000 m race was fastest in most months, the average speeds in the 1,200 and 1,400 m races were sometime close to those in the 1,000 m race. the average speed in the 1,800 m race was also close to that in the 1,700 m race for most months. the difference in average speed was not remarkable on dirt tracks. therefore, while the average speed decreased on turf tracks as the race length was extended, the influence of this extension of race length was low on dirt tracks. the reason for this seems to be that the top speed on dirt tracks is limited by the nature of the race. the top speed for turf track races of 1,200 m was about 17.2 m / sec, while that for dirt track races of 1,000 m was about 16.5 m / sec. another reason might be that the dirt tracks used for the 1,200 and 1,400 m races included a short turf zone (about 100 m) just after the starting gate on a few racecourses, and horses can run faster on turf than dirt tracks, as demonstrated in this study. however, although both the 1,200 and 1,400 m tracks of a few racecourses have a short turf zone, the difference in average speed between these two types of dirt track was not remarkable. therefore, extending the length of a dirt track had little effect on average speed. although the 5 race lengths surveyed for the turf tracks were different, with equal intervals of 200 m, the difference in average speed between the 1,600 and 1,800 m distances was larger than the differences for the other tracks. the 1,600 m racetracks used at most jra racecourses include a single turn, while most of the 1,800 and 2,000 m racetracks include two turns. because racing speed decreases at a turn compared with straights, the difference in average speed between the 1,600 and 1,800 m races might be larger than the difference between other races without different numbers of turns. on the dirt tracks, races up to 1,400 m also include a single turn, while 1,700 and 1,800 m races include two turns at most jra racecourses. although the difference between 1,400 and 1,700 m races is 300 m, the decrease in average speed between these two races was larger than that between 1,000 and 1,400 m races, in which the difference was 400 m. therefore, turns induce a decrease in average speed regardless of the composition of the track. it was possible that the influence of track turns was greater on dirt tracks than on turf tracks. the average speeds on turf tracks after the age of 4.5 years old were about 17.1 m / sec and 16.6 m / sec in 1,400 and 1,800 m races, respectively, a difference of about 0.5 m / sec. on the other hand, the difference was about 0.7 m / sec on dirt tracks of the same length (average speeds of about 16.4 m / s and 15.7 m / s, respectively). furthermore, the decrease in average speed with extension of the race length was less on dirt tracks than on turf tracks. therefore, larger decreases in average speed between the 1,400 and 1,800 m races on the dirt tracks seem likely to have been caused by the greater influence of turning on racing speed on the dirt tracks per se. one other potential reason is that the dirt tracks are generally located on the inside of turf tracks at all jra racecourses, and the turning radius of dirt tracks is smaller than that of turf tracks. another reason may be that under standard conditions, dirt tracks might have less grip than turf track ; as a result, horses might reduce their speed on dirt tracks during turning. the propulsive force on turf tracks was shown to be larger than on either synthetic or dirt tracks. in conclusion, the average speeds for all race distances surveyed on turf and dirt increased up until the first half of the age of 4 years old. the effect of the increase in weight carried on the increase in average speed with growth was only small. after the latter half of the age of 4 years old, the average speed remained at an almost constant level, with little variation. i speculate that the decrease in weight carried and retirement of less well performing horses kept the average speed high. | abstractthe running performance of thoroughbred racehorses has been reported to peak when they are between 4 and 5 years old. however, changes in their racing speed by month or season have not been reported. the purposes of this study were to reveal the average racing speed of thoroughbreds, and observe changes in their average speed with age. the surveyed races were flat races on turf and dirt tracks with firm or standard track conditions held by the japan racing association from january 1st, 2002 to december 31st, 2010. the racing speed of each horse was calculated by dividing the race distance (m) by the horse s final time (sec). average speeds per month for each age and distance condition were calculated for each gender group when there were 30 or more starters per month for each age and distance condition for each gender group. the common characteristic change for all conditions was an average speed increase up until the first half of the age of 4 years old. the effect of increased carry weight on average speed was small, and average speed increased with the growth of the horse. after the latter half of the age of 4 years old, the horses average speed remained almost constant, with little variation. it is speculated that decreases in the weight carried ; and the retirement of less well performing horses ; are responsible for the maintenance of average speed. |
thirty patients were diagnosed with iac in the peking union medical college hospital (pumch) from january 2011 to september 2014, during which 275 patients were diagnosed with cca. all patients were retrospectively reviewed and information was collected including their sex, age, symptoms, weight loss (decreased > 5% within 6 mo), and serological tests, including biochemical tests, tumor markers, and the sigg4 level. imaging characteristics including endoscopic retrograde cholangiopancreatography (ercp), magnetic resonance cholangiopancreatography (mrcp), computed tomography (ct), b - ultrasound, and endoscopic ultrasonography (eus) were also collected. chicago, il). the primary outcome consisted of the clinical parameters that showed significant differences in iac and cca. differences between the groups were evaluated using the independent samples t test, the test, the mann - whitney u, or the fisher test according to their characteristic. in all tests, p values receiver operating characteristic curves were used to estimate the diagnostic application of sigg4 levels (youden index = sensitivity+specificity1). data were analyzed using spss version 13.0 (spss inc., chicago, il). the primary outcome consisted of the clinical parameters that showed significant differences in iac and cca. differences between the groups were evaluated using the independent samples t test, the test, the mann - whitney u, or the fisher test according to their characteristic. in all tests, p values receiver operating characteristic curves were used to estimate the diagnostic application of sigg4 levels (youden index = sensitivity+specificity1). thirty patients (21 male and 9 female ; median age 59.012.7 y ; ranging from 28 to 83 y) were diagnosed with iac, with the criteria described in the introduction section, and 275 cca patients (170 male and 105 female ; median age 61.811.3 y ; ranging from 30 to 89 y) were diagnosed with histopathology and/or cytology. there was no significant difference in the gender and the age between the 2 groups (table 1). demographic data and symptoms of iac and cca patients as shown in table 1, a significantly higher number of iac patients experienced weight loss than cca patients (66.7% in iac vs. 45.1% in cca, p=0.025). moreover, iac patients had a significantly higher level of weight loss than cca patients (7.58.1 vs. 3.24.0 kg, p=0.008). on comparing the prognosis of the 2 groups, iac patients had a significantly longer survival time than cca patients (p 1400 mg / l) and 4 (3.2%) had a > 2-fold (> 2800 mg / l) increase. in our study, 16.1% of the cca patients had an elevated sigg4 level (range, 29 to 8230 mg / l), which could mislead to an iac diagnosis, although the level was significantly lower than that of the iac group. on the basis of this study, we concluded that the best cutoff value for sigg4 level was 1575 our study suggested a cutoff level that was 6-fold higher than the upper normal limit of igg4, which was different from the 4-fold criteria proposed previously by oseini.13 ca199 presents in the fetal gastrointestinal and pancreatic epithelium, whereas its serum level in adults is very low. its expression is elevated in adenocarcinoma cells, and is released into the blood through the thoracic duct. therefore, it can be a useful marker for the diagnosis of pancreatic carcinoma, gastric carcinoma, cca, and intrahepatic cca.14 the serum level of ca199 can also be elevated in pancreatitis, obstructive jaundice, and sclerosing diseases, which may be produced by abnormal epithelial cells.1517 in our study, the serum ca199 level was found to be increased in most of the cca patients. in iac patients, the serum ca199 level also increased, but at a significantly lower incidence and a significantly lower level. similarly, cea and ca242 were also found in the normal tissue.18 the incidence and elevated levels of cea and ca242 in cca patients were significantly higher than those in iac patients. these findings were in line with the studies published earlier.14,19,20 space - occupying lesions of the biliary tract are often diagnosed by b - ultrasound, ct, mri, or ercp. cca patients exhibit similar imaging characteristics, such as dilatation, thickening wall, or occupying lesion, which makes it difficult to distinguish one from the other. on reviewing the cases in our study, we found that these 3 manifestations exhibited significantly differently under eus between iac and cca, which could make eus a valuable tool to distinguish these 2 diseases. this finding was consistent with a previous study.21 multiple organ involvement, including most commonly the pancreas,19 the kidney, and the salivary and the lacrimal glands, is characteristic of iac.22,23 in this study, we had similar observations : 83.3% of the iac patients had obvious involvements of the pancreas, 20% had involvement of the kidney, and 53.3% had involvement of the salivary or the lacrimal glands. in contrast, in cca patients, the biliary tract was always the only involved organ at an early stage and few had other organs involved even though neighboring tissue / organ invasion and distant metastasis could occur at middle and advanced stages.. however, obtaining pathologic samples by puncture or ercp brush before surgery is invasive and may not be suitable for all patients, such as patients who are old, patients with coagulopathy, or those with high bilirubin.24 in addition, the positive rate of brush check is low.25 therefore, clinical examination and experimental treatment are very important for a differential diagnosis. we observed complete response of iac patients to the steroid treatment, although in some cases the stent placement also played a role in the symptom alleviation. the retrospective nature of this study made it difficult to obtain data of a single variable from all patients. the case number of the iac was low, which may affect the significance of the study. the use of a stent in some patients could be another factor in alleviating symptoms in iac patient, which was not taken into account for the response to steroid treatment because of the limited numbers. our study suggested that 6-fold higher levels of sigg4, tumor markers (ca199, cea, and ca242), and other organ involvement could be used as reference criteria for the differential diagnosis of iac and cca. for difficult cases, experimental steroid treatment can be used for further diagnosis under appropriate conditions. | background and aim : immunoglobulin g4-associated cholangitis (iac) shares many similar symptoms with cholangiocarcinoma (cca). however, the treatment and the prognosis are substantially different. this study aimed to identify the important markers for the differential diagnosis of these 2 diseases.methods:thirty iac patients and 275 cca patients were reviewed retrospectively for their clinical symptoms, serological tests, and imaging characteristics. posttreatment responses were also studied.results:igg4 had 100% specificity for iac at a cutoff of 6 times the upper normal limit. iac patients had a significantly higher incidence of weight loss (p=0.025) and a higher level of weight loss (p=0.008) than cca patients. the positive rates of biological markers ca199, ca242, and cea in cca and iac were 81.5% versus 42.9%, 45.5% versus 4.5%, and 29.2% versus 7.1%, respectively. levels of these tumor markers in cca were significantly higher than in iac (p<0.05). the thickened wall [17/18 (94.4%) vs. 3/10 (30%), p=0.001 ] and the occupying lesion on the bile duct [1/18 (5.6%) vs. 8/10 (80%), p<0.001 ] were found to be significantly different in iac and cca, respectively, by endoscopic ultrasonography. autoimmune pancreatitis was the most frequently observed comorbidity of iac (25/30). all iac patients respond positively to steroid treatment.conclusions:increased tumor markers, 6-fold higher levels of serum igg4, and other organs involvement could be the reference factors for a differential diagnosis of iac and cca. endoscopic ultrasonography might be an effective imaging tool for diagnosis, although clinical signs and symptoms of iac and cca are similar. experimental steroid treatment can be useful in the diagnosis for certain difficult cases. |
the first core functionality of the laglidadg homing endonuclease database and engineering server (lahedes) resource is an updateable collection of wild - type and engineered lhes that have been shown to cleave precisely defined dna sequences corresponding to their target sites in original host gene, and for which the exact positioning and orientation of the target site relative to the lhe s n- and c - terminal domains are known. in the database, the target sites are entered and listed as 22-bp sequences that exactly span the center of four consecutive bases (termed the central four target region) that are converted into mutually cohesive four - base 3-overhangs by all known lhes. the orientation of the target site relative to the bound endonuclease (i.e. which half - sites are engaged by the n- and c - terminal domains of the lhe, respectively) is defined based on biochemical and/or structural analyses. in this convention, the left half - site (basepairs 11 to 1) is contacted by residues from the n - terminal lhe domain, while the right half - site (basepairs + 1 to + 11) is bound by the c - terminal domain. entry tool for addition of new lhes to the database provides individual fields for the enzyme name, its amino acid sequence (entered as a fasta character string), its dna target site (entered from basepair 11 to + 11 as described above) and a notes field for the entry of additional information for the endonuclease. this information usually includes (i) the host organism and corresponding host gene ; (ii) the relationship of the lhe to any surrounding self - splicing elements (introns or inteins) or its existence as a stand - alone endonuclease ; (iii) links to genomic or structural information for the endonuclease ; and (iv) the nature of experiments that have validated the lhe 's activity. chimeric lhes (which correspond to various types of structural fusions between n- and c - terminal lhe domains) (2527) monomerized lhes (which correspond to homodimeric endonucleases that have been converted into single - chain reagents through the fusion and tethering of two protein subunits with an artificial peptide linker) (28,29) and fully redesigned lhes (for those that have been entirely retargeted to genomic target sites and that have been biochemically characterized at a level that matches their wild - type parental enzyme) (20). in each case, the same general entry tools and note fields are provided, with individualized instructions for the information required for adequate archiving. finally, it is also possible to enter the names, protein sequences and biological origins of pseudo - endonucleases, which correspond to lhe genes that do not appear to encode stable or active enzymes (a category motivated by the observation that a significant fraction of homing endonuclease genes have accumulated disabling mutations subsequent to the successful invasion of their host gene) (30). the rules for naming new lhes, following the conventions described in roberts. (31) are explicitly described and followed by the lahedes database, including instructions to examine the rebase database (23) to ensure that unique acronyms for novel host species and genus are chosen. in general, the entry tool recommends adding an additional character to the end of the acronym to further denote the source of the lhe in cases where a newly discovered enzyme is derived from a mitochondrial (m) or chloroplast (c) genome. certain enzymes that have already enjoyed a long history in the published literature and corresponding databases (such as i - scei, i - crei, etc.) as mentioned above, the browser is limited to those lhes that have been sufficiently characterized that they can be utilized for the creation of gene - targeting reagents (a list that currently spans 24 enzymes). however, the resource is open - ended and available for deposition of any lhes that meet the necessary criterion for protein engineering and selection experiments. in addition to the exact sequence of their naturally occurring dna targets (which usually corresponds to the site in the host gene which is cleaved by the homing endonuclease, resulting in invasion of that site by the mobile he gene and surrounding dna sequences), the specificity of a given lhe in many cases is also represented in the database by an additional position weight matrix (pwm) (32). this pwm takes into account any positions in the dna target where base substitutions are tolerated in cleavage experiments (in other words, positions in the dna target that are recognized with reduced fidelity). this feature of lhes (the ability to tolerate individual polymorphisms in their natural target sites) is an evolutionary consequence of the need to accommodate the natural drift in the sequence of their host gene targets, and to effectively execute ectopic transfers into new host genes that contain related target sites when the opportunity arises (30,33). in particular, lhe reading frames that are found within protein - coding genes often tend to display reduced fidelity at positions corresponding to wobble positions in the host gene reading frame (33) [a feature of dna recognition that is also explicitly accounted for in the homebase webserver (21) ]. the use of an experimentally determined pwm as a search - scoring matrix exploits this property, but reduces the risk of false positives that might arise from enzymes that depart from this general rule for recognition specificity. dna recognition is important in enzyme redesign experiments, where mismatches between the wild - type target site and the desired dna target which correspond to well - tolerated polymorphisms can be accommodated with minimal effort during the engineering or selection process. accounting for the specificity profile of an lhe is also important in predicting potential genomic off - target sites, as well as regions of the protein dna interface where specificity may be enhanced through additional engineering. pwms are entered into the database with a separate entry tool, using information derived either from direct biochemical measurements of the enzyme 's ability to cleave alternative target site variants (34) or from experiments that identify collections of cleavable dna target variants from pools of partially randomized sites (33). in either case, the relative ability of the enzyme to accommodate each possible base at each possible position in the target site is usually entered using a scale of 1.0 (wild - type cleavage activity or recovery for a given base) to 0.0 (complete lack of cleavage activity or recovery for a given base). the resulting pwm values are displayed by the database both as a sequence logo plot, and as raw text that can be incorporated into separate computational analyses (figure 1). specificity profiles, reported as pwms that have been experimentally determined for a number of lhes can be entered individually and are available on the site as part of the browser functionality. these matrices are displayed in graphical format as a sequence logo plot (left) and in tabular format. the ability of the enzyme to cleave dna targets that contain a given nucleotide at a specific position within the target site is indicated by letter height, and positions with greater overall information content are more specifically recognized. the profile displayed in this figure was determined in a series of biochemical experiments where the cleavability of target site variants was individually measured (34). the specificity profile (pwm) for the i - anii lhe. specificity profiles, reported as pwms that have been experimentally determined for a number of lhes can be entered individually and are available on the site as part of the browser functionality. these matrices are displayed in graphical format as a sequence logo plot (left) and in tabular format. the ability of the enzyme to cleave dna targets that contain a given nucleotide at a specific position within the target site is indicated by letter height, and positions with greater overall information content are more specifically recognized. the profile displayed in this figure was determined in a series of biochemical experiments where the cleavability of target site variants was individually measured (34). in addition to target sites and pwms, the database accommodates lists of residues for each homing endonuclease that might be potentially useful in any redesign or selection process, and links the information within those lists to the output of target site searches (described below). after entry of a new wild - type lhe, the entry tool for contact modules is then populated by that enzyme in a drop - down menu that allows an investigator to list those amino acids that the investigator believes to be within contact distance to individual clusters of target sites basepairs. modules across the target site, that can be incorporated into experiments to alter the enzyme 's recognition specificity within that same dna module. for example, the i - onui endonuclease displays direct and water - mediated contacts between the 11 to 9 bp positions and at least seven separate amino acid side - chains : asn 32, lys 34, ser 35, ser 36, val 37, gly 38 and ser 40 (20) ; all are listed as residues that comprise the dna contact module for those three corresponding basepairs. the choice of amino acids that should populate individual dna contact modules can be derived either from crystallographic structures of a corresponding lhe the contact residues entered into the database for the i - crei homodimeric lhe and the i - onui monomeric lhe have been extensively validated for engineering purposes, and those can be used as an initial reference for the entry of corresponding residue lists for homologous lhes. the premise behind entering amino acid contact lists in a modular format is based on past experimental observations that sequence recognition within the lhe dna interface often displays considerable context dependence and cross - talk between adjacent positions (28,34,35), such that even when only 1-bp substitution is required in the novel target site, best practice often dictates that residues involved in contacts to the n + 1 basepairs should also be subjected to redesign or selection. for many enzymes in the database, specific mutations in the dna contacting residues described above have been shown to be associated with defined alterations in target sequence specificity (20,34,36). for example, incorporation of three amino acid substitutions in the monomerized version of i - msoi (i30e, s43r andi85y) results in a shift in specificity from a wild - type a : t basepair at position 8 (termed 8a in the database) to preferential recognition of a g : c basepair at the same position (8g) (35). in addition to the entry tool for wild - type dna contacting residues, an additional specificity changing mutation entry tool is provided that allows the archiving of such substitutions in the protein scaffold and the corresponding change in dna base preference in the altered target site. similar to the list of wild - type dna contacting residues, the identities of such mutations are provided to the user both in the endonuclease browser tool, and as a subsequent link from the output of the genomic sequence target site searches to aid in the design of engineering or selection experiments. the first core functionality of the laglidadg homing endonuclease database and engineering server (lahedes) resource is an updateable collection of wild - type and engineered lhes that have been shown to cleave precisely defined dna sequences corresponding to their target sites in original host gene, and for which the exact positioning and orientation of the target site relative to the lhe s n- and c - terminal domains are known. in the database, the target sites are entered and listed as 22-bp sequences that exactly span the center of four consecutive bases (termed the central four target region) that are converted into mutually cohesive four - base 3-overhangs by all known lhes. the orientation of the target site relative to the bound endonuclease (i.e. which half - sites are engaged by the n- and c - terminal domains of the lhe, respectively) is defined based on biochemical and/or structural analyses. in this convention, the left half - site (basepairs 11 to 1) is contacted by residues from the n - terminal lhe domain, while the right half - site (basepairs + 1 to + 11) is bound by the c - terminal domain. entry tool for addition of new lhes to the database provides individual fields for the enzyme name, its amino acid sequence (entered as a fasta character string), its dna target site (entered from basepair 11 to + 11 as described above) and a notes field for the entry of additional information for the endonuclease. this information usually includes (i) the host organism and corresponding host gene ; (ii) the relationship of the lhe to any surrounding self - splicing elements (introns or inteins) or its existence as a stand - alone endonuclease ; (iii) links to genomic or structural information for the endonuclease ; and (iv) the nature of experiments that have validated the lhe 's activity. chimeric lhes (which correspond to various types of structural fusions between n- and c - terminal lhe domains) (2527) monomerized lhes (which correspond to homodimeric endonucleases that have been converted into single - chain reagents through the fusion and tethering of two protein subunits with an artificial peptide linker) (28,29) and fully redesigned lhes (for those that have been entirely retargeted to genomic target sites and that have been biochemically characterized at a level that matches their wild - type parental enzyme) (20). in each case, the same general entry tools and note fields are provided, with individualized instructions for the information required for adequate archiving. finally, it is also possible to enter the names, protein sequences and biological origins of pseudo - endonucleases, which correspond to lhe genes that do not appear to encode stable or active enzymes (a category motivated by the observation that a significant fraction of homing endonuclease genes have accumulated disabling mutations subsequent to the successful invasion of their host gene) (30). the rules for naming new lhes, following the conventions described in roberts. (31) are explicitly described and followed by the lahedes database, including instructions to examine the rebase database (23) to ensure that unique acronyms for novel host species and genus are chosen. in general, the entry tool recommends adding an additional character to the end of the acronym to further denote the source of the lhe in cases where a newly discovered enzyme is derived from a mitochondrial (m) or chloroplast (c) genome. certain enzymes that have already enjoyed a long history in the published literature and corresponding databases (such as i - scei, i - crei, etc.) as mentioned above, the browser is limited to those lhes that have been sufficiently characterized that they can be utilized for the creation of gene - targeting reagents (a list that currently spans 24 enzymes). however, the resource is open - ended and available for deposition of any lhes that meet the necessary criterion for protein engineering and selection experiments. in addition to the exact sequence of their naturally occurring dna targets (which usually corresponds to the site in the host gene which is cleaved by the homing endonuclease, resulting in invasion of that site by the mobile he gene and surrounding dna sequences), the specificity of a given lhe in many cases is also represented in the database by an additional position weight matrix (pwm) (32). this pwm takes into account any positions in the dna target where base substitutions are tolerated in cleavage experiments (in other words, positions in the dna target that are recognized with reduced fidelity). this feature of lhes (the ability to tolerate individual polymorphisms in their natural target sites) is an evolutionary consequence of the need to accommodate the natural drift in the sequence of their host gene targets, and to effectively execute ectopic transfers into new host genes that contain related target sites when the opportunity arises (30,33). in particular, lhe reading frames that are found within protein - coding genes often tend to display reduced fidelity at positions corresponding to wobble positions in the host gene reading frame (33) [a feature of dna recognition that is also explicitly accounted for in the homebase webserver (21) ]. the use of an experimentally determined pwm as a search - scoring matrix exploits this property, but reduces the risk of false positives that might arise from enzymes that depart from this general rule for recognition specificity. the need to account for relaxed fidelity in lhe dna recognition is important in enzyme redesign experiments, where mismatches between the wild - type target site and the desired dna target which correspond to well - tolerated polymorphisms can be accommodated with minimal effort during the engineering or selection process. accounting for the specificity profile of an lhe is also important in predicting potential genomic off - target sites, as well as regions of the protein dna interface where specificity may be enhanced through additional engineering. pwms are entered into the database with a separate entry tool, using information derived either from direct biochemical measurements of the enzyme 's ability to cleave alternative target site variants (34) or from experiments that identify collections of cleavable dna target variants from pools of partially randomized sites (33). in either case, the relative ability of the enzyme to accommodate each possible base at each possible position in the target site is usually entered using a scale of 1.0 (wild - type cleavage activity or recovery for a given base) to 0.0 (complete lack of cleavage activity or recovery for a given base). the resulting pwm values are displayed by the database both as a sequence logo plot, and as raw text that can be incorporated into separate computational analyses (figure 1). figure 1.the specificity profile (pwm) for the i - anii lhe. specificity profiles, reported as pwms that have been experimentally determined for a number of lhes can be entered individually and are available on the site as part of the browser functionality. these matrices are displayed in graphical format as a sequence logo plot (left) and in tabular format. the ability of the enzyme to cleave dna targets that contain a given nucleotide at a specific position within the target site is indicated by letter height, and positions with greater overall information content are more specifically recognized. the profile displayed in this figure was determined in a series of biochemical experiments where the cleavability of target site variants was individually measured (34). the specificity profile (pwm) for the i - anii lhe. specificity profiles, reported as pwms that have been experimentally determined for a number of lhes can be entered individually and are available on the site as part of the browser functionality. these matrices are displayed in graphical format as a sequence logo plot (left) and in tabular format. the ability of the enzyme to cleave dna targets that contain a given nucleotide at a specific position within the target site is indicated by letter height, and positions with greater overall information content are more specifically recognized. the profile displayed in this figure was determined in a series of biochemical experiments where the cleavability of target site variants was individually measured (34). in addition to target sites and pwms, the database accommodates lists of residues for each homing endonuclease that might be potentially useful in any redesign or selection process, and links the information within those lists to the output of target site searches (described below). after entry of a new wild - type lhe, the entry tool for contact modules is then populated by that enzyme in a drop - down menu that allows an investigator to list those amino acids that the investigator believes to be within contact distance to individual clusters of target sites basepairs. modules across the target site, that can be incorporated into experiments to alter the enzyme 's recognition specificity within that same dna module. for example, the i - onui endonuclease displays direct and water - mediated contacts between the 11 to 9 bp positions and at least seven separate amino acid side - chains : asn 32, lys 34, ser 35, ser 36, val 37, gly 38 and ser 40 (20) ; all are listed as residues that comprise the dna contact module for those three corresponding basepairs. the choice of amino acids that should populate individual dna contact modules can be derived either from crystallographic structures of a corresponding lhe dna complex, or from homology models constructed from such available structures. the contact residues entered into the database for the i - crei homodimeric lhe and the i - onui monomeric lhe have been extensively validated for engineering purposes, and those can be used as an initial reference for the entry of corresponding residue lists for homologous lhes. the premise behind entering amino acid contact lists in a modular format is based on past experimental observations that sequence recognition within the lhe dna interface often displays considerable context dependence and cross - talk between adjacent positions (28,34,35), such that even when only 1-bp substitution is required in the novel target site, best practice often dictates that residues involved in contacts to the n + 1 basepairs should also be subjected to redesign or selection. for many enzymes in the database, specific mutations in the dna contacting residues described above have been shown to be associated with defined alterations in target sequence specificity (20,34,36). for example, incorporation of three amino acid substitutions in the monomerized version of i - msoi (i30e, s43r andi85y) results in a shift in specificity from a wild - type a : t basepair at position 8 (termed 8a in the database) to preferential recognition of a g : c basepair at the same position (8g) (35). in addition to the entry tool for wild - type dna contacting residues, an additional specificity changing mutation entry tool is provided that allows the archiving of such substitutions in the protein scaffold and the corresponding change in dna base preference in the altered target site. similar to the list of wild - type dna contacting residues, the identities of such mutations are provided to the user both in the endonuclease browser tool, and as a subsequent link from the output of the genomic sequence target site searches to aid in the design of engineering or selection experiments. the second core functionality of the lahedes resource is the ability to search individual genes or collections of genes for potential matches against lhe target sites based on four separate search criteria : searches for dna sequences that exhibit identity across the central 4 bp of an lhe target site, because those bases are usually not in direct contact with amino acid side chains. therefore, specificity changes at these basepairs are often not easily achieved through protein engineering or selection (34). additional experiments on individual lhe enzymes that further profile the ability of the enzyme to accommodate individual basepair substitutions in the central four region of the target site expands the number of hits within a genomic query. for those enzymes where such information is available, the central four search algorithm takes such polymorphisms into account when returning potential targets and allows such sites to appear on the list of target site hits.searches for highest possible sequence identity (fewest dna basepair mismatches) across a 22-bp dna sequence in the genomic query relative to an lhe s entire physiological target site. some redesign experiments indicate, not surprisingly, that the most effective way to maintain wild - type levels of affinity, activity and overall specificity is to maintain the highest degree of sequence similarity to the wild - type target (20).for those lhes that have had their complete specificity profile determined, the user is provided with the opportunity to search and score potential targets using a specificity profile pwm described above. in this search algorithm, the penalty for a mismatch between a protein s natural target site and a potential genomic target is differentially weighted depending on the fidelity of recognition displayed at each dna basepair position. the difference between the two search strategies described in (ii) versus (iii) is simple : the use of a simple identity matrix will return those potential targets with the fewest mismatches relative to the enzyme 's wild - type recognition site, while the use of a scoring matrix that accounts for recognition degeneracy would indicate sites that might be more distantly related to the protein 's wild - type recognition site, while nevertheless indicating more tractable gene - targeting sites.the i - onui lhe has been systematically tested for its ability to be retargeted towards each possible altered base triplet across the entire length of the dna target site, using a high throughput method that combines yeast surface display and flow cytometry (37) (j. jarjour, unpublished data). for that enzyme, genomic searches are therefore possible using corresponding modular scoring matrices, returning lists of potential target sites to the investigator that might be accessible for modification through a subsequent experimental strategy that makes use of highthroughput selection from pools of enzyme variants that are randomized at corresponding dna - contacting residues. searches for dna sequences that exhibit identity across the central 4 bp of an lhe target site, because those bases are usually not in direct contact with amino acid side chains. therefore, specificity changes at these basepairs are often not easily achieved through protein engineering or selection (34). additional experiments on individual lhe enzymes that further profile the ability of the enzyme to accommodate individual basepair substitutions in the central four region of the target site expands the number of hits within a genomic query. for those enzymes where such information is available, the central four search algorithm takes such polymorphisms into account when returning potential targets and allows such sites to appear on the list of target site hits. searches for highest possible sequence identity (fewest dna basepair mismatches) across a 22-bp dna sequence in the genomic query relative to an lhe s entire physiological target site. some redesign experiments indicate, not surprisingly, that the most effective way to maintain wild - type levels of affinity, activity and overall specificity is to maintain the highest degree of sequence similarity to the wild - type target (20). for those lhes that have had their complete specificity profile determined, the user is provided with the opportunity to search and score potential targets using a specificity profile pwm described above. in this search algorithm, the penalty for a mismatch between a protein s natural target site and a potential genomic target is differentially weighted depending on the fidelity of recognition displayed at each dna basepair position. the difference between the two search strategies described in (ii) versus (iii) is simple : the use of a simple identity matrix will return those potential targets with the fewest mismatches relative to the enzyme 's wild - type recognition site, while the use of a scoring matrix that accounts for recognition degeneracy would indicate sites that might be more distantly related to the protein 's wild - type recognition site, while nevertheless indicating more tractable gene - targeting sites. the i - onui lhe has been systematically tested for its ability to be retargeted towards each possible altered base triplet across the entire length of the dna target site, using a high throughput method that combines yeast surface display and flow cytometry (37) (j. jarjour, unpublished data). for that enzyme, genomic searches are therefore possible using corresponding modular scoring matrices, returning lists of potential target sites to the investigator that might be accessible for modification through a subsequent experimental strategy that makes use of highthroughput selection from pools of enzyme variants that are randomized at corresponding dna - contacting residues. the search algorithm also allows the user to search for genomic sequences that might be targeted through the application of validated chimeric homing endonucleases (where n- and c - terminal domains or dna contacting surfaces of unrelated lhes have been fused or individually modified to create scaffolds that can recognize corresponding chimeric dna target sites) (2527). following genomic target site searches using any of the four methods outlined above (along with user - chosen endonucleases for the search that can span all or a smaller subset of those lhes that are available in the database), a top - scoring list of putative target sequences is returned in a graphical user interface, alongside the enzyme 's wild - type target for comparison (figure 2a). the output, which can be saved to a text file, indicates the position and identity of all basepairs in the potential target that differs from the enzyme 's wild - type recognition site, and provides links from each base in the candidate targets to information that has been entered about amino acids and mutations in the lhe that might influence specificity and redesign at that position. figure 2.genomic search results. the human monoamine oxidase b (maob) gene was searched for potential target sites matches using the i - onui lhe and either the identity algorithm (a) or the modular engineerability algorithm (b). for both searches, a list of best matches is shown, together with their position in the query sequence, orientation (forward or reverse) and scores. identity search (panel a, top maob sequence) was targeted for cleavage at the endogenous chromosomal maob locus by an engineered version of i - onui (20) (listed as the target site hits, mismatches are shown as lower base bases. in the output from a module search, each score is linked to a more detailed view (c) illustrating how well each dna module scores using an modules are represented by individual bars ; those that score favorably in a given target are colored blue, while those that do not score as favorably are colored red. the engineerability scoring scale (0 to 10 ; 10 is best) is shown to the right. clicking on individual bases or modular bars in the search output provides links to lists of amino acids (d) and (if they are available) mutations in the protein that are associated with recognition at those positions in the target. the human monoamine oxidase b (maob) gene was searched for potential target sites matches using the i - onui lhe and either the identity algorithm (a) or the modular engineerability algorithm (b). for both searches, a list of best matches is shown, together with their position in the query sequence, orientation (forward or reverse) and scores. identity search (panel a, top maob sequence) was targeted for cleavage at the endogenous chromosomal maob locus by an engineered version of i - onui (20) (listed as the target site hits, mismatches are shown as lower base bases. in the output from a module search, each score is linked to a more detailed view (c) illustrating how well each dna module scores using an modules are represented by individual bars ; those that score favorably in a given target are colored blue, while those that do not score as favorably are colored red. nucleotides that directly match the wild type target are indicated by vertical bars. the engineerability scoring scale (0 to 10 ; 10 is best) is shown to the right. clicking on individual bases or modular bars in the search output provides links to lists of amino acids (d) and (if they are available) mutations in the protein that are associated with recognition at those positions in the target. while the search output using the first three scoring algorithms (central 4 match, target identity and pwm search) is arranged to clearly display the conservation or mismatch at each individual dna basepair, the output for the modular search displays individual genomic sequences in the form of information regarding the engineerability of each protein dna module that harbors one or more basepair changes (figure 2b). as described above, the individual regions and basepairs in potential target sites are linked to previously entered information regarding the identity of amino acids and the corresponding mutations that are involved in the recognition of those positions. the field of genome and gene engineering is currently experiencing a rapid increase in the amount of information and data relating to the creation of gene - targeting proteins derived from the lhe family. these include : (i) the continuing identification of new lhes from worldwide microbial and metagenomic sequencing projects and (ii) the generation of a large numbers of engineered lhe variants with altered dna recognition properties. one manner in which the full potential and impact of this information can be fully exploited is through the development and maintenance of a computational database and search engine for lhe proteins. although lhes have historically been considerably more difficult to engineer for altered dna recognition and cleavage properties relative to their artificial, modular zfn and talen counterparts, there still exists considerable industrial and academic activity and motivation to reduce or eliminate the technical gulf that separates them from routine application in genome engineering applications. it is likely that the combination of highthroughput modular screens for altered specificity and the increasing numbers of wild - type and chimeric lhe protein scaffolds, along with the ability to apply deep sequencing methods to resulting pools of highly active enzyme variants, may soon drive a significant reduction in the time and cost of assembling artificial lhes for the life science community. barry stoddard is a founder, and jordan jarjour is an employee, of pregenen inc., which is focused on the development and engineering of lhes for gene targeting applications. | laglidadg homing endonucleases (lhes) are dna cleaving enzymes, also termed meganucleases that are employed as gene - targeting reagents. this use of lhes requires that their dna specificity be altered to match sequences in genomic targets. the choice of the most appropriate lhe to target a particular gene is facilitated by the growing number of such enzymes with well - characterized activities and structures. lahedes (the laglidadg homing endonuclease database and engineering server) provides both an online archive of lhes with validated dna cleavage specificities and dna - binding interactions, as well as a tool for the identification of dna sequences that might be targeted by various lhes. searches can be performed using four separate scoring algorithms and user - defined choices of lhe scaffolds. the webserver subsequently provides information regarding clusters of amino acids that should be interrogated during engineering and selection experiments. the webserver is fully open access and can be found at http://homingendonuclease.net. |
the art world changed forever in 1945, the year that jackson pollock moved from downtown manhattan to the countryside of long island, new york. friends recall the many hours that pollock spent on the back porch of his new house, staring out at the scenery as if assimilating the natural shapes surrounding him (see figure 1 ; potter, 1985). using an old barn as his studio purchasing yachting canvas from his local hardware store, he simply rolled the large canvases (sometimes spanning five meters) out across the floor of the barn. the brush was not used in its expected capacity : abandoning physical contact with the canvas, he dipped the stubby, paint - encrusted brush in and out of a can and poured the fluid paint from the brush onto the canvas below. fingerprints of his motions through the air. left : pollock 's house on long island. in contrast to his previous urban life in manhattan, pollock perfected his pouring technique surrounded by the complex patterns of nature. although the patterns observed at different magnifications do n't repeat exactly, analysis shows them to have the same statistical qualities. was this painting style driven by raw genius or was he simply mocking artistic traditions ? sixty - five years on, pollock 's brash and energetic works continue to grab public attention and command staggering prices of up to $ 200 m. however, despite the millions of words written about pollock through the years, the real meaning behind his infamous swirls of paint remained the source of fierce debate in the art world (o'connor, 1967 ; varnedoe and karmel, 1998). one issue agreed upon early in the pollock story was that his paintings represent one extreme of the spectrum of abstract art, with the paintings of his contemporary, piet mondrian, representing the other. mondrian 's so - called abstract plasticism generated paintings that seem as far removed from nature as they possibly could be (taylor, 2002a, 2004). they consist of elements primary colors and straight lines that never occur in a pure form in the natural world. in contrast to mondrian 's simplicity, pollock 's abstract expressionism speaks of complexity a tangled web of intricate paint splatters. whereas mondrian 's patterns are traditionally described as artificial and geometric, pollock 's are natural and organic (taylor, 2011). but if pollock 's patterns celebrate nature 's organic shapes, what shapes would these be ? since the 1970s many of nature 's patterns have been shown to be fractal (mandelbrot, 1982 ; barnsley, 1993 ; gouyet, 1996). in contrast to the smoothness of artificial lines, fractals consist of patterns that recur on finer and finer scales, building scale - invariant shapes of immense complexity. even the most common fractal objects, such as the tree shown in figure 1, contrast sharply with the simplicity of artificial shapes. an important parameter for quantifying a fractal pattern 's visual complexity is the fractal dimension, d. this parameter describes how the patterns occurring at different magnifications combine to build the resulting fractal shape (mandelbrot, 1982). for euclidean shapes, dimension is described by familiar integer values for a smooth line (containing no fractal structure) d has a value of 1, whilst for a completely filled area (again containing no fractal structure) its value is 2. however, the repeating patterns of a fractal line cause the line to begin to occupy space. as a consequence, its d value lies between 1 and 2. by increasing the amount of fine structure in the fractal mix of repeating patterns, the d value moves closer to 2 (mandelbrot, 1982 ; taylor and sprott, 2008). thus, for fractals described by a low d value, the small content of fine structure builds a very smooth, sparse shape. however, for fractals with a d value closer to two, the larger content of fine structure builds a shape full of intricate, detailed structure (taylor and sprott, 2008). figure 2 (left column) demonstrates how a pattern 's d value has a profound effect on the visual appearance. the pattern established by clouds (left, top) has a d value of 1.3, while the pattern established by the trees (left, bottom) has a d value of 1.9. examples of natural scenery (left column) and poured paintings (right column). top : clouds and pollock 's painting untitled (1945) are fractal patterns with low d values (d = 1.3 and 1.10 respectively). bottom : a forest and pollock 's painting untitled (1950) are fractal patterns with high d values (both d = 1.89). in 1999, we published an analysis of pollock 's paintings that confirmed his poured patterns to be fractal (taylor., 1999a). building on this initial analysis, a number of groups have shown diverse fractal analysis techniques to be useful approaches to quantifying the visual complexity of pollock 's poured patterns (mureika., 2004, 2005 ; mureika, 2005 ; lee., 2006, 2007 ; graham and field, 2007, 2008 ; redies, 2007 ; redies., 2007 ; alvarez - ramirez., 2008a, b ; coddington., 2008 ; irfan and stork, 2009 ; fairbanks., 2010). our initial analysis employed the well - established box - counting method, in which digitized images of pollock paintings were covered with a computer - generated mesh of identical squares (or boxes). the statistical scaling qualities of the pattern were then determined by calculating the proportion of squares occupied by the painted pattern and the proportion that were empty. reducing the square size is equivalent to looking at the pattern at finer magnification. in this way, we could compare the pattern 's statistical qualities at different magnifications. specifically, the number of squares, n(l), that contained part of the painted pattern were counted and this was repeated as the size, l, of the squares in the mesh was reduced. the largest size of square was chosen to match the canvas size (l 2.5 m) and the smallest was chosen to match the finest paint work (l 1 mm). for fractal behavior, n(l) scales according to the power law relationship n(l) l, where 1 this power law generates the scale - invariant properties that are central to fractal geometry. the d values, which chart this scale invariance, were extracted from the gradient of a graph of log n(l) plotted against log l. details of the procedure, along with typical graphs, are presented elsewhere (taylor., 2007). we note that the standard deviation associated with fitting the data to the fractal scaling behavior is such that d can be determined to an accuracy of two decimal places (taylor., 2007). many of pollock 's paintings are composed of a number of distinctly colored paint layers. one of the central challenges is to separate these layers so that each can be passed through the box - counting analysis. colors have been filtered using the physical model based on red green blue primaries (taylor., 1999a, 2007 ; mureika, 2005) and also a perceptual model based on lab color space (mureika, 2005). the extracted patterns are labeled as color blobs, and light - colored blobs typically have higher d values than darker blobs (mureika, 2005). the question of how pollock combined the blobs into an integrated, multi - colored visual fractal led us to investigate his painting technique in detail. (taylor., 1999b ; taylor, 2011) to distinguish it from computer - generated fractal art. fractal expressionism indicates an ability to generate and manipulate fractal patterns directly. in many ways, our analysis of film footage taken at his peak in 1950 reveals a remarkably systematic process (taylor., 2002). he started by painting localized islands of trajectories distributed across the canvas, followed by longer extended trajectories that joined the islands, gradually submerging them in a dense fractal web of paint. this process was very swift with the fractal dimension rising sharply to a mid - range value of d = 1.5 at 20 s. he would then break off and later return to the painting over a period of several days, depositing extra layers on top of this initial anchor layer (taylor, 2011). whether or not fractal layers merge to create a combined pattern that is also fractal depends on the relative d values of the individual layers, their densities and their degrees of overlap (taylor. the dark - colored, anchor layer set the initial d value of the painting, which was then fine - tuned by adding multiple, light - colored layers (taylor., 2002). this fine - tuning process has been interpreted in terms of a mathematical union of the individual fractal layers (vicsek, 1989), in which the combined pattern has a d value that matches the highest d of the individual layers (mureika., 2005) : thus as lighter - colored, higher d layers were added, the painting 's overall d value rose. pollock 's multi - stage painting technique was therefore clearly aimed at generating high d fractal paintings (taylor, 2011). art theorists categorize the evolution of pollock 's pouring technique into three phases (varnedoe and karmel, 1998). in the preliminary phase of 19431945, an example is the fractal pattern of the painting untitled from 1945, which has a d value of 1.10 (see figure 2). during his transitional phase from 1945 to 1947, he started to experiment with the pouring technique and his d values rose sharply (as indicated by the first gradient in figure 3). in his classic period of 19481952, he perfected his technique and d rose more gradually (second gradient in figure 3) to the value of d = 1.7. during his classic period he also painted untitled (see figure 2), which has an even higher d value of 1.89. however, he immediately erased this pattern (it was painted on glass), prompting the speculation that he regarded this painting as too complex and immediately scaled back to paintings with d = 1.7. this suggests that his 10 years of refining the pouring technique were motivated by a desire to generate fractal patterns with d 1.7. this distinct evolution raises an intriguing question : did these higher d fractal patterns hold a special esthetic quality for pollock and, if so, do observers of his work share the same preference ? the fractal dimension d of pollock paintings plotted against the year in which they were painted (19431953). the right hand images show computer constructions of three of pollock 's paintings. in the following sections our initial motivation for extracting the box - counting dimension for pollock 's patterns was to facilitate a direct comparison with previous investigations of human response to fractals, which focused on the relationship between their esthetic value and d (see later). before we move onto these comparisons, it is important to emphasize that d is just one of a spectrum of dimensions that can be used to quantify the scaling properties of fractal patterns. a number of groups, including ours, have gained further insight into the rich structure of pollock 's patterns by performing a multi - fractal analysis (mureika., 2005 ; coddington., 2008 ; irfan and stork, 2009 ; fairbanks., 2010). in addition, whereas our work focused on the colored blobs, the edge patterns extracted from the luminance gradients of grayscale images of pollock 's work are also fractal (mureika., 2005). the d values extracted from these fractal edge patterns can be related mathematically to a power spectrum analysis of the grayscale images (fairbanks and taylor, 2011). spectral analysis of pollock 's paintings reveals a scale - invariant power law behavior (redies., 2007 ; alvarez - ramirez., 2008a ; graham and field, 2008). this latter result is appealing because it facilitates a comparison between the luminance properties of pollock 's work and those of other artworks (graham and redies, 2010 ; koch. field and brady, 1997 ; ruderman, 1997 ; billock, 2000 ; billock., 2001). however, the relationship between the grayscale (i.e., power spectral analysis) and colored (i.e., box - counting analysis of the blobs) patterns of pollock 's fractals is not without its complexities (fairbanks and taylor, 2011) and our future research will continue to seek a precise characterization of this relationship. for the remainder of the present article it is also valuable to highlight an inevitable restriction of all of the above forms of fractal analysis that the fractal magnification range is limited. unlike mathematical fractals, which span from the infinitesimally small through to the infinitely large, pollock 's fractals ca n't exceed the canvas size, nor can they be smaller than the smallest speck of paint. concerns that pollock 's limited magnification range prevents an accurate extraction of d values have been successfully addressed elsewhere (taylor., 2006 ; taylor, 2011). of more interest for the current study is whether this magnification range is sufficient for the fractals to induce marked responses in the human visual system. the results that follow show that a magnification factor of only 20 (i.e., the largest pattern is just 20 times larger than the smallest) is enough to trigger striking responses. significantly, most of nature 's fractals match this highly limited magnification range and pollock 's fractals exceed it. the use of eye - tracking techniques to examine the gaze of the observer is a potentially powerful approach to understanding art appreciation (busswell, 1935 ; yarbus, 1967 ; nodine and krupinski, 2003 ; locher, 2006). while eye - tracking investigations of many types of artworks have revealed a great inter individual variability in scan path characteristics, several systematic findings have emerged. coarse - to - fine strategy where an initial global sweep of the image is followed by a later period of visual scrutiny of finer local details (locher., 2007). furthermore, the points of high salience computed in terms of local feature differences in luminance, color and orientation were found to drive eye fixations in viewing abstract and representational artworks (wallraven., 2007 ; dipaola., 2010 ; foulsham and kingstone, 2010 ; fuchs., 2011). based on these investigations, how the eye scans across pollock 's patterns, which lack obvious salient features and which scale across multiple sizes, is of obvious interest. figure 4a shows an eye - tracking system used in our study, which integrates infrared and visual camera techniques to determine the location of the eye 's gaze when looking at a pattern formed on a computer screen (hyona., 2002). the sizes of the fractal images displayed on the screen were 290 by 290 mm, corresponding to 1024 by 1024 screen pixels (i.e., the image resolution was 35.3 pixels / cm). the eye - tracker can locate the gaze with an accuracy of 4 pixels. subsections of a single eye - tracking data set : the spatial pattern plotted in the x (horizontal) and y (vertical) directions, (b) and the time series x vs. time (c). figure 4b shows a magnified section of the spatial pattern traced out by the eye 's gaze as it moves across the screen. as expected, the pattern is composed of long ballistic trajectories as the eye jumps between the locations of interest, and smaller motions called micro - saccades that occur during the dwell periods to ensure that the retina does not de - sensitize (hyona., 2002). figure 4b plots the horizontal (x) and vertical (y) locations in units of screen pixels. micro - saccades are expected to occur over an angular range of typically 0.5. this angle translates to a distance of 15 pixels on the screen and, as expected, this approximately matches the typical width of the dwell regions observed in figure 4b. figure 4c shows the corresponding temporal pattern by plotting the x position against time t. the periods of relative motionlessness are the dwell periods at a given location, during which time the eye is undergoing micro - saccades. the typical dwell time is approximately 0.4 s. the time scale of the individual micro - saccades is expected to be approximately 1020 ms. we note that this is on the same order as the sampling rate of the eye - tracking equipment (16 ms, 60 hz). this measurement limitation would, therefore, impact on any studies of the micro - saccades. however, the focus of our investigations lies with the saccades, since these larger motions are the ones that dictate the search motion, and these operate on longer time scales than the equipment 's sampling rate. figure 5 shows the eye 's spatial patterns (red trajectories) superimposed on pollock 's fractal paintings that were displayed on the computer screen. the observer was instructed to memorize the observed painting in order to induce the search activity. the observation period lasted 60 s. the d values of the displayed monochrome paintings from left to right were 1.11, 1.66, and 1.89. the fourth image (right) is a pollock painting composed of four differently colored interlocking fractal patterns, each with a d value of 1.6. eye - tracks are overlaid on the observed fractal patterns, which have dimensions of d = 1. 11 (far left), d = 1.66 (second left), and d = 1.89 (third left). the final pattern (right) is a colored composite of four d = 1.6 patterns. details of the box - counting analysis applied to the eye spatial pattern can be found elsewhere (fairbanks and taylor, 2011). the results show that the eye trajectories trace out fractal patterns with d values that are insensitive to the d value of the fractal pattern being observed : the saccade pattern is quantified by d = 1.4, even though the underlying pattern varied over a very large range from 1.11 to 1.89. we note that this characteristic value of d = 1.4 also holds for observations of multi - colored fractals (far right image of figure 5). to test this result further, we considered another form of fractal pattern for observers to search through the computer - generated fractals shown in figure 6. table 2 compares the d values of the spatial patterns traced out by the saccades and the d values of the observed fractal patterns. in each case, the d values of the saccades are averaged over the results from six observers, each of whom observed the nine fractal images for 30 s, separated by a checkerboard pattern observed for 30 s. the results confirm that the saccades trace out an inherent search pattern set at d = 1.5, regardless of the d values of the fractal pattern being observed (fairbanks and taylor, 2011). an example of the computer - generated fractals (black and white) viewed by the subjects for the eye - tracking results shown in table 2. a comparison of the d values of the fractal images being viewed, and the d values of the patterns traced out by the saccades. this insensitivity to such a wide range of d values in the observed pattern is striking. it suggests that the eye 's search mechanism follows an intrinsic mid - range d value when in search mode. a number of successful investigations have proposed that animals adopt fractal motions when searching for food. the smaller trajectories allow the animal to look for food in small region and then to travel to neighboring regions and then onto regions further away. significantly, such fractal motion has an enhanced diffusion compared to the equivalent random motion of brownian motion. this might explain why it is adopted for both animal searches for food and the eye 's search for visual information. the amount of space covered by fractal trajectories is bigger than for random trajectories, and a mid - range d value appears to be optimal for covering terrain efficiently (fairbanks and taylor, 2011). the mathematical properties of fractals, therefore, provide the explanation for why the human eye follows a fractal trajectory with an inherent d value set at 1.5. what happens when the eye is made to view a fractal pattern of d = 1.5 ? will this trigger a resonance when the eye sees a fractal pattern that matches its own inherent characteristics ? could such a resonance lead to a peak in esthetic appeal ? in the next section, we will use visual perception experiments to explore this hypothesis. the prevalence of fractals in our natural environment has motivated a number of studies to investigate the relationship between a pattern 's fractal character and its visual properties (pentland, 1984 ; cutting and garvin, 1987 ; jang and rajala, 1990 ; knill., 1990 ; rogowitz and., 1990 ; gilden., 1993 ; geake and landini, 1997). whereas these studies concentrated on perceived qualities such as roughness and complexity, other studies have focused on esthetics and the quantification of the visual appeal of fractal patterns (sprott, 1993 ; pickover, 1995 ; aks and sprott, 1996 ; taylor, 1998, 2001 ; richards and kerr, 1999 ; richards, 2001 ; spehar., 2003 ; hagerhall., 2004 ; taylor and sprott, 2008 ; boon., 2011). in one of the initial experiments performed in 1994, we used a chaotic pendulum called the pollockiser to generate fractal and non - fractal poured paintings (example sections from two paintings are shown in figure 7 ; taylor, 2011). in the perception studies that followed, participants were shown one fractal and one non - fractal pattern (randomly selected from 40 images) and asked to state a preference (taylor, 1998, 2003). out of the 120 participants, 113 preferred examples of fractal patterns over non - fractal patterns, confirming their powerful esthetic appeal. the chaotic pendulum (left) employed to generate non - fractal (top right) and fractal (bottom right) poured paintings. this technique was documented by abc television in 1998. given the profound effect that d has on the visual appearance of fractals (see, for example, figure 2), previous studies by aks and sprott used computer - generated fractals and reported preferred values of 1.3 (sprott, 1993 ; aks and sprott, 1996). to determine if this was a universal esthetic quality of fractals, we performed an experiment incorporating all three categories of fractal pattern : fractals formed by nature 's processes (natural scenery), by mathematics (computer - generated images) and by humans (pollock paintings) (spehar., 2003). within each category of fractals (i.e., mathematical, natural, and human), we investigated the visual preference as a function of d. this was done using a forced choice paired comparison technique, in which participants were shown a pair of images with different d values on a monitor and asked to chose the more visually appealing. introduced by cohn (1894), the forced choice paired comparison technique is well - established for securing value judgments. in our experiments, the presentation order was fully randomized and preference was quantified in terms of the proportion of times each image was chosen. the results, based on 220 participants, indicated that across all categories the visual preference peaks for fractal dimension between 1.3 and 1.5, whereas lower visual preferences are found for fractals outside of this range (spehar., 2003). we have further extended these findings by measuring visual preference for the same computer - generated fractals that were used in our eye - tracking experiments. visual preference for computer - generated fractals : the vertical axis in each panel corresponds to the percentage of trails for which patterns of a given d value were chosen as a function of fractal dimension (d). each of the four different panels uses a different fractal configuration to investigate this visual preference. the main effect of fractal dimension (d) on visual preference was significant for all four types of fractal images : f8,19 = 22.16, p < 0.0001 ; f8,19 = 38.01, p < 0.0001 ; f8,19 = 15.68, p < 0.0001 ; and f8,19 = 1.54, p < 0.0001 from the top to the bottom panel respectively. for each panel in figure 8, we show how the visual preference for fractal patterns depends on their d values. the same 20 observers viewed each image configuration and the results reveal a remarkable consistency in terms of the preference across the different configurations. for each configuration of fractal image, visual preference was significantly affected by a pattern 's fractal dimension (f8,19 = 22.16, p < 0.0001). as in our previous study (spehar., 2003), the highest average visual preference is observed for fractal dimensions in the 1.31.5 range. a comparison across the four panels shows how little this preference varies for different examples of fractal patterns with the same d value. character of fractal esthetics is further emphasized by an investigation indicating that gender and cultural background of participants did not significantly influence preference (abraham., each image featured just one form of fractal pattern (for example, the clouds or trees shown in figure 2). furthermore, the selected images provided a relatively high contrast against a uniform background, facilitating the application of the box - counting technique. an obvious step is to extend our studies to consider preferences for natural scenes, which typically feature a combination of several different fractal objects (e.g., clouds, tress, mountains etc). although the characteristics of typical scenes are considerably more subtle than the simple shapes considered above, their fractal statistics are well - charted. analysis has shown that typical scenes are scale invariant, following a power law behavior (field and brady, 1997 ; billock, 2000 ; billock., 2001). this behavior is thought to be due to a combination of the following factors : (i) many of the individual objects in the scene are fractal (see table 1), (ii) many scenes contain a power law distribution of object sizes (field and brady, 1997 ; ruderman, 1997), and (iii) the structure in each of the luminance edges in the scene is expected to follow a power law distribution of sizes (switkes., 1978). does the preference for mid - range d values of simple fractal objects (sprott, 1993 ; aks and sprott, 1996 ; spehar., 2003) extend to these more visually intricate fractal scenes ? one possible approach to addressing this issue would be to concentrate on the luminance properties of the overall scene. this could be done by adopting the technique that performs a spectral analysis of the spatial frequencies of the grayscale image of the scene, as discussed earlier (field and brady, 1997 ; billock, 2000). the appeal of this approach is that the grayscale analysis can be related to key variables in studies of spatial vision, such as michelson contrast. of a scene and previous fractals research indicates that roughness texture is an important property for perception in particular, a strong correlation has been found between fractal dimension and perceived roughness (pentland, 1984 ; jang and rajala, 1990). in contrast, other research indicates that perception is determined by the edge contours of the observed fractal pattern (rogowitz and voss, 1990). therefore, an alternative approach to the analysis of a fractal scene would be to select a prominent edge contour and investigate its impact on perception. the importance of edge contours to the visual system is supported by eye - tracking experiments which show that, in free viewing situations, subjects fixate on definite contours (rayner and pollatsek, 1992). the dominant contour in many scenes is formed by the skyline, and consequently these contours have been the focus of previous perception studies. in particular, in architectural studies of tall building skylines, the silhouette complexity significantly affected preference scores while facade complexity was of less importance (heath., 2000). furthermore, perception experiments using computer - generated images have investigated the impact of matching a city skyline to the background horizon formed by fractal mountains (stamps, 2002). due to this inter - disciplinary interest, our investigations of fractal scenery focused on the importance of the skyline contour for determining esthetic preference of natural scenes (hagerhall., the skyline contour of natural scenes has previously been found to be fractal, with the d value depending on the objects that define the contour (keller., 1987). our box - counting analysis of the skyline contours extracted from 80 scenes photographed in australia, sweden and italy confirms this fractal behavior. the procedure for extracting the skyline contour, shown in figure 9, the preference experiments, involving 119 participants from the general public, show the most preferred d value to be 1.3 (hagerhall., 2004), indicating that the preference for mid - range d values revealed for simple fractal shapes (aks and sprott, 1996 ; spehar., 2003) appears to extend to the fractal characteristics of more intricate fractal scenery. the preference for skyline contours with d = 1.3 was also confirmed in another study with 63 students in psychology and landscape architecture who rated 12 landscape silhouettes extracted from photographs of natural scenery. in addition to preference, the participants rated the naturalness of the silhouettes and the results showed that the perceived naturalness was also highest for the silhouettes with a fractal dimension of around 1.3 (hagerhall, 2005). the processing steps used in the extraction of the fractal skyline contour of a natural scene. bottom : the extracted skyline contour subjected to the box - counting fractal analysis. to summarize this section, perception studies of fractals generated by nature, mathematics and art indicate that images in the range d = 1.31.5 have the highest esthetic appeal. these mid - d values are close to the d values of 1.41.5 values predicted from the eye - tracking experiments. does this visual appreciation for mid - range d values affect the physiological condition of the observer ? this question motivated us to analyze the results of experiments performed at the nasa - ames research center, in which 24 participants were seated in a simulated space station cabin, each facing one image on the wall. during continuous exposure to the image, each task period was separated by a 1-min recovery period, thus creating a sequence of alternating high and low stress periods. to measure the subject 's physiological response to the stress of mental work prior studies have shown skin conductance to be a reliable indicator of mental performance stress with higher conductance occurring under high stress (ulrich and simons, 1986). the results showed that the mental tasks induced the smallest rise in stress when the observer was observing a fractal pattern with a d value of 1.4 (taylor, 2006). to build on this result, we extended our studies of relaxation to include neurophysiological responses (hagerhall., 2008). this was done by monitoring subjects quantitative eeg (qeeg) response while viewing fractals with different d values. previous eeg recordings by others have shown that people are more wakefully relaxed during exposure to natural landscapes than during exposure to townscapes (ulrich, 1981) and studies of wall art in hospitals find that images with natural content have positive effects on anxiety and stress (ulrich, 1993). however, the definition of nature adopted in these previous studies was vague compared to our proposal of considering the d dependence. similarly, there seems to be agreement that, in the awake brain, power in the alpha - band (912 hz) of the eeg is inversely related to activity (laufs., 2003a, b ; oakes., 2004). human behavior also seems to be more strongly related to the alpha - band than to the other frequency bands in the eeg (davidson and hugdahl, 1996) and that the alpha components seems to be especially responsive to environmental stimulation (kller, 1991 ; kller., 2009). while the alpha component of eeg is considered to show a wakefully relaxed state, the delta component (2.253 hz) is prominent during drowsiness and deep sleep. the beta component (1824 hz) is associated with external focus, attention and an alert state (kolb and whishaw, 2003). three regions of the brain frontal, parietal and temporal were chosen for the qeeg recordings. processes in these three associational zones are thought to be complementary (kolb and whishaw, 2003). hence, the three selected regions are expected to reveal significant psycho - physiological impacts of exposure to fractal images. based on the preferences for mid - d fractals and the possibility, based on the skin conductance measurements, that these fractals might also induce a relaxed state (taylor, 2006), we hypothesized that mid - d fractals would produce a maximal alpha response in the frontal areas. additionally, we hypothesized that the different fractal dimensions would generate different levels of activation in the processing of the pattern, i.e., a difference in beta responses would be likely in the parietal and temporal regions. computer - generated fractal skylines, shown in figure 10, were chosen with the d values of 1.14, 1.32, 1.51, and 1.70. the fractal images were viewed for 1 min each and interspaced by a neutral gray picture for 30 s. this exposure period was chosen to ensure that a relaxation effect in the subjects could occur. half of the subjects viewed the stimuli with increasing fractal dimension and the other half with decreasing fractal dimension. during the viewing, the fractal dimensions of the images were as follows : d (a) 1.14 (b) 1.32 (c) 1.51 and (d) 1.70. the results shown in figure 11 indicate that fractal images quantified by d = 1.3 induce the largest changes in subjects qeeg response (hagerhall., 2008). these fractals generated the maximal alpha response in the frontal region, consistent with the hypothesis that they are most relaxing. they, at the same time, generated the highest beta response in the parietal region, indicating that this pattern was conversely generating most activation in the processing of the pattern 's spatial properties. this points to a very interesting interplay between these brain areas for mid - d fractals, which requires further investigation. significant effects of the fractal dimension d on eeg. mean and sd in mv (mean sd). (a) alpha for frontal regions f3f4 together for d = 1.14 (2.28 1.77), d = 1.32 (2.80 2.36), d = 1.51 (2.53 2.09), and d = 1.70 (2.39 1.88). (b) delta for the frontal regions f3f4 together for d = 1.14 (5.57 5.96), d = 1.32 (4.91 4.44), d = 1.51 (6.06 6.11), and d = 1.70 (5.60 5.86). (c) beta for the parietal regions p3p4 together for d = 1.14 (1.69 1.57), d = 1.32 (1.95 1.74), d = 1.51 (1.80 1.63) and d = 1.70 (1.76 1.54). current studies are using the fmri technique to identify more precisely the regions of the brain that are preferentially activated when observing the stress - reducing fractals. preliminary results suggest that mid - d fractals activate the ventral visual stream (including the ventrolateral temporal cortex), the parahippocampal region, and the dorsolateral parietal cortex, involved with spatial long - term memory. interestingly, the parahippocampal area has also been discussed in relation to detection and regulation of emotional input, for instance with reactions to happy and sad classical music (mitterschiffthaler., 2007). these studies belong to the emerging field of neuro - esthetics, which explores the relationship between the neural cells activated and the esthetics of the object being observed (zeki, 1999). however, our preliminary experiments provide a fascinating insight into the impact that art might have on the perceptual, physiological and neurological condition of the observer. our future investigations will explore the possibility of incorporating fractal art into the interior and exterior of buildings, in order to adapt the visual characteristics of artificial environments to the positive responses. our findings might apply to a remarkably diverse range of fractal patterns appearing in art, architecture and archeology spanning more than five centuries. in addition to pollock 's poured fractals, other examples of fractals include the nazca lines in peru (pre - seventh century) (castrejon - pita., 2003), early chinese paintings (tenth to thirteenth century) (voss, 1998), the ryoanji rock garden in japan (fifteenth century) (van tonder., 2002), leonardo da vinci 's sketch the deluge (1500) (mandelbrot, 1982), katsushika hokusai 's wood - cut print the great wave (1846) (mandelbrot, 1982), gothic cathedrals (goldberger, 1996), gustave eiffel 's tower in paris (1889) (schroeder, 1991), frank lloyd wright 's palmer house in michigan (1950) (eaton, 1998), m. c. escher 's circle limit iii and iv (1960) (taylor, 2009) and frank gehry 's proposed architecture for the guggenheim museum in new york (2001) (taylor, 2001). is jackson pollock an artistic enigma ? according to our results, the low d patterns painted in his earlier years should have more visual appeal than the higher d patterns in his later classic poured paintings should we conclude that he wanted his work to be esthetically challenging to the gallery audience ? it is interesting to speculate that pollock might have regarded the visually restful experience of a low d pattern as being too bland for an artwork and that he wanted to keep the viewer alert by engaging their eyes in a constant search through the dense structure of a high d pattern. speculation over pollock 's preference for high d fractals leads us back to the fundamental question driving this article : why do most people prefer fractals in the range d = 1.31.5 ? we have noted that one potential explanation lies in a resonance with our eye trajectories, which trace out fractal patterns characterized by d = 1.41.5 when in search mode. however, an alternative explanation was presented by aks and sprott (1996) when interpreting their pioneering perception experiment. they speculated that the preference for mid - range d values is set through exposure to nature 's fractal patterns. indeed, table 2 shows that many of nature 's fractals cluster around d = 1.3. perhaps then people 's preference for mid - range fractals is based on familiarity with these d = 1.3 shapes ? intriguingly, table 2 also reveals another cluster at d = 1.7, matching pollock 's preference, raising the possibility that pollock 's preference was set by exposure to these more complex fractals (taylor, 2011). for example, mureika appealed to the peak shift effect (mureika, 2005), one of the eight laws of artistic experience is strengthened by overtly enhancing key characteristics of an image, in pollock 's case the d value. another esthetics model, the principle of the esthetic middle, predicts that the viewer will be drawn to a visual scene of mid - complexity (berlyne, 1971). given that higher d values exhibit higher visual complexity through their higher content of fine structure (sprott and taylor, 2008), this might explain why most people prefer mid - d fractals, but not pollock 's quest for higher values. recent studies that supplement d with other measures of complexity, such as gif file size and algorithm length (taylor and sprott, 2008 ; boon., 2011 ; forsythe., 2011), might prove useful in addressing this issue. the discrepancy between pollock 's preference and those of other observers might also lie in the fact that the paintings might have looked different to pollock simply because he spent so much time generating and looking at them. webster has argued that a prolonged exposure to any pattern or a visual environment leads to a process of adaptation, a process through which the perceptual norms are constantly adjusted (webster, 2002). we plan to test the idea of habituation to fractals in future experiments that examine if exposure to high d fractals causes the observer 's preference to move to these higher d values. we finish with a remark made by one of pollock 's friends, ruebin kadish, who noted, i think that one of the most important things about pollock 's work is that it is n't so much what you 're looking at but it 's what is happening to you as you 're looking at his particular work this observation emphasizes both the importance of the long tradition of experimental esthetics (fechner, 1876) and the value of employing modern tools for analyzing human response to art works. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. | fractals have been very successful in quantifying the visual complexity exhibited by many natural patterns, and have captured the imagination of scientists and artists alike. our research has shown that the poured patterns of the american abstract painter jackson pollock are also fractal. this discovery raises an intriguing possibility are the visual characteristics of fractals responsible for the long - term appeal of pollock 's work ? to address this question, we have conducted 10 years of scientific investigation of human response to fractals and here we present, for the first time, a review of this research that examines the inter - relationship between the various results. the investigations include eye tracking, visual preference, skin conductance, and eeg measurement techniques. we discuss the artistic implications of the positive perceptual and physiological responses to fractal patterns. |
cardiovascular disease is the leading cause of death in patients with chronic kidney disease (ckd). cardiovascular mortality in patients with end - stage renal disease (esrd) is 10 to 20 times higher than in the general population. classic risk factors (diabetes mellitus, smoking, dyslipidemia, high blood pressure, sedentary lifestyle, and obesity) do not entirely explain the high incidence of cv disease in these patients ; other, non - traditional risk factors must play a role and amongst them oxidative stress (os) and inflammation should be emphasized. os and inflammation are inseparably linked, as they induce and amplify one another and may cause cardiovascular damage. in addition, os may be involved in the pathogenesis of other cardiovascular risk factors in ckd, such as anemia, amyloidosis and malnutrition. hd patients are subjected to enhanced oxidative stress, as a result of increased pro - oxidant activity and reduced anti - oxidant systems related both to end stage renal disease (esrd) and hemodialysis techniques. diabetes mellitus, advanced age, inflammation, uremia, bio - incompatibility of dialysis membranes and solutions (use of ultrapure dialysate results in less os than standard dialysate), intravenous iron therapy are the main causes of increased pro - oxidant activity in hd patients. excessive reactive oxygen species (ros) levels can produce cellular damage by interacting with biomolecules (proteins, lipids, and nucleic acids) and thus have negative effects on tissue function and structure. malondialdehyde (mda) is the breakdown product of the major chain reactions leading to definite oxidation of polyunsaturated fatty acids such as linolenic acid and thus is a useful indicator for assessing oxidative damage. mda can interact with dna and proteins and has been shown to have mutagenic and cytotoxic effects and possibly to be involved in the pathogenesis of several human diseases, including atherosclerosis. mda levels increase with the progression of kidney dysfunction and in hd patients with dialysis vintage. in biological systems, mda exists both free (fmda) and bound (bmda) to sh and/or nh2 groups of proteins, nucleic acids and lipoproteins. chemically reactive fmda is an index of recent and potential damage, while bmda, excreted by the kidney, is a marker of an older injury. mda levels in hd patients can be reduced by l - carnitine and n - acetylcysteine. proteins are susceptible to oxidative stress too, and recently some studies have demonstrated the deleterious effect of serum oxidized albumin on cardiovascular mortality and morbidity in hd patients. the biomarker generally used to estimate protein oxidation are protein carbonyls (pc) ; increased levels have been described in hd patients. antioxidant systems including enzyme systems, water soluble, and fat - soluble free radical scavengers eliminate reactive oxygen species ideally before they inflict oxidative damage. ceruloplasmin (cp) is a plasma protein that allows incorporation of iron into transferrin without the formation of toxic iron products. under physiologic conditions, cp is also important in the control of membrane lipid oxidation, likely by direct oxidation of cations, thus preventing their catalysis of lipid peroxidation. nitric oxide (no), part of the antioxidant system, is a gaseous lipophilic free radical cellular messenger synthesized by nitric oxide synthases and which plays an important role in the protection against cv disease. few long - term follow - up studies that evaluate the impact of os on morbidity and mortality in hd patients are available in the literature. the aim of this study is to evaluate the impact of os markers on cv morbidity and mortality and all - cause mortality in a long - term follow - up and to examine potential determinants of os markers in hd patients. we conducted an analytical longitudinal prospective observational study, carried on a cohort of hd patients, randomly selected, with the aim to investigate the possible predictive role of os markers on survival and cv morbidity and mortality during a long term follow - up (108 months). of the 90 patients on conventional hd treatment in nefromed dialysis center cluj - napoca, 44 patients met the inclusion criteria and also agreed to participate in this study in 2005. inclusion criteria were : prevalent hd patients, age>18 years, duration of maintenance hemodialysis at least 6 months (hd vintage), without residual renal function. we excluded patients with acute inflammation processes, terminal neoplasia, previous renal transplantation, immunosuppressive treatment, active hepatitis, antiviral treatment. patients demographics data, duration of maintenance hemodialysis, and comorbidity conditions (diabetes, hypertension, virus hepatitis b or c infection, smoking status, statins treatment) at the time of enrolment were obtained from medical records. we also registered clinical data : age, weight, height, systolic blood pressure (sbp), diastolic blood pressure, (predialysis values). we registered previous cardiovascular disease (cardiac disease evaluated by : electrocardiogram with q - wave infarction, or myocardial enzyme elevation, coronary revascularization, typical history of angina with abnormal coronarography, neurological disease with new onset focal neurological deficit, or carotid stenosis or lower extremity arterial disease with revascularization or amputation, new onset of intermittent claudication confirmed by doppler or arteriography findings). we calculated body mass index (bmi) as bmi = (weight (kg)/height (m) and pulse pressure (pp) (mmhg) with formula : pp = sbp - dbp. all patients remained in the study and were followed prospectively for 108 months or until death. during the follow - up period we registered every 6 months the general mortality, fatal cve (myocardial infarction, congestive heart failure, stroke and sudden death) and non - fatal cve with the same method as the registration of previous cv disease. all biochemical analyses were performed after an overnight fast between 7.009.00 a.m. always during a midweek non - dialysis day. current measurements at the initiation of this study included serum electrolytes, albumin, creatinine, uric acid, iron profile (iron, transferrin and ferritin), lipid profile (total cholesterol, triglycerides (tg) and hdl - cholesterol), c - reactive protein (crp), alkaline phosphatase, intact parathormone (ipth) and transaminases. pre - dialysis and post - dialysis urea levels were used to calculate kt / v. serum calcium was corrected (cca) for albumin according to the formula : cca (mg / dl)=serum calcium(mg / dl)+0.8x(4.0-serum albumin(g / dl), ldl - cholesterol was calculated with friedewald formula : ldl - cholesterol = total cholesterol-(hdl - chol+tg/5). hepatitis virus b and c detection was performed by electrochemiluminiscence for hbs antigen (hbs ag) and hepatitis c virus antibodies (hcv ab). free and bound mda (nmol / ml) were measured using the thiobarbituric acid test and satoh methods. the antioxidant status was evaluated by measuring serum ceruloplasmin (mg%) colorimetrically by ravin method and nitric oxide was evaluated by measuring serum stable no metabolites nitrate and nitrite (nox) (mol / l) by griess reaction. measurements were performed in the oxidative stress laboratory of the physiology department, university of medicine and pharmacy of cluj. all patients were managed by nephrologists and were dialysed with bicarbonate based dialysate, volumetric ultrafiltration control, single use synthetic (polysulphone) dialyzers and heparin as standard anticoagulant. dialysis prescription was guided by a goal of achieving a value of kt / v1.2. antihypertensive drugs were prescribed for patients having post - dialysis or inter - dialysis blood pressure persistently above 150/95 mmhg, at dry weight. continuous variables were presented as mean standard deviation or median (2575 percentile) and categorical variables were expressed as percentages. for identifying correlations between two continuous variables, pearson s correlation coefficient or spearman correlation coefficient were used. cox proportional hazards regression analysis was used to examine the associations between variables and survival time. calculation of survival rates were plotted by the kaplan - meier method and compared using log - rank test. variables that were significant in the univariate analysis were included in a multivariate cox proportional hazards regression model (enter method). hazard ratios (hr) and their 95% confidence intervals (ci) were calculated. the cut - off was obtained with roc (receiver operating characteristic) curve analysis as the value which maximizes the youden index. the study protocol was in accordance with the ethical standards of the institutional and national research committees and with the 1964 helsinki declaration and its later amendments or comparable ethical standards and was approved by the university ethics 24 committee. we conducted an analytical longitudinal prospective observational study, carried on a cohort of hd patients, randomly selected, with the aim to investigate the possible predictive role of os markers on survival and cv morbidity and mortality during a long term follow - up (108 months). of the 90 patients on conventional hd treatment in nefromed dialysis center cluj - napoca, 44 patients met the inclusion criteria and also agreed to participate in this study in 2005. inclusion criteria were : prevalent hd patients, age>18 years, duration of maintenance hemodialysis at least 6 months (hd vintage), without residual renal function. we excluded patients with acute inflammation processes, terminal neoplasia, previous renal transplantation, immunosuppressive treatment, active hepatitis, antiviral treatment. patients demographics data, duration of maintenance hemodialysis, and comorbidity conditions (diabetes, hypertension, virus hepatitis b or c infection, smoking status, statins treatment) at the time of enrolment were obtained from medical records. we also registered clinical data : age, weight, height, systolic blood pressure (sbp), diastolic blood pressure, (predialysis values). we registered previous cardiovascular disease (cardiac disease evaluated by : electrocardiogram with q - wave infarction, or myocardial enzyme elevation, coronary revascularization, typical history of angina with abnormal coronarography, neurological disease with new onset focal neurological deficit, or carotid stenosis or lower extremity arterial disease with revascularization or amputation, new onset of intermittent claudication confirmed by doppler or arteriography findings). we calculated body mass index (bmi) as bmi = (weight (kg)/height (m) and pulse pressure (pp) (mmhg) with formula : pp = sbp - dbp. all patients remained in the study and were followed prospectively for 108 months or until death. during the follow - up period we registered every 6 months the general mortality, fatal cve (myocardial infarction, congestive heart failure, stroke and sudden death) and non - fatal cve with the same method as the registration of previous cv disease. all biochemical analyses were performed after an overnight fast between 7.009.00 a.m. always during a midweek non - dialysis day. current measurements at the initiation of this study included serum electrolytes, albumin, creatinine, uric acid, iron profile (iron, transferrin and ferritin), lipid profile (total cholesterol, triglycerides (tg) and hdl - cholesterol), c - reactive protein (crp), alkaline phosphatase, intact parathormone (ipth) and transaminases. pre - dialysis and post - dialysis urea levels were used to calculate kt / v. serum calcium was corrected (cca) for albumin according to the formula : cca (mg / dl)=serum calcium(mg / dl)+0.8x(4.0-serum albumin(g / dl), ldl - cholesterol was calculated with friedewald formula : ldl - cholesterol = total cholesterol-(hdl - chol+tg/5). hepatitis virus b and c detection was performed by electrochemiluminiscence for hbs antigen (hbs ag) and hepatitis c virus antibodies (hcv ab). free and bound mda (nmol / ml) were measured using the thiobarbituric acid test and satoh methods. the antioxidant status was evaluated by measuring serum ceruloplasmin (mg%) colorimetrically by ravin method and nitric oxide was evaluated by measuring serum stable no metabolites nitrate and nitrite (nox) (mol / l) by griess reaction. measurements were performed in the oxidative stress laboratory of the physiology department, university of medicine and pharmacy of cluj. all patients were managed by nephrologists and were dialysed with bicarbonate based dialysate, volumetric ultrafiltration control, single use synthetic (polysulphone) dialyzers and heparin as standard anticoagulant. dialysis prescription was guided by a goal of achieving a value of kt / v1.2. antihypertensive drugs were prescribed for patients having post - dialysis or inter - dialysis blood pressure persistently above 150/95 mmhg, at dry weight. continuous variables were presented as mean standard deviation or median (2575 percentile) and categorical variables were expressed as percentages. for identifying correlations between two continuous variables, pearson s correlation coefficient or spearman correlation coefficient were used. cox proportional hazards regression analysis was used to examine the associations between variables and survival time. calculation of survival rates were plotted by the kaplan - meier method and compared using log - rank test. variables that were significant in the univariate analysis were included in a multivariate cox proportional hazards regression model (enter method). hazard ratios (hr) and their 95% confidence intervals (ci) were calculated. the cut - off was obtained with roc (receiver operating characteristic) curve analysis as the value which maximizes the youden index. the study protocol was in accordance with the ethical standards of the institutional and national research committees and with the 1964 helsinki declaration and its later amendments or comparable ethical standards and was approved by the university ethics 24 committee. demographical and clinical characteristics of the patients (44 patients) are reported in table i ; 42 patients (95.4%) had an arterio - venous fistula, and 2 (4.6%) patients had a semi - permanent transcutaneous access. comorbidity conditions included 45.4% hypertension, 52.6% had previous cv events, hepatitis virus infection 43.2%, (20 patients, 2 hbs ag positive, 18 hcv ab positive) and no diabetes mellitus. data are presented as mean standard deviation or median (2575 percentile) or absolute or relative frequencies, sbp : systolic blood pressure, dbp : diastolic blood pressure, pp : pulse pressure, cv : cardiovascular disease, hd : hemodialysis, chol : cholesterol, cca : calcium corrected by serum albumin, p : phosphate, ipth : intact parathyroid hormone, crp : c - reactive protein, hv : hepatitis virus, ast : aspartat aminotransferase, alt : alanine aminotransferase, bmda : bound malondialdehyde, fmda : free malondialdehyde, pc : protein carbonyls, cp : ceruloplasmin, nox : nitrate / nitrite, epo : erythropoietin. the analysis of potential determinants of os markers revealed a direct correlation of bmda with cca (r=0.30, p=0.05) of protein carbonyls with serum ferritin (r=0.33, p=0.04), of ceruloplasmin with nox (r=0.35, p=0.02) and serum albumin with nox (r=0.30, p=0.05). an inverse correlation was found between protein carbonyls and dbp (r=0.31, p=0.02). we found no significant correlations between bmda and cholesterol and between os markers and erythropoietin dose. total mortality rate was 45.4% (20 patients), 10 cardiovascular deaths (cardiovascular mortality rate 22.7%) and 10 deaths of other causes (infections, malignancies, hyperkalaemia and gastro - intestinal bleeding). identified cut - off value for bmda was 2.34 nmol / ml : bmda lower than 2.34 nmol / ml is associated with better survival (p=0.01) (figure 1). univariate cox s proportional hazards regression analysis showed that pp (hr=1.04 ci 95% (1.001.08) p=0.029), cca (hr=1.75 ci 95% (1.162.62) p=0.007), crp (hr=1.47 ci 95% (1.032.11) p=0.03) and bmda (hr=2.12 ci 95% (0.984.58) p=0.05) had a significant association with survival. these parameters were included in a multivariate cox proportional hazards regression model which shows that bmda has the strongest influence on survival (hr=3.29 ci 95% (1.288.44) p=0.01) (table ii). sixteen nonfatal cv events occurred within the follow - up period (36.3% of the patients). univariate cox regression analysis performed to evaluate the impact of os markers on fatal and non - fatal cv events showed that only bmda exerts an influence on fatal cv events that approaches statistical significance (hr=2.85 ci 95% (0.889.22) p=0.07). none of the os markers showed any effect on non - fatal cv events (table iii). our main finding is that bmda is a strong predictor of survival in hd patients in a long - term (9 years) follow - up. low levels of bmda, suggesting lower oxidative stress, are associated with better survival. in addition we identified that high bmda tends to be associated with fatal cv events, but not with non - fatal cv events. other studies in hd patients had partial similar results : mda was the single strong predictor of prevalent cv disease in one transversal study, and also mda was associated with cardiovascular events in other studies. moreover, significantly lower levels of antioxidant markers were related with cv disease, but we have not found this association. the results of our research, only partially similar to previous studies, might be influenced by the characteristics of the study design : absence of diabetic patients, long - term follow - up, high prevalence of hepatitis virus c positive patients. although we found no correlations between virus status and os markers kato. observed that vhc infection can enhance oxidative stress in hd patients. the role of os in cv disease pathogenesis in ckd patients is well - known. were the first to propose the hypothesis that increased os and its consequences is a major contributor to increased atherosclerosis and cv morbidity and mortality found in uremia. likewise, via formation of pro - inflammatory oxidized lipids and advanced protein oxidation and glycation end products, os promotes inflammation. conversely, by generating reactive oxygen, chlorine, and nitrogen species, activated leukocytes, macrophages and resident cells cause os. oxidative stress and inflammation induce diminished endothelial function and impair vascular structural and functional parameters our research is to our knowledge the longest follow - up (9 years) design in the literature to observe the predictive value of bmda on survival and cv morbidity and mortality. we propose bmda as a cv risk biomarker in hd patients. os markers are determinants of survival and cardiovascular events in hd patients, consequently identification of factors associated with levels of these os markers is necessary for developing targeted therapies, in order to reduce os. in our patients, first, higher bmda is associated with higher cca, and indeed high cca is as expected a predictor of high mortality. hypercalcemia and increased os might act synergistically in aggravating the severe vascular lesions found in hd patients. second the association of high values of protein carbonyls with high serum ferritin (an iron storage protein but also inflammation marker) might be either the effect of iron treatment or of the inflammation process which can increase os. third, higher protein carbonyls were associated with low dbp and hence increased pulse pressure, which was also predictive for increased mortality. fourth, higher ceruloplasmin and serum albumin were associated with higher nox which might reflect the vasodilation improvement in our patients with increased antioxidant capacity. it seems to reflect the antioxidant capacity rather than inflammation because its levels do not correlate with any other inflammation markers. moreover, no, an inductor of vasodilation by regulation of vascular tone, inhibition of platelet aggregation and leukocyte adhesion, and prevention of smooth muscle cell proliferation, is affected in hd patients by many factors. no may increase in some patients during hd by cytokine release while in others it varies during dialysis, in correlation with bp variations. in some studies in hd patients the os markers (mda values and plasma advanced oxidation protein products) were associated with lipid profile and erythropoietin treatment. erythropoietin has anti - oxidative effects which depend on treatment duration and not epo dose. we did not observe correlations of measured os markers with erythropoietin dose, the same as described above, and unlike de vecchi. is related with cv mortality but is not a predictor of cv events in long - term follow - up (9 years). regular assessment of mda in hd patients and the development of strategies aimed at reducing oxidative stress in these patients might be beneficial. the limit of this study is the relative low number of patients. future studies might investigate whether mda is a potential biomarker that can be used to guide strategies for the management of cv risk in hd. | background and aimscardiovascular (cv) disease is the leading cause of morbidity and mortality in hemodialysis (hd) patients. kidney disease is associated with increased oxidative stress (os), a nontraditional cv risk factor. few studies evaluate the effect of os markers on cv events (cve) and survival in hd patients. the aim of this study is to examine potential determinants of os markers and their predictive role on survival and cv morbidity and mortality in hd patients during a long - term follow - up (108 months).methodswe conducted an analytical cross - sectional prospective observational study, carried on a cohort of randomly selected hd patients. we registered in 44 hd patients baseline characteristics, os markers, mortality and cve over a period of 108 months and we used statistical analysis (descriptive, kaplan - meier, univariate and multivariate cox model) for interpretation.resultsbound malondialdehyde (bmda) was positively correlated with serum calcium, protein carbonyls (pc) were inversely correlated with diastolic blood pressure (dbp) and directly correlated with ferritin, nox was directly correlated with ceruloplasmin) and serum albumin. of the measured os markers only bmda was related to survival (hr=3.29 95% ci (1.288.44), p=0.01), and approached statistical significance in the effect on cv mortality (hr=2.85 95% ci (0.889.22), p=0.07). none of the measured os markers was associated with cve.conclusionsbmda has a strong predictive value on survival in hd patients in a long - term follow - up (9 years). its value is correlated with cv mortality but is not a predictor of cv events. regular assessment of mda in hd patients and the development of strategies aimed at reducing oxidative stress in these patients might be beneficial. |
cp describes a group of permanent disorders of the development of movement and posture, causing activity limitation, that are attributed to nonprogressive disturbances that occurred in the developing fetal or infant brain. the motor disorders of cp are often accompanied by disturbances of sensation, perception, cognition, communication, and behavior, by epilepsy and secondary musculoskeletal problems. various studies had been carried out from all over the world for prevalence, reporting estimates of cp ranging from 1.5 to > 4 per 1000 live births or children of a defined age range. a number of factors contribute to the development of cp including antenatal, natal, and postnatal factors. intrapartum factors such as perinatal asphyxia also play role for the development of cp which have more contribution in developing countries. prematurity also became an important factor as survival of preterm babies is increasing owing to better health facilities. the physiological classification classifies cp children into spastic, dyskinetic, hypotonic, and mixed types on the basis of major motor abnormality while topographical classification divides them into monoplegia, diplegia, triplegia, quadriplegia, paraplegia, and hemiplegia, indicating involved extremities. besides movement and motor dysfunction, common associated comorbidities are epilepsy, speech, hearing and vision impairment, oromotor dysfunction, and intellectual disability. this study aimed to describe clinical spectrum, associated comorbidities, and risk factors associated with cp children presented to our hospital that will help in better understanding of etiology and presentation of cp children. this hospital - based observational study was conducted from march 2012 to march 2013 in tertiary level hospital in jaipur. one - hundred and eighty cp children aged 112 years were enrolled from paediatric neurology outdoor and child development centre. detailed birth history including antenatal, natal, postnatal, socioeconomic status, and maternal nutritional status was taken. detailed examination performed to classify cp children according to topography and physiological classification and also for associated comorbidities. in this study, most of children (35.56%) were in 34 years age group followed by 56 years age group (22.78%). of the 180 children, males were 56.11% while females were 43.33% of total children [table 1 ]. in other prenatal risk factors, antepartum hemorrhage, pregnancy - induced hypertension (pih) and infections contributed to 5.5%, 4.4%, and 3.3%, cases respectively [table 2 ]. among natal factors, small for gestational age (sga) (25.5%) and prematurity (17.7%) were also common risk factors for cp [table 3 ]. seizure in postnatal life was the second most common risk factor for cp after asphyxia. pathological jaundice and infections are responsible for 15.5% and 25% cases, respectively [table 4 ]. distribution of patients according to age and sex antenatal risk factors, n (%) natal risk factors, n (%) postnatal risk factors, n (%) spastic cp (84.4%) was the most common physiological type and quadriplegia (56.6%) was the most common topographical type observed in this study. hypotonic and dyskinetic types contributed for equal cases (5.5% each case) [table 5 ]. distribution of cerebral palsy children according to physiological and topographical classification, n (%) one or more comorbidities were present in cp children in this study. intellectual disability (47.7%) followed by epilepsy (41.6%) was the most common comorbidity. speech delay, hearing defects, and visual impairment were present in 27.7%, 10%, and 10% cases, respectively [table 6 ]. in the present study, we described the clinical spectrum, risk factor profile, and comorbidities associated with cp children. as cp is the most common and costly form of chronic motor disability in children, understanding of probable risk factors that can cause cp is utmost important. a european study by johnson also showed similar result with male : female ratio of 1.33:1. maternal anemia contributed for 17.7% cases followed by antepartum hemorrhage (5.5%), hypertension (4.4%), and infections (3.3%). described probable etiological factors of cp children in central india and found that antepartum hemorrhage and hypertension contributed 10% and 6%, respectively. pattar and yelamali described similar results with equal frequency of maternal anemia, pih / toxemia, and aph (in 6% cases each) as risk factors of cp. consistent with literature, our study also showed asphyxia (45.5%) as the most common risk factor of cp. anwar. observed that majority (53.6%) of the cp cases were reported to had perinatal asphyxia. they also observed that mothers of 43.6% cp children had history of prolonged labor while in our study only 1.6% cp chil - dren 's mothers had prolonged labor history. our study result was supported by similar finding in study performed by gedam. they found 2% mothers of cp children had history of prolonged labor. in this study, o'callaghan. estimated epidemiological risk factors of cp children and found that 43.9% and 29.3% cp children were sga and preterm at birth, respectively. seizure (35.5%) was the most common risk factor in postnatal life for the development of cp, and majority of these cases were consequences of hypoxic ischemic encephalopathy. pathological jaundice and infection contributed for 15.5% and 25% cases, respectively. in developed countries, children of spastic diplegia cp are increasing as survival of preterm babies is improved, but in this study, spastic quadriplegia was the most common topographical type and contributed for 56.6% cases. these results were consistent with results of study by singhi. who reviewed clinical profile of 1000 cp children. intellectual disability and epilepsy were the most common comorbidities associated with cp children while 27.7% cp children had speech delay. other associated comorbidities are visual impairment, hearing defect, malnutrition, and oromotor dysfunction. even with advancement of health - care system, asphyxia is the most common risk factor, and spastic quadriplegia is the most common type of cp. there is still a need for improving the health facilities to overcome this costly and common neuromotor disability. widespread knowledge of common risk factors that can predispose to cp can prevent the cp development to some extent and knowledge of clinical spectrum, and comorbidities can improve their targeted treatment which can improve their growth and social participation. | aim and objective : cerebral palsy (cp) is the most common motor disability in childhood. this study aimed to describe clinical spectrum, comorbidities, and risk factors associated with cp children.materials and methods : this hospital - based observational study was conducted in tertiary level hospital in jaipur including 180 cp children aged 112 years, attending the paediatric neurology outdoor and child development centre. a detailed history of antenatal, natal, and postnatal events taken and thorough examination was performed to stratify children in proper topographical and physiological classification.results:mothers of 47.7% cp children were primigravida and 17.7% mothers had anemia during pregnancy. among natal factors, asphyxia contributed to maximum cases (52.2%). seizure in postnatal life was the second most common risk factor for cp after asphyxia. spastic cp (84.4%) was the most common physiological type, and quadriplegia (56.6%) was the most common topographical type observed in this study. intellectual disability (47.7%) followed by epilepsy (41.6%) was the most common comorbidity.conclusion:even with the advancement of health - care system, asphyxia is the most common risk factor, and spastic quadriplegia is the most common type of cp. there is still a need of improving the health facilities to overcome this costly and common neuromotor disability. widespread knowledge of common risk factors that can predispose to cp can prevent the cp development to some extent and knowledge of clinical spectrum, and comorbidities can improve their targeted treatment which can improve their growth and social participation. |
the study population consisted of all consecutive patients undergoing ccta in our institution between 1 december 2003 and 29 february 2008, for evaluation of suspected cad. exclusion criteria were 1) typical angina pectoris, 2) a history of myocardial infarction including electrocardiographic signs of a silent myocardial infarction, 3) a history of coronary revascularization, either by percutaneous coronary intervention or bypass or otherwise known cad, 4) absence of stable sinus rhythm during the investigation, and 5) a life - threatening conditions. patients were subdivided according to the presence of diabetes, defined as current treatment with insulin or oral hypoglycemic medication or dietetic control of blood glucose levels in patients having elevated fasting blood glucose levels or an abnormal glucose tolerance test based on the world health organization criteria (11). written informed consent was obtained from all patients before examination. a structured interview was performed before examination, and information about age, patients ' height and weight, history of cardiac disease, and present complaints was collected. the following cardiac risk factors were recorded : 1) presence and degree of hypertension, 2) diabetes (see definition above), 3) smoking (defined as current smoker or previous smoker within the last year), and 4) a positive family history (defined as the presence of cad in first - degree relatives aged 1.5 mm was evaluated by two experienced readers (one radiologist and one cardiologist). the degree of stenosis was rated visually using four groups : no relevant stenosis (1.5 mm in diameter categorized as follows : score 0 : all evaluable coronary segments 1.5 mm was evaluated by two experienced readers (one radiologist and one cardiologist). the degree of stenosis was rated visually using four groups : no relevant stenosis (1.5 mm in diameter categorized as follows : score 0 : all evaluable coronary segments 1.5 mm in diameter categorized as follows : score 0 : all evaluable coronary segments 9 lesions, resulting in an hr of 1.3 (1.11.7, p = 0.005) for each additional lesion. for comparison, in nondiabetic patients the annual event rate increased from 0.3% (0.10.6%) for patient with 9 lesions. 1). survival free of hard cardiac events in correlation with the atherosclerosis burden score, counting the number of lesions having either nonstenotic plaques or stenoses (irrespective of degree), in patients both with and without diabetes. the numbers of patients at risk refer to the three groups analyzed (top 9 diseased segments). in multivariable analysis of the total patient population, the atherosclerotic burden score was the only significant predictor for hard cardiac event besides patient 's age (table 3). coronary obstruction score and calcium score were both significant in the univariate model but could not add prognostic information on top of the atherosclerotic burden score. the atherosclerotic burden score significantly improved the predictive value of a model including all conventional risk factors, increasing the likelihood ratio from 26.2 to 38.1 (p 9 lesions, resulting in an hr of 1.3 (1.11.7, p = 0.005) for each additional lesion. for comparison, in nondiabetic patients the annual event rate increased from 0.3% (0.10.6%) for patient with 9 lesions. 1). survival free of hard cardiac events in correlation with the atherosclerosis burden score, counting the number of lesions having either nonstenotic plaques or stenoses (irrespective of degree), in patients both with and without diabetes. the numbers of patients at risk refer to the three groups analyzed (top 9 diseased segments). in multivariable analysis of the total patient population, the atherosclerotic burden score was the only significant predictor for hard cardiac event besides patient 's age (table 3). coronary obstruction score and calcium score were both significant in the univariate model but could not add prognostic information on top of the atherosclerotic burden score. the atherosclerotic burden score significantly improved the predictive value of a model including all conventional risk factors, increasing the likelihood ratio from 26.2 to 38.1 (p 9 coronary segments affected) having a risk of nearly 10% per year for having a severe cardiac event, the effort and risks of a intensive blood glucose control combined with a secondary prevention regimen for cad might be justified even in the absence of cardiac symptoms. in addition, obstructive cad can be detected or ruled out with high accuracy (5), circumventing both the limitations of myocardial stress imaging and the risks of invasive angiography but providing valuable information for the selection of patients who could benefit from timely coronary revascularization. whether an approach such as this is actually better than the current concepts and whether ccta can replace myocardial perfusion imaging as a gatekeeper for revascularization still need to be assessed in larger studies, but this study clearly demonstrates that ccta has the potential to identify patients with a particularly high risk for hard cardiac events in a group of diabetic patients without known coronary artery disease. it is an observational study, and the result of the investigation guided further treatment, both interventional and medical. because most of the patients were referred from outside cardiologists in private practice, valid information regarding diabetic control or changes of medication after the investigation is not available. in addition, the number of diabetic patients is small in this unrestricted patient population. in summary, diabetic patients without known cad undergoing ccta have an increased prevalence of both coronary plaques and obstructive cad compared with nondiabetic patients. a ccta atherosclerotic burden score based on the number of diseased coronary segments (irrespective of the degree of stenosis) correlates best with events during follow - up and can significantly improve the risk stratification over and above that of conventional risk factor assessment. this procedure allows the identification of a patient group of particular high risk for incident cardiac events. | objectivediabetic patients have a high prevalence of coronary artery disease (cad), but timely diagnosis of cad remains challenging. we assessed the ability of coronary computed tomography angiography (ccta) to detect cad in diabetic patients and to predict subsequent cardiac events.research design and methodswe analyzed 140 diabetic patients without known cad undergoing ccta ; 1,782 patients without diabetes were used as a control group. besides calcium scoring and the degree of the most severe stenosis, the atherosclerotic burden score counting the number of segments having either a nonstenotic plaque or a stenosis was recorded. the primary end point was a composite of hard cardiac events defined as all - cause death, nonfatal myocardial infarction, or unstable angina requiring hospitalization.resultsduring a mean follow - up of 33 months, there were seven events in the diabetic group and 24 events in the control group. the best predictor in diabetic patients was the atherosclerotic burden score : the annual event rate ranged from 0.5% for patients with 9 lesions, resulting in a hazard ratio (hr) of 1.3 (95% ci 1.11.7) for each additional lesion (p = 0.005). for comparison, in nondiabetic patients the annual event rate ranged from 0.3 to 2.2%, respectively, resulting in an hr of 1.2 (95% ci 1.11.3, p < 0.001). the atherosclerotic burden score improved the prognostic value of conventional risk factors significantly (p < 0.001).conclusionsin diabetic patients without known cad, ccta can identify a patient group at particularly high risk for subsequent hard cardiac events. |
the postinfectious irritable bowel syndrome is characterized by the sudden onset of symptoms mentioned in the diagnostic criteria for irritable bowel syndrome (with rome iv criteria being the most recently defined). they appear following an episode of acute infectious gastroenteritis characterized by two or more of the following symptoms and findings : diarrhea, vomiting, fever and a positive stool culture result. the human gastrointestinal (gi) microbiota is a rich and dynamic community inhabited by approximately 1014 bacteria, most of which uncultivated yet in the laboratory (zoetendal, 2006). multiple theories linking irritable bowel syndrome etiology with the intestinal microbiota have been proposed, which, together with the discovered irritable bowel syndrome - associated gi microbiota alterations, imply that bacteria could play a part in irritable bowel syndrome etiology. the overall microbial community from fecal samples of irritable bowel syndrome subjects has been analyzed applying denaturing gradient gel electrophoresis (dgge), microarray (hitcip and phylochip), and sequencing (conventional sanger sequencing and 2nd generation 454 pyrosequencing). these methods are capable of detecting the unculturable species in the microbiota, although they have restrictions due to primer and probe dependency and technical biases. the possibility to gain a non - restricted overview with sequencing, to design targeted primers and probes for applications based on pcr or hybridization is the main advantage. the differences in the intestinal microbiota between irritable bowel syndrome patients and healthy controls (hcs) have mostly been studied using fecal material, known as the most accessible source of the gi microbiota. developed a study regarding the alteration in composition and diversity of the intestinal microbiota in patients with diarrhea - predominant irritable bowel syndrome. therefore, fecal dna was isolated from 23 d - irritable bowel syndrome patients and 23 healthy controls (hc). variable regions v1v3 and v6 of the 16s rrna gene were amplified from all samples. pcr products were sequenced using 454 high throughput sequencing. using quantitative insights into microbial ecology pipeline the composition, richness and diversity of microbial communities were determined and compared between d - irritable bowel syndrome and hc. the results were the fact that the contribution of bacterial groups to the composition of the intestinal microbiota differed between d - irritable bowel syndrome and hc. d - irritable bowel syndrome patients had significantly higher levels of enterobacteriaceae (p=0.003) and lower levels of faecalibacterium genera (p=0.04) compared to hc. beta - diversity values demonstrated significantly lower levels of unifrac distances in hc compared to d - irritable bowel syndrome patients. the richness of 16s rrna sequences was significantly decreased in d - irritable bowel syndrome patients (p<0.04). their 16s rrna sequence data demonstrated that a community - level intestinal microbiota in d - irritable bowel syndrome is associated with significant increase, which is detrimental and decreases beneficial bacterial groups, and a reduction in microbial richness. suggest that altered intestinal microbiota contributes to the symptoms of irritable bowel syndrome through increased levels of organic acids. in fecal samples, irritable bowel syndrome patients had significantly higher numbers of veillonella and lactobacillus than healthy controls. furthermore, in irritable bowel syndrome patients with high acetic acid or propionic acid levels the symptoms were more severe, they presented negative emotions and an impaired quality of life. the results are in accordance with the concept that the gut microbiota interacts with higher brain centers that influence the sensory, motor and immune system of the gut. the bacterial overgrowth in the small intestinal observed in a subset of irritable bowel syndrome patients shows quantitative changes in the small bowel microbiota. data are lacking on qualitative changes in the gut microbiota in irritable bowel syndrome patients. the concepts identified here may lead to the development of novel therapeutic strategies for irritable bowel syndrome using manipulation of the intestinal microbiota. dysbiosis of the intestinal microbiota in irritable bowel syndrome has been detected on several levels : the overall community appears to be less diverse with more variation between individuals and overtime. these phenomena may reduce the resilience of the microbiota to external stressors, and both trigger and sustain functional aberrations in the gut. in addition to overall dysbiosis, specific bacterial groups are either elevated (lactobacillus, veillonella, ruminococcus, enterobacteriaceae, aerobes group, s. aureus) or reduced (bifidobactrium, b.catenulatum, bacteroides) in irritable bowel syndrome, with the exception of bifidobacteria. treatment is frequently symptom directed rather than curative and includes agents prescribed for the treatment of irritable bowel syndrome- d. it follows therefore that reducing fiber intake might be beneficial in d - irritable bowel syndrome. opiates : codeine or loperamide inhibit rapid transit whatever the cause and also inhibit secretions. although loperamide is effective in improving stool consistency it is less effective in controlling pain in irritable bowel syndrome. antispasmodics, such as the anticholinergic agent hyoscyamine, reduce intestinal the activity of smooth muscle. tricyclic antidepressants : these have multiple actions with anti - histaminic, anti - muscarinic as well as serotonin reuptake inhibition. tricyclics have been shown in large clinical trials to reduce pain, nausea and diarrhea in irritable bowel syndrome. 5ht3-antagonists : alosetron slows colonic transit and improves stool consistency and frequency in d - irritable bowel syndrome. side effects include constipation which can be severe, and rarely ischemic colitis which caused a temporary suspension of the drug. in an outbreak of waterborne giardiasis where 1300 subjects were diagnosed, with g. lamblia 139 patients continued to have abdominal symptoms of whom two of three had negative stool microscopy and culture. investigated visceral hypersensitivity in patients with persisting abdominal symptoms after g. lamblia infection ; they also assessed the effect of 5ht(3)-antagonist ondansetron. patients with g. lamblia induced gastrointestinal symptoms developed both functional dyspepsia and irritable bowel syndrome. ondansetron (5-ht(3) antagonist), did not improve gastric emptying, drinking capacity, or symptoms except nausea. 5ht4 agonists : tegaserod is the only one agent marketed in this class, and it stimulates colonic transit in both healthy volunteers and patients with constipated irritable bowel syndrome. it is successful in improving global symptoms, it softens the stool consistency, increases the frequency of bowel movement, and reduces the symptoms of bloating (nnt = 1012). cholestyramine is useful in diarrhea due to bile salt malabsorption which may develop following acute gastroenteritis. several studies have documented that postinfectious irritable bowel syndrome can respond to cholestyramine which is nevertheless rather poorly tolerated owing to its unpleasant taste in its current formulation. antibiotics : the diagnostic criteria for irritable bowel syndrome include symptoms (bloating, abdominal pain and altered bowel habits) are similar to those experienced by subjects with small intestinal bacterial overgrowth (sibo). studies have demonstrated an association between sibo and irritable bowel syndrome using breath testing techniques. when galatola. performed 14c - xylose breath tests on subjects with a number of gastrointestinal disorders, the prevalence of abnormal breath tests demonstrating sibo was 56% and 29% in diarrhea and constipation predominant irritable bowel syndrome, respectively.. however, nayak. demonstrated that irritable bowel syndrome subjects treated with metronidazole were significantly better than placebo - treated patients. this suggested that bacteria could play a part in the symptomatology of the irritable bowel syndrome. pimentel. showed that eradication of sibo improves the gastrointestinal symptoms of irritable bowel syndrome. the antibiotics used in the treatment of sibo in the 47 subjects were neomycin, ciprofloxacin, flagyl and doxycycline, 710 days. although efficacy data for antibiotic prophylaxis in the prevention of acute bacterial diarrhea are limited, antibiotics have demonstrated efficacy for treating bacterial diarrheal illnesses and reducing the duration of illness by 12 days compared with placebo or no intervention. even though fluoroquinolones have become standard therapy for the treatment of travelers diarrhea, in double - blind, placebo - controlled, randomized, and comparative studies rifaximin 6001,800 mg / day for 35 days has also been shown to be effective treatment. the efficacy of antibiotics for the treatment of postinfectious irritable bowel syndrome has not been specifically evaluated, but research suggests that antibiotics may be effective in treating a subset of patients with irritable bowel syndrome. prophylaxis aimed at preventing or early treatment of acute bacterial diarrhea may reduce the risk of postinfectious irritable bowel syndrome development by reducing the occurrence, duration, and severity of the chronic inflammation and mucosal alterations believed to play a role in disease persistence. several agents, including bismuth subsalicylate and antibiotics (e.g., fluoroquinolones and rifaximin), have been evaluated for the prevention of travelers diarrhea. bismuth subsalicylate is not as effective as antibiotics in preventing diarrheal illness, and concerns about bacterial resistance may limit the use of fluoroquinolones prophylactic. probiotics can restore the intestinal microbiota in patients with irritable bowel syndrome and result in an improvement of postinfectious irritable bowel syndrome in animal models. fecal microbiota transplantation (fmt) can be probably more beneficial, as donated feces, in a sense, are the ultimate human probiotic. in a case series of 55 patients with irritable bowel syndrome and ibd treated with fmt, cure was reported in 20 (36%), decreased symptoms in nine (16%) and no response in 26 (47%) patients. in another series, 45 patients with chronic constipation were treated with colonoscopic fmt and subsequent fecal enema infusions, 89% of whom (40 of 45 patients) reported relief in abdominal pain, bloating and defecation, immediately after the procedure. normal defecation, without using laxatives, persisted in 18 of 30 patients (60%) contacted 919 months later. treatment of recurrent clostridium difficile infection (cdi) with antibiotics leads to recurrences in up to 50% of patients. mattila e. investigated the efficacy of fecal transplantation in treatment of recurrent cdi. persistent or recurrent symptoms and signs were defined as clinical failure and a need for new therapy. symptoms resolved in all patients who did not have strain 027 cdi during the first 12 weeks after fecal transplantation. of 36 patients with 027 cdi, 32 (89%) had a favorable response ; all 4 nonresponders had a pre - existing comorbidity or serious condition, caused by a long lasting diarrheal disease and subsequently died of colitis. during the first year after transplantation, 2 patietnts were treated successfully with another fecal transplantation and 2 with antibiotics for cdi ; 4 patients with an initial favorable response after receiving antibiotics for unrelated causes had a relapse. within 1 year after transplantation 10 patients died of unrelated illnesses. fecal transplantation through colonoscopy seems to be an effective treatment for recurrent cdi and also for recurrent cdi caused by the virulent clostridium difficile 027 strain. patients diagnosed with irritable bowel syndrome (ibs) have observed the association between specific foods with worsening of symptoms. because of limited data and guideline consensus and also because of the nuances of symptoms associated with ibs subtypes, clinical guidance for doctors and nurse practitioners can be challenging. by addressing the relevance of diet for symptom alleviation, doctors and nurse practitioners are able to better support patients and collaborate with dieticians to improve symptom management. there is no convincing evidence that gluten causes the new and debated diagnosis of non - coeliac gluten sensitivity (ncgs), as well as there is no evidence that ibs patients suffer from food allergy or food intolerance. patients with ncgs appear to be ibs patients who are self - diagnosed and self - treated with a gluten - free diet. the consumption of the poorly absorbed fermentable oligo-, di-, monosaccharide and polyols (fodmaps) and insoluble fiber might be a trigger in ibs symptoms. fodmaps and insoluble fiber increase the osmotic pressure in the large - intestine lumen and provide a substrate for bacterial fermentation, on reaching the distal small intestine and colon. poor fodmaps and insoluble fibers diet reduces the symptom and improve the quality of life in ibs patients. low intake in fodmaps can change favorably the intestinal microbiota and restores the abnormalities in the gastrointestinal endocrine cells. five gastrointestinal endocrine cell types that produce hormones regulating appetite and food intake are abnormal in ibs patients. based on these hormonal abnormalities, it is expected that ibs patients might have increased food intake and body weight gain. the link between obesity and ibs is not fully studied. individual dietary guidance for intake of poor fodmaps and insoluble fibers diet in combination with probiotics intake and regular exercise is to be recommended for ibs patients. a diet with reduced content fosmaps has been reported to be effective in the treatment of patients with irritable bowel syndrome (ibs). bhn. compared the effects of a diet low in fodmaps with traditional dietary advice in a randomized controlled trial of patients who met rome iii criteria for ibs and reached to the conclusion that a diet low in fodmaps reduces ibs symptoms as well as traditional ibs dietary advice. approximately 70% of ibs patients point at certain foods as triggers for their symptoms. to help identify potential trigger foods zia. evaluated the feasibility and usability of a novel food and symptom journal app, specifically designed for patients with ibs. the results were that the app appeared to be a feasible and usable tool for ibs patients. the findings were that most ibs patients have food triggers and that these vary by individual. future studies can explore whether individualized dietary changes guided by an app can result in ibs symptom improvement. rome iv recognize further the postinfectious ibs as a specific entity, according to the multidimensional clinical chronic mucosal inflammation triggered by enteric infection may underlie persistent bowel symptoms in patients who develop postinfectious irritable bowel syndrome. antimicrobials, such as rifaximin, have shown potential benefit in the prevention and treatment of acute bacterial illness in international travelers, as well as in the treatment of established irritable bowel syndrome. combining a diet low in fodmaps with traditional ibs dietary advice, might further reduce symptoms of ibs. | after acute infectious gastroenteritis, up to thirty percent of patients present prolonged gastrointestinal symptoms and a part of those affected patients can have the diagnostic criteria for postinfectious irritable bowel syndrome.treatment is symptom directed rather than curative and includes agents prescribed for the treatment of irritable bowel syndrome in general. prophylaxis or early treatment of acute bacterial diarrhea may reduce the risk of postinfectious irritable bowel syndrome development by reducing the occurrence, duration, and severity of the chronic inflammation and mucosal alterations (all these believed to play an important role in disease persistence). probiotic treatment is effective in restoring the intestinal microbiota in patients with irritable bowel syndrome and in animal models there are improvements of postinfectious irritable bowel syndrome. fecal microbiota transplantation seems to be one of the most effective methods of treating the postinfectious irritable bowel syndrome (with recurrent episodes) caused by clostridium difficile. |
all protocols and experiments were approved by the washington university animals studies committee (protocol 20150285) and followed national institutes of health animal care guidelines. male c57bl/6 mice, tsc1 and raptor mice, were purchased from the jackson laboratory (bar harbor, me). villin cre mice were obtained via a generous donation from sylvie robine (curie institute, paris, france). intestinal epithelial - specific tsc1 and raptor knockout mice were generated by crossing villin cre mice with tsc1 or raptor, respectively. wild - type littermates villin cre () ; tsc1 or villin cre(-) ; raptor were used as control mice. louis, mo) was dissolved in sunflower oil at 10 mg / ml and injected intraperitoneally at 50 g per gram of body weight for 3 consecutive days to induce deletion of gene expression. mice were kept in the animal holding area with a 12-hour light - dark cycle and given rodent chow ad libitum after weaning. the intestinal resections were performed by transecting the bowel 1- to 2-cm distal from the ligament of treitz and at 12-cm proximal to the ileocecal junction, followed by removal of the intervening segment. intestinal continuity was re - established by an end - to - end primary anastomosis using interrupted 9 - 0 monofilament sutures. mice then were fed with a standard liquid diet (pmi micro - stabilized rodent liquid diet ld 101 ; testdiet, richmond, in) until death. at the time of death, a midline laparotomy was performed and the entire small intestine was flushed with ice - cold phosphate - buffered saline containing protease inhibitors (0.2 nmol / l phenylmethylsulfonyl fluoride, 5 g / ml aprotinin, 1 mol / l benzamidine, 1 mmol / l sodium orthovanadate, and 2 mol / l cantharidin). a 2-cm segment of bowel distal to the anastomosis was fixed in 10% neutral - buffered formalin for histology. the remainder of the distal segment was used to isolate crypt and villus. protein extracted from isolated crypt or villus was used for western blot assay, and rna was used for real - time polymerase chain reaction (pcr) assays. intestinal tissue was paraffin - embedded and cut into 5-m thick longitudinal sections followed by h&e staining. villus height and crypt depth were measured with a video - assisted computer program (nis elements ar 4 ; nikon, melville, ny). crypt depth was measured as the length between the bottom of the crypts and the crypt - villus junction, and villus height was determined by the length between the crypt villi junction and the top of the villus. at least 20 well - oriented crypts and villi were counted per slide. crypts were counted only if the crypt villus junctions on both sides of the crypt were intact and if paneth cells were present at the base of the crypt. villi were counted only if the central lymphatic channel extended from the villus base to the tip and if the mucosal surface was in continuity with an intact crypt. alkaline phosphatase activity was detected via immunofluorescence using a vector red alkaline phosphatase substrate kit (vector laboratories, burlingame, ca). antigen retrieval was performed using diva decloaking solution (biocare medical, concord, ca) (120c for 2 minutes using a high - pressure cooker). slides were blocked with avidin - pink and biotin - blue (biocare medical), treated with a specific antibody in davinci green (biocare medical), incubated overnight at 4c, and visualized with biotinylated goat anti - rabbit igg (jackson immunoresearch, inc, west grove, pa), followed by streptavidin horseradish peroxidase (jackson immunoresearch laboratories, inc, west grove, pa), diaminobenzidine (sigma - aldrich, st. p - histone h3 antibody (9701, 1:400 ; cell signaling technology, danvers, ma) for cell proliferation ; mucin-2 (15334, 1:1000 ; santa cruz, dallas, tx) for goblet cell differentiation ; chromogranin a (20085, 1:800 ; immunostar, hudson, wi) for enteroendocrine cell differentiation ; matrix metalloproteinase (mmp)-7 (3801, 1:100 ; cell signaling technology, danvers, ma) ; and lysozyme (rp 028 - 05, 1:100 ; diagnostic biosystems, pleasanton, ca) for paneth cell differentiation. isolated crypt and villus samples were lysed with sodium dodecyl sulfate sample buffer (50 mmol / l tris - hcl, ph 6.8, 2% sodium dodecyl sulfate, 10% glycerol, and 5% mercaptoethanol). the lysate then was heated for 5 minutes at 100c, and the protein concentration was determined using the rc - dc kit (bio - rad, hercules, ca). antibodies used in this study were as follows : tsc1 (# 6935), tsc2 (# 4308), raptor (# 2280), ps6k (# 9234), s6k (# 2708), ps6 (s235/236 ; # 4858), ps6 (s240/244 ; # 5364), s6 (# 2217), glyceraldehyde-3-phosphate dehydrogenase (# 5174), and mmp-7 (# 3801) (all from cell signaling technology). the proteins were detected using the bio - rad chemidoc xrs+ system with image lab software (bio - rad). isolated crypts and villi were homogenized in lysis buffer and rna was extracted according to the manufacturer s protocol (rnaqueous kit ; ambion, austin tx). the total rna concentration was determined using a nanodrop spectrophotometer (nd-1000 ; nanodrop technologies, wilmington, de). tsc1, tsc2, mmp-7, and lysozyme primers were obtained from life technologies (carlsbad, ca). -actin was used as the endogenous control (applied biosystems, foster city, ca). the applied biosystems 7500 fast real - time pcr system was used to obtain relative rna expression. statistical analysis was performed using the student t test to compare the 2 experimental groups. all protocols and experiments were approved by the washington university animals studies committee (protocol 20150285) and followed national institutes of health animal care guidelines. male c57bl/6 mice, tsc1 and raptor mice, were purchased from the jackson laboratory (bar harbor, me). villin cre mice were obtained via a generous donation from sylvie robine (curie institute, paris, france). intestinal epithelial - specific tsc1 and raptor knockout mice were generated by crossing villin cre mice with tsc1 or raptor, respectively. wild - type littermates villin cre () ; tsc1 or villin cre(-) ; raptor were used as control mice. louis, mo) was dissolved in sunflower oil at 10 mg / ml and injected intraperitoneally at 50 g per gram of body weight for 3 consecutive days to induce deletion of gene expression. mice were kept in the animal holding area with a 12-hour light - dark cycle and given rodent chow ad libitum after weaning. the intestinal resections were performed by transecting the bowel 1- to 2-cm distal from the ligament of treitz and at 12-cm proximal to the ileocecal junction, followed by removal of the intervening segment. intestinal continuity was re - established by an end - to - end primary anastomosis using interrupted 9 - 0 monofilament sutures. mice then were fed with a standard liquid diet (pmi micro - stabilized rodent liquid diet ld 101 ; testdiet, richmond, in) until death. at the time of death, a midline laparotomy was performed and the entire small intestine was flushed with ice - cold phosphate - buffered saline containing protease inhibitors (0.2 nmol / l phenylmethylsulfonyl fluoride, 5 g / ml aprotinin, 1 mol / l benzamidine, 1 mmol / l sodium orthovanadate, and 2 mol / l cantharidin). a 2-cm segment of bowel distal to the anastomosis protein extracted from isolated crypt or villus was used for western blot assay, and rna was used for real - time polymerase chain reaction (pcr) assays. intestinal tissue was paraffin - embedded and cut into 5-m thick longitudinal sections followed by h&e staining. villus height and crypt depth were measured with a video - assisted computer program (nis elements ar 4 ; nikon, melville, ny). crypt depth was measured as the length between the bottom of the crypts and the crypt - villus junction, and villus height was determined by the length between the crypt villi junction and the top of the villus. at least 20 well - oriented crypts and villi were counted per slide. crypts were counted only if the crypt villus junctions on both sides of the crypt were intact and if paneth cells were present at the base of the crypt. villi were counted only if the central lymphatic channel extended from the villus base to the tip and if the mucosal surface was in continuity with an intact crypt. alkaline phosphatase activity was detected via immunofluorescence using a vector red alkaline phosphatase substrate kit (vector laboratories, burlingame, ca). antigen retrieval was performed using diva decloaking solution (biocare medical, concord, ca) (120c for 2 minutes using a high - pressure cooker). slides were blocked with avidin - pink and biotin - blue (biocare medical), treated with a specific antibody in davinci green (biocare medical), incubated overnight at 4c, and visualized with biotinylated goat anti - rabbit igg (jackson immunoresearch, inc, west grove, pa), followed by streptavidin horseradish peroxidase (jackson immunoresearch laboratories, inc, west grove, pa), diaminobenzidine (sigma - aldrich, st. p - histone h3 antibody (9701, 1:400 ; cell signaling technology, danvers, ma) for cell proliferation ; mucin-2 (15334, 1:1000 ; santa cruz, dallas, tx) for goblet cell differentiation ; chromogranin a (20085, 1:800 ; immunostar, hudson, wi) for enteroendocrine cell differentiation ; matrix metalloproteinase (mmp)-7 (3801, 1:100 ; cell signaling technology, danvers, ma) ; and lysozyme (rp 028 - 05, 1:100 ; diagnostic biosystems, pleasanton, ca) for paneth cell differentiation. isolated crypt and villus samples were lysed with sodium dodecyl sulfate sample buffer (50 mmol / l tris - hcl, ph 6.8, 2% sodium dodecyl sulfate, 10% glycerol, and 5% mercaptoethanol). the lysate then was heated for 5 minutes at 100c, and the protein concentration was determined using the rc - dc kit (bio - rad, hercules, ca). antibodies used in this study were as follows : tsc1 (# 6935), tsc2 (# 4308), raptor (# 2280), ps6k (# 9234), s6k (# 2708), ps6 (s235/236 ; # 4858), ps6 (s240/244 ; # 5364), s6 (# 2217), glyceraldehyde-3-phosphate dehydrogenase (# 5174), and mmp-7 (# 3801) (all from cell signaling technology). the proteins were detected using the bio - rad chemidoc xrs+ system with image lab software (bio - rad). isolated crypts and villi were homogenized in lysis buffer and rna was extracted according to the manufacturer s protocol (rnaqueous kit ; ambion, austin tx). the total rna concentration was determined using a nanodrop spectrophotometer (nd-1000 ; nanodrop technologies, wilmington, de). tsc1, tsc2, mmp-7, and lysozyme primers were obtained from life technologies (carlsbad, ca). -actin was used as the endogenous control (applied biosystems, foster city, ca). the applied biosystems 7500 fast real - time pcr system was used to obtain relative rna expression. statistical analysis was performed using the student t test to compare the 2 experimental groups. to determine whether mtorc1 is involved in intestinal adaptation after resection, we first performed 50% proximal sbr on male c57bl/6 mice followed by systemic inhibition of mtorc1 via rapamycin. small bowel resection is a major abdominal surgery with a significant physiological impact on the mice in the first 48 hours after surgery. in addition, we see a significant decrease in oral intake during this period despite the rapid regeneration process occurring at the molecular level. rapamycin injections have a much smaller, but similar, effect on oral intake and frailty in the mice. when these 2 procedures are compounded, the postsurgery survival rate decreases sharply. to accommodate, we allowed the resected mice 48 hours to recover from surgery before randomization. mice received a daily 200-l intraperitoneal injection of either vehicle (5% tween-80, 5% polyethylene glycol 400 (peg-400) in phosphate - buffered saline) or rapamycin (dissolved in vehicle) for 1 week at a dose of 4 mg / kg., crypts, villi, and the adjacent mesenchyme were separated for detecting mtorc1 activity in response to rapamycin inhibition. one week of rapamycin treatment resulted in a diminished adaptive response as shown by significantly decreased villus height (figure 1a and d). crypt cell proliferation, as measured by phosphorylated histone h3 (p - hh3, mitosis marker) ihc staining, also was decreased significantly in rapamycin - treated sbr mice (figure 1c and e). the successful inhibition of mtorc1 activity across all layers of small intestine was confirmed by measuring phosphorylation of ribosomal protein s6, which is a common surrogate of mtorc1 activity.15, 21 in crypts, western blot assay showed a dramatic decrease in ribosomal protein s6 phosphorylation at both ser235/236 and ser240/244, indicating decreased mtorc1 signaling (figure 1f). because s6 phosphorylation is similar at ser235/236 and ser240/244, only ser235/236 phosphorylation was recorded for subsequent experiments. ihc staining of small intestine with ps6 antibody confirmed a significant reduction of ps6 signal in rapamycin - treated mice (figure 1b). when body weight was measured, rapamycin - treated mice weighed significantly less when compared with vehicle - treated mice (figure 1 g). these data indicate that systemic mtorc1 signaling is important for crypt cell proliferation and adaptation after sbr. to determine whether the effects of rapamycin inhibition were specific for the adapting bowel, we also treated unoperated c57bl/6 mice with the same dose of rapamycin for the same time period. rapamycin treatment of these mice did not affect intestinal structure, crypt cell proliferation, or weight gain (figure 2). these findings verify that the mtorc1 signaling pathway is involved specifically in the resection - induced adaptation process. although treatment of mice with rapamycin showed that systemic mtorc1 signaling is critical for intestinal adaptation after massive sbr, our ultimate goal was to enhance adaptation responses after sbr. because of the ubiquitous nature of mtorc1 signaling throughout the body, tissue - specific contributions to adaptation may require targeted mtorc1 activation. because adaptation is believed to be an event involving stimulated rates of enterocyte proliferation, we focused on genetic manipulation of intestinal epithelial cells. when bred with rosa26 reporter mouse line, the villin cre line has been shown to target intestinal stem cells after tam injection. we therefore crossed the villin cre transgenic mouse with the tsc1 mouse line to generate inducible intestinal epithelial cell specific tsc1 null mice (i - tsc1-/-). when mice reached 68 weeks of age, tam was injected intraperitoneally for 3 consecutive days. after 2 weeks, the distal ileum was excised and the deletion of tsc1 in i - tsc1-/- mice was confirmed by real - time pcr using isolated epithelial cells (data not shown). western blot then was used to verify the efficient deletion of tsc1 protein (figure 3a). as expected, in tsc1-deficient epithelial cells, the well - established mtorc1 kinase target s6k and s6 were highly phosphorylated. in addition, protein expression of tsc2, the binding partner of tsc1, was degraded (figure 3a). in contrast, tsc1 protein expression in smooth muscle was not changed in i - tsc1-/- mice (data not shown). when crypt depth and villus height were measured, a small, yet significant, increase (17.6%) in crypt depth was seen in unoperated i - tsc1 null mice (figure 3b and d). the villus height, however, was not changed (figure 3b and d). when the paraffin - embedded slides were stained with p - hh3specific antibody to measure crypt cell proliferation, we found 34% more mitotically active crypt cells in i - tsc1 null mice (figure 3c). the literature shows several differing approaches to determine the role of mtorc1 in intestinal epithelial cell differentiation. however, these studies have yielded many different results based on the approach used.16, 21 systemic inhibition of mtor or raptor has been shown to diminish the activity of alkaline phosphatase. in this study, we found no change in alkaline phosphatase activity within villi between wild - type (wt) and i - tsc1-/- small intestine (figure 4a), which indicates normal absorptive cell lineage differentiation in the absence of tsc1. secretory cell differentiation was investigated (paneth, goblet, and enteroendocrine cells) with ihc staining using lysozyme, mucin-2, and chromogranin a, respectively. we found that mtorc1 activation through tsc1 ablation in epithelial cells had no effect on differentiation of goblet and enteroendocrine cells (figure 4b e). because paneth cell turnover time is much longer (3 to 8 weeks) than other cell lineages,24, 25, 26 we investigated the long - term (4 weeks) effects of tsc1 deficiency on paneth cells. lysozyme - positive paneth cells in wt mice showed a typical clustered pattern on the bottom of the crypt base. however, lysozyme - positive cells in i - tsc1-/- crypts were less uniform, yet remained confined to the crypt compartment (figure 5a). despite the aberrant location of lysozyme - positive cells, lysozyme is one of many antimicrobial peptides within the granules of paneth cells. to see whether tsc1 affects the overall paneth cells, indeed, the granule - containing paneth cells often were not clustered on the bottom of i - tsc1-/- crypts (figure 5b). to further delineate the effects of tsc1 deficiency on paneth cell function, a metalloproteinase (mmp-7) that regulates intestinal -defensin activation was measured.27, 28, 29 similar to lysozyme staining, mmp-7positive paneth cells also clustered on the bottom of wt crypts, but were disorganized in tsc1-deficient crypts (figure 5c). the expression level of mmp-7 protein as shown via western blot assay was not affected in tsc1-deficient crypts (figure 5e). these data indicate that acute activation of mtorc1 in adult mice affects crypt cell proliferation and paneth cell organization, whereas goblet, enteroendocrine, and absorptive cell lineage differentiation remain undisturbed. next, we sought to investigate whether the increased proliferation seen with increased mtorc1 activation would promote structural adaptation after sbr. this study was designed to test whether acute enhancement of mtorc1 activity may have therapeutic benefit in the postoperative phase after massive sbr. therefore, we performed sbr on villin - cre(-) ; tsc1 or villin - cre(+) ; tsc1 mice first. after a 2-day recovery period, we followed up with tam injection for 3 consecutive days to activate mtorc1 as a means of intervention during the adaptation process. wt mice showed a typical adaptation response although the response of the i - tsc1-/- mice was much stronger (20% greater villus growth) (figure 6a and b). crypt proliferation in i - tsc1-/- mice, as shown by p - hh3 ihc staining, was 44% more than in the wt mice (figure 6c). the activation of mtorc1 signaling in resected mice was confirmed by decreased tsc2 expression and increased phosphorylation of ps6 and s6k in epithelial cells (figure 6d). despite the increased structural intestinal adaptation, the i - tsc1-/- mice did not gain more weight than wt mice at 2 weeks after resection (figure 6e). we wanted to confirm that the proliferative and adaptive responses seen after sbr were owing to mtorc1 activation secondary to tsc1 inhibition rather than an alternate function of tsc1 protein. to test this, we injected mice with 3 doses of tam to delete tsc1 first, waited for a week, and then performed sbr procedures on i - tsc1-/- mice. the modified research design was to focus on the role of tsc1 and simultaneously avoid the stress of injecting both tam and rapamycin in postsurgical mice. after a 2-day recovery, the resected mice were randomized and treated with either vehicle or rapamycin (to inhibit mtorc1) for 2 weeks. we found that adaptation as well as resection - induced crypt cell proliferation was diminished by rapamycin treatment in i - tsc1-/- mice (figure 7a c). the inhibition of mtorc1 in the rapamycin - treated mice was confirmed by western blot (figure 7d). these data clearly verify that the enhanced proliferation and adaptation seen in tsc1-null mice after sbr is owing to the activated mtorc1 signaling pathway within intestinal epithelial cells. it also suggests that resection - induced crypt cell proliferation could be modulated by enhancing intestinal epithelial cell mtorc1 activity. we have established that intestinal epithelial - specific activation of mtorc1 is capable of enhancing adaptation after sbr. however, it was not clear after the systemic rapamycin inhibition study whether mtorc1 signaling in intestinal epithelium is necessary for normal adaptation to occur. to investigate this, we bred villin cre mice with raptor mice to delete raptor protein as a means of inactivating mtorc1 specifically in epithelial cells. the same experimental design in tsc1 null mice was adopted for this study. we first confirmed the deletion of raptor protein in epithelial cells (figure 8a). the downstream protein kinase s6k was phosphorylated at baseline but was undetectable when raptor was deleted. in addition, ps6 phosphorylation was greatly reduced in the absence of raptor. despite the lack of mtorc1 signaling in the i - raptor-/- mice, the structure of the small intestine did not change (figure 8b and d). rates of crypt cell proliferation were the same as in wt mice (figure 8c), which is consistent with previously published data. in addition, alkaline phosphatase activity was not changed, verifying that enterocyte maturation was not altered (figure 9a). when secretory cell lineage differentiation was analyzed via ihc staining using cell differentiation specific markers, we found that goblet cells were decreased, whereas enteroendocrine cells were increased in the absence of intestinal epithelial - specific raptor (figure 9b e). lysozyme - positive paneth cells were greatly reduced after 4 weeks (figure 10a). the granule - containing paneth cells also were diminished in raptor - deficient crypts in h&e - stained tissue (figure 10b). moreover, the expression of mmp-7 also was reduced dramatically in raptor - deficient crypts (figure 10c and f). surprisingly, neither lysozyme nor mmp-7 mrna expression levels were affected (figure 10d and e), suggesting that raptor protein may have a role in the translational regulation of lysozyme and mmp-7 expression during paneth cell maturation. sampson previously showed that mtorc1 activity is required for crypt regeneration after irradiation - induced intestinal injury. we therefore sought to determine whether mtorc1 activity is necessary for resection - stimulated crypt cell proliferation. a similar strategy was used in which sbr was performed on villin cre(-) ; raptor mice and villin cre(+) ; raptor mice. two days after surgery tam was given via intraperitoneal injection for 3 consecutive days to inactivate the mtorc1 pathway in the intestinal epithelium. remarkably, crypt depth and villus height in i - raptor-/- mice was the same as in wt mice (figure 11a and b). crypt cell proliferation, as measured by p - hh3 ihc, also was not changed (figure 11c). blocked mtorc1 signaling in raptor - deficient mice was confirmed (figure 11d). despite the normal structural adaptation, the raptor - deficient mice had significantly more weight loss after surgery than the wt mice (figure 11e). in summary, our results show that mtorc1 activity in intestinal epithelial cells is not required for crypt proliferation and has different effects on enterocyte differentiation. furthermore, resection - induced crypt proliferation and intestinal adaptation requires systemic, but not intestinal epithelial - specific, mtorc1 activity. however, stimulation of mtorc1 in intestinal epithelium increases crypt cell proliferation, which further enhances adaptation after sbr (figure 12). the long - term functional significance of manipulating mtorc1 signaling in intestinal epithelial cells after small bowel resection remains unclear and will require further studies. to determine whether mtorc1 is involved in intestinal adaptation after resection, we first performed 50% proximal sbr on male c57bl/6 mice followed by systemic inhibition of mtorc1 via rapamycin. small bowel resection is a major abdominal surgery with a significant physiological impact on the mice in the first 48 hours after surgery. in addition, we see a significant decrease in oral intake during this period despite the rapid regeneration process occurring at the molecular level. rapamycin injections have a much smaller, but similar, effect on oral intake and frailty in the mice. when these 2 procedures are compounded, the postsurgery survival rate decreases sharply. to accommodate, we allowed the resected mice 48 hours to recover from surgery before randomization. mice received a daily 200-l intraperitoneal injection of either vehicle (5% tween-80, 5% polyethylene glycol 400 (peg-400) in phosphate - buffered saline) or rapamycin (dissolved in vehicle) for 1 week at a dose of 4 mg / kg., crypts, villi, and the adjacent mesenchyme were separated for detecting mtorc1 activity in response to rapamycin inhibition. one week of rapamycin treatment resulted in a diminished adaptive response as shown by significantly decreased villus height (figure 1a and d). crypt cell proliferation, as measured by phosphorylated histone h3 (p - hh3, mitosis marker) ihc staining, also was decreased significantly in rapamycin - treated sbr mice (figure 1c and e). the successful inhibition of mtorc1 activity across all layers of small intestine was confirmed by measuring phosphorylation of ribosomal protein s6, which is a common surrogate of mtorc1 activity.15, 21 in crypts, western blot assay showed a dramatic decrease in ribosomal protein s6 phosphorylation at both ser235/236 and ser240/244, indicating decreased mtorc1 signaling (figure 1f). because s6 phosphorylation is similar at ser235/236 and ser240/244, only ser235/236 phosphorylation was recorded for subsequent experiments. ihc staining of small intestine with ps6 antibody confirmed a significant reduction of ps6 signal in rapamycin - treated mice (figure 1b). when body weight was measured, rapamycin - treated mice weighed significantly less when compared with vehicle - treated mice (figure 1 g). these data indicate that systemic mtorc1 signaling is important for crypt cell proliferation and adaptation after sbr. to determine whether the effects of rapamycin inhibition were specific for the adapting bowel, we also treated unoperated c57bl/6 mice with the same dose of rapamycin for the same time period. rapamycin treatment of these mice did not affect intestinal structure, crypt cell proliferation, or weight gain (figure 2). these findings verify that the mtorc1 signaling pathway is involved specifically in the resection - induced adaptation process. although treatment of mice with rapamycin showed that systemic mtorc1 signaling is critical for intestinal adaptation after massive sbr, our ultimate goal was to enhance adaptation responses after sbr. because of the ubiquitous nature of mtorc1 signaling throughout the body, tissue - specific contributions to adaptation may require targeted mtorc1 activation. because adaptation is believed to be an event involving stimulated rates of enterocyte proliferation, we focused on genetic manipulation of intestinal epithelial cells. when bred with rosa26 reporter mouse line, the villin cre line has been shown to target intestinal stem cells after tam injection. we therefore crossed the villin cre transgenic mouse with the tsc1 mouse line to generate inducible intestinal epithelial cell specific tsc1 null mice (i - tsc1-/-). when mice reached 68 weeks of age, tam was injected intraperitoneally for 3 consecutive days. after 2 weeks, the distal ileum was excised and the deletion of tsc1 in i - tsc1-/- mice was confirmed by real - time pcr using isolated epithelial cells (data not shown). western blot then was used to verify the efficient deletion of tsc1 protein (figure 3a). as expected, in tsc1-deficient epithelial cells, the well - established mtorc1 kinase target s6k and s6 were highly phosphorylated. in addition, protein expression of tsc2, the binding partner of tsc1, was degraded (figure 3a). in contrast, tsc1 protein expression in smooth muscle was not changed in i - tsc1-/- mice (data not shown). these results confirm that we successfully established an inducible intestinal epithelial cell specific mtorc1 activation system for further characterization of mtorc1 signaling in the gut. when crypt depth and villus height were measured, a small, yet significant, increase (17.6%) in crypt depth was seen in unoperated i - tsc1 null mice (figure 3b and d). the villus height, however, was not changed (figure 3b and d). when the paraffin - embedded slides were stained with p - hh3specific antibody to measure crypt cell proliferation, we found 34% more mitotically active crypt cells in i - tsc1 null mice (figure 3c). the literature shows several differing approaches to determine the role of mtorc1 in intestinal epithelial cell differentiation. however, these studies have yielded many different results based on the approach used.16, 21 systemic inhibition of mtor or raptor has been shown to diminish the activity of alkaline phosphatase. in this study, we found no change in alkaline phosphatase activity within villi between wild - type (wt) and i - tsc1-/- small intestine (figure 4a), which indicates normal absorptive cell lineage differentiation in the absence of tsc1. secretory cell differentiation was investigated (paneth, goblet, and enteroendocrine cells) with ihc staining using lysozyme, mucin-2, and chromogranin a, respectively. we found that mtorc1 activation through tsc1 ablation in epithelial cells had no effect on differentiation of goblet and enteroendocrine cells (figure 4b e). because paneth cell turnover time is much longer (3 to 8 weeks) than other cell lineages,24, 25, 26 we investigated the long - term (4 weeks) effects of tsc1 deficiency on paneth cells. lysozyme - positive paneth cells in wt mice showed a typical clustered pattern on the bottom of the crypt base. however, lysozyme - positive cells in i - tsc1-/- crypts were less uniform, yet remained confined to the crypt compartment (figure 5a). despite the aberrant location of lysozyme - positive cells, lysozyme is one of many antimicrobial peptides within the granules of paneth cells. to see whether tsc1 affects the overall paneth cells, indeed, the granule - containing paneth cells often were not clustered on the bottom of i - tsc1-/- crypts (figure 5b). to further delineate the effects of tsc1 deficiency on paneth cell function, a metalloproteinase (mmp-7) that regulates intestinal -defensin activation was measured.27, 28, 29 similar to lysozyme staining, mmp-7positive paneth cells also clustered on the bottom of wt crypts, but were disorganized in tsc1-deficient crypts (figure 5c). the expression level of mmp-7 protein as shown via western blot assay was not affected in tsc1-deficient crypts (figure 5e). these data indicate that acute activation of mtorc1 in adult mice affects crypt cell proliferation and paneth cell organization, whereas goblet, enteroendocrine, and absorptive cell lineage differentiation remain undisturbed. next, we sought to investigate whether the increased proliferation seen with increased mtorc1 activation would promote structural adaptation after sbr. this study was designed to test whether acute enhancement of mtorc1 activity may have therapeutic benefit in the postoperative phase after massive sbr. therefore, we performed sbr on villin - cre(-) ; tsc1 or villin - cre(+) ; tsc1 mice first. after a 2-day recovery period, we followed up with tam injection for 3 consecutive days to activate mtorc1 as a means of intervention during the adaptation process. wt mice showed a typical adaptation response although the response of the i - tsc1-/- mice was much stronger (20% greater villus growth) (figure 6a and b). crypt proliferation in i - tsc1-/- mice, as shown by p - hh3 ihc staining, was 44% more than in the wt mice (figure 6c). the activation of mtorc1 signaling in resected mice was confirmed by decreased tsc2 expression and increased phosphorylation of ps6 and s6k in epithelial cells (figure 6d). despite the increased structural intestinal adaptation, the i - tsc1-/- mice did not gain more weight than wt mice at 2 weeks after resection (figure 6e). we wanted to confirm that the proliferative and adaptive responses seen after sbr were owing to mtorc1 activation secondary to tsc1 inhibition rather than an alternate function of tsc1 protein. to test this, we injected mice with 3 doses of tam to delete tsc1 first, waited for a week, and then performed sbr procedures on i - tsc1-/- mice. the modified research design was to focus on the role of tsc1 and simultaneously avoid the stress of injecting both tam and rapamycin in postsurgical mice. after a 2-day recovery, the resected mice were randomized and treated with either vehicle or rapamycin (to inhibit mtorc1) for 2 weeks. we found that adaptation as well as resection - induced crypt cell proliferation was diminished by rapamycin treatment in i - tsc1-/- mice (figure 7a c). the inhibition of mtorc1 in the rapamycin - treated mice was confirmed by western blot (figure 7d). these data clearly verify that the enhanced proliferation and adaptation seen in tsc1-null mice after sbr is owing to the activated mtorc1 signaling pathway within intestinal epithelial cells. it also suggests that resection - induced crypt cell proliferation could be modulated by enhancing intestinal epithelial cell mtorc1 activity. we have established that intestinal epithelial - specific activation of mtorc1 is capable of enhancing adaptation after sbr. however, it was not clear after the systemic rapamycin inhibition study whether mtorc1 signaling in intestinal epithelium is necessary for normal adaptation to occur. to investigate this, we bred villin cre mice with raptor mice to delete raptor protein as a means of inactivating mtorc1 specifically in epithelial cells. we first confirmed the deletion of raptor protein in epithelial cells (figure 8a). the downstream protein kinase s6k was phosphorylated at baseline but was undetectable when raptor was deleted. in addition, ps6 phosphorylation was greatly reduced in the absence of raptor. despite the lack of mtorc1 signaling in the i - raptor-/- mice, the structure of the small intestine did not change (figure 8b and d). rates of crypt cell proliferation were the same as in wt mice (figure 8c), which is consistent with previously published data. in addition, alkaline phosphatase activity was not changed, verifying that enterocyte maturation was not altered (figure 9a). when secretory cell lineage differentiation was analyzed via ihc staining using cell differentiation specific markers, we found that goblet cells were decreased, whereas enteroendocrine cells were increased in the absence of intestinal epithelial - specific raptor (figure 9b e). lysozyme - positive paneth cells were greatly reduced after 4 weeks (figure 10a). the granule - containing paneth cells also were diminished in raptor - deficient crypts in h&e - stained tissue (figure 10b). moreover, the expression of mmp-7 also was reduced dramatically in raptor - deficient crypts (figure 10c and f). surprisingly, neither lysozyme nor mmp-7 mrna expression levels were affected (figure 10d and e), suggesting that raptor protein may have a role in the translational regulation of lysozyme and mmp-7 expression during paneth cell maturation. sampson previously showed that mtorc1 activity is required for crypt regeneration after irradiation - induced intestinal injury. we therefore sought to determine whether mtorc1 activity is necessary for resection - stimulated crypt cell proliferation. a similar strategy was used in which sbr was performed on villin cre(-) ; raptor mice and villin cre(+) ; raptor mice. two days after surgery tam was given via intraperitoneal injection for 3 consecutive days to inactivate the mtorc1 pathway in the intestinal epithelium. remarkably, crypt depth and villus height in i - raptor-/- mice was the same as in wt mice (figure 11a and b). crypt cell proliferation, as measured by p - hh3 ihc, also was not changed (figure 11c). blocked mtorc1 signaling in raptor - deficient mice was confirmed (figure 11d). despite the normal structural adaptation, the raptor - deficient mice had significantly more weight loss after surgery than the wt mice (figure 11e). in summary, our results show that mtorc1 activity in intestinal epithelial cells is not required for crypt proliferation and has different effects on enterocyte differentiation. furthermore, resection - induced crypt proliferation and intestinal adaptation requires systemic, but not intestinal epithelial - specific, mtorc1 activity. however, stimulation of mtorc1 in intestinal epithelium increases crypt cell proliferation, which further enhances adaptation after sbr (figure 12). the long - term functional significance of manipulating mtorc1 signaling in intestinal epithelial cells after small bowel resection remains unclear and will require further studies. the mtor signaling pathway has been studied extensively because it is a master regulator of cell proliferation, growth, and metabolism.3, 4, 6, 30 historically, the majority of these studies were based in cell culture. however, more recently, studies have emerged with tissue / organ - specific research that has shown varied physiological functions of mtor in adult tissues and during development.12, 13, 15, 16, 31 in intestinal tissue, several groups have used various strategies to manipulate mtor signaling and have yielded dissimilar results. for example, using a similar strategy to constitutively delete mtor protein specifically in intestinal epithelial cells,11, 16 one group clearly showed a dilated small bowel with a reduced body weight. on the other hand, another group found that the mtor - deficient mice have a shorter small bowel but a similar body weight. there is also some controversy regarding the role of mtor signaling in intestinal cell differentiation. one report found that intestinal epithelial - specific mtor signaling is required for proper lysozyme transcription in paneth cells. however, other studies found that mtor activation via a constitutive systemic tsc2 mutation also impaired lysozyme expression in paneth cells. by using an inducible cre system to manipulate mtor signaling in adult intestinal epithelial cells, we found that paneth cell differentiation was indeed regulated by mtorc1 signaling in intestinal epithelial cells, but via a different mechanism. mtorc1 inactivation does not inhibit lysozyme or mmp-7 transcription, rather, it appears to regulate lysozyme or mmp-7 translation. activating mtorc1 in intestinal epithelium, on the other hand, appears to affect paneth cell clustering on the base of crypts. maturation of enterocytes also has been found to be disrupted in mtor or raptor - deficient cells based on alkaline phosphatase activity. in our acute ablation model, we did not see any alteration in the expression of alkaline phosphatase in raptor- or tsc - deficient mice. these seemingly conflicting studies may be explained by the different methods used in each study to manipulate mtor signaling and may represent different aspects of regulation during enterocyte differentiation. in the tsc2 mutant model, mtorc1 activation caused by loss of the functional tsc2 was not confined to the intestine. the mesenchyme, as well as other tissues, also would show mtorc1 activity, confounding the autonomous role of mtor in intestinal epithelial cells. in the enterocyte mtor - deficient model, villin cre was activated from embryonic day 12.5, which suggests that mtorc1 activity may be required during the development of paneth cells as well as absorptive enterocyte differentiation. the multitude of differing results illustrates the complexity of the mtorc1 signaling pathway in regulating development and maintenance of the small intestine. in this study, we investigated the role of mtorc1 during normal intestinal homeostasis as well as during the adaptive response after massive sbr. although inactivating mtorc1 signaling in intestinal epithelium has no effect on intestinal structure or the adaptive response after resection, we found that stimulating mtorc1 resulted in enhanced crypt proliferation in adult mice. in addition, we showed that after massive sbr, adaptation and crypt proliferation were enhanced further when mtorc1 was activated in remnant small bowel. the notion that the function of mtorc1 differs during homeostasis and regeneration after injury has been established.15, 16, 32 constitutively ablating mtor or raptor in intestinal epithelial cells has little effect on crypt cell proliferation and wnt activity in the normal intestine. however, when mtorc1 signaling was absent, crypt regeneration after irradiation injury was compromised. in apc mice, mtorc1 activity is required for wnt - mediated intestinal polyp formation, likely via regulating the translational elongation rate.15, 32 our results support the notion that mtorc1 regulates intestinal homeostasis and recovery after injury by different mechanisms. however, they also provide a clear distinction between the mechanism behind adaptation and that of wnt - mediated crypt growth. raptor deficiency alone is not sufficient to alter small intestine proliferation or adaptation after massive sbr, which indicates pathways other than the wnt pathway may be crucial for regulating adaptation. inhibiting mtorc1 via rapamycin systemically, but not by raptor deficiency in intestinal epithelial cells, it is possible that rapamycin may have other unknown targets aside from mtorc1 that regulate crypt cell proliferation. alternatively, it must be considered that intestinal epithelial cells possess a redundant system to compensate for the loss of mtorc1 signaling to maintain proliferation and growth. however, this theory contradicts the findings that raptor - deficient crypts do not grow into organoid outside of the intestine niche in vitro. the more plausible mechanism to consider is that mtor signals originating from the mesenchyme or the surrounding tissues play a critical role in this process, given that mtor functions in a non cell - autonomous manner. the critical role of mesenchyme subepithelial fibroblasts in maintaining intestinal niche function was established clearly in a recent report. it appears that non cell - autonomous mtorc1 signaling is crucial for the small bowel adaptive response after resection. it is well known that nutrients and growth factors can enhance adaptation after resection.18, 22, 34 we previously showed that a high - protein diet improves postoperative weight gain in resected mice, an effect possibly owing to the higher glutamine levels in the high - protein diet. our laboratory previously has shown that epidermal growth factor (egf) treatment will increase the adaptive response after resection. because egf stimulation activates phosphatidylinositol 3 kinase, it may destabilize the tsc1/tsc2 complex, causing increased mtorc1 activation and enhanced adaptation. interestingly, we recently discovered that the intestinal epithelium - specific egf receptor is not necessary for adaptation. these egf and mtorc1 studies provide a similar pattern for how adaptation might be regulated. the crypt niche is crucial to provide cues for adaptation to occur ; when the cues are present, adaptation can be manipulated in an enterocyte - dependent manner. | background & aimsintestinal adaptation is a compensatory response to the massive loss of small intestine after surgical resection. we investigated the role of intestinal epithelial cell specific mammalian target of rapamycin complex 1 (i - mtorc1) in intestinal adaptation after massive small bowel resection (sbr).methodswe performed 50% proximal sbr on mice to study adaptation. to manipulate i - mtorc1 activity, villin - creer transgenic mice were crossed with tuberous sclerosis complex (tsc)1flox / flox or raptorflox / flox mice to inducibly activate or inactivate i - mtorc1 activity with tamoxifen. western blot was used to confirm the activity of mtorc1. crypt depth and villus height were measured to score adaptation. immunohistochemistry was used to investigate differentiation and rates of crypt proliferation.resultsafter sbr, mice treated with systemic rapamycin showed diminished structural adaptation, blunted crypt cell proliferation, and significant body weight loss. activating i - mtorc1 via tsc1 deletion induced larger hyperproliferative crypts and disorganized paneth cells without a significant change in villus height. after sbr, ablating tsc1 in intestinal epithelium induced a robust villus growth with much stronger crypt cell proliferation, but similar body weight recovery. acute inactivation of i - mtorc1 through deletion of raptor did not change crypt cell proliferation or mucosa structure, but significantly reduced lysozyme / matrix metalloproteinase-7positive paneth cell and goblet cell numbers, with increased enteroendocrine cells. surprisingly, ablation of intestinal epithelial cell specific raptor after sbr did not affect adaptation or crypt proliferation, but dramatically reduced body weight recovery after surgery.conclusionssystemic, but not intestinal - specific, mtorc1 is important for normal adaptation responses to sbr. although not required, forced enterocyte mtorc1 signaling after resection causes an enhanced adaptive response. |
it is estimated that half a million cases occur worldwide annually, making primary liver cancer the fifth most common malignancy in men and the ninth in women [16 ]. hepatocellular carcinoma (hcc) accounts for 85% to 90% of primary liver cancers and the age - adjusted hcc mortality rate has increased in recent decades in japan. similarly, a rising hcc trend has been reported in several developed countries in north america, europe, and asia. hcc often develops in patients with liver cirrhosis caused by hepatitis b virus (hbv), hepatitis c virus (hcv), excessive alcohol consumption, or nonalcoholic fatty liver disease. of the hepatitis viruses that cause hcc, however, it has been reported that the absolute numbers and proportion of hbsag and hcvab negative hcc (hcc - nonbc) have both been steadily increasing in japan. recently, radio - frequency ablation (rfa) and percutaneous ethanol injection (pei) have also been recognized as effective methods of achieving complete tumor necrosis for small hccs. however, the chance of curative treatment is often limited by several features of hcc itself. the incidence of associated cirrhosis is also high, exceeding 80% in most series [1820 ]. transcatheter intra - arterial chemoembolization (tace), with which complete necrosis of hccs is thought to be difficult to achieve, is also impacted by the above factors. to increase opportunities for meaningful intervention and to improve survival, early detection of hcc by measuring alpha - fetoprotein (afp) and/or imaging screening however, the poorer prognosis of patients with hcc - nonbc is reportedly attributable to its late detection in an advanced stage, owing to the lack of a surveillance system for early detection of hcc. in this retrospective cohort study, our aim was to characterize consecutive patients who had been diagnosed with hcc - nonbc during an 11-year period (19992010) at the centers comprising the nagasaki association study of liver disease (nasld) group. we evaluated the clinical characteristics of patients with hcc - nonbc, their tumor stages, treatment, afp and dpc as potential biomarkers, and survival. in total, 2638 patients with hcc diagnosed between 1999 and 2010 in the nasld were recruited for this study. the diagnosis of hcc was based on afp and/or dcp levels, as well as the results of imaging techniques such as ultrasonography (usg), computerized tomography (ct), magnetic resonance imaging (mri), and hepatic angiography (hag), and/or liver biopsy. the diagnostic criteria included characteristic liver biopsy findings, elevated afp (20 ng / ml) and/or dcp (40 ng / ml), and neovascularization on hag, ct, and/or mri. the diagnosis of chronic hcv infection was positive for both anti - hcv, by a third - generation enzyme - linked immunosorbent assay (elisa), and for hcv rna by polymerase chain reaction (pcr). the diagnosis of chronic hbv infection was based on the presence of hbsag (enzyme - linked immunosorbent assay ; abbott laboratories) ; serum afp was measured by radioimmunoassay (abbott laboratories). the history of alcohol intake was obtained from medical records ; habitual drinking was defined as an average daily consumption of an amount equivalent to 80 g of pure ethanol for a period of more than 10 years. hcc etiologies were categorized into 4 groups : (1) hcc - b, hbsag positive, and hcvab negative ; (2) hcc - c, hcvab positive, and hbsag negative ; (3) hcc - bc, both hbsag and hcvab positive ; and (4) hcc - nonbc, both hbsag, and hcvab negative. the significance of age, sex, body mass index (bmi), alcohol intake, diabetes mellitus, underlying liver disease child - pugh score, platelet count, prothrombin time (pt), albumin (alb), total bilirubin (bil), aspartate aminotransferase (ast), alanine aminotransferase (alt), afp, dcp, and tumor - node - metastasis (tnm) stage were examined to identify possible relationships with hcc - nonbc using logistic regression analysis. patients diagnosed with hcc were assessed for surgery based on the extent of lobar involvement and liver function status. the extent of lobar involvement was evaluated based on a combination of usg, ct, mri, and hag findings. patients were considered to be poor candidates for resection if they met any of the following criteria : (1) bilobar involvement, (2) evidence of tumor infiltration into the main portal vein or thrombosis of the vein, (3) evidence of extrahepatic metastases, (4) child s grade c cirrhosis, or (5) poor cardiac and/or respiratory status. if surgery was contraindicated or the patient refused to undergo an operation, rfa or pei therapy was the second treatment choice, offered to those with hccs less than 3 cm in diameter. the remaining patients without main portal vein thrombosis or extrahepatic metastasis were advised to undergo tace, regardless of tumor size or number. after initial treatment, the afp levels and liver functions of the patients were assessed every 1 to 3 months, and usg imaging was performed every 3 to 6 months during the follow - up period. the assessment of treatment for recurrent hcc was based on lobar involvement and liver function status as described for the initial treatment. rfa or liver transplantation to treat hcc was started at our institution in 2002. furthermore, none of the subjects in our study received either of these treatments for recurrent hcc during the follow - up period. the survival duration was the time from the diagnosis of hcc until the time of death or the time of preparation of this manuscript. the survival rate was analyzed using the kaplan - meier method, and differences between the survival probability curves were tested using the log - rank test. descriptive summaries of study groups are reported as the median value (sd : standard deviation) and number (%). data were analyzed using the mann - whitney u test for continuous ordinal data, and the chi - square test with yates correction and fisher s exact test were used for intergroup comparisons to determine the association between 2 qualitative variables. variables achieving statistical significance according to univariate analysis were subsequently included in the multivariate analysis using a logistic regression model and were described as hazard ratios (hr) with 95% confidence intervals (ci). in total, 2638 patients with hcc diagnosed between 1999 and 2010 in the nasld were recruited for this study. the diagnosis of hcc was based on afp and/or dcp levels, as well as the results of imaging techniques such as ultrasonography (usg), computerized tomography (ct), magnetic resonance imaging (mri), and hepatic angiography (hag), and/or liver biopsy. the diagnostic criteria included characteristic liver biopsy findings, elevated afp (20 ng / ml) and/or dcp (40 ng / ml), and neovascularization on hag, ct, and/or mri. the diagnosis of chronic hcv infection was positive for both anti - hcv, by a third - generation enzyme - linked immunosorbent assay (elisa), and for hcv rna by polymerase chain reaction (pcr). the diagnosis of chronic hbv infection was based on the presence of hbsag (enzyme - linked immunosorbent assay ; abbott laboratories) ; serum afp was measured by radioimmunoassay (abbott laboratories). the history of alcohol intake was obtained from medical records ; habitual drinking was defined as an average daily consumption of an amount equivalent to 80 g of pure ethanol for a period of more than 10 years. hcc etiologies were categorized into 4 groups : (1) hcc - b, hbsag positive, and hcvab negative ; (2) hcc - c, hcvab positive, and hbsag negative ; (3) hcc - bc, both hbsag and hcvab positive ; and (4) hcc - nonbc, both hbsag, and hcvab negative. the significance of age, sex, body mass index (bmi), alcohol intake, diabetes mellitus, underlying liver disease child - pugh score, platelet count, prothrombin time (pt), albumin (alb), total bilirubin (bil), aspartate aminotransferase (ast), alanine aminotransferase (alt), afp, dcp, and tumor - node - metastasis (tnm) stage were examined to identify possible relationships with hcc - nonbc using logistic regression analysis. patients diagnosed with hcc were assessed for surgery based on the extent of lobar involvement and liver function status. the extent of lobar involvement was evaluated based on a combination of usg, ct, mri, and hag findings. patients were considered to be poor candidates for resection if they met any of the following criteria : (1) bilobar involvement, (2) evidence of tumor infiltration into the main portal vein or thrombosis of the vein, (3) evidence of extrahepatic metastases, (4) child s grade c cirrhosis, or (5) poor cardiac and/or respiratory status. if surgery was contraindicated or the patient refused to undergo an operation, rfa or pei therapy was the second treatment choice, offered to those with hccs less than 3 cm in diameter. the remaining patients without main portal vein thrombosis or extrahepatic metastasis were advised to undergo tace, regardless of tumor size or number. after initial treatment, the afp levels and liver functions of the patients were assessed every 1 to 3 months, and usg imaging was performed every 3 to 6 months during the follow - up period. the assessment of treatment for recurrent hcc was based on lobar involvement and liver function status as described for the initial treatment. furthermore, none of the subjects in our study received either of these treatments for recurrent hcc during the follow - up period. the survival duration was the time from the diagnosis of hcc until the time of death or the time of preparation of this manuscript. the survival rate was analyzed using the kaplan - meier method, and differences between the survival probability curves were tested using the log - rank test. descriptive summaries of study groups are reported as the median value (sd : standard deviation) and number (%). data were analyzed using the mann - whitney u test for continuous ordinal data, and the chi - square test with yates correction and fisher s exact test were used for intergroup comparisons to determine the association between 2 qualitative variables. variables achieving statistical significance according to univariate analysis were subsequently included in the multivariate analysis using a logistic regression model and were described as hazard ratios (hr) with 95% confidence intervals (ci). the underlying causes of hcc were as follows : 474 (18%) patients were positive for hbsag, 1533 (58%) were positive for hcvab, 40 (2%) were positive for both hbsag and hcvab, and 591 (22%) were negative for hbsag and anti - hcv. the cumulative 5-year survival rates of the patients with hcc - b, hcc - c, hcc - bc, and hcc - nonbc were 43%, 52%, 49%, and 47%, respectively (figure 1). patients in the hcc - c group had a higher cumulative survival rate than those in the hcc - b and hcc - nonbc groups. univariate and multivariate analyses were performed to identify factors independently related to hcc - nonbc. in the univariate analysis, the following 13 factors significantly influenced hcc - nonbc : age, sex, bmi, alcohol consumption, diabetes mellitus, underlying liver disease, platelet count, bil, ast, alt, afp, dcp, and tnm stage (table 2). multivariate analysis identified age (70 years, hr 1.63), sex (female, hr 1.73), bmi (25, hr 2.12), alcohol consumption (not excessive, hr 3.41 ; excessive, hr 14.73), diabetes mellitus (hr 2.42), underlying liver disease (chronic hepatitis, hr 0.46 ; cirrhosis, hr 0.52), platelet count (3 and <3 cm, respectively. firstly, dcp is a more specific hcc marker than afp because other liver diseases do not cause an increase of dcp serum levels. however, we often encounter patients with liver disease who have slightly elevated dcp levels, but undetectable hcc as assessed by imaging studies. it has been reported that aberrant elevation of dcp is occasionally observed in patients with alcoholic cirrhosis, obstructive jaundice, or vitamin k deficiency. recently, toyoda. measured a novel dcp (nx - dcp) in serum using a newly developed sandwich eclia with new anti - dcp monoclonal antibodies p11 and p16, and reported preliminary data from only 20 hcc patients. they showed that the dcp / nx - dcp ratio may be useful for the diagnosis of hcc among warfarin users. neither dcp alone nor afp alone was optimal for the detection of hcc, but the combination of both markers enhanced sensitivity, indicating that these 2 markers are complementary. several other studies have shown dcp and afp to be complementary, which is consistent with the production of dcp and afp in hcc occurring through different pathways, possibly explaining why sex, race, underlying liver disease, and hepatic disease etiologies had opposite effects on these 2 markers [4648 ]. in conclusion, this retrospective cohort study demonstrated dcp to be more sensitive than afp for the diagnosis of early - stage cryptogenic hcc. we advocate that dcp be used as the main serum test for detecting cryptogenic hcc. | backgroundthe incidence of hepatocellular carcinoma (hcc) continues to increase in japan, but the clinical characteristics of japanese patients with hcc have not been well described. the aim of this study was to determine the frequencies and utilities of elevated -fetoprotein (afp) and des - gamma - carboxy prothrombin (dcp) levels as biomarkers in cryptogenic hcc.material/methodsa total of 2638 patients with hcc diagnosed between 1999 and 2010 in the nagasaki association study of liver (nasld) were recruited for this study. the cause of hcc was categorized into 4 groups ; hcc - b, hcc - c, hcc - bc, and hcc - nonbc. the significance of factors was examined for hcc - nonbc using logistic regression analysis in all patients.resultsmultivariate analysis identified age, sex, bmi, alcohol consumption, platelet count, ast, alt, afp, dcp, and tnm stage as independent and significant risk factors for hcc - nonbc. according to tnm stage, the median afp levels in hcc - nonbc with tnm stages i, ii, and iii were significantly lower than in either hcc - b or hcc - c. in tnm stage iv, the median afp level in hcc - nonbc was significantly lower than in either hcc - b or hcc - bc. the median dcp levels in hcc - nonbc with tnm stages i and ii were significantly higher than those in either hcc - b or hcc - c. in tnm stage iii, the median dcp level in hcc - nonbc was significantly higher than that in hcc-c.conclusionsdcp was more sensitive than afp for the diagnosis of early stage cryptogenic hcc. dcp should be used as the main serum test for cryptogenic hcc detection. |
the ovaries are the most common sites affected, but endometriosis can also involve the gastrointestinal tract, urinary tract, chest, and soft tissues. endometriosis of the chest is uncommon, and the diagnosis is usually established on clinical grounds. endometrial tissue may involve the pleura by migrating from the peritoneal cavity to the pleural cavity through diaphragmatic defects or via microembolization. pleuritic chest pain, pneumothorax, pleural effusions, or cyclic haemoptysis can occur with pulmonary involvement [35 ]. a 35-year - old female presented with episodes of a right chest pain approximately 3 - 4 days in a month and resolved spontaneously. her primary care physician had treated her with antibiotics empirically throughout the four months. during the last episode of chest pain, the patient described having a pain not resolving with analgesics combination. the patient did not have any exacerbating factors, fevers, dyspnoea, haemoptysis, weight loss, and gastrointestinal complaints. the patient 's medical history was unremarkable, and she specifically denied a history of trauma and cardiopulmonary disease. she had spent 4 months in seaside town and had also worked at a seafood restaurant. her physical examination was within normal limits, except minimal pain in the right - sided lower chest and tenderness of the left lower abdominal quadrant. routine laboratory tests and tumor markers (afp, cea, ca 15 - 3, ca 19 - 9) were within normal limits but increased serum level of ca-125 level (53.7 u / ml, normal value : 035 u / ml). her chest radiography showed a closed right - sided costophrenic angle and minimal pleural effusion without evidence of pneumonia (figure 1(a)). chest computed, tomography (ct) scans were performed 6 days after the onset of menstruation, and these did not demonstrate pleural effusion or any abnormality (figure 1(b)). a percutane thoracal punction (no abnormalities were noted on histopathologic examination) was done because she denied thoracoscopic examination. pelvic endometriosis was considered a possible diagnosis according to the results of us and mr of the abdomen. pelvic us revealed a left adnexal semisolid mass, with a thick wall and septa, measuring 71 61 cm (figure 1(c)). mr imaging evaluated a left adnexal mass in 67 57 mm diameter with, high - signalintensity areas on t1- (figures 2(a) and 2(b)) and t2-weighted (figures 2(c) and 2(d)) images. in addition, dynamic signal range was not narrowed with fat - suppressed sequence, and heterogeneous pattern was found on postcontrast series. therefore, based on imaging characteristics immature teratoma, endothermal sinus tumor, and germ cell tumor must be considered primarily. at exploratory laparotomy, a transverse incision was performed, and a 6 cm mass was found just behind the uterus, as well as adhesions between the mass and the adjacent tissues. the patient needed sharp dissection and underwent adhesiolysis with left - sided salpingo - oophorectomy. rest of endometriotic focuses on uterus, pouch of douglas, and other peritoneal surfaces were destroyed with electro - coagulation. macroscopic appearance showed multiple irregular hemorrhagic foci and chocolate cysts (figure 3). the postoperative recovery was uneventful, and the patient was discharged on the third post - operative day. leuprolide acetate (lucrin 3.75 mg ; abbott australasia, kurnell, nsw, australia) was used to achieve endometrial atrophy for six months after surgery. medical treatment was continued with a cyclic low - dose combined oral contraceptive (yasmin ; bayer healthcare pharmaceuticals inc., one year of regular followup, there was no evidence of recurrent pleural effusion, chest pain, and abdominal complaints. the endometrial cells implant on serosal surfaces into the peritoneal cavity and transport to the thorax through diaphragmatic defects and lymphatic or vascular channels. thoracal endometriosis, depending on the extent and tissue affected, can produce pleuritic chest pain, pleural effusion, hemothorax, and pneumothorax. the physical manifestations are variable, with some patients being asymptomatic and others having disabling chest or pelvic pain, adnexal masses, or unusually signs. in our patient, periodic episodes of symptoms concurrent with menstruation led to the suspicion of a relationship between these conditions. the peak incidence for pelvic endometriosis occurred between 24 and 29 years, whereas the peak incidence for thoracal involvement was between 30 and 34 years. in a series of 110 patients with thoracal endometriosis, pneumothorax, hemothorax, hemoptysis, and pulmonary nodules the right hemithorax was involved in more than 90% of all manifestations except for nodules. regardless of pathophysiology, thoracal endometriosis is generally associated with coexistent pelvic endometriosis and usually occurs 5 years after the diagnosis of pelvic endometriosis. however, most women with endometriosis have normal or nonspecific results from physical examinations, and laparoscopy is necessary for the definitive diagnosis. for the definite confirmation of presence of endometrial tissue ct - guided percutaneous transthoracic needle biopsy or thoracoscopic tissue biopsy we only able to perform thoracal ct and abdominal mr imaging in present case, because our patient denied a thoracoscopic examination. the us appearance of pelvic endometriosis exhibits diffuse low - level internal echoes, hypoechoic focal lesion, and rarely, may be anechoic, mimicking a functional ovarian cyst. patel. found that wall thickness is not a differentiating feature between endometriomas and other ovarian masses. using ct, endometriosis of the lung parenchyma mr imaging has been shown to have greater specificity for the diagnosis of abdominal endometriomas.. lesions with degenerated blood products, including concentrated protein, appear with high - signalintensity areas on t1- and t2-weighted images. in our case, t1-weighted mr image showed a multilocular high - signalintensity mass on the left ovary, and highness in signal intensity remained in t2-weighted image. a common feature of an endometrioma, shading, is present when a cyst that is hyperintense on a t1-weighted image becomes hypointense on a t2-weighted image. this shading reflects the chronic nature of an endometrioma and helps differentiate it from other blood - containing lesions except hemorrhagic corpus luteum cysts, which do not exhibit shading on t2-weighted images. other lesions that appear with high - signalintensity on t1-weighted images include dermoids, mucinous cystic tumors, and hemorrhagic masses. treatment for thoracal endometriosis can be medical for chest pain and effusion or surgical, depending on the severity of urgent and elective symptoms. medical treatment is one of the choices of treatment to relieve cyclic pain in endometriosis. multiple pharmacologic agents in use include combined oral contraceptives, danazol, gn - rh agonists and progestins. in our patient, medical treatment with a gn - rh agonist, which was continued with a cyclic low - dose definitive surgery includes hysterectomy and oophorectomy and is usually reserved for women with intractable pain. the conservative surgery, including left - sided oophorectomy, was performed to our patient. in our patient,, we did not establish pleural endometriosis cytologically but the monthly chest pain associated with endometrioma of the ovary supported extrapelvic lesion, clinically. | chest pain is a rare sign of thoracal endometriosis associated with endometrioma of the tubo - ovarian endometrioma. we report the case periodic episodes of chest pain concurrent with menstruation in a 35-year - old female, in which ovarian endometrioma was diagnosed and left - sided oophorectomy was performed. after surgery, patient underwent medical treatment which included a gn - rh agonist and a combined oral contraceptive. in the follow - up period, there was no evidence of chest pain. |
bfgfbasic fibroblast growth factorcafcancer - associated fibroblastnatnormal fibroblast basic fibroblast growth factor cancer - associated fibroblast although genetic mutations in tumor cells are the primary drivers of tumorigenesis, stromal cells in the tumor microenvironment, including fibroblasts, immune cells, and endothelial cells, are active conspirators in promoting tumor growth and metastasis. oncogenic signaling within tumors frequently drives the recruitment of normal fibroblasts (nafs) and reprograms them into cancer - associated fibroblasts (cafs). cafs are activated fibroblasts that share similarities with fibroblasts and are stimulated by inflammatory conditions or activated during wound healing. they constitute a significant component of the stroma and mediate changes in the composition of extracellular matrix to one with an increased amount of collagens (desmoplastic response). cafs are phenotypically and functionally distinct from nafs and can be identified based on the expression of several markers including smooth muscle actin (-sma), fibroblast activation protein (fap) ; fibroblast - specific protein 1 (fsp1), and platelet - derived growth factor receptor (pdgfr). transforming growth factor (tgf-), platelet - derived growth factor (pdgf), basic fibroblast growth factor (bfgf), interleukin 6 (il-6), and lysophosphatidic acid (lpa), which can induce desmoplastic reactions in tumors, cafs are functionally distinct from nafs and significantly promote tumor growth in xenograft models when mixed with tumor cells. the tumor - promoting effects of cafs are mainly mediated through a paracrine mechanism involving multiple secreted factors, including hepatocyte growth factor (hgf), connective tissue growth factor (ctgf), epidermal growth factor (egf), insulin growth factor (igf), nerve growth factor (ngf), bfgf, wingless / integrase-1 (wnt) ligands, and matrix metalloproteinase. in addition to these paracrine events, cafs secrete many chemokines (such as c - x - c motif chemokine 12 [cxcl12 ], cxcl14, and ccl7) and vascular endothelial growth factor (vegf - a) to regulate angiogenesis. for instance, cafs secrete cxcl12, which binds and activates cxcr4 in tumor cells, to induce migration and proliferation of tumor cells. in addition, cafs can change their metabolic profile and provide metabolic intermediates that enhance tumor growth. for example, phosphoglycerate kinase-1 (pgk1), a component of the glycolytic pathway, is dramatically upregulated in cafs compared with nafs. overexpression of pgk1 reprograms nafs into cafs, causing a proliferation of cafs, and promotes tumor growth when co - implanted in vivo. the current hypothesis is that a switch to aerobic glycolysis in cafs would generate lactate and ketones, which, when secrete into the intracellular space, act as paracrine oncometabolites to fuel oxidative mitochondrial metabolism in tumor cells. the metabolic switch to aerobic glycolysis, referred to as the reverse warburg effect (fig. 1), occurs in cafs through molecular mechanisms that are largely undefined. a recent paper by zhang. showed that downregulation of isocitrate dehydrogenase 3 (idh3) plays a critical role in the metabolic reprogramming of cafs. downregulation of idh3 decreases the effective level of -ketoglutaric acid (-kg) by reducing the ratio of -kg to fumurate and succinate ; this results in inhibition of prolyl hydroxylase domain - containing protein 2 (phd2) and stabilization of hypoxia - inducible factor 1- (hif1) protein. the accumulation of hif1, in turn, promotes glycolysis by increasing the uptake of glucose, upregulating expression of glycolytic enzymes under normoxic conditions, and inhibits oxidative phosphorylation by upregulating nadh dehydrogenase 1 subcomplex 4-like 2 (ndufa4l2). cafs from tumor samples exhibit low levels of idh3, and overexpression of idh3 prevents transformation of fibroblasts into cafs. together, these findings reveal that idh3 is a critical metabolic switch in cafs. this includes metabolic reprogramming in cafs. in triple - negative breast cancer (bc), tumor cells are prone to glycolysis and the adjacent cafs can also adapt to glycolysis. the acidic environment generated by this not only activates matrix metalloproteinase (mmp), but also prevents attack from immune cells. however, in the luminal subtype of breast cancer, tumor cells are not prone to glycolysis although their adjacent cafs can adopt glycolysis. metabolic intermediates, such as lactate, secreted by cafs can be utilized by tumor cells for the biosynthesis of macromolecules. the metabolic symbiosis between tumor cells and cafs provides a growth advance for the proliferation and metastatic dissemination of tumor cells. this includes metabolic reprogramming in cafs. in triple - negative breast cancer (bc), tumor cells are prone to glycolysis and the adjacent cafs can also adapt to glycolysis. the acidic environment generated by this not only activates matrix metalloproteinase (mmp), but also prevents attack from immune cells. however, in the luminal subtype of breast cancer, tumor cells are not prone to glycolysis although their adjacent cafs can adopt glycolysis. metabolic intermediates, such as lactate, secreted by cafs can be utilized by tumor cells for the biosynthesis of macromolecules. the metabolic symbiosis between tumor cells and cafs provides a growth advance for the proliferation and metastatic dissemination of tumor cells. first, cafs promote a dynamic metabolic interaction with tumor cells and generate a metabolic niche to nourish tumor growth. an example is breast cancer, a heterogeneous disease that can be divided into at least 4 different subtypes based on gene expression profiling : luminal a, luminal b, human epidermal growth factor receptor 2 (her2), and basal - like. after examining markers of glycolysis, autophagy, and proliferation in 740 tumor tissues, choi. identified 4 different metabolic phenotypes in tumor and stroma. these include warburg type (glycolysis in tumor cells, non - glycolysis in stroma), reverse warburg type (non - glycolysis in tumor cells, glycolysis in stroma), mixed type (glycolysis in both tumor cells and stroma), and null type (non - glycolysis in both tumor cells and stroma) (fig. 1). triple - negative (basal - like) breast cancer is enriched in mixed and warburg types with high metabolic activity, whereas luminal breast cancer is enriched in null and reverse warburg types with low metabolic activity. this study reveals the metabolic heterogeneity in breast cancer, and demonstrates a correlation between tumor subtypes and metabolic phenotypes. new therapeutic approaches that metabolically uncouple the symbiosis between tumor cells and cafs may inhibit the development and growth of tumors. second, tumor cells co - evolve with nafs during tumor progression and reprogram them into cafs. once reprogrammed, the caf phenotype becomes permanent even in the absence of continued exposure to intratumoral stimuli. this stable phenotype suggests that epigenetic regulation and an autocrine signaling loop operate in the reprogramming of cafs. identification of the mechanisms that govern these inferred processes may provide a new approach to target cafs. fuel source enabling tumor cell propagation, survival, and systemic dissemination, they are a heterogeneous cell population. several cell types can be transdifferentiated into cafs ; the majority of cafs are derived from resident tissue fibroblasts and mesenchymal stem cells. stellate cells are predominantly responsible for the desmoplastic reaction seen in chronic pancreatitis and pancreatic cancer, as well as in liver fibrosis, and are categorized as cafs when present in cancer tissue. in addition, epithelial and endothelial cells can be converted to cafs through epithelial - mesenchymal transition and endothelial - mesenchymal transition, respectively. thus, cafs may be derived from multiple tissue types, reflecting local and distant cues that are sensed during tumorigenesis, and thus can not be referred to as a single population of cells. although many exciting studies have been completed, the remaining challenge is to translate our knowledge into targeting tumor cells to alleviate side effects, drug resistance, metastasis, and recurrence. we apologize to the many contributors to this field whose work is important but could not be cited due to space limitations. our study is supported by the grants from nih (ro1s ca125454 and ca188118), dod breakthrough award (bc140733p1), the mary kay ash foundation (to b. p. zhou), and the national natural science foundation of china (81402432 to j. liu). | abstractcancer - associated fibroblasts (cafs) are major participants in the crosstalk between tumor cells and their microenvironment. cafs provide not only multiple soluble factors but also metabolic fuels to promote tumor growth, invasion, and metastasis. we discuss recent developments delineating the effects of metabolic symbiosis between cafs and tumor cells on tumor growth. |
radicular back pain is an important public health issue that can result in long term disability and poor quality of life. conservative therapy is the initial treatment of choice, but fails to provide relief in a substantial number of patients. central and foraminal stenosis with entrapment of descending and/or exiting nerve roots is a common cause of radicular pain, with an estimated incidence of 8 to 11% 1 2 3. spinal stenosis of the thoracic vertebrae is less common than that of the cervical and lumbar regions. in our experience, patients tend to be older and are more commonly male. due to the close proximity to thoracic and abdominal organs, open surgical operations can be difficult and carry a greater risk of complications due to the requirement of a transthoracic approach. the most efficacious intervention for thoracic stenosis refractory to conservative management is uncertain at this time. here we report on our experience with 12 patients diagnosed with thoracic radiculopathy due to central or foraminal stenosis treated with endoscopic laminoforaminoplasty via a small incision, of less than one inch. twelve patients were treated with endoscopic laminoforaminoplasty (elfp) of the thoracic spine for radicular pain. all patients were diagnosed with radicular pain involving the lower thoracic levels (at or below t6). prior to surgery, all patients were treated with conservative therapy, including physical therapy and epidural steroid injections, which failed to provide adequate relief. intravenous (iv) antibiotics were administered perioperatively ; cefazolin was used unless there was an allergy, in which case ciprofloxacin was substituted. remifentanil and midazolam were the most commonly used sedating agents. utilizing fluoroscopy, the entry site was then determined and a 3/4-inch incision was made at a 30-degree angle to the vertebrae. through this incision, a guide wire was inserted down to the lamina of the stenotic vertebra. over this guide wire a bullet system was inserted to dilate the tissues to a final diameter of 14.5 mm. a 5 mm laparoscopy scope, with 3.2x magnification, was used to visualize the procedure. pituitaries and kerrisons were then used to remove bulk tissues and bone to open up the spinal canal. a standard burr with a 6 mm bit was used to remove bone and smooth the bony edges of the opening. a holmium outcome measures were percent change from baseline in oswestry disability index (oswestry) and visual analog scale (vas) pain scores. the author acknowledges that there are no conflicts of interest or financial benefits with the results of the study. all twelve patients (10 males, 2 females) completed the surgery without complication. average age was 60.2 years (range : 49 - 73). at baseline, most patients reported moderate to disabling pain, with average scores of 6.7 and 24.75 on the vas and oswestry, respectively and the individual patient data is presented in table 1. utilizing the student 's t - test, the data was separated into pre and post surgical scores. even though the sample size is small, the improvement is significant with a p value of 0.005. with all patients, average follow - up scores were 2.9 and 12.08 on the vas and oswestry, respectively. one patient with moderate symptoms, two with severe symptoms, and two with crippling symptoms did not report significant improvement on vas or oswestry. of the twelve patients, 8 had foraminal stenosis and 4 had central issues per both mri and surgical report. thoracic radiculopathy is rare, as evidenced by the paucity of literature regarding the appropriate management of these patients. in our experience, patients with thoracic central and foraminal stenosis are more likely to be male, and tend to be of older age than patients with cervical or lumbar disease. also, the stenosis tends to be foraminal and not central since 66% of patients had foraminal stenosis. the correct surgical management of these patients is based largely on data regarding lumbar and cervical radiculopathy. however, in the thoracic vertebrae proximity to both thoracic and abdominal internal organs as well as prominent vascular and neural structures increases the risk of adverse events with invasive approaches. open surgical correction is the current standard of care for foraminal stenosis of cervical and lumbar vertebrae. open surgery requires a longer operative time, hospital stay, and postoperative recovery period and carries significant risks. the anterior approach requires a transthoracic approach with close proximity to the major abdominal and thoracic organs and neurovasculature 4, and posterior approaches require subperiosteal of the paraspinal muscles, which can result in increased pain and spasms 5. as with any deeply invasive procedure, blood loss, infection, prolonged hospital stay, and postoperative pain are potential complications. in contrast, interventions that are less invasive, such as endoscopic laminoforaminoplasty, should decrease the risk of major adverse events, allow for same day hospital discharge, and decrease the need for postoperative analgesia and immobility 5 6. in the current study, at the same time, reports in the literature suggest similar patient outcomes to conventional open approaches 7 4 8 9. in this study, 7 of 12 patients (58.3%) experienced noticeable improvement as evidence by decreased vas and oswestry scores at postoperative follow - up, results consistent with published data. patients additionally benefit from a decrease risk of complications, short hospital stay, and faster recovery. this approach should be considered in patients with simple thoracic radiculopathy due to central or foraminal stenosis who fail to benefit from conservative management. finally, we do recommend that a larger study would be beneficial in confirming our data due to our small study group. | background : spinal stenosis of the thoracic spine is less common than that of the cervical and lumbar regions. due to the close proximity to thoracic and abdominal organs, surgical operations can be difficult and carry a greater risk of complications. the most efficacious intervention for thoracic stenosis, whether central or foraminal, refractory to conservative management is uncertain. we aimed to evaluate the efficacy of endoscopic laminoforaminoplasty (elfp) in the treatment of thoracic radiculopathy.methods : twelve patients with radicular pain involving the lower thoracic levels (at or below t6) were treated with elfp.results : seven of twelve patients showed marked improvement in pain scores. average follow - up scores were 2.9 and 12.08 on the visual analog scale (vas) and oswestry disability index, respectively. the significance was 0.005 between the pre and post surgical data. one patient with moderate symptoms, two with severe symptoms, and two with crippling symptoms did not report significant improvement on vas or oswestry. no complications were encountered.conclusions : endoscopic laminoforaminoplasty offers an alternative to fusion or conventional laminotomy with similar success rates. patients additionally benefit from a decrease risk of complications, short hospital stay, and faster recovery. |
in 2000, the 24 member boards of the american board of medical specialties, including the american board of pathology, agreed to evolve their recertification programs toward continuous professional development to ensure that physicians are committed to lifelong learning and competency in their specialty areas (1, 2). measuring competencies occurs in a variety of ways according to specialty, which each board determined in 2006 (1). one way competency measures are assessed by the board is practice performance assessment, which involves demonstrating use of best evidence and practices compared to peers and national benchmarks (1). all specialty boards are now in the process of implementing their respective maintenance of certification requirements. to incentivize physicians to participate in new maintenance of certification activities, the affordable care act (3) required the centers for medicare & medicaid services to implement the physician quality reporting system incentive program, which is a voluntary reporting program that provides an incentive payment to board certified physicians who acceptably report data on quality measures for physician fee schedule covered services furnished to medicare part b fee - for - service recipients (4). the physician quality reporting system represents a stunning change and likely an advancement in physicians professional development ; namely, the opportunity for reporting of and reflection upon actual clinical practice activities. it is too early to tell what the above changes will mean for improvements in clinical care, or what the future holds in terms of required versus voluntary reporting of clinical care performance. however, there is much to be learned about how physicians process information about their clinical performance, which is directly relevant to parts 2 and 3 of maintenance of certification, lifelong learning and self- and practice performance assessment (1). reviews on the effectiveness of continuing medical education indicate that for physicians to change their practice behaviors they must understand that a gap exists between their actual performance and what is considered optimal (5), which is not always immediately evident. identifying an existing gap is the initial step, but understanding what might be causing the gap could assist physicians to identify strategies to improve their practice. interpretation of breast pathology is an area where significant diagnostic variation exists (68). we conducted a study with 92 pathologists across the u.s. that involved administering test sets of 60 breast pathology cases and comparing participants interpretations to a consensus reference diagnosis determined by a north american panel of experienced breast pathologists. we used the findings from the test set study to design an individualized educational intervention that identified the diagnostic agreement for four categories of breast pathology interpretations : benign without atypia, atypia (including atypical ductal hyperplasia and intraductal papilloma with atypia), ductal carcinoma in situ and invasive cancer. in this paper, we report on : 1) breast pathologists estimates on how their estimated diagnostic interpretations compare to the reference diagnoses before they learned the actual reference diagnosis, 2) physician characteristics associated with under- and overestimates of diagnostic agreement with specialist consensus diagnosis, 3) the extent to which pathologists recognized the gap after the intervention, and 4) what pathologists reported they would change about their clinical practices. the approach we undertook to understand how pathologists process information about breast pathology cases has important implications for maintenance of certification activities in the field of pathology and for pathologist recognition of cases likely to have diagnostic disagreements. all study activities were health insurance portability and accountability act compliant and were approved by the institutional review boards of the university of washington, dartmouth college, the university of vermont, fred hutchinson cancer research center, and providence health & services of oregon. a study - specific certificate of confidentiality was also obtained to protect the study findings from forced disclosure of identifiable information. detailed information on the development of the test set is published elsewhere (9). briefly, test set cases were identified from biopsy specimens obtained from mammography registries with linkages to breast pathology and/or tumor registries in vermont and new hampshire (10). samples were chosen from cases biopsied between january 1, 2000 and december 31, 2007. a consensus process was undertaken by three experienced breast pathologists to come to a final reference diagnosis for each case in the test set, which is described elsewhere (12). using a random stratified approach, patient cases were assigned into one of four test sets, which contained 60 cases each (240 total unique cases) and represented the following diagnostic categories : benign without atypia (30%), atypia (30%), ductal carcinoma in situ (30%) and invasive cancer (10%). this distribution resulted in an oversampling of more atypia and ductal carcinoma in situ cases, which would help quantify the diagnostic challenges to be included in the educational intervention. pathologists were recruited to participate from eight geographically diverse states (ak, me, mn, nm, nh, or, wa, vt) via email, telephone, and street mail. all practicing pathologists in these states were invited to participate. to be eligible for participation, pathologists interpret breast biopsies as part of their practice, have been signing out breast biopsies for at least one year post residency or fellowship, and intend to continue interpreting breast biopsies for at least one year post enrollment. all participating physicians completed a brief 10-minute survey that assessed their demographic characteristics (age, sex), training and clinical experiences (fellowship, case load, interpretive volume, years interpreting, academic affiliations), and perceptions of how challenging breast pathology is to interpret. two hundred and fifty - two pathologists of 389 eligible participants (65%) agreed to take part in the study. among these, 126 were randomized to the current study (126 participants were offered participation in a related future study), 115 of these completed interpretation of test set cases and 94 completed the educational intervention upon which this study is based. the educational intervention was designed to provide a research - based review of differences among pathologists in breast tissue interpretation. it was a self - paced internet hosted program individualized to participant s interpretive performance on their respective test set. before they reviewed how their interpretations compared to the reference diagnosis, we asked participants to compare how similar the test set cases were to cases they see in their practice (response options ranged from i always see cases like these), and we asked them to indicate the number of continuing medical education hours they have undertaken in breast pathology interpretation over the past year as well as their continuing medical education preferences (instructor led, self - directed or other). lastly, at the beginning of the continuing medical education program, we asked participants to estimate, globally, how their interpretations would compare to the reference diagnosis (over interpret, under interpret, do nt know) and to estimate the proportion of their diagnoses on test cases they thought would agree with the reference diagnoses within each of the four diagnostic categories reviewed (benign, atypia, ductal carcinoma in situ, invasive). participants estimates for each of the four categories were then assigned a weighted average using the proportion of their diagnoses they estimated agreed with the reference diagnoses and, as the weighting pattern, the number of cases each participant interpreted within each diagnostic class. subtracting the weighted estimate of agreement with specialist consensus diagnoses from the participants actual agreement gave us the difference between perceived and actual agreement, or we then categorized these differences for each of the four diagnostic categories according to three classifications : 1) those who were within one standard deviation of the mean (when compared to the reference diagnosis) were those who closely estimated their performance ; 2) those whose estimates were more than one standard deviation above the mean were those who overestimated their agreement rates ; and 3) those whose estimates were more than one standard deviation below the mean were those who underestimated their agreement rates. the continuing medical education program then proceeded to show the pathologists, on a case - by - case basis, how their independent interpretations actually compared with both the reference diagnosis and with other participating pathologists. by clicking on the case number, participants could view a digital whole slide image of the case on their computer screens and could dynamically magnify and scan the image similar to a microscope (virtual digital microscope). participants were given the opportunity to share their own thoughts on each case after seeing their results and reading the experienced pathologists teaching points. the intervention included an open text field that asked them what they would change in their clinical practice as a result of what they learned in this program. lastly, a post - test asked study participants to again rate how their interpretations compared to the reference diagnosis, so we could assess the extent to which they recognized any areas of significant disagreement with reference diagnoses. we then asked them to complete required knowledge questions so that continuing medical education credits could be awarded. completion of all study activities, including the test set interpretations and the continuing medical education program resulted in awarding up to 20 category 1 continuing medical education hours (majority awarded 1517 hours). we used descriptive statistics to characterize the demographic and clinical training experience as well as ratings of the test sets and challenges involved in interpreting breast pathology. histograms were used to compare the pre - test differences between overall perceived and actual diagnostic agreement as well as agreement within each diagnostic group in both pre- and post - test settings. among the 94 participants who completed the continuing medical education program, differences between perceived and actual performance rates could not be assigned to 2 participants (2.1%) due to missing responses. categorical data are presented as frequencies and percentages and for continuous variables, values are reported as the mean and standard deviation. cumulative logit models were fit to test the association between each participant characteristic and the ordered three - category dependent variable, perception gaps. each model was adjusted for actual overall agreement. analyses were performed using a commercially available sas v9.4 (sas institute, cary nc). a classical content analysis (12) was performed on participants test responses regarding whether there was anything they would change in their practice as a result of what they learned from this program. this process allowed us to identify and describe thematic areas according to over and underestimates of diagnostic agreement. all study activities were health insurance portability and accountability act compliant and were approved by the institutional review boards of the university of washington, dartmouth college, the university of vermont, fred hutchinson cancer research center, and providence health & services of oregon. a study - specific certificate of confidentiality was also obtained to protect the study findings from forced disclosure of identifiable information. detailed information on the development of the test set is published elsewhere (9). briefly, test set cases were identified from biopsy specimens obtained from mammography registries with linkages to breast pathology and/or tumor registries in vermont and new hampshire (10). samples were chosen from cases biopsied between january 1, 2000 and december 31, 2007. a consensus process was undertaken by three experienced breast pathologists to come to a final reference diagnosis for each case in the test set, which is described elsewhere (12). using a random stratified approach, patient cases were assigned into one of four test sets, which contained 60 cases each (240 total unique cases) and represented the following diagnostic categories : benign without atypia (30%), atypia (30%), ductal carcinoma in situ (30%) and invasive cancer (10%). this distribution resulted in an oversampling of more atypia and ductal carcinoma in situ cases, which would help quantify the diagnostic challenges to be included in the educational intervention. pathologists were recruited to participate from eight geographically diverse states (ak, me, mn, nm, nh, or, wa, vt) via email, telephone, and street mail. all practicing pathologists in these states were invited to participate. to be eligible for participation, pathologists interpret breast biopsies as part of their practice, have been signing out breast biopsies for at least one year post residency or fellowship, and intend to continue interpreting breast biopsies for at least one year post enrollment. all participating physicians completed a brief 10-minute survey that assessed their demographic characteristics (age, sex), training and clinical experiences (fellowship, case load, interpretive volume, years interpreting, academic affiliations), and perceptions of how challenging breast pathology is to interpret. two hundred and fifty - two pathologists of 389 eligible participants (65%) agreed to take part in the study. among these, 126 were randomized to the current study (126 participants were offered participation in a related future study), 115 of these completed interpretation of test set cases and 94 completed the educational intervention upon which this study is based. the educational intervention was designed to provide a research - based review of differences among pathologists in breast tissue interpretation. it was a self - paced internet hosted program individualized to participant s interpretive performance on their respective test set. before they reviewed how their interpretations compared to the reference diagnosis, we asked participants to compare how similar the test set cases were to cases they see in their practice (response options ranged from i always see cases like these), and we asked them to indicate the number of continuing medical education hours they have undertaken in breast pathology interpretation over the past year as well as their continuing medical education preferences (instructor led, self - directed or other). lastly, at the beginning of the continuing medical education program, we asked participants to estimate, globally, how their interpretations would compare to the reference diagnosis (over interpret, under interpret, do nt know) and to estimate the proportion of their diagnoses on test cases they thought would agree with the reference diagnoses within each of the four diagnostic categories reviewed (benign, atypia, ductal carcinoma in situ, invasive). participants estimates for each of the four categories were then assigned a weighted average using the proportion of their diagnoses they estimated agreed with the reference diagnoses and, as the weighting pattern, the number of cases each participant interpreted within each diagnostic class. subtracting the weighted estimate of agreement with specialist consensus diagnoses from the participants actual agreement gave us the difference between perceived and actual agreement, or we then categorized these differences for each of the four diagnostic categories according to three classifications : 1) those who were within one standard deviation of the mean (when compared to the reference diagnosis) were those who closely estimated their performance ; 2) those whose estimates were more than one standard deviation above the mean were those who overestimated their agreement rates ; and 3) those whose estimates were more than one standard deviation below the mean were those who underestimated their agreement rates. the continuing medical education program then proceeded to show the pathologists, on a case - by - case basis, how their independent interpretations actually compared with both the reference diagnosis and with other participating pathologists. by clicking on the case number, participants could view a digital whole slide image of the case on their computer screens and could dynamically magnify and scan the image similar to a microscope (virtual digital microscope). participants were given the opportunity to share their own thoughts on each case after seeing their results and reading the experienced pathologists teaching points. the intervention included an open text field that asked them what they would change in their clinical practice as a result of what they learned in this program. lastly, a post - test asked study participants to again rate how their interpretations compared to the reference diagnosis, so we could assess the extent to which they recognized any areas of significant disagreement with reference diagnoses. we then asked them to complete required knowledge questions so that continuing medical education credits could be awarded. completion of all study activities, including the test set interpretations and the continuing medical education program resulted in awarding up to 20 category 1 continuing medical education hours (majority awarded 1517 hours). we used descriptive statistics to characterize the demographic and clinical training experience as well as ratings of the test sets and challenges involved in interpreting breast pathology. histograms were used to compare the pre - test differences between overall perceived and actual diagnostic agreement as well as agreement within each diagnostic group in both pre- and post - test settings. among the 94 participants who completed the continuing medical education program, differences between perceived and actual performance rates could not be assigned to 2 participants (2.1%) due to missing responses. categorical data are presented as frequencies and percentages and for continuous variables, values are reported as the mean and standard deviation. cumulative logit models were fit to test the association between each participant characteristic and the ordered three - category dependent variable, perception gaps. each model was adjusted for actual overall agreement. analyses were performed using a commercially available sas v9.4 (sas institute, cary nc). a classical content analysis (12) was performed on participants test responses regarding whether there was anything they would change in their practice as a result of what they learned from this program. this process allowed us to identify and describe thematic areas according to over and underestimates of diagnostic agreement. overall (all diagnostic categories combined), participants were very accurate in their estimates of their perceived versus actual diagnostic agreement with specialist consensus diagnosis with a slight tendency to overestimate their agreement, with a mean gap between perceived vs. actual agreement of 5.5% (mean for actual agreement = 75.9% ; mean for estimated agreement = 81.4%,) (figure 1a). figure 1b shows the distribution in performance estimates for under - estimating (17.7%). as indicated in table 1, non - academic affiliated pathologists were more likely to more closely estimate their performance relative to academic affiliated pathologists (77.6% versus 48% ; p=0.001), whereas participants affiliated with an academic medical center were more likely to underestimate agreement with their diagnoses compared to non - academic affiliated pathologists (40% versus 6%). in addition, those who perceived that their colleagues consider them an expert in breast pathology were more likely to underestimate their agreement (41.2% versus 9.3% ; 0.029) (table 1). the vast majority of participants indicated that, within the entire spectrum of breast pathology, the type of cases included in the sample sets were either often (51.7%) or always (24.7%) seen in their practice, and though not statistically significant, were able to fairly closely estimate their agreement with the specialist consensus diagnoses (table 2). prior to the continuing medical education program, nearly 55% (54.9%) of participants could not estimate whether they would over - interpret the cases or under - interpret them relative to the reference diagnosis. nearly 80% (79.8%) reported learning new information from this individualized web - based continuing medical education program as well as strategies they can apply to their own clinical practice (table 2). figure 2 illustrates that participants were most likely to overestimate their performance for atypia and least likely to overestimate their performance for invasive cancer prior to the educational intervention. figure 3 shows that following the continuing medical education program, participants were more able to recognize the gap in their estimated versus actual agreement. twenty - two of 92 participants (23.9%) indicated areas in their clinical practice they would change as a result of the continuing medical education program (table 3). among those who underestimated agreement with their diagnosis, threshold setting and information seeking were equally described, while among those who overestimated agreement with their diagnoses, more careful review of cases was most frequently described. this study is, to our knowledge, the first detailed analysis of the perceptions pathologists have regarding the gap in perceived versus actual diagnostic agreement in breast pathology interpretation. the characteristics most likely associated with underestimating agreement with their diagnoses were affiliation with an academic medical center and their self - report of being perceived as an expert in breast pathology by colleagues. it may be that pathologists affiliated with an academic medical center or who are perceived by their colleagues as experts in breast pathology by their peers are more aware of areas of poor diagnostic agreement in breast pathology and so have lower expectations for diagnostic agreement than those with other clinical experiences, especially in diagnostic categories like atypia. it may also be that breast pathologists exposed to a high volume of consults, such as those who practice in tertiary care centers or other high volume centers, see a broader array of difficult cases, which results in less inherent confidence that they can predict the biologic behavior of the disease or be assured that their expert peers would arrive at the same diagnosis. while research in visual interpretive practice has examined the learning curve post residency with radiologists (14, 15), this topic has not been studied with breast pathologists. in addition, both prior radiology studies focused on learning curves at the beginning of independent practice, rather than among a broad range of physician ages. we found that physicians were most likely to overestimate their diagnostic agreement rates with atypia and least likely to over or underestimate these rates for invasive cancer. many studies have shown less interpretive variability in distinguishing between just two categories : benign and malignant (6, 8). it appears to become much more challenging when pathologists must differentiate between atypia and ductal carcinoma in situ (68). given that this clinical conundrum is well documented, understanding how to reduce this variability could improve clinical practice. our hope is that educational interventions, similar to the one we developed for this study, will result in improved clinical care. maintenance of certification has stimulated similar novel educational programs for continued professional development, as gaps in professional practice are recognized. the accreditation council for continuing medical education has adopted the agency for healthcare research and quality s definition of a gap in professional practice as the difference between health care processes or outcomes observed in practice, and those potentially achievable on the basis of current professional knowledge (16). with changes in maintenance of certification occurring in subspecialties, many groups are redesigning continuing medical education to examine gaps between actual and optimal practice. for example, the american college of physicians is currently hosting an educational program on cardiovascular risk reduction (17) aimed at identifying and addressing gaps in knowledge and practice to improve the care of patients. as with our study, it will be vitally important to determine whether such educational programs can improve both physician practice and patient outcomes so the changes in maintenance of certification can be linked to actual improvements. our previously published work identified high diagnostic disagreement rates for atypia in breast pathology, and the current study s continuing medical education intervention identified a gap in pathologists perception of how frequently their diagnoses would agree with the specialist reference diagnoses of atypia. this continuing medical education is novel because it focused on problematic diagnostic areas (such as atypia) that are less clearly defined than areas that are frequently tested with typical continuing medical education activities (such as invasion versus no invasion). our study is unique in that we studied the gap between perceived versus actual practice when interpreting test sets. this is important because research shows that for physicians to change practice behaviors they must be motivated by an understanding of a need to change, which was an important focus of this study. most studies focus on recognizing and rewarding performance that is of high quality (18, 19) or report performance gaps at health system levels without detailing how individual physicians processed their own gaps in performance (2021). we found that after recognizing the gap in perceived diagnostic agreement, those who underestimated agreement with their diagnoses reported that setting different clinical thresholds for interpretation and seeking additional information would be steps they would undertake to improve performance. this suggests that web - based learning loops composed of assessment followed by time - limited access to educational tools and visual diagnostic libraries may be useful in improving performance with a reference standard ; when the time limit expires, the participant would repeat the loop with another assessment. this training set could help improve diagnostic concordance with a reference standard in actual practice. physicians who overestimated their diagnostic agreement rates reported they would undertake more careful review as a way to improve. physicians who closely estimated their diagnostic agreement rates most often reported intending to seek additional consultations, likely because of a good perception of how low diagnostic agreement is in breast pathology for diagnoses such as atypia. these strategies might indeed improve performance if they were implemented, but understanding if this happened and what the impact might be was beyond the scope of this study. a strength of this study is that a broad range of pathologists participated, including university - affiliated and private - practice pathologists, pathologists with various levels of expertise in breast pathology and pathologists with various total years in practice. another strength of the study is that we oversampled challenging cases (atypia) in a effort to focus on interventions to address the most problematic areas of breast pathology. limitations of the study include the fact that study was limited to cases in the study test sets. in addition, the educational program necessarily used digital images of the glass slides to educate physicians about specific features of the slides that contributed to the reference diagnosis. it is possible that the digital slide images were to some extent dissimilar from the actual glass slides, which could have influenced what pathologists learned from the program. in conclusion, our unique individualized web - based educational program helped pathologists to understand gaps in their perceived versus actual diagnostic agreement rates when their interpretations of breast biopsy cases were compared with a reference standard. we found that pathologists can closely estimate their overall diagnostic agreement with a reference standard in breast pathology but in particularly problematic areas (such as atypia), they tend to over - estimate agreement with their diagnosis. pathologists who both over and under interpreted their diagnostic agreement rates could identify strategies that could help them improve their clinical practice. | we examined how pathologists process their perceptions of how their interpretations on diagnoses for breast pathology cases agree with a reference standard. to accomplish this, we created an individualized self - directed continuing medical education program that showed pathologists interpreting breast specimens how their interpretations on a test set compared to a reference diagnosis developed by a consensus panel of experienced breast pathologists. after interpreting a test set of 60 cases, 92 participating pathologists were asked to estimate how their interpretations compared to the standard for benign without atypia, atypia, ductal carcinoma in situ and invasive cancer. we then asked pathologists their thoughts about learning about differences in their perceptions compared to actual agreement. overall, participants tended to overestimate their agreement with the reference standard, with a mean difference of 5.5% (75.9% actual agreement ; 81.4% estimated agreement), especially for atypia and were least likely to overestimate it for invasive breast cancer. non - academic affiliated pathologists were more likely to more closely estimate their performance relative to academic affiliated pathologists (77.6% versus 48% ; p=0.001), whereas participants affiliated with an academic medical center were more likely to underestimate agreement with their diagnoses compared to non - academic affiliated pathologists (40% versus 6%). prior to the continuing medical education program, nearly 55% (54.9%) of participants could not estimate whether they would over - interpret the cases or under - interpret them relative to the reference diagnosis. nearly 80% (79.8%) reported learning new information from this individualized web - based continuing medical education program, and 23.9% of pathologists identified strategies they would change their practice to improve.in conclusion, when evaluating breast pathology specimens, pathologists do a good job of estimating their diagnostic agreement with a reference standard, but for atypia cases, pathologists tend to overestimate diagnostic agreement. many of these were able to identify ways to improve. |
hek293 cells stably expressing human glp-1 receptor and a 3x - cre luciferase reporter were grown at 37c in 5% co2 in dulbecco 's modified eagle 's medium-31053 (invitrogen, carlsbad, ca) supplemented with 0.5% fbs, 2 mmol / l l - glutamine, 50 units / ml penicillin, 50 g / ml streptomycin, and 20 mmol / l hepes. for compound testing, cells were plated into 96-well poly - d - lysine, white opaque microplates. compounds were solubilized in dmso, diluted in medium containing 0.1% bsa fraction v substituted for 0.5% fbs, and added to cells. after a 5-h incubation, cells were harvested in steadylite plus lysis reagent (perkin elmer, waltham, ma), and luciferase activity was measured according to the manufacturer 's instructions using an envision 2104 multilabel reader. data are expressed as a percentage of maximum stimulation induced by the glp-1 (736) amide peptide (bachem, torrance, ca). two hours before compound testing, cells were resuspended in the aforementioned medium and plated in 96-well half area, solid black microplates. cells were assayed for camp using the camp dynamic 2 kit with homogenous time - resolved fluorescence technology (cisbio, bedford, ma). fluorescence was measured according to the manufacturer 's instructions using an envision 2,104 multilabel reader. data are expressed as nm camp of the final assay solution induced by the glp-1 receptor agonists. animals were maintained in accordance with the institutional animal use and care committee of eli lilly and company and the guide for the use and care of laboratory animals by the national institutes of health. for animal treatment, compounds were solubilized in dosing solution containing 10% ethanol / solutol, 20% polyethylene glycol-400, and 70% pbs (ph 7.4). male sd rats were purchased from harlan (indianapolis, in) and group - housed three per cage in polycarbonate cages with filter tops. rats were maintained on a 12:12 h light - dark cycle (lights on at 6:00 a.m.) at 21c and received 2014 teklad global diet (harlan, indianapolis) and deionized water ad libitum. rats were fasted overnight and anesthetized with 60 mg / kg pentobarbital (lundbeck, deerfield, il) for the duration of the experiment. for glucose and compound administration, a catheter with a diameter of 0.84 mm (braintree scientific, braintree, il) was inserted into the jugular vein. for rapid blood collection, a larger catheter with 1.02-mm diameter (braintree scientific, braintree, il) was inserted into the carotid artery. blood was collected for glucose and insulin levels at time 0, 2, 4, 6, 10, and 20 min after intravenous administration of the compound which was immediately followed by an intravenous glucose bolus of 0.5 g / kg. plasma levels of glucose were determined using a hitachi 912 clinical chemistry analyzer (roche, indianapolis, in). plasma insulin was determined using an electrochemiluminescence assay (meso scale, gaithersburg, md). for the hyperglycemic clamp, sd rats were purchased from taconic with surgically implanted femoral artery and vein catheters. after an overnight fast, an initial blood sample was taken at time 0 from the arterial catheter, followed by compound administration via the venous catheter. subsequently, glucose infusion via the venous catheter was initiated, and the infusion rates were varied to maintain a blood glucose concentration of 250 mg / dl throughout the experiment. blood samples were collected every 5 min for glucose and every 10 min for insulin measurements over the course of 1 h. blood samples were collected in edta tubes. glucose concentrations were determined using an accucheck advantage glucometer (roche diagnostics, indianapolis, in), and insulin was measured using an electrochemiluminescence assay for rat insulin (meso scale, gaithersburg, md). male sd rats weighing 300 g were killed by co2 asphyxiation and subsequent cervical dislocation. the common bile duct was cannulated with a 27-gauge needle, and the pancreas was distended with 10 ml of hank 's balanced salt solution buffer ([hbss ], sigma, st. louis, mo) containing 2% bsa (applichem, boca raton, fl) and 1 mg / ml collagenase (sigma, st. islets were purified on a histopaque (histopaque-1077 : histopaque-11991 mixture, sigma, st. islets were cultured overnight in rpmi-1640 medium containing 10% fbs, 100 units / ml penicillin, and 100 g / ml streptomycin (invitrogen, carlsbad, ca). human islets from healthy donors were purchased from prodo laboratories (irvine, ca). human islets from a donor with type 2 diabetes (a 59-year - old male who died of a cerebrovascular stroke ; islets were harvested on the day of his death, cultured overnight, and shipped the next day) were obtained from asterand (detroit, mi). islet perifusion experiments were carried out in a buffered, temperature controlled perifusion system as previously described (19,20). briefly, groups of 20 islets were placed in reaction chambers and perifused with earle 's balanced salt solution (ebss) supplemented with 10 mmol / l hepes and 3.3 mmol / l glucose for 2040 min. the glucose concentration in the perifusion buffer was then raised to 16.7 mmol / l to stimulate insulin secretion. insulin secretion in static incubation experiments was measured in ebss (invitrogen, carlsbad, ca). islets were incubated in ebss containing 2.8 mmol / l glucose at 37c for 30 min. groups of three size - matched islets were then hand picked and incubated in 0.3 ml of ebss containing the indicated amount of glucose and compounds at 37c for 90 min. subsequent to the perifusion and static incubation experiments, supernatants and perifusates were collected and stored at 20c until assayed for insulin using a commercially available electrochemiluminescence assay (meso scale, gaithersburg, md). in vivo and islet data are represented as mean sem and were compared using anova followed by dunnett test. repeated measures analysis of variance was used to assess the statistical significance between time courses. hek293 cells stably expressing human glp-1 receptor and a 3x - cre luciferase reporter were grown at 37c in 5% co2 in dulbecco 's modified eagle 's medium-31053 (invitrogen, carlsbad, ca) supplemented with 0.5% fbs, 2 mmol / l l - glutamine, 50 units / ml penicillin, 50 g / ml streptomycin, and 20 mmol / l hepes. for compound testing, cells were plated into 96-well poly - d - lysine, white opaque microplates. compounds were solubilized in dmso, diluted in medium containing 0.1% bsa fraction v substituted for 0.5% fbs, and added to cells. after a 5-h incubation, cells were harvested in steadylite plus lysis reagent (perkin elmer, waltham, ma), and luciferase activity was measured according to the manufacturer 's instructions using an envision 2104 multilabel reader. data are expressed as a percentage of maximum stimulation induced by the glp-1 (736) amide peptide (bachem, torrance, ca). two hours before compound testing, cells were resuspended in the aforementioned medium and plated in 96-well half area, solid black microplates. cells were assayed for camp using the camp dynamic 2 kit with homogenous time - resolved fluorescence technology (cisbio, bedford, ma). fluorescence was measured according to the manufacturer 's instructions using an envision 2,104 multilabel reader. data are expressed as nm camp of the final assay solution induced by the glp-1 receptor agonists. animals were maintained in accordance with the institutional animal use and care committee of eli lilly and company and the guide for the use and care of laboratory animals by the national institutes of health. for animal treatment, compounds were solubilized in dosing solution containing 10% ethanol / solutol, 20% polyethylene glycol-400, and 70% pbs (ph 7.4). male sd rats were purchased from harlan (indianapolis, in) and group - housed three per cage in polycarbonate cages with filter tops. rats were maintained on a 12:12 h light - dark cycle (lights on at 6:00 a.m.) at 21c and received 2014 teklad global diet (harlan, indianapolis) and deionized water ad libitum. rats were fasted overnight and anesthetized with 60 mg / kg pentobarbital (lundbeck, deerfield, il) for the duration of the experiment. for glucose and compound administration, a catheter with a diameter of 0.84 mm (braintree scientific, braintree, il) was inserted into the jugular vein. for rapid blood collection, a larger catheter with 1.02-mm diameter (braintree scientific, braintree, il) was inserted into the carotid artery. blood was collected for glucose and insulin levels at time 0, 2, 4, 6, 10, and 20 min after intravenous administration of the compound which was immediately followed by an intravenous glucose bolus of 0.5 g / kg. plasma levels of glucose were determined using a hitachi 912 clinical chemistry analyzer (roche, indianapolis, in). plasma insulin was determined using an electrochemiluminescence assay (meso scale, gaithersburg, md). for the hyperglycemic clamp, sd rats were purchased from taconic with surgically implanted femoral artery and vein catheters. after an overnight fast, an initial blood sample was taken at time 0 from the arterial catheter, followed by compound administration via the venous catheter. subsequently, glucose infusion via the venous catheter was initiated, and the infusion rates were varied to maintain a blood glucose concentration of 250 mg / dl throughout the experiment. blood samples were collected every 5 min for glucose and every 10 min for insulin measurements over the course of 1 h. blood samples were collected in edta tubes. glucose concentrations were determined using an accucheck advantage glucometer (roche diagnostics, indianapolis, in), and insulin was measured using an electrochemiluminescence assay for rat insulin (meso scale, gaithersburg, md). male sd rats weighing 300 g were killed by co2 asphyxiation and subsequent cervical dislocation. the common bile duct was cannulated with a 27-gauge needle, and the pancreas was distended with 10 ml of hank 's balanced salt solution buffer ([hbss ], sigma, st. louis, mo) containing 2% bsa (applichem, boca raton, fl) and 1 mg / ml collagenase (sigma, st. islets were purified on a histopaque (histopaque-1077 : histopaque-11991 mixture, sigma, st. islets were cultured overnight in rpmi-1640 medium containing 10% fbs, 100 units / ml penicillin, and 100 g / ml streptomycin (invitrogen, carlsbad, ca). human islets from healthy donors were purchased from prodo laboratories (irvine, ca). human islets from a donor with type 2 diabetes (a 59-year - old male who died of a cerebrovascular stroke ; islets were harvested on the day of his death, cultured overnight, and shipped the next day) were obtained from asterand (detroit, mi). islet perifusion experiments were carried out in a buffered, temperature controlled perifusion system as previously described (19,20). briefly, groups of 20 islets were placed in reaction chambers and perifused with earle 's balanced salt solution (ebss) supplemented with 10 mmol / l hepes and 3.3 mmol / l glucose for 2040 min. the glucose concentration in the perifusion buffer was then raised to 16.7 mmol / l to stimulate insulin secretion. insulin secretion in static incubation experiments was measured in ebss (invitrogen, carlsbad, ca). islets were incubated in ebss containing 2.8 mmol / l glucose at 37c for 30 min. groups of three size - matched islets were then hand picked and incubated in 0.3 ml of ebss containing the indicated amount of glucose and compounds at 37c for 90 min. subsequent to the perifusion and static incubation experiments, supernatants and perifusates were collected and stored at 20c until assayed for insulin using a commercially available electrochemiluminescence assay (meso scale, gaithersburg, md). in vivo and islet data are represented as mean sem and were compared using anova followed by dunnett test. repeated measures analysis of variance was used to assess the statistical significance between time courses. since identification of small molecule activators of class b gpcrs remains largely elusive, we surmised that assessment of additional chemical space associated with several literature reports of glp-1 receptor agonists (13,17,2123) would provide a more rational group of molecules for evaluation versus high throughput screening. accordingly, a series of three - dimensional pharmacophore models was created, leading to the identification of a small (2000 compound) library gleaned from a variety of internal and commercial sources. this library was designed to assess key hypotheses associated with novel chemical space aiming to identify new glp-1 receptor ligands. compound a (fig. 1a) was discovered via screening of this library using hek293 cells stably cotransfected with the human glp-1 receptor (nm_002062) and a 3x - camp response element (cre) luciferase reporter. compound a, which is commercially available (cas registry number : 870083 - 94 - 6), increased luciferase in glp-1 receptor hek293 cells, but was inactive in parent hek293 cells. although this compound represented a viable starting point with moderate in vitro activity and some insulinotropic capability in ex vivo rat islet assays, structural modifications were introduced to improve potency to warrant in vivo studies. through examination of the various regions of the molecule, compound b (fig. 1b) with a benzyloxy substituent introduced onto the phenyl ring of compound a in the meta position, along with deletion of the chlorine atom and a change of the oxidation state of the sulfur from sulfone to sulfoxide, resulted in an improved ec50 value of 0.66 mol / l and 99% efficacy (similar data were obtained using the rat glp-1 receptor ; ec50 = 0.755 neither compound a nor compound b were active in cells expressing the glp-2, gip, pth, or glucagon receptors (fig. the chemical structures of two pyrimidine - based glp-1 receptor agonists, compound a (a) and compound b (b) are depicted. a : compound a and compound b induced glp-1 receptor - mediated signaling in hek293 cells coexpressing the human glp-1 receptor and a 3x - camp response element - luciferase reporter, but were not active in cells lacking the glp-1 receptor. in the human glp-1 receptor hek293 cells, the ec50 values for compounds a and b were 1.6 mol / l and 0.66 mol / l, respectively ; data are presented as percentages of stimulation of a maximum concentration of human glp-1. b : the competitive glp-1 receptor peptide antagonist exendin (9 - 39) blunted glp-1 peptide activity but did not reduce compound b - induced signaling. c : compound b was active in hek293 cells expressing a modified form of the glp-1 receptor lacking the nh2-terminal ecd (ecd - glp-1 receptor) ; the native glp-1 peptide had no effect in cells expressing the ecd - glp-1 receptor. d : compound b was not active in hek293 cells expressing the glucagon - like peptide-2 receptor (glp-2r), glucose - dependent insulinotropic polypeptide receptor (gip - r), glucagon receptor (gcg - r), or parathyroid hormone receptor (pth - r). key structural differences between the pyrimidine series and the quinoxalines reported by knudsen. the pyrimidines reported here require both the trifluoromethyl and sulfonyl groups for high activity and an electron deficient heterocycle, whereas the quinoxaline - based glp-1 receptor agonists require one or the other of these functional groups and a more electron - rich ring system. the optimized quinoxaline contains an additional electron donating t - butylamine function, providing an even more electron - rich heterocyclic ring and an additional hydrogen bond donor, not seen with these pyrimidines, whose h bond characteristics are considerably different both in nature and position. finally, although not to the extent reported for the quinoxalines (13), it should be noted that high concentrations of compound a or compound b display lower signaling in the in vitro assays. compound b also showed activity in rat and human islets (figs. 3b and 7a c, respectively), enabling in vivo profiling of the compound. additional details of the structure - activity relationship will be published in due course. to further evaluate compound b, assays were performed using the glp-1 receptor peptide antagonist, exendin 9 - 39 (exendin-49 - 39) (24,25). this competitive antagonist binds the glp-1 receptor ecd, but lacks the amino acids needed for interaction with extracellular loop regions to induce intracellular signaling (25,26). treatment of glp-1 receptor expressing hek293 cells with exendin 9 - 39 blunted glp-1 activity ; however, the antagonist had no inhibitory effect on compound b - induced glp-1 receptor signaling (fig. these results suggest compound b activates the glp-1 receptor via a different mechanism than native glp-1. consistent with these findings, compound b was unable to displace [i ] glp-1 binding to cell membranes expressing the human glp-1 receptor (data not shown). additional in vitro studies were performed to further evaluate the mechanistic differences between glp-1 and compound b using a modified form of the glp-1 receptor lacking the nh2-terminal ecd (deletion of amino acids 1138 ; referred to as ecd - glp-1 receptor). in line with the established requirement of the ecd for glp-1 binding and receptor activation, glp-1 (tested at concentrations as high as 300 nmol / l) was not active in cells expressing the ecd - glp-1 receptor (fig. 2c) ; however, compound b did show activation of the truncated receptor (fig. 2c), indicating the ecd is not required to induce glp-1 receptor signaling by this small molecule. based on these results, compound b likely interacts with an allosteric site proximal to or within the glp-1 receptor transmembrane domains. a similar hypothesis was proposed previously for the quinoxaline series of glp-1 receptor agonists (13,16). a : insulin concentrations from static cultures of sd rat islets incubated in media containing low glucose (2.8 mmol / l) and either glp-1 (100 nmol / l), compound b (3 mol / l), or the sulfonylurea glibenclamide (5 mol / l). b : insulin concentrations from static cultures of sd rat islets incubated in media containing high glucose (11.2 mmol / l) and either glp-1 (100 nmol / l) or various concentrations of compound b (0.310 accordingly, bona fide nonpeptide glp-1 receptor agonist compounds would be predicted to act as insulin secretagogues only in conditions of elevated glucose concentrations. to evaluate these properties, static incubations of pancreatic islets isolated from sd rats (2.8 mmol / l), neither glp-1 nor compound b increased the concentration of insulin secreted into the media after a 90-min incubation. in these conditions, however, treatment of islets with the sulfonylurea glibenclamide (glyburide) caused a fourfold increase in insulin levels (fig. mmol / l), glp-1 demonstrated insulinotropic activity, and compound b caused a robust, concentration - dependent increase in insulin secretion (fig. the ability of compound b to specifically induce camp - mediated signaling in glp-1 expressing cells, in combination with its glucose - dependent insulinotropic activity, supports the conclusion that compound b is a glp-1 receptor agonist. development of a low molecular weight glp-1 receptor agonist that is efficacious in combination with endogenous glp-1 or therapeutic glp-1 mimetics may offer advantages such as improved efficacy and flexibility with combination treatment regimens for type 2 diabetes. data on compound b indicate this molecule is a glp-1 receptor agonist that does not compete with native glp-1 and likely interacts with an allosteric site to activate the glp-1 receptor (see above). therefore, experiments were undertaken to evaluate the activity of compound b in the presence of the glp-1 peptide. for these studies, a camp assay using glp-1 receptor expressing hek293 cells and an insulin secretion assay in cultured pancreatic islets isolated from sd rats were used. coincubation of compound b with various concentrations of glp-1 induced both camp production (fig. the observation that compound b potentiates glp-1 action supports exploring further optimization of these pyrimidine - based compounds as a novel treatment for type 2 diabetes. a : combination treatment of the glp-1 peptide and compound b increases the intracellular concentration of camp in hek293 cells expressing the human glp-1 receptor. b : insulin concentrations from static cultures of sd rat islets incubated in media containing high glucose (11.2 results are expressed as mean sem, p < 0.05. to explore the in vivo insulinotropic effects of compound b, glucose - stimulated insulin secretion was measured in compound - treated sd rats undergoing an ivgtt and a hyperglycemic clamp. in both models, compound b induced insulin secretion over the time course of the glucose challenge (figs. 5 and 6). in the ivgtt, fasted - sd rats implanted with dual cannulas were anesthetized and administered via a jugular vein cannula either vehicle, glp-1 (dosed at 10 g / kg), or compound b (dosed at 10 mg / kg) immediately followed by a bolus of glucose (administered at 0.5 g / kg). blood samples were drawn from the carotid artery cannula for measurement of glucose (fig. 5b) levels at times 0, 2, 4, 6, 10, and 20 min. both glp-1 and insulin output is reported as incremental area under the curve (auc) of plasma insulin concentrations during the 20-min time course. compared with vehicle, animals dosed with compound b exhibited a threefold elevation in insulin auc, whereas glp-1 treatment increased insulin by fourfold (fig. although the ivgtt model demonstrated significant increases in circulating levels of insulin, robust changes in plasma glucose were not induced by compound b treatment. this result is likely caused by anesthesia - induced insulin resistance in this model in which typically only very potent insulinotropic molecules, such as the glp-1 peptide, induce a statistically significant change in glucose (unpublished data). therefore, we further assessed the glucodynamic effects of compound b in the more sensitive (nonanesthetized sd rats) hyperglycemic clamp model that enables evaluation of changes in insulin and glucose over a longer time course. compound b (dosed at 10 mg / kg) or vehicle was administered to animals as a single intravenous dose at the beginning of the experiment. intravenous infusion of glucose maintained blood glucose concentrations at 250 mg / dl (fig. compound b - treated animals required 20% higher glucose infusion rates to maintain this glucose level (fig. measurement of serum insulin concentrations over the next 60 min demonstrated higher insulin levels in compound b - treated animals compared with vehicle controls (fig. the insulin secretory response induced by compound b observed using both the ivgtt and hyperglycemic clamp methods is consistent with pharmacology demonstrated by peptide glp-1 receptor agonists (29) and supports the results obtained from the islet assays showing that compound b is a glucose - dependent insulin secretagogue. because oral dosing of compound b failed to show insulinotropic effects similar to those achieved by intravenous administration, additional optimization of compound b is required to improve the pharmacokinetic properties of the molecule to enable longer - term in vivo testing that will allow evaluation of efficacy, including effects on food intake and body weight, and toxicity. time course of plasma (a) glucose and (b) insulin concentrations in fasted, anesthetized animals treated with either vehicle (), glp-1 () (10 g / kg), or compound b () (dosed at 10 mg / kg) immediately before intravenous administration of a glucose bolus (0.5 g / kg). c : auc of the insulin excursion curves for vehicle versus the glp-1 or compound b treatment groups, p < 0.05. a : intravenous dosing with vehicle () or 10 mg / kg compound b () occurred immediately before intravenous infusion of glucose. b : blood glucose concentrations of 250 mg / dl were maintained throughout the experiment by varying the glucose infusion rates. c : time course of plasma insulin concentrations in fasted animals treated with either vehicle () or compound b (). d : auc2060 min of the insulin secretion for vehicle (filled bar) versus compound b - treated (open bar) animals, p < 0.05. to increase the probability of successfully developing novel glucose - dependent insulin secretagogues for the treatment of type 2 diabetes, similar to the insulinotropic effects in rodent islets, compound b stimulated glucose - dependent insulin release from human islets. static cultures of islets from a healthy donor incubated with various concentrations of compound b showed increased insulin levels (fig. further, we established a perifusion system for compound testing using human islets. in this system, reaction chambers containing islets from a healthy individual were perifused first with media containing low glucose (3.3 mmol / l) followed by perifusate containing high glucose (16.7 mmol / l). for islets treated with media containing compound b, similar experiments were performed with islets harvested from a donor who had suffered from type 2 diabetes. in these assays, treatment with compound b again caused an increase in insulin release into the media (fig. comparison of results from the perifusion studies indicates that the increase in insulin secretion from diabetic islets achieved by compound b approached 50% of that observed with high glucose treatment of islets from the healthy donor. the observed insulin secretory properties of compound b in human islets from both normal and diabetic individuals demonstrates that application of the compound selection and preclinical testing scheme used here can result in the discovery of novel glp-1 receptor low molecular weight agonists. a : insulin concentrations from static cultures of normal human islets incubated in media containing high glucose (11.2 mmol / l) and either glp-1 (100 nmol / l) or various concentrations of compound b (110 the treatments were performed for 90 min, and results are expressed as mean sem, p < 0.05. in perifusion experiments, insulin concentrations from reaction chambers containing 20 human islets from (b) normal or (c) diabetic individuals perifused with media containing either vehicle () or compound b () (3 or 10 mol / l) in low glucose (3.3 mmol / l) for 40 min followed by high glucose (16.7 mmol / l) for an additional 35 min. auc of the insulin excursion for vehicle versus compound b - treated (b) normal and (c) diabetic human islets, p < 0.05. since identification of small molecule activators of class b gpcrs remains largely elusive, we surmised that assessment of additional chemical space associated with several literature reports of glp-1 receptor agonists (13,17,2123) would provide a more rational group of molecules for evaluation versus high throughput screening. accordingly, a series of three - dimensional pharmacophore models was created, leading to the identification of a small (2000 compound) library gleaned from a variety of internal and commercial sources. this library was designed to assess key hypotheses associated with novel chemical space aiming to identify new glp-1 receptor ligands. compound a (fig. 1a) was discovered via screening of this library using hek293 cells stably cotransfected with the human glp-1 receptor (nm_002062) and a 3x - camp response element (cre) luciferase reporter. compound a, which is commercially available (cas registry number : 870083 - 94 - 6), increased luciferase in glp-1 receptor hek293 cells, but was inactive in parent hek293 cells. although this compound represented a viable starting point with moderate in vitro activity and some insulinotropic capability in ex vivo rat islet assays, structural modifications were introduced to improve potency to warrant in vivo studies. through examination of the various regions of the molecule, compound b (fig. 1b) with a benzyloxy substituent introduced onto the phenyl ring of compound a in the meta position, along with deletion of the chlorine atom and a change of the oxidation state of the sulfur from sulfone to sulfoxide, resulted in an improved ec50 value of 0.66 mol / l and 99% efficacy (similar data were obtained using the rat glp-1 receptor ; ec50 = 0.755 neither compound a nor compound b were active in cells expressing the glp-2, gip, pth, or glucagon receptors (fig. the chemical structures of two pyrimidine - based glp-1 receptor agonists, compound a (a) and compound b (b) are depicted. a : compound a and compound b induced glp-1 receptor - mediated signaling in hek293 cells coexpressing the human glp-1 receptor and a 3x - camp response element - luciferase reporter, but were not active in cells lacking the glp-1 receptor. in the human glp-1 receptor hek293 cells, the ec50 values for compounds a and b were 1.6 mol / l and 0.66 mol / l, respectively ; data are presented as percentages of stimulation of a maximum concentration of human glp-1. b : the competitive glp-1 receptor peptide antagonist exendin (9 - 39) blunted glp-1 peptide activity but did not reduce compound b - induced signaling. c : compound b was active in hek293 cells expressing a modified form of the glp-1 receptor lacking the nh2-terminal ecd (ecd - glp-1 receptor) ; the native glp-1 peptide had no effect in cells expressing the ecd - glp-1 receptor. d : compound b was not active in hek293 cells expressing the glucagon - like peptide-2 receptor (glp-2r), glucose - dependent insulinotropic polypeptide receptor (gip - r), glucagon receptor (gcg - r), or parathyroid hormone receptor (pth - r). key structural differences between the pyrimidine series and the quinoxalines reported by knudsen. the pyrimidines reported here require both the trifluoromethyl and sulfonyl groups for high activity and an electron deficient heterocycle, whereas the quinoxaline - based glp-1 receptor agonists require one or the other of these functional groups and a more electron - rich ring system. the optimized quinoxaline contains an additional electron donating t - butylamine function, providing an even more electron - rich heterocyclic ring and an additional hydrogen bond donor, not seen with these pyrimidines, whose h bond characteristics are considerably different both in nature and position. finally, although not to the extent reported for the quinoxalines (13), it should be noted that high concentrations of compound a or compound b display lower signaling in the in vitro assays. compound b also showed activity in rat and human islets (figs. 3b and 7a c, respectively), enabling in vivo profiling of the compound. additional details of the structure - activity relationship will be published in due course. to further evaluate compound b, assays were performed using the glp-1 receptor peptide antagonist, exendin 9 - 39 (exendin-49 - 39) (24,25). this competitive antagonist binds the glp-1 receptor ecd, but lacks the amino acids needed for interaction with extracellular loop regions to induce intracellular signaling (25,26). treatment of glp-1 receptor expressing hek293 cells with exendin 9 - 39 blunted glp-1 activity ; however, the antagonist had no inhibitory effect on compound b - induced glp-1 receptor signaling (fig. these results suggest compound b activates the glp-1 receptor via a different mechanism than native glp-1. consistent with these findings, compound b was unable to displace [i ] glp-1 binding to cell membranes expressing the human glp-1 receptor (data not shown). additional in vitro studies were performed to further evaluate the mechanistic differences between glp-1 and compound b using a modified form of the glp-1 receptor lacking the nh2-terminal ecd (deletion of amino acids 1138 ; referred to as ecd - glp-1 receptor). in line with the established requirement of the ecd for glp-1 binding and receptor activation, glp-1 (tested at concentrations as high as 300 nmol / l) was not active in cells expressing the ecd - glp-1 receptor (fig. 2c) ; however, compound b did show activation of the truncated receptor (fig. 2c), indicating the ecd is not required to induce glp-1 receptor signaling by this small molecule. based on these results, compound b likely interacts with an allosteric site proximal to or within the glp-1 receptor transmembrane domains. a similar hypothesis was proposed previously for the quinoxaline series of glp-1 receptor agonists (13,16). a : insulin concentrations from static cultures of sd rat islets incubated in media containing low glucose (2.8 mmol / l) and either glp-1 (100 nmol / l), compound b (3 mol / l), or the sulfonylurea glibenclamide (5 mol / l). b : insulin concentrations from static cultures of sd rat islets incubated in media containing high glucose (11.2 mmol / l) and either glp-1 (100 nmol / l) or various concentrations of compound b (0.310 glp-1 is a glucose - dependent insulinotropic peptide (27,28). accordingly, bona fide nonpeptide glp-1 receptor agonist compounds would be predicted to act as insulin secretagogues only in conditions of elevated glucose concentrations. to evaluate these properties, static incubations of pancreatic islets isolated from sd rats were used. in low glucose (2.8 mmol / l), neither glp-1 nor compound b increased the concentration of insulin secreted into the media after a 90-min incubation. in these conditions, however, treatment of islets with the sulfonylurea glibenclamide (glyburide) caused a fourfold increase in insulin levels (fig. 3a). in islet experiments using high glucose concentrations (11.2 mmol / l), glp-1 demonstrated insulinotropic activity, and compound b caused a robust, concentration - dependent increase in insulin secretion (fig. the ability of compound b to specifically induce camp - mediated signaling in glp-1 expressing cells, in combination with its glucose - dependent insulinotropic activity, supports the conclusion that compound b is a glp-1 receptor agonist. development of a low molecular weight glp-1 receptor agonist that is efficacious in combination with endogenous glp-1 or therapeutic glp-1 mimetics may offer advantages such as improved efficacy and flexibility with combination treatment regimens for type 2 diabetes. data on compound b indicate this molecule is a glp-1 receptor agonist that does not compete with native glp-1 and likely interacts with an allosteric site to activate the glp-1 receptor (see above). therefore, experiments were undertaken to evaluate the activity of compound b in the presence of the glp-1 peptide. for these studies, a camp assay using glp-1 receptor expressing hek293 cells and an insulin secretion assay in cultured pancreatic islets isolated from sd rats were used. coincubation of compound b with various concentrations of glp-1 induced both camp production (fig. the observation that compound b potentiates glp-1 action supports exploring further optimization of these pyrimidine - based compounds as a novel treatment for type 2 diabetes. a : combination treatment of the glp-1 peptide and compound b increases the intracellular concentration of camp in hek293 cells expressing the human glp-1 receptor. b : insulin concentrations from static cultures of sd rat islets incubated in media containing high glucose (11.2 mmol / l) and compound b plus increasing concentrations of glp-1. to explore the in vivo insulinotropic effects of compound b, glucose - stimulated insulin secretion was measured in compound - treated sd rats undergoing an ivgtt and a hyperglycemic clamp. in both models, compound b induced insulin secretion over the time course of the glucose challenge (figs. 5 and 6). in the ivgtt, fasted - sd rats implanted with dual cannulas were anesthetized and administered via a jugular vein cannula either vehicle, glp-1 (dosed at 10 g / kg), or compound b (dosed at 10 mg / kg) immediately followed by a bolus of glucose (administered at 0.5 g / kg). blood samples were drawn from the carotid artery cannula for measurement of glucose (fig. 5b) levels at times 0, 2, 4, 6, 10, and 20 min. both glp-1 and compound insulin output is reported as incremental area under the curve (auc) of plasma insulin concentrations during the 20-min time course. compared with vehicle, animals dosed with compound b exhibited a threefold elevation in insulin auc, whereas glp-1 treatment increased insulin by fourfold (fig. although the ivgtt model demonstrated significant increases in circulating levels of insulin, robust changes in plasma glucose were not induced by compound b treatment. this result is likely caused by anesthesia - induced insulin resistance in this model in which typically only very potent insulinotropic molecules, such as the glp-1 peptide, induce a statistically significant change in glucose (unpublished data). therefore, we further assessed the glucodynamic effects of compound b in the more sensitive (nonanesthetized sd rats) hyperglycemic clamp model that enables evaluation of changes in insulin and glucose over a longer time course. compound b (dosed at 10 mg / kg) or vehicle was administered to animals as a single intravenous dose at the beginning of the experiment. intravenous infusion of glucose maintained blood glucose concentrations at 250 mg / dl (fig. compound b - treated animals required 20% higher glucose infusion rates to maintain this glucose level (fig. 6b). measurement of serum insulin concentrations over the next 60 min demonstrated higher insulin levels in compound b - treated animals compared with vehicle controls (fig. the insulin secretory response induced by compound b observed using both the ivgtt and hyperglycemic clamp methods is consistent with pharmacology demonstrated by peptide glp-1 receptor agonists (29) and supports the results obtained from the islet assays showing that compound b is a glucose - dependent insulin secretagogue. because oral dosing of compound b failed to show insulinotropic effects similar to those achieved by intravenous administration, additional optimization of compound b is required to improve the pharmacokinetic properties of the molecule to enable longer - term in vivo testing that will allow evaluation of efficacy, including effects on food intake and body weight, and toxicity. time course of plasma (a) glucose and (b) insulin concentrations in fasted, anesthetized animals treated with either vehicle (), glp-1 () (10 g / kg), or compound b () (dosed at 10 mg / kg) immediately before intravenous administration of a glucose bolus (0.5 g / kg). c : auc of the insulin excursion curves for vehicle versus the glp-1 or compound b treatment groups, p < 0.05. a : intravenous dosing with vehicle () or 10 mg / kg compound b () occurred immediately before intravenous infusion of glucose. glucose levels measured from venous blood every 5 min are shown. b : blood glucose concentrations of 250 mg / dl were maintained throughout the experiment by varying the glucose infusion rates. c : time course of plasma insulin concentrations in fasted animals treated with either vehicle () or compound b (). d : auc2060 min of the insulin secretion for vehicle (filled bar) versus compound b - treated (open bar) animals, p < 0.05. to increase the probability of successfully developing novel glucose - dependent insulin secretagogues for the treatment of type 2 diabetes, ex vivo insulin secretion assays using human pancreatic islets are sometimes conducted. similar to the insulinotropic effects in rodent islets, compound b stimulated glucose - dependent insulin release from human islets. static cultures of islets from a healthy donor incubated with various concentrations of compound b showed increased insulin levels (fig. further, we established a perifusion system for compound testing using human islets. in this system, reaction chambers containing islets from a healthy individual were perifused first with media containing low glucose (3.3 mmol / l) followed by perifusate containing high glucose (16.7 mmol / l). for islets treated with media containing compound b, similar experiments were performed with islets harvested from a donor who had suffered from type 2 diabetes. in these assays, treatment with compound b again caused an increase in insulin release into the media (fig.. comparison of results from the perifusion studies indicates that the increase in insulin secretion from diabetic islets achieved by compound b approached 50% of that observed with high glucose treatment of islets from the healthy donor. the observed insulin secretory properties of compound b in human islets from both normal and diabetic individuals demonstrates that application of the compound selection and preclinical testing scheme used here can result in the discovery of novel glp-1 receptor low molecular weight agonists. a : insulin concentrations from static cultures of normal human islets incubated in media containing high glucose (11.2 mmol / l) and either glp-1 (100 nmol / l) or various concentrations of compound b (110 the treatments were performed for 90 min, and results are expressed as mean sem, p < 0.05. in perifusion experiments, insulin concentrations from reaction chambers containing 20 human islets from (b) normal or (c) diabetic individuals perifused with media containing either vehicle () or compound b () (3 or 10 mol / l) in low glucose (3.3 mmol / l) for 40 min followed by high glucose (16.7 mmol / l) for an additional 35 min. auc of the insulin excursion for vehicle versus compound b - treated (b) normal and (c) diabetic human islets, p < 0.05. class b gpcrs typically are activated by endocrine peptide hormones such as glp-1, gip, glucagon, pth, vip, secretin, crf, and calcitonin (79). accordingly, class b gpcrs represent some of the most attractive targets for therapeutic intervention, and this is borne out by regulatory approval of several large molecule biotherapeutics, including pth (teriparatide, forteo) for osteoporosis, exendin-4 (exenatide, byetta) and liraglutide (victoza) for type 2 diabetes, and calcitonin (calcitonin - salmon, miacalcin) for paget disease, hypercalcemia, and osteoporosis (12). unfortunately, there has been much difficulty identifying nonpeptide, low molecular weight organic molecules that activate class b gpcrs. the inability to modulate the activity of class b gpcrs by traditional small molecule approaches likely is caused by the unique structural architecture and activation mechanism used by these gpcrs. ligands to these receptors typically are 3040 amino acids in size and bind via a two - step mechanism (1012). the initial binding event is an interaction between the cooh - terminal amino acids of ligand peptides and the ecd of class b gpcrs. the second phase of receptor activation is the interaction of the nh2-terminal residues of the ligand with transmembrane domains of the receptor to induce an activated conformation (1012). it appears that the main functions of the glp-1 receptor ecd are to confer peptide selectivity and act as a high affinity binding site for the peptide ligand. this unique mechanism of activation of class b gpcrs likely has hindered conventional screening approaches for this target. recently, substantial progress was made in the generation of antagonists for several class b gpcrs, including the glucagon, pth, cgrp, and crf receptors (12,30). small molecule antagonists of class b gpcrs have been characterized as either orthosteric antagonists or negative allosteric modulators. in contrast, minimal success has been achieved in the discovery of class b small molecule agonists ; isolated examples include the discovery of small molecule agonists of the pth receptor (31), the calcitonin receptor (32,33), and the crf receptor (34). with the exception of low - nanomolar pyrazolopyridine calcitonin receptor partial agonists (33), class b gpcr agonist molecules have micromolar potencies. much activity has been expended searching for glp-1 receptor small molecule agonists, and up to this point, only two bona fide agonists have been described : low molecular weight substituted quinoxalines (1316) and the large cyclobutane derivative, boc-5 (17). boc-5 is described as an orthosteric agonist, but it likely does not have suitable physiochemical properties to be developed as an orally available glp-1 receptor agonist. the quinoxaline compounds exhibit the mechanism of action of the substituted quinoxalines appears to be analogous to compound b. both molecules exhibit agonist and positive allosteric modulator activity at the glp-1 receptor, and neither competes with glp-1 for receptor binding (13). we probed the structural determinants of compound b interaction with the glp-1 receptor using a functional glp-1 receptor variant lacking the ecd (ecd - glp-1 receptor). interestingly, we observed that compound b action is independent of the glp-1 receptor ecd, implying that compound b probably acts proximal to the transmembrane domains of the glp-1 receptor, similar to the mechanism used by canonical small molecule agonists and allosteric modulators for class a and class c gpcrs (35). further determinants of compound b interaction with the glp-1 receptor have not been fully elucidated. recent studies have defined the structure of the glp-1 peptide - bound ecd of the glp-1 receptor (36,37). however, there is little additional structural data to guide targeted design of low molecular weight agonists for the glp-1 receptor, especially with regard to understanding and possibly exploiting critical transmembrane domains to modulate signaling. computational approaches have been used to generate hypotheses around the structural determinants of peptide and small molecule binding to the juxtamembrane regions of the glp-1 receptor (38). the quinoxaline series of glp-1 receptor agonists is predicted to bind in a pocket formed by the first and second extracellular loops ; however, these predictions need to be confirmed by mutagenesis studies (38). the discovery of pyrimidine - based glp-1 receptor agonists that induce glucose - dependent insulin secretion in vitro and in vivo demonstrates that modulating class b gpcrs with low molecular weight compounds is technically feasible. however, further work is needed to improve potency and optimize pharmacokinetic properties of these molecules to enable clinical development. future studies will also focus on characterizing the allosteric binding site and ligand - mediated conformational changes induced by compound b to potentiate receptor signaling. a better understanding of the pocket and mechanism of activation will facilitate molecular modeling strategies to develop more potent small molecule glp-1 receptor agonists. | objectivethe clinical effectiveness of parenterally - administered glucagon - like peptide-1 (glp-1) mimetics to improve glucose control in patients suffering from type 2 diabetes strongly supports discovery pursuits aimed at identifying and developing orally active, small molecule glp-1 receptor agonists. the purpose of these studies was to identify and characterize novel nonpeptide agonists of the glp-1 receptor.research design and methodsscreening using cells expressing the glp-1 receptor and insulin secretion assays with rodent and human islets were used to identify novel molecules. the intravenous glucose tolerance test (ivgtt) and hyperglycemic clamp characterized the insulinotropic effects of compounds in vivo.resultsnovel low molecular weight pyrimidine - based compounds that activate the glp-1 receptor and stimulate glucose - dependent insulin secretion are described. these molecules induce glp-1 receptor - mediated camp signaling in hek293 cells expressing the glp-1 receptor and increase insulin secretion from rodent islets in a dose - dependent manner. the compounds activate glp-1 receptor signaling, both alone or in an additive fashion when combined with the endogenous glp-1 peptide ; however, these agonists do not compete with radiolabeled glp-1 in receptor - binding assays. in vivo studies using the ivgtt and the hyperglycemic clamp in sprague dawley rats demonstrate increased insulin secretion in compound - treated animals. further, perifusion assays with human islets isolated from a donor with type 2 diabetes show near - normalization of insulin secretion upon compound treatment.conclusionsthese studies characterize the insulinotropic effects of an early - stage, small molecule glp-1 receptor agonist and provide compelling evidence to support pharmaceutical optimization. |
multiple sclerosis (ms) is an inflammatory disease characterized by damage to the myelin sheath surrounding neurons in the central nervous system (cns). this damage may be progressive, or it may wax and wane with periods of relapse and remission. motor, somatosensory, visual, cognitive, and psychiatric deficits may occur in ms patients depending on the location and size of the focal demyelination in the cns. cognitive impairments may manifest in the early phases of the clinical course of ms.1 in fact, the prevalence of cognitive deficits in ms patients ranges from 43%70%.2 cognitive impairments may prevent patients from being able to perform activities of daily living. studies have shown that patients with cognitive deficits tend to avoid social activities, have higher rates of unemployment, and have difficulties in performing routine household chores. as such, the quality of life for these patients becomes further compromised as the degree of cognitive impairment increases.3 due to the limited treatment options for ms,4 it is critical to understand what agents may worsen clinical symptoms. cigarette smoking may trigger ms,5 facilitate the transformation of a clinically isolated syndrome into ms,6 increase ms relapse frequency,7 and promote progression of the disease.8 however, smoking is also known to increase cognitive performance via its effects on nicotinic acetylcholine receptors.9,10 even though it is understood that smoking affects the clinical course of ms, there are no studies that have investigated the relationship between smoking and cognitive impairment in ms patients. on the other hand, there are many studies evaluating ms patients, and the relationship between cannabis use and cognitive impairment.11,12 cigarette smoking exerts both positive and negative effects on cognition, and due to the high prevalence of cognitive impairment in ms patients, it is imperative to elucidate the effects of smoking on cognition in these patients. in this study we examined the potentially deleterious effects of heavy smoking on mentation in patients with ms. ms patients that presented to the neurology clinic at bezmialem vakf university (istanbul, turkey) were enrolled in the study once informed consent was obtained. a total of 72 consecutive patients presenting to the clinic between january 2013 and november 2013 met the inclusion criteria for this study and voluntarily agreed to participate it. inclusion criteria were that the patients meet the revised mcdonald s diagnostic criteria (2010) for a diagnosis of ms,13 fall between 1865 years old, and have at least graduated elementary school. patients with cognitive impairment due to a condition other than ms ; with a known psychiatric disorder ; taking medications with cognitive side effects including anticholinergics and benzodiazepines ; or who had received glucocorticoid treatments within the last 30 days were excluded from the study. information on the type of ms, clinical course, and duration of disease were obtained from reviewing patient charts. the extent of physical disability was measured using the expanded disability status scale (edss). smoking rate was calculated with the following formula : (number of cigarettes per day years of smoking)/20. patients that were currently smoking and smoked for at least 10 pack - years were considered heavy smokers.14 the brief repeatable battery of neuropsychological tests (brb - n) is a commonly utilized method for evaluating cognitive impairment in ms patients, with high sensitivity and specificity.15 the brb - n was administered by an experienced neuropsychologist, and the presence of cognitive impairment and the specific areas of debility were detected with this test. the subtests of the brb - n test include the selective reminding test (srt) and srt - delayed recall (srt - dr), spatial recall test (spart) and spart - delayed recall (spart - dr), symbol digit modalities test (sdmt), paced auditory serial addition test (pasat), and word list generation (wlg). patients scoring in the fifth percentile or less in at least two of these tests were considered to have cognitive impairment according to the normative data from the general turkish population.16 all statistical analyses were completed using spss version 20 (ibm corp., data that were normally distributed were analyzed with the student s t - test, and data that were not normally distributed were analyzed with the mann backward stepwise logistic regression was used to identify the factors that were statistically predictive of cognitive impairment the study protocol was reviewed and approved by the istanbul bezmialem vakf university ethics committee. informed consent documentation was collected from each patient after the research study was explained in full detail. information on the type of ms, clinical course, and duration of disease were obtained from reviewing patient charts. the extent of physical disability was measured using the expanded disability status scale (edss). smoking rate was calculated with the following formula : (number of cigarettes per day years of smoking)/20. patients that were currently smoking and smoked for at least 10 pack - years were considered heavy smokers.14 the brief repeatable battery of neuropsychological tests (brb - n) is a commonly utilized method for evaluating cognitive impairment in ms patients, with high sensitivity and specificity.15 the brb - n was administered by an experienced neuropsychologist, and the presence of cognitive impairment and the specific areas of debility were detected with this test. the subtests of the brb - n test include the selective reminding test (srt) and srt - delayed recall (srt - dr), spatial recall test (spart) and spart - delayed recall (spart - dr), symbol digit modalities test (sdmt), paced auditory serial addition test (pasat), and word list generation (wlg). patients scoring in the fifth percentile or less in at least two of these tests were considered to have cognitive impairment according to the normative data from the general turkish population.16 all statistical analyses were completed using spss version 20 (ibm corp., armonk, ny, usa). data were compared to a normal distribution using the kolmogorov data that were normally distributed were analyzed with the student s t - test, and data that were not normally distributed were analyzed with the mann backward stepwise logistic regression was used to identify the factors that were statistically predictive of cognitive impairment. the study protocol was reviewed and approved by the istanbul bezmialem vakf university ethics committee. informed consent documentation was collected from each patient after the research study was explained in full detail. a total of 72 patients were enrolled in the study, their average age (mean standard deviation) was 36.5410.29 years, and 36.1% were males. out of all patients, 80.6% had relapsing - remitting ms, 13.9% had secondary progressive ms, and 5.6% had primary progressive ms. the mean duration of having an ms diagnosis was 6.576.13 years. on average, the patients received 8.743.68 years of schooling. it was determined that 41.7% were smokers, and of these patients, 53.3% were male. out of the initial group of 72 patients, 28 patients did not meet the criteria for heavy cigarette smoking and therefore, were not included in the statistical analysis. eighteen of the excluded patients were former smokers, while ten patients were excluded due as a result of tobacco consumption of less than 10 pack - years. among the patients that were included in the study, the heavy smoking group consisted of 20 patients and the nonsmoker group included 24 patients. demographics and ms characteristics are summarized for heavy smokers (n=20) and nonsmokers (n=24) in table 1. cognitive impairment was identified in seven out of 24 nonsmokers (29.2%) and in 12 out of 20 heavy smokers (60%). despite the lack of statistically significant differences between these groups in terms of subtest scoring, cognitive impairment was significantly greater (p=0.04) in heavy smokers. in patients with cognitive impairment, the pasat (78.9%) and sdmt (63.2%) test results were shown to be the most abnormal. a logistic regression model was used to evaluate age, sex, education level, disease duration, edss score, and smoking status as independent predictors of cognitive impairment. the results demonstrate that edss and smoking status are independently associated with cognitive impairment in patients with ms (table 3). a total of 72 patients were enrolled in the study, their average age (mean standard deviation) was 36.5410.29 years, and 36.1% were males. out of all patients, 80.6% had relapsing - remitting ms, 13.9% had secondary progressive ms, and 5.6% had primary progressive ms. the mean duration of having an ms diagnosis was 6.576.13 years. on average, the patients received 8.743.68 years of schooling. it was determined that 41.7% were smokers, and of these patients, 53.3% were male. out of the initial group of 72 patients, 28 patients did not meet the criteria for heavy cigarette smoking and therefore, were not included in the statistical analysis. eighteen of the excluded patients were former smokers, while ten patients were excluded due as a result of tobacco consumption of less than 10 pack - years. among the patients that were included in the study, the heavy smoking group consisted of 20 patients and the nonsmoker group included 24 patients. demographics and ms characteristics are summarized for heavy smokers (n=20) and nonsmokers (n=24) in table 1. cognitive impairment was identified in seven out of 24 nonsmokers (29.2%) and in 12 out of 20 heavy smokers (60%). despite the lack of statistically significant differences between these groups in terms of subtest scoring, cognitive impairment was significantly greater (p=0.04) in heavy smokers. in patients with cognitive impairment, the pasat (78.9%) and sdmt (63.2%) test results were shown to be the most abnormal. a logistic regression model was used to evaluate age, sex, education level, disease duration, edss score, and smoking status as independent predictors of cognitive impairment. the results demonstrate that edss and smoking status are independently associated with cognitive impairment in patients with ms (table 3). previous studies have identified both the positive17,18 and negative effects19,20 of smoking on the cognitive function. we demonstrated that cognitive impairment is significantly higher in ms patients that are heavy smokers. our data are supported by other studies that have shown that smoking worsens ms symptoms.21,22 however, this study is the first to report the effects of smoking on cognition in ms patients. in the 72 ms patients that participated in this study, it was found that 41.7% smoked, which is higher than the general turkish population at 27% according to the turkish statistical institute (turkstat).23 our results contradict those of friend as they reported lower smoking rates in the sample of ms patients that they studied. the high number of smokers in our study may be due to the small patient sample size and insufficient public health education regarding smoking in that area of the country. the prevalence of cognitive impairment ranges between 43%70% in ms patients according to a previous study, and these deficits in cognition impact quality of life and employability.2 memory is most often affected and the quantity of patients that experience memory and learning problems are between 40%60%.24 in our study, there were no statistically significant differences between the battery of cognitive subtests. yet the testing demonstrated that the greatest deficits were in the pasat and sdmt, which demonstrated cognitive impairments in 78.9% and 63.2% of the patients, respectively. these two tests are specifically utilized to assess working memory and how well individuals process information. our cognitive testing results are consistent with previous literature.25 the logistic regression analysis demonstrated that smoking status and edss scores are statistically significant predictors of cognitive impairment. there was a sex difference between heavy smokers and nonsmokers, but this discrepancy was not statistically significant. this difference might be due to fact that there is a higher proportion of male smokers as opposed to female smokers in the general population (approximately 3:1), and this is likely reflected in our ms patient sample.23 additionally, previous studies have reported that male ms patients have greater cognitive impairments than females,26 but in a recent extensive study, it was found that sex is not associated with cognitive impairment.27 according to our results, cognitive impairment was found to be higher in heavy smokers as compared to nonsmokers among ms patients. the agonistic effects of nicotine on cholinergic receptors are thought to contribute to cholinergic dysfunction observed in patients with cognitive deficits.10 moreover, the risk of developing cognitive impairments increases in smokers in cohort studies. in a meta - analysis of 19 prospective studies, anstey reported that the risk of developing dementia in smokers was 70% higher than that of nonsmokers. even though it has been reported that nicotine has positive effects on cognition, the adverse effects of chronic smoking on cognition might be related to the high proportion of substances in the tar besides nicotine. inflammatory changes induced by tar substances on cerebral artery endothelial surfaces in addition to the chronic exposure to carbon monoxide may lead to detrimental effects in cns neurons over the long - term. in fact, in scandinavian countries where moist snuff use is common, the risk of ms was higher in smokers as opposed to moist snuff users. blood nicotine levels in moist snuff users are similar or higher in smokers, and their higher nicotine levels reportedly decrease ms risk.29,30 this suggests that cerebral tissue inflammation may arise from tar substances in cigarettes. if pure nicotine and cigarette smoke were compared in terms of their effects to cause cognitive impairments in an experimental setting, and nicotine is found to be beneficial for cognition, then nicotine may be considered for treating ms patients with cognitive impairments in the form of a patch or gum. moreover, ms patients would be instructed to avoid smoking in order to reduce exposure to tar substances. there are significant limitations to the present study including the small sample size, the lack of a healthy control group, and reliance on patient self - reports concerning the details of tobacco consumption. our study demonstrated that heavy cigarette smoking negatively affected cognition in ms patients. in the future, we recommend that further studies are performed comparing cigarette smokers with moist snuff users in order to determine whether chronic nicotine exposure and/or cigarette tar substances contribute to cognitive impairment in ms patients. nevertheless, smoking is a risk factor for the development of ms and cognitive deficits, and it is imperative that clinicians increase patient awareness regarding these risks. | purposealthough smoking is known to cause various symptoms in multiple sclerosis (ms) patients, there have been no reports regarding the relationship between smoking and cognitive impairment in ms. studying the effects of cigarette smoking in ms patients is imperative as there is a high prevalence of cognitive impairment in ms patients. in this study we examined the potentially deleterious effects of heavy smoking on mentation of patients with ms.patients and methodsms patients receiving care at the neurology clinic at bezmialem vakf university, between the ages of 1865 years who have at least graduated elementary school were included in the study. the brief repeatable battery of neuropsychological tests (brb - n) is a commonly used method to assess cognitive function in ms patients and was utilized in our study. patients that smoked for at least 10 pack - years were considered heavy smokers.resultsall the patients were stratified into two groups : heavy smokers (n=20) and nonsmokers (n=24). for heavy smokers, their cognitive functioning was more impaired than that of nonsmokers (p=0.04, 2=4.227). for patients with cognitive impairment, 78.9% of the paced auditory serial addition test and 63.2% of the symbol digit modalities test scores were found to be lower.conclusionprevious reports have suggested that smoking increases the frequency of relapse among individuals with relapsing - remitting ms and accelerates disease progression in patients with progressive ms. according to the results of our study, heavy smokers had increased cognitive impairment when compared to nonsmokers. extensive studies are necessary to further elucidate the relationship between smoking and cognitive impairment in ms patients. |
glomerular disease, characterized by focal and segmental glomerulosclerosis histology (fsgs), is a challenging disease to treat due to its frequent relapsing unremitting course and high rate of progression to end - stage renal disease (esrd). for unclear reasons, fsgs has a rising incidence, now becoming a common cause of glomerular disease in both children and adults worldwide. although only a minority of those affected by fsgs have a family history of this lesion, the study of hereditary forms has helped inform our understanding of the molecular pathogenesis of fsgs. mutations in actn4, trpc6 and cd2ap are all rare causes of fsgs, although never quantified in the literature. in contrast, several recent studies suggest that mutations in the inf2 gene account for a significant proportion of hereditary cases. inf2 belongs to the formin family, a group of heterogeneous actin binding proteins that regulate a variety of cytoskeleton - dependent cellular processes. moreover, inf2 has been implicated in individuals with charcot - marie - tooth disease who manifest fsgs as part of this syndrome. we previously reported inf2 as a cause of autosomal dominant fsgs in 11 of 93 families screened. initial screening of the entire gene revealed disease - causing mutations only in exons 2 to 4. in this study, we expand on our initial report by mutational analysis of the dna sequence encoding the diaphanous inhibitory domain (did) of inf2 in a total of 215 probands from autosomal dominant fsgs families and also in 281 individuals with apparent sporadic disease. known autosomal dominant fsgs genes including actn4, trpc6 and cd2ap were also screened in 213 probands for comparison. inf2 exons 2, 3, 4 and 5 were sequenced by sanger method in the dna belonging to 215 probands from autosomal dominant fsgs families and 281 sporadic cases in order to evaluate variation in the did domain of the gene. given the absence of mutations detected outside of this domain based on our own experience and other published reports, we restricted mutational screening to these exons. thirteen missense variants in 20 families that segregated with disease were identified, thereby explaining disease in 9% of our cohort with hereditary proteinuric renal disease (tables 1 and 2). individuals whose clinical status was defined as indeterminate given their young age were also found to have the mutations in some instances. we also now include sporadic cases of fsgs and identify mutations in 2 individuals (tables 1 and 3). scores from polyphen-2 software analysis (http://genetics.bwh.harvard.edu/pph2) to predict the functional effects of missense inf2 variants ranged from 0.789 to 1.000, predicting that inf2 variants were possibly or probably damaging. no inf2 variants were present in any of the 10800 control chromosomes assayed or referenced in dbsnp, 1000 genomes project or in the national heart, lung and blood institute s exome sequencing project. some of the mutations identified in our cohort have been described before, whereas others are novel (tables 2 and 3). none of these families are known to be related and this mutation has been described by other groups as well. mutations in the arginine at the 214 position are also frequently seen in our cohort and others ; two of our families have an arginine to histidine mutation and one family has an arginine to cysteine mutation. finally, two families share the p.s186p mutation but are not known to be closely related. though we believe that there are certain hotspots for mutations, an alternative explanation is that these mutations could have been passed from a common ancestor. however, in family fg - jn, with the recurrent mutation p.r218q, the mutation appears to have arisen de novo in an apparent founder individual within the pedigree. we do not have this individual s dna sample but several of his unaffected siblings share the haplotype on which the mutation is found in later generations (data not shown). these unaffected siblings do not harbor the mutation thus suggesting that their affected sibling is the founder. our clinical data suggests that affected families are predominantly caucasian, though this may reflect bias in our cohort. affected individuals who have had a kidney biopsy generally show focal segmental glomerulosclerosis, usually of the not otherwise specified variant but collapsing in one instance, on histology. affected individuals generally develop disease during adolescence or early adulthood, which frequently leads to end - stage renal disease in the third or fourth decades of life (table 4). ages of onset for renal disease and esrd ranged from 8 to 72 years and 13 to 67 years, respectively. most of the families were moderately sized, with 2 to 19 affected individuals per family. disease penetrance is variable. within families, there are rare individuals who harbor the variant but remain clinically unaffected into their sixth and seventh decades of life. urine screening has revealed microalbumin ratios > 250mg / g creatinine in some of these asymptomatic individuals. of note, one affected female individual from family fs - v with the p.l81p variant developed motor weakness but the cause was unclear. she was diagnosed with fsgs at the age of 15 and developed esrd at the age of 30. in light of the recent publication linking charcot - marie - tooth (cmt) to inf2 mutations the inf2 mutations described in individuals with cmt disease with associated fsgs do not overlap with individuals with familial fsgs (figure 2). the underlying mechanism causing individuals with inf2 mutations to develop kidney disease and/or neurological manifestations as part of cmt disease still remain unknown. of one was a mutation in exon 2 leading to a serine to proline change at the 129 position, which was not found in control chromosomes. the other mutation was a heterozygous in - frame 9 base pair deletion (c.305_314deltcagctgcg, p.del102_104vsc) in exon 2. this individual was diagnosed with primary fsgs on biopsy but also has a long standing history of sarcoidosis involving the skin. four unaffected individuals from this family, including both parents, were also sequenced and not found to have this variant thereby indicating it to be de novo. examination of the burden of coding variants in the entire inf2 gene documented in the 1000 genomes project and the exome sequencing project is telling in that the ratio of non - synonymous (ns) to synonymous (s) variants in exons 6 to 22 is higher than the ratio for exons 2 to 5 in both datasets. in the 1000 genomes project, this ratio is 36/20 for exons 6 to 22 and 1/9 for exons 2 to 5 (p=0.002 by right - tailed fisher exact test). similarly, in the exomes sequencing project, the ratios are 57/38 versus 4/9, in exons 6 to 22 and exons 2 to 5, respectively (p=0.045 by right - tailed fisher exact test). this suggests that coding variants in exons 2 to 5 of inf2 are less tolerated than coding variants in exons 6 to 22, resulting in a higher rate of purifying selection in the first coding exons. only the first 10 exons of the actn4 gene were sequenced by sanger method given that all disease - causing mutations have been localized to this part of the gene. novel missense variants in actn4 and trpc6 that segregated were identified in 7 and 5 or 3% and 2% of families, respectively (supplementary tables 1 and 2). these variants were not present in any of the 10800 control chromosomes assayed or referenced in dbsnp, 1000 genomes project or in the national heart, lung and blood institute s exome sequencing project. the most recent gene to be identified as causing a form of autosomal - dominant fsgs is inverted formin 2 (inf2). mutations in this gene have been demonstrated to be a major cause of autosomal dominant fsgs, previously reported to account for up to 16% to 17% of familial cases. we report a lower proportion of inf2-related disease, 9%, in a larger familial cohort than has been previously tested. we also show it to be a more common, albeit still minor, monogenic cause of fsgs when compared to other known gene culprits including actn4, trpc6, and cd2ap. conversely, similar to other reports, our results indicate that mutations in inf2 are rarely found in sporadic cases of fsgs, with only 2 identified cases in our cohort of 281 sporadic individuals. identified variants in inf2, actn4, trpc6, and cd2ap were ultimately determined to be disease - causing if they a) segregated with disease b) were not present in control chromosomes in dbsnp, 1000 genomes project and the exome sequencing project and 3) predicted to be damaging by in silico analysis. for each mutation, every affected individual tested for whom we had a dna sample harbored the variant. for inf2, there were occasional family members who carried the family variant and had asymptomatic proteinuria or indeterminate microalbuminuria (25250 mg / g creatinine). many of these individuals are children and may not have manifested clinical disease yet, however, there are rare adults with disease - associated mutations who do not have clinical kidney disease. we include in this report a list of all inf2, actn4, and trpc6 mutations found in screening our expanded cohort of autosomal dominant families with fsgs, including those published earlier as part of the initial discovery of these genes. most of the mutations are missense with only one structural variant in a sporadic case a finding that is not surprising given the significantly higher frequency of missense variants in the human genome. we now exclude two missense variants previously reported as disease - causing, inf2 p.a13 t and trpc6 p.n143s as both have now been discovered in controls in the exome sequencing project (exome variant server, nhlbi exome sequencing project (esp), seattle, wa (url : http://evs.gs.washington.edu/evs/) [date (january, 2011) accessed ]). the recessive gene, nphs2 or podocin, has also been previously sequenced in the sporadic cohort given that it has been found in sporadic cases of fsgs, though usually in children. the new inf2 families we have identified since our first report of inf2 mutations have a similar phenotype. our current data continue to support the trend that individuals with inf2-related disease typically present in the second to fourth decade of life with onset of renal failure in the third decade. however, there continues to be wide inter - family and intra - family variability for ages at which disease onset and esrd occurs. there were several cases of affected children manifesting proteinuria and esrd in adolescence, suggesting that inf2 should be considered in the pediatric population as well. previous work on genes identified as causing familial forms of nephrotic syndrome and/or fsgs such as actn4, trpc6, and cd2ap highlight the importance of the podocyte slit diaphragm and actin cytoskeleton in the pathogenesis of disease. inf2 is also highly expressed in the podocyte and belongs to the formin family, a group of heterogeneous actin binding proteins that regulate a variety of cytoskeleton - dependent cellular processes. our work on the initial inf2 discovery families showed that all mutations were contained within the diaphanous inhibitory domain (did), suggesting an important role for this domain in its signaling pathway (figure 2). furthermore, the burden of coding variants in the entire inf2 gene documented in the 1000 genomes project and the exome sequencing project is weighted to outside of the did, suggesting that coding variants in exons 2 to 5 of inf2 are less tolerated than coding variants in exons 6 to 22. the inf2 protein exists in 3 isoforms, 2 of which are long forms and 1 of which is a short form lacking the c - terminal portion downstream from the did. thus, we hypothesize that there is something inherently more biologically relevant about the short splice variant (nm_032714) of inf2 compared to the long splice variants (nm_022489 and nm_001031714). given that only inf2 exons 2 to 5 were sequenced in this study, it is possible that mutations outside of the did have been missed. however, previous studies sequencing the entire inf2 gene have localized mutations to this domain only, suggesting that mutations outside of the did domain are relatively infrequent if they exist at all. inf2 s depolymerization activity is regulated via an autoinhibitory interaction of its did with its diaphanous autoregulatory domain (dad). subsequent work has shown that inf2-did interacts with the dad of the mammalian diaphanous - related formins (mdias), which are a family of rho effectors that also regulate actin dynamics. inf2 bearing the p.e184k, p.s186p and p.r218q mutations decreased the binding affinity of inf2 did with the mdia dad. we hypothesize that mutations within the did domain of inf2 may interrupt the binding conformation of inf2 to the dad domains of itself and the mdias leading to altered cytoskeletal rearrangements. to date, all fsgs - associated inf2 mutations alter highly conserved residues within the did domain. familial studies have yielded significant insight into our current understanding of fsgs. despite the fact that mutations in inf2 do not contribute significantly to sporadic disease, they are a relatively common cause of familial fsgs. the lessons learned from the biological study of inf2 and disease - causing inf2 mutations are likely to be relevant to the broader patient population with sporadic disease. though the primary insult leading to disease may be different, the downstream effects leading to altered actin dynamics and glomerulosclerosis may reveal common targets for therapy. thus, mutations in inf2 explain a greater, albeit still minor, proportion of hereditary fsgs compared to actn4, trpc6 and cd2ap while not contributing significantly to sporadic disease. inf2-related disease has variable penetrance, presenting in the second to fourth decades of life, though childhood onset has also been documented. inf2 mutations cluster in exons 2 to 4, representing the did domain, and highlights the importance of this domain and its ability to regulate actin assembly and disassembly in the podocyte. a total of 912 individuals belonging to 215 families and 281 sporadic cases of fsgs were included in this study. affected status was defined as having either a reported history of nephrotic syndrome or biopsy - proven fsgs, having documented proteinuria with urine microalbumin > 250mg / g creatinine in a family with at least one case of documented fsgs or nephrotic syndrome. we obtained blood, sputum, or isolated dna and clinical information after receiving informed consent from participants in accordance with the institutional review board at the beth israel deaconess medical center and brigham and women s hospital. genomic dna was extracted from blood or sputum samples using standard procedures. for inf2, mutational screening sanger sequencing was performed using big dye terminator cycle sequencing kit and analyzed with an abi prism 3130 xl dna analyzer. sequence chromatograms were analyzed using the sequencher software (gene codes, ann arbor, mi). a shotgun sequencing library for each sample was constructed and captured using either the nimblegen 2.1 m human exome kit or the nimblegen seqcap ez exome v2. the potential pathogenicity of variants were assessed in silico using polyphen-2 software analysis (http://genetics / bwh.harvard.edu / pph2). variants were compared against dbsnp 134 (ftp://ftp.ncbi.nih.gov/snp/organisms/human_9606/vcf/v4.0/00-all.vcf.gz), 1,000 genomes project (ftp://ftp-trace.ncbi.nih.gov/1000genomes/ftp/release/20110521/all.wgs.phase1_intergrated_calls.20101123.snps_indels_svs.sites.vcf.gz) and the exome sequencing project (exome variant server, nhlbi exome sequencing project (esp), seattle, wa (url : http://evs.gs.washington.edu/evs/) [(january 2012) accessed ]). where a novel variant was identified in a family, all available affected and unaffected family members were sequenced to investigate if the variant segregated with disease. if any affected individual of a family did not harbor the variant of interest, it was excluded as disease - causing. three - dimensional models of the human inf2 (amino acids 1 through 234) were designed using the phyre threading program based on primary sequence conservation and known protein structures. the model was manipulated using the program pymol (delano, w.l. the pymol molecular graphics system 2002). a total of 912 individuals belonging to 215 families and 281 sporadic cases of fsgs were included in this study. affected status was defined as having either a reported history of nephrotic syndrome or biopsy - proven fsgs, having documented proteinuria with urine microalbumin > 250mg / g creatinine in a family with at least one case of documented fsgs or nephrotic syndrome. we obtained blood, sputum, or isolated dna and clinical information after receiving informed consent from participants in accordance with the institutional review board at the beth israel deaconess medical center and brigham and women s hospital. genomic dna was extracted from blood or sputum samples using standard procedures. for inf2, mutational screening sanger sequencing was performed using big dye terminator cycle sequencing kit and analyzed with an abi prism 3130 xl dna analyzer. sequence chromatograms were analyzed using the sequencher software (gene codes, ann arbor, mi). a shotgun sequencing library for each sample was constructed and captured using either the nimblegen 2.1 m human exome kit or the nimblegen seqcap ez exome v2. the potential pathogenicity of variants were assessed in silico using polyphen-2 software analysis (http://genetics / bwh.harvard.edu / pph2). variants were compared against dbsnp 134 (ftp://ftp.ncbi.nih.gov/snp/organisms/human_9606/vcf/v4.0/00-all.vcf.gz), 1,000 genomes project (ftp://ftp-trace.ncbi.nih.gov/1000genomes/ftp/release/20110521/all.wgs.phase1_intergrated_calls.20101123.snps_indels_svs.sites.vcf.gz) and the exome sequencing project (exome variant server, nhlbi exome sequencing project (esp), seattle, wa (url : http://evs.gs.washington.edu/evs/) [(january 2012) accessed ]). where a novel variant was identified in a family, all available affected and unaffected family members were sequenced to investigate if the variant segregated with disease. if any affected individual of a family did not harbor the variant of interest, it was excluded as disease - causing. three - dimensional models of the human inf2 (amino acids 1 through 234) were designed using the phyre threading program based on primary sequence conservation and known protein structures. the model was manipulated using the program pymol (delano, w.l. the pymol molecular graphics system 2002). | mutations in the inverted formin 2 gene (inf2) have recently been identified as the most common cause of autosomal dominant focal and segmental glomerulosclerosis (fsgs). in order to quantify the contribution of various genes contributing to fsgs, we sequenced inf2 where all mutations have previously been described (exons 2 to 5) in a total of 215 probands and 281 sporadic individuals with fsgs, along with other known genes accounting for autosomal dominant fsgs (actn4, trpc6 and cd2ap) in 213 probands. variants were classified as disease - causing if they altered the amino acid sequence, were not found in control samples, and in families segregated with disease. mutations in inf2 were found in a total of 20 of the 215 families (including those previously reported) in our cohort of autosomal dominant familial nephrotic syndrome or fsgs, thereby explaining disease in 9 percent. inf2 mutations were found in 2 of 281 individuals with sporadic fsgs. in contrast, actn4 and trpc6-related disease accounted for 3 and 2 percent of our familial cohort, respectively. inf2-related disease showed variable penetrance, with onset of disease ranging widely from childhood to adulthood and commonly leading to esrd in the third and fourth decade of life. thus, mutations in inf2 are more common, although still minor, monogenic cause of familial fsgs when compared to other known autosomal dominant genes associated with fsgs. |
a simulation for each dipeptide (in their zwitterionic form) was set up using the gromacs molecular dynamics package. a cubic box with 300 dipeptides, placed randomly with a minimum distance of 3 between them, was solvated in standard martini cg water (four water molecules per bead) to a final concentration of 0.4 m. a berendsen thermostat and barostat were used to keep the temperature at 303 k and pressure at 1 bar, respectively. bond lengths in aromatic side chains and the backbone side - chain bonds in i, v, and y were constrained using the lincs algorithm. all boxes were energy minimized using the steepest descent integrator and then equilibrated for 4 10 time steps of 25 fs. the extended ff simulation was performed in duplicate, and reported tube sizes were averaged over 10 different positions in either simulation. for all experimentally studied dipeptides, a similar simulation over 40 10 steps was performed to study the effect of a longer simulation on the ap. the total screening simulation time equates to 100 ns, but because of the smoothness of the cg potentials, this roughly equates to an effective 400 ns of atomistic simulation time. throughout this letter, all times refer to the simulation time speeded up by this factor of 4. the size of our systems, the time scales required, and the number of systems that are assessed in a virtual screen excludes the possibility of performing these md simulations using all - atom models on modest computing resources. the complete, 400 ns simulation for a single dipeptide system described above can be carried out in ca. 4 h on a four - core 2.6 ghz opteron compute node. more details of the simulation can be found in the supporting information. | several short peptide sequences are known to self - assemble into supramolecular nanostructures with interesting properties. in this study, coarse - grained molecular dynamics is employed to rapidly screen all 400 dipeptide combinations and predict their ability to aggregate as a potential precursor to their self - assembly. the simulation protocol and scoring method proposed allows a rapid determination of whether a given peptide sequence is likely to aggregate (an indicator for the ability to self - assemble) under aqueous conditions. systems that show strong aggregation tendencies in the initial screening are selected for longer simulations, which result in good agreement with the known self - assembly or aggregation of dipeptides reported in the literature. our extended simulations of the diphenylalanine system show that the coarse - grain model is able to reproduce salient features of nanoscale systems and provide insight into the self - assembly process for this system. |
alzheimer 's disease (ad) is a progressive brain disease affecting the elderly population, causing problems with memory, thought, and behavior. approximately 25% of ad cases are familial (fad), caused by autosomal dominant mutations in amyloid precursor protein (app) or the presenilin (ps1, ps2) genes [13 ], while the majority of sporadic ad cases are not associated with any known mutations. the hallmarks of alzheimer disease include intraneuronal neurofibrillary tangles, consisting of the hyperphosphorylated microtubule - associated protein tau and extracellular deposits of filaments of 42-residue amyloid (a) peptide [4, 5 ]. a is the product of sequential cleavage of app by - and -secretases [7, 8 ]. nonharmful app cellular processing by - and -secretases results in a short, highly soluble, nonamylogenic p3 peptide. in alternative amyloidogenic processing, app is hydrolyzed by - and -secretases, and three possible peptides (a40, a42, a43) can be generated. variability of the cleavage site of -secretase is associated with mutations in the ps1 and ps2 genes. a peptides are secreted from the presynaptic terminal into the extracellular matrix, where fibrillary a deposits are formed outside of neurons. some evidences suggest that the a aggregates are the critical factor which triggers a complex pathological cascade leading to neurodegeneration. all strategies to lower brain a42 levels should be therapeutically beneficial in ad treatment. given that bace1 is the initiating enzyme in a generation, it is considered a prime target for drug in ad for reducing cerebral a levels [1315 ]. rna interference (rnai) is an eukaryotic regulatory mechanism that uses double - stranded rna (dsrna) for induction of posttranscriptional gene silencing by the sequence - specific hydrolysis of homologous mrna [16, 17 ]. rnai has already been proposed for therapy of neurodegenerative diseases, including amyotrophic lateral sclerosis (als), spinocerebellar ataxia (sca), huntington 's disease, and alzheimer 's disease [2123 ]. reduced the cleavage of app at the beta site, lowered amyloid burden, and achieved amelioration of dendritic and synaptic pathology in the hippocampus of tested animals. other bace1 silencing studies, performed in vitro in primary neurons derived from app - transgenic mice, resulted in reduced production of app fragments, ctfs and a. the present studies concern optimization of rnai for effective silencing of overexpressed and endogenous bace1 protein in the human / mouse / rat cell cultures. for that purpose we used original sequences of sirnas coding synthetic sirna duplexes as well as shrna - encoding plasmids and lentiviral vector. moreover, we analyzed the effects of the use of bace1-specific sirnas and, in consequence, bace1 silencing on the expression of selected genes involved, for example, in adult neurogenesis. the synthesis of rna oligonucleotides was performed according to the routine phosphoramidite approach, using lca cpg glass support and commercially available nucleoside phosphoramidites (glen research). oligonucleotide synthesis was performed with an applied biosystems 394 instrument under the conditions recommended by the manufacturer. assembly of sirna duplexes was performed by mixing the equimolar amounts of complementary sense and antisense oligoribonucleotides in pbs buffer, heating at 96c for 2 minutes, followed by slow (2 hours) cooling to room temperature. japan) were generated by annealing two complementary 62-mer oligonucleotides containing (i) a 21 nucleotide (nt) sense strand and 21 nt antisense strand separated by loop, (ii) a stretch of five thymidines as the pol iii promoter termination signal, and (iii) both sides of the insert flanked by bspmi restriction site. additionally, the use of the following loop sequences was explored : gtgtgctgtcc, ttcaagaga, cttcctgtca, and tagtgaagccacagatgta. hela (human, cervical carcinoma) cells were cultured in rpmi 1640 medium (gibco, brl, paisley) supplemented with 10% heat - inactivated fetal bovine serum (fbs) (gibco, brl, paisley), 100 u / ml penicillin, and 100 g / ml streptomycin (polfa) at 37c and 5% co2. sh - sy5y (human, caucasian, bone marrow neuroblastoma) cells were cultured in 50% f12 nutrient mixture (ham) medium (gibco, brl, paisley)/50% mem (gibco, brl, paisley), supplemented with 15% fbs and antibiotics (100 mg / ml streptomycin and 100 u / ml penicillin). hek293 cells (human, embryonic kidney) and m15 cells (mouse, mesonephric epithelium) were cultured in dulbecco 's mem (sigma - aldrich co., saint louis, mo), supplemented with 10% fbs and antibiotics at 37c and 5% co2. before transfection transfections were performed using lipofectamine 2000 (invitrogen) at a 2 : 1 ratio and appropriate sirnas or plasmids encoding shrna were added. for dual fluorescence assay, hela cells were cotransfected with plasmid dna pdsred2-n1, 15 ng / well (bd biosciences) and p - bace - gfp, 70 ng / well, provided by dr. weihong song (the university of british columbia, vancouver, canada), and with sirna (0.15 nm final concentrations) or plasmids (psilencer - shrna / pcpurhu6-shrna 30 ng / well) dissolved in opti - mem medium (50 l / well, gibco). the cells were incubated for 5 - 6 hours and then medium with transfection mixture was replaced with the fresh, culturing medium with antibiotics. after 48-hour incubation at 37c in atmosphere of 5% co2, the cells were washed three times with phosphate saline buffer (pbs) and lysed overnight with mixture of np-40 buffer (150 mm nacl, 1% igepal, 50 mm tris - hcl (ph 7), 1 mm pmsf and pbs (ratio 1 : 3) at 37c). cell lysates were used for fluorescence determination by a dual fluorescence assay, as described previously. shortly, fluorescence values of enhanced green fluorescent protein (egfp) and red fluorescent protein (rfp) were measured using a synergy ht reader (bio - tek) ; data quantification was performed using kc4 software. excitation and emission wavelengths were as follows : gfp ex = 485/20 nm and em = 528/20 nm ; rfp ex = 530/25 nm and em = 590/30 nm. the sirna activity was calculated as the ratio of gfp to rfp fluorescence values, averaged over eight repetitions. the relative level of fluorescence (gfp / rfp) in control cells (transfected with pbace - gfp, pdsred2-n1 and control s-0 sirna) was taken as the reference (100%). hek293, m15, sh - sy5y cells were transfected with plasmids encoding shrna expression cassettes using lipofectamine 2000 (invitrogen) according to the manufacturer 's protocol. the cells were collected 36 hours after transfection, lysed with tripure isolation reagent (roche applied science), and total rna was extracted and analyzed by rt - pcr. for a single reaction, 1 g of total rna was used as a template. primers of the following sequences : for bace1 (h / m / r) : forward (633652) tgtggagatggtggacaacc, reverse (993 - 1012), atctcagcataggccagccc ; for gapdh (h) : forward gagtcaacggatttggtcgt, reverse ttgattttggagggatctcg ; for gapdh (m / r) : forward gtgtgaacggatttggccgt, gapdh (m) reverse ttgatgttagtggggtctcg, gapdh (r) reverse ttgatgttagcgggatctcg were synthesized in house. commercially available primers were used for rt - pcr amplification of genes listed in table 2. the reverse transcription and pcr amplification reactions were performed using onestep rt - pcr kit (qiagen). cell lysates obtained by tripure isolation reagent (roche applied science) were used for preparation of total protein fraction, according to manufacturer 's protocol. protein samples (20 g for each lane) were separated by 10% sds - page and semi - dry electroblotted to immobilon p pvdf membrane (millipore corp., mass, usa). rabbit polyclonal anti - bace1 (santa cruz biotechnology inc.) in dilution 1 : 300 and rabbit polyclonal anti--actin (abcam) in dilution 1 : 5000 were used as primary antibodies. goat antirabbit igg conjugated to alkaline phosphatase (zymed, san francisco) in dilution 1 : 5000 was used. bound antibodies were visualized by reaction of alkaline phosphatase with chemiluminescence substrate (millipore corp.) at the visualization system (g - box, syngene). 293 t cells were cultured in 10 cm dish in iscove 's modified dulbecco 's medium (gibco / invitrogen), supplemented with 1% l - glutamine, 10% heat - inactivated fbs (sigma) and 1% antibiotics (gibco / invitrogen). the tuhc pcsc - sp - pw - egfp vector (20 g), coding for the shrna sequence, and helper vectors, pmdl (12 g), rev (6 g), and vsvg (8 g), were cotransfected into 293 t cells using a calcium - phosphate method [33, 34 ]. 48 and 72 hours after transfection, culture medium was collected, pooled together, filtered, and concentrated by ultracentrifugation. virus titers were determined by transduction of 293 t cells and enhanced gfp expression visualization using fluorescence microscopy. hcn a94 cells (adult rat hippocampal neural stem cells) were cultured as described. the day before transduction, cells were passaged into 6 well plates. then, the cells were transduced with appropriate recombinant lentiviruses : lv - si-5, lv - si-6, and control lv - egfp. after infection, the hcn a94 cells were cultured in conditions specific for neuronal differentiation : in f12 media containing 1% n-2 supplement (gibco brl, paisley) with 1 m retinoic acid (ra) and 5 m forskolin (sigma). four days after infection, level of mrna of the screened proteins were determined by rt - pcr. several target sites in human / mouse / rat (h / m / r) bace1 genes were selected for sirna duplexes using available tools [3639 ]. the sirna duplexes used had the typical structure of 19-base pairs (bp) fully complementary duplex with 2-nucleotide (nt) overhangs at each 3 end, typically two thymidine units (table 1). all rna strands were synthesized in house and their structures and purity were uniformly confirmed by maldi - tof ms and page electrophoresis, respectively, (data not shown). the shrna encoding sequences were designed to express rna transcripts with a hairpin structure of a 19-bp stem with a 9-nt loop : ttcaagaga (psilencer 2.0-u6), or a 21-bp stem with an 11-nt loop : gtgtgctgtcc (pcpurhu6). to investigate the silencing activity of sirna duplexes or shrna - expressing vectors we optimized a dual fluorescence reporter system (dfa) [30, 40 ]. the system is based on measurement of the relative fluorescence intensity of enhanced green fluorescent protein (egfp, expressed from fusion p - bace - gfp plasmid) and coral (discosoma spp.) derived red fluorescent protein (rfp), expressed in hela cells from exogenously delivered plasmids. localization of fluorescent proteins is shown in figure 1(a), and interestingly bace1-egfp fusion protein localizes in the cytoplasmatic membranes, probably in the golgi apparatus and/or er compartments, while rfp protein is present in the nucleus and cytoplasm with no localization in the membrane. all duplexes used in the experiments mediated the human target gene silencing to varying extent (see table 1), depending on the sirna concentration and target site. variability of sirna potency is most likely the result of changed thermodynamic properties of the 5- and 3-ends of the duplexes as well as secondary structure of target mrna. representative microscopic images of dfa control cells (transfected with pdsred2-n1 and p - bace - gfp plasmids) and cells additionally transfected with si-2 and si-4 duplexes are shown at figure 1(b). silencing activities of sirnas or shrna - encoded plasmids directed toward endogenous bace1 mrna were screened in human (hek293 and sh - sy5y) and mouse (m15) cell lines by semiquantitative rt - pcr and by western blot analysis. in sh - sy5y cells, the most active was si-4 duplex which lowered bace1 mrna level up to 34% (100% value consists of bace1 expression in control sample without silencing) (see table 1). low activity of sirna in sh - sy5y neuroblastoma cell line was probably caused by lower transfection efficiency of these cells as compared to hela cells, in which screened duplexes si-2si-4 were much more active. fluorescence of gfp or rfp expressed from pgfp - bace or pdsred2-n1 plasmids, respectively, was ca. 1020 times higher in hela cells than in sh - sy5y cells transfected in standard conditions (using lipofectamine at a 2 : 1 ratio) (see figure 2). the pcpurhu6 si-5 vector (sequence corresponding to si-5a), specific for the human bace1 gene, was the most potent inhibitor in hek293 cells (32% of expression of the control sample). additionally, pcpurhu6 si-5b, specific for mouse and rat bace1 mrna, also revealed high silencing efficiency in m15 mouse cells (30% of expression level of the control sample). the second plasmid construct, pcpurhu6 si-6 (sequence corresponding to si-6), specific for the h / m / r bace1 gene, resulted in bace1 expression of 51% in hek293 cells and 71% in m15 cells. the loop structure has a significant impact on export of pre - mirna or shrna from nucleus and their silencing efficiency was proven to be the most efficient with loops ranging from 9 to 19 nt [27, 28, 36 ]. we designed and cloned into the pcpurhu6 vector the hairpin - type rnas with si-6 sequence (pcpurhu6 si-6) with the 19 - 21 base pair (bp) stems and with various loops : (1) pcpurhu6 si-6 (21 bp)-mir26, (2) si-6 (19 bp) with 9-nt uucaagaga loop, (3) si-6 (21 bp) with 9-nt uucaagaga loop, (4) si-6 (21 bp) with 10-nt cuuccuguca (loop from mirna23), and (5) si-6 (21 bp) with 19-nt uagugaagccacagaugua (loop from mirna30) (see figure 3). all five plasmids were tested in hek293 cells and the most active was the construct 1 causing 50% lowering of bace1 mrna. constructs 4 and 5 with mirna - origin loops mirna23 and mirna30, respectively, demonstrated moderate silencing activity, lowering bace1 mrna by 27% and 38%, respectively. in order to validate the effects of shrnas on bace1 gene expression in rat cells model, the lentiviral vectors were constructed and used for the lv - si-5 and lv - si-6 lentiviruses production. the high titer lentiviruses lv - si-5 and lv - si-6 were used for transduction of adult hippocampal neural stem cells hcn a94. both vectors caused significant reduction in bace1 mrna (> 75%) in comparison to the level of mrna expressed by control cells (figure 4). in search for additional functions of bace1 or products of bace1 proteolytic activity, we analyzed mrna levels of several genes involved in adult neurogenesis (listed in table 2). their list consists of a transcription factor sox-2 (essential for maintaining progenitor cells in the undifferentiated stage), transcription factors neurogenin 13 and neurod1, nrsf / rest (expressed during neuronal differentiation and responsible for activation of the expression of neuronal genes), synapsin i, nachii, glur2, iii - tubulin, calbidin, bdnf, and scg10. additionally, we assessed expression of gfap, indicative of astrocytes ; mbp, specific for oligodendrocytes ; and genes of creb, mecp2, app, bace2, pkr, and gapdh. we did not find any influence of bace1-specific sirnas on the mrna level of the above - mentioned genes. interestingly, we found correlation between bace1 and scg10 gene expression, as bace1 inhibition by lv - si-5 and lv - si-6 resulted in simultaneous downregulation of scg10 (figure 4, table 2). moreover, during neurogenesis in conditions favouring the differentiation of progenitor cells the level of bace1 expression was increasing over the four days of the experiment (data not shown). many alzheimer 's disease treatments are aimed at blocking the formation of pathogenic amyloid- peptides. both - and -secretases, due to their crucial role in the secretion of a, are supposed to be useful therapeutic targets. successful inhibition of these enzymes may reduce the burden of amyloid--peptide in ad patients ' brains, which may slow down the neurodegeneration. inhibition of -secretase activity can evoke severe side effects, because this protease is involved in processing of other important substrates, including notch receptor and cell surface proteins type i [43, 44 ]. therefore, bace1, being a major -secretase participating in the toxic a generation in the brain, is a primary therapeutic target. multiple strategies have been used to inhibit bace1 gene expression, including antisense oligonucleotides and catalytic nucleic acids [21, 25, 4548 ]. in the present studies it was already demonstrated that silencing of bace1 decreases the amount of secreted a peptides [21, 24, 25, 47 ], therefore the main goal of these studies was to select sirnas that are able to reduce specifically bace1 expression in the designed experimental system. several sirna sequences directed toward human, mouse, and rat bace1 mrna were originally designed and their functionality against overexpressed and endogenous bace1 was evaluated. the experiments were performed in hek293 and sh - sy5y human and m15 mouse cell lines as well as in hcn a94 rat cells, where a lentiviral vector expressing active shrna was applied. as determined in the bace - gfp / rfp dual fluorescence assay, the most active were si-3 and si-4 constructs, which at 100 pm concentration reduced the level of bace - gfp mrna by ca. these two sirnas were the most active in the same system when introduced into psilencer plasmid (5 and 11% of bace1 expression, resp. interestingly, two other sirnas, si-5a and si-6, cloned into pcpurhu6 plasmid, silenced bace1 in more than 80%, and may offer a good model system for further investigations with the use of plasmid - coded sirna. synthetic sirnas, si-2, si-3, and si-4, transfected into human sh - sy5y cells, reduced bace1 mrna and protein level to the lower extent than it was seen in dfa experiments performed in hela cells. although sh - sy5y neuroblastoma cells endogenously express high level of -secretase and are often used in studies on neurodegeneration, their low transfection efficiency using conventional approach is the most limiting feature. 5-fold lower transfection efficiency of pegfp - c1 plasmid into sh - sy5y cells in comparison to hela cells was observed with the use of conventional polycationic transfecting agents as well as with the more sophisticated gas plasma transfection methodology. in our experiments, transfection of plasmid dna, assessed by the extent of expression of pgfp - bace or pdsred2-n1 plasmids in sh - sy5y cells, reached the level of only 10 20% of that in hela cells (figure 2). si-5a specific for human bace1 mrna and si-5b, varying with one nucleotide, specific for mouse and rat homologs. both these sirnas were rather selective toward cognate genes, as it is seen from experiments in hek293 and m15 cells with sirnas coded in pcpurhu6 plasmid (table 1, the last column). thus, fully complementary si-5a caused selective silencing of human bace1 (32% of bace1 expression) but being by one nucleotide mismatched (uc) with mouse bace1 mrna, it was almost inactive toward this gene (92% of bace1 expression). in contrary, the duplex si-5b, fully complementary to mouse bace1 mrna, was more efficient in mouse m15 cells than in hek293 human cells. such high specificity of sirna with mutation at the position 16 of the antisense strand (counting from the 5-end of this strand) was previously reported by schwarz. for two alleles of the same gene of sod1. to improve the knockdown efficiency of our constructs, we designed and cloned hairpin - type rnas with the same stem sequence, but with various loops, derived from mirnas : 23, 26b, or 30. all variants showed suppressive activity, but the most potent was the construct with the 21 bp stem and 11-nt loop from the microrna 26b (50% expression of target bace1). moreover, the efficacy of constructs with the same loop sequence did not depend on the length of stem (19-bp or 21-bp) (see the activity of constructs 2 and 3, figure 3). finally, active sirna sequences, si-5b and si-6, were cloned into lentiviral vector (tuhc pcsc - sp - pw - egfp) and used to silence the target protein in rat adult neural progenitor cells hcn a94. both lentivirus - coded sirnas were very efficient in bace1 silencing in hcn a94 cells, allowing to demonstrate that si-5b and si-6 duplexes, complementary to human, mouse, and rat mrna target sites, can be simultaneously used as inhibitors of bace1 gene expression in human, mouse, and rat cells, although with various efficiency in particular cells. we asked a question, whether the activity of bace1-specific sirnas, and in consequence silencing of bace1 protein, influence the profile of expression of other genes. such nonspecific off - target effects are observed when target - specific sirna molecules are used at high molar concentrations (> 100 nm) [52, 53 ]. subsequent analysis of mrna levels of several genes involved in neurogenesis showed that screened sirnas and bace1 silencing did not affect the expression of most of selected genes (see table 2). unexpectedly, we observed downregulation of scg10 expression. ncbi / blast analysis has shown no significant similarity between scg10 and bace1 sequences. therefore, our observation suggests the presence of a regulatory pathway for scg10 expression involving bace1 or products of its proteolytic activity, although this hypothesis requires additional studies. scg10 is a neuron - specific member of the stathmin family of microtubule regulatory proteins. like stathmin, it can bind to soluble tubulin and depolymerize microtubules in neurons. because this protein has restricted localization in neurons, expression of scg10 gene is tightly regulated, mainly by nrsf / rest transcription factor.. it would be interesting to explain the potential metabolic pathway between -secretase and scg10 and these studies are currently in progress. the scg10 downregulation observed during rnai - induced silencing of bace1 may constitute important limitation of therapeutic application of this antiamyloid gene therapy, especially because increased expression of scg10 is observed in the cortical and hippocampal regions of brain after the neuronal lesions. in summary, we demonstrate high silencing activity of synthetic sirnas and viral vectors - encoded shrnas against overexpressed and endogenous bace1. this process is fairly selective as expression of majority of screened genes involved in neurogenesis is not affected by bace1-specific sirnas nor by bace1 level reduction. | beta - secretase (bace1) is the major enzyme participating in generation of toxic amyloid - beta (a) peptides, identified in amyloid plaques of alzheimer 's disease (ad) brains. its downregulation results in decreasing secretion of a. thus, bace1 silencing by rnai represents possible strategy for antiamyloid therapy in the treatment of ad. in this study, a series of newly designed sequences of synthetic and vector - encoded sirnas (psilencer, pcpurhu6, and lentivirus) were tested against overexpressed and endogenous bace1 in several cell lines and in adult neural progenitor cells, derived from rat hippocampus. sirnas active in human, mouse, and rat cell models were shown to diminish the level of bace1. in hcn a94 cells, two bace1-specific sirnas did not alter the expression of genes of bace2 and several selected genes involved in neurogenesis (synapsin i, iii - tubulin, calbidin, neurod1, glur2, creb, mecp2, pkr), however, remarkable lowering of scg10 mrna, coding protein of stathmin family, important in the development of nervous system, was observed. |
phenylketonuria (pku ; omim 261600) is defined as an autosomal recessive genetic inborn error of phenylalanine (phe) metabolism (1). insufficiency in the hepatic specific enzyme, phenylalanine- 4-hydroxylase (pah) (ec 1.14.16.1) leads to hyperphenylalaninemia that is associated with the pku (1). deficiency of the pah enzyme results in the elevation of phe concentration in blood and biological fluids that is approximately above 2 mg / dl (120 mol / l) in the pre - treatment condition (1 - 4). the prevalence of pku among patients institutionalized for mental retardation varies from 1% to 3% (4 - 6). the frequency of pku varies from high incidence in turkey (about 1 in 2600 births) to low incidence in japan (about 1 in 125000 births) (7). overall, the incidence of pku among caucasians is about 1 in 10,000, giving a carrier frequency of about 1 in 50 to 1 in 70 (7). the incidence of pku in iranian population has been expected at 1 in 3627 live births (8). genetic overall diversity in iranian populations is very high and comparable to the other populations from the south caucasus region, anatolia and europe (9). it has been shown that iranian azerbaijanis with a population of about 15 to 20 million are more related to the georgians in comparison to other iranian groups (9). the finding of derenko (2013) is based on maternal genetic structure on the mitochondrial dna studies (9). however, this result may change based on paternal genetic structure and y - chromosome tracing. west azerbaijan province with a population of about 3 million is in north - west of iran and closely related to turks. regarding to a relatively high incidence of pku alleles in iranian population as well as high rate of consanguineous marriages in iran (10), this study was carried out for mutation analysis of the pah gene in west azerbaijan province of iran. this study was performed regarding the ethical guideline in human genetic research as described by ethics committee of urmia university of medical sciences (west - azerbaijan, urmia, iran) and was conducted in accordance with declaration of helsinki. pku patients were diagnosed and sequentially selected among patients referred to motahari hospital of urmia university of medical sciences. a total of 109 individuals from 40 pku families including 40 pku patients (16 males and 24 females) and their parents entered in the study. all cases were diagnosed by a pediatric neurologist in the department of pediatrics at the university hospital of motahary (urmia, iran). medical data recordings, and tests assessments were carried out by the same physician for all cases using criteria for diagnosis of pku (7,11). an informed written consent from the parents of the kids for research study, 3 to 5 ml whole blood was taken from patients and their parents and collected in ethylenediaminetetraacetic acid (edta) tube. genomic dna was isolated from blood samples using salting out method (12). a total of 218 alleles from109 individuals from 40 pku families (40 pku patients and their parents) were tested for ivs10 - 11, s67p, r261q, r252w, ivs11nt-1 g > c, r408q, q232q, r243q, 364delg, l333f, 261x, i65 t, and r408w mutations in the pah gene using restriction fragment length polymorphism - polymerase chain reaction (rflp - pcr) as described previously (13,14) (table 1). tested mutations in phenylketonuria families from west azerbaijan province of iran pcr reaction was performed in a 25 l solution containing 50 ng dna, 1x reaction buffer, 10 pmol of each primer, 200 mol of dntps, 0.3 unit of taq dna polymerase, and 1.5 mmol mgcl2 (genefanavaran, tehran, iran). a 10 to 15 l of the pcr products were examined for the presence or absence of tested mutations by restriction digestion at 37 c for 2 hr according to the manufacturer s instructions. 2%-3% agarose gel containing ethidium bromide was used for electrophoresis of pcr amplicons and digested fragments. presence or absence of a mutation contains the highest number of mutations (87 out of 567) (15.34%) (pahdb ; http://www.mcgill.ca/pahdb). the identified mutations on the exon 7 of the pah gene were confirmed with the direct sequencing in an abi 730xl dna analyzer (applied biosystems) using the primer sequences of 5actaccaaaggtctcctagtgcct3 and 5ctacacaactagcctgtggaccag3 (15). the frequencies of ivs10 - 11, s67p, r261q, r252w, ivs11nt-1 g > c, r408q, and q232q mutations were 28(35), 17(21.25), 15(18.75), 3(3.75), 3(3.75), 2(2.5), and 1(1.25), in case group and 51(23.4), 31(14.2), 27(12.4), 6(2.75), 6(2.75), 4(1.83), and 2(0.92) in total group, respectively. observed mutations in the patients were inherited from their parents. the mutations of r243q, 364delg, l333f, 261x, i65 t, and r408w were not found in this study. of the alleles studied, the most frequent mutation was ivs10nt546 (35%). seven mutations represent approximately 86.25% and 83% of pku chromosomes analyzed in cases and total groups, respectively. our analysis showed that 37.5% (15/40) and 62.5% (25/40) of the cases have homozygote and compound heterozygote genotypes regarding the studied mutations (table 3). the most common mutations of ivs10 - 11, s67p, and r261q can be as a result of the high rate of consanguineous marriages. the frequencies of missense, splice, and silent mutations were 37 (46.25), 31 (38.75), and 1 (1.25), in cases and 68 (31.18), 57 (26.15), and 2 (0.92) in total groups, respectively. mutation analysis in the phenylalanine hydroxylase gene of 40 cases and total (patients and parents) groups in west azerbaijan province of iran the allele frequency was based on 218 alleles including mutant (153/218) and normal (65/218) alleles in total (patients and parents) group the allele frequency was based on 80 mutant alleles in case group ; the mutation detection rate was 86.25% (69 out of 80 pku chromosomes) and 83% (127 out of 153 pku chromosomes) in case and total (patients and parents) groups in the west azerbaijani population. f : frequency distribution of homozygote and compound heterozygote genotypes in the west azerbaijani among phenylketonuria patients detection of ivs10nt-11 (c.1066 - 11g > a) and ivs11nt1 g > c (c.1199 + 1g > c) mutations in six samples pcr products (357 bp) were digested with ddei. the presence of ivs11nt1 g > c mutation naturally produces restriction site for ddei enzyme. individuals homozygous for normal sequence regarding ivs11nt1 g > c mutation show a single un - cut band of 357 bp. individuals homozygous for ivs11nt1 g > c mutation show two bands of 244- and 113- bp. individuals heterozygous for ivs11nt1 g > c mutation show three bands of 357-, 244- and 113- bp. as well as, individuals homozygous for normal sequence regarding ivs10nt-11 mutation show a single un - cut band of 357 bp. individuals heterozygous for ivs10nt-11 (c.1066 - 11g > a) mutation show three bands of 357-, 261- and 96- bp lane m : 50 bp marker (fermentas). lanes 1 : homozygous for ivs10nt-11 g > a mutation. lanes 4 and 6 : heterozygous for ivs10nt-11 g > a mutation detection of r261q mutation in 7 samples. individuals homozygous for r261q mutation show a single un - cut band of 285 bp. individuals heterozygous for r261q mutation show two bands of 285 and 123 bp lane m : 50 bp marker (fermentas) lane 7 : homozygous for r261q mutation pku nucleotide sequences of pku mutation of c.782g > a (p.r261q) of exon 7 of the pah gene in a sample detection of r252w mutation in 8 samples. individuals homozygous for r252w mutation show a single un - cut band of 285 bp. individuals heterozygous for r252w mutation show three bands of 285, 162 and 123 bp lane m : 50 bp marker (fermentas). lanes 5 - 8 : without r252w mutation detection of s67p mutation in 11 samples. the presence of s67p mutation removes restriction site for xbai enzyme individuals homozygous for s67p mutation show a single un - cut band of 463 bp. individuals heterozygous for s67p mutation show three bands of 463, 348 and 115 bp lane m : 50 bp marker (fermentas). the tested mutations were chosen based on similarity between population in the west azerbaijan province and the mediterranean groups. the ivs10nt-11g > a mutation with systematic name of c.1066 - 11g > a also known by the trivial name ivs10nt546 g > a, is the most common mediterranean pku mutation (1). dworniczak (1991) reported transition of g to a at location 546 in intron 10 of the pah gene (1). this mutation activates a splicing site and leads to insertion of nine nucleotides between exons 10 and 11 during splicing. ivs10nt546g > a is the major cause of pku in parts of southern and southeastern europe, mainly in turkey. several investigations have been conducted to study the spectrum of pku causing mutations in various groups (8, 11, 13, 16 - 23). interestingly, the frequency of ivs10nt-11 mutation in our cases is higher compared to other reports (8, 11, 13, 16 - 23). the high rate of consanguineous marriages (47.5%) is a contributing reason to this high prevalence in tested families. it has been suggested that the world - wide distribution of ivs10nt546 mutation has turkish origin with expansion in different geographic regions (7). in this study, it was established that the ivs10 - 11 mutation has the highest frequency in the pku patients among the iranian azerbaijanis, and it can be considered for molecular diagnosis in this population. the findings of the present study may be a sign of close familial link between west azerbaijanis and turks, which is consistent with the historical as well as geographical relations between west azerbaijan and turkey. the second most common mutation identified in our investigation, s67p (c.199t > c), is a missense mutation with low frequency in other populations (4). unexpectedly, the mutation of s67p with 25% frequency seemed to be explained by the high rate of consanguineous marriages in the tested group (47.5%). the third most common mutation identified in our investigation, r261q (c.782g > a), is a mediterranean missense mutation and occurs on a cpg dinucleotide on exon 7 in the pah gene. this mutation results in conversion of arggln at codon 261 and is the second most frequent mutation in turks (19). the remaining mutations of r252w (c.754c > t), ivs11nt-1 g > c (c.1199 + 1g > c), r408q (c.1223g > a), and q232q (c.696a / g) account for 12.47% of the identifiable mutations. this study indicated high level of heterogeneity of the pah gene in pku families in the west azerbaijan, and thus further investigation should be carried out. mutation analysis in the pah gene can be used in carrier detection, prenatal diagnosis and prevent the incidence of pku phenotypes in the west azerbaijani population. the results of this study would be useful for biomedicine and molecular anthropology studies by tracing the anthropological characters of the population regarding autosomal chromosomes. this study had some limitations including the small sample size and poor quality of medical records. exon 11 and its intronic regions carry the most prevalent mutant alleles in pku families in the west azerbaijan. screening of ivs10nt-11 g > a mediterranean mutation should be tested for detection of possible mutations of pah in the west azerbaijan (iran). this report reveals the genetic heterogeneity in the west azerbaijani pku population with a high frequency of ivs10nt-11 g > a mutation (35%) that shows similarity to turks. | objective(s):phenylketonuria (pku) is a genetic inborn error of phenylalanine (phe) metabolism resulting from insufficiency in the hepatic enzyme, phenylalanine hydroxylase (pah), which leads to elevated levels of phe in the blood. the present study was carried out for mutation analysis of the pah gene in west azerbaijan province of iran.materials and methods : a total of 218 alleles from 40 pku families were studied using restriction fragment length polymorphism - polymerase chain reaction (rflp - pcr) method.results:the frequencies of ivs10 - 11, s67p, r261q, r252w, ivs11nt-1 g > c, r408q, and q232q mutations were 28(35), 17(21.25), 15(18.75), 3(3.75), 3(3.75), 2(2.5), and 1(1.25), in cases group, and 51(23.4), 31(14.2), 27(12.4), 6(2.75), 6(2.75), 4(1.83), and 2(0.92) in total group, respectively. the mutations of r243q, 364delg, l333f, 261x, i65 t, and r408w were not detected in our samples.conclusion:it can be concluded that the ivs10 - 11 mutation has the highest frequency in the tested population. to our knowledge, this report is the first in its own kind and provides better understanding of the genetic heterogeneity, the origin and distributions of pah mutations in west azerbaijan province of iran. |
parkinson 's disease (pd) is one of the most common neuro - degenerative disorders characterized by tremor, bradykinesia, rigidity and postural instability as well as several nonmotor features including dementia and depression. the exact pathophysiology of the disease is largely unknown though oxidative stress and mitochondrial dysfunction are generally believed to play a critical role. in fact, several epidemiologic studies have demonstrated an increased risk of dementia, another neuro - degenerative disorder, among patients with chronic autoimmune inflammatory diseases. psoriasis is a common immune - mediated skin disorder with an estimated prevalence of 24% in the adult population. patients with psoriasis are well - known to have a high prevalence of comorbidities, especially metabolic syndrome and cardiovascular diseases. chronic inflammation is believed to play a pivotal role for this increased risk as several studies have illustrated the unfavorable effect of oxidative stress and inflammatory cytokines on endothelial function, resulting in premature atherosclerosis. in light of chronic inflammation thus, we conducted a systematic review and meta - analysis of observational studies to investigate if the risk of pd is increased in patients with psoriasis compared with nonpsoriasis participants. two investigators (patompong ungprasert and narat srivali) independently searched published articles indexed in medline and embase database from inception to october 2015 using the search terms that comprised the terms for psoriasis and pd described in supplementary data. the eligibility criteria included the following : (1) cohort study or case control study comparing the risk of pd between subjects with and without psoriasis, (2) relative risk (rr), hazard ratio, incidence ratio (ir), odds ratio (or) or standardized ir with 95% confidence intervals (cis) or sufficient raw data to calculate these ratios were provided. study eligibility was independently determined by the two aforementioned investigators. the senior investigator (wonngarm kittanamongkolchai) served as the deciding vote for any different decisions. this scale assessed each study in three areas including (1) the recruitment of the subjects (2) the comparability between the two groups and (3) the ascertainment of the outcomes of interest and exposures of interest for cohort study and case control study, respectively. a standardized data collection form was used to extract the following information : first author 's last name, title of the study, year of publication, year of study, country where the study was conducted, study population, method used to identify cases and controls, number of subjects, average duration of follow - up (for cohort study), demographic data of subjects, confounders that were adjusted and adjusted effect estimates with 95% ci. any discrepancies were resolved by referring back to the original articles. if the necessary data were not provided in the article, the corresponding author of the article would be contacted. data analysis was performed using review manager 5.3 software from the cochrane collaboration (london, united kingdom). we pooled the point estimates from each study using the generic inverse variance method of dersimonian and laird. as the outcome of interest in this study was relatively uncommon, we used or of case control study as an estimate for rr to combine this data with rr of cohort study to increase the power and precision of our pooled estimates. we used a random - effect model rather than a fixed - effect model because of the high likelihood of between - study variance due to different populations and study designs. cochran 's q test, which is complemented with the i statistic, was used to assess statistical heterogeneity. this i statistic quantifies the proportion of total variation across studies that is due to true heterogeneity rather than chance. a value of i of 025% represents insignificant heterogeneity, more than 25% but 50% low heterogeneity, more than 50% but 75% moderate heterogeneity, and more than 75% high heterogeneity. funnel plot and egger 's linear regression were used for evaluation of publication bias using comprehensive meta - analysis version 2.2 software (englewood, new jersey, usa). two investigators (patompong ungprasert and narat srivali) independently searched published articles indexed in medline and embase database from inception to october 2015 using the search terms that comprised the terms for psoriasis and pd described in supplementary data. the eligibility criteria included the following : (1) cohort study or case control study comparing the risk of pd between subjects with and without psoriasis, (2) relative risk (rr), hazard ratio, incidence ratio (ir), odds ratio (or) or standardized ir with 95% confidence intervals (cis) or sufficient raw data to calculate these ratios were provided. study eligibility was independently determined by the two aforementioned investigators. the senior investigator (wonngarm kittanamongkolchai) served as the deciding vote for any different decisions. this scale assessed each study in three areas including (1) the recruitment of the subjects (2) the comparability between the two groups and (3) the ascertainment of the outcomes of interest and exposures of interest for cohort study and case control study, respectively. a standardized data collection form was used to extract the following information : first author 's last name, title of the study, year of publication, year of study, country where the study was conducted, study population, method used to identify cases and controls, number of subjects, average duration of follow - up (for cohort study), demographic data of subjects, confounders that were adjusted and adjusted effect estimates with 95% ci. any discrepancies were resolved by referring back to the original articles. if the necessary data were not provided in the article, the corresponding author of the article would be contacted. data analysis was performed using review manager 5.3 software from the cochrane collaboration (london, united kingdom). we pooled the point estimates from each study using the generic inverse variance method of dersimonian and laird. as the outcome of interest in this study was relatively uncommon, we used or of case control study as an estimate for rr to combine this data with rr of cohort study to increase the power and precision of our pooled estimates. we used a random - effect model rather than a fixed - effect model because of the high likelihood of between - study variance due to different populations and study designs. cochran 's q test, which is complemented with the i statistic, was used to assess statistical heterogeneity. this i statistic quantifies the proportion of total variation across studies that is due to true heterogeneity rather than chance. a value of i of 025% represents insignificant heterogeneity, more than 25% but 50% low heterogeneity, more than 50% but 75% moderate heterogeneity, and more than 75% high heterogeneity. funnel plot and egger 's linear regression were used for evaluation of publication bias using comprehensive meta - analysis version 2.2 software (englewood, new jersey, usa). two investigators (patompong ungprasert and narat srivali) independently searched published articles indexed in medline and embase database from inception to october 2015 using the search terms that comprised the terms for psoriasis and pd described in supplementary data. the eligibility criteria included the following : (1) cohort study or case control study comparing the risk of pd between subjects with and without psoriasis, (2) relative risk (rr), hazard ratio, incidence ratio (ir), odds ratio (or) or standardized ir with 95% confidence intervals (cis) or sufficient raw data to calculate these ratios were provided. study eligibility was independently determined by the two aforementioned investigators. the senior investigator (wonngarm kittanamongkolchai) served as the deciding vote for any different decisions. this scale assessed each study in three areas including (1) the recruitment of the subjects (2) the comparability between the two groups and (3) the ascertainment of the outcomes of interest and exposures of interest for cohort study and case control study, respectively. a standardized data collection form was used to extract the following information : first author 's last name, title of the study, year of publication, year of study, country where the study was conducted, study population, method used to identify cases and controls, number of subjects, average duration of follow - up (for cohort study), demographic data of subjects, confounders that were adjusted and adjusted effect estimates with 95% ci. any discrepancies were resolved by referring back to the original articles. if the necessary data were not provided in the article, the corresponding author of the article would be contacted. data analysis was performed using review manager 5.3 software from the cochrane collaboration (london, united kingdom). we pooled the point estimates from each study using the generic inverse variance method of dersimonian and laird. as the outcome of interest in this study was relatively uncommon, we used or of case control study as an estimate for rr to combine this data with rr of cohort study to increase the power and precision of our pooled estimates. we used a random - effect model rather than a fixed - effect model because of the high likelihood of between - study variance due to different populations and study designs. cochran 's q test, which is complemented with the i statistic, was used to assess statistical heterogeneity. this i statistic quantifies the proportion of total variation across studies that is due to true heterogeneity rather than chance. a value of i of 025% represents insignificant heterogeneity, more than 25% but 50% low heterogeneity, more than 50% but 75% moderate heterogeneity, and more than 75% high heterogeneity. funnel plot and egger 's linear regression were used for evaluation of publication bias using comprehensive meta - analysis version 2.2 software (englewood, new jersey, usa). our search strategy yielded 202 potentially relevant articles (183 articles from embase and 19 articles from medline). one hundred and sixty four articles were excluded at this stage since they were case reports, review articles, correspondences or interventional studies, leaving 20 articles for full - length article review. sixteen of these articles were excluded after the full - length review as they did not report the exposure or outcome of interest, leaving three retrospective cohort studies and 1 case figure 1 outlines the search and literature review process. the clinical characteristics and quality assessment of the included studies the inter - rater agreement for the quality assessment was high with the kappa statistics of 0.64. search methodology and literature review process clinical characteristics and quality assessment of the included studies all studies did reveal an increased risk of pd among patients with psoriasis even though the increased risk did not always reach statistical significance. the pooled analysis of all studies demonstrated a significantly increased risk of pd in patients with psoriasis with the pooled risk ratio of 1.38 (95% ci, 1.151.66). forest plot of this meta - analysis to confirm the robustness of our results, we performed jackknife sensitivity analysis by excluding one study at a time from the pooled analysis. the pooled risk ratios from this sensitivity analysis changed slightly, ranging from 1.25 to 1.47 with the lower bounds of the corresponding cis remained above 1.0. furthermore, there was no evidence of publication bias detected by egger 's regression test (p = 0.72). furthermore, there was no evidence of publication bias detected by egger 's regression test (p = 0.72). furthermore, there was no evidence of publication bias detected by egger 's regression test (p = 0.72). this meta - analysis is the first study that comprehensively combined all available data on the risk of pd among patients with psoriasis. we were able to demonstrate a significantly elevated risk with 38% excess risk compared with subjects without psoriasis. why patients with psoriasis have a higher risk of pd remains unclear and therefore, further studies are required. first, this association might be just the result of confounding by obesity as obesity is associated with both psoriasis and pd. high body mass index has been shown to increase the risk of pd in a dose - dependent manner in a recent epidemiologic study while the relationship between obesity and psoriasis has been recognized for over a decade. a systematic review and meta - analysis of observational studies published between 1980 and 2012 showed the pooled or for obesity for patients with psoriasis compared with subjects without psoriasis of 1.66. moreover, the odds for obesity were more prominent in patients with severe psoriasis than those with mild psoriasis. it is hypothesized that the cytokines and bioactive products such as tumor necrosis factor - alpha, interleukin-6, leptin and resistin produced by adipose tissue could predispose patients to psoriasis. the second explanation is related to chronic inflammation that is seen in patients with psoriasis. as previously mentioned, chronic peripheral inflammation could have an essential role in the development of neuro - degenerative diseases. it has been demonstrated that peripheral inflammation can induce microglial activation, resulting in liberation of free radical / reactive oxygen species and, ultimately, neuronal damages. the microglial - mediated neurotoxicity is of particular importance for the development of pd as substantia nigra pars compacta, the principal pathological region of pd, has the highest density of microglial cells compared with other parts of the brain. in fact, animal models and postmortem studies of patients with pd consistently demonstrated robust microglial activation in the substantia nigra. more interestingly, frequent use of nonsteroidal anti - inflammatory drugs, particularly ibuprofen, is associated with a lower risk of developing pd which could serve as an indirect evidence to support the role of chronic inflammation in the pathogenesis of this disease. the major strength of this study is the advantage of systemic review and meta - analysis that allows a comprehensive estimation of the risk. the major limitation is related to the methodology of the primary studies as those studies were conducted using coding - based medical registry which would raise a concern over misclassification and coding incompleteness. moreover, because of the observational nature of the primary studies, this meta - analysis could only demonstrate an association but could not establish causality. our meta - analysis demonstrated a significantly increased risk of pd among patients with psoriasis. patients with psoriasis are at a higher risk of parkinson 's disease with 38% excess risk compared with subjects without psoriasis. patients with psoriasis are at a higher risk of parkinson 's disease with 38% excess risk compared with subjects without psoriasis. patients with psoriasis are at a higher risk of parkinson 's disease with 38% excess risk compared with subjects without psoriasis. | background : patients with psoriasis might be at a higher risk of developing parkinson 's disease (pd) as a result of the detrimental effect of chronic inflammation on the neuronal tissue. this meta - analysis aimed to investigate this risk by comprehensively reviewing all available data.methods:we conducted a systematic review and meta - analysis of cohort and case control studies that reported relative risk, hazard ratio, odds ratio, or standardized incidence ratio comparing the risk of pd in patients with psoriasis versus subjects without psoriasis. pooled risk ratio and 95% confidence interval (ci) were calculated using random - effect, generic inverse variance methods of dersimonian and laird.results:three retrospective studies and one case control study met our eligibility criteria and were included in this meta - analysis. the pooled risk ratio of pd in patients with psoriasis versus participants without psoriasis was 1.38 (95% ci, 1.151.66). the statistical heterogeneity was low with an i2 of 35%.conclusions : our meta - analysis demonstrated a statistically significant increased risk of pd among patients with psoriasis. |
even though there have been continual advances in neonatal care and a decline in mortality of preterm infants in the past several decades, the incidence of severe long - term sequelae such as chronic lung disease and neurodevelopmental disability in survivors remains high, particularly in newborns delivered at early gestational ages. it is an important public health issue as rates of preterm birth are rising in many countries. so, prevention and management of preterm birth continue to be a major challenge worldwide. cervical incompetence is a known risk factor for preterm birth and is considered responsible for 5% of extremely preterm deliveries (2 of 6 signs : 1) fever > 38c, 2) hysteralgia, 3) fetal tachydardia (> 160 beats / minute), 4) maternal tachydardia (> 100/minute), 5) foul - smelling amniotic fluid, 6) increased wbc count (12000/mm3). prolonged rupture of membrans (prom) was defined as rupture of membranes lasting more than 18 hours before labor. continuous data were compared by student 's t - test, and comparisons between proportions were assessed by either the chi - square test or fisher s exact test. a total of 581 neonates with birth weight less than 2000 g were included in the study. of these, there were 79 cases born to mothers with cervical incompetence and 502 to mothers without cervical incompetence. the mean gestational age among the preterm babies born to mothers with cervical incompetence was lower than control group. infants with maternal cervical incompetence had a higher incidence of prom, maternal antibiotic therapy and clinical chorioamnionitis than in control group, while incidence of maternal hypertension was higher in the control group. in patient characteristics such as birth weight, frequency of female, vaginal delivery, maternal diabetes mellitus, and antenatal steroid therapy, there was no difference between the two groups.. demographics and clinical characteristics of preterm neonates between cervical incompetence (case) and control groups we compared morbidity and mortality of preterm neonates (table 2) and found no significant differences in the incidences of rds, rop, bpd, pvl, ivh, nec, severe asphyxia, eos, and mortality between cervical incompetence and control groups. a lower incidence of sga was detected in preterm infants in the cervical incompetence group than in control group. postnatal morbidities of preterm neonates in the ci with cerclage (case) and control groups ci : cervical incompetence in 13 out of 79 mothers, mcdonald cerclage was not performed in the cervical incompetence group. the effects of mcdonald cerclage on postnatal morbidity and mortality of preterm neonates are shown in table 3. there were no significant differences in the incidences of rop, bpd, pvl, ivh, nec, severe asphyxia, eos, sga, and mortality between the two groups. postnatal morbidities between the cerclage and no cerclage in cervical incompetence groups emergency cerclage was performed in 8 out of 66 patients in the cervical incompetence group. table 4 shows a comparison of postnatal morbidity and mortality of preterm neonates between elective - cerclage and emergency cerclage in cervical incompetence group. incidence of rds, rop, bpd, pvl, ivh, nec, severe asphyxia, eos, sga, and mortality were not different between elective cerclage and emergency cerclage groups. postnatal morbidities of preterm neonates in the ci with elective cerclage and emergency cerclage groups ci : cervical incompetence to analyze factors associated with frequency of rds, clinical characteristics of the cerclage and no cerclage in cervical incompetence group are presented in table 5. the mean weeks of gestation and mean birth weight were significantly lower in no cerclage group. there was no significant difference in the incidence of antenatal steroid therapy between the two groups. clinical characteristics of the cerclage and no cerclage in cervical incompetence group ci : cervical incompetence it is increasingly being accepted that the cervix plays more than just a mechanical role, it also acts as a barrier to prevent ascending infection from the lower genital tract. meanwhile little is known about the mortality and morbidity of preterm neonates born to mothers with cervical incompetence. was the frequency of postnatal sequelae in preterm neonates born to mothers with cervical incompetence higher than in those born to mothers without cervical incompetence ? in this study, we found that, except for lower frequency of sga in cervical incompetence group, there were no statistical differences in the incidences of rds, bpd, severe ivh, nec, eos, rop, pvl, severe asphyxia and mortality between the cervical incompetence and control groups. our results agree with those of tae - jung sung and disagree with the findings of mitani which indicated that cervical incompetence was a significant factor related to the occurrence of neonatal death and abnormal cerebral ultrasound scans. increasing evidence suggests that pathologically early cervical ripening associated with cervical incompetence was related with intrauterine infection or inflammation, so we speculated that there might be higher frequency of eos of preterm neonates in cervical incompetence group, but it did not occur as expected. we examined the clinical characteristics of neonates and found that frequency of maternal antibiotic therapy was very high in cervical incompetence group. whether intrapartum antibiotic prophylaxis (iap) provided for women with cervical incompetence could alter the outcome of pregnancy and the newborn infant, is currently uncertain. nonetheless, lee have reported that intra amniotic inflammation was present in approximately 80% of patients with acute cervical incompetence and suggested that parenteral antibiotic treatment may sometimes reduce the intensity of the intra amniotic inflammatory response, prolonging the time interval to delivery and improving neonatal outcome. natale believed that antepartum group b streptococcal (gbs) antibiotic prophylaxis may reasonably be useful in the subset of patients with ci / bulging membranes. so, higher frequency of maternal antibiotic therapy in our study may explain why incidence of eos of preterm neonates in cervical incompetence was not higher than in control group. we also found that frequency of maternal hypertension was lower in cervical incompetence group which may result in lower incidence of sga in this group. cervical cerclage is an intervention that is widely used to prevent miscarriage or delivery in the second trimester of pregnancy. these include infection and ensuing chorioamnionitis, ruptured membranes, bleeding, miscarriage, and cervical laceration requiring repair, etc. the effect of the procedure of cervical cerclage on the mortality and morbidity of newborns is a major concern for neonatologists. in this study, infants with no cerclage had a higher prevalence of rds compared to cerclage group ; incidence of neonatal bpd, pvl, severe ivh, nec, eos, rop, sga, severe asphyxia and mortality were not affected by cerclage status. our results disagree with those of tae - jung sung that found no significant difference in the incidences of rds in cerclage and no cerclage groups. since many risk factors are associated with frequency of rds, we analyzed clinical characteristics of preterm neonates in cerclage and no cerclage groups, and found that the neonates from mothers with no cerclage status were much smaller and younger. this result suggests that lower gestational age and birth weight may result in higher incidence of rds in neonates with no cerclage, the lower the gestational age, the higher the risk of rds. cervical cerclage may be performed prophylactically in the first trimester (elective cerclage) when the clinical history suggests risk of mid - trimester loss or as emergency at mid - trimester when there is evidence of a short cervix or cervical shortening on ultrasound. it was reported that emergency cerclage carried the highest complication rate and the outcome of these pregnancies was usually poor, so placement of emergency cerclage at mid - trimester was controversial. andrea liddiard recently reported that there was little difference in the gestation at delivery (35 vs 33 weeks), live birth rate (93% vs 92%) and mean birth weight between the elective and emergency cerclage groups. clinical neonatal morbidity with emergency cerclage based on limited information is not well known at present. hence, we compared the neonatal outcomes between the elective and emergency cerclage status in this study. we found that there was no statistical difference between the two groups in the incidences of rds, bpd, severe ivh, nec, eos, rop, pvl, sga, severe asphyxia, and mortality of neonates. this result suggests that the neonatal outcomes were not affected by emergency cerclage status in this study. it was reported that cervical incompetence occurs in 1% of the obstetric population and up to 8% of patients with recurrent midtrimester losses. most patients and clinicians when faced with risk factors for preterm delivery seem to prefer intervention over no intervention. cervical cerclage remains a common procedure that is offered to women at moderate to high risk. both patients and clinicians worry about the safety of this procedure for fetus or newborns, which maybe result in no improvement in obstetrical outcomes or adverse neonatal outcomes. overall, neonatal outcomes in the cervical incompetence group in our study are somewhat encouraging, but there are some limitations to this study. since pathology of placentas was not screened in all neonatal mothers enrolled in this study, we could not collect enough data to analyze the incidence of histopathological chorioamnionitis between cervical incompetence and control groups. another limitations of our study were the small sample size and retrospective time frame, only 8 samples were enrolled in the emergency cerclage group and 13 samples in no cerclage group, which were still not representative of such clinical features in these preterm infants. the results of this study provide evidence that maternal cervical incompetence, regardless of cerclage status, was not associated with postnatal adverse neonatal outcomes. these findings can be beneficial to clinicians in the counseling and clinical management of these challenging patients. concept / design : w. hua, z. wei, f. ling acquisition of data and data analysis : f. ling, y. song, m. jian - rong, w. ping manuscript preparation : w. hua critical revision of the manuscript : w. hua, z. wei all authors approved final version of the manuscript. | objective : this study aimed to determine the impact of maternal cervical incompetence (with or without mcdonald cerclage) on mortality and morbidity of preterm infant with birth weight < 2000g.methods:581 neonates were eligible for this study, 79 with cervical incompetence and 502 without it (control). incidences of neonatal respiratory distress syndrome (rds), bronchopulmonary dysplasia (bpd), intraventricular hemorrhage (ivh), neonatal necrotizing enterocolitis (nec), retinopathy of prematurity (rop), periventricular leukomalacia (pvl), severe asphyxia, small for gestational age (sga), early - onset sepsis (eos), and mortality were compared between the two groups.findings:mean gestational age was earlier in cervical incompetence group than in control (30.22.1 vs 30.71.9, p<0.05). except lower frequency of sga, there were no significant differences in the incidences of rds, bpd, rop, pvl, ivh, nec, eos, severe asphyxia and mortality between the two groups. infants with no cerclage had a higher prevalence of rds (21/66 vs 9/13, p<0.05) compared to cerclage group due to lower mean gestational age (30.682.1 vs 28.61.4, p<0.01) and birth weight (1519.5274.6 vs 1205.8204.4, p<0.001), and clinical neonatal outcomes of the elective cerclage were similar to emergency cerclage in cervical incompetence groups.conclusion:maternal cervical incompetence was not associated with postnatal adverse neonatal outcomes. lower mean gestational age was a major risk associated with higher prevalence of rds in preterm neonates with no mcdonald cerclage, and emergency cerclage did not predict poor clinical neonatal outcomes. |
glaucoma is a progressive, vision - threatening disease characterized by functional and structural ocular abnormalities and is commonly associated with increased intraocular pressure (iop). in the last few years, clinical perspectives have evolved to define glaucoma as a collection of diseases with varied etiologies leading to similar characteristic changes in the optic nerve disc and resulting defects of the visual field.1 these changes occur in normotensive patients and in patients with elevated iop.2 patients with ocular hypertension lack the optic disc pathology characteristic of glaucoma but are also at risk for visual impairment.3 despite advances in diagnosis and treatment, glaucoma remains a leading global cause of visual impairment and irreversible blindness.4,5 in japan, glaucoma is the leading cause of visual impairment and has an incidence of approximately 4% in patients aged 40 years.6,7 the prevalence of visual impairment in japan is projected to increase to nearly 2 million people by 2050, and glaucoma accounts for approximately 24% of patients with impaired vision.7 the primary treatment approach for managing and preventing progression of glaucoma and ocular hypertension is lowering iop.8 maintaining sufficient reduction of iop decreases the risk of vision loss and improves outcomes even in patients with normal - tension glaucoma.9 large - scale clinical studies have demonstrated that 40% of patients with glaucoma or ocular hypertension require two or more medications to maintain sufficient reductions in iop after the first year of treatment ; however, increasing the complexity of treatment decreases patient compliance with dosing regimens.1012 compared with use of multiple separate topical medications, use of fixed - combination therapies combining iop - lowering medications may simplify drug administration, eliminate risk of drug washout, and decrease cumulative patient exposure to preservatives.1215 brinzolamide 1%, a reversible carbonic anhydrase inhibitor, and timolol 0.5%, a 1/2-blocker, effectively reduce iop when used individually as topical monotherapy and exhibit increased efficacy when used in combination.16 a fixed combination of brinzolamide 1% and timolol 0.5% (brinz / tim - fc) was demonstrated to be noninferior to a fixed - combination therapy of timolol plus an alternative carbonic anhydrase inhibitor, dorzolamide, and to be preferred over patients previous monotherapies and combined therapies.17,18 fixed - combination ocular hypotensive therapies have consistently demonstrated iop - lowering efficacy similar to or better than unfixed combinations of their component drugs.1923 concomitant therapy with multiple individual drugs is associated with decreased treatment compliance compared with single - drop therapy;12,15,20,24 therefore, fixed combinations are a desirable treatment option. a study of 162 japanese patients treated with multiple drugs revealed that nearly 30% of the study population was treated with combinations including -blockers and carbonic anhydrase inhibitors.25 there are currently no published studies of long - term brinz / tim - fc therapy in japanese patients with open - angle glaucoma or ocular hypertension. the objective of this multicenter, open - label, phase iii study was to evaluate the safety and efficacy of 52 weeks of twice - daily brinz / tim - fc therapy in adult japanese patients with open - angle glaucoma (primary open - angle, normal - tension, exfoliation, or pigmentary) or ocular hypertension. this was a multicenter, open - label, 52-week, phase iii study. at the screening visit, the baseline visit was scheduled at least 427 days after the screening visit according to the required drug washout duration for discontinued iop - lowering drugs (-blockers and prostaglandin analogs, > 27 days ; and agonists, > 13 days ; miotics and carbonic anhydrase inhibitors, > 4 days) ; when multiple medications were used (fixed or unfixed combinations), a longer washout period was used. these washout periods were similar to durations described in previous studies.26,27 baseline ophthalmic assessments (iop, best - corrected visual acuity, visual field test, slit - lamp examination, gonioscopy, ophthalmoscopy), physiologic assessments (resting blood pressure, pulse rate), and laboratory tests were performed at 9 am for the screening or baseline visit before administration of the investigational drug ; iop, blood pressure, and pulse were also assessed at 11 am, 2 hours post instillation. at the conclusion of the baseline visit, patients were instructed to instill one drop of brinz / tim - fc in each eye at 9 am (30 minutes) and 9 pm (30 minutes) for the duration of the study. at the screening visit, patients were provided with a journal and requested to record the conditions of brinz / tim - fc instillation (eg, time of instillation, missed doses) and changes in the use of concomitant drugs. the study protocol was reviewed and approved by the institutional review board of each participating institution and was conducted in accordance with the declaration of helsinki. study participants were japanese patients aged 20 years with an existing diagnosis of open - angle glaucoma (primary open - angle, normal - tension, exfoliation, or pigmentary) or ocular hypertension at enrollment, and with iop levels of 1536 mmhg in both eyes at 9 am and 11 am at the baseline visit. patients were eligible if they were receiving treatment with multiple iop - lowering drugs (including combination drugs) at screening, or if they were treated with a single iop - lowering drug and had insufficient iop reduction at screening. insufficient iop reduction was defined as iop > 18 mmhg in at least one eye at the screening visit (primary open - angle, exfoliation, or pigmentary glaucoma)28,29 or iop elevation 27 days ; and agonists, > 13 days ; miotics and carbonic anhydrase inhibitors, > 4 days) ; when multiple medications were used (fixed or unfixed combinations), a longer washout period was used. these washout periods were similar to durations described in previous studies.26,27 baseline ophthalmic assessments (iop, best - corrected visual acuity, visual field test, slit - lamp examination, gonioscopy, ophthalmoscopy), physiologic assessments (resting blood pressure, pulse rate), and laboratory tests were performed at 9 am for the screening or baseline visit before administration of the investigational drug ; iop, blood pressure, and pulse were also assessed at 11 am, 2 hours post instillation. at the conclusion of the baseline visit, patients were instructed to instill one drop of brinz / tim - fc in each eye at 9 am (30 minutes) and 9 pm (30 minutes) for the duration of the study. at the screening visit, patients were provided with a journal and requested to record the conditions of brinz / tim - fc instillation (eg, time of instillation, missed doses) and changes in the use of concomitant drugs. the study protocol was reviewed and approved by the institutional review board of each participating institution and was conducted in accordance with the declaration of helsinki. study participants were japanese patients aged 20 years with an existing diagnosis of open - angle glaucoma (primary open - angle, normal - tension, exfoliation, or pigmentary) or ocular hypertension at enrollment, and with iop levels of 1536 mmhg in both eyes at 9 am and 11 am at the baseline visit. patients were eligible if they were receiving treatment with multiple iop - lowering drugs (including combination drugs) at screening, or if they were treated with a single iop - lowering drug and had insufficient iop reduction at screening. insufficient iop reduction was defined as iop > 18 mmhg in at least one eye at the screening visit (primary open - angle, exfoliation, or pigmentary glaucoma)28,29 or iop elevation < 30% from the screening visit to the baseline visit (normal - tension glaucoma). in previous studies, reducing iop to < 18 mmhg in patients with open - angle glaucoma or by 30% in patients with normal - tension glaucoma resulted in slower rates of visual field progression.9,30,31 patients were required to have been on a stable ocular hypotensive treatment regimen for 4 weeks before the screening visit and to be able to safely discontinue use of all ocular hypotensive medications before the baseline visit according to the washout schedule described above. key exclusion criteria included women who were pregnant, nursing, or planning to become pregnant during the study ; current or previous (within 30 days of the screening visit) treatment with another investigational agent ; inner eye surgery within 6 months or laser eye surgery within 3 months before screening ; post - washout iop 36 mmhg ; best - corrected visual acuity worse than 0.2 (decimal acuity scale) in either eye ; anterior angle grade below grade 2 in either eye ; significant visual field defects as determined by the investigators ; chronic or recurrent ocular inflammation, injury, or disease ; and medical conditions or histories that could interfere with treatment, iop and safety assessments, or data interpretation. patients received brinz / tim - fc (azarga, alcon laboratories, fort worth, tx, usa) ophthalmic solution. iop was measured at 9 am and 11 am at the baseline, week 26, and week 52 visits and at 11 am only at the week 4, 8, 13, 19, 32, 39, and 45 visits. tonometry was performed at each study site using a goldmann tonometer that was standard for that clinical practice ; iop was measured once at each time point. safety endpoints were assessed throughout the study, and included adverse events, resting blood pressure and pulse rate, visual field (static perimetry ; stages based on greve s modified method of the aulhorn classification32), best - corrected visual acuity (decimal), slit - lamp examination (cornea, eyelid / conjunctiva, iris / anterior chamber, and lens), anterior chamber angle grade (gonioscopy), cup - to - disc ratio, ophthalmoscopy (vitreous body, retina / macula lutea / choroid, and optic nerve), and laboratory tests (hematology, blood biochemistry, qualitative urine test). solicited and unsolicited adverse events were recorded at each visit and coded using the medical dictionary for regulatory activities (meddra), japanese version 14.1. statistical analyses were performed when all patients completed the week 26 and week 52 visits. least squares means of iop change from baseline were estimated with 95% confidence intervals using repeated - measures analysis of variance. significance of the primary endpoint, ie, reduction in iop from baseline, was determined by paired t - tests at each time point. descriptive statistics (eg, mean, standard deviation, percentage) were obtained for iop change from baseline, iop over time, and safety parameters. group sizes and statistical power were determined before initiation of the study. with an estimated standard deviation of 3.0 mmhg for iop change from baseline, a sample size of 100 patients was determined. with a group size of 100 patients, mean scores were estimated within 0.6 mmhg (standard deviation 0.20 mmhg) using 95% two - sided confidence intervals based on a paired t - test with 99 degrees of freedom. all study outcomes were analyzed using one eye (the target eye) from each patient. the target eye was defined as the eye satisfying the inclusion / exclusion criteria ; if both eyes satisfied these criteria, the worse eye was selected. the worse eye was defined as the eye with higher iop at 11 am on the baseline visit. if iop was equal at 11 am, the eye with higher iop at 9 am was selected. if both eyes had equal iop at 9 am and 11 am, the right eye was selected for analysis. efficacy was assessed in the intent - to - treat population (ie, all patients who received study medication and had available examinations / observation data) and the per - protocol population (ie, all patients who received study medication, had available examinations / observation data, and satisfied the protocol criteria). safety variables were analyzed in the safety population (ie, all patients who received study medication). a total of 126 patients (mean sd age, 6312 years) were enrolled in the study. demographic and disease characteristics from the intent - to - treat population at baseline are presented in table 1. most patients (n=98/125 ; 78%) had a diagnosis of open - angle glaucoma (primary open - angle, normal - tension, or exfoliation glaucoma), whereas 22% (n=27/125) had a diagnosis of ocular hypertension. the glaucoma medications used included prostaglandin and -blocker monotherapies and prostaglandin/-blocker, prostaglandin / carbonic anhydrase inhibitor, -blocker / carbonic anhydrase inhibitor, and prostaglandin/-blocker / carbonic anhydrase inhibitor combination therapies (fixed and unfixed). mean iop at screening ranged from 16.2 mmhg to 19.0 mmhg ; after washout of glaucoma medications, mean increases in iop from screening to baseline ranged from 1.0 mmhg to 6.6 mmhg (table 2). mean iop increased from screening levels after washout of all classes of previously used glaucoma drugs. one patient was discontinued from the study after screening but before receiving brinz / tim - fc because the inclusion criteria were not met. a total of 125 patients were treated with brinz / tim - fc and included in the intent - to - treat and safety populations. five patients discontinued because of adverse events (hospitalization and treatment for unrelated conditions [n=2 ], ocular complications [n=2 ], and insufficient iop reduction [n=1 ]). the other cases of discontinuation were because of patient request (n=4) and investigator decision (n=2). mean iop and efficacy results for the intent - to - treat and per - protocol populations were similar throughout the study ; therefore, efficacy data are presented only for the intent - to - treat population. mean sd baseline iop values at 9 am and 11 am were 20.53.3 mmhg and 20.83.3 mmhg, respectively. with brinz / tim - fc treatment, least squares mean iop reductions from baseline were significant at all time points assessed (range 4.1 to 5.7 mmhg ; all p<0.0001). descriptive statistics (mean standard deviation) for iop reductions from baseline are shown in figure 1. at treatment weeks 4 through 52, mean iop ranged from 15.1 mmhg to 16.4 mmhg (figure 2). overall, adverse events were reported in 66% of patients (n=82/125) ; adverse events for which a causal relationship with brinz / tim - fc could not be ruled out were observed in 22% of patients (n=28/125, table 3). all potentially treatment - related adverse events were mild (n=26/28) or moderate (n=2/28). there were six serious adverse events reported in five patients (n=1 each of malignant lung neoplasm, cholelithiasis, epilepsy / sudden hearing loss, cerebral artery occlusion, and hemorrhagic enterocolitis) ; none were considered to be related to brinz / tim - fc treatment. the most frequently observed treatment - emergent adverse events (occurring in 5% of patients) were rhinopharyngitis (21% [n=26 ]), punctate keratitis (10% [n=13 ]), and eye irritation (6% [n=7 ]). treatment - related adverse events with an incidence 2% included punctate keratitis, eye irritation, keratitis, and dysgeusia (table 3). fundus examination via ophthalmoscopy revealed no cases of score aggravation from baseline for vitreous, retina, macula, choroid, or optic nerve ; no patient showed substantial changes in cup - to - disc ratio, and there was no change in anterior chamber angle grade in any patient (data not shown). of the 123 patients with complete baseline and follow - up data, worsening of more than one stage in visual field testing from baseline to week 52 was observed in nine patients (7%) ; changes in visual field were mild in all cases. slit - lamp examination showed that 11/125 patients (9%) developed conjunctival or eyelid aggravation during the study, but all cases resolved by the exit visit. corneal score aggravation was observed in 18/125 patients (14%) during the study ; 7/125 patients (6%) continued to have corneal score aggravation at the exit visit. declines in best - corrected visual acuity 3 steps on the logmar scale (ie, 0.5 decrease in decimal visual acuity) occurred in 2/125 cases (2%), both of which resolved by the exit visit. at the exit visit, 3/125 patients (2%) had a best - corrected visual acuity decrease of two lines, 10/125 (8%) had a decrease of one line, and 1/125 (1%) had an increase of one line. no clinically significant changes in blood biochemistry, hematology, or urinalysis were observed, and in most cases, changes from baseline remained within the range of physiologic variation (data not shown). eleven abnormal laboratory values in four patients were reported as adverse events ; no causal relationship with brinz / tim - fc was found for any of these adverse events, except one case of leukocytopenia. all changes in mean pulse rate, systolic blood pressure, and diastolic blood pressure from baseline over 52 weeks were within the predetermined normal ranges (ie, pulse rate, 60100 beats per minute ; systolic blood pressure 100140 mmhg ; diastolic blood pressure 6090 mmhg). a total of 126 patients (mean sd age, 6312 years) were enrolled in the study. demographic and disease characteristics from the intent - to - treat population at baseline are presented in table 1. most patients (n=98/125 ; 78%) had a diagnosis of open - angle glaucoma (primary open - angle, normal - tension, or exfoliation glaucoma), whereas 22% (n=27/125) had a diagnosis of ocular hypertension. the glaucoma medications used included prostaglandin and -blocker monotherapies and prostaglandin/-blocker, prostaglandin / carbonic anhydrase inhibitor, -blocker / carbonic anhydrase inhibitor, and prostaglandin/-blocker / carbonic anhydrase inhibitor combination therapies (fixed and unfixed). mean iop at screening ranged from 16.2 mmhg to 19.0 mmhg ; after washout of glaucoma medications, mean increases in iop from screening to baseline ranged from 1.0 mmhg to 6.6 mmhg (table 2). mean iop increased from screening levels after washout of all classes of previously used glaucoma drugs. one patient was discontinued from the study after screening but before receiving brinz / tim - fc because the inclusion criteria were not met. a total of 125 patients were treated with brinz / tim - fc and included in the intent - to - treat and safety populations. five patients discontinued because of adverse events (hospitalization and treatment for unrelated conditions [n=2 ], ocular complications [n=2 ], and insufficient iop reduction [n=1 ]). the other cases of discontinuation were because of patient request (n=4) and investigator decision (n=2). mean iop and efficacy results for the intent - to - treat and per - protocol populations were similar throughout the study ; therefore, efficacy data are presented only for the intent - to - treat population. mean sd baseline iop values at 9 am and 11 am were 20.53.3 mmhg and 20.83.3 mmhg, respectively. with brinz / tim - fc treatment, least squares mean iop reductions from baseline were significant at all time points assessed (range 4.1 to 5.7 mmhg ; all p<0.0001). descriptive statistics (mean standard deviation) for iop reductions from baseline are shown in figure 1. at treatment weeks 4 through 52 overall, adverse events were reported in 66% of patients (n=82/125) ; adverse events for which a causal relationship with brinz / tim - fc could not be ruled out were observed in 22% of patients (n=28/125, table 3). all potentially treatment - related adverse events were mild (n=26/28) or moderate (n=2/28). there were six serious adverse events reported in five patients (n=1 each of malignant lung neoplasm, cholelithiasis, epilepsy / sudden hearing loss, cerebral artery occlusion, and hemorrhagic enterocolitis) ; none were considered to be related to brinz / tim - fc treatment. the most frequently observed treatment - emergent adverse events (occurring in 5% of patients) were rhinopharyngitis (21% [n=26 ]), punctate keratitis (10% [n=13 ]), and eye irritation (6% [n=7 ]). treatment - related adverse events with an incidence 2% included punctate keratitis, eye irritation, keratitis, and dysgeusia (table 3). fundus examination via ophthalmoscopy revealed no cases of score aggravation from baseline for vitreous, retina, macula, choroid, or optic nerve ; no patient showed substantial changes in cup - to - disc ratio, and there was no change in anterior chamber angle grade in any patient (data not shown). of the 123 patients with complete baseline and follow - up data, worsening of more than one stage in visual field testing from baseline to week 52 was observed in nine patients (7%) ; changes in visual field were mild in all cases. slit - lamp examination showed that 11/125 patients (9%) developed conjunctival or eyelid aggravation during the study, but all cases resolved by the exit visit. corneal score aggravation was observed in 18/125 patients (14%) during the study ; 7/125 patients (6%) continued to have corneal score aggravation at the exit visit. declines in best - corrected visual acuity 3 steps on the logmar scale (ie, 0.5 decrease in decimal visual acuity) occurred in 2/125 cases (2%), both of which resolved by the exit visit. at the exit visit, 3/125 patients (2%) had a best - corrected visual acuity decrease of two lines, 10/125 (8%) had a decrease of one line, and 1/125 (1%) had an increase of one line. no clinically significant changes in blood biochemistry, hematology, or urinalysis were observed, and in most cases, changes from baseline remained within the range of physiologic variation (data not shown). eleven abnormal laboratory values in four patients were reported as adverse events ; no causal relationship with brinz / tim - fc was found for any of these adverse events, except one case of leukocytopenia. all changes in mean pulse rate, systolic blood pressure, and diastolic blood pressure from baseline over 52 weeks were within the predetermined normal ranges (ie, pulse rate, 60100 beats per minute ; systolic blood pressure 100140 mmhg ; diastolic blood pressure 6090 mmhg). there were no adverse events related to pulse rate or blood pressure. reducing iop is currently the only therapeutic approach effective in preventing progression of open - angle glaucoma and ocular hypertension.8,33 topical ophthalmic pharmacotherapies are commonly employed to manage iop in patients with these conditions.8 chronic treatment with a single iop - lowering agent is often insufficient to maintain iop reduction in the long term;10,11 as a result, concomitant pharmacotherapies may be required to achieve additional iop reduction.10,16 a trend toward increasing use of multiple medications to manage iop has been observed in japanese patients.34 fixed - combination therapies enable instillation of multiple agents from one bottle, providing additive effects on iop reduction compared with single agents and simplifying administration compared with multiple medications.15,16 whereas several studies of short - term (up to one month) safety and efficacy of brinz / tim - fc have been reported,3537 long - term (12 months) clinical studies of brinz / tim - fc ocular hypotensive therapy are limited.17 the goal of the current study was to evaluate the long - term safety and efficacy of brinz / tim - fc in japanese patients with open - angle glaucoma (primary open - angle, normal - tension, exfoliation, or pigmentary) or ocular hypertension. treatment with brinz / tim - fc significantly reduced iop from baseline by 4 weeks, and iop reductions were maintained through 52 weeks. long - term treatment with brinz / tim - fc was generally well tolerated, with no serious adverse events associated with instillation. additionally, no pathologic worsening of visual field, best - corrected visual acuity, optic nerve aspect, or cup - to - disc ratio was observed, and no clinically significant effects on resting pulse rate, blood pressure, or blood biochemistry were reported. brinz / tim - fc has been shown to reduce iop effectively in patients with open - angle glaucoma and ocular hypertension and to be noninferior to an alternative fixed - combination therapy comprising dorzolamide 2% and timolol 0.5%.1618 in a double - masked, 52-week clinical trial comparing brinz / tim - fc with a fixed combination of dorzolamide / timolol in patients with glaucoma or ocular hypertension, both fixed - combination agents decreased iop and had safety profiles similar to those observed in the current study.17 furthermore, long - term (1224 months) treatment with other topical fixed - combination therapies (timolol with the 2-adrenoceptor agonist brimonidine or the prostaglandin analog latanoprost) showed sustained reductions in iop, with generally good safety and tolerability in patients with glaucoma or ocular hypertension.38,39 in the current study, long - term treatment with brinz / tim - fc decreased iop by 4.1 mmhg to 5.7 mmhg, which translated to a mean iop reduction of approximately 25%. studies of patient preference and safety profiles comparing brinz / tim - fc with dorzolamide 2%/timolol 0.5% demonstrated that brinz / tim - fc therapy was favored by a majority of patients with a treatment preference, possibly because brinz / tim - fc was associated with less ocular discomfort.36,40 in the present study, with up to 52 weeks of treatment with brinz / tim - fc, no serious treatment - related adverse events were observed. the most frequently reported treatment - related adverse event was punctate keratitis, which was mild in all cases and did not impede patient compliance. these findings are consistent with clinical studies of 18 months of brinzolamide monotherapy and 60 months of brinz / tim combination therapy.41,42 similar to the current study, these studies demonstrated that long - term brinzolamide, both alone and in combination with timolol, maintained significant iop reductions from baseline and had a favorable safety profile. a potential limitation of this study is the lack of a placebo or active control ; however, given that uncontrolled iop is a significant risk factor for disease progression and vision loss,3,9 long - term placebo - controlled studies in patients with glaucoma or ocular hypertension may not be feasible. long - term ocular hypotensive therapy with twice - daily brinz / tim - fc is efficacious in producing and maintaining significant iop reductions in japanese patients with open - angle glaucoma or ocular hypertension. brinz / tim - fc was generally safe and well tolerated over 52 weeks of treatment. in general, visual field, cup - to - disc ratio, angle grade, and visual acuity were stable throughout the study, and no serious adverse events were observed, indicating that brinz / tim - fc can be used safely for long - term reduction of iop. | backgroundthe purpose of this study was to evaluate the safety and efficacy of a long - term, twice - daily brinzolamide 1%/timolol 0.5% fixed combination ophthalmic suspension (brinz / tim - fc) in japanese patients with open - angle glaucoma (primary open - angle, normal - tension, exfoliation, or pigmentary) or ocular hypertension.methodsthis was a prospective, nonrandomized, multicenter, open - label, phase iii study of japanese patients aged 20 years with diagnoses of open - angle glaucoma or ocular hypertension. patients were treated with topical brinz / tim - fc twice daily for 52 weeks. the primary endpoint was mean reduction from baseline in intraocular pressure. data were analyzed using repeated - measures analysis of variance and t - tests. adverse events and ophthalmic, physiologic, and laboratory parameters were measured throughout the study as safety endpoints. a total of 126 patients (mean sd age, 6312 years) were enrolled, and 125 received brinz / tim - fc.resultsmean intraocular pressure was significantly reduced from baseline at weeks 4 through 52, with changes ranging from 4.1 mmhg to 5.7 mmhg (p<0.0001, all time points). adverse events related to brinz / tim - fc treatment were observed in 22% of patients. no substantial changes from baseline were observed in ophthalmic, physiologic, or laboratory variables.conclusionlong-term, twice - daily brinz / tim - fc therapy produced and maintained significant intraocular pressure reductions and was generally well tolerated in japanese patients with open - angle glaucoma or ocular hypertension. |
leptin is a hormone that was initially found to be synthesized by white adipocytes and has a strong correlation with the amount of adipose tissue and with body mass index (bmi). leptin was first discovered in 1994 and found to act as a signal for the central nervous system to inhibit food intake and to stimulate energy expenditure. more recent findings on the ubiquitous expression of leptin receptors in almost all tissues and on its cellular effects have revealed that leptin is also involved in the regulation of a variety of biological functions related to immune responses and inflammatory diseases, and to cardiovascular and respiratory pathophysiology [25 ]. increased joint loading and altered mechanic loading axis has been proposed to explain the increased risk of oa in weight - bearing joints, including hip and knee joints. surprisingly, there is also a positive association between obesity and oa in the hand, pointing to an obesity related metabolic factor that acts as a risk factor for oa. recently, it has been shown that synovial fluid (sf) from oa patients contains leptin concentrations that are similar or higher than those measured in serum [79 ]. furthermore, low soluble leptin receptor (sob - r) level in sf potentiates the biological activity of leptin in the joint as compared to that in serum. articular cartilage has been reported to produce leptin [8, 10 ] and express functional leptin receptor ob - r, and the expression of these two is further increased in advanced oa correlating with bmi of the patients. in vitro, leptin has been shown to potentiate interleukin-1 (il-1) and interferon (ifn)-induced production of nitric oxide (no) in chondrocytes, which is a proinflammatory and destructive mediator in cartilage [12, 13 ]. leptin has been shown to decrease chondrocyte proliferation and to increase production of proinflammatory cytokine il-1 and destructive matrix metalloproteinases 9 and 13 (mmp-9 and 13) in human chondrocytes [9, 14 ]. on the other hand, leptin has also been reported to increase proliferation and to enhance proteoglycan and collagen synthesis in human chondrocytes. in vivo, leptin injection into rat knee was reported to increase synthesis of insulin - like growth factor 1 (igf - i) and transforming growth factor (tgf) both contributing to increased proteoglycan synthesis. these effects are linked to increased cartilage matrix production, and also to osteophyte formation. inducible nitric oxide synthase (inos) is expressed in oa cartilage, and there are markers of enhanced no production in oa joints [15, 16 ]. prostaglandins (pgs), especially pge2, mediate inflammation, tissue destruction, and pain in oa and in oa joints they are formed by cyclooxygenase (cox) enzymes (particularly cox-2) and prostaglandin synthases. interleukin-6 (il-6) and interleukin-8 (il-8) are produced by oa cartilage and have a proinflammatory and modulatory role in the pathogenesis of oa [10, 18 ]. the presence of bioactive leptin in oa joint and the effects of leptin on cartilage metabolism point to a pathophysiological role for leptin in oa. the aim of the present study was to investigate the effects of leptin on mediators of cartilage metabolism by measuring its effects on the production of no, pge2, il-6, and il-8 in oa cartilage and by evaluating the signaling mechanisms involved in these effects by pharmacological means. the study was approved by the ethics committee of tampere university hospital, and the patients gave their written approval. the donor patients, age ranging from 53 to 87 years and body mass index ranging from 20 to 32, were all diagnosed to have osteoarthritis. cartilage samples were washed with phosphate buffered saline (pbs) and processed for the experiments within two hours after the operation. full thickness pieces of articular cartilage from femoral condyles, tibial plateaus, and patellar surfaces showing macroscopical features of early oa were removed aseptically from subchondral bone with a scalpel and cut into small pieces (about 2 2 2 mm). cartilage cubes randomly selected from 3 different areas of the joint were incubated in one well of a 6-well plate in 3 ml of tissue culture medium (dulbecco 's modified eagle 's medium (dmem) with glutamax - i containing 10% heat - inactivated fetal bovine serum, penicillin (100 units / ml), streptomysin (100 g / ml), and amphotericin b (250 ng / ml) ; all obtained from invitrogen, carlsbad, calif, usa)) at 37c in humidified 5% carbon dioxide atmosphere. in the first two series of experiments, oa cartilage explants from 8 patients were incubated with leptin (0.1 g / ml or 10 g / ml) alone or in combination with il-1 (10 pg / ml) for 48 hours. concentrations of no, pge2, il-6, and il-8 were determined in the culture medium. in the third series of experiments oa explants from 3 patients were incubated with leptin (0.1 g / ml or 10 g / ml) alone or in combination with il-1 (10 pg / ml) for 48 hours. cartilage samples were used to determine expression of inos and cox-2 protein. in the fourth series of experiments, signaling mechanisms involved in the leptin - induced no, pge2, il-6, and il-8 production were studied using pharmacological inhibitors. oa explants from 7 patients were incubated for 48 hours with leptin (10 g / ml) and following signaling pathway inhibitors : sp600125 10 m (jnk inhibitor), sb220025 0.5 m (p38 inhibitor), pd98059 10 m (erk1/2 inhibitor), ag490 10 m (jak2 inhibitor), whi - p154 10 m (jak3 inhibitor), ro 31 - 8220 1 m (pkc inhibitor), mg132 10 m (nf-b inhibitor), and pdtc 10 m (nf-b inhibitor). concentrations of no, pge2, il-6, and il-8 were determined in the culture medium. in the fifth series of experiments, the effect of no on leptin - induced (10 g / ml) il-6, il-8, and pge2 production was studied by inhibiting leptin - induced endogenous no production with a selective inos inhibitor 1400 w (1 mm) during a 48 hour incubation of oa explants from 8 patients. the effect of no was further investigated by studying if exogenous no could reverse the effects of inos inhibitor 1400 w in leptin - treated cartilage. this was made by adding no - donor snap (100 m) together with 1400 w and leptin in the cartilage cultures. concentrations of no, pge2, il-6, and il-8 were determined in the culture medium. after the experiment the cartilage explants were weighed, and the results were expressed per mg of cartilage. aliquots of the culture media were kept at 20c until assayed, and cartilage samples for western blotting were first snap frozen in liquid nitrogen and analysed as described below. concentrations of nitrite, a stable product of no in aqueous solutions, were measured using the griess reaction. the amount of pge2 released into the incubation medium was determined by radioimmunoassay, using reagents from the institute of isotopes (budapest, hungary). the concentrations of il-6 (sanquin, pelipair, amsterdam, the netherlands) and il-8 (r&d systems, minneapolis, mn, usa) in the culture medium were determined by elisa. the results were expressed as pg of il-6/mg of cartilage, or pg of il-8/mg of cartilage. after incubations, the cartilage specimen were snap frozen in liquid nitrogen, milled and lysed in extraction buffer (10 mm tris - hcl, 5 mm edta, 50 mm nacl, 1% triton - x-100, 0.5 mm phenylmethylsulfonylfluoride (pmsf), 1 mm sodiumorthovanadate, 20 g / ml leupeptin, 50 g / ml aprotin, 5 mm sodium fluoride, 2 mm sodium pyrophosphate, 10 m n - octyl - beta - d - glucopyranoside). following incubation on ice for 15 minutes, samples were centrifuged and supernatants were mixed with sample buffer 1 : 4 (62.5 mm tris - hcl, ph 6.8, 10% glycerol, 2% sds, 0.025% bromophenol blue, and 5% -mercaptoethanol) and stored at 20c until analyzed. coomassie blue method was used to measure the protein content of the samples. after boiling, protein samples (20 g) were separated with 8% sds - polyacrylamide electrophoresis gels and transferred to hybond enhanced chemiluminescence nitrocellulose membrane (amersham biosciences uk limited, buckinghamshire, uk). proteins were identified by western blotting using rabbit polyclonal antibody for human inos and goat polyclonal antibody for human cox-2 (both obtained from santa cruz biotechnology, santa cruz, calif, usa). actin was analysed as a loading control by using rabbit polyclonal antibody (santa cruz biotechnology, santa cruz, calif, usa). bound antibody was detected using supersignal west pico chemiluminescent substrate (pierce, rockford, il, usa) and fluorchem 8800 imaging system (alpha innotech, san leandro, calif, usa). results are expressed as mean standard error of the mean (sem). recombinant human leptin and recombinant human il-1 beta were purchased from r&d systems ; manufacturer ensures low endotoxin level of the products (< 1.0 eu per 1 g of the recombinant protein), and that amount in relation to the leptin concentrations used in the present study was tested to have no effect in our tissue culture conditions. other reagents were obtained as follows : sp600125, sb220025, ag 490 and whi - p154 were from calbiochem (merck, darmstadt, germany) ; pd 98059 was from promega (madison, wi, usa) ; ro 31 - 8220 was from alexis corporation (lausen, switzerland) ; mg 132 was from tocris bioscience (ellisville, mo, usa) ; pdtc was from sigma chemical co (st louis, mo, usa) ; snap was from cayman chemical (ann arbor, mi, usa). 1400 w was kindly given by dr richard g knowles, glaxo smithkline research & development, stevenage, uk. leptin (0.1 g / ml and 10 g / ml) enhanced no production in oa cartilage in a dose - dependent manner (figure 1(a)). western blot analysis with human inos antibody showed that leptin (10 g / ml) induced also inos expression in cultured cartilage tissue (figure 1(b)). in addition, leptin (10 g / ml) increased pge2 production and cox-2 expression, and il-6 and il-8 production in human oa cartilage during 48 hours incubation (figures 1(c), 1(d), 1(e), and 1(f)). a low concentration of proinflammatory cytokine il-1 (10 pg / ml) had a slight stimulatory effect on no, pge2, il-6, and il-8 production and inos and cox-2 expression (figure 2). leptin (10 g / ml) enhanced no, pge2, il-6, and il-8 production, and inos and cox-2 expression in oa cartilage also in the presence of il-1 (figure 2). the involvement of signaling pathways (jnk, p38, and erk1/2 map - kinases, jak2 and jak3, pkc, and transcription factor nf-b) in leptin - stimulated no, pge2, il-6, and il-8 production in oa cartilage was studied by pharmacological means. inhibitors of transcription factor nf-b, mg 132 (10 m) and pdtc (100 m), and jnk inhibitor sp600125 (10 m) significantly inhibited leptin - induced no, pge2, il-6, and il-8 production (figure 3). in addition to the effect of jnk inhibitor, inhibitors of other map - kinases, that is, sb220025 (p38 inhibitor ; 0.5 m) and pd 98059 (erk1/2 inhibitor ; 10 m) inhibited leptin - induced pge2 production, but had no effect on no, il-6, or il-8 production. jak2 inhibitor ag 490 (10 m) had no effect on leptin - induced no, pge2, il-6, or il-8 production, whereas jak3 inhibitor whi - p154 (10 m) inhibited leptin - induced no synthesis, but not pge2, il-6, or il-8 production. leptin - induced no, il-6, and il-8 production was inhibitable with protein kinase c inhibitor ro 31 - 8220 (1 m), while it had no effect on pge2 production. a selective inos inhibitor 1400 w (1 mm) inhibited leptin - induced no production almost completely indicating that it was synthesized through inos pathway (figure 4(a)). interestingly, inhibition of no production with 1400 w reduced also the production of il-6, il-8, and pge2 (figures 4(b)4(d)). the effect of 1400 w was reversed when no - donor snap (100 m) was added into the culture. those results suggest that the increasing effect of leptin on il-6, il-8, and pge2 production in human oa cartilage is dependent on no. the course of the destructive process is determined by the balance between anabolic and catabolic mediators and their regulators in the joint, and the local distribution of these mediators in the cartilage. leptin is an obesity related mediator, which has been suggested to take part in the regulation of anabolic and catabolic processes within the osteoarthritic joint and to play a role in the pathogenesis of oa. in the present study, we found that leptin induced the production of no, pge2, il-6, and il-8 in human osteoarthritic cartilage and that leptin - induced pge2, il-6, and il-8 production was dependent on no. no mediates many of the destructive effects of il-1 in inflamed joints [15, 16 ]. no has been reported to increase the production of matrix metalloproteinases (mmps) and to activate them [10, 22, 23 ], to inhibit proteoglycan [2426 ] and collagen synthesis and to induce chondrocyte cell death [28, 29 ]. no is also involved in the progress of inflammation by reducing the production of anti - inflammatory / anabolic factors tgf-, endogenous il-1 receptor antagonist (il-1ra), and il-10 in chondrocytes [10, 31, 32 ], and by contributing to the resistance against anabolic effects of igf-1. no has also been shown to sustain activation of nf-b providing a prolonged transcription of nf-b dependent genes. in support, pelletier. reported reduced destruction of the articular cartilage by using inos - inhibitor l - nil in instability - induced oa in dogs. in further studies with this model, l - nil was shown to reduce the levels of matrix metalloproteinase-1 and -3 (mmp-1 and -3), to inhibit chondrocyte apoptosis and to reduce the interleukin-1 converting enzyme (ice) levels. van den berg. studied the development of experimental osteoarthritis induced with intra - articular collagenase injection in inos knock - out mice. in this model, no has several catabolic and antianabolic actions in cartilage and thus it is identified as a possible target of treatment in osteoarthritis. leptin has been shown to induce or to potentiate together with interferon (ifn), with tumor necrosis factor (tnf) or with ifn and il-1, no production in murine j774a.1 macrophages, rat adipocytes, c6 glioma cell - line, and rat vascular smooth muscle cells (vsmcs) [3942 ]. in human chondrocytes, leptin was reported to enhance interleukin-1 (il-1) and interferon (ifn)-induced production of no [12, 13 ]. in the present study, we showed that leptin alone is sufficient to induce the inos expression and no production in human oa cartilage, and an enhancing effect was seen also in the presence of low concentrations of il-1 (figures 1(a), 1(b), and 2(a), 2(b)). prostaglandins (especially pge2) are produced in high amounts in oa cartilage and are modulators of inflammation, tissue destruction, and inflammatory pain. prostaglandins are formed from arachidonic acid by the prostaglandin synthesizing cyclooxygenase (cox) enzymes and prostaglandin synthases. cox-2 is highly expressed in oa cartilage and is induced by various cytokines that are involved in destructive processes in oa cartilage, for example, il-1 and tnf [4345 ]. current drug therapy of oa is based on nonsteroidal anti - inflammatory drugs (nsaids). nsaids inhibit cox enzymes and prostanoid production, and they are used to relieve oa pain [46, 47 ]. to our knowledge, we show here for the first time that leptin increases cox-2 expression and pge2 production in human oa cartilage in the absence and in the presence of il-1 (figures 1(c), 1(d) and 2(c), 2(d)). previously, leptin has been shown to induce pge2 production in oe33 barret 's esophageal adenocarcinoma (eac) cell - line and in murine j774a.1 macrophages [39, 48 ]. oa cartilage produces il-6 and il-8, and quantitative rt - pcr studies have shown elevated il-6 and il-8 mrna levels in oa cartilage as compared to normal cartilage [10, 50 ]. cytokines il-1 and tnf which induce destructive effects in cartilage both induce il-6 and il-8 production in human articular chondrocytes. il-6 and il-8 may promote inflammation and cartilage destruction induced by il-1 or tnf and have a modulatory role in the pathogenesis of oa [18, 5254 ]. in the present study, we show for the first time that leptin enhances il-6 and il-8 production in human oa cartilage (figures 1(e), 1(f) and 2(e), 2(f)). leptin has previously been shown to induce il-6 production in human dendritic cells, human monocytes, human endometrial stromal cells (esc), and in epithelial cells [5557 ], and to stimulate il-8 production in human endometrial stromal cells (escs) and in epithelial cells. leptin signaling through leptin receptors (ob - r) is thought to be mediated through janus kinase / signal transducer and activator of transcription (jak / stat) pathway and in addition to this, also mitogen - activated protein kinases (mapks), protein kinase c (pkc), phosphatidylinositol 3-kinase (pi3k), and nuclear factor b (nf-b) pathways have been reported to mediate some effects of leptin, depending on the cell type [3, 58 ]. in chondrocytes, otero. showed by using pharmacological inhibitors that induction of no production with a combination of leptin and il-1 or ifn was dependent on jak2, pi3k, erk1/2, and p38 [12, 13, 59 ], but these studies did not show signaling pathways involved in the responses induced by leptin alone. we studied the effects of inhibitors of jak (jak2 and jak3), mapk (erk1/2, p38, jnk), pkc and nf-b pathways on leptin - induced no, pge2, il-6, and il-8 production in oa cartilage. there seems to be some differences in the signaling pathways important for production of the four different leptin - induced inflammatory molecules in oa cartilage. leptin - induced no production was suppressed by inhibitors of jnk, jak3, pkc, and nf-b, while leptin - induced pge2 production was reduced by inhibitors of jnk, p38, and erk1/2 mapkinases and transcription factor nf-b. leptin - induced il-6 and il-8 production was reduced by inhibitors of jnk, pkc, and nf-b (figure 3). in the present study, inhibition of leptin - induced endogenous no production in oa cartilage with a selective inos inhibitor 1400 w also suppressed the effects of leptin on pge2, il-6, and il-8 production. the effect was reversed with exogenously added no (no - donor snap) (figure 4). those results suggest that leptin induces pge2, il-6, and il-8 production in oa cartilage by an no - dependent manner. the mediator role of no in leptin - induced metabolic changes in human oa cartilage has not been reported previously. it is, however, supported by the previous findings on the involvement of no in the effects of leptin in some other organ systems, that is, in the secretion of luteinizing hormone - releasing hormone from the pituitary gland, in the control of blood pressure, and in the gastroprotection upon vagal activity [6062 ]. in conclusion, oa cartilage was shown to respond to leptin by producing increased amounts of no, pge2, il-6, il-8, and all those effects can be considered harmful in cartilage metabolism. those effects of leptin seem to be dependent on activation of transcription factor nf-b and the mapk pathway c - jun nh2-terminal kinase (jnk) in human oa cartilage. in addition, jak3 signaling seems to be involved in leptin - induced no production, p38, and erk1/2 mapk pathways in leptin - induced pge2 production, and pkc pathway in leptin - induced no, il-6, and il-8 production. inhibition of no production reduced the effects of leptin on pge2, il-6, and il-8 production pointing to a mediator role of no in these leptin - induced changes in cartilage metabolism and to a possible beneficial effect of inos inhibitors on oa cartilage. these findings support the idea of leptin as a factor in the pathogenesis of osteoarthritis, and as a possible link between obesity and osteoarthritis. | obesity is an important risk factor for osteoarthritis (oa) in weight - bearing joints, but also in hand joints, pointing to an obesity - related metabolic factor that influences on the pathogenesis of oa. leptin is an adipokine regulating energy balance, and it has recently been related also to arthritis and inflammation as a proinflammatory factor. in the present paper, the effects of leptin on human oa cartilage were studied. leptin alone or in combination with il-1 enhanced the expression of inos and cox-2, and production of no, pge2, il-6, and il-8. the results suggest that the effects of leptin are mediated through activation of transcription factor nuclear factor b (nf-b) and mitogen - activated protein kinase (mapk) pathway c - jun nh2-terminal kinase (jnk). interestingly, inhibition of leptin - induced no production with a selective inos inhibitor 1400 w inhibited also the production of il-6, il-8, and pge2, and this was reversed by exogenously added no - donor snap, suggesting that the effects of leptin on il-6, il-8, and pge2 production are dependent on no. these findings support the idea of leptin as a factor enhancing the production of proinflammatory factors in oa cartilage and as an agent contributing to the obesity - associated increased risk for osteoarthritis. |
iranian traditional medicine (itm) is rich in intact information about plants that have been used to treat various diseases, especially skin disorders. world plant biodiversity is the best source of herbal medicine and still about 60%-80% world population trust on plant based medicines which are being used since the ancient ages as traditional health care system (1). use of traditional remedies and plants in the treatment of burns and wounds is an important aspect of health management and at the same time is an efficient way to provide cheaper healthcare options. several indigenous plants and formulations described in folkloric and ayurvedic systems of medicine have been reported for the management of cuts, bruises, burns and wounds (2). the famous texts on itm claim many of herbs and several formulations as potential wound healing agents (3 - 6). review on itm references showed that herbal therapy was the major treatment prescribed by iranian physicians for wound healing. according to itm references, herbals which were used to treat wounds have shown healing activity as well as flesh growing and cicatrizant properties (3 - 5). topical formulations, traditionally named zemad, marham and zaroor, were the most ancient pharmaceutical dosage forms used in itm for burn and wound healing. according to the belief of many iranian traditional scholars, " hippocrates " was the first who invented marham in order to combine two medicinal components with different therapeutic effects for a single target. based on itm manuscripts, zemad is a combination of fine and pulverized drugs with or without beeswax and oils. marham is a combination of fine and pulverized drugs with beeswax, oils, animal fats or bone marrows. zaroor is combination of fine and pulverized powder drug form which sprayed on the wound area. these topical forms were used for injuries, wounds and some swellings (7). (frankincense) has been prescribed by itm scholars in the form of zaroor or zemad for wound healing (3 - 5). boswellia carteri (burseraceae) is known as kondor in persian language and containing, boswellic acid, the main well - known active component of the resin. anti - inflammatory effects of b. carteri as well as its ethnomedicinal use to treat rheumatoid arthritis and other inflammatory diseases have been proven (8). anti - inflammatory, antinociceptive and antioxidant effects of other species of boswellia have been established as well (10). myrrh (morr in persian) is a yellow - brown aromatic oleo - gum resin obtained from the stems of the genus commiphora, particularly c. myrrha (burseraceae). it has been demonstrated that myrrh has broad spectrum of biological properties including antibacterial, antinociceptive, anti - inflammatory and anti - ulcer activities. moreover, it has been reported that myrrh has antioxidant and immunopotentiating properties (11). aloe vera (liliacea,sabr in persian) has been widely cultivated in china and used as a traditional medicine to induce wound healing. moreover it has been proved as an anti - cancer and anti - viral agent. several studies have been shown that aloe gel (derived from a. vera) improves wound healing after topical and systemic administration. several polysaccharides have been detected or isolated from the gel, including mannan, galactan, glucomannan, arabinorhamnogalactan and glucuronic acid - containing polysaccharide that have antioxidant, anti - microbial, anti - inflammatory, anti - cancer and anti - malaria properties (12 - 14). in general, according to the mentioned effects of the species which are important in wound healing, the formulation containing a. vera, b. carteri and c. myrrha could be a good candidate for wound healing. so, in the present study, a topical poly herbal paste consisting of a. vera gel and b. carteri and c. myrrha oleo gum resins was prepared and in order to develop a method for quality control of the prepared formulation, hptlc fingerprinting of php has been performed. this formulation has been prepared and used in iranian traditional medicine for many years to treat wounds in patients. although we have not carried out any clinical trials yet, the traditional usage of the formulation shows the importance of formulating and standardizing the formulation, as the beginning steps of the mass production insight. m. kamalinejad, department of pharmacognosy, school of pharmacy, shahid beheshti university of medical sciences, tehran, iran. all the reagents, media, solvents and hptlc silica gel 60 f254 plates (2020 cm) were purchased from merck company (germany). preparation of herbal powders the oleo gum resins of myrrh and frankincense were washed with water and dried in room temperature, then they were powdered and passed through 40 mesh sieve. fresh aloe vera leaves were sliced and the gel was separated from other parts of the leaves. temperature of the condenser and average chamber pressure were adjusted at -40 c and 50 ml tour (virtis, benchtop slc). after four days aloe powder obtained from frozen aloe gel and was passed through 40 mesh sieve (15). plant materials analysis the various physicochemical parameters such as loss on drying (all plants), total ash (all three plants), acid insoluble ash (boswellia carteri) and matter insoluble in ethanol (commiphora myrrha, boswellia carteri) were determined according to the plants monographs in british pharmacopoeia (16). formulation of a topical preparation based on itm manuscripts we prepared a poly herbal product for wound healing containing aloe, myrrh and frankincense (10%) which has been used in form of zemad (3). paste was chosen as the most suitable base for preparation of poly herbal formulation due to its similarity to zemad which have been used in itm. hydrophilic paste components were included : herbal powder containing : aloe, myrrh and frankincense (10 %, as mentioned in itm references), glycerin (20 %), methyl and propyl parabens (0.20 % and 0.05 %), sodium metabisulfite (0.26 %), hydrophilic base 69.5%. different concentrations (0.5 %, 1% and 2 %) of the hydrophilic base were made by using carbomer 940. in order to prepare hydrophilic paste, first several concentrations of carbomer 940 (0.5 %, 1 % and 2%) 0.1 m solution was added gradually to the mixture until the gel was formed, also ph was measured to achieve desired ph. in another bowl, herbal powders were triturated and levigated with glycerin. finally, this mixture gradually was added to the gels which were made of several concentrations of carbomer 940. in addition, methyl and propyl parabens has been dissolved in ethanol and added to the formulation as microbial preservative, also sodium metabisulfite has been dissolved in distilled water and added to the formulation as an antioxidant. oily paste components were contained : herbal powders (10 %) containing ; aloe, myrrh and frankincense, vaseline, oserin, beeswax, glycerin, methyl and propyl parabens. herbal powders were triturated well, then powders were levigated with glycerin. in the other bowl, vaseline, oserin and beeswax finally methyl and propyl parabens has been dissolved in ethanol and added to the formulation as a microbial preservative, and bht has been dissolved in ethanol and added to the formulation as an antioxidant. these formulations were evaluated with some of the tests, containing physical stability of formulations (thermal stability, mechanical stability). the physical stability of formulations was evaluated by testing the physical changes like phase separation, color, odor, and consistency. short term thermal stability in short term stability tests, samples of the paste formulations were submitted to temperature of 40 c for 1 week and then were put to temperature of 4 c for 1 week. after fourteen days, samples were observed for changes like phase separation, color, odor, etc. mechanical stability in mechanical stability, samples of the paste formulations were weighed and put in centrifuge. centrifugation was performed at 3750 rpm for 15 min to evaluate the accelerated deterioration of the paste with a hettich centrifuge. after centrifugation process, the mechanical changes of the paste like phase separation were investigated. determination of ph the ph of formulated paste diluted 1:10 in distilled water was measured using a digital ph meter. viscosity measurement and evaluation of rheological properties of php the viscosity of php was measured at room temperature in triplicate, using a cone / plate brookfield dv- ultra programmable rheometer (brookfield, usa). different shear rates and shear stresses were applied on the sample, and the resulting rheogram was constructed to determine the rheological behavior and viscosity of the php. microbiological tests microbial limit tests including : total aerobic viable count (tavc) and tests for specified bacteria (staphylococus aureus, pseudomonas aeroginosa and candida albicans) were performed on php according to who guideline (17). sabouraud dextrose agar, mannitol salt agar and cetrimid agar were used as selective and differential media for candida albicans, staphylococus aureus and pseudomonas aeroginosa, respectively. php was diluted with normal saline (1:10) and cultured in the special medium. hptlc fingerprinting of poly herbal paste in order to extract php components for hptlc, php was extracted with methanol. for this purpose, 5 g of php was weighed in a flask, and then 20 ml of methanol was added to it. flask was put in sonicator for 15 min to extract the phytochemical constituents of php, then the supernatant was removed and poured into a centrifuge tube and centrifugation was performed for 10 min. after wards, the supernatant of centrifuged solution was removed and concentrated at room temperature (4 : 1). in addition, methanol extracts of a. vera, c. myrrha and b. carterri were processed and used as standard materials. thin layer chromatography was performed by spotting methanol fractions of poly herbal paste and standards on pre - coated silica gel plate using camag linomat 5 automatic sample spotter and 100 l hamilton syringe. the samples, in the form of band of length 8 mm, were spotted 10 mm from the bottom using nitrogen aspirator. the development was carried out using mobile phase systems (toluene : ethyl acetate : heptan : formic acid 80:20:10:3) and (n - butanol : n - propanol : acetic acid : water 30:15:10:5), respectively. at the first, plates were developed with solvent system to the distance of 185 mm in order to separate less polar constituents. then they were dried and developed with solvent system to the distance of 90 mm to detect higher polar substances. pre - saturation of the chromatographic chamber was performed for both systems for 30 min. the plates were sprayed with methanolic sulfuric acid 10 % reagent, and then the plates were put on the heater with 105 c for 3 to 5 min. densitometric scanning was performed on camag tlc scanner iii with wincats 1.3.0 software (camag, switzerland) at 366 nm in the fluorescence mode with slit dimension of 6.000.20 mm, micro. analysis of plant materials the results of analysis of the plants, used in the formulation have been shown in table1. analysis of a.vera, b.carteri, c.myrrha formulation of a topical preparation paste with hydrophilic base has demonstrated to be more stable than the oily base. also the hydrophilic base has more acceptance than the oily base among the patients, nowadays. recent investigations have been reported that moisture and good hydration are necessary factors for re - epithelialization and angiogenesis, so these factors could be considered as the most important external factors responsible for optimal wound healing (17 - 19). the moist regulation of wound has been reported to have multiple advantages namely prevention of tissue dehydration and death, alleviation of pain sensation, promotion of angiogenesis, breakdown of dead tissue and fibrin, and interaction between growth factors and target cells (20). for this purpose, paste containing oily base has not been shown good results in thermal and mechanical stability tests. among several pastes containing different concentration of hydrophilic base, gel 2 % has been investigated to be the most stable base towards thermal and mechanical changes. passing through short term thermal and mechanical stability tests, the paste containing 69.5 % of hydrophilic base (gel 2% made with carbomer 940), 10 % active ingredients (containing a. vera gel, b. carteri oleo gum and c. myrrha oleo gum), 20 % of glycerin, 0.26 % of sodium metabisulfite, 0.20 % of methyl paraben and 0.05 % of propyl paraben showed the most stability towards physical changes, so it was selected as poly herbal paste (php) for viscosity measurement and fingerprinting studies. in addition to its appropriate consistency and ph value (5.00 0.05), the final formulation was spread easily on the skin. determining the rheological behavior of php the determination of rheological behaviors is one of the most important evaluation characteristics of topical products (22). rheological behavior of topical formulations has a substantial effect on the spread ability of the formulation, its retention and contact time on the skin surface (23). the rheogram of php has been shown in figure 1. according to the figure, the rheogram of php was non - linear indicating non - newtonian behavior. since the curve did not start from the origin of the coordinates, it could be concluded that php showed the plastic (bingham) rheological behavior. rheogram of poly herbal paste, (containing aloe, myrrh and frankincense), showing the presence of a plastic behavior. (n = 3, data points are presented as mean sd the calculated viscosity and bingham yield stress of php were 0.78 pa.sec and 183.06 pa, respectively, obtained from the slope and y - intercept of the equation (y = 0.78x+ 183.06) corresponding to the linear part of php rheogram (figure 2). since the amount of bingham yield value was greater than real yield value, the results were not reliable. the linear part of poly herbal paste, (containing : aloe, myrrh and frankincense), (n = 3, data points are presented as mean sd in order to measure the real yield value of php, the log10 values of shear stress were plotted against the log10 values of shear rate (figure 3). by calculating the antilog of y - intercept of the equation (y = 0.3456x+ 1.7497) corresponding to the linear plot, the real yield value was determined (73.5 pa). the linear plot of log shear stress - log shear rate for poly herbal paste, (containing aloe, myrrh and frankincense), (n = 3, data points are presented as mean sd hptlc fingerprinting of poly herbal paste the fingerprint provided a means of a convenient identity check for the finished product. the hptlc fingerprint can be used efficiently for the identification and quality assessment of the formulation (24). also hptlc study of the extracts and poly herbal formulation was carried out to ensure the correlation between them (25). the detection of php contents with different polarities was performed by utilizing methanol fraction of the paste. for spotting the php fractions and standards, different volumes (10 - 100 l) finally, volume of 15 l was chosen for b. carteri, a. vera and c. myrrha methanol extracts, while 10 l was the best volume for php fractions. among several investigated solvent systems, system (toluene : ethyl acetate : heptan : formic acid 80:20:10:3) and (n - butanol : n - propanol : acetic acid : water 30:15:10:5) were found to be the most selective and repeatable systems for detecting low and high polar substances, respectively. development of the plate was performed with systems and in two stages which led to detection of less polar compounds in the upper half of the plate and medium and higher polar substances in the lower half. sulfuric acid reagent was used and the plate heated at 105 c for 3- 5 min which appeared in different colored spots (under uv light at 366 nm). the hptlc chromatograms of php and standards have been shown in (figure 4). the peaks that existed both in the standards and php with reasonable heights and good resolution were assigned as " characteristic peaks " for identification of each plant extract in php. the chromatograms showed the characteristic peaks of the plant extracts with max rf values of 0.22, 0.52 and 0.75 related to a. vera, b. carteri and c. myrrha extracts, respectively. it was observed that the chromatogram of the formulation matched exactly with that of each plant extract as shown in fig.4. thus hptlc studies confirmed that there was good correlation between extracts and php formulation. hptlc fingerprint of poly herbal paste including aloe vera ; boswellia carteri ; commiphora myrrha ; and the plant extracts. arrows show the characteristic peaks of the plant extracts in php chromatogram (a : aloe vera ; b : boswellia carteri ; c : commiphora myrrha) in the current study, we prepared a poly herbal paste for wound healing, based on the iranian traditional medicine (itm). this formula has been made from the powders of aloe vera gel, boswellia carteri and commiphora myrrha oleo gum resins which containing several polysaccharides, boswellic acid, sesqui- and triterpenoids compounds. stability and rheological behavior evaluations as well as microbiological tests showed that the prepared formulation was stable with no growth of pathogenic microorganisms and suitable for topical application. hptlc fingerprinting of php confirmed the presence of compounds corresponding to each of the plants used in the formulation. moreover, characteristic peaks were observed in php profile, so hptlc fingerprint could be used as an applicable method for quality control assessment of the prepared formulation. regarding to the antioxidant, anti - inflammatory and antimicrobial effects of the mentioned plants (8, 10, 12 - 14 and 26 - 28), php could be an appropriate candidate for wound healing with respect to its traditional use in itm. | herbal therapy was the common treatment prescribed by iranian physicians for wound healing. zemad was the most ancient pharmaceutical dosage form used in iranian traditional medicine (itm) for skin diseases. in the present research, formulation of a traditionally used poly herbal paste (php) for wound healing was performed. moreover, the fingerprint of the product was prepared by hptlc method for identification and quality assessment of the formulation. 3.33 % of each plant materials containing aloe vera, boswellia carteri and commiphora myrrha were used in a hydrophilic base. the physical stability and rheological behavior of the formulation was evaluated. moreover, microbiological tests was performed. methanol fraction of a. vera, c. myrrha and b. carterri were used as standard materials in hptlc method. stability and rheological behavior evaluations as well as microbiological tests showed that the prepared formulation was stable towards physical changes with no growth of pathogenic microorganisms and suitable for topical application. hptlc fingerprinting of php confirmed the presence of compounds corresponding to the plants used in the formula. regarding to the antioxidant, anti - inflammatory and antimicrobial effects of the constituents of php, the product could be an appropriate candidate for wound healing with respect to its traditional use in itm. in addition, hptlc fingerprinting could be used as an applicable method for quality control assessment of the prepared formulation. |
monoclonal immunoglobulin deposition disease, (midd) is a systemic disease characterized by non - fibrillar, congo red negative deposition of monoclonal immunoglobulins in the various organs of the body. midd is of three types depending on the composition of the deposits : light chain deposition disease (lcdd), heavy chain deposition disease (hcdd) and light and heavy chain deposition disease (lhcdd). of these three types, lcdd is usually seen in association with multiple myeloma or other lymphoproliferative disorders, and presents with renal involvement in the form of proteinuria and renal insufficiency. microscopic hematuria is seen in 60% of the cases, while gross hematuria is rare. we hereby present a young male who developed gross hematuria and rapidly progressive renal failure and was diagnosed to have non - myeloma related lcdd. a 31-year - old male presented with 1 week history of anorexia, headache, and gross hematuria. he did not have history of fever, urinary tract infection, stone disease, rash, arthralgia, night sweats, and weight loss, nor was there any significant past history. he was a non - smoker and non - alcoholic, and family history was not contributory. on examination, his blood pressure was 180/100 mmhg, heart rate was 100/min and he had mild pallor. systemic examination was normal and fundus examination did not reveal any changes of hypertensive retinopathy. g / l), total leukocyte count (9500/dl) and platelet count (2.4 10/dl), but increased serum creatinine (4.8 mg / dl). urine examination revealed proteinuria (4 +) and dysmorphic rbcs (> 80% of rbcs), and his 24-h urine protein excretion was 3.8 g. for evaluation of gross hematuria, he underwent cystoscopic examination, ultrasonography and non - contrast computerized tomography of the genitourinary tract, which were normal. anti - nuclear antibodies, anti - neutrophil cytoplasmic antibodies, anti - glomerular basement membrane antibodies and serum cryoglobulins were negative, so were hepatitis b surface antigen, anti - hepatitis c antibody and human immunodeficiency virus. his renal function further deteriorated, requiring initiation of hemodialysis, and subsequently, a kidney biopsy was performed. the kidney biopsy specimen contained nine glomeruli, and consisted of both cortex and medulla. light microscopy examination of the biopsy revealed that all the glomeruli showed mesangial expansion, hypercellularity and mesangial nodules.. the tubulointerstitial compartment showed fibrosis and atrophy involving 90% of the cases ; however, proteinuria may be absent during the early phase of disease and it does not correlate with the presence of nodular glomerulosclerosis. nephrotic range proteinuria can be seen in up to 23 - 57% of the patients, while microcytic hematuria is seen in around 60% of the patients and gross hematuria is seen rarely. at presentation, 80% of the patients are hypertensive and > 90% have renal insufficiency (serum creatinine > 1.2 mg%) patients with a combination of both lcdd and cast nephropathy usually have more severe disease and renal insufficiency as compared with cases with lcdd alone. other symptoms include hepatomegaly, mild alteration in liver functions, cardiomegaly, conduction abnormalities, heart failure and peripheral neuropathy. the pathological features are dominated by deposition of monoclonal immunoglobulin in various organs. in kidneys, these deposits are mainly in the glomerular basement membrane and tubular basement membrane. the glomeruli are enlarged with diffuse, nodular expansion of the mesangial matrix along with mild cellularity. these nodules are eosinophilic and pas positive, but negative with jones silver methenamine and congo red stains. nodular glomerulosclerosis of lcdd in light microscopy appears similar to nodules found in other glomerular diseases, including diabetic nephropathy, membranoproliferative glomerulonephritis, amyloidosis and fibrillary glomerulonephritis. however, nodules of midd do not stain with congo red and silver stain, which differentiates it from amyloidosis (congo red positive) and diabetic nephropathy (jones methenamine positive), respectively. the glomerular basement membrane other rare manifestations include immune complex - mediated disease and minimal change glomerulopathy if biopsy is done at an early stage of the disease. the extraglomerular changes include ribbon like thickening of tubular basement membrane and the vessel wall. patients with gross hematuria may have presence of rbc casts in the tubules due to interaction of filtered rbc with tamm - horsfall protein. these rbc casts can themselves generate an inflammatory reaction, leading to damage to the tubulointerstitium. up to one - third of the patients with midd secondary to multiple myeloma may have coexisting light microscopic features of both immunoglobulin deposition and cast nephropathy. presence of crescents in midd has been described mainly in association with alpha heavy chain disease and less commonly, with lcdd. presence of monoclonal immunoglobulin deposits in glomerular and tubular basement membrane is pathognomonic of midd. in cases of lcdd, kappa light chain deposition predominates over lambda light chain (: = 4:1). ultra structural examination shows flocculent to granular to powdery electron - dense material in glomerular basement membrane (100%), mesangium (96%), tubular basement membrane (96%), interstitium (18%), and vascular basement membrane (78%). the goals of treatment in midd are to control proliferation of plasma cells, preserve renal function and improve survival by using chemotherapeutic agents and autologous hematopoietic cell transplantation. treatment of non - myeloma lcdd is not clear ; chemotherapy with alkylating agents and steroids have shown modest results. bortezomib has been tried with success in patients with lcdd along with other chemotherapeutic agents. with therapy, 42% of the lcdd patients had either stabilization or improvement in renal function, 8% had worsening renal function (> 50% increase in serum creatinine from baseline) and 50% progressed to end - stage kidney disease. age and serum creatinine at presentation are important predictors of renal survival, while age and coexisting myeloma are predictors of overall survival. renal recurrence is seen in about 70% of the cases, but is not always associated with rapid graft loss. the median time to reach therefore, renal transplantation could be done to improve quality of life, but should be only carried out after achieving complete remission with chemotherapeutic agents and/or hematopoietic cell transplantation. the highlight of our case is that he was a young person presenting with gross hematuria and rapidly progressive renal failure with renal biopsy showing crescent formation along with mesangial nodules. a cursory examination of such biopsies can be labeled as mesangio - capillary glomerulonephritis with crescent formation. thus, a detailed evaluation with immunofluorescence and electron microscopy, along with a high index of suspicion, is required to properly diagnose such cases. | monoclonal immunoglobulin deposition disease (midd) is an uncommon disease with a peak incidence between the 5th and 6th decades of life. it is characterized by non - fibrillar, congo red negative deposition of monoclonal immunoglobulins in various organs, including in the kidneys. midd can be of three types depending on the composition of the deposits, and includes light chain deposition disease (lcdd), heavy chain deposition disease and light and heavy chain deposition disease, of which lcdd is the most common. renal involvement is a universal finding in midd, and is in the form of renal insufficiency, microscopic hematuria and nephrotic range proteinuria. gross hematuria is a rare occurrence. renal biopsy usually shows nodular sclerosing glomerulopathy on light microscopy and diffuse linear staining of glomerular and tubular basement membrane on immunofluorescence microscopy. we report a young male who presented with rapidly progressive renal failure and gross hematuria and was diagnosed as lcdd with nodular glomerulopathy and crescents on renal biopsy. |
several governmental and scientific bodies are dedicated to ensuring protection of the public from radiation. the international commission on radiological protection was created in 1928 by the international congress of radiology to advance the science of radiation protection for the public by publishing peer reviewed radiation articles. the united states atomic regulatory commission was established in 1946 with a mission to encourage nuclear power and also protect the public. eventually strong concerns about the dual roles of the commission resulted in congress dissolving this commission and forming another, the united states nuclear regulatory commission (usnrc). the usnrc began operation in 1975 and is responsible for protection and measurement, with regulatory involvement in nuclear facilities and protection of public health and safety. in 1955, the general assembly of the united nations established the united nations scientific committee on the effects of atomic radiation (unscear), which releases reports on important current topics of concern such as the fukushima - daiichi nuclear power plant accident. in 1964, the us congress chartered the national council on radiation protection and measurements with a mission to develop and disseminate guidance and recommendations on radiation protection and measurement. this group is well known for producing technical documents concerning a vast array of radiation topics. radioisotopes of iodines (stable elemental iodine (i) and radioactive forms of iodine (such as i) are converted in the body to stable iodide (i) and radioiodide (i), primarily in the gut. iodine in the diet refers to several inorganic forms (e.g., iodates) that are converted in the body to iodide) are produced in large quantities by fission reactions of uranium atoms in nuclear reactors and either plutonium or uranium atoms in nuclear detonations. the radioisotopes of iodines are subsequently released into the environment. at three mile island, 6 10 bq was released into the atmosphere over several hours, while at chernobyl 10 10 bq was released over a 10-day period, and most recently at fukushima, several releases occurred totaling 10 10 bq. once in the environment, the radioactive iodines can be inhaled or ingested by consumption of contaminated food and milk. the threat of nuclear detonations or nuclear industrial accidents resulted in laboratory experiments to characterize the health hazards of radionuclides throughout the late 1940s into the 1960s [3437 ]. fresh cow 's milk was considered to be a primary source of radionuclides after cows forage on contaminated vegetation. the first radioiodine and stable iodine (i) experiments with cows to simulate a nuclear detonation or nuclear industrial accident were conducted by bustad.. the authors demonstrated that increasing the intake of stable or dietary iodine resulted in less radioiodide dose in the thyroid gland and milk. the use of stable iodine as a blocking agent for thyroidal uptake of radioiodide was an area of active research in the 1950s and 1960s [16, 30, 38 ]. unknown at this time, iodide in systemic circulation, radioactive or stable, is sequestered into the thyroid gland and mammary tissue by the sodium iodide symporter protein (nis), a basolateral transport protein. the stable form of systemic iodide competes with radioiodide for transport into the thyroid gland via the nis. additionally excess stable systemic iodide can cause a transient shut - down in the thyroid gland referred to as the wolff - chaikoff effect. once in the thyroid gland excess stable iodide can also bind to thyroglobulin, the protein backbone for synthesis of thyroid hormones, and reduce the extent of binding of radioiodides to thyroglobulin. thyroid cancer in children and adolescents is one of the most severe health outcomes resulting from releases of radioiodines after a nuclear mishap or detonation. children 's increased sensitivity to thyroidal radiation is one of the most important scientific findings from the chernobyl nuclear accident. the rates of thyroid cancer were greater than expected in children exposed to radioactive isotopes of iodide [42, 43 ]. a workshop report found evidence for mild goiter in the regions ' children suggesting mild to moderate iodide deficiency. some of the conclusions in the workshop report were that iodide deficient children with goiter may result in less radiation dose per mg weight of the thyroid gland or an altered distribution of radioiodides within the report also noted that thyroidal uptake of systemic radioiodide may be greater in iodide deficient children compared to euthyroid children. in addition to radioiodide dosimetry concerns in iodide deficient children the thyroid glands of these children may be more susceptible to exposure of radioiodines. potassium iodide (ki), a thyroidal radioiodide blocking agent, is recommended by the united states food and drug administration (us fda) as a drug to reduce the thyroid radioiodide dose in children and adults. in this paper, we integrate interdisciplinary information from health physics, basic and clinical thyroid endocrinology, physiology, public health, and mathematical modeling. this review focuses on the biology of the hypothalamic - pituitary - thyroid (hpt) axis in children, selected clinical and field studies with ki and radioiodine tracer, and current knowledge about ki use in children. protecting children from the potential harmful effects of radioiodines, drugs, or chemicals is not as simple as treating children as small adults. how children differ from adults in their overall kinetic and dynamic responses to drugs and chemicals remains a concern for conducting appropriate safety or risk assessments. growth from birth to adolescence alters, to varying degrees, the pharmacokinetics of therapeutic drugs and chemicals. several physiological processes undergo maturation including breathing rate, cardiac output, blood flows to tissues and organs, and organ or tissue volumes. table 1 provides examples of some important physiological changes that occur during maturation of infants and children. on a per kg basis, cardiac output, ventilation rates, blood flow rates to organs, and organ volume are greater in early life (table 1). other aspects of physiology gradually increase with age such as glomerular filtration (table 1) and kidney transporter proteins, which both affect the pharmacokinetics of drugs and chemicals. for example, cytochrome p450 (cyp) cyp3a is an important drug metabolizing enzyme. one isoform (cyp3a7) is active in utero and decreases the first week of life, while another isoform, cyp3a4, increases rapidly the first year of life. much is known about age - dependent changes in gross physiology ; however, no data were found on the blood flow rate to the thyroid gland in infants and children. measurements of blood flow rate for the thyroid gland in infants and children would help clarify if the rate of delivery of systemic radioiodide to the thyroid gland (normalized to the weight of the thyroid gland) is different than in adults. iodine is an essential element for life and its retention in the body is controlled by urinary excretion and sequestration into the thyroid gland by the nis protein. iodide can be sequestered into other nis containing tissues (e.g., mammary tissue and gut lumen), but organification does not take place. transfer of iodide (and to some degree thyroid hormones) to the nursing infant represents an important physiological process for dietary iodide intake for the nursing infant. in the body, systemic levels of iodide originate from dietary ingestion of iodide and the release of iodide atoms from deiodination of thyroid hormones. the function of the hpt axis has been studied by independently evaluating several aspects of the hpt axis. this includes measuring the uptake of trace amounts of radioiodide into the thyroid gland, intake of stable iodide, the excretion of stable iodide into urine, serum levels of stable iodide, thyroid pools of stable iodide, and rates of thyroid hormone secretion. the state of knowledge about the age - dependent changes in the hpt axis is discussed below. tracking trace amounts of radioactive iodide uptake (raiu) into the thyroid gland in a clinical setting is expressed as percent of administered radioiodine dose. this measurement reflects the ability of the thyroid gland to sequester radioiodide and is a fundamental functional aspect of the thyroid gland. the measured fraction of administered radioiodine dose in the thyroid gland is a consequence of nis mediated transport of radioiodide and its organification. in a study conducted in the united states, fields. reported a mean 24 hr raiu value of 31.1% for 60 children, which did not differ from the mean 24 hr raiu value for 64 euthyroid adults (32.2%). the same authors reported a mean 24 hr raiu value of 76.1% for hyperthyroid adult (n = 62), which compares favorably to their findings for hyperthyroid children (87%, n = 5). fields. stated that for euthyroid children under the age of 4 increased hyperactivity of the thyroid gland was evident and this hyperactivity may persist until age 9. these authors also stated that thyroid activity in older children aged 10 to 18 was similar to adults. fields. also summarized 8 child raiu studies reported from the late 1940s to early 1950s. in general these earlier studies reported raiu values less than the values fields. reported, except for premature infants and newborns. van middleworth reported a mean raiu value of 69.7% in 7 newborns from the united states and martmer reported a mean raiu value of 38.6% for 16 premature infants from the united states. twenty - four - hour raiu values for 5 children from the united states, 2 years of age, were reported to range from 15 to 23%. twenty - six children, aged 9 to 15 years, had a mean 24 hr raiu value of 52.9%. ingenbleek and beckers reported a mean 24 hr raiu value of 39.6% for children aged 1.5 to 2 years (n = 6) from the republic of senegal. cuddihy reported a mean raiu value of 23.5% in 4 children aged 7 to 9 years from the united states. sternthal. determined a mean 24 hr raiu value of 20.0% in adults from the united states. reported a range of raiu values in 37 adults from the united states of 18.1 to 21.6%. in a recent german study, a mean raiu value of 24.8% raiu values reflect the ability of the thyroid gland to form precursor thyroid hormones (organify radioiodide) and the functionality of the nis symporter proteins. some studies show that the raiu in the young is greater than in adults (table 2) suggesting that infants and children may be at a greater risk of radiation exposure. another measure of thyroidal uptake of radioiodide is the thyroidal clearance of radioiodide, defined as a volume of serum or plasma cleared of radioiodide per unit time and is calculated by monitoring radioiodide uptake into the thyroid gland and clearance of radioiodide from the serum. reported thyroidal radioactive iodide clearance values of 30.3 and 25.3 ml / min for adolescents and adults and when expressed as ml / min / kg, the values were 0.80 and 0.35. the authors also calculated 24 hr accumulation rates of dietary (stable) iodide in the thyroid gland of 1.0 and 0.65 g / kg / day for adolescents and adults. investigated the iodide kinetics in 21 newborns and infants, and pharmacokinetic parameters were compared to values reported earlier for adolescents and adults. the thyroidal clearance of iodide, expressed in units of ml / min / kg, was found to decrease with increasing age. ingenbleek and beckers reported thyroidal radioiodide clearance values of 21.5 ml / min for normal children and 7.3 ml / min for malnourished children. thyroidal clearance of radioactive iodide (uptake of radioiodide into the thyroid gland and its clearance from blood) appears to be a better measure of the thyroidal uptake of radioiodide than raiu because the rate at which this happens is captured and can be used in quantitative and dynamic evaluations of radioiodide dosimetry. these studies indicate that the uptake of thyroidal iodide occurs at a faster rate in the young than adults when normalized to body weight. the neonatal kidneys are anatomically and functionally immature, exhibiting a disproportionately low glomerular filtration rate (about 30% of the adult level) and relatively low blood flow compared to the adult [51, 52 ]. the level of glomerular filtration increases very rapidly, especially within the first three months of life. age related differences in renal clearance of iodide from the plasma or serum have been documented. evaluated dietary iodide in many subjects from australia and the united states, using a linear statistical model. despite the immature glomerular filtration, the authors concluded that the renal clearance of iodide decreased with increasing age by about 0.7% per year. also, hypothyroid individuals had a lower renal clearance rate of iodide compared to euthyroid individuals. reported renal clearance values of 25.5 and 29.7 ml / min for adolescents and adults and on a ml / min / kg basis, the values were 0.65 and 0.41 for adolescents and adults. similar to the thyroidal clearance of iodide, the renal clearance of iodide was also found to be higher in the young, particularly between the age of 3 weeks to 6 months. when normalized for body weight, the young excrete iodide in urine at a greater rate than adults, which is inconsistent with maturation of glomerular filtration. these observations suggest that other biological determinants, perhaps age - dependent, are important for kidney function such as protein transporters. adequate intake levels for iodine estimated for the first year of life (110 to 130 g / day,) are not much different than the recommended dietary allowances for adults (150 g / day,) suggesting that on a body weight basis the hpt axis for the young is accelerated. in the united states, the pediatric intake of iodine, on a g / kg / day basis, is greater than adults. in children of 6 years of age or under, the lower and upper bound for iodine intake ranged from 144 to 280 g / person / day and in adults 40 to 65 years of age, 138 to 284 g / person / day. there is a dearth of data on direct measurements of iodide in serum or whole blood. a recent study in the united states using modern analytical methods reported that median serum iodide concentrations were 8 g / l for fetal cord blood and 2.58 g / l for maternal blood serum. in china the reverse was reported, using modern analytical methods and whole blood samples. the mean infant iodide blood concentration was 15.7 g / l (range of 12.5 to 21.7 g / l) compared to adult mean serum iodide concentration of 110 g / l (range of 14.1 to 812 g / l). during the first year of life for infants in belgium, the serum iodide levels were 2.2 to 6 g / l and for adults, near 1 g / l. the intake of dietary iodine appears to be fairly well established in the young based on urinary excretion of iodide and iodide in breast milk and formula. the resulting serum levels of iodide in the young are less known because only in the last decade have advanced analytical methods been used to measure the inorganic iodide directly. understanding the circulating levels of inorganic stable iodide is important for understanding the influence of dietary iodide on the radiation health risks (thyroid radioiodide dose) of infants and children exposed to radioiodine. the dose of radioiodide to the thyroid gland can be predicted mathematically based on competitive inhibition of radioiodide by stable iodide at the nis protein of the thyroid gland. there are limited data on the total iodide content of thyroid glands in adults, children, and newborns (table 3). iodide content of thyroid glands provides an indicator of the status of the hpt axis. for euthyroid adults the thyroidal iodide stores (organified iodide) zabala. reported a median of 15 mg of thyroidal iodide content for adults, with a range of 4 to 37 mg of thyroidal iodide (table 3). fisher and oddie reported a mean value of 15 mg iodide in thyroids of 8 young adults from the united states with a range of 9.0 to 23.6. in russia, where mild iodide deficient conditions exist, lower thyroidal iodide values of 3.9 to 8.3 mg were found for adults and in teenagers, 1.5 mg (table 3). thyroidal iodide stores have been measured in premature or term infants who only survived for a short period after birth (table 3). a mean thyroidal iodide value of 0.29 mg for newborns is reported from canada, where dietary iodide is sufficient. other studies in europe reported thyroidal iodide concentrations of 0.09 and 0.04 mg for term babies [23, 24 ] (table 3), where iodide insufficient conditions exist. thyroidal iodide stores are useful indicators of the status of the hpt axis, but data is difficult to obtain in humans. more age - specific information is needed on the thyroid gland, including thyroidal iodide content, weight, and the content of thyroid hormones and their precursors. the hpt axis is very dynamic in the first hours and days after birth (table 4). at birth serum thyroid this suggests that the negative feedback system is ineffective and that cold stimulation of the newborn may be the dominant factor controlling the hpt axis. the calculated t4 secretion rate from the thyroid gland of the newborn is very high (table 4). however, this condition is transient and a steady decline in serum tsh and t4 concentrations and t4 secretion occurs over several days after birth and the negative feedback becomes functional. establishing population based reference intervals for serums tsh, t4, ft4, and t3 in newborns, infants, and children from the united states is needed along with clinical studies which can be used to quantitatively estimate thyroid secretion rates of thyroid hormones and deiodination rates (thyroid hormone metabolic rates) for euthyroid populations. this information would provide baseline data for better understanding the consequences of ki administration. in conclusion, the infant and child homeostatic control of the hpt axis is very different than in the adult. therefore, when considering the protection of infants and children from the harmful effects of thyroidal radiation, the age - dependent changes in physiology and the dynamic nature of the hpt axis need to be accounted for in estimating thyroidal radioiodine dosimetry. safety concerns have been expressed regarding ki administration to infants and children while also ensuring adequate protection from radioiodine exposure. the effectiveness of ki to reduce systemic radioiodide uptake into the thyroid gland in a clinical environment is inferred by evaluating the reduction in fractional raiu. the pharmacokinetic profiles for iodide are age - dependent, in part, because of physiological differences, but more importantly, the hpt axis differences between the infant and child and the adult are pronounced as discussed above. reviewed the results of adverse effects from repeated doses with ki, iodide deficient population sensitivities to iodine, case studies of adverse effects, and the use of ki in poland after the chernobyl nuclear power plant accident. they concluded that newborns and young children are most vulnerable to radioiodines and are also the group who experience a low frequency of adverse effects from ki. the blocking effects of stable iodide salts (ki or sodium iodide (nai)) on raiu have been evaluated in adult human clinical studies, but clinical studies in children or infants are limited. evaluated a few adult individuals with doses of 5 to 247 mg ki (table 4) and reported greater than 86% raiu inhibition at 30 hr for all doses except for the 5 mg ki (54% raiu inhibition). at 3 or 5 days after dosing, the percent of raiu inhibition was 16 to 22%. in another study (table 5) using several adult volunteers, 100 or 200 mg nai was administered together with tracer radioiodine resulting in average 24 hr raiu inhibition values ranging from 98 to 99% for both nai doses. the raiu inhibition drops to 50% if nai was administered 3 hr after exposure to radioiodine. the effectiveness of nai drops substantially after radioiodine is administered because the thyroidal radioiodide is organified (iodination of thyroglobulin) and stored in the thyroid gland. the iodinated thyroglobulin is transformed into thyroid hormones and slowly secreted from the thyroid gland in adults. the duration of effectiveness of a single dose is less than a day because of the renal clearance of iodide ; thus, the authors recommend daily repeated doses of 100 to 200 mg nai for radiation exposure situations exceeding one day. on a mg / kg body weight basis, this equates to 1.43 to 2.86 mg / kg ki administration for a 70 kg individual. these authors dosed a small number of individuals with other doses of ki (5, 25, 50, and 1000 mg) at the same time as administration of radioiodine. although the study was not designed for dose - response assessment of ki, all doses were effective except for possibly the 5 mg of ki (raiu inhibition value of 78%) (table 5). reported 24 hr raiu inhibition values of over 92% for ki doses of 30, 50, and 100 mg and 36% raiu inhibition for 10 mg ki (table 4). in a more recent study, hnscheid. reported 24 hr raiu inhibition values of 64% for 7 individuals administered 100 mg ki 2 hr after administration of radioiodine. the effectiveness of ki plummeted as the time interval was increased between administration of radioiodine and ki. administration of ki before radioiodine administration was very effective, even 24 hr before administration of radioiodine. reported 24 hr raiu inhibition values of 73 and 80% in 8 hyperthyroid individuals dosed with 50 and 100 mg of ki, respectively. data on the ability of ki to block thyroidal uptake of radioiodide is considerable in adults, including varying conditions for time intervals between exposure to radioiodines and administration of ki and repeated dosing with ki. ki is very effective at reducing the thyroid gland burden of radioiodines if the treatment is administered within hours as of the exposure to radioiodines. dose adjustment of ki to account for body weight is probably not needed in healthy nonpregnant, nonlactating adults if kidney function and nutrition are normal (e.g., 130 mg ki). for pediatric populations, the minimum effective ki dosages required for newborns, infants, and children are less certain because of a lack of adequate clinical studies. a clinical children 's study was conducted in the 1960s, during the cold war at a state hospital in the united states, to determine the minimal effective dose of nai to protect their thyroid glands from radioactive iodide irradiation. the dose - responses for nai and raiu values were reported as g stable iodide per m skin surface area per day. for five 2-year - old children, baseline 24 hr raiu values were collected and then over 8 weeks of daily administration of 0.3 mg stable iodide four 24 hr raiu values were collected before the stable iodide dose was increased to 0.6 mg for a 4-week period in the same children and two 24 hr raiu values were collected. nai administration was curtailed and a final raiu value was determined 2 weeks after nai administration. raiu inhibition values ranged from approximately 20 to 55% during 8 weeks of daily doses of 0.3 mg stable iodide and near 47 to 67% during 4 weeks of daily administration of 0.6 mg stable iodide. to convert dosing units from mg / m to body weight (mg / kg) center for disease control and prevention (cdc) body weight growth charts for children from the united states a 5th percentile for a 2-year - old female child (lowest body weight) and a 95th percentile for a 2-year - old male child (largest body weight) were selected to represent the range of body weights of 2-year - old children reported in. three - tenths of one mg stable iodide / child (0.3 mg) equates to a stable iodide dose range of 0.03 to 0.02 mg / kg / day for a 2 yr infant and for 0.6 mg, 0.04 to 0.06 mg / kg / day. cuddihy reported that a ki dose of 1.8 mg repeated daily doses for 14 days in two children, 8 and 9 years old, resulted in 24 hr raiu inhibitions of 33 and 48%, which would be for an estimated dose range of 0.05 to 0.06 mg / kg / day (using cdc growth charts). six infant chimpanzees, aged two weeks to 2 years, had baseline raiu values of 3.1 to 32.8%, with a mean value of 11.5%. mean raiu inhibition at 24 hr for doses of 0.5 (n = 4), 1.5 (n = 3), and 5.0 mg / kg (n = 6) of ki was 74, 95, and 93%, respectively. body weights were not given for the infant chimpanzees ; however assuming a weight range of 2 to 4 kg, this equates to doses of 1 - 2, 36, and 1020 mg of ki, respectively, which resulted in 93 to 95% raiu inhibition for the 1.5 and 5.0 mg / kg dose groups and 74% for the 0.5 mg / kg dose group. single ki doses were administered to 10.5 million children in poland in response to the chernobyl nuclear disaster. newborns received 15 mg iodine, children under 5 years of age were given 50 mg iodine, and all other children were administered 70 mg iodine. ki administration occurred days after the onset of exposure to radioactive iodines. in children of 5 years and younger, raiu inhibition of inhaled and ingested radioactive iodide-131 (i) was estimated to range from 40 to 14%. the dose of ki for a newborn was approximately 6.7 to 3.5 mg / kg using a 5th percentile body weight for girls and 95th percentile body weights for boys in the united states. less than 1% of newborns exhibited hypothyroidism (12 of 3214 babies) or increased serum tsh levels and decreased serum total thyroxine levels. the predominant side effects for children were gastrointestinal (vomiting, stomach ache, and diarrhea), skin rashes, headache, and shortness of breath. children under one year of age had the highest committed doses of thyroidal i. an increased sensitivity of young children to thyroid cancer was observed [42, 43, 66 ], although the influence of iodine deficiency may be a contributing factor for thyroid cancer rates. the proceedings from a workshop on iodine nutrition and radioactive iodide after chernobyl incident state that, for a variety of reasons, it is difficult to determine the influence of iodide nutrition on the risks of thyroid cancer from exposure to radioactive iodine. to better understand the effectiveness and safety of ki administration to infants and children more research is required, perhaps clinical studies. compartmental mathematical models for predicting the dosimetry of radioiodide have existed for decades, primarily for adults. this nonphysiological model uses first order terms to account for age - dependent thyroidal uptake of radioiodide and secretion of organified radioiodide (thyroid hormone) from the thyroid gland. the model predicted that the mean i absorbed thyroidal dose in newborns is 26 times greater than adults. in another modeling study jang. created a compartmental model for ki and radioiodide in children over 3 months of age. these authors used first order terms to describe thyroidal uptake of stable iodide and radioiodide without considering age - dependent kinetic behavior. a first order term, describing secretion of organified radioiodide (thyroid hormone), the model predicted that ki would be equally effective at blocking thyroidal uptake of radioactive iodide for ages of 3 months to adulthood. future modeling efforts, using physiological models for the infant and child, and known information about the age - dependent physiology and the hpt axis (tables 1to 5) should provide useful insights into the effectiveness of ki as a drug to treat exposure to radioiodines. to protect people from radioiodines the us food and drug administration recommends a single oral dose of 16 mg ki for neonates from birth to 1 month of age (7.1 to 3.7 mg / kg ki for 5th percentile female body weight and 95% percentile male body weight), 32 mg ki (7.0 to 3.6 mg / kg ki) for infants 1 month of age to children 3 years of age, and 65 mg ki for children from 3 years of age to up to 18 years old (5.7 to 0.6 mg / kg ki). in the case of adults, 130 mg ki per day is recommended, averaging about 2 mg / kg. the recommended ki dosages for the infant and child, on a mg / kg basis, would typically be greater than for an adult. the two repeated dosing ki studies in children with small doses of ki [12, 15 ] are not adequate to draw general conclusions about the safety and efficacy of single high dose ki administration in children. since infants and children have a hyperactive hpt axis (tables 2, 3, and 4), the evaluation of the efficacy of ki in hyperthyroid adults is useful for speculating on the efficacy of ki in children. the baseline raiu in hyperthyroid, iodide sufficient adults from japan was 65% of the administered radioiodide dose, while in the united states euthyroid (iodide sufficient) adult baseline raiu values ranged from 17 to 50% [9, 16, 31 ]. for hyperthyroid iodide sufficient children from the united states fields. reported raiu baseline values of 72 to 99%, while several authors report a wide range of baseline raiu values (40 to 70%) for iodide sufficient euthyroid children (table 2). twenty - four hr raiu inhibition values of 73 and 80% for ki doses of 50 and 100 mg were reported for iodide sufficient adult hyperthyroid japanese subjects and 94 to 99% for ki doses of 50 and 100 mg [16, 31 ] in iodide sufficient euthyroid adult volunteers from the united states. these results demonstrate that ki is less effective at blocking thyroidal uptake of radioiodide if the hpt axis is hyperactive in adults. by analogy ki is expected to be less effective in infants and children with a hyperactive hpt axis. the poland experience, where very large numbers of children were administered doses of 15 to 50 mg ki, resulted in apparently low raiu inhibition for children less than 5 years of age. interpreting this study is difficult because of confounding factors. these children may have been iodide deficient, which would further exacerbate the hyperactive hpt axis and further reduce the effectiveness of ki. also the time lag from the onset of radioiodine exposure to ki treatment was probably detrimental, further reducing the effectiveness of ki. interestingly the authors of the infant monkey ki study suggest that a dose of at least 1.5 mg / kg (5.1 mg ki for a newborn human) is needed to protect the infant thyroid gland. clearly, more research is needed to better characterize the safety and effectiveness of ki in infants and children.. the protective effect of ki will be for a shorter duration than in adults because of the hyperactive nature of the hpt axis. stable iodide will be excreted into urine more quickly reducing the protective effect of ki. the half - life of organified iodide in the thyroid gland of children (~2.5 or 3 days) is less than the radionuclide decay half - life of i (8 days), which is not the case in adults. thus, radioactive thyroid hormones would be secreted from the thyroid gland and distributed into the body. radioiodide derived from deiodination of radioactive thyroid hormones would be secreted in urine or recycled back into the thyroid gland, increasing the duration of systemic radioiodide. as the lag time from radioiodine exposure to administration of ki increases, the effectiveness of ki would be expected to decrease at a faster rate than in adults because of the hyperactive nature of the hpt axis, raising an important question about single versus multiple doses of ki. the iodide nutritional status of the sensitive population is expected to alter the effectiveness of ki. to conduct ki clinical trials in children seems unattainable ; however, the presidential commission of bioethical issues did recently provide research guidelines to the secretary of health and human services for considering medical countermeasure pediatric trails for an anthrax vaccine. preevent pediatric testing of medical countermeasures may be carried out by clinical trials using age deescalation, coupled with previous informative research endeavors such as mathematical modeling, toxicity testing of laboratory animals, and adult human studies. with over 100 operational nuclear reactors in the usa, continued planning and reevaluation for the possible use for ki is prudent. advanced research methods for toxicity testing and computational modeling of the thyroid system [71, 7376 ] and extrapolation tools can provide useful quantitative predictions of pediatric ki doses which will maximize the blocking effect of ki while protecting against adverse outcomes from ki. these research findings can then be compared to existing recommended pediatric ki doses to ensure the safety of children. | potassium iodide (ki) is recommended as an emergency treatment for exposure to radioiodines, most commonly associated with nuclear detonation or mishaps at nuclear power plants. protecting the thyroid gland of infants and children remains a priority because of increased incidence of thyroid cancer in the young exposed to radioiodines (such as 131i and 133i). there is a lack of clinical studies for ki and radioiodines in children or infants to draw definitive conclusions about the effectiveness and safety of ki administration in the young. in this paper, we compare functional aspects of the hypothalamic - pituitary - thyroid (hpt) axis in the young and adults and review the limited studies of ki in children. the hpt axis in the infant and child is hyperactive and therefore will respond less effectively to ki treatment compared to adults. research on the safety and efficacy of ki in infants and children is needed. |
current hiv prevention strategies (condoms and abstinence) force hiv - serodiscordant couples to choose between risking hiv transmission to a partner, or accepting childlessness [112 ]. behavioral strategies (home artificial insemination, sex without condoms limited to peak fertility), male circumcision [1315 ], antiretroviral therapy (art) for the infected partner [1618 ], and preexposure antiretroviral prophylaxis (prep) for the negative partner [1922 ] create opportunities for hiv - serodiscordant couples to realize fertility goals and minimize periconception hiv transmission [2327 ]. prior to effective hiv treatment, the prevailing professional recommendation was for people living with hiv to avoid having children [28, 29 ]. in 2001, the u.s. centers for disease control recommended that healthcare providers support the fertility desires of people living with hiv. south africa 's constitution protects the right to reproductive choice for hiv - infected persons, and the most recent guidelines from the southern african hiv clinicians society offer risk - reduction strategies for hiv - serodiscordant couples who choose to conceive [31, 32 ]. cross - sectional studies indicate that people living with hiv are receptive to safer conception advice from providers [3336 ], but that healthcare workers (hcws) are not routinely engaging in conversations about fertility desires or plans, a crucial first piece of any reproductive health intervention [31, 34, 35, 37 ]. in cape town, over 30% of hiv - infected women and 65% of hiv - infected men attending public sector clinics were interested in having additional children, yet only 19% and 6%, respectively, had discussed this with a hcw. among hiv - infected women in johannesburg, with plans to conceive in the next year, 40% had ever had a conversation about fertility plans with a provider. conversations with hcws about conception plans were also infrequent in argentina, brazil, and the united states. barriers to these conversations include a combination of patient (e.g., fear of judgment, lack of pregnancy planning), provider (e.g., limited experience, knowledge, or skills), and structural factors (e.g., competing healthcare demands, limited resources, poor integration of family planning and hiv services) [31, 3537, 40, 41 ]. while some conversations may be initiated with hiv lay counselors, they may not have the skills to address clinical issues beyond their focused training [42, 43 ]. data demonstrating that arvs minimize hiv transmission suggest that periconception risk - reduction interventions will require hcw involvement [16, 1922, 27 ]. in our conceptual framework for periconception risk behavior, hcws have the potential to minimize risk behavior through providing information about hiv risk, offering prevention strategies, and promoting adherence to risk reduction strategies. there are no data on practices in kwazulu - natal, the most hiv - affected province in south africa, where 41% of pregnant women attending antenatal clinics are hiv positive. a better understanding of current hcw knowledge, attitudes, and practices will enhance the provision of reproductive counseling for hiv - infected individuals by allowing for development of interventions that capitalize on hcw strengths and address weaknesses. we present qualitative data resulting from interviews with 30 hiv - infected women and 20 hiv - infected men with serodiscordant sexual partners in durban, south africa. we previously reported on periconception risk behavior within this sample and here focus on participant reports of their experiences with hcw provision of reproductive counseling. these data offer early insight into current hcw practices and may contribute to development of feasible safer conception interventions. participants were recruited from the antiretroviral (arv) and preventing maternal - to - child - transmission (pmtct) clinics within a state - aided (public / private partnership) general hospital serving a predominantly urban population from the greater durban area where district antenatal clinic hiv prevalence is estimated at 41.5%. in 2011, the arv clinic was providing care and treatment to 4734 patients on art. sixty percent of these patients are women ; the majority (> 90%) are black south africans. patients pay approximately 25 usd per month for comprehensive hiv services, which includes the cost of arvs. pregnant patients pay approximately 35 usd per visit to access antenatal care, which includes pmtct clinic services. in 2010, 200 hiv - infected pregnant women enrolled in this program. male participants were recruited from the arv clinic and female participants were recruited from the arv and pmtct clinics. inclusion criteria were (1) age 1845 years ; (2) hiv - positive ; (3) pregnancy in the prior 12 months, including currently pregnant (for women) ; (4) partner of unknown or seronegative hiv status (prior to referent pregnancy) by participant report (father of the referent pregnancy for women, current sexual partner for men) ; (5) fluent in english or isizulu ; (6) able to give informed consent. initial attempts to recruit men with partner pregnancy in the past year were unsuccessful, men were subsequently recruited independent of recent partner pregnancy. it is not clear if initial recruitment challenges were due to sensitivities of reporting partner pregnancy (in a setting where condoms are promoted strongly) or a paucity of men with recent partner pregnancy. we conducted in - depth, qualitative, individual interviews to explore reproductive decision - making, sexual transmission risk understanding and practices, and periconception risk understanding and practices. here, we focus on data from the questions what have health care workers advised you about having children (after knowing your status) ? and what advice have you received around getting pregnant / having children safely (since knowing your status) ? participants were recruited from march through july 2010 via purposive sampling from patients awaiting clinical consultation. after obtaining informed consent, a gender - concordant research assistant trained in qualitative interviewing techniques interviewed participants in a private setting in isizulu or english. transcripts were independently reviewed and coded, and resultant conceptual categories and emergent themes were discussed by the research team using content analysis [46, 47 ]. several authors reviewed coding categories and emergent themes with the research assistants in order to explore additional themes and confirm accuracy of interpretation. ethics approvals were obtained from the mccord hospital research ethics committee (durban, south africa) and from the partners healthcare institutional review board (boston, usa). baseline demographic data, hiv history, reported partner hiv status, and reproductive history for 30 female and 20 male participants are shown in table 1. women and men averaged 30 (sd 4) and 34 (sd 6) years of age, respectively, and had been diagnosed with hiv for a mean of 3 years (sd 2 women, sd 5 men). seventy - three percent of women and 60% of men had completed secondary school, while 63% of women and 75% of men reported current employment. women had an average of 2 (sd 1) pregnancies (including current), 1.1 (sd 0.7) prior live births, 0.9 (sd 0.6) living children, and 18 (60%) were pregnant at the time of interview. we have previously detailed the complexities of pregnancy intention in this sample, but about a third (11) of women described the referent pregnancy as explicitly planned. men had an average of 0.9 (sd 1) living children ; three (16%) reported partner pregnancy in the past year. structural, individual, and dyadic domains affect access to risk reduction information (e.g., knowledge that arvs can reduce sexual transmission risk), motivation (e.g., to adhere to prevention strategies), and ability to implement behavioral change (e.g., partnership dynamics and discussions of safer sex practices). within this framework, hcws have the potential to minimize risk behavior through providing hiv - affected couples with information about hiv transmission and conception, supporting disclosure, providing arvs as prevention, and promoting adherence to hiv risk reduction strategies. here we present themes suggesting that, in this sample, hiv - infected men and women in serodiscordant partnerships (1) are aware of and receptive to the idea that one should speak to an hcw prior to becoming pregnant, (2) seldom seek or receive conception advice from healthcare workers, and (3) when advice is shared, patients receive a range of information around safer conception. in addition, (4) men are eager for safer conception advice. most participants indicated that they had been informed by a hcw that they should seek advice when they were ready to conceive. in some cases, participants communicated that this advice might help minimize transmission to a child, and in some cases to a partner. this awareness was related to general information shared by counselors during routine arv adherence training sessions (group adherence training sessions prior to art initiation are routine in south africa), regardless of the participant 's fertility goals at the time. they [healthcare workers during the training session ] told me that when i have told her [disclosed to partner ], we should come here [to the clinic ] together so that they will explain to both of us. they tell us that we should come back with our partners so that the doctor tells us what to do in order for the virus not to be transferred to the child. (participant b03, 26-year - old man)they [counselors ] said that we should come with our partners so that you explain to the doctor that you want to have a child so that he tells you what to do, and that was it. no, they only said that we should consult a doctor with your partner if you want to have children. (participant b15, 29-year - old man)in addition to knowing that they should tell a hcw if they wanted to have children, participants were open to seeking this advice from healthcare workers. with us black people, if it happens that you get the virus and you die not having a child, your name just disappears and you are never mentioned. so if it happens that you do get hiv then you should go to the clinic and talk to them [healthcare workers ] so that they help you to get a child in a safe way. (participant b04, 28-year - old man)we want to have a child together because we love each other and we are so close to each other i will probably go to special doctors when i am ready for that so that i hear from them what it is that i have to do in order to have a child since i have the virus and my partner does not. (participant b16, 36-year - old man)if you want to have children you need to consult the doctor then they will advise you what to do. (participant a27, 34-year - old woman) they [healthcare workers during the training session ] told me that when i have told her [disclosed to partner ], we should come here [to the clinic ] together so that they will explain to both of us. they tell us that we should come back with our partners so that the doctor tells us what to do in order for the virus not to be transferred to the child. (participant b03, 26-year - old man) they [counselors ] said that we should come with our partners so that you explain to the doctor that you want to have a child so that he tells you what to do, and that was it. no, they only said that we should consult a doctor with your partner if you want to have children. (participant b15, 29-year - old man) with us black people, if it happens that you get the virus and you die not having a child, your name just disappears and you are never mentioned so if it happens that you do get hiv then you should go to the clinic and talk to them [healthcare workers ] so that they help you to get a child in a safe way. (participant b04, 28-year - old man) we want to have a child together because we love each other and we are so close to each other i will probably go to special doctors when i am ready for that so that i hear from them what it is that i have to do in order to have a child since i have the virus and my partner does not. (participant b16, 36-year - old man) if you want to have children you need to consult the doctor then they will advise you what to do. (participant a27, 34-year - old woman) while most participants were aware that they should approach a healthcare worker prior to conception, few sought, or received safer conception advice. participants described several barriers to accessing reproductive counseling prior to conception including fear of judgment from nurses and financial challenges. they did not tell us that we should no longer have children, but you could see that is what they meant. the other day, one of the nurses made a comment and asked why do n't we go for family planning because they do not want to see us coming back to take the treatment [arvs for pmtct ] again. (participant a26, 23-year - old woman) i spoke to the doctor who said it is safe to have more children if i want to. he said i can come to him, but i did n't because he was expensive as he is a gynecologist. (participant a13, 32-year - old woman) they did not tell us that we should no longer have children, but you could see that is what they meant. the other day, one of the nurses made a comment and asked why do n't we go for family planning because they do not want to see us coming back to take the treatment [arvs for pmtct ] again. (participant a26, 23-year - old woman) i spoke to the doctor who said it is safe to have more children if i want to. he said i can come to him, but i did n't because he was expensive as he is a gynecologist. (participant a13, 32-year - old woman) additional barriers may be related to dyadic factors. for example, participants described that they were told to seek reproductive counseling at the arv clinic with their partners. however, about a third of participants had not disclosed his / her hiv status to their partner, making this scenario unlikely. further, about a third of the women in this sample described the referent pregnancy as unplanned. participants reported a range of information received from providers. at one end of the spectrum, some participants had not received advice about options for having children since their hiv diagnosis, including in the setting of expressing plans for having children. they [healthcare workers ] haven't advised me : they have asked me about it but they have never given me any advice. they asked me if i am planning on having more children and i told them, (participant a28, 24-year - old woman)what advice have you received from health care workers around having children after knowing your status ? except that i have to practice safe sex, there is nothing (participant a30, 31-year - old woman) they [healthcare workers ] haven't advised me : they have asked me about it but they have never given me any advice. they asked me if i am planning on having more children and i told them, (participant a28, 24-year - old woman) what advice have you received from health care workers around having children after knowing your status ? except that i have to practice safe sex, there is nothing (participant a30, 31-year - old woman) others had received helpful safer conception information from doctors or nurses at pmtct, arv, and gynecology clinics. risk reduction strategies that participants had learned included artificial insemination, intercourse timed to peak fertility, manual insemination (for male uninfected couples the uninfected male ejaculates into a condom or other container and the semen is inserted into the woman 's vaginal canal via a syringe or reversed condom), sperm washing, and intercourse with lubrication (to avoid abrasions). they told me that i can go to one of those private hospitals to ask about sperm washing one of the times when i came into the clinic there was a poster on the wall saying if you want to have a child, speak to either a doctor or a nurse. so i asked the doctor, do you think is it possible for me to have a child even if i 'm positive ? but i had to go to one of those private hospitals to look into that thing [sperm washing ]. (participant b05, 31-year - old man)a doctor gave us a [syringe ] which we had to use after sex to withdraw sperm [from the condom to insert into the woman ]. we are both aware that i am positive and so we would use a condom all the time and we received advice from the doctor on how to use the syringe that he gave us so that he [partner ] does not get infected. (participant a25, 32-year - old woman)one participant suggested the importance of a lower plasma hiv viral load prior to conception, but it was not clear where she and her partner had learned this information. art as prevention was not a component of the south african department of health treatment guidelines at the time of this study (or now).after finding out that my viral load was very low, even undetectable, he [husband ] decided that let 's take a chance and try and see what is going to happen. he said he has taken that decision, it 's not that i am forcing him to take it. (participant a04, 28-year - old woman)some participants explained that the advice they had received about whether or not they, as hiv - infected individuals, could have children evolved over time or varied with different providers. but then they changed [and said ] that i can have children, and that is what i am not sure of. (participant b11, 33-year - old man) they told me that i can go to one of those private hospitals to ask about sperm washing one of the times when i came into the clinic there was a poster on the wall saying if you want to have a child, speak to either a doctor or a nurse. so i asked the doctor, do you think is it possible for me to have a child even if i 'm positive ? but i had to go to one of those private hospitals to look into that thing [sperm washing ]. (participant b05, 31-year - old man) a doctor gave us a [syringe ] which we had to use after sex to withdraw sperm [from the condom to insert into the woman ]. we are both aware that i am positive and so we would use a condom all the time and we received advice from the doctor on how to use the syringe that he gave us so that he [partner ] does not get infected. (participant a25, 32-year - old woman) after finding out that my viral load was very low, even undetectable, he [husband ] decided that let 's take a chance and try and see what is going to happen. he said he has taken that decision, it 's not that i am forcing him to take it. (participant a04, 28-year - old woman) so far they told me that i can not have children. but then they changed [and said ] that i can have children, and that is what i am not sure of. (participant b11, 33-year - old man) from our sample, many male participants had engaged with a hcw around discussions of safer conception or had sought out information from the internet, relatives, or other news sources. no [i have not had a conversation with a hcw ], but i 've done research and they said that one can do artificial insemination but i am not sure if it is done on humans. artificial insemination means that a person can be impregnated by a man, but technology can be used to make a baby without them having sex the child is yours because the semen is taken from you and can be injected into the women and a baby grows inside the woman, the genes of that child are yours. (participant b13, 28-year - old man)several male participants became quite interested in safer conception options during the interview and planned to seek out additional advice from a hcw. one participant (b12, 35-year - old man) responded to a question about fertility desire by saying, so in the situation that i am in now i do not think i want to have children again, but by the end of the interview he asks : is it possible to have children if i am positive and my partner is negative ? even before i was diagnosed [with hiv ], we were not planning to have more two is enough. however, by the end of the interview, he asks : i want to know if i decide to have kids how is that possible ? maybe i 'll try to find more ways to get information about how to have kids when you 're hiv positive. however, this may simply reflect the study sample given that fewer women were planning a future pregnancy and many were still close to or in the midst of a current pregnancy. no [i have not had a conversation with a hcw ], but i 've done research and they said that one can do artificial insemination but i am not sure if it is done on humans. artificial insemination means that a person can be impregnated by a man, but technology can be used to make a baby without them having sex the child is yours because the semen is taken from you and can be injected into the women and a baby grows inside the woman, the genes of that child are yours. (participant b13, 28-year - old man) is it possible to have children if i am positive and my partner is negative ? maybe i 'll try to find more ways to get information about how to have kids when you 're hiv positive. these qualitative data suggest that hiv - infected patients are increasingly aware of reproductive counseling opportunities. many participants understood that hcws may have valuable advice to offer to facilitate safer conception and were open to seeking this advice. while few participants had sought advice, some participants had received safer conception advice from healthcare encounters. prior studies suggest that the majority of hiv - infected patients are not receiving reproductive counseling and are reluctant to engage with healthcare workers to discuss reproductive plans [12, 35, 36, 39, 4951 ]. [34, page 73 ] presented data collected during 2009 and reported that only 41% of hiv - infected women reported that an art healthcare provider had spoken with them about their options should they want to conceive in the future. in work by cooper., collected in 2006, 19% of women and 6% of men had consulted a doctor, nurse, or counselor in hiv care about fertility intentions [38, page s44 ]. the fact that many participants, including men, in this small sample knew that hcws may have advice to offer captures data not mentioned in prior studies. these data suggest that clinical settings may be adapting to accommodate the fertility goals of people living with hiv. many participants reported the expectation that they could access detailed counseling if they returned to the clinic when they were ready to have a child. from work by our group and others, several facts of periconception practice waiting to talk to a provider until one is ready to have a child eliminates the opportunity to discuss the risks of having children in order to inform the decision to have biologic children [24, 52, 53 ]. many men and women living with hiv do not know their partner 's status and/or have not disclosed to their partners. prior to testing and disclosure, it is impossible for an individual or a couple to assess sexual transmission risk in the context of conception. continued efforts to promote couple - based testing and supported disclosure are critical. for those who decide to have children, a preconception conversation with a healthcare worker should include an assessment of the hiv - infected partner 's health ; the hiv status of the partner ; if the woman is positive, a discussion of the risks of pregnancy when hiv infected ; risks of transmission to a partner with various periconception risk reduction strategies ; fertility assessment ; the increased risk of transmission and acquisition during unprotected sex during pregnancy ; the risks of perinatal transmission. furthermore, asking individuals or couples to return when they are ready to have children presupposes conception planning. however, many pregnancies are not explicitly planned [55, 56 ]. providing up - front information about the options for safer conception may communicate the importance of preconception planning to protect the future child and the partner. recent data from johannesburg (south africa) suggest high fertility intentions at art initiation, reflecting the importance of providing safer conception information at treatment initiation and in followup. a partner (who is not attending clinic) may make decisions about having children if his or her partner has not been educated it is impossible for them to have an informed conversation about the risks and options for safer conception. in addition, life transitions may be quick and there may be plans for pregnancy long before a next visit with a provider. expecting a patient to raise the issue of fertility plans on his or her own may be problematic. while not a theme in our data, published data suggest that women and men living with hiv hesitate to reveal fertility plans to hcws for fear of judgment [36, 58 ]. it is not part of routine clinical practice to expect patients to tell providers when they are ready to discuss health behavior change (e.g., smoking, substance abuse, exercise, sexual behavior)the onus is on the provider to actively inquire about behaviors that compromise health. routine assessment of fertility goals and plans should be incorporated into clinical care for people living with hiv, with subsequent recommendations for safer conception or effective contraception options, depending on fertility goals. how to execute this in overburdened healthcare systems is a challenge but may require increased training in fertility intention assessment and comprehensive reproductive counseling for counselors. participants had learned of safer conception strategies from hcws including artificial insemination, intercourse timed to peak fertility, sperm washing, home manual insemination, and intercourse with lubrication to avoid abrasions. the frequency with which sperm washing and artificial insemination was raised is interesting since these are some of the least accessible (geographically, economically) strategies for reducing transmission risk. simpler risk reduction strategies such as delaying conception until the infected partner is on treatment with suppressed hiv rna viral load, timing sex without condoms to peak fertility, circumcision for the male partner if he is uninfected, and manual insemination are likely to be more feasible. our semistructured interview guide was not designed to probe specifically about particular techniques and it is possible that participants were more likely to recall discussions about and have faith in high - tech concepts such as sperm washing compared to behavioral modifications such as timing unprotected sex to peak fertility. in addition, patients may have received limited information, perhaps due to insufficient clinician training on this topic. the who guidelines for serodiscordant couples offer some safer conception recommendations, in addition, a more comprehensive guideline was recently published by the southern african hiv clinicians society and will be helpful for clinicians [32, 54 ]. hcw training on the interpretation and application of these guidelines should be a priority for promoting comprehensive reproductive health counseling. we found that, in this sample, male participants were eager to engage with hcws in order to seek reproductive counseling. prior data suggests that providers may have less insight into male reproductive intentions and that men are less likely to seek advice from providers. we previously published on the important role of men in conception decisions from an earlier analysis of these data, an observation which has been reported by others [9, 11, 12, 36, 5961 ]. as reproductive counseling is integrated into hiv care, it will be crucial to increase male involvement. interventions to engage men in contraception and family planning have been effective in several sub - saharan african settings [6163 ]. in addition, the dyadic nature of conception decisions and periconception risk behavior emphasizes the importance of a couple - oriented counseling approach when feasible. findings from this small qualitative sample are meant to generate hypotheses to pursue in future larger scale research. in addition, our participants were attending clinical services at a semiprivate hospital and may not represent the broader population who access public sector care or those who do not access any healthcare. while this clinic does not have a formal program for safer conception counseling, several of the authors previously worked at this clinic which may have heightened some of the clinic providers ' awareness around reproductive counseling for people living with hiv. finally, patient perspectives of past experiences with provider counseling may not accurately reflect what occurred ; provider perspectives are also needed to understand current practices. these are the first data to explore patient experiences with provider provision of reproductive counseling in kwazulu natal, where 41% of women attending antenatal clinics are hiv infected. this work suggests that men and women living with hiv are aware that safer conception options may be available and are interested in accessing this information. further, there is a clear need to expand the quality and reach of periconception risk reduction information to both providers and patients. these data serve as important hypothesis generation to guide future research as reproductive counseling interventions are developed. | background. understanding hiv - infected patient experiences and perceptions of reproductive counseling in the health care context is critical to inform design of effective pharmaco - behavioral interventions that minimize periconception hiv risk and support hiv - affected couples to realize their fertility goals. methods. we conducted semistructured, in - depth interviews with 30 hiv - infected women (with pregnancy in prior year) and 20 hiv - infected men, all reporting serodiscordant partners and accessing care in durban, south africa. we investigated patient - reported experiences with safer conception counseling from health care workers (hcws). interview transcripts were reviewed and coded using content analysis for conceptual categories and emergent themes. results. the study findings indicate that hiv - infected patients recognize hcws as a resource for periconception - related information and are receptive to speaking to a hcw prior to becoming pregnant, but seldom seek or receive conception advice in the clinic setting. hiv nondisclosure and unplanned pregnancy are important intervening factors. when advice is shared, patients reported receiving a range of information. male participants showed particular interest in accessing safer conception information. conclusions. hiv - infected men and women with serodiscordant partners are receptive to the idea of safer conception counseling. hcws need to be supported to routinely initiate accurate safer conception counseling with hiv - infected patients of reproductive age. |
the objective signs and subjective symptoms of dry eye fluctuate greatly across patient populations, creating a significant challenge for the clinician to diagnose and treat the condition effectively. a more recent area of study in dry eye is the implications for visual function. the decreased blink rate experienced during visual function tasks, (eg, extended computer use, reading, video gaming, watching tv) can exacerbate dry eye and the signs and symptoms of dry eye (eg, blurred vision, ocular surface staining, short tear film break - up time [tfbut ]), which, in turn, can limit patients visual functioning capabilities. not surprisingly, this reciprocal relationship between dry eye and visual tasking can confound the clinician s diagnosis and treatment even further. patient complaints of the effect of dry eye on visual function may include difficulty driving, reading, and watching television.1 during each blink of the eye, the action of the upper lid serves the essential purpose of reestablishing the tear film over the ocular surface epithelium.2 the tear film instability and increased rates of tear film break - up following a blink that are characteristic of dry eye can be caused by insufficiencies in any of the three major tear film components : lipid, mucin, and aqueous.3,4 ocular surface protection is contingent upon the patient s tfbut matching or exceeding his or her inter - blink interval (ibi).5 blink rate is thereby closely integrated with ocular surface integrity. the effects of dry eye on visual function can be assessed by testing the visual acuity degradation during the ibi. the inter - blink interval visual acuity decay (ivad) test is a novel diagnostic tool that evaluates functional visual acuity between blinks. c s at individualized best - corrected visual acuity (bcva) between blinks and measures parameters based on patient responses. during the test, the rotating optotype c is presented and the subject responds using a keypad to indicate the direction of the c.1 by using a standardized task for all patients before and after treatment, the test is designed to establish an accurate representation of the effects of dry eye treatments on visual function. a new artificial tear, systane ultra lubricant eye drops (alcon, inc., fort worth, tx, usa), contains polyethylene glycol 400 (peg 400) and propylene glycol (pg) as active demulcents, gelling agent hp - guar, sorbitol, and preservative polyquad. the viscosity is optimized in the bottle with sorbitol to allow for efficient ocular spreading with minimal blur. upon instillation, the solution then interacts with the mucins and divalent ions of the natural tear film and releases sorbitol, allowing enhanced cross - linking of borate with hp - guar, and forming a matrix on the ocular surface.6 optive (allergan, inc., irvine, ca, usa) contains carboxymethylcellulose sodium (cmc) and glycerin, and is preserved with purite.7 the drops were chosen as comparators because they contain different polymeric formulations and target similar dry eye populations. over - the - counter (otc) artificial tears are the mainstay in dry eye treatment, and impact the visual function capabilities of patients. clinical studies of artificial tears have demonstrated differences in blurring effects upon instillation between marketed products, as well as the relationship of residence time to this blurring upon - instillation.8,9 knowledge of the considerable impact of dry eye on visual function and the implications for quality - of - life led to further investigation of the effects of dry eye treatment on visual function. the present study was designed to evaluate the effect of two lubricant eye drops (systane ultra and optive) on visual function of dry eye patients using the ivad test. this study utilized a single - center, randomized, double masked, cross - over design to evaluate the visual function effects of two lubricant eye drops in patients with dry eye. the study protocol, protocol amendments, informed consent form, investigator qualifications and site, and recruiting materials were approved by an institutional review board (southwest independent ; fort worth, tx). the study was conducted in accordance with current good clinical practice guidelines and the declaration of helsinki. subjects were recruited from an existing database of dry eye patients, and were enrolled in the study if they inclusion and no exclusion criteria. enrolled subjects were at least 18 years of age, provided written informed consent, and had a reported history of dry eye in both eyes. enrolled subjects also had a documented history within the previous 6 months of both a tfbut 5 seconds and a sodium fluorescein corneal staining sum score of 1 (on a standardized 0 [none ] to 4 [worst ] scale)10 in both eyes. subjects were enrolled if they reported a use and/or desire to use an artificial tear within the past year, and had a bcva of 0.6 logmar or better in each eye using the early treatment of diabetic retinopathy study (etdrs) chart. subjects were excluded if they had undergone ocular surgery in the previous 6 months, had current punctal occlusion, had a history of intolerance or hypersensitivity to any component of the study medications, or had a history or evidence of external ocular infection. subjects who had a history or evidence of glaucoma, ocular hypertension, and intraocular inflammation ; and those who used systemic medications known to cause ocular drying on an unstable dose for the 30 days prior to visit 1 were also excluded from the study. subjects who had any ocular or systemic medical condition that might, in the opinion of the investigator, preclude the safe administration of test product, were excluded as well. use of topical ocular drops within 3 hours of visit 1, use of restasis (allergan) within 30 days of visit 1, and use of either (except in the case of artificial tears) throughout the duration of the study were disallowed. at visit 1 (day 0) subjects provided written informed consent and signed a health insurance portability and accountability act (hipaa) privacy document prior to any study procedures. each subject s bcva was tested using the etdrs chart, and primary gaze blink rate was obtained using a digital microcamera and infrared illuminator while the subject was isolated and asked to complete a standard visual task (subjects were not instructed that their blink rate was being monitored). each subject s functional blink rate was acquired during a practice session of the ivad test. reading rate was determined by timing each subject while reading a list of 16 words, one eye at a time. slit lamp examination of the anterior eye was conducted on both eyes of the subjects. as subjects qualified, they were assigned enrollment numbers in numerical sequence, and these numbers corresponded to the treatment order for the two test products. after resting for at least 5 minutes, 1 drop of randomized treatment was instilled in both eyes by a designated member of the investigative staff who was not involved in clinical assessment, data management, or data analysis, and who did not disclose treatment assignments to the investigator, sponsor, or patients. subjects then underwent functional blink rate assessment, ivad testing, and reading rate evaluation at 15, 45, and 90 minutes post - dose. finally, any adverse events reported or observed after instillation of test product were recorded and assessed and subjects were scheduled for their next visit. subjects returned for visit 2 on day 7 3, and were queried for artificial tear use in the 3 hours prior to their visit and any adverse event occurrence since visit 1, and the same method was applied for the cross - over treatment, followed by study exit. all patients receiving test product were considered evaluable for the safety analysis and all patients receiving test product and completing both visits were considered evaluable for the intent - to - treat (itt) analysis. all patients who met the criteria for itt analysis, and satisfied all inclusion and exclusion criteria were considered evaluable for the per - protocol (pp) analysis. the primary efficacy variables were ivad test recorded time at bcva and reading rate of the worse eye as assessed at baseline and 15, 45, and 90 minutes post - dose. descriptive statistics were presented for each of the efficacy variables (including the mean, standard deviation, sample size, minimum, and maximum) and by treatment and time points. repeated measures analysis of variance (anova) were used to test for treatment differences in the ivad test recorded time and reading rate of the worse eye. descriptive statistics for the secondary variable of functional blink rate assessed at baseline and 15, 45, and 90 minutes post - treatment were generated by treatment and time points. repeated measures of variance were used to test for treatment differences in functional blink rate. post hoc exploratory efficacy analysis was conducted using survival analyses (right censored) performed for ivad time at bcva at 15, 45, and 90 minutes post - dose. all patients receiving test product were considered evaluable for the safety analysis and all patients receiving test product and completing both visits were considered evaluable for the intent - to - treat (itt) analysis. all patients who met the criteria for itt analysis, and satisfied all inclusion and exclusion criteria were considered evaluable for the per - protocol (pp) analysis. the primary efficacy variables were ivad test recorded time at bcva and reading rate of the worse eye as assessed at baseline and 15, 45, and 90 minutes post - dose. descriptive statistics were presented for each of the efficacy variables (including the mean, standard deviation, sample size, minimum, and maximum) and by treatment and time points. repeated measures analysis of variance (anova) were used to test for treatment differences in the ivad test recorded time and reading rate of the worse eye. descriptive statistics for the secondary variable of functional blink rate assessed at baseline and 15, 45, and 90 minutes post - treatment were generated by treatment and time points. repeated measures of variance were used to test for treatment differences in functional blink rate. post hoc exploratory efficacy analysis was conducted using survival analyses (right censored) performed for ivad time at bcva at 15, 45, and 90 minutes post - dose. fifty - three subjects were screened and 48 subjects were enrolled in the study, completed all visits, and were evaluable for safety, itt and pp analyses (mean age = 61.1 14.8 years ; 20.8% male ; 95.8% white, 2.1% black, 2.1% other). since the itt and pp data sets were identical, analyses were performed only on the itt set. the results for time at bcva, reading rate, and functional blink rate measurements are listed in table 1. a significant difference in survival distribution for time at bcva (time to one - line loss of bcva) evaluated using the ivad test was observed at 90 minutes post - dose : 50% of patients demonstrated time to one - line loss of bcva greater than 9.17 seconds in peg 400/pg treatment group compared to 6.84 seconds in cmc / glycerin treatment group (wilcoxon test, p = 0.037 ; see table 2, figure 1). repeated measures anova (used to compare treatment differences in mean scores by time because anova allows tests for treatment - by - time and treatment - by - sequence interactions) showed no significant between - treatment differences for time at bcva overall (p = 0.49) or any time point (p > 0.36), for reading rate overall (p = 0.082) or at any timepoint (p > 0.20), or for functional blink rate overall (p = 0.1408) or at any timepoint (p > 0.14). no adverse events related to the test product were reported and no patients discontinued due to an adverse event. the current study was designed to demonstrate the visual function impact of two lubricant eye drops through the use of the ivad test. the ivad test has been utilized in prior studies, demonstrating the statistically significantly shorter time at which dry eye patients could maintain their bcvas compared to normals (p = 0.0001). 1 the present study utilized this clinical tool in order to investigate the potential benefits of artificial tear use on these visual function parameters in dry eye patients. although no significant between - treatment differences were observed in the mean values of reading rate or functional blink rate at any time point post - treatment, the survival distribution for time at bcva demonstrated a statistically significant difference between treatments at 90 minutes post - dose favoring the peg 400/pg formulation (wilcoxon test, p = 0.0365). the ability of the peg 400/pg formulation to extend the amount of time to one - line loss of bcva for prolonged periods of time, as demonstrated by the ivad test, may suggest beneficial visual effects for patients. the link between visual function loss and diminished quality - of - life is well established in literature.11,12 the ability of ocular lubricants to stabilize the tear film during visual tasking and to retard the visual acuity decay between blinks likely translates to enhanced visual functioning capabilities for patients. previous research has explored the residence time and duration of action of lubricant eye drops. a prior study compared the duration of tear film stability achieved by the cmc / glycerin tear to that of a peg 400/pg tear (a formulation with similar active ingredients to that used in the present study). the results of the study demonstrated that the peg 400/pg drop achieved significantly greater extension of tfbut at 45, 60, and 90 minutes post - instillation than the cmc / glycerin drop (p < 0.05). while similar ocular surface protection was determined to result with both artificial tears immediately following instillation, the peg 400/pg tear was able to prolong tfbut and maintain positive changes in ocular protection index up to 90 minutes post - instillation.13 these results may suggest the prolonged duration of action of the peg 400/pg formulation used in the current study, as noted in the ability to positively impact the time to one - line loss of bcva 90 minutes post - instillation. additionally, previous work has shown that the peg 400/pg formulation used in this study has enhanced rheological properties, including those resulting from the dilution of sorbitol upon introduction to the tear film, which may also help to explain the effect at 90 minutes.14 while this data is important, no significant differences from baseline in bcva maintenance existed for either drug until 90 minutes post - instillation, when both tears appeared to show their maximum effectiveness. the ability of an artificial tear to promote visual function abilities has the potential to benefit various dry eye patient populations. in order to elaborate upon the extent of these visual effects, future research could examine the impact of visual function improvement on patient quality - of - life over longer - term artificial tear use ; the potential correlation of sign and symptom reduction with visual function improvement ; or the use of artificial tears while performing specific visual function tasks (eg, driving at night, computer use, watching television). investigating the potential effects of artificial tear use on visual function in patients who may not be diagnosed with dry eye, but who may experience ocular discomfort when acutely exacerbated by prolonged periods of visual tasking, could illuminate potential benefits of ocular lubricants in that population as well. no significant between - treatment differences were observed in mean scores for reading rate at any of the time points measured post - treatment. median time to one - line loss of bcva as measured using the more sensitive measure of the ivad test, however, was significantly longer with the peg 400/pg ocular lubricant than the cmc / glycerin product 90 minutes post - instillation. this is the first clinical trial using the novel ivad test to demonstrate the ability of lubricant eye drops to extend visual acuity maintenance between blinks. | objective : the purpose of the current study was to evaluate the effects of two marketed ocular lubricants on the visual decay in dry eye patients using the inter - blink interval visual acuity decay (ivad) test.methods:this controlled, randomized, double - masked crossover study compared the effects of a polyethylene glycol / propylene glycol - based (peg / pg) tear and a carboxymethylcellulose sodium (cmc)/glycerin tear on the visual acuity decay between blinks of dry eye patients. at visit 1 (day 0), baseline ivad measurements were recorded prior to instillation of a single drop of randomized study medication. ivad testing was repeated at 15-, 45-, and 90-minutes post - instillation. reading rate and functional blink rate were also evaluated. at the second visit (day 7 3), study procedures were repeated using crossover treatment.results:forty-eight (48) subjects with dry eye (61.1 14.8 years old, 79.2% female, 95.8% white) completed the study. treatment with the peg / pg - based tear demonstrated statistically significantly longer time to one - line loss of best - corrected visual acuity (bcva) as determined by the ivad test at 90 minutes post - instillation compared to the cmc / glycerin tear (p = 0.0365). measurements of median time at bcva, reading rate, and functional blink rate were similar for both treatments. both formulations were well tolerated in the population studied.conclusions:treatment with the peg / pg - based tear demonstrated statistically significant improved maintenance of visual acuity between blinks at 90 minutes post - instillation compared to the cmc / glycerin tear. this is the first study to demonstrate the ability of an artificial tear to extend visual acuity maintenance between blinks, as measured by the ivad test. |
the early and late mortality after acute myocardial infarction (ami) is declining, but cardiovascular disease (cvd) is still one of the leading causes of morbidity and death in the western world. ischemic heart disease is a feared, but often inevitable complication of atherosclerosis, the main underlying cause of myocardial infarction [1, 2 ]. inflammation is considered to be a key process for development of atherosclerosis and this includes a number of cellular and molecular responses resulting in plaque formation [2, 3 ]. despite well - documented treatment of ami survivors, both medically and by percutaneous coronary intervention (pci), some patients either do not receive this treatment, do not respond satisfactorily, or develop congestive heart failure despite treatment. several animal studies have shown that bone marrow stem cells differentiate to cardiomyocytes when infused into the affected myocardium. treatment with autologous stem cells from bone marrow has been suggested to reduce myocardial damage in patients with ami. results from clinical trials are, however, conflicting with regard to improvement of left ventricular ejection fraction [510 ]. possible mechanisms by which autologous bone marrow stem cells act are discussed to be cardiac transdifferentiation, paracrine effects, angiogenesis, and reduced apoptosis [11, 12 ]. matrix metalloproteinases (mmps), a class of 24 endopeptidases, participate in plaque instability by degrading the extracellular matrix. mmp-9, a zinc - dependent gelatinase, is found in the shoulder of the plaque, contributes to plack instability and rupture, and has been associated with acute coronary syndrome (acs) [3, 13 ]. circulating mmp-9 has been shown to be elevated in patients with ami, stable, and unstable angina pectoris [13, 14 ], as well as in hypertensives and smokers. in addition, mmp-9 is discussed to be involved in adverse left ventricular remodelling and associated with higher cardiovascular risk score. the mmps are regulated by specific endogenous inhibitors, tissue inhibitor of metalloproteinases (timps), and mmp-9 is specifically regulated when pro - mmp-9 binds to timp-1 [14, 17 ]. lately, the extracellular matrix metalloproteinase inducer (emmprin, cd147), a member of the immunoglobulin superfamily, has been discussed to be involved in both expression and release of mmp-9, thus, having a potentially regulatory role in cvd. emmprin has been shown to be expressed in atherosclerotic plaques as well as in cell types like monocytes, macrophages, and platelets. in humans, limited data exists on the influence of bone marrow stem cells on mmps that may be of importance for the myocardium and the infarction process. in the (astami) trial, the main aim was to assess the effects of intracoronary injection of autologous mononuclear bone marrow - derived cells (mbmc) on left ventricular ejection fraction in patients with st - elevation myocardial infarction (stemi). the main hypothesis was that the treatment would reduce the infarction sequelae, which, however, could not be demonstrated. the aim of this astami substudy was to investigate the influence of coronary injection of mbmc on mmp-9, timp-1, and emmprin, circulating levels as well as on gene expression in leukocytes, in patients with stemi undergoing successful pci. furthermore, to investigate any association between the measured biomarkers and infarct size and left ventricular function, our hypothesis was that mmp-9 levels would be reduced after mbmc treatment, in parallel with reduction of emmprin. briefly, it was a randomized 1 : 1 open - labelled study, where one arm was intracoronary treatment with mbmc, and the other controls without aspiration and injection of bone marrow. they were all treated with pci with stent implantation in the left anterior descending (lad) coronary artery. exclusion criteria were previous q - wave infarction, cardiogenic shock, or severe comorbidity interfering with compliance to the protocol. baseline recordings were performed during day 4 - 5 after ami, before bone marrow aspiration (in the treatment group). the study protocol, including the biobank, was approved by the regional committee for medical research ethics and all patients gave written, informed consent. a biobank, kept at 80c consisting of plasma, serum, and paxgene tubes (preanalytix gmbh, hombrechtikon, ch), the latter for gene expression measures in circulating leukocytes, was established. blood samples were collected in fasting condition between 08.00 and 10.00 am the day before transplantation in the mbmc group (day-1) (baseline), the day after (day 1) and further day 3, after 2 - 3 weeks and after 3 months. the same time interval was used for the control group, except baseline sampling (day-1) which was drawn median 4 days after pci compared to 5 days in the mbmc group. for analyses of mmp-9, timp-1, and emmprin commercial enzyme linked immunosorbent assays (elisa) (r&d systems europe, abingdon, oxford, uk) were used on serum samples, which were performed within 1 hour by centrifugation at room temperature 2500 g for 10 min. the interassay coefficients of variation (cv) were 7.3% for mmp-9, 4.4% for timp-1, and 5.4% for emmprin. isolation of rna from paxgene tubes was performed according to the manufacturers instruction (preanalytix, qiagen gmbh, germany) in a subset of randomly selected samples (n = 47), with an additional cleaning step (rneasy minelute cleanup kit, qiagen). a complementary dna (cdna) of the messenger rna (mrna) content was achieved by inversely transcribing total rna in the samples. the genetic expression of mrna of mmp-9 and emmprin was performed by use of real - time pcr on the viia 7 real time pcr system (applied biosystems, foster city, ca, usa) and the ct method was applied. this relative or comparative ct method determines the relative target quantity (rq - values) in the samples, by measuring the amplification (crossing threshold ct) of the target samples and in a reference sample and normalized to an endogenous control (house - keeping gene). assays for the target genes were hs00234579_m1 for mmp-9, hs00936295_m1 for emmprin, and -2 macroglobulin (hs99999907_m1) was chosen as house - keeping gene. left ventricular ejection fraction (lvef) and infarct size were obtained by electrocardiogram - gated single photon emission computed tomography (spect) (ge medical systems with 4d - mspect software) at baseline (4.0 1.4 days after the ami). mmp-9, timp-1, and emmprin levels were all skewly distributed and nonparametric statistics were used throughout. for group comparisons the mann - whitney test was used for continuous data and chi square test for categorical data. friedman test was performed to analyze for differences between any time points within the groups. for changes from baseline (day-1) to the subsequent time points, wilcoxon test was used only when friedman test was significant. for differences in changes between the randomized groups, baseline characteristics of the study population according to the randomized groups are shown in table 1. one hundred patients included in the astami study, 50 randomized to mbmc treatment and 50 controls, were followed. from one patient they were all medically treated according to current guidelines, thus, all patients were on statins, beta - blockers, ace - inhibitors / atii antagonists, and antithrombotic agents. although blood samples at baseline were obtained one day later (median) from symptom start of ami in the mbmc group compared to controls, no significant differences between the groups were recorded at baseline (day-1). no differences in mmp-9, timp-1, or emmprin between the mbmc group and controls were seen at any further time points. in the mbmc group there was a significant increase in mmp-9 levels from baseline to 2 - 3 weeks (p = 0.009), which could not be demonstrated in the control group. emmprin levels were significantly reduced from baseline to 2 - 3 weeks and 3 months in both groups (p < 0.0001, all). when analyzing for differences between the groups in changes from baseline to further time points, we could demonstrate a significant difference in change in mmp-9 levels between the two groups at 2 - 3 weeks and after 3 months, showing a more pronounced increase in the mbmc group (p = 0.030 and p = 0.05, resp.). we observed no differences in mmp-9 gene expression between the two groups at any time points, while the emmprin gene expression was significantly lower in the mbmc group (n = 23) versus the controls (n = 24) after 3 months (p = 0.03) (table 3). the levels of both mmp-9 and emmprin gene expressions were significantly reduced from baseline to 3 months in the mbmc group (p < 0.0001 and p = 0.002, resp.). there were, however, no differences between the groups in changes from baseline to any later time points. when defining baseline mrna level (rq - values) in the total population to 1, there was a 20% reduction in mmp-9 gene expression from baseline to 2 - 3 weeks, and a 50% reduction after 3 months in the mbmc group. a similar pattern was seen in gene expression of emmprin, with a 20% reduction after 2 - 3 weeks and 60% reduction after 3 months in the mbmc group. the results of the gene expression presented as fold changes are illustrated in figure 1. in the total population at baseline we observed a significant correlation between mmp-9 and emmprin (r = 0.25, p = 0.011). a strong correlation was also shown between mmp-9 and timp-1 (r = 0.66, p < 0.0001) and also between timp-1 and emmprin (r = 0.36, p = 0.01). significant correlations between ck and baseline levels of both mmp-9 and emmprin were found (r = 0.29 p = 0.005 and r = 0.43 p < 0.001, resp.). mmp-9 and emmprin, but not timp-1, showed also significant correlations to infarct size measured by spect (r = 0.24, p = 0.018 and r = 0.27 p = 0.008, resp.). emmprin levels were also found to be inversely correlated to lvef at baseline (r = 0.31 p = 0.002). we observed no significant correlations between circulating mmp-9 and gene expression of mmp-9 at any time points in the total population, or in the single groups. likewise there were no correlations between circulating emmprin and gene expression of emmprin, or between gene expression of emmprin and mmp-9 levels in either groups or in the total population. the main finding in the present study was that there was limited influence of intracoronary injection of mbmc transplantation after ami on circulating levels of mmp-9, timp-1, and emmprin, other than a more pronounced increase in mmp-9 after 2 - 3 weeks in the mbmc group. emmprin levels were reduced after 2 - 3 weeks and 3 months in both groups. at baseline both mmp-9 and emmprin were significantly correlated to myocardial injury assessed by biomarkers and infarct size and might therefore support their predictory ability for later outcome. all patients were medically treated according to current guidelines ; thus, any influence by medication on the measured variables would be equally affected in the randomized groups. in both in vitro and in vivo studies, stem cell transplantation has been shown to reduce mmps after ami and improve ventricular remodeling. our hypothesis was therefore that treatment with mbmc would reduce the circulating levels of the selected biomarkers. in a study using modified mesenchymal stem cell transplantation into ami rat hearts, mesenchymal stem cells are multipotent stromal cells that can differentiate into a variety of cell types, and the results are thus not quite comparable to ours. in addition, in contrast, we found a significantly more pronounced increase in mmp-9 levels from baseline to 2 - 3 weeks in the mbmc group compared to controls. in accordance with our findings roderfelt. demonstrated a transient inflammatory response and upregulation of mmp-9 activity after bone marrow transplantation in abcb4 (hepatic fibrosis) mice. therefore we assume that the levels were normalized when baseline sampling in the present study was performed and limited influenced by the acute phase reaction. in the control group in our study, this procedure which itself is a trauma could influence the release of inflammatory markers and contribute to the elevated levels in the mbmc group. in the study by shu. using mesenchymal stem cell transplantation, timp-1 levels did not vary significantly, which is in accordance with our findings of no changes in this variable during the observation period in any of the groups. the significant reduction in genetic expression of mmp-9 seen at 3 months might be discussed as compensatory to the increase observed in the circulating levels. mmp-9 expression is a crucial pathogenic feature in a range of conditions and disease states, also other than cvd [2830 ], in which treatment with stem cells has been shown to suppress or downregulate the mmp-9 expression and thereby improving the current condition. the underlying mechanisms for the influence of stem cells on mmps are not clarified. in cell culture of cardiac fibroblasts could demonstrate that the protein expression and activity of mmp-2, but not mmp-9, were increased in response to hypoxia and decreased when cocultured with mesenchymal stem cells. it has also been demonstrated that early endothelial progenitor cells increased mmp-9 expression in vitro, whereas mmp-2 was increased in outgrowth endothelial cells. the type of stem cells seems to be of importance regarding the degree of influence on mmps. the importance of emmprin as an inducer of mmp-9 has been explored to a limited extent in humans. in our study circulating levels of mmp-9 and emmprin were significantly correlated, indicating a common regulatory pathway. circulating levels as well as genetic expression of emmprin there was, however, no influence of mbmc on circulating levels or gene expression of emmprin, shown by the significant reduction in both groups during the observation period. expression of the emmprin - gene in circulating leukocytes, also reported by xu. assessed by flow cytometry, may indicate that the leukocytes contribute to the circulating levels, although no correlation between circulating levels and gene expression was observed. the reduction over time seen in emmprin expression, with subsequent reduction in mmp-9 gene expression, contributes to the assumption that emmprin is an inducer of mmp-9. the significant correlations found between both mmp-9 and emmprin, and myocardial injury assessed by biomarkers as well as infarct size measured by spect, have been sparsely explored in humans. in experimental ami, mmp-9 has been shown to increase infarct size and left ventricular fibrosis, in accordance with our findings. an association between emmprin and the degree of myocardial injury and lvef has previously been reported in the work by nie., but this was a post mortem immunohistochemistry study which showed a strong increase in emmprin around the zone of necrosis in the ami group. this can to some degree be compared to our findings of the correlations between mmps and biomarkers of ami and also to our results of an inverse correlation between emmprin and lvef. an additional contribution to this understanding has been demonstrated in cd147 mice, where the disruption of the emmprin - cyclophilin a interaction reduced infarct size. our findings contribute to the suggestion that the expression of emmprin is a decisive factor in regulating mmp-9 activity and thereby involved in myocardial remodeling. the strength of the present study is the randomized design, the rather frequent sample collection for determination of the profiles, and gene expression analysis in a relatively large subpopulation. all patients were medically treated according to current guidelines ; thus any influence by medication on the measured variables would therefore be equal in the randomized groups. there was, however, no significant difference between the two groups at baseline, that is, after the bone marrow aspiration in the mbmc group. it should be noted that the measures of circulating mmp-9 and timp-1 were performed in serum, as also used in many other studies. the proteins are released upon platelet activation during clotting, thus, the levels measured do not reflect the true circulating levels. however, the same standardized procedure for serum preparation was applied throughout the study, and therefore we assume that the comparisons between the randomized groups have been limited influenced. from the literature there are both coincide results and not when using plasma or serum samples, thus, it is important to take this into account when comparing results between studies. the gene expression analyses were performed in whole blood with circulating leukocytes as the rna source, which might not be the most important source of either mmp-9 or emmprin. when performing stem cell transplantation as treatment regimen, several studies have discussed the timing, type of stem cells, and the procedure of the transplantation for optimization of the results [37, 38 ], but a conclusion has not yet been made. limited effects of intra coronary injection of mbmc transplantation on circulating levels as well as gene expression of mmp-9 and emmprin in patients with stemi treated with pci could be demonstrated. emmprin levels were reduced in both groups, whereas mmp-9 showed increased levels in the mbmc group. both mmp-9 and emmprin were significantly correlated to myocardial injury and infarct size, indicating that the regulation of metalloproteinases is important in the process of an ami. the results contribute to the understanding of the pathophysiology of metalloproteinases in ami, but further investigations are needed regarding timing and type of stem cells. | background. matrix metalloproteinase-9 (mmp-9), regulated by tissue inhibitor of metalloproteinase-9 (timp-1) and the extracellular matrix metalloproteinase inducer (emmprin), contributes to plaque instability. autologous stem cells from bone marrow (mbmc) treatment are suggested to reduce myocardial damage ; however, limited data exists on the influence of mbmc on mmps. aim. we investigated the influence of mbmc on circulating levels of mmp-9, timp-1, and emmprin at different time points in patients included in the randomized autologous stem - cell transplantation in acute myocardial infarction (astami) trial (n = 100). gene expression analyses were additionally performed. results. after 2 - 3 weeks we observed a more pronounced increase in mmp-9 levels in the mbmc group, compared to controls (p = 0.030), whereas emmprin levels were reduced from baseline to 2 - 3 weeks and 3 months in both groups (p < 0.0001). gene expression of both mmp-9 and emmprin was reduced from baseline to 3 months. mmp-9 and emmprin were significantly correlated to myocardial injury (ck : p = 0.005 and p < 0.001, resp.) and infarct size (spect : p = 0.018 and p = 0.008, resp.). conclusion. the results indicate that the regulation of metalloproteinases is important during ami, however, limited influenced by mbmc. |
tarsal plates removed from fresh cadaver 's upper and lower eyelids of a healthy caucasian female donor (36 years of age) were obtained from mid - america transplant (st. louis, mo, usa). the use of human tissue in research conformed to the provisions of the declaration of helsinki and was exempted by the washington university human subjects protection office. prior to removal of eye tissues, medical and ocular histories of the donor had been deidentified and reviewed to ensure no evident ocular or systemic diseases. the removal of donor eyelid tissues and corneas was performed under a standard protocol for procurement of ocular tissues. all transgenic mice were bred at the animal science research center of the university of missouri (columbia, mo, usa). animal experiments were conducted in accordance with the institutional guidelines on the care, welfare and treatment of laboratory animals, and the protocols were approved by the university of missouri institutional animal care and use committee. the experiments conformed to the standards in the arvo statement for the use of animals in ophthalmic and vision research. transgene alleles were screened by pcr using tail dna, following the conditions and primer pairs recommended for jax mice (krt14-rtta stock#008099 and teto - cre stock#006224) and previously reported for fgfr2-flox mice. compound transgenic mice of k14rtta - tetocre - fgfr2 were generated via natural mating following the scheme illustrated in figure 1. in this deletion system, cre expression in krt14- (or k14)-expressing cells can be initially induced in mice of any age by systemic administration of dox, and consequently the floxed fgfr2 is ablated by cre recombinase (fig. conditional knockout of fgfr2 was induced in 2-month - old adult mice by ad libitum dox chow feeding, for 4 days to 2 weeks, at the dosage of 1 g dox / kg chow (dox diet # ad3008 ; custom animal diets, bangor, pa, usa). fresh mouse eyelids were collected from transgenic and control mice, immediately fixed with 4% paraformaldehyde overnight, and rinsed with pbs. for oil - red - o (oro) staining of the eyelid whole mount, eyelids were placed in 60% 2-propanol for 15 minutes, stained with oro solution for 30 minutes, and then destained with 60% 2-propanol for 15 to 30 minutes to achieve optimal lipid staining over the background color. for oro staining on cryosections, frozen sections were placed in 60% 2-propanol for 1 minute, stained with oro solution for 15 minutes, rinsed with pbs, and counterstained with hematoxylin. mouse eyes with eyelids were dissected, fixed overnight in 4% paraformaldehyde (pfa) in pbs, and then processed for embedding in paraffin. tissue sections (5 m) were deparaffinized with xylene, rehydrated with ethanol, and stained with either hematoxylin and eosin (h&e) or periodic acid - schiff (pas) reagent per the manufacturer 's instructions. 5-bromo-2-deoxyuridine (brdu), 0.1 mg / g of body weight, was injected intraperitoneally and labeled for 2 hours before mice were euthanized. paraffin sections were deparaffinized in xylene, rehydrated in a decreased ethanol series, and subjected to antigen retrieval in 10 mm sodium citrate buffer by boiling for 10 minutes. sections were treated with 3% hydrogen peroxide in pbs for 20 minutes to block endogenous peroxidase activity. cyrosections (7 m) were dipped in pbs to remove oct, fixed with 4% pfa for 10 minutes, and then rinsed with pbs three times. tissue sections were blocked with 3% horse serum in pbst (pbs plus 0.1% tween-20 for paraffin sections) or pbs plus 0.5% triton x-100 (for cryosections) for 1 hour at room temperature and then incubated overnight at 4c, with primary antibodies diluted in the same buffer. slides were washed with pbs, incubated at room temperature for 1 hour with either fluorophore - conjugated or biotinylated secondary antibodies, and then washed with pbs. for immunofluorescence, cell nuclei were stained with 4,6-diamidino-2-phenylindole (dapi), and slides were mounted with mowiol (sanofi - aventis, bridgewater, nj, usa) for viewing under a leica microscope equipped with a charge - coupled device (ccd) camera for photography. for immunohistochemistry, sections were incubated with vectastain elite abc reagent (pk-6100 ; vector laboratories, burlingame, ca, usa), and color was developed by using 3,3-diaminobenzidine as a substrate (d4293 ; sigma - aldrich corp. primary antibodies were purchased from the following sources : anti - fgfr2 (ab10648 ; abcam, cambridge, ma, usa) ; anti - keratin 10 and anti - keratin 14 (prb-159p and prb-155p, respectively ; covance, emeryville, ca, usa) ; anti - keratin 16 (nbp2 - 45538 ; novusbio, littleton, co, usa) ; anti - p63 (gtx102425, genetex, irvine, ca, usa), anti - ppar (# 2435 ; cell signaling, danvers, ma, usa) ; anti - pcna (ab29 ; abcam) ; and anti - brdu (m-0744 ; dako, carpinteria, ca, usa). fluorophore - conjugated secondary antibodies were obtained from thermofisher scientific (rockford, il, usa) and biotinylated secondary antibodies were from vector laboratories. for quantitative analysis of brdu index in mg ductal epithelial cells, two eyelids of different mice were excised from either control or fgfr2 fed with dox for 6 days. a minimal of four cross sections along a mg central duct and a minimal of six ducts on each section data were expressed as mean sem, and p values were calculated using paired student 's t - tests, with p < 0.05 being significant. tarsal plates removed from fresh cadaver 's upper and lower eyelids of a healthy caucasian female donor (36 years of age) were obtained from mid - america transplant (st. louis, mo, usa). the use of human tissue in research conformed to the provisions of the declaration of helsinki and was exempted by the washington university human subjects protection office. prior to removal of eye tissues, medical and ocular histories of the donor had been deidentified and reviewed to ensure no evident ocular or systemic diseases. the removal of donor eyelid tissues and corneas was performed under a standard protocol for procurement of ocular tissues. all transgenic mice were bred at the animal science research center of the university of missouri (columbia, mo, usa). animal experiments were conducted in accordance with the institutional guidelines on the care, welfare and treatment of laboratory animals, and the protocols were approved by the university of missouri institutional animal care and use committee. the experiments conformed to the standards in the arvo statement for the use of animals in ophthalmic and vision research. transgene alleles were screened by pcr using tail dna, following the conditions and primer pairs recommended for jax mice (krt14-rtta stock#008099 and teto - cre stock#006224) and previously reported for fgfr2-flox mice. compound transgenic mice of k14rtta - tetocre - fgfr2 were generated via natural mating following the scheme illustrated in figure 1. in this deletion system, cre expression in krt14- (or k14)-expressing cells can be initially induced in mice of any age by systemic administration of dox, and consequently the floxed fgfr2 is ablated by cre recombinase (fig. conditional knockout of fgfr2 was induced in 2-month - old adult mice by ad libitum dox chow feeding, for 4 days to 2 weeks, at the dosage of 1 g dox / kg chow (dox diet # ad3008 ; custom animal diets, bangor, pa, usa). fresh mouse eyelids were collected from transgenic and control mice, immediately fixed with 4% paraformaldehyde overnight, and rinsed with pbs. for oil - red - o (oro) staining of the eyelid whole mount, eyelids were placed in 60% 2-propanol for 15 minutes, stained with oro solution for 30 minutes, and then destained with 60% 2-propanol for 15 to 30 minutes to achieve optimal lipid staining over the background color. for oro staining on cryosections, frozen sections were placed in 60% 2-propanol for 1 minute, stained with oro solution for 15 minutes, rinsed with pbs, and counterstained with hematoxylin. mouse eyes with eyelids were dissected, fixed overnight in 4% paraformaldehyde (pfa) in pbs, and then processed for embedding in paraffin. tissue sections (5 m) were deparaffinized with xylene, rehydrated with ethanol, and stained with either hematoxylin and eosin (h&e) or periodic acid - schiff (pas) reagent per the manufacturer 's instructions. 5-bromo-2-deoxyuridine (brdu), 0.1 mg / g of body weight, was injected intraperitoneally and labeled for 2 hours before mice were euthanized. paraffin sections were deparaffinized in xylene, rehydrated in a decreased ethanol series, and subjected to antigen retrieval in 10 mm sodium citrate buffer by boiling for 10 minutes. sections were treated with 3% hydrogen peroxide in pbs for 20 minutes to block endogenous peroxidase activity. cyrosections (7 m) were dipped in pbs to remove oct, fixed with 4% pfa for 10 minutes, and then rinsed with pbs three times. tissue sections were blocked with 3% horse serum in pbst (pbs plus 0.1% tween-20 for paraffin sections) or pbs plus 0.5% triton x-100 (for cryosections) for 1 hour at room temperature and then incubated overnight at 4c, with primary antibodies diluted in the same buffer. slides were washed with pbs, incubated at room temperature for 1 hour with either fluorophore - conjugated or biotinylated secondary antibodies, and then washed with pbs. for immunofluorescence, cell nuclei were stained with 4,6-diamidino-2-phenylindole (dapi), and slides were mounted with mowiol (sanofi - aventis, bridgewater, nj, usa) for viewing under a leica microscope equipped with a charge - coupled device (ccd) camera for photography. for immunohistochemistry, sections were incubated with vectastain elite abc reagent (pk-6100 ; vector laboratories, burlingame, ca, usa), and color was developed by using 3,3-diaminobenzidine as a substrate (d4293 ; sigma - aldrich corp. primary antibodies were purchased from the following sources : anti - fgfr2 (ab10648 ; abcam, cambridge, ma, usa) ; anti - keratin 10 and anti - keratin 14 (prb-159p and prb-155p, respectively ; covance, emeryville, ca, usa) ; anti - keratin 16 (nbp2 - 45538 ; novusbio, littleton, co, usa) ; anti - p63 (gtx102425, genetex, irvine, ca, usa), anti - ppar (# 2435 ; cell signaling, danvers, ma, usa) ; anti - pcna (ab29 ; abcam) ; and anti - brdu (m-0744 ; dako, carpinteria, ca, usa). fluorophore - conjugated secondary antibodies were obtained from thermofisher scientific (rockford, il, usa) and biotinylated secondary antibodies were from vector laboratories. for quantitative analysis of brdu index in mg ductal epithelial cells, two eyelids of different mice were excised from either control or fgfr2 fed with dox for 6 days. a minimal of four cross sections along a mg central duct and a minimal of six ducts on each section data were expressed as mean sem, and p values were calculated using paired student 's t - tests, with p < 0.05 being significant. to investigate the importance of fgfr2 in mg homeostasis, we first examined fgfr2 expression patterns in the tarsal plate of human and mouse eyelids. we noted high fgfr2 levels were expressed in both acinar and ductal epithelial cells of human and mouse mgs (fig. the finding of mouse mgs having a similar fgfr2 expression pattern to that of human mgs suggests that fgfr2 signaling is required for mg homeostasis in both species, similar to what has been reported in mouse sgs. a) in human mg, fgfr2 is expressed in the acini (a), ductules (d), and central duct (d). in the peripheral mg acinus, fgfr2 immunoreactivity was detected in both the cell membrane and nuclei of basal epithelial cells (black arrow) and in newly differentiated meibocytes (white arrow). (b) in mouse mg, the fgfr2 expression pattern was similar to that seen in human mg (a). conditional deletion mediated by keratin 5 (krt5) promoter has shown that fgfr2b is required for sg homeostasis in the skin of adult mice. however, to our knowledge, the role of fgfr2 in mg homeostasis has never been investigated in that mouse model. keratin 14 (krt14) is a keratin pair of krt5 and is known to be expressed in various ocular surface epithelial tissues, including mgs. to investigate whether fgfr2 plays a role in mg homeostasis, we generated a triple transgenic mouse model (krt14ta - tetocre - fgfr2), as depicted in figure 1, in which conditional deletion of fgfr2 only occurs via activation of krt14 promoter on dox feeding. at 2 months of age, the mice were fed either regular chow (control mice) or dox chow (fgfr2 conditional knockout or fgfr2 mice). the triple transgenic mice fed with regular chow display no evident mg pathologies but develop mg atrophy on feeding with dox - containing chow. after 7 to 10 days of dox chow feeding, fgfr2 mice were reluctant to keep their eyes open wide and showed symptoms of ocular irritation. with extended dox feeding (14 days), more advanced symptoms were noted, with macerated periorbital hairs and eyelids, suggesting excessive eye rubbing due to ocular irritation (fig. lipid (meibum) production by mgs in the upper eyelids was assessed by eyelid whole mounts stained with oro in control mice, meibum was seen in the central duct, but in fgfr2 mice, a reduction of meibum staining in the central duct and a reduction in mg acinar size were visible (compare fig. these findings suggest that fgfr2 signaling is essential for mg function and homeostasis in adult mice. the results further indicate that we have created a mouse model with inducible mg atrophy that causes ocular symptoms similar to those of mgd in humans. upper eyelids were dissected from control mice (fed regular chow) and fgfr2 mice (fed dox chow for 10 days) and subjected for whole - mount oro staining to view lipid (meibum) production by mg acini (arrows labeled a). meibum secreted into main duct (arrowhead labeled d) was stained in a dark - red color in control mice (a). compared with control mice, fgfr2 mice exhibited a reduction of mg acinar area and meibum production (b). (c, d) compared with control mice (c), fgfr2 mice showed signs of ocular irritation, including loss of corneal luster and macerated eyelids, after extended (2 to 3 weeks) dox chow feeding (d). such signs of ocular irritation were likely due to increased tear evaporation and tear film instability. histologic examination of mg atrophy after 1 week of dox feeding revealed a moderate reduction in the number of mg acini in fgfr2 mice compared with the number of mg acini in control mice (fig. immunostainings of mucin 5ac (muc5ac) as a goblet cell marker and of krt13 as a conjunctival epithelial marker (supplementary fig. however, pas staining revealed no discernible difference in goblet cell density between control and fgfr2 mice. in contrast to the conjunctival epithelium, the corneal epithelial layer after 2 weeks of dox feeding appeared to be thinner in fgfr2 mice than in control mice (figs. 4c, 4d). (a, b) h&e staining of frontal sections from control (no dox) and fgfr2 mice after 1 week of dox feeding, showing a moderate reduction in the number of mg acini in mutant mice compared with the number of mg acini in control mice (broken line circled areas). the conjunctival (conj) and corneal (co) epithelium (epi) looked similar in the control and fgfr2 mice. (c, d) pas staining showed severe mg atrophy, with minimal acinar tissue, after 2 weeks of dox feeding. there was no discernible difference in pas - positive goblet cells (gb, arrowheads) between control and fgfr2 mice. the thickness of the corneal epithelial layer (epi, arrows in d) was significantly reduced in fgfr2 deletion mice. (e, f) oro staining of cross sections of the upper eyelids in fgfr2and control mice showing a reduction mg acinar size (labeled a) and a decrease in meibum volume in the central duct (labeled d) in fgfr2 mice fed dox chow for 10 days. cross sections of the upper eyelids of fgfr2 and control mice were stained with oro to correlate reduced meibum production with the morphologic and histologic changes of mg atrophy (figs. lipid staining confirmed that mg atrophy in fgfr2 mice was associated with a severe decrease in acinar size and a reduction of meibum volume in the central duct. the results suggest that the degree of mg atrophy in this mouse model can be modulated by the duration of dox feeding. to evaluate the efficiency of dox induced gene deletion, we examined the levels of cre and fgfr2 in the eyelids of control and fgfr2 mice (supplementary fig cre was expressed in most mg acinar cell nuclei but with variable amounts (supplementary fig. the expression of cre in ductal cells was delayed, but high levels were detected after 6 days of dox feeding (supplementary fig. fgfr2 level was reduced significantly in the mg acini of fgfr2 mice fed with dox chow compared with that in control mice (supplementary figs. immunofluorescence of fgfr2 was diminished in both mg acinar and ductal cells but was still detectable in the conjunctival epithelium of fgfr2 mice after 10 days of dox induction (supplementary figs. s2f, s2f). to further evaluate the phenotype of mg atrophy in fgfr2 mice, we examined the immunofluorescence of krt14 expression in different mg structures, such as the acinus, ductule, and the central duct (fig. as the diagram in figure 5 illustrates, cross sections of the upper eyelid in the distal mg area and of the lower eyelid close to mg orifice were selected to investigate any changes in acini around the ductules and acini around central duct. mg acinar atrophy was readily visible in fgfr2 mice fed with dox for 1 week compared with the control mice. the acellular area (occupied by meibum) within the ductule or central duct was reduced or nearly absent in fgfr2 mice, a phenotype consistent with reduced meibum synthesis and secretion and ductal obstruction with exfoliated epithelial plugs known in human mgd. cross sections of the distal acinar area of the upper eyelid (a, b) and the central ductal area of lower eyelid (c, d), as illustrated in the diagram on left, were examined for krt14 immunofluorescence. (a, b) mg acinar atrophy was seen in fgfr2 mice fed with dox for 7 days, as shown by the reduction of krt14 staining compared with control mice. in contrast to acinar tissue, the ductal structures in mutant mice were not affected significantly (compare areas marked by dotted lines in b and d versus a and c). (c, d) the acellular area (occupied by meibum) within the ductule or central duct (white arrows, labeled d) can be readily seen in control mice, but is either visibly reduced or nearly absent in fgfr2 mice because of decreased meibum production. in normal mgs, meibocytes within an mg acinus undergo a pattern of differentiation, starting from undifferentiated proliferating basal cells in the periphery and progressing to suprabasal nucleated meibocytes that synthesize lipids. during this differentiation process, peroxisome proliferator activated receptor gamma (ppar), a lipid - activated hormone receptor that regulates lipid synthesis, is up - regulated in newly differentiated meibocytes and then down - regulated in mature or terminally differentiated meibocytes. compared with control mice, fgfr2 mice fed dox chow for 1 week exhibited a significant decrease in the number of ppar-positive meibocytes, which correlates with the finding of acinar atrophy (figs. ppar, krt10, and krt16 expression in lower eyelids detected by immunohistochemistry. (a) in control mice, within an acinus, ppar is not expressed in undifferentiated basal cells (small arrow in a). ppar expression (brown nuclear staining) is up - regulated in differentiated meibocytes (large arrow) and then down - regulated in mature meibocytes (white arrow). meibocytes inside the duct (labeled d ; red broken - line circle) were negative for ppar. (b) in fgfr2 mice fed with dox chow for 1 week, mg acinar atrophy was noted, with a reduction of ppar-positive meibocytes in mg acinus. additionally, although ductal cells in mutant mice were ppar negative, they did not appear to be fully mature (as shown in the nucleated cells inside red circle in fig. (c, d) in both control and fgfr2 mice, krt16 expression levels were higher in the ductules (d) and main duct (labeled d) than in acini. severe mg acinar atrophy was seen in fgfr2 mice, but ductal tissues looked intact. (e, f) krt10 expression was found in cells within central duct (red broken - line circles) in both control and fgfr2 mice. in fgfr2 mice, a reduction of meibum volume and the presence of nucleated cell debris were seen (f). normally, as meibocytes proceed through their usual holocrine differentiation, the acinar cells increase in size as a consequence of accumulating lipid droplets, and then rupture and release their lipid cargo into the ductule space. before the lipid (meibum) in the central duct is delivered to the ocular surface to form the outer layer of tear film, most of the cellular remnants are disintegrated. in the control mice, this process was evident by the lack of ppar expression in mature meibocytes with high lipid content inside the duct (fig. the meibocytes in the central duct contained more densely packed and nucleated cell debris, suggesting that fgfr2 deletion inhibits differentiation and maturation of meibocytes and disrupts the normal holocrine mechanism (fig. 6b). to confirm the observation that ductal structures are less or minimally affected compared with acini in fgfr2 mice, we examined by immunohistochemistry the expression of krt16, a marker for ductal epithelia (figs. 6c, 6d). in control mice, krt16 was expressed at a much higher level in mg ductules and central duct than in acini. in fgfr2 mice, despite severe mg acinar atrophy, the intensity of krt16 immunostaining in the ductal tissues was at a similar level as in control mice (compare fig. this result suggests that, in contrast to mg acinar cells, ductal epithelial cells are not significantly affected by fgfr2 deletion. jester. previously demonstrated that expression of krt1 (which pairs with krt10) extends from the fully keratinized epidermis (skin) into the ductal epithelium at the mg orifice in young adult mice and that krt1 expression extends posteriorly toward the conjunctiva. krt10 expression in the mg central duct was also shown by call. recently. we found that krt10 was expressed in ductal epithelial cells in both control and fgfr2 mice (figs. however, the central ducts of fgfr2 mice showed a reduction of meibum volume and an increase of cellular debris (fig. in contrast, ductal epithelial cells are not significantly affected by the loss of fgfr2. when apoptosis was examined by tunel assay, a few positive nuclei (indicating apoptosis) were only found in the duct, but not in the acini, in both control and fgfr2 mice, suggesting that mg atrophy in mutant mice is not caused by cell death (data not shown). to further explore the pathogenic mechanisms of mg atrophy in fgfr2 mice, we examined the number of basal cells in mg acini using p63 as a marker. transcription factor p63 is a member of the p53 family and a key regulator of epithelial cell fate. we found that basal cell density in mg acini of fgfr2 mice was largely reduced after 4 days of dox induction compared with the control mice (compare fig. we then investigated the expression pattern of another cell proliferation marker, proliferating cell nuclear antigen (pcna) (figs. immunofluorescence of pcna (red) was colocalized with krt14 immunofluorescence (green) to demarcate the mgs in eyelids. in control mice, pcna - positive nuclei were found in basal epithelial cells of mg acini and ducts, suggesting that these cells are in the proliferative state. in fgfr2 mice fed dox chow for 1 week, pcna - positive nuclei were found in ductal basal cells but rarely seen in acinar basal cells. we further confirmed that cell proliferation in mg ductal epithelium of fgfr2 mice by colocalizing pcna immunofluorescence with krt17. 6c, 6d), is also preferentially expressed in mg ductal cell (supplementary fig., these results suggest that fgfr2 deletion primarily inhibits proliferation of the mg acinar basal cells. (a, b) transcription factor p63 in mgs detected by immunohistochemistry on crysections. the basal cells in mg acini (dark brown nuclei indicated by arrows in a) and ducts (data not shown) express p63 (a). in fgfr2 mice fed with dox for 4 days, the number of basal cells around the mg acini was markedly reduced (b). (c, d) immunofluorescence of krt14 (green) and proliferative cell nuclear antigen (pcna) (red). (c), intense pcna immunofluorescence was found in acinar (a) and ductal (d) basal epithelial cell nuclei (red as indicated by white arrow in c), suggesting that these cells are in the proliferative state. within a mg acinus, pcna immune intensity decreases when basal cells are differentiated into meibocytes (arrowhead in c). in fgfr2 mice induced by dox for 1 week, pcna - positive nuclei were rarely seen in acinar basal cells, but detected in ductal basal layer (white broken - line circle in d). (e, f) brdu - labeled cells were found in mg acinar and ductal basal cell layer in control mice (arrows in e). in fgfg2 mice fed with dox for 6 days, brdu incorporation was seen in mg ductal basal cells (arrows in f), but rarely detected in the acini. brdu incorporation assay was performed to examine the effect of fgfr2 on cell cycle progression in mg acinar basal cells (figs. brdu - positive nuclei, indicative of cells at s - phase of cell cycle, were found in the basal cell layers of mg acini and in central ducts. compared with the control mice, a drastic reduction in brdu - labeled cells was noted in mg acini of fgfr2 mice, suggesting that fgfr2 deletion blocks cell cycle progression in mg acinar basal cells. in contrast, brdu incorporation in the ductal basal cells of fgfr2 mice did not seem to be affected. the brdu labeling index in ductal epithelium was 7.31 0.65% in control and 5.90 0.55% in fgfr2 (p = 0.08), indicating the difference was not statistically significant. the findings of brdu labeling are consistent with those of pcna immunofluorescence. taken together, our cell proliferation studies imply that fgfr2 signaling is crucial for acinar basal cell proliferation to maintain mg homeostasis in adult mice. to explore the downstream signaling pathways of fgfr2, we further examined the levels of erk1/2 (or erk) proteins and their active form, the phosphorylated erk (or perk), in the mgs of control and fgfr2 mice fed with dox for 4 days (supplementary fig. s4). we found that erk proteins were present in both mg acinar and ductal cells in control mice (supplementary figs. s4a, s4c), but perk (the active form) was mostly localized in the nuclei of mg acini. despite mg atrophy in fgfr2 mice, perk could still be found in the nuclei of mg acinar cells of both control and fgfr2 mice (supplementary figs. s4b, s4d), suggesting that fgfr2 may regulate mg basal cell proliferation via erk - independent pathways. to investigate the importance of fgfr2 in mg homeostasis, we first examined fgfr2 expression patterns in the tarsal plate of human and mouse eyelids. we noted high fgfr2 levels were expressed in both acinar and ductal epithelial cells of human and mouse mgs (fig. the finding of mouse mgs having a similar fgfr2 expression pattern to that of human mgs suggests that fgfr2 signaling is required for mg homeostasis in both species, similar to what has been reported in mouse sgs. a) in human mg, fgfr2 is expressed in the acini (a), ductules (d), and central duct (d). in the peripheral mg acinus, fgfr2 immunoreactivity was detected in both the cell membrane and nuclei of basal epithelial cells (black arrow) and in newly differentiated meibocytes (white arrow). (b) in mouse mg, the fgfr2 expression pattern was similar to that seen in human mg (a). conditional deletion mediated by keratin 5 (krt5) promoter has shown that fgfr2b is required for sg homeostasis in the skin of adult mice. however, to our knowledge, the role of fgfr2 in mg homeostasis has never been investigated in that mouse model. keratin 14 (krt14) is a keratin pair of krt5 and is known to be expressed in various ocular surface epithelial tissues, including mgs. to investigate whether fgfr2 plays a role in mg homeostasis, we generated a triple transgenic mouse model (krt14ta - tetocre - fgfr2), as depicted in figure 1, in which conditional deletion of fgfr2 only occurs via activation of krt14 promoter on dox feeding. at 2 months of age, the mice were fed either regular chow (control mice) or dox chow (fgfr2 conditional knockout or fgfr2 mice). the triple transgenic mice fed with regular chow display no evident mg pathologies but develop mg atrophy on feeding with dox - containing chow. after 7 to 10 days of dox chow feeding, fgfr2 mice were reluctant to keep their eyes open wide and showed symptoms of ocular irritation. with extended dox feeding (14 days), more advanced symptoms were noted, with macerated periorbital hairs and eyelids, suggesting excessive eye rubbing due to ocular irritation (fig. lipid (meibum) production by mgs in the upper eyelids was assessed by eyelid whole mounts stained with oro in control mice, meibum was seen in the central duct, but in fgfr2 mice, a reduction of meibum staining in the central duct and a reduction in mg acinar size were visible (compare fig. these findings suggest that fgfr2 signaling is essential for mg function and homeostasis in adult mice. the results further indicate that we have created a mouse model with inducible mg atrophy that causes ocular symptoms similar to those of mgd in humans. upper eyelids were dissected from control mice (fed regular chow) and fgfr2 mice (fed dox chow for 10 days) and subjected for whole - mount oro staining to view lipid (meibum) production by mg acini (arrows labeled a). meibum secreted into main duct (arrowhead labeled d) was stained in a dark - red color in control mice (a). compared with control mice, fgfr2 mice exhibited a reduction of mg acinar area and meibum production (b). (c, d) compared with control mice (c), fgfr2 mice showed signs of ocular irritation, including loss of corneal luster and macerated eyelids, after extended (2 to 3 weeks) dox chow feeding (d). such signs of ocular irritation were likely due to increased tear evaporation and tear film instability. histologic examination of mg atrophy after 1 week of dox feeding revealed a moderate reduction in the number of mg acini in fgfr2 mice compared with the number of mg acini in control mice (fig. immunostainings of mucin 5ac (muc5ac) as a goblet cell marker and of krt13 as a conjunctival epithelial marker (supplementary fig. however, pas staining revealed no discernible difference in goblet cell density between control and fgfr2 mice. in contrast to the conjunctival epithelium, the corneal epithelial layer after 2 weeks of dox feeding appeared to be thinner in fgfr2 mice than in control mice (figs. (a, b) h&e staining of frontal sections from control (no dox) and fgfr2 mice after 1 week of dox feeding, showing a moderate reduction in the number of mg acini in mutant mice compared with the number of mg acini in control mice (broken line circled areas). the conjunctival (conj) and corneal (co) epithelium (epi) looked similar in the control and fgfr2 mice. (c, d) pas staining showed severe mg atrophy, with minimal acinar tissue, after 2 weeks of dox feeding. there was no discernible difference in pas - positive goblet cells (gb, arrowheads) between control and fgfr2 mice. the thickness of the corneal epithelial layer (epi, arrows in d) was significantly reduced in fgfr2 deletion mice. (e, f) oro staining of cross sections of the upper eyelids in fgfr2and control mice showing a reduction mg acinar size (labeled a) and a decrease in meibum volume in the central duct (labeled d) in fgfr2 mice fed dox chow for 10 days. cross sections of the upper eyelids of fgfr2 and control mice were stained with oro to correlate reduced meibum production with the morphologic and histologic changes of mg atrophy (figs. lipid staining confirmed that mg atrophy in fgfr2 mice was associated with a severe decrease in acinar size and a reduction of meibum volume in the central duct. the results suggest that the degree of mg atrophy in this mouse model can be modulated by the duration of dox feeding. to evaluate the efficiency of dox induced gene deletion, we examined the levels of cre and fgfr2 in the eyelids of control and fgfr2 mice (supplementary fig. s2). after 4 days of dox feeding, cre was expressed in most mg acinar cell nuclei but with variable amounts (supplementary fig. the expression of cre in ductal cells was delayed, but high levels were detected after 6 days of dox feeding (supplementary fig. fgfr2 level was reduced significantly in the mg acini of fgfr2 mice fed with dox chow compared with that in control mice (supplementary figs. immunofluorescence of fgfr2 was diminished in both mg acinar and ductal cells but was still detectable in the conjunctival epithelium of fgfr2 mice after 10 days of dox induction (supplementary figs. s2f, s2f). to further evaluate the phenotype of mg atrophy in fgfr2 mice, we examined the immunofluorescence of krt14 expression in different mg structures, such as the acinus, ductule, and the central duct (fig. as the diagram in figure 5 illustrates, cross sections of the upper eyelid in the distal mg area and of the lower eyelid close to mg orifice were selected to investigate any changes in acini around the ductules and acini around central duct. mg acinar atrophy was readily visible in fgfr2 mice fed with dox for 1 week compared with the control mice. the acellular area (occupied by meibum) within the ductule or central duct was reduced or nearly absent in fgfr2 mice, a phenotype consistent with reduced meibum synthesis and secretion and ductal obstruction with exfoliated epithelial plugs known in human mgd. cross sections of the distal acinar area of the upper eyelid (a, b) and the central ductal area of lower eyelid (c, d), as illustrated in the diagram on left, were examined for krt14 immunofluorescence. (a, b) mg acinar atrophy was seen in fgfr2 mice fed with dox for 7 days, as shown by the reduction of krt14 staining compared with control mice. in contrast to acinar tissue, the ductal structures in mutant mice were not affected significantly (compare areas marked by dotted lines in b and d versus a and c). (c, d) the acellular area (occupied by meibum) within the ductule or central duct (white arrows, labeled d) can be readily seen in control mice, but is either visibly reduced or nearly absent in fgfr2 mice because of decreased meibum production. in normal mgs, meibocytes within an mg acinus undergo a pattern of differentiation, starting from undifferentiated proliferating basal cells in the periphery and progressing to suprabasal nucleated meibocytes that synthesize lipids. during this differentiation process, peroxisome proliferator activated receptor gamma (ppar), a lipid - activated hormone receptor that regulates lipid synthesis, is up - regulated in newly differentiated meibocytes and then down - regulated in mature or terminally differentiated meibocytes. compared with control mice, fgfr2 mice fed dox chow for 1 week exhibited a significant decrease in the number of ppar-positive meibocytes, which correlates with the finding of acinar atrophy (figs. (a) in control mice, within an acinus, ppar is not expressed in undifferentiated basal cells (small arrow in a). ppar expression (brown nuclear staining) is up - regulated in differentiated meibocytes (large arrow) and then down - regulated in mature meibocytes (white arrow). meibocytes inside the duct (labeled d ; red broken - line circle) were negative for ppar. (b) in fgfr2 mice fed with dox chow for 1 week, mg acinar atrophy was noted, with a reduction of ppar-positive meibocytes in mg acinus. additionally, although ductal cells in mutant mice were ppar negative, they did not appear to be fully mature (as shown in the nucleated cells inside red circle in fig. (c, d) in both control and fgfr2 mice, krt16 expression levels were higher in the ductules (d) and main duct (labeled d) than in acini. severe mg acinar atrophy was seen in fgfr2 mice, but ductal tissues looked intact. (e, f) krt10 expression was found in cells within central duct (red broken - line circles) in both control and fgfr2 mice. in fgfr2 mice, a reduction of meibum volume and the presence of nucleated cell debris were seen (f). as meibocytes proceed through their usual holocrine differentiation, the acinar cells increase in size as a consequence of accumulating lipid droplets, and then rupture and release their lipid cargo into the ductule space. before the lipid (meibum) in the central duct is delivered to the ocular surface to form the outer layer of tear film, most of the cellular remnants are disintegrated. in the control mice, this process was evident by the lack of ppar expression in mature meibocytes with high lipid content inside the duct (fig. the meibocytes in the central duct contained more densely packed and nucleated cell debris, suggesting that fgfr2 deletion inhibits differentiation and maturation of meibocytes and disrupts the normal holocrine mechanism (fig. 6b). to confirm the observation that ductal structures are less or minimally affected compared with acini in fgfr2 mice, we examined by immunohistochemistry the expression of krt16, a marker for ductal epithelia (figs. 6c, 6d). in control mice, krt16 was expressed at a much higher level in mg ductules and central duct than in acini. in fgfr2 mice, despite severe mg acinar atrophy, the intensity of krt16 immunostaining in the ductal tissues was at a similar level as in control mice (compare fig. this result suggests that, in contrast to mg acinar cells, ductal epithelial cells are not significantly affected by fgfr2 deletion. previously demonstrated that expression of krt1 (which pairs with krt10) extends from the fully keratinized epidermis (skin) into the ductal epithelium at the mg orifice in young adult mice and that krt1 expression extends posteriorly toward the conjunctiva. krt10 expression in the mg central duct was also shown by call. recently. we found that krt10 was expressed in ductal epithelial cells in both control and fgfr2 mice (figs. however, the central ducts of fgfr2 mice showed a reduction of meibum volume and an increase of cellular debris (fig. in contrast, ductal epithelial cells are not significantly affected by the loss of fgfr2. when apoptosis was examined by tunel assay, a few positive nuclei (indicating apoptosis) were only found in the duct, but not in the acini, in both control and fgfr2 mice, suggesting that mg atrophy in mutant mice is not caused by cell death (data not shown). to further explore the pathogenic mechanisms of mg atrophy in fgfr2 mice, we examined the number of basal cells in mg acini using p63 as a marker. transcription factor p63 is a member of the p53 family and a key regulator of epithelial cell fate. we found that basal cell density in mg acini of fgfr2 mice was largely reduced after 4 days of dox induction compared with the control mice (compare fig. we then investigated the expression pattern of another cell proliferation marker, proliferating cell nuclear antigen (pcna) (figs. immunofluorescence of pcna (red) was colocalized with krt14 immunofluorescence (green) to demarcate the mgs in eyelids. in control mice, pcna - positive nuclei were found in basal epithelial cells of mg acini and ducts, suggesting that these cells are in the proliferative state. in fgfr2 mice fed dox chow for 1 week, pcna - positive nuclei were found in ductal basal cells but rarely seen in acinar basal cells. we further confirmed that cell proliferation in mg ductal epithelium of fgfr2 mice by colocalizing pcna immunofluorescence with krt17. krt17, similar to krt 16 (as shown in figs. 6c, 6d), is also preferentially expressed in mg ductal cell (supplementary fig., these results suggest that fgfr2 deletion primarily inhibits proliferation of the mg acinar basal cells. (a, b) transcription factor p63 in mgs detected by immunohistochemistry on crysections. the basal cells in mg acini (dark brown nuclei indicated by arrows in a) and ducts (data not shown) express p63 (a). in fgfr2 mice fed with dox for 4 days, the number of basal cells around the mg acini was markedly reduced (b). (c, d) immunofluorescence of krt14 (green) and proliferative cell nuclear antigen (pcna) (red). (c), intense pcna immunofluorescence was found in acinar (a) and ductal (d) basal epithelial cell nuclei (red as indicated by white arrow in c), suggesting that these cells are in the proliferative state. within a mg acinus, pcna immune intensity decreases when basal cells are differentiated into meibocytes (arrowhead in c). in fgfr2 mice induced by dox for 1 week, pcna - positive nuclei were rarely seen in acinar basal cells, but detected in ductal basal layer (white broken - line circle in d). (e, f) brdu - labeled cells were found in mg acinar and ductal basal cell layer in control mice (arrows in e). in fgfg2 mice fed with dox for 6 days, brdu incorporation was seen in mg ductal basal cells (arrows in f), but rarely detected in the acini. brdu incorporation assay was performed to examine the effect of fgfr2 on cell cycle progression in mg acinar basal cells (figs. indicative of cells at s - phase of cell cycle, were found in the basal cell layers of mg acini and in central ducts. compared with the control mice, a drastic reduction in brdu - labeled cells was noted in mg acini of fgfr2 mice, suggesting that fgfr2 deletion blocks cell cycle progression in mg acinar basal cells. in contrast, brdu incorporation in the ductal basal cells of fgfr2 mice did not seem to be affected. the brdu labeling index in ductal epithelium was 7.31 0.65% in control and 5.90 0.55% in fgfr2 (p = 0.08), indicating the difference was not statistically significant.. taken together, our cell proliferation studies imply that fgfr2 signaling is crucial for acinar basal cell proliferation to maintain mg homeostasis in adult mice. to explore the downstream signaling pathways of fgfr2, we further examined the levels of erk1/2 (or erk) proteins and their active form, the phosphorylated erk (or perk), in the mgs of control and fgfr2 mice fed with dox for 4 days (supplementary fig. we found that erk proteins were present in both mg acinar and ductal cells in control mice (supplementary figs. s4a, s4c), but perk (the active form) was mostly localized in the nuclei of mg acini. despite mg atrophy in fgfr2 mice, perk could still be found in the nuclei of mg acinar cells of both control and fgfr2 mice (supplementary figs. s4b, s4d), suggesting that fgfr2 may regulate mg basal cell proliferation via erk - independent pathways. by definition, mgd is a chronic, diffuse mg abnormality, commonly characterized by terminal duct obstruction and/or qualitative / quantitative changes in glandular secretion. this condition may result in alterations of the tear film on the ocular surface, symptoms of eye irritation, clinically apparent inflammation, and ocular surface morbidities. mgd is the leading cause of ded in the united states and elsewhere in the developed world, affecting 5% to 30% of the population aged 50 or older. age - related changes in human mgs include primary acinar atrophy and/or inspissation of mg orifices leading to decreased meibum secretion. mg atrophy and dropout can apparently occur as early as 25 years of age, and the extent of these pathogenic changes increases significantly and approximately linearly with age. at present, the underlying mechanism of age - related mg acinar atrophy is poorly understood. in this study, we developed a novel mouse model of inducible mg atrophy by conditional deletion of fgfr2. we demonstrate for the first time in mice that fgfr2 plays an essential role in mg acinar maintenance and homeostasis. importantly, the observed mg atrophy in our mouse model as a result of loss of fgfr2 is in striking resemblance to age - related mg atrophy in humans. because fgfr2 proteins are present at high levels in both mouse and human mgs (fig. 1), our current findings thus imply that reduced or altered fgfr2-signaling activity could be one of the underlying mechanisms that lead to age - related mg acinar atrophy and glandular dropouts in humans. it is well known that the mg acinar cells (meibocytes) secrete meibum via a holocrine mechanism. during this secretion process, the meibocytes undergo a well - defined program of cell differentiation and maturation, which can be defined morphologically as undifferentiated (basal), differentiating, mature, and hypermature meibocytes. a single mg acinus consists of a contiguous layer of proliferative basal cells in the acinar periphery that surrounds a cluster of lipid - filled meibocytes undergoing differentiation and maturation. lysis of hypermature meibocytes releases meibum via a small canal (ductule) to a central excretory duct that opens at the lid margin near the mucocutaneous junction. to maintain meibum production and secretion continuously, the meibocytes are constantly undergoing renewal that is sustained by division of the basal cells in the peripheral acinus. our current data from the control mice (fig. however, how does fgfr2 signaling control mg homeostasis at cellular level ? our findings in the fgfr2 mice with dox - induced mg atrophy suggest that cell proliferation markers, including pcna expression and brdu incorporation, are drastically reduced in the mg acinar basal cells (fig. deletion of fgfr2 induced by dox results in the loss of mg acinar basal cells, as shown by the number of p63-expressing cells (fig. 7b) and disruption of the continuous replenishment of meibocytes and regeneration of mg clusters, thus leading to mg atrophy. this finding further suggests that fgfr2 signaling plays an essential role in maintaining acinar basal cell proliferation in mgs. alternatively, it is also possible that fgfr2 activity is required for the maintenance of mg acinar progenitor / stem cell population, which was recently demonstrated by parfitt. dox - induced fgfr2 deletion may result in a depletion of mg acinar progenitor cells in fgfr2 mice. nonetheless, whether fgfr2-signaling activity plays a similar role in human mgs and whether such activity is altered in aged human mgs await further investigation. in obstructive mgd, hyperkeratinization of the mg orifice is thought to lead to cystic ductal dilation and downstream disuse atrophy of the mg acini. however, ductal hyperkeratinization was not observed in a mouse model of age - related mgd. in our current mouse model, we did not see ductal dilation in fgfr2 mice, and the k16 and k10 expression patterns were not affected by mg atrophy (fig. a low level of fgfr2 was still detectable in mg ductal epithelial cells in fgfr2 mice fed dox for 6 days (data not shown). the differential deletion efficiency between mg acinar and ductal cells potentially could result from a higher fgfr2 level (fig. 1b) and a slower cell turnover rate in ductal epithelial cells than in acinar meibocytes. however, the acellular areas (indicative of meibum volume) in mg ducts were visibly reduced, and the pyknotic nuclei were increased in the ductules and central ducts of fgfr2 mice (figs. we speculate that such an accumulation of cellular / nuclear debris in the ductal system could be a contributing factor, eventually leading to pathogenic ductal obstruction. the causal relationship between mgd and inflammation remains somewhat debatable. in our fgfr2 mouse model, inflammation was not readily evident when the mutant mice developed severe mg atrophy after 2 weeks of dox treatment (fig. because dox has been shown to have anti - inflammatory effects and is frequently used clinically for treating mgd, it is possible that dox is suppressing inflammation in the fgfr2 mice. alternative conditional deletion systems have been investigated, and we are currently breeding another transgenic model using tamoxifen (instead of dox) to turn on cre expression. nonetheless, we can take advantage of our current dox inducible model to explore the pathogenic mechanisms of glandular atrophy in mgd independent of inflammation - mediated pathways. conventionally, ded is often considered to be a disorder of tear film, accompanied by changes in several ocular surface tissues, including the conjunctiva, goblet cells and corneal epithelium. similar to mgs, these ocular surface epithelial tissues also express krt14 and are subject to fgfr2 deletion in our mouse model. however, the deletion efficiency varies among these tissues, depending on several factors such as the k14-promoter activity level, accessibility to dox, and cell turnover rate. when fgfr2 protein level was examined by immunofluorescence in ocular surface tissues of fgfr2 mice fed with dox for 10 days, the signal intensity was reduced but still detectable in conjunctival and corneal epithelial cells (data not shown). in this study, we could not examine whether prolonged dox exposure results in complete depletion of fgfr2 in these tissues, because the general health of fgfr2 mice started to deteriorate after 2 weeks of feeding with dox. when conjunctival epithelia of control mice and fgfr2 mice fed with dox chow for 2 weeks were carefully examined by histology, we did not observe any major changes in cell morphology or goblet cell density (fig. s1). however, the corneal epithelial layer of fgfr2 mice was notably thinner than that of control mice (fig. 4d, pointed out by arrows). because corneal surface damage can occur in mgd patients, the corneal changes in fgfr2 mice could be secondary to the severe mg atrophy induced after 2 weeks of dox feeding. alternatively, corneal epithelial cells can be directly affected by fgfr2 deletion, as we have previously shown that fgfr2 plays a critical role in control of cell proliferation during early corneal development. to further explore whether fgfr2 is directly involved in maintaining normal corneal epithelium homeostasis, an inducible cre system driven by the cornea - specific krt12 promoter can be used in future studies to eliminate confounding factors such as the interference from eyelids and other ocular surface tissues. in conclusion, our novel mouse model with conditional deletion of fgfr2 clearly demonstrates that the fgfr2-signaling pathway is critical for mg maintenance and homeostasis in adult mice. because human mgs also express high levels of fgfr2 and because mgd is the most common cause of evaporative ded, it would be exciting to further substantiate that age - related mg atrophy and glandular dropouts in aging humans are a result of deficient fgfr2 signaling. understanding the underlying mechanism of mgd can potentially lead to the development of effective management of this condition. the animal model of mg atrophy we developed not only should allow us to elucidate a previously unexplored disease process, but would also facilitate the development of novel therapeutic strategies specific for mgd, such as modulation of fgfr2 signaling in mgs and ocular surface tissues. | purposelittle is known about the signaling mechanisms controlling meibomian gland (mg) homeostasis and the pathogenic processes leading to mg atrophy and dysfunction in dry eye disease (ded). we investigated the role of fibroblast growth factor receptor 2 (fgfr2) in the mg homeostasis of adult mice.methodsa triple transgenic mouse strain (krt14-rtta ; teto - cre ; fgfr2flox / flox), referred to as fgfr2cko mice, was generated in which the fgfr2 gene is ablated by cre recombinase in keratin 14 (krt14)-expressing epithelial cells on doxycycline (dox) induction. fgfr2 expression in normal human and mouse mgs was evaluated by immunohistochemistry. pathologic mg changes in transgenic mice with conditional deletion of fgfr2 were examined by lipid staining, histology, and immunostaining.resultsfgfr2 was highly expressed in normal human mgs and adult mouse mgs. two - month - old fgfr2cko mice fed dox - containing chow for 2 weeks developed severe mg atrophy. mg acinar atrophy in the fgfr2cko mice was associated with reduced lipid (meibum) production and the development of clinical findings similar to those in humans with evaporative ded related to mg dysfunction (mgd). immunohistochemical analyses showed that fgfr2 deletion severely affected proliferation and differentiation of mg acinar cells but affected mg ductal cells to a lesser extent.conclusionsfgfr2 deletion results in significant mg acinar atrophy and clinical manifestations of mgd in fgfr2cko mice, suggesting that mg homeostasis is fgfr2 dependent. the fgfr2cko mice with inducible mg atrophy can serve as a valuable animal model for investigating the pathogenesis of mgd and developing novel therapeutic strategies for mgd - related ded. |
assessment of functional capacity is important for identifying the physical implications of stroke, since it is currently considered the main cause of serious long - term disability in adults1, impairing physical, psychological, and social functions2. after a stroke, individuals remain with several residual impairments, especially those related to motor function, which lead to reduced functional ability3. in this sense, instruments that adequately capture several aspects of disability progression / regression are essential within clinical settings, implement more specific and effective disability management4. the use of functional tests is sometimes impossible during rehabilitation, due to the need for specialized equipment, expertise and space. in this sense, it is already known that aerobic capacity assessed on a treadmill, by analyzing the oxygen consumption (vo2) is the gold standard measure of functional performance for disabled individuals5. however, the widespread utilization of this method is limited by expertise, associated with the need for the use of specific and expensive equipment6. on the other hand, an easy assessment, such as the six - minute walking test (6mwt), which is routinely used to assess functional walking capacity of stroke individuals4, 7, 8 requires only a chronometer and a 30-meter corridor to be performed9,10,11. the establishment of valid and simple ways to use alternative measures of functional capacity after stroke would be, therefore, clinically relevant. the use of a simple tool for the assessment of functional capacity may allow clinicians to obtain clinically useful methods to estimate an important outcome, which can determine the degree of constraint imposed by the stroke, as well as its importance, by being a factor in diagnosis, prognosis, and a strong predictor of mortality12. an easily administered questionnaire was developed to assess functional capacity by the prediction of oxygen consumption (vo2) without the need for maximal cardiopulmonary exercise testing13. the duke activity status index (dasi) is a short, simple questionnaire that can be administered to patients with physical limitations. it has been previously validated with physiological measurements, such as vo2 in cardiac patients14, 15. although it was originally designed to evaluate patients with cardiovascular diseases, the dasi has also been shown to be valid and appropriate for the assessment of functional capacity of disabled individuals, such as those with moderate to severe chronic obstructive pulmonary disease (copd)16. in order to allow for its clinical use in individuals with stroke, this study investigated the associations between the dasi scores and valid and extensively used functional capacity measures (distance covered and oxygen consumption obtained during the 6mwt). therefore, the specific research question for this study was : are there significant associations between the dasi scores and the distance covered and relative vo2 during the 6mwt in individuals with chronic stroke ? individuals with chronic stroke were recruited from the general community of the city of belo horizonte, brazil, according to the following criteria : were 20 years old, had a mean time since the onset of a unilateral stroke between 1 and 5 years, were able to walk with or without assistive devices, and had no cognitive deficits, as determined by an education - adjusted cutoff score on the mini - mental state examination : 18/19 for the individuals with illiteracy and 24/25 for individuals with a basic education17, and no other neurological or orthopedic disorders. this study was approved by the ethics review board of the universidade federal de minas gerais, and all participants provided written consent, prior to data collection. initially, the participants underwent a physical examination and an interview for the collection of clinical and demographical data, which included age, gender, body mass, height, time since stroke onset, number of medications, associated diseases, and habitual walking speed (10-meter walking test)18, 19. at least 500 ml of water was provided prior to the tests, to guarantee normal hydration. the questions were read loud and repeated if necessary, and none of the participants had difficulties in understanding them. then, the participants performed the 6mwt without metabolic monitoring equipment, and the distance covered was recorded. the test was carried out in a 30-meter corridor according to the procedures and recommendations of the american thoracic society9, which were adapted to the brazilian portuguese language11. then, the individuals performed the 6mwt test with a portable metabolic system, which was previously calibrated. the means of the relative vo2 (mlkgmin) values for the final three minutes of the 6mwt (steady state condition) were recorded for analyses20. the brazilian version of the dasi was employed to assess the individuals perceived functional capacity14, 16. its scores reflect the role of physiological factors in the individual s daily life and consider all important spheres related to functional capacity status, such as personal care, ambulation, household tasks, sexual function, and recreational activities21. it is composed of 12 items which describe daily living activities, with their correspondent metabolic equivalents (mets), and are answered with yes or no. the dasi scores ranged from 0 to 58.2, and higher scores reflect higher functional capacity14, 16. the distance covered during the 6mwt, which appropriately reflects functional capacity status, was recorded for analyses10, 22. the cortex metamax 3b is a portable metabolic system that allows online data transmission for a distance up to 800 meters. the measures are adjusted in real time, according to the environmental test conditions, by means of temperature and internal pressure sensors, and an electronic barometer. its face mask has a low dead space volume and two inspiratory valves with low inspiratory resistance, and it allows the removal of exhaled air during testing, which leads to improved quality of the analyzed gases. the instrument has been shown to have adequate validity and reliability, when used in various activities with individuals with stroke23 and to reflect the capture, transport and peripheral oxygen consumption. descriptive statistics and tests for normality (shapiro - wilk test) were carried out for all outcomes. pearson correlation coefficients were calculated to explore the relationships between the dasi scores, distance covered, and the relative vo2 during the 6mwt. the magnitudes of the correlations were classified as follows : low or none (0.000.75)24. all analyses were carried out with the spss software (release 17.0) with a significance level of 5%. they had a mean age of 58.613 years, and a mean time since the onset of stroke ranging from 12 to 60 months. they had a mean dasi score of 27.314.4, a mean oxygen consumption of 9.62.3 mlkgmin, and a mean distance covered of 325.2140.2 m during the 6mwt. their characteristics are described in table 1table 1.characteristics of the participantscharacteristicn=31age (years), mean (sd)58.6 (13)gender, men, n (%) 17 (54.8)body mass index (kg / m), mean (sd)25.7 (4.2)time since the onset of stroke (months), mean (sd)28.3 (15.1)number of medications, mean (sd)4.6 (2.1)associated diseases, mean (sd)1.8 (.96)mmse (scores : 030), mean (sd)25.6 (3)habitual walking speed (m / s), mean (sd)0.8 (0.3)dasi (scores : 058.2), mean (sd)27.3 (14.4)6mwt (distance, in meters), mean (sd)325.2 (140.2)relative vo2 (ml.kg.min), mean (sd)9.6 (2.3)sd : standard deviation ; mmes : mini - mental state examination ; dasi : duke activity status index ; 6mwt : 6-minute walking test ; vo2 : oxygen consumption. sd : standard deviation ; mmes : mini - mental state examination ; dasi : duke activity status index ; 6mwt : 6-minute walking test ; vo2 : oxygen consumption moderate to good correlation coefficients were found between the dasi scores and the distance covered during the 6mwt (r=0.68, p<0.0001). significant and fair associations were also found between the dasi scores and the relative vo2 obtained during the 6mwt (r=0.45, p= 0.03). to the best of our knowledge, this was the first study to use a brief and self - administered questionnaire to assess functional capacity in individuals with stroke, and the results answered the main question of this study. this study used a sample of ambulatory, individuals with chronic stroke with high functional levels, as demonstrated by their walking capacity and speed. significant correlations were found between the dasi scores, the relative vo2, and the distance covered during the 6mwt. in agreement with the findings of previous studies with other health conditions14, 25, the dasi scores were significantly associated with both the physiological and physical performance measures. the results of the present study supported the use of the dasi as a tool to assist in clinical evaluations related to the functional capacity of individuals with chronic stroke. previous studies observed significant associations between the dasi scores and several outcomes in cardiac patients, such as metabolic equivalent26, 27, new york heart association28, canadian cardiovascular society of angina29, and body mass index27. the associations between the dasi scores and the distance covered during the 6mwt were previously investigated in cardiac6 and in copd patients16, and moderate to good correlations were found between the investigated variables (r=0.68 ; p<0.001 and r=0.58, p<0.0001, respectively). additionally, bagur.28 also found moderate to good correlations between the dasi scores and the distance covered during the 6mwt in patients, who underwent transcatheter aortic valve implantation at baseline (r=0.55, p<0.0001) and at six - month follow - up (r=0.66, p<0.0001). these results are in line with the findings of the present study, which found correlation coefficients of similar magnitudes. these similarities could be explained by the fact that all studies had participants with chronic diseases and several disabilities. in addition, individuals with stroke have some cardiac dysfunctions as the main associated morbidity and risk factors for new episodes of stroke2. no previous studies were found that investigated the associations between relative vo2 during the 6mwt and the dasi scores. several studies found associations between the dasi scores and peak vo2 during maximal tests on cycle and arm ergometers, as well on treadmills with various populations, such as patients with vascular diseases (r=0.51, p<0.001)14, copd patients (0.34<r<0.38, p<0.0001)16, and cardiac patients (0.58<r<0.81, p<0.0001)13. in the present study, fair correlations between the relative vo2 during the 6mwt and dasi scores were found. regarding these findings, jakovljevic.30 pointed out that the ability of the skeletal muscles to extract oxygen is decreased after stroke, but their cardiac function and pumping capability were preserved. additionally, it was found that individuals with stroke showed reduced blood flow, higher lactic acid production, and decreased capacity to oxidase free fatty acids by their paretic muscles31. these findings could partially explain the results of the present study, since fair correlations were found. however, it is well known that stroke individuals exhibit a constellation of impairments, as well as comorbidities, which were not investigated in the present study, and these could have influenced the results. it is important to notice that this was the first study to analyze the associations between self - reported and direct measures of functional capacity and found associations of magnitudes ranging from fair to good. these results are in agreement with those of teixeira - salmela, devaraj, and olney32, who found good relationships between self - reported physical activity levels and observed performances of individuals with chronic stroke. taking together, these findings reinforce the importance of taking the patients ` perceptions into consideration during the rehabilitation process. due to the design of this study, causal relationships can not be determined. the sample size was composed of individuals at the chronic stages after stroke, who had a time since the onset of the stroke ranging from one to five years, were able to walk independently, and had good functional levels (mean walking speed of 0.81 m / s and mean distance covered during the 6mwt of 325 meters). in this sense, the results of the present study can not be generalized to individuals with different functional levels and at the acute and subacute phases after stroke33. for instance, it is well known that the major motor deficit after stroke is weakness, which is found in 80% of stroke survivors. it is important for health professionals to focus on the implications of a given health condition on an individual s life14. thus, some instruments should be used based upon their impact on their real life contexts. the dasi has been demonstrated to be a useful tool for clinical and research purposes, since it provides insights regarding function that may not be captured by physiological measures14, 16. the results of the present study revealed positive, significant, and moderate to good associations between the dasi scores and the distance covered during the 6mwt and positive, significant, and fair correlations between the dasi scores and the relative vo2 during the 6mwt. these findings support the utility and validity of a self - report measure in providing an indirect index of functional capacity. | [purpose ] the aim of this study was to investigate the associations between self - reported and valid performance - based measures of functional capacity in individuals with chronic stroke. [subjects and methods ] self - reported measures of functional capacity of 31 individuals with chronic stroke were assessed by the duke activity status index scores, whereas performance - based measures were assessed by the distance covered (in meters) and oxygen consumption (relative oxygen consumption, in mlkg1min1) during the six - minute walking test. [results ] the subjects had a mean age of 58.613 years and a mean time since the onset of stroke of 28.315.1 months. they had a mean duke activity status index of 27.314.4, mean distance covered of 325.2140.2 m, and mean relative oxygen consumption of 9.62.3 mlkg1min1. significant, positive, and moderate to good correlation coefficients were found between the duke activity status index scores and the distance covered during the six - minute walking test (r=0.68). significant, positive, and fair associations were also found between the duke activity status index scores and relative oxygen consumption values obtained during the six - minute walking test (r=0.45). [conclusion ] the findings of the present study support the clinical use of the duke activity status index as a tool to assist in clinical evaluations of functional capacity of individuals with chronic stroke. |
dendritic cells (dcs) are professional antigen - presenting cells that possess the unique capacity to activate and prime naive cd4 and cd8 t cells. they form a heterogeneous population consisting of specialized dc subsets that differ in their surface marker expression, molecular phenotype, and antigen - processing and antigen - presentation capacity [24 ]. in peripheral blood, at least two major types of dcs can be distinguished, namely, myeloid dcs (mdcs) and plasmacytoid dcs (pdcs) [5, 6 ]. myeloid dcs express high levels of cd11c and can further be subdivided based on the differential expression of either cd1c (blood dendritic cell antigen 1 = bdca1) or cd141 (bdca3). each dc subset has its own repertoire of toll - like receptors (tlrs), underlining their functional specialization [3, 7 ]. both mdc subsets express tlr3 and tlr8 among others, although expression levels of tlr3 are much higher in cd141 mdcs. plasmacytoid dcs are key effectors of innate immune responses due to their capacity to produce large amounts of type i ifns in response to bacterial or viral infections ; this production can also be induced by tlr agonists such as r848 and oligodeoxynucleotides class c (cpg) [8, 9 ]. besides their role in the innate immune system, pdcs also participate in priming t helper (th) cells, depending on the stimulus they receive (summarized in). myeloid dcs, on the other hand, have the capacity to produce the th1 skewing cytokine interleukin- (il-) 12. for both pdcs and mdcs, it has been shown that they induce proliferation in an allogeneic setting and that they can cross - present exogenous antigens to prime cd8 t cells [1016 ]. as a result of their unique capacity to orchestrate adaptive immune responses, recently, more advanced examination of primary blood dcs has come within reach through the availability of efficient isolation techniques. primary dcs are hypothesized to be stronger inducers of anticancer responses than monocyte derived dcs in cell - based vaccination strategies since they differentiate in vivo and require only short ex vivo handling. the first clinical studies utilizing primary blood dcs have recently been conducted by our group, demonstrating the safety and efficacy of cd1c mdcs and pdcs in cancer immunotherapy [17, 18 ]. in order for dc - based immunotherapy to elicit potent antitumor t cell responses, the administered dcs need to raise an immune - stimulatory rather than tolerogenic t cell response. naive t cells will proliferate upon encounter with antigen - presenting cells presenting their specific antigen in the presence of costimulatory signals. the nature of costimulation and cytokines from the dc will influence the polarization of the t cells into different t helper phenotypes such as th1, th2, and th17 or regulatory t cells (tregs). for example, the presence of il-12 promotes the induction of th1 cells, whereas il-10 inhibits induction of th1 cells and promotes the differentiation of tregs [20, 21 ]. in antiviral responses, th1 cells and antigen - specific cytotoxic cd8 t cells this type of immune response is also highly desirable in antitumor strategies, in which the aim is to eradicate tumor cells. toll - like receptor ligands such as polyinosinic : polycytidylic acid (polyi : c), r848, and cpg have been shown to possess th1 polarizing capacity when used as adjuvants or maturation agents for dcs [2226 ]. to be able to successfully manipulate t cell responses for therapeutic strategies, a better understanding of the functional specialization of human dc subsets is needed. in this study, we compared the cd4 t cell stimulatory and polarizing capacity of human blood mdcs and pdcs side by side especially the capacity to induce th1 responses upon differential stimulation. human blood dcs were isolated from buffy coats (sanquin) obtained from healthy volunteers after written informed consent and according to institutional guidelines. pbmcs were purified via ficoll density gradient centrifugation (lymphoprep by axis - shield). for this, lineage positive cells were depleted from pbmcs either with dynabeads human dc enrichment kit (invitrogen by life technologies) or with anti - fitc microbeads (miltenyi biotec) after incubation with fitc - conjugated anti - lin1 antibody cocktail (cd3cd14cd16cd19cd20cd56) (bd biosciences). the remaining cells were labeled with fitc - conjugated anti - lin1 antibody cocktail (bd biosciences), pe - cy7-conjugated anti - hla - dr (bd biosciences), bv421-conjugated anti - cd1c (biolegend), apc - conjugated anti - cd141 (miltenyi biotec), and pe - conjugated anti - bdca4 (miltenyi biotec). subsets were sorted to obtain cd1c mdcs, cd141 mdcs, or pdcs, respectively (purity 98100%) (see suppl. in some experiments, cd1c mdcs were isolated from pbmcs with a cd1c dc isolation kit (miltenyi biotec). cd141 mdcs and pdcs were isolated from pbls by positive selection with anti - cd141 (cd141) and anti - bdca4 magnetic microbeads, respectively (miltenyi biotec). naive cd4 t cells were isolated from pbls by depleting cd4 cells with macs multisort beads and additional use of pe - conjugated anti - cd45ro (dako) and anti - pe beads (miltenyi biotec) for the depletion of cd45ro memory t cells (purity > 95%). all cells were cultured in x - vivo 15 medium (lonza) supplemented with 2% human serum (sigma - aldrich). the dcs were stimulated with the following tlr ligands : 4 g / ml r848 (axxora), 2 g / ml polyi : c (sigma) (figures 1 and 2) or 20 g / ml polyi : c (enzo life sciences) (figures 3 and 4), 450 u / ml gm - csf (cellgenix), or 5 g / ml cpg - c (designated cpg throughout text ; enzo life sciences). for the control condition of pdcs, the medium was supplemented with 10 ng / ml recombinant human il-3 (cellgenix) to ensure pdc survival. cell sorting was performed on a bd aria and flow cytometry on a bd calibur or bd verse. the dc subsets were incubated overnight at 37c with different stimuli in triplicate (cd1c mdcs, pdcs) or in duplicate (cd141 mdcs). the next day, supernatants were taken and cells were labeled with pe - conjugated anti - mhc class i and fitc - conjugated anti - mhc class ii (bd), pe - conjugated anti - cd80 (bd biosciences), and pe - conjugated anti - cd86 (bd biosciences). supernatants were analyzed for il-10 (ebioscience) and il-12p70 (m122 and m121b by pierce endogen, standard by bd biosciences) by standard sandwich elisa. depicted in figure 2 is the cytokine production by 50,000 dcs in a volume of 100 l. for cd141 mdcs, in some instances cd1c mdcs, cd141 mdcs, or pdcs (1 10 cells) were incubated overnight at 37c with different stimuli in triplicate. the next day, allogeneic naive cd4 t cells were added to the dcs at a ratio of 1 : 5 (dc : t cell). proliferative responses were determined by adding 1 ci [0.037 mbq]/well of tritiated thymidine (h) (mp biomedicals) to the cells after three days of coculture. h incorporation over a time course of 16 hours was measured with a scintillation counter. dendritic cells (1 10) were stimulated overnight with the different stimuli in 100 l medium. next, allogeneic naive cd4 t cells (4 10) were added at a ratio of 1 : 4 (dc : t cell) in a final volume of 200 l medium containing 10 pg / ml superantigen staphylococcus aureus enterotoxin b (seb) (sigma). at day 5, human ril-2 (20 iu / ml, novartis) was added and the cultures expanded for the next 68 days. on days 1113, resting t cells were counted and analyzed by flow cytometry with three panels. panel 1 includes anti - cd25-apc (bd bioscience), anti - cd127-pe (ebioscience), and anti - foxp3-a488 (ebioscience). panel 2 includes anti - t - bet - a488, anti - gata-3-pe, and anti - rort - apc (all ebioscience). panel 3 includes anti - cd45ro - apc (bd bioscience), anti - cd197 (r&d systems) with goat - anti - mouse igg2a - a488 (life technologies), and anti - cd62-l (ebioscience) with rat - anti - mouse igg1-pe (bd pharmingen). the population of tregs was determined by selecting cd25 cd127 cells and subsequently gating on the foxp3 population (suppl. tcm were determined by further gating on cd197/cd62-l and tem were determined by further gating on cd197 cells. both populations are shown as percentage of live cells (forward - sideward scatter) (suppl. furthermore, 5 10 of the t cells of each condition were restimulated with 5 10 anti - cd3/anti - cd28 beads (dynabeads gibco by life technologies) in triplicate and supernatants from 24-hour cultures were analyzed for levels of ifn- (pierce endogen), il-5, and il-10 (ebioscience) by standard sandwich elisa. data were analyzed by kruskal - wallis test followed by dunn 's testing, by a 1-way anova followed by tukey testing or with paired student 's t - test using prism5 (graphpad prism5). statistical significance was defined as < 0.05 (p <.05 ; p <.01 ; p <.001). high expression of mhc molecules is a hallmark of dcs, underlining their antigen - presenting capacities. accordingly, we found high levels of both mhc class i and mhc class ii molecules on all three dc subsets (figure 1(a)). the levels of both mhc class i and mhc class ii molecules were highest for cd141 mdcs and comparable for cd1c mdcs and pdcs, both on freshly isolated cells and after tlr activation. the expression of costimulatory molecules by dcs is essential to activate t cells and can be induced by tlr ligands. throughout the study, cd1c and cd141 mdc maturation cd1c mdcs were also stimulated with granulocyte - macrophage colony - stimulating factor (gm - csf). plasmacytoid dcs were stimulated with r848 or cpg and il-3 used for the control to secure pdc survival. on cd1c mdcs, the costimulatory molecule cd86 was already highly expressed after overnight culture in medium alone ; on cd141 mdcs, this holds true for the expression of both cd80 and cd86 (figure 1(b)). in comparison, cd141 mdcs showed the highest expression of cd80 and cd86, both after culturing in medium alone or after tlr ligation (figure 1(b)). although cd80 and cd86 molecules were expressed already at high levels on immature dcs, expression of both molecules was significantly increased upon culture with tlr ligands on all dcs. dendritic cell - derived il-10 is known to inhibit th1 cells and induce type 1 tregs (tregs producing il-10), whereas il-12 is a th1-inducing cytokine and therefore desirable in the context of anticancer therapy [20, 21 ]. plasmacytoid dcs did not secrete il-10 or il-12 at detectable levels, whereas cd1c and cd141 mdcs secreted both il-10 and il-12 at differential levels depending on the stimulus (figure 2). r848 and polyi : c, alone or in combination, induced il-10 production in cd1c mdcs, while only the combination of both tlr ligands induced a significant increase in the secretion of il-12. cd141 mdcs secreted low amounts of il-10, irrespective of the stimulus and at lower levels than cd1c mdcs. we observed a significant increase in il-12 production by cd141 mdcs after stimulation with both polyi : c and r848, which is higher than the production by cd1c mdcs. we can therefore conclude that cd141 mdcs produce less il-10 and more il-12 than cd1c mdcs. a primary immune response constitutes the activation of naive t cells in response to antigen and their subsequent proliferation and differentiation. besides recognition of their cognate antigen, naive t cells depend on costimulation by the antigen - presenting cell to start such a primary response. the ability of blood dcs to induce proliferation of naive t cells was directly compared by coculturing overnight stimulated pdcs and cd1c and cd141 mdcs of the same donors with allogeneic naive cd4 t cells. all primary blood dc subsets showed the ability to induce proliferation of naive cd4 t cells (figure 3). even so, r848-matured mdcs induced the highest levels of proliferation, while polyi : c maturation did not further increase proliferation as compared to unstimulated mdcs. for pdcs, r848 and il-3 (control) treatment stimulate similar levels of naive cd4 t cell proliferation, while the levels for cpg - treated pdcs tend to be lower than for r848 or il-3. besides providing effector t cells, a primary immune response can generate immunological memory in the form of memory t cells. while central memory t cells (tcm) are responsible for rapid clonal expansion after reexposure to antigen and localize in lymphoid organs, effector memory t cells (tem) localize in mucosal tissue and mediate rapid effector functions there. although the formation and longevity of such memory cells can only be accurately measured in vivo, we wanted to get an idea of the individual capacities of the different dc subsets to induce them. for this, we cocultured naive, allogeneic cd4 t cells with the differentially activated blood dc subsets until the t cells had ceased to proliferate. at this resting state (after ~12 days), we analyzed their cd45ro, ccr7 (cd197), and l - selectin (cd62l) expression. the percentages of cd45ro ccr7 (tem) and cd45ro l - selectin ccr7 (tcm) among the t cells did not differ significantly between the subsets or different stimuli (suppl. at the time point measured, the t cells comprise a larger proportion of tem (mean 47.14%71.51%) than tcm (mean 13.47%24%). taken together, all subsets can effectively induce proliferation of naive t cells and are probably able to induce memory t cells. however, mdcs induce significantly higher proliferation when matured with r848 in comparison to polyi : c maturation or culturing alone. dendritic cells play a critical role in the polarization of naive cd4 t cells into different t helper phenotypes or tregs. in a th1 response, cytotoxic cd8 t cells that are able to kill cells bearing their specific antigen are elicited. therefore, this type of immune response is highly desirable in antitumor strategies. to compare the differential t cell stimulatory and polarizing capacity especially the capacity to induce th1 responses upon differential stimulation with polyi : c, r848, and cpg and possible treg induction by human blood mdcs and pdcs, naive cd4 t cells were cocultured with the dc subsets until they reached resting state. importantly, analysis of the resting t cells did not show a large fraction of tregs for any dc subset or condition (mean 3%10%) (figure 4(a) ; suppl. 2a). although the differences are small, it is interesting to note that the percentages of these cells were lowest for polyi : c and r848-matured mdcs and were highest for gm - csf - stimulated cd1c mdcs (mean 3% and 10%, resp.). for the pdc cocultures, there is a tendency of a higher proportion of tregs being induced after r848 or cpg stimulation compared to the control (il-3-treated cells) (mean 7%, 7%, and 4%, resp.). furthermore, we analyzed the induction of th subset - specifying transcription factors t - bet, gata-3, and rort (figure 4(b)). we found pronounced populations expressing t - bet across the subsets and stimuli (cd1c mdcs : 9%35%, cd141 mdcs : 23%35%, and pdcs : 32%42%), indicating th1 polarization by all subsets. cd141 mdcs showed the most pronounced gata-3 expression for control and r848 stimulation (mean 5.1% and 4.25%, resp.), which was significantly reduced with polyi : c or combined r848 and polyi : c stimulation of cd141 mdcs (mean 1.87% for both). furthermore, rort expression was only detected in a very small population of cd4 t cells across the subsets (0.08%0.72%), indicating th1 rather than th17 polarization of these cells. resting cd4 t cells were also restimulated with anti - cd3/anti - cd28 beads and their supernatants analyzed for il-5, il-10, il-17, and ifn- production to determine the th1 polarization capacity of the dc subsets. interleukin-5 is a th2 cytokine, while il-10 inhibits th1 polarization and ifn- is a strong th1 inducer [20, 21, 28 ]. notably, coculture with all three blood dc subsets induced t cells with prominent ifn- production after restimulation even without tlr maturation (figure 4(c)). t cells primed by cd141 or cd1c mdcs induced prominent populations of t - bet expressing cells and secreted high levels of ifn-, indicating th1 skewing (figure 4(c), lower panel). gm - csf - stimulated cd1c mdcs induced smaller populations of t - bet expressing cells and lower levels of ifn- and similar levels of both il-5 and il-10 as the medium control or tlr - matured dcs ; therefore, gm - csf maturation of cd1c mdcs does not induce the most potent th1 response. also pdcs induce a prominent population of t - bet expressing cells and ifn- release from restimulated cd4 t cells, although the levels of ifn- are lower than for optimally stimulated mdcs. plasmacytoid dcs induce similar levels of il-5 in cocultured t cells as mdcs. however, the levels of il-10 are higher, especially for r848 and cpg stimulated pdcs, which coincides with a tendency for a bigger proportion of tregs (cd25 cd127 foxp3) induced in these conditions. we measured no il-17 for pdcs and modest levels for mdcs stimulated with r848 or cd1c mdcs stimulated with the combination of r848 and polyi : c (suppl. 4). together with the rort expression data we conclude a th1 rather than th17 polarization of the nave cd4 t cells. in sum, all subsets polarize naive cd4 t cells mainly towards th1 cells with a strong t - bet signature producing mainly ifn- after restimulation. in order to manipulate t cell responses for dc - based cancer immunotherapy, a better understanding of the functional specialization of human dc subsets is needed. in this study, we compared the capacities of primary human blood mdcs and pdcs to activate and polarize cd4 t cells side by side. we report that cd1c mdcs, cd141 mdcs, and pdcs all induce proliferation of naive cd4 t cells. importantly, naive cd4 t cells are not skewed towards a regulatory phenotype by coculture with either mature mdcs or pdcs. despite differences in activation and cytokine profile, both cd141 and cd1c mdcs polarize naive cd4 t cells towards t cells with a strong ifn- signature ; also pdcs induce ifn-, although at lower levels and accompanied by a higher il-10 production. while all dc subsets mature upon tlr ligation, we observed distinct cytokine responses for different subsets and stimuli. cd1c mdcs produced only a limited amount of il-12 after maturation with either r848 or polyi : c alone, but production was significantly increased with a combination of these tlr ligands. even higher levels of il-12 are produced by cd141 mdcs when stimulated with the combination of polyi : c and r848. in contrast to our findings, nizzoli. did not find il-12 production for cd141 mdcs after combined polyi : c and r848 stimulation. other studies have shown that, in order to induce strong il-12 responses in human and mouse dcs, both an innate trigger such as tlr ligation and a second trigger like ligation of cd40 by cd40l on t cells are needed [7, 30 ]. more recently, it has been shown for cd1c mdcs that the combination of the tlr ligands r848 and lps can trigger significant il-12 production. in the case of cd141 mdcs, a cocktail of polyi : c together with the cytokines ifn-, tnf-, ifn-, and il-1 was shown to induce significant levels of il-12. showed that cd141 mdcs produced less il-12 as compared to cd1c mdcs for single tlr ligation but that a higher proportion produced il-12 after tlr1/2 or tlr3 ligation in a whole blood assay. our data supports the notion that a single stimulus is not sufficient to induce high il-12 production and with polyi : c and r848 we describe a new combination that can trigger substantial il-12 secretion by both human mdc subsets. all dc subsets induced proliferation of naive cd4 t cells regardless of the stimulus. the level of t cell proliferation induced by polyi : c - matured mdcs is similar to nonstimulated mdcs. strikingly, gm - csf - stimulated cd1c mdcs and r848-matured cd1c and cd141 mdcs cause an extra boost in proliferation of naive cd4 t cells. this is in accordance with an earlier study by jongbloed., which described equally high induction of proliferation of naive cd4 t cells for nonstimulated or polyi : c stimulated cd1c and cd141 mdcs after six days. because of the upregulation of the expression of costimulatory molecules with both stimuli compared to untreated dcs, one would expect a higher proliferation rate than with untreated dcs. certainly, other cytokines and immunostimulatory, but also immunoinhibitory, molecules expressed by cultured dcs are integrated into a single response by the t cells and possible differences in these factors might cause the observed differences in t cell proliferation. only a minor percentage of cd4 t cells that grew out of cocultures with the different dc subsets displayed a treg phenotype. earlier studies suggest that pdcs can act as th1, th2, th17, or even treg inducers in t cell priming, depending on the stimulus they receive (summarized in). one stimulus that can induce this regulatory t cell phenotype is cpg and the proposed mechanism is via the expression of inducible costimulator ligand (icos - l). icos - l upon cpg maturation, which triggers il-10 production of t cells but no production of il-4, il-5, or il-13. this is in accordance with our findings, where we observed higher levels of il-10 and a tendency of a higher proportion of tregs for pdcs matured with cpg or r848 compared to matured mdcs but no elevated levels of il-5. however, regardless of the stimulus we also found a strong t - bet expression and ifn- production by cd4 t cells that had grown out of cocultures. plasmacytoid dcs secrete large amounts of type i ifns in response to bacterial or viral stimuli, including r848 and cpg. type i ifns not only are important in innate responses, but can also help to skew t cells towards a th1 phenotype. type i ifns secreted by pdcs might play a role in the observed ifn- induction. regulatory t cell induction with functional effects on t cells has been described in one study for tissue mdcs of the skin. we show here that primary blood mdcs induce only a low proportion of tregs and, importantly, the overall cd4 t cell population displays a th1 phenotype after coculture (pronounced t - bet expression and high ifn- production) and no th2 or th17 phenotype. this is in line with the ability of mdcs to produce il-12 after combined polyi : c and r848 stimulation. for the other conditions, one can speculate whether the addition of the cd4 t cells and therefore ligation of cd40 on the dcs give the needed second signal for il-12 production and help the th1 skewing. different groups have shown that blood mdcs can induce ifn- production in naive cd4 and cd8 t cells [7, 35, 36 ]. found that cd141 mdcs were more potent than cd1c dcs at inducing ifn- responses in total cd4 t cells, especially after polyi : c stimulation. we found that although cd1c mdcs show a less mature phenotype than cd141 mdcs including higher il-10 and lower il-12 production, cd1c and cd141 mdcs induce similar ifn- responses after coculture with naive cd4 t cells. however, there is a tendency for cd141 mdcs to induce less il-5 and il-10 than cd1c, also arguing for an overall stronger th1 skewing by this subset. for cd141 mdcs, high tlr3 expression and the ability to produce ifn- and cxcl10, both known to induce antiviral responses, all suggest their capability to induce th1 skewing in t cells [7, 37, 38 ]. certainly, r848 and polyi : c can trigger distinct pathways as tlr3 signals through a trif - to - irf3 pathway, rather than an myd88-to - irf7 pathway that is used by tlr8. it is interesting to note that both mdc subsets react strongly and in a similar way to polyi : c, although the expression levels of tlr3 are much higher in cd141 mdcs than in cd1c mdcs. likely, other receptors for polyi : c contribute to the response in one or both of the mdc subsets. the synthetic dsrna analog is a ligand for multiple pathogen recognition receptors, and besides tlr3 also triggers cytosolic rig - i - like receptors that are expressed by mdcs [39, 40 ]. suggest in a study on mdcs and nk cells that both tlr3 stimulation and rig - i - like receptor ligation are needed for ifn- induction by mdcs. in addition to their cd4 t cell activating capacities, all three subsets can cross - present exogenous antigens for cognate restimulation of previously activated cd8 t cells [1014 ], making them promising candidates for dc - based vaccination strategies against cancer. both cd1c mdcs and pdcs have generated promising results in first clinical studies utilizing these primary blood dc subsets as vaccines [17, 18 ]. these studies support their excellent in vivo functioning and mark them as the next generation of cancer vaccines. in this context, we have learned from the current work that gm - csf is not the optimal stimulus for cd1c mdcs, since gm - csf stimulation showed an overall lower th1 skewing capacity and induced more tregs than other stimuli. while maturation with polyi : c or the combination of polyi : c and r848 induces the most pronounced th1 skewing, the number of t cells that grow out with these stimuli is lower than, for example, with r848 stimulation. considering the proliferation data and the similar polarization capacity by all subsets and with all stimuli including control dcs, one can only speculate about a recommendation for a suited stimulation of dcs for dc - based vaccination strategies. for example, tlr activation of dcs can lead to the upregulation of otherwise unexpressed tlr ligands in the dcs, making them sensitive to a broader range of danger signals. furthermore, in an in vivo situation also other cell types might play a crucial role for the overall outcome of a therapy. such cells include nk and cd8 t cells, for which type i ifns and il-12secreted at higher levels upon tlr maturation are important [4346 ]. as discussed above, cd141 mdcs certainly display promising properties for dc - based anticancer vaccination strategies. besides their th1-inducing capacity, human cd141 mdcs are also excellent cross - presenters of exogenous antigens to cd8 t cells. while some publications show superior cross - presentation capacity of cd141 mdcs [31, 4749 ] and put them forward as the human counterparts of mouse cd8 dcs [31, 4750 ], other studies suggest that the different human dcs subsets bear similar cross - presentation capacities at least for soluble antigens delivered through early endosomes [14, 15, 51 ]. the type and size of the antigen as well as the compartments they are targeted to probably underlie these differing outcomes (reviewed in [52, 53 ]). in addition to using single subsets for therapeutic approaches, we hypothesize that using a combination of several dc subsets could further increase t cell activating properties, since earlier studies have shown that cell - cell interactions as well as soluble factors can act to cross - activate the different dcs (summarized in). with this comparative study, we have reinforced the establishment of human circulating cd1c mdcs, cd141 mdcs, and pdcs as promising candidates for dc - based immunotherapy in the context of cancer. | dendritic cells (dcs) are central players of immune responses ; they become activated upon infection or inflammation and migrate to lymph nodes, where they can initiate an antigen - specific immune response by activating naive t cells. two major types of naturally occurring dcs circulate in peripheral blood, namely, myeloid and plasmacytoid dcs (pdcs). myeloid dcs (mdcs) can be subdivided based on the expression of either cd1c or cd141. these human dc subsets differ in surface marker expression, toll - like receptor (tlr) repertoire, and transcriptional profile, suggesting functional differences between them. here, we directly compared the capacity of human blood mdcs and pdcs to activate and polarize cd4 + t cells. cd141 + mdcs show an overall more mature phenotype over cd1c+ mdc and pdcs ; they produce less il-10 and more il-12 than cd1c+ mdcs. despite these differences, all subsets can induce the production of ifn- in naive cd4 + t cells. cd1c+ and cd141 + mdcs especially induce a strong t helper 1 profile. importantly, naive cd4 + t cells are not polarized towards regulatory t cells by any subset. these findings further establish all three human blood dcs despite their differences as promising candidates for immunostimulatory effectors in cancer immunotherapy. |
unless otherwise noted, all reagents were purchased from sigma aldrich (st. louis, mo, usa) and used without further purification. boc - gly, merrifield resin and boc - lys - ome were purchased from bachem (torrance, ca, usa). boc - ala - oh, boc - lys - oh, boc - phe - oh and boc - val - oh were purchased from novabiochem (merck kgaa, darmstadt, germany). 3-(4-phenylacetic acid)-1,2,4,5-tetrazine (tz - cooh) and (e)-cyclooct-4-enyl 2,5-dioxopyrrolidin-1-yl carbonate (tco - nhs) were synthesized as described before., hplc analyses were performed using a shimadzu hplc equipped with 2 lc-10at pumps, a spd - m10avp photodiode array detector, a flow count pin diode radiodetector from bioscan and a waters atlantis t3 column (6250 mm, 5 m). a gradient of 95:50:100 h2o / ch3cn supplemented with 0.1 % tfa over 18 min at 1 ml min was used. for preparative hplcs, a phenomenex jupiter (250100 mm, 5 m), and flowrates of 5 ml min were used. radioactivity measurements were performed with a capintec crc1243 dose calibrator (capintec, ramsay, nj, usa). for tlc measurements with radioactive materials, a bioscan ar2000 (bioscan, inc., washington, dc, usa) was used. microwave irradiations were carried out using a biotage initiator microwave synthesizer (biotage, llc, charlotte, nc, usa). lrms were recorded with a waters acquity uplc with electrospray ionization sq detector (esi). hrms were recorded with a waters lct premier system (esi). h nmr spectra were recorded on a bruker aviii (500 mhz) spectrometer. chemical shifts for protons are reported in parts per million (ppm) and are referenced against the residual proton resonance of deuterated solvents (cdcl3 : h, 7.26 ppm ; [d4]meoh : h, 3.31 ppm ; [d4]dmso : h, 2.50 ppm). nmr data are reported as follows : chemical shift, multiplicity (s = singlet, d = doublet, t = triplet, m = multiplet), coupling constants (hz) and integration. 3-(4-phenylacetic acid)-1,2,4,5-tetrazine succinimidyl ester (tz - nhs) : n - hydroxysuccinimide (163 mg, 1.42 mmol) and et3n (495 l, 3.55 mmol) were added to a mixture tz - cooh (150 mg, 0.71 mmol) and n-(3-dimethylaminopropyl)-n-ethylcarbodiimide hydrochloride (edci, 544 mg, 2.84 mmol) in ch2cl2 (15 ml), and the reaction mixture was stirred for 6 h at rt. the mixture was extracted with acetic acid (1 m, 210 ml) and h2o (210 ml), dried (mgso4), and volatiles were removed in vacuo. the crude product was purified by column chromatography (ch2cl2/meoh, 97.5:2.5), yielding tz - nhs as a pink solid (67.3 mg, 0.22 mmol, 31 %): h nmr (500 mhz, [d4]meoh) : =10.60 (s, 1 h), 8.51 (d, j=8.3, 2 h), 7.55 (d, j=8.3, 2 h), 7.20 (d, j=7.7, 1 h), 4.32 (s, 2 h), 2.36 (s, 4 h) ; lc ms (esi) : m / z (%) : 313.1 (100) [mh ], 312.1 (100) [2 mh ]. n-(tert - butoxycarbonyl)-n-(tetrazine)-l - lysine (boc--oh, 1) : tz - nhs (55.0 mg, 0.18 mmol) was dissolved in a mixture of boc - l - lys - oh (53.2 mg, 0.36 mmol) and et3n (63 l, 0.45 mmol) in meoh (6 ml) and stirred for 2 h. the reaction mixture was dried in vacuo, and the resulting crude product purified by column chromatography (525 % meoh in ch2cl2), yielding 1 as a pink film (40.3 mg, 0.09 mmol, 50 %): h nmr (500 mhz, [d4]meoh) : =10.31 (s, 1 h), 8.55 (d, j=8.4 hz, 2 h), 7.56 (d, j=8.4 hz, 2 h), 4.05 (dd, j=8.7, 4.7 hz, 1 h), 3.22 (t, j=6.9 hz, 2 h), 1.861.61 (m, 2 h), 1.581.38 (m, 13 h) ; lc ms (esi+) : m / z (%) : 467.3 (30) [m+na ], 911.6 (10) [2 m+na ] ; lc ms(esi) : m / z (%) : 443.3 (10) [mh ], 887.6 (20) [2 mh ] ; hrms (esi) m / z [m+na]calcd for c21h28n6o5na : 467.2005, found : 467.2019. methyl n-(tert - butoxycarbonyl)-n-(tetrazine)-l - lysinate (boc--ome, 2) : n-(3-dimethylaminopropyl)-n-ethylcarbodiimide hydrochloride (51.8 mg, 0.27 mol) was added to a mixture of 3-(4-phenylacetic acid)-1,2,4,5-tetrazine succinimidyl ester (20 mg, 0.09 mmol), boc - l - lys - oh (28.6 mg, 0.11 mmol), et3n (63 l, 0.45 mmol) in ch2cl2 (5 ml), and the reaction mixture was stirred over night at rt, before it was dried in vacuo. the resulting crude product was purified by column chromatography (5 % meoh in dcm), yielding 2 as a pink film (20.8 mg, 0.05 mmol, 56 %): h nmr (500 mhz, [d6]dmso) : =10.57 (s, 1 h), 8.44 (d, j=8.2, 2 h), 8.13 (t, j=5.5 hz, 1 h), 7.55 (d, j=8.2 hz, 2 h), 7.20 (d, j=7.7 hz, 1 h), 3.933.88 (m, 1 h), 3.61 (s, 3 h), 3.55 (s, 2 h), 3.05 (q, j=6.5 hz, 2 h), 1.651.52 (m, 2 h), 1.431.27 (m, 13 h) ; lc ms (esi+) m / z (%) : 359.3 (75) [mboc+h ], 459.3 (40) [m+h ], 917.7 (30) [2 m+h ] ; hrms (esi) : m / z [m+h ] calcd for c22h30n6o5na : 481.2171, found : 481.2175. n-(tetrazine)-l - lysine (h--oh, 3) : boc--oh 1 (10 mg, 22.5 mol) was dissolved in a mixture of tfa / ch2cl2 (1:1) and vigorously stirred for 1.5 h. volatiles were removed in vacuo, and the resulting crude material purified using hplc, yielding 3 as a pink solid (5.6 mg, 16.3 mol, 72 %): h nmr (500 mhz, [d4]meoh) : =10.32 (s, 1 h), 8.55 (d, j=8.3, 2 h), 7.57 (d, j=8.3, 2 h), 3.92 (t, j=6.3, 2 h), 3.65 (s, 2 h), 3.24 (dt, j=6.3, 3.2 hz, 2 h), 2.001.84 (m, 2 h), 1.621.42 (m, 2 h) ; lc ms (esi+) : m / z (%) : 345.2 (100) [m+h ], 367.2 (15) [m+na ] ; hrms (esi) : m / z [m+h ] calcd for c16h21n6o3 : 345.1668, found : 345.1675. pentapeptide gafv (4) : the synthesis was carried out on a 0.010.02 mmol scale in a fritted syringe (3 ml volume), using a merrifield resin, which was preloaded with boc - gly - oh (20 mg, 0.51.0 mmol g). the resin was swollen by washing with dmf (22 ml) and ch2cl2 (22 ml). n-boc groups were removed by addition of a solution of tfa / ch2cl2 (1:1 ; 15 min, 2 ml and 120 min, 2 ml), followed by washing with ch2cl2 (22 ml) and dmf (22 ml). amino acids were coupled (1 h, rt) without prior neutralization of the resin using a freshly prepared mixture of bop (0.04 mmol, 18 mg), hnigs base (n, n-diisopropylethylamine, diea ; 0.12 mmol, 16 mg) and amino acid (0.08 mmol) in dmf (2.5 ml). after coupling, the resin was washed with dmf (32 ml) and ch2cl2 (32 ml). after completion of the deprotection / coupling sequence, the peptide was transferred to a microwave vessel, suspended in a solution of tfa / h2o (97.5:2.5, 500 l), and microwaved (25 min, 50 hz). the resin was removed by filtration and et2o (10 ml) added to the supernatant. the resulting crude precipitate was filtered and purified using hplc to yield 4 as a pink solid (0.9 mg, 1.3 mol, 7 % yield) : lc ms (esi+) : m / z (%) : 719.5 (20) [m+h ] ; lc ms (esi) : m / z (%) : 717.5 (10) [mh ] ; hrms (esi) : m / z calcd for [m+h ] c35h47n10o7 : 719.3633, found : 719.3629. trans - cyclooctene desferrioxamine conjugate (tco dfo) : tco - nhs (12 mg, 45 mol) was added to a solution deferrioxamine mesylate salt (20 mg, 30 mol) and et3n (21 l, 0.15 mmol) in ch3cn / h2o (1:1, 1 ml) and stirred at rt for 90 min. subsequently, volatiles were removed in vacuo, and the crude product was purified using hplc, yielding tco dfo as a white solid (6.6 mg, 9 mol, 30 %): h nmr (500 mhz, [d6]dmso) : =9.689.54 (m, 2 h), 7.787.74 (m, 1 h), 6.936.88 (m, 1 h), 5.605.40 (m, 2 h), 4.214.17 (m, 1 h), 3.483.41 (m, 6 h), 3.032.87 (m, 6 h), 2.612.53 (m, 4 h), 2.292.21 (m, 7 h), 1.96 (s, 3 h), 1.911.85 (m, 4 h), 1.561.15 (m, 22 h) ; lc ms (esi+) : m / z (%) : 357.4 (10) [m+2 h ], 713.6 (100) [m+h ], 735.5 (70) [m+na ], 759.4 (10) [m+hcoo ] ; hrms (esi) : m / z calcd for [m+h ] c34h61n6o10 : 713.4474, found : 713.4449. zr - trans - cyclooctene (zr - tco, 5) : [zr]zr - oxalate (59.274 mbq, 1.6002.000 ci) in oxalic acid (1.0 m, 150 l) was adjusted to ph 7.28.0 with na2co3 (1.0 m, 150 l). after the evolution of co2(g) stops, the zr was added to a solution of tco dfo (1 mm, 100 l) in pbs / dmso (9:1). the reaction solution was stirred at 37 c for 30 min, before the reaction progress was assayed using instant thin - layer chromatography (itlc) with an eluent of 1 m citric acid. in the itlc experiments, zr - tco remains at the baseline, while free zr ions and other [zr]-citrate complexes elute with high rf values. the crude reaction mixture was purified using hplc, and volatiles were removed in vacuo, yielding 5 in > 98 % radiochemical purity, 39 % uncorrected isolated radiochemical yield (rcy), and a specific activity of > 5.59 mci mol (n=3). zr - gafv (6) : gafv (4, 20 nmol, 20 l, 1 mm in dmso) was added to zr - tco (56 ci, 10 l, 5.56 mci ml in 1:1 ch3cn / h2o with 0.05 % tfa), and the mixture was agitated at rt for 20 min, before purification using hplc, yielding 6 in > 95 % purity, 65 % uncorrected isolated rcy, and a specific activity of > 3.00 mci mol (n=3). boc - deprotection conditions : tfa (760 l) was added to a solution of 3 (5 mm, 20 l, dmso) and coumarin (5 mm, 20 l, dmso) and the resulting mixture stirred at room temperature. a control sample consisted of dmso (760 l), which was added to a solution of 3 (5 mm, 20 l, dmso) and coumarin (5 mm, 20 l, dmso). the amount of 3 relative to coumarin was measured at t=0, 0.5, 1, 2, 3, 4, 5, 6, 7, 8 and 9 h using hplc analysis, and the results were compared to the control sample. coupling conditions : solutions of (benzotriazol-1-yloxy)tris(dimethylamino)phosphonium hexafluorophosphate (bop, 10 mm, 25 l, dmf) and diea (100 mm, 25 l, dmf) were added to a solution of 2 (5 mm, 25 l, dmf) and coumarin (5 mm, 25 l, dmf). a control sample consisted of dmf (50 l), which was added to a solution of 2 (5 mm, 25 l, dmf) and coumarin (5 mm, 25 l, dmf). the amount of 3 relative to coumarin was measured at t=0, 0.5, 1 h, 2 h, 3 h, 4 h, 5 h, 6 h, 7 h, 8 h and 9 h using hplc analysis, and the results were compared to the control sample. resin - cleavage conditions : tfa (950 l) and deionized h2o (25 l) were added to a solution of 3 (5 mm, 20 l, dmso) and coumarin (5 mm, 5 l, dmso), and the resulting mixture was exposed to sequential microwave irradiation intervals (0112.5 min, 50 w). a control sample consisted of dmso (975 l), which was added to a solution of 3 (5 mm, 20 l, dmso) and coumarin (5 mm, 5 l, dmso). at the end of each microwave irradiation interval, a sample was drawn, the amount of 3 relative to coumarin was measured using hplc analysis, and the results were compared to the control sample. 3-(4-phenylacetic acid)-1,2,4,5-tetrazine succinimidyl ester (tz - nhs) : n - hydroxysuccinimide (163 mg, 1.42 mmol) and et3n (495 l, 3.55 mmol) were added to a mixture tz - cooh (150 mg, 0.71 mmol) and n-(3-dimethylaminopropyl)-n-ethylcarbodiimide hydrochloride (edci, 544 mg, 2.84 mmol) in ch2cl2 (15 ml), and the reaction mixture was stirred for 6 h at rt. the mixture was extracted with acetic acid (1 m, 210 ml) and h2o (210 ml), dried (mgso4), and volatiles were removed in vacuo. the crude product was purified by column chromatography (ch2cl2/meoh, 97.5:2.5), yielding tz - nhs as a pink solid (67.3 mg, 0.22 mmol, 31 %): h nmr (500 mhz, [d4]meoh) : =10.60 (s, 1 h), 8.51 (d, j=8.3, 2 h), 7.55 (d, j=8.3, 2 h), 7.20 (d, j=7.7, 1 h), 4.32 (s, 2 h), 2.36 (s, 4 h) ; lc ms (esi) : m / z (%) : 313.1 (100) [mh ], 312.1 (100) [2 mh ]. n-(tert - butoxycarbonyl)-n-(tetrazine)-l - lysine (boc--oh, 1) : tz - nhs (55.0 mg, 0.18 mmol) was dissolved in a mixture of boc - l - lys - oh (53.2 mg, 0.36 mmol) and et3n (63 l, 0.45 mmol) in meoh (6 ml) and stirred for 2 h. the reaction mixture was dried in vacuo, and the resulting crude product purified by column chromatography (525 % meoh in ch2cl2), yielding 1 as a pink film (40.3 mg, 0.09 mmol, 50 %): h nmr (500 mhz, [d4]meoh) : =10.31 (s, 1 h), 8.55 (d, j=8.4 hz, 2 h), 7.56 (d, j=8.4 hz, 2 h), 4.05 (dd, j=8.7, 4.7 hz, 1 h), 3.22 (t, j=6.9 hz, 2 h), 1.861.61 (m, 2 h), 1.581.38 (m, 13 h) ; lc ms (esi+) : m / z (%) : 467.3 (30) [m+na ], 911.6 (10) [2 m+na ] ; lc ms(esi) : m / z (%) : 443.3 (10) [mh ], 887.6 (20) [2 mh ] ; hrms (esi) m / z [m+na]calcd for c21h28n6o5na : 467.2005, found : 467.2019. methyl n-(tert - butoxycarbonyl)-n-(tetrazine)-l - lysinate (boc--ome, 2) : n-(3-dimethylaminopropyl)-n-ethylcarbodiimide hydrochloride (51.8 mg, 0.27 mol) was added to a mixture of 3-(4-phenylacetic acid)-1,2,4,5-tetrazine succinimidyl ester (20 mg, 0.09 mmol), boc - l - lys - oh (28.6 mg, 0.11 mmol), et3n (63 l, 0.45 mmol) in ch2cl2 (5 ml), and the reaction mixture was stirred over night at rt, before it was dried in vacuo. the resulting crude product was purified by column chromatography (5 % meoh in dcm), yielding 2 as a pink film (20.8 mg, 0.05 mmol, 56 %): h nmr (500 mhz, [d6]dmso) : =10.57 (s, 1 h), 8.44 (d, j=8.2, 2 h), 8.13 (t, j=5.5 hz, 1 h), 7.55 (d, j=8.2 hz, 2 h), 7.20 (d, j=7.7 hz, 1 h), 3.933.88 (m, 1 h), 3.61 (s, 3 h), 3.55 (s, 2 h), 3.05 (q, j=6.5 hz, 2 h), 1.651.52 (m, 2 h), 1.431.27 (m, 13 h) ; lc ms (esi+) m / z (%) : 359.3 (75) [mboc+h ], 459.3 (40) [m+h ], 917.7 (30) [2 m+h ] ; hrms (esi) : m / z [m+h ] calcd for c22h30n6o5na : 481.2171, found : 481.2175. n-(tetrazine)-l - lysine (h--oh, 3) : boc--oh 1 (10 mg, 22.5 mol) was dissolved in a mixture of tfa / ch2cl2 (1:1) and vigorously stirred for 1.5 h. volatiles were removed in vacuo, and the resulting crude material purified using hplc, yielding 3 as a pink solid (5.6 mg, 16.3 mol, 72 %): h nmr (500 mhz, [d4]meoh) : =10.32 (s, 1 h), 8.55 (d, j=8.3, 2 h), 7.57 (d, j=8.3, 2 h), 3.92 (t, j=6.3, 2 h), 3.65 (s, 2 h), 3.24 (dt, j=6.3, 3.2 hz, 2 h), 2.001.84 (m, 2 h), 1.621.42 (m, 2 h) ; lc ms (esi+) : m / z (%) : 345.2 (100) [m+h ], 367.2 (15) [m+na ] ; hrms (esi) : m / z [m+h ] calcd for c16h21n6o3 : 345.1668, found : 345.1675. pentapeptide gafv (4) : the synthesis was carried out on a 0.010.02 mmol scale in a fritted syringe (3 ml volume), using a merrifield resin, which was preloaded with boc - gly - oh (20 mg, 0.51.0 mmol g). the resin was swollen by washing with dmf (22 ml) and ch2cl2 (22 ml). n-boc groups were removed by addition of a solution of tfa / ch2cl2 (1:1 ; 15 min, 2 ml and 120 min, 2 ml), followed by washing with ch2cl2 (22 ml) and dmf (22 ml). amino acids were coupled (1 h, rt) without prior neutralization of the resin using a freshly prepared mixture of bop (0.04 mmol, 18 mg), hnigs base (n, n-diisopropylethylamine, diea ; 0.12 mmol, 16 mg) and amino acid (0.08 mmol) in dmf (2.5 ml). after coupling, the resin was washed with dmf (32 ml) and ch2cl2 (32 ml). after completion of the deprotection / coupling sequence, the peptide was transferred to a microwave vessel, suspended in a solution of tfa / h2o (97.5:2.5, 500 l), and microwaved (25 min, 50 hz). the resin was removed by filtration and et2o (10 ml) added to the supernatant. the resulting crude precipitate was filtered and purified using hplc to yield 4 as a pink solid (0.9 mg, 1.3 mol, 7 % yield) : lc ms (esi+) : m / z (%) : 719.5 (20) [m+h ] ; lc ms (esi) : m / z (%) : 717.5 (10) [mh ] ; hrms (esi) : m / z calcd for [m+h ] c35h47n10o7 : 719.3633, found : 719.3629. trans - cyclooctene desferrioxamine conjugate (tco dfo) : tco - nhs (12 mg, 45 mol) was added to a solution deferrioxamine mesylate salt (20 mg, 30 mol) and et3n (21 l, 0.15 mmol) in ch3cn / h2o (1:1, 1 ml) and stirred at rt for 90 min. subsequently, volatiles were removed in vacuo, and the crude product was purified using hplc, yielding tco dfo as a white solid (6.6 mg, 9 mol, 30 %): h nmr (500 mhz, [d6]dmso) : =9.689.54 (m, 2 h), 7.787.74 (m, 1 h), 6.936.88 (m, 1 h), 5.605.40 (m, 2 h), 4.214.17 (m, 1 h), 3.483.41 (m, 6 h), 3.032.87 (m, 6 h), 2.612.53 (m, 4 h), 2.292.21 (m, 7 h), 1.96 (s, 3 h), 1.911.85 (m, 4 h), 1.561.15 (m, 22 h) ; lc ms (esi+) : m / z (%) : 357.4 (10) [m+2 h ], 713.6 (100) [m+h ], 735.5 (70) [m+na ], 759.4 (10) [m+hcoo ] ; hrms (esi) : m / z calcd for [m+h ] c34h61n6o10 : 713.4474, found : 713.4449. zr - trans - cyclooctene (zr - tco, 5) : [zr]zr - oxalate (59.274 mbq, 1.6002.000 ci) in oxalic acid (1.0 m, 150 l) was adjusted to ph 7.28.0 with na2co3 (1.0 m, 150 l). after the evolution of co2(g) stops, the zr was added to a solution of tco dfo (1 mm, 100 l) in pbs / dmso (9:1). the reaction solution was stirred at 37 c for 30 min, before the reaction progress was assayed using instant thin - layer chromatography (itlc) with an eluent of 1 m citric acid. in the itlc experiments, zr - tco remains at the baseline, while free zr ions and other [zr]-citrate complexes elute with high rf values. the crude reaction mixture was purified using hplc, and volatiles were removed in vacuo, yielding 5 in > 98 % radiochemical purity, 39 % uncorrected isolated radiochemical yield (rcy), and a specific activity of > 5.59 mci mol (n=3). zr - gafv (6) : gafv (4, 20 nmol, 20 l, 1 mm in dmso) was added to zr - tco (56 ci, 10 l, 5.56 mci ml in 1:1 ch3cn / h2o with 0.05 % tfa), and the mixture was agitated at rt for 20 min, before purification using hplc, yielding 6 in > 95 % purity, 65 % uncorrected isolated rcy, and a specific activity of > 3.00 mci mol (n=3). boc - deprotection conditions : tfa (760 l) was added to a solution of 3 (5 mm, 20 l, dmso) and coumarin (5 mm, 20 l, dmso) and the resulting mixture stirred at room temperature. a control sample consisted of dmso (760 l), which was added to a solution of 3 (5 mm, 20 l, dmso) and coumarin (5 mm, 20 l, dmso). the amount of 3 relative to coumarin was measured at t=0, 0.5, 1, 2, 3, 4, 5, 6, 7, 8 and 9 h using hplc analysis, and the results were compared to the control sample. coupling conditions : solutions of (benzotriazol-1-yloxy)tris(dimethylamino)phosphonium hexafluorophosphate (bop, 10 mm, 25 l, dmf) and diea (100 mm, 25 l, dmf) were added to a solution of 2 (5 mm, 25 l, dmf) and coumarin (5 mm, 25 l, dmf). a control sample consisted of dmf (50 l), which was added to a solution of 2 (5 mm, 25 l, dmf) and coumarin (5 mm, 25 l, dmf). the amount of 3 relative to coumarin was measured at t=0, 0.5, 1 h, 2 h, 3 h, 4 h, 5 h, 6 h, 7 h, 8 h and 9 h using hplc analysis, and the results were compared to the control sample. resin - cleavage conditions : tfa (950 l) and deionized h2o (25 l) were added to a solution of 3 (5 mm, 20 l, dmso) and coumarin (5 mm, 5 l, dmso), and the resulting mixture was exposed to sequential microwave irradiation intervals (0112.5 min, 50 w). a control sample consisted of dmso (975 l), which was added to a solution of 3 (5 mm, 20 l, dmso) and coumarin (5 mm, 5 l, dmso). at the end of each microwave irradiation interval, a sample was drawn, the amount of 3 relative to coumarin was measured using hplc analysis, and the results were compared to the control sample. | the need for post - synthetic modifications and reactive prosthetic groups has long been a limiting factor in the synthesis and study of peptidic and peptidomimetic imaging agents. in this regard, the application of biologically and chemically orthogonal reactions to the design and development of novel radiotracers has the potential to have far - reaching implications in both the laboratory and the clinic. herein, we report the synthesis and development of a series of modular and versatile building blocks for inverse electron - demand diels alder copper - free click chemistry : tetrazine - functionalized artificial amino acids. following the development of a novel peptide coupling protocol for peptide synthesis in the presence of tetrazines, we successfully demonstrated its effectiveness and applicability. this versatile methodology has the potential to have a transformational impact, opening the door for the rapid, facile, and modular synthesis of bioorthogonally reactive peptide probes. |
recently, the belgian government issued a bill regulating the organisation of and minimal requirements for specialist breast units (kb, 2007). the criteria were much based on a eusoma (european society of mastology) position paper (eusoma, 2000 ; perry, 2001), a text which was adopted in a resolution on breast cancer by the european parliament. this implied that criteria for accreditation were defined based on minimal standards to ensure high quality of care for women with breast cancer. a lot of attention was given to case load per surgeon and the limit of at least 150 newly diagnosed cases of primary breast cancer per year per centre was subject to much debate. a survey on caseload and surgery for some cancers (one of them breast cancer) was published recently by kce (federal expertise centre for health care), an advisory committee of experts that provides scientific evidence to guide decision making in health issues by the government. this survey supports an association between caseload and improved outcome (vrijens., 2009). we believe, however, that caseload as a surrogate marker of quality of care is inferior to a direct audit of outcome of treatment.. therefore prospective registration of relevant clinical, treatment - related, and follow - up data is mandatory and is indeed one of the eusoma recommendations for specialised breast units. the eusoma consensus group published guidelines setting out the objectives which loco - regional treatment in breast cancer should meet and to determine the outcome measures to these objectives. in this way each centre with good prospective registration is able to set its outcome against these guidelines as an objective quality control (rutgers, 2001). we report on the feasibility of such a prospective registration of treatment outcome and discuss the results relative to the outcome of breast cancer care as published in the flemish cancer registry (van eycken and de wever, 2006). patients with breast cancer are diagnosed and managed in our unit according to standard treatment protocols based on the best evidence available at the time. these protocols are widely used within the leuven hospital network, a regional network of eighteen hospitals in flanders aiming at optimising quality and efficiency in health care, training, research, and management. a total of 37 characteristics per patient, including data on demographics, medical history, co - morbidity, staging findings, histology, multi - disciplinary treatment decisions, and post - therapy follow - up are prospectively recorded in an electronic database. the database is managed and updated by one of the authors (jv) at the time of a new follow - up visit. follow - up attendance in our region is excellent with exceptional losses to follow - up. women who were not seen at our clinic within the scheduled follow up interval (mostly 12 months) were considered lost to follow - up and data on their health status were retrieved via the family physician in most cases. logistic regression was used to examine relations between clinical and demographical variables and binary responses. we focus on two outcomes of interest : overall survival (os) time and disease - free survival (dfs) time. os was defined as time (in months) from diagnosis until death from any cause. patients who were alive at the end of their follow - up were considered censored observations. dfs was defined as time (in months) from start of treatment until tumour recurrence or death. patients who were alive without tumour recurrence at the end of their follow - up were considered censored observations. univariate analysis of survival was performed by using the kaplan and meier estimates of survival curves and the log rank test. the results of statistical significance tests were assessed by using the 0.05 twosided significance level. during a 6-year period between january 2002 and december 2007, a total of 859 newly diagnosed patients with primary breast cancer were treated in our unit. of these, 76 (8.8%) presented with a carcinoma in situ lesion and 48 (5.6%) were primarily metastatic breast carcinomas. for the purpose of this report, we consider only patients with invasive non - metastatic carcinomas. among the 735 operated patients, out of the 715 patients, 60 died, while 99 died or experienced tumour recurrence. median follow - up for patients without recurrence was equal to 33.4 months and for those still alive it was equal to 34.4 months. we serve a population of breast carcinoma patients that is similar to other series (soerjomataram., 2008) : two thirds of women are menopausal with a median age of 57 years (sd = 12.81) ; 91% of tumours are ductal adenocarcinomas ; 60% of tumours were detected as stage t1 disease ; 70% of tumours are oestrogen - receptor positive. during the reported observation period, the proportion of breast conservation surgery remained unchanged and was equal to 57% for the entire group. although there was a tendency towards a more extensive use of breast conservation surgery in the group of patients over the age of 60 years, as compared to the group of patients of age less than 60 years, the difference was not statistically significant (based on a logistic regression model with the year of diagnosis and age, with cut - off at 60 yrs, as covariates). two major developments in breast cancer care changed our management protocol during the study period : i) the sentinel node technique, introduced in the period from 2002 - 2003 ; and ii) the use of trastuzumab in the adjuvant setting. at present, the shift in the use of type of axillary surgery is similar in both the younger (60 years) patients. over time, the average tumour size, for which a sentinel node technique was selected, increased from 12 mm to 17 mm. in the last 3 years, tumour size average has stabilized. table 1 illustrates the learning curve in adopting the sentinel technique in our service : an increasing detection rate and number of procedures with a decreasing percentage of positive nodes. in 32 (50%) cases with a positive sentinel node that underwent axillary node dissection, the fish technique for determining her-2-neu receptor status became routine in our practice in 2005, at the time when trastuzumab was approved for the adjuvant treatment of her-2-neu positive breast cancer by the european medicines agency. the number of breast cancers that tested fish - positive for her-2-neu receptor in our series is 16.8%. the 5-year disease - free survival and overall survival in our series were respectively 77% and 84%. table 2 presents the univariate analysis for both os and dfs. except for histology, tumour grade, and axillary surgery, all prognostic factors reached significance in this analysis. in the multivariate analysis of dfs, only her-2-neu status (her-2-neu positivity being associated with a poor prognosis) and age (older age being a worse prognostic factor) were statistically significant prognostic factors (table 3). for os, her-2-neu, age, and positive node status our report focuses on routine breast cancer care to the best - of - evidence and self - initiated clinical research rather than on data from a multi - centre trial to explore new standards of therapy. an extensive medline literature search revealed no reports on the results of routine breast cancer care according to current practice in a single centre. however, it is precisely this type of care, to which the majority of women with breast cancer present themselves. there are potential limitations (selection of specific patients) inherent to the experimental setting that can affect the validity generalization of research results. our data are important as they reflect an in vivo testing of the evidence and could be regarded as an example, to which the outcome of routine breast cancer care within a comparable demographic setting could be compared. we have shown that it is feasible to run a proper outcome - based database of all patients managed within a specialized breast unit, as it is envisaged by eusoma guidelines (blamey and cataliotti, 2006). belgian legislation concerning accreditation of specialized breast units, however, mainly focuses on case load per surgeon as a primary qualification criterion (eusoma, 2007). we like to argue that treatment outcome is a better reflection of quality of breast cancer care than is case load per surgeon or per hospital. first and foremost, case load is a surrogate marker, while outcome, measured in terms of either overall or diseasefree survival, is a direct parameter related to treatment effectiveness. although high surgeon or hospital volume contributes significantly to patient outcomes, no clear critical volume thresholds associated with substandard breast cancer care have been described (allgood and bachmann, 2006). caseload improves clinical skills indeed but it could be argued that this is less relevant to experienced breast surgeons. treatment outcome is also influenced by good clinical (surgical) skills, irrespective of caseload (zork., 2008). we are obviously in search for an accreditation system based on criteria that also select for good clinical skills. treatment outcome in breast cancer care is the overall result of the combined skills not only of breast surgeons, but also those of radiotherapists and medical oncologists. for these reasons, an accreditation system based on the case load per surgeon as a single determinant does not necessarily guarantee optimal assessment of a centres performance. five - year dfs and os for the total population in our series were equal to 77% and 84%, respectively, and compare well with national and international registries. the global 5-year survival and the 5-year relative survival in the flemish cancer registry are 82% and 75%, respectively (van eycken and de wever, 2006). in the seer data, 5-year relative survival is equal to 88% (horner., 2009). these numbers can not be compared directly, because relative survival represents breast cancer specific survival by dividing overall survival by the background survival in the population, a number unknown to us. a comparison of the survival stage by stage between our data set and that from the flemish cancer registry is however possible and is shown in figure 1. comparison with large data sets, such as the flemish cancer registry and the seer data, enables to detect differences in outcome and/or to understand differences in populations. should outcome be inferior to what is expected in a specific population, one should institute a critical case review of all treatment failures in order to correct possible errors. such an outcome evaluation should be done periodically in every specialized breast unit by the healthcare authorities. whether it is appropriate to make data on provider performance available to the public is still a matter of debate (chen., 2008 ; mannion and goddard, 2001 ; marshall., 2000). we also recommend internal audits, in particular, at the time of management changes, for instance the introduction of a new surgical technique. we have seen a clear improvement of detection rate without increase of positive cases in our series. nevertheless, the opposite could have been true and this should be anticipated in an early stage to avoid potential deterioration of outcome over time. most patient and tumour characteristics, as described in our series, reflect those presented in other breast cancer populations (soerjomataram., 2008). there are, however, some remarkable findings : the univariate analysis reveals no significant prognostic value for tumour grading. this is in contrast to the well validated nottingham prognostic index (galea., 1992). this might be due to chance, the results of the analysis may be confounded by the tumor - grade - based selection of treatment regimen, which might remove the prognostic value of the tumor grade or to a lack of power. the reasonable large number of tumours designated to grade iii (grade i : 12% ; grade ii : 49%, grade iii : 35% ; grade unknown : 4%) suggests that the lack of an association with outcome is not caused by overrepresentation of grade ii tumours. the multivariate analysis indicates that older age, positive node status, and fish - positive her-2-neu receptor status are the most important prognostic factors with regard to outcome. we have no formal proof that evaluation of outcome should replace case load as the primary criterion for accrediting breast cancer centres as this study was not designed to do so. however the mere fact that we demonstrated that an outcome based evaluation is feasible in a centre dedicated to breast cancer care moderates the relevance of this discussion. moreover belgium has an electronic network in place between the population registry, the national health insurance system and the national cancer registry that is capable of doing this monitoring nationwide. we acknowledge that monitoring quality of care by outcome is far more complex and expensive than monitoring case load. in conclusion, we showed that it is feasible to run an uptodate clinical database in a district hospital. these data allowed us to infer that the quality of care offered to women with breast cancer in our hospital is conform to national and international standards. we argued the pros and cons of accreditation of specialist breast units based on the performance of the multidisciplinary team measured by outcome versus case load per hospital or surgeon. | aim : criteria for future accreditation of breast cancer centres in belgium will be mainly based on the case load per surgeon or per centre. we would like to argue that the prospective collection of relevant data and the analysis of treatment related outcome derived from these data is feasible and should be the ultimate criterion for quality assessment and thus for accreditation since outcome is a more direct measurement of quality.methods : data were prospectively collected on 715 invasive non metastatic breast cancers between 2002 and 2007 treated according to standard, best - evidence protocols in the setting of a large district hospital. univariate and multivariate survival analysis were performed and compared to national and international databases.results : 5 year disease - free survival (dfs) and overall survival (os) in our series were respectively 77 and 84%. in the multivariate analysis of dfs, only her-2-neu status (her-2-neu positivity being associated with a poor prognosis) and age (older age being a worse prognostic factor) were statistically significant prognostic factors. for os, her-2-neu, age, and positive nodes were statistically significant prognostic factors. the outcome is comparable to other data sets.conclusion : centres dedicated to the care of women with breast cancer have the moral duty to produce outcome based results of their treatment. this report shows that such a collection of data is feasible and can be imposed as a prerequisite for accreditation. we also argue that outcome based data of treatment are a more solid base for quality assurance than case load. |
spinocerebellar ataxias (scas) are autosomal - dominant neurodegenerative diseases that are clinically and genetically heterogeneous. scas are characterized by a range of neurological symptoms, including loss of balance and motor coordination, which are caused by progressive dysfunction of the cerebellum and its afferent and efferent connections. clinical diagnosis of specific subtypes is difficult because of the overlap of phenotypes among genetic subtypes and the variability in clinical features found within distinct genetic subtypes. sca12 is an autosomal - dominant (ad) ataxia caused by a cag repeat expansion mutation in a presumed promoter region of the gene ppp2r2b in a non - coding region on chromosome 5q32. determined that sca12 is very rare, accounting for only 6.5% of all ad cases. pathogenesis is likely caused by repetition, amplification, and mutation of cag, which can affect the transcription of the promoter. the structure of 1 shear transcription of ppp2r2b or other types of genetic expression can change the conformation and functions of the adjusting subunit of protein phosphatase 2a to strengthen chondriokinesis, thereby resulting in neuronic pathology. an action tremor is a prominent feature in sca12, and is often the presenting neurologic sign. action tremors then gradually develop into ataxia gait, head tremor, hypokinesia, abnormal eye movements, and tendon hyperreflexia ; in patients with dementia, mood disorders may occur [26 ]. atrophy of both the cerebral cortex and cerebellum has been reported on either computed tomography (ct) or brain magnetic resonance imaging (mri) images from sca12 patients in a north american kindred and indian sca12 patients. no focal signal abnormalities in grey or white matter have been reported in sca12 brain images. neuropathology of the sca12 proband revealed atrophy of the cerebral cortex and cerebellum plus mild pontine atrophy. microscopic examination of this sca12 brain demonstrated moderate - to - marked purkinje cell loss and atrophy of the cerebellar granule cell layer. neuronal intranuclear inclusions were found in dopamine neurons of the substantia nigra, purkinje cells, and rare motor cortical neurons. diffusion tensor imaging (dti) refers to the use of water molecule diffusion anisotropy of nerve fibers in multiple directions on a diffusion - sensitive gradient. dti detects each individual element of water molecular diffusion anisotropy, and reflects the fine structure of cerebral white matter fiber tracts of damage through the obtained fractional anisotropy (fa) and apparent diffusion coefficient (adc) values. dti provides a non - invasive method of showing living brain white matter nerve fiber access, reflects the diffusion of water molecules, and provides a quantitative description of organization by diffuse anisotropy. adc mainly reflects the diffusion speed of water molecules without indicating the direction of movement. when nerve degeneration occurs, nerve cell loss and myelin depigmentation increase the movement of water molecules. the fa value can reflect the consistency of nerve fibers, structural tightness, and integrity of microstructure. adc and fa values obtained from dti have gained widespread acceptance as sensitive indicators to quantify microstructural damage of gray and white matter in neurodegenerative diseases. the evaluation of deep cerebellar nuclei (dcn) using dti can serve as a simple imaging biomarker of cerebellar disease. as of this writing, reports on sca12 using dti analysis are rare. in this study, changes in adc and fa in sca12 were investigated to determine whether they cause damage to white matter. significant correlations of adc and fa with disease course and clinical scores were also determined. by detecting different types of micro - damage in brain white matter structure in the presymptomatic patients and a control group of a large uighur sca12 pedigree using dti, morphological markers were found to have an important function in early judgment of the morbidity situation of presymptomatic patients and the quantitative assessment of the severity of disease in patients. participants were uyghur patients and their family members preliminarily diagnosed with sca based on the harding standard. data from 1 uyghur pedigree were collected, among which 13 cases were patients and 54 cases are healthy individuals from xinjiang. the study used the tracking investigation method and selected 1 uyghur pedigree using the following criteria : (1) with pedigree analysis, the genetic mode of the disease in the family are autosomal - dominant inheritance ; (2) chronic progressive disorder of cerebellar ataxia was the main clinical manifestation ; (3) imaging changes in the cerebellum and brainstem atrophy as the main features. exclusion criteria : other diseases that can cause cerebellar ataxia, like multiple sclerosis, cerebellar tumor, inflammation, and cerebral vascular diseases. the diagnosis was genetically confirmed by means of polymerase chain reaction (pcr) of the gene expansions, agarose gel electrophoresis, and t carrier molecular cloning technology, to be combined with digestion identification and other techniques as described elsewhere. the genetics - based diagnosis of sca12 patients, including 7 male patients and 6 female patients, with average disease onset age of 43.006.56 years old and the mean course of the disease was (6.924.82) years. in 5 presymptomatic patients (2 male, 3 female), the control group included 15 healthy uyghur individuals without blood relationship and with average age of 35.653.75 years. five presymptomatic patients with sca12 and 13 other patients were scanned as part of a locally approved multicenter study. we obtained written informed consent from all participants, in accordance with institutional guidelines and with the helsinki declaration. we also enrolled 3.15 age - matched controls (7 male and 8 female, age 38.363.46 years) without a history of neurologic disturbances, with normal results on brain mr imaging, who did not smoke, drink, or take medications that act on the cns. the protocol of the study was approved by the medical ethics committee of the first affiliated hospital of xinjiang medical university (approval no. 20090822007). on the day of scanning, patients were assessed by a senior neurologist using the scale for the assessment and rating of ataxia (sara), which quantifies the degree of neurologic impairment, with scores ranging from 0 (no ataxia) to 40 (most severe ataxia) (table 1). we used an achieva 1.5 t double - gradient magnetic resonance scanner (philips) and an 8-channel head coil sense. the conventional scanning line used the conventional spin - echo sequences for t1wi and t2wi. dti cross - sectional scan levels were consistent with conventional mri, and diffusion - weighted single - excitation se - epi sequences were used. dti was performed with a twice - refocused, single - shot, spin - echo echo - planar sequence, using 15 directions and b=1000 s / mm. the following conditions were used in dti : tr, 2644 ms ; te, 55.0 ms ; nex, 1 ; 256256 matrix ; fov, 230230 mm ; thickness, 6.0 mm ; and no intersection gap. original data were collected in a post - processing workstation and a post - processing dispersion software package was used to establish the adc and fa values. transverse bitmap t1wi and t2wi were used as a reference, and placed in regions of interest (rois). a flair map matching positioning was then employed to outline the roi area in the bilaterally symmetric cerebral hemisphere. adc and fa were measured with planar circular rois positioned on the dti color maps jointly by 2 neuroradiologists blinded to patient identity, clinical data, and structural imaging. the fa and dc values were determined in each roi, and were subsequently measured 3 times. roi was positioned mainly in the following regions : the corticospinal tract (cst) at the level of the pons (pons), superior peduncle (scp), middle cerebellar peduncle (mcp), cerebellar cortex (cec), cerebral cortex (cc), and cerebellar vermis (cv) white matter. six different positions of the adc and fa values were measured in 3 groups (patients, presymptomatic patients, and control group). a normal distribution of the obtained data was shown using the normality test and distribution curve. differences among the 3 groups in 6 different positions of the 2 indicators (adc and fa values) were examined and the kruskal - wallis h test was used for the 3 groups and the wilcoxon test was used for multiple - comparison. for sca12 patients, multiple linear correlation analysis was used to determine any correlations in the cag repeat frequency, duration, sara score, and different position between the adc and fa values. participants were uyghur patients and their family members preliminarily diagnosed with sca based on the harding standard. data from 1 uyghur pedigree were collected, among which 13 cases were patients and 54 cases are healthy individuals from xinjiang. the study used the tracking investigation method and selected 1 uyghur pedigree using the following criteria : (1) with pedigree analysis, the genetic mode of the disease in the family are autosomal - dominant inheritance ; (2) chronic progressive disorder of cerebellar ataxia was the main clinical manifestation ; (3) imaging changes in the cerebellum and brainstem atrophy as the main features. exclusion criteria : other diseases that can cause cerebellar ataxia, like multiple sclerosis, cerebellar tumor, inflammation, and cerebral vascular diseases. the diagnosis was genetically confirmed by means of polymerase chain reaction (pcr) of the gene expansions, agarose gel electrophoresis, and t carrier molecular cloning technology, to be combined with digestion identification and other techniques as described elsewhere. the genetics - based diagnosis of sca12 patients, including 7 male patients and 6 female patients, with average disease onset age of 43.006.56 years old and the mean course of the disease was (6.924.82) years. in 5 presymptomatic patients (2 male, 3 female), the control group included 15 healthy uyghur individuals without blood relationship and with average age of 35.653.75 years. five presymptomatic patients with sca12 and 13 other patients were scanned as part of a locally approved multicenter study. we obtained written informed consent from all participants, in accordance with institutional guidelines and with the helsinki declaration. we also enrolled 3.15 age - matched controls (7 male and 8 female, age 38.363.46 years) without a history of neurologic disturbances, with normal results on brain mr imaging, who did not smoke, drink, or take medications that act on the cns. the protocol of the study was approved by the medical ethics committee of the first affiliated hospital of xinjiang medical university (approval no. on the day of scanning, patients were assessed by a senior neurologist using the scale for the assessment and rating of ataxia (sara), which quantifies the degree of neurologic impairment, with scores ranging from 0 (no ataxia) to 40 (most severe ataxia) (table 1). we used an achieva 1.5 t double - gradient magnetic resonance scanner (philips) and an 8-channel head coil sense. the conventional scanning line used the conventional spin - echo sequences for t1wi and t2wi. dti cross - sectional scan levels were consistent with conventional mri, and diffusion - weighted single - excitation se - epi sequences were used. dti was performed with a twice - refocused, single - shot, spin - echo echo - planar sequence, using 15 directions and b=1000 s / mm. the following conditions were used in dti : tr, 2644 ms ; te, 55.0 ms ; nex, 1 ; 256256 matrix ; fov, 230230 mm ; thickness, 6.0 mm ; and no intersection gap. original data were collected in a post - processing workstation and a post - processing dispersion software package was used to establish the adc and fa values. transverse bitmap t1wi and t2wi were used as a reference, and placed in regions of interest (rois). a flair map matching positioning was then employed to outline the roi area in the bilaterally symmetric cerebral hemisphere. adc and fa were measured with planar circular rois positioned on the dti color maps jointly by 2 neuroradiologists blinded to patient identity, clinical data, and structural imaging. the fa and dc values were determined in each roi, and were subsequently measured 3 times. roi was positioned mainly in the following regions : the corticospinal tract (cst) at the level of the pons (pons), superior peduncle (scp), middle cerebellar peduncle (mcp), cerebellar cortex (cec), cerebral cortex (cc), and cerebellar vermis (cv) white matter. six different positions of the adc and fa values were measured in 3 groups (patients, presymptomatic patients, and control group). a normal distribution of the obtained data was shown using the normality test and distribution curve. differences among the 3 groups in 6 different positions of the 2 indicators (adc and fa values) were examined and the kruskal - wallis h test was used for the 3 groups and the wilcoxon test was used for multiple - comparison. for sca12 patients, multiple linear correlation analysis was used to determine any correlations in the cag repeat frequency, duration, sara score, and different position between the adc and fa values. the standard for the evaluation of encephalatrophy degrees is : 0 stands for normal brain structure, 1 is for mild encephalatrophy (deepening anfractuosity and thinning gyrus), 2 is for moderate encephalatrophy (more obvious deepening of anfractuosity, thinning gyrus with obvious shrinking, and mild expansion to the ventricle), and 3 is for serious encephalatrophy (anfractuosity deepening to alba, thinning gyrus with obvious shrinkage, and obvious expansion in the ventricle and cistern) (table 2). to summarize the mri manifestations of patients with sca12 : 9 cases had cerebral cortex shrinkage in the frontal lobe, parietal lobe, and other parts ; 12 cases exhibited shrinkage in the cv, overall shrinkage in the cerebellar hemispheres characterized by deepening and widening of anfractuosity in the epencephalon cortex and thinning of gyrus ; and 7 cases had brainstem atrophy, including volume shrinkage in pons and medulla, expansion of the pons forebay, and other characteristics (figure 1). based on the different positions of adc values, no statistically significant difference was found in the positions of the mcp and cst pons among the 3 groups (p>0.05). by contrast, the positions in the scp, cec, cc, and cv white matter were found to be significantly different among the 3 groups (p0.05). by contrast, the positions in the scp, cec, cc, and cv white matter were found to be significantly different among the 3 groups (p<0.05). the results showed a statistically significant difference in the positions of the scp, cec, cc, and cv white matter between the patients and normal group (p<0.05). adc values in the patients were higher than those in the normal group, and the position of cv white matter was significantly different between the patients and presymptomatic patients (p<0.05). the kruskal - wallis h test was used in the 3 groups. based on the different positions of fa values, significant differences in the positions of the scp, cc, and cv the results show that the position of the cc was significantly different between the patients and normal group (p<0.05). significant differences in the positions of the cv and cc were observed between the presymptomatic patients and normal group (p<0.05). fa values in the presymptomatic patients were lower than those in the normal group in the cv. the results show that the positions of the cst (pons), scp, mcp, cec, cc, and cv white matter were significantly different based on the 2 indicators (adc and fa values) among the 3 groups (p<0.05). correlation analysis showed that the sara score was correlated with adc in the cv white matter (r=0.72, p<0.05). disease duration was correlated with adc in the cv white matter (r=0.71, p<0.05) (table 3, figures 2, 3). quantitative assessment of the dcn may be invaluable to diagnosis, staging, and prognosis in neurodegenerative diseases with cerebellar involvement. dti evaluation of the dcn can serve as a simple imaging biomarker of cerebellar disease [710 ]. neuroimaging evidence of microstructural changes consistent with neurodegeneration has been found in patients with familial essential tremor. the method used in this study should be applied to sca3 and friedreich s ataxia, which may show significant dentate involvement. based on the aforementioned studies, it is important to use dti for quantifying the microstructural damage to white matter in neurodegenerative diseases caused by sca12 [1316 ]. the detection of sca12 subtypes of microstructural damage in cerebral white matter using dti has not been reported in detail. ohearn. reported that no focal signal abnormalities in grey or white matter have been reported in sca12 brain images. in the present study, some differences in adc values in the cv of the patients and presymptomatic patients were found. moreover, the presymptomatic patients and control group exhibited differences in the positions of the cec and cc. fa values of the presymptomatic patients and control group decreased in the cv region, which may indicate the onset of symptoms in patients with pre - existing microstructural damage in cerebral white matter of the cv [1719 ]. thus, the detection of dti changes in the assessment of the structural damage in white matter of the cv may be used as relatively objective morphological markers to assess the outcome in presymptomatic patients. however, strongly significant differences were found between the 2 subtypes compared with the controls, and correlations with clinical scores were detected. compared with the controls, adc significantly increased in the mcp and hemispheric white matter in sca1, and in all regions under consideration in sca2. reports on other subtypes of white matter damage using dti detection are rare [2023 ]. the results in our study show that the course of the disease and adc values of cv were highly positively correlated (r=0.71). sara score and adc values of cv also showed a highly positive correlation (r=0.72). damage in the brain white matter fiber structure of the cv could reflect the severity of damage of sca12 nerve pathology. this finding was consistent with the report of ohearn., who found that the cv appears more atrophic than the cerebellar hemispheres. thus, our results suggest that neurodegenerative pathology of cec and cv white matter structures may have a key function in disease onset. further studies are necessary to assess the function of fa and mean diffusivity changes in the differential diagnosis of sca12, which may present similar clinical signs at disease onset. although the degree of atrophy was not measured quantitatively, visual assessment performed in clinical practice was determined to be adequate for the purpose of the present study. although a certain margin for rating subjectivity remained, blinding prevented bias [2426 ]. however, the technical limitations of this method should be considered, particularly problems concerning fiber crossing, delineation of tracts using manually drawn rois, and distortion of axonal and neuronal architecture in neurodegenerative diseases ; these limitations make it difficult for the tracking algorithm to follow the fibers over longer distances or changes in direction. dti is useful in differentiating patients with sca12, but has limitations when used in the presymptomatic patients and controls because of the substantial overlap among the 3 groups. the strongly significant differences and correlations with clinical scores suggest an important function in combination with structural imaging characterizing the phenotypes, and provide a quantitative measure of disease severity. data from a single uyghur pedigree were collected, among which 13 cases were patients and 54 cases were healthy data from a single uyghur pedigree were collected, among which 13 cases were patients and 54 cases were healthy | backgroundspinocerebellar ataxias (scas) are autosomal - dominant neurodegenerative diseases that are clinically and genetically heterogeneous. scas are characterized by a range of neurological symptoms. sca12 is an autosomal - dominant (ad) ataxia caused by a cag repeat expansion mutation in a presumed promoter region of the gene ppp2r2b in a non - coding region on chromosome 5q32. this study sought to determine changes in different positions in a single uyghur sca12 pedigree by measuring the apparent diffusion coefficient (adc) and fractional anisotropy (fa).material / methodsa single uyghur pedigree was collected and was confirmed to possess sca12 by genetic diagnosis, among which 13 cases were patients and 54 cases were healthy individuals. five patients were presymptomatic and 15 individuals selected as a control group were examination in the same time. dti was performed on a 1.5 t scanner, with b=1000 s / mm2 and 15 directions. adc and fa were measured by regions of interest positioned in the corticospinal tract at the level of the pons (pons), superior peduncle (scp), middle cerebellar peduncle (mcp), cerebellar cortex (cec), cerebral cortex (cc), and cerebellar vermis (cv) white matter.resultscompared with the controls, the adc was significantly elevated in the cec, scp, cc, and cv regions in sca12 patients. the fa significantly decreased in the cc region in sca12 patients and the cc and cv regions in sca12 presymptomatic patients. the course of the disease, sara score, and adc values in cv showed highly positive correlations.conclusionssca12 pedigree patients exhibited microstructural damage in the brain white matter. the damage in white matter fiber may first occur in the cc and cv regions in sca12 presymptomatic patients. the adc values in the cv region could reflect disease severity in sca12 patients. |
traditionally, this has been via the abdominal or vaginal routes. in the present era, hysterectomies are undertaken using minimal access techniques. total laparoscopic hysterectomy (tlh) is performed entirely by the laparoscopic route, including closure of the vaginal vault, with the uterus being removed vaginally or by morcellation. today, lap hysterectomy is a safe and feasible technique to manage benign uterine pathology as it offers minimal postoperative discomfort, shorter hospital stay, rapid convalescence, and early return to the activities of daily living. considerable technical advances in this procedure have occurred during the last few years. in our study, we have modified the steps and started with the ligation of the uterine artery at its origin from the internal iliac artery on both sides causing transient uterine ischemia as most blood enters the uterus through these vessels especially its ascending branch. the hypothesis of this study proposes that, soon after occlusion, blood within the myometrium clots and the myometrium becomes hypoxic. the aim of this study was to compare conventional tlh to prior uterine artery ligation at its origin. total of 52 cases were included in the study of which 26 underwent conventional total laparoscopic hysterectomy and another 26, underwent uterine artery ligation at its origin prior to total laparoscopic hysterectomy. patients were kept nil by mouth 12 hours before the procedure and no bowel preparation was done prior to surgery. a veress needle is inserted at the umbilicus or supraumbilical site depending on the size of the uterus and abdomen is insufflated with carbon dioxide at initial pressure of 20 mm hg and maintenance at 15 mm hg. a 10 mm trocar is inserted blindly and 10 mm telescope is introduced through this port. three additional 5 mm ports are introduced : one along the left spinoumbilical line at the junction of medial 2/3rd and lateral 1/3rd, second port at right angles to the previous port two ports, and a third 5 mm port placed around 2 cm below and to the right of umbilicus. the entire abdomen is surveyed before starting the procedure. the size of the uterus, presence of myomas, and adnexa and course of ureters are visualized. the ascending branch of the uterine artery is identified close to the isthmus (figure 1). the uterine vessels are ligated at this level close to the uterus using 1 - 0 delayed absorbable suture material or coagulated using bipolar diathermy (figure 2). the uterine artery is not sutured away from the uterus as the ureters cross beneath them at that level. dissecting the uterovesical fold and pushing the bladder down the vasculature of the uterus is thus secured and this is evidenced by the color change in the fundus, which becomes pale. the cornual pedicles on one side are then desiccated and cut either using bipolar diathermy or the harmonic ultracision. the position of the myoma spiral is then changed so that the opposite side pedicles can be taken care of. if both ovaries need to be removed, the infundibulopelvic ligaments are desiccated and cut. now a vaginal cuff is introduced through the vagina to identify the vault and the anterior lip of cervix held with a tenaculum. we prefer to use the contralateral ports for suturing. the right midquadrant port and the left lower quadrant port are ergonomically apt for suturing. no irrigation is used throughout the procedure until the calculation of the total blood loss. peritoneal lavage is given with normal saline solution and 500 ml of normal saline is left in the peritoneal cavity. the catheter is removed after 6 hours and liquid diet started after peristalsis is established. the patient is discharged the following day and called for follow - up after 7 days. 52 cases were included in the study, of which 26 underwent conventional tlh (group a) and another 26 underwent tlh with prior uterine artery ligation at its origin (group b). the main symptoms of patients were similar in both groups, with the predominant being menorrhagia (74.9% in group a and 74.1% in group b). indication for surgery also revealed similar results in both groups as shown in table 1. in group a, 72.9% of women had previous normal delivery and 27.1% had previous cesarean section and in group b 68% had previous normal delivery and 22% had previous cesarean section. in patients with previous cesarean section, clinical size of the uterus ranged from 10 weeks to 22 weeks in both groups. the hemoglobin levels in all patients of both groups were above 9 g / dl. a, 64.6% of specimens were retrieved vaginally and 35.4% of specimens were morcellated and retrieved. in group b, total duration of surgery and blood loss in both groups were compared (table 2). in group a, the average duration of surgery was 71 minutes. in group b, the comparison between the 2 groups revealed a statistically significant difference (p < 0.001) in duration of surgery between the 2 groups. the time taken was less in patients where the uterine artery was prior ligated. in group the comparison between the 2 groups revealed a statistically significant difference (p value < 0.001). the data reveal that a significant decrease in blood loss and need for blood transfusion existed in group b where the uterine arteries were ligated before dividing the cornual structures. one patient in group b with multiple fibroids and previous 2 lower segment cesarean section (lscs) had bladder injury, detected postoperatively, and was treated conservatively with catheterization for 2 weeks. the vascular supply of the uterus is mainly derived from the uterine and ovarian arteries. because most blood enters the uterus through the uterine arteries, transient uterine ischemia occurs after uterine artery ligation. bilateral uterine vessel ligation is an efficient method to obliterate the blood flow to the uterus. like most studies, we believe that the main step in hysterectomy is securing the uterine vascular pedicle. enlarged uteri allow limited access to uterine vascular pedicles depending on the size and location of myomas and may be associated with high risk of complications such as hemorrhage, ureteric injury. prior dissection of uterine artery at its origin and ligating helps in reducing the blood supply and also lowering the risk of ureteral injury [7, 8 ]. to reduce the total blood loss and the duration of surgery, in this study we ligated the uterine arteries as the first step before tackling the other pedicles. in case of very large uterus, it may sometimes be difficult to dissect the ureter away from the uterine arteries properly. in such situations, coagulation of uterine vessels poses the risk of thermal damage to the ureters if they were not fully mobilized. our study showed that the average blood loss during the procedure is considerably reduced if the uterine vessels are primarily handled at its origin as compared to the study done by sinha.. the fear of ureteric injury is mostly caused by lack of familiarity with the pelvic anatomy. once the bladder is dissected down, the ureters fall laterally and move away with the peritoneum. the risk of ureteric injuries is lower using suture compared with bipolar desiccation or staples. only one patient in group b with multiple fibroids and previous 2 lscs had bladder injury, detected postoperatively, and was treated conservatively with catheterization for 2 weeks comparable to sinha.. prior uterine artery ligation at its origin during tlh reduces the blood loss and surgical duration as well as the complications during surgery. as the expertise of the surgeon increases in retroperitoneal dissection | we compared the duration of surgery, blood loss, and complications between patients in whom both uterine arteries were ligated at the beginning of total laparoscopic hysterectomy (tlh) and patients in whom ligation was done after cornual pedicle. using a prospective study in a gynecologic laparoscopic center, a total of 52 women who underwent tlh from june 2013 to january 2014 were assigned into two groups. in group a, uterine arteries were ligated after the cornual pedicles as done conventionally. in group b, tlh was done by ligating both uterine arteries at the beginning of the procedure. all the other pedicles were desiccated using harmonic scalpel or bipolar diathermy. uterus with cervix was removed vaginally or by morcellation. the indication for tlh was predominantly dysfunctional uterine bleeding and myomas in both groups. in group a, the average duration of surgery was 71 minutes, when compared to 60 minutes in group b (p < 0.001). in group a, the total blood loss was 70 ml, when compared to 43#x2009;ml in group b (p value < 0.001). there were no major complications in both groups. to conclude, prior uterine artery ligation at its origin during tlh reduces the blood loss and surgical duration as well as the complications during surgery. |
when multiple hypotheses are tested in a single experiment, the risk of type i error is increased and with it the risk of promulgating spurious significant findings.[13 ] the likelihood of obtaining a false positive result increases proportional to the number of tests performed. for example, the probability of obtaining at least one false positive result when performing 10 tests is given by 1- p(a) = 1 - 0.95=0.4013 (1) where p(a) is the confidence level of the test. although the problems associated with multiple testing are well known, numerous studies still fail to correct their reported p - values. for instance, bennett. found that only between 60% and 74% of the neuroimaging articles published in several major journals corrected for multiple comparisons. similarly, a study performed by austin. also demonstrated that the failure to account for multiple testing resulted in statistically significant, yet implausible results. in both cases the lack of attention paid to this problem in the pathology literature stands in stark contrast to its recognition in other fields such as ecology where there has been intense interest for over two decades since the seminal publication by rice. that being said, even within the field of ecology this topic still engenders debate. a systematic exploration of this problem in the pathology literature has not been undertaken ; however we have previously reported on a convenience sample of 800 publications from the pathology literature in 2003, of which 37 presented multiple comparisons. twenty one of these 37 did not attempt to control for increased type i error due to multiple comparisons. one means of reducing the type i error from multiple testing is the bonferroni correction, which controls the family - wise error rate (fwer). the fwer is the probability of type i error among the entire set of hypotheses. the bonferroni correction is calculated as follows : pcorrected= poriginal.n (2) where n is the number of hypotheses tested. there is a lack of consensus as to what actually represents a family of statistical tests ; however it has been suggested that if it is appropriate to place multiple p - values in the same table, it may be appropriate to correct all values in that table for multiple comparisons. because the bonferroni correction is conservative with regard to statistical power the bonferroni - holm correction is calculated as follows : pcorrected= poriginal.(n - k+1) (3) where n is the number of hypotheses tested, and k is the ordered rank of the uncorrected p - values (from smallest p - value to largest p - value). rather than controlling for the probability of one or more type i errors in the entire experiment, some of the more recent approaches to the multiple testing problem have focused on controlling the false discovery rate (fdr) in the experiment. by controlling the proportion of type i errors, this has the advantage of further increasing the statistical power of the algorithm, and is especially suitable when conducting numerous hypothesis tests. the benjamini - hochberg method is a commonly used way to control the fdr of an experiment. it is calculated as follows : where n is the number of hypotheses tested, and k is the rank of the uncorrected p value. several commercial statistical software packages are capable of performing one or more of these corrections as well as at least one open - source program (gnu r) ; however the cost of the commercial packages, and the learning curves involved, may discourage researchers from using these programs. online tools are also available (e.g., http://www.quantitativeskills.com/sisa/calculations/bonfer.htm) but are limited in scope and available options and rely on continued access to the publisher 's website. using the open - source programming language python v 3.2, we developed a program capable of performing bonferroni, bonferroni - holm, and benjamini - hochberg corrections for any number of p - values. the user is prompted for a set of p - values and the desired significance (alpha) level. from the main menu the user may choose to display the results of the desired correction to the screen, or to export the corrected p values to the hard disk (text and csv file types). the source code is available free as a supplementary file to this article (which may serve as a literature reference for the program). a copy of the source code the program requires the free programming language python 3.2 which is capable of running on microsoft windows, mac os, and linux / unix operating systems. it may be downloaded from http://www.python.org/getit/releases/3.2/.. the program is available for free by emailing the senior author at [email protected]. detailed instructions and a faq are available at https://sites.google.com / site / christophernaugler/. to use the bonferroni calculator software, place the files bonferroni calculator.py and lesack and naugler.txt in a folder on your hard drive. in windows, the program will run from the command line by double clicking on the bonferroni calculator.py icon ; however the preferred method is to right click on the icon and select edit with idle from the dropdown list. press f5 to run the software, and then maximize the size of the window. follow the instructions on the screen. if the option is selected to save the results to files, these will be found in the same folder as the bonferroni calculator.py icon. the program is also available from the authors as a stand - alone executable file. using the open - source programming language python v 3.2, we developed a program capable of performing bonferroni, bonferroni - holm, and benjamini - hochberg corrections for any number of p - values. the user is prompted for a set of p - values and the desired significance (alpha) level. from the main menu the user may choose to display the results of the desired correction to the screen, or to export the corrected p values to the hard disk (text and csv file types). the source code is available free as a supplementary file to this article (which may serve as a literature reference for the program). a copy of the source code the program requires the free programming language python 3.2 which is capable of running on microsoft windows, mac os, and linux / unix operating systems. it may be downloaded from http://www.python.org/getit/releases/3.2/.. the program is available for free by emailing the senior author at [email protected]. detailed instructions and a faq are available at https://sites.google.com / site / christophernaugler/. to use the bonferroni calculator software, place the files bonferroni calculator.py and lesack and naugler.txt in a folder on your hard drive. in windows, the program will run from the command line by double clicking on the bonferroni calculator.py icon ; however the preferred method is to right click on the icon and select edit with idle from the dropdown list. press f5 to run the software, and then maximize the size of the window. follow the instructions on the screen. if the option is selected to save the results to files, these will be found in the same folder as the bonferroni calculator.py icon. the program is also available from the authors as a stand - alone executable file. | increased type i error resulting from multiple statistical comparisons remains a common problem in the scientific literature. this may result in the reporting and promulgation of spurious findings. one approach to this problem is to correct groups of p - values for family - wide significance using a bonferroni correction or the less conservative bonferroni - holm correction or to correct for the false discovery rate with a benjamini - hochberg correction. although several solutions are available for performing this correction through commercially available software there are no widely available easy to use open source programs to perform these calculations. in this paper we present an open source program written in python 3.2 that performs calculations for standard bonferroni, bonferroni - holm and benjamini - hochberg corrections. |
the most ideal outcomes for tumor targeted therapy are improved patient survival and minimal adverse effects on normal tissues. drugs that can specifically home to a cancer cell based on a surface receptor have helped to address that goal with the advent of monoclonal antibody therapy. rituximab, directed against the cd20 antigen found on the surface of normal and malignant b cells, is the first monoclonal antibody approved by the us food and drug administration for the treatment of b - cell non - hodgkin 's lymphoma. monoclonal antibodies have been developed and have been impressive, but they are limited by immunogenicity, thus, leading to the development of single - chain variable fragment (scfv) antibodies. recombinant scfvs are promising because they can target an effector molecule or a cell to a disease - related target structure [4, 5 ]. immunotoxin, as one type of immunoconjugate, can be produced by genetically fusing scfv with toxin and this molecule can recognize target cells by scfv and kill them via its toxin. many immunotoxins have undergone or are currently undergoing study in humans for leukemia treatment [6, 7 ]. denileukin diftitox (ontak) has been approved by the fda for the treatment of cutaneous t - cell lymphoma in adults. epithelial cell adhesion molecule (epcam), also known as cd326, is a type i membrane glycoprotein of approximately 40 kda. it participates in many biological processes, such as cell adhesion, proliferation, and differentiation. epcam is frequently highly expressed on most solid tumors, including carcinomas of the breast, ovarian, lung, colon, and pancreatic cancer and in squamous cell carcinoma of the head and neck, suggesting its potential as a therapeutic target [10, 11 ]. mab17 - 1a, a low affinity monoclonal antibody against epcam, is successfully used in germany for breast and colon carcinoma therapy [12, 13 ] and cd3/17 - 1a, a bispecific scfv, is demonstrated to have cytotoxicity to epcam - positive tumor cells in vitro. finally, catumaxomab, a trifunctional anti - epcam / cd3 monoclonal antibody, has been approved in the european union for the treatment of epcam - positive tumors in patients with malignant ascites. due to limited applications and adverse effects of these antibodies, researchers wish to exploit more effective and epcam antibodies with greater potential to treat carcinomas. in the past 20 years, fully humanized and bispecific scfv fusion proteins have been studied in preclinical and clinical trials [16, 17 ] and epcam targeted immunotoxins have been confirmed to have antitumor activity in vitro. simon made modification to an epcam - targeting fusion toxin by facile click pegylation to increase its antitumor efficacy in vitro and in vivo. all these investigations have increased the promise of epcam as a target for cancer therapy. we prepared seven epcam monoclonal antibodies, fmu - epcam-2a9, fmu - epcam-2d7, fmu - epcam-4b11, fmu - epcam-4f11, fmu - epcam-4e4, fmu - epcam-4a11, and fmu - epcam-4f6. fmu - epcam-2a9 and fmu - epcam-2d7 are also named fmu - ep1 and fmu - ep3, respectively. in previous work, we reported that some of these antibodies (fmu - ep1 and fmu - ep3) can be used for immunohistochemical staining to identify normal and malignant colon tissue. thus, we report the construction, expression, and characterization of an immunotoxin, comprised of a single - chain variable fragment (scfv) of fmu - epcam-2a9 and a truncated form (pe38kdel) of pseudomonas aeruginosa exotoxin. the recombinant immunotoxin was successfully cloned and expressed and its antigen - binding ability and cytotoxicity were measured. this recombinant immunotoxin potently inhibited hhcc cell lines, which lays the foundation for further development of this agent as a possible cancer chemotherapeutic. the recombinant plasmid pgex-4t3-epcam and the monoclonal antibodies of epcam (fmu - epcam-2a9 and fmu - epcam-2d7) are all prepared in our lab. fetal bovine serum and mrna isolation kit mouse anti - gst antibody, protein ultrafiltration centrifugal tube, and pvdf membrane are from millipore. escherichia coli dh5 and bl21 were used for cloning of the pmd - t18 - 2a9-vh (or -vl) plasmid and pgex-4t1-scfv plasmid, respectively. e. coli m15 was used to express the extracellular domain of epcam (pqe30-epcam). the hepatocellular carcinoma cell lines (hhcc and smmc-7721), breast cancer cell line (skbr3), and colon cancer cells (colo205 and sw480) are all from atcc. they were grown in rpmi 1640 medium supplemented with 10% fetal bovine serum (fbs) and 1% penicillin - streptomycin (100 units / ml penicillin and 100 g / ml streptomycin) at 37c and 5% co2 in a humidified incubator. cells were collected in the logarithmic phase and total rna was extracted with trizol according to the manufacturer 's instructions. the sequences encoding the light and heavy chain variable regions (vl and vh) of 2a9 were amplified by rt - pcr. the vh sequence was amplified using primers a and b, while the vl sequence was amplified with primers c and d. after purification, pcr products were cloned into a pmd - t18 vector and transformed into e. coli dh5. the positive colony (pmd - t18 - 2a9-vh or pmd - t18 - 2a9-vl) was identified by colony pcr and restriction enzyme analysis. the sequence encoding the 2a9-vh and 2a9-vl was amplified by pcr from plasmids pmd - t18 - 2a9-vh and pmd - t18 - 2a9-vl, respectively, and inserted into the pgex-4t1 expression vector in two steps. the 2a9-vh sequence was amplified by primers e and f, whereas the 2a9-vl sequence was amplified using primers g and h. after gel purification, the amplified vh products were digested, purified, and ligated between the bamh i and sal i sites of plasmid vector pgex-4t1. after identification of the pgex-4t1-vh plasmid, the amplified vl products were ligated between the sal i and ecor i sites of plasmid vector pgex-4t1-vh. the pgex-4t1-vh - vl (pgex-4t1-scfv2a9) vector was confirmed by restriction enzyme digestion and dna sequencing. the sequence encoding a truncated form of pseudomonas exotoxin (pe38kdel) was amplified by pcr, and the template was kindly supplied by professor boquan jin of the fourth military medical university and cloned as an ~1,200 bp ecor i - xhol i fragment downstream of the scfv2a9 sequence present in the pgex-4t1-based scfv2a9 expression vector. the primers used were i and j. the expression vector pgex-4t1-scfv2a9-pe was identified by restriction enzyme digestion and dna sequencing. bacterial cultures were incubated at 37c in lb growth medium containing 100 ng / ml ampicillin and grown until an early log phase (a600 nm = 0.60.8). protein expression was induced for 7 h at 30c by the addition of iptg (final concentration 500 nm). bacteria were harvested by centrifugation at 12,000 rpm for 20 min at 4c. for purification, the pellet obtained from a 100 ml culture was resuspended in 10 ml 0.15 m pbs and pulse - sonicated for 30 1 min (1 s working and 1 s resting for a 1 min pulse and then cooled on ice for 1 min). the soluble and insoluble fractions were separated by centrifugation at 12,000 rpm for 20 min at 4c. then the soluble fraction was purified by using the glutathione resin gst fusion protein purification kit according to the manufacturer 's instructions (genscript cat. the purified immunotoxin was labeled by biotin according to the manufacturer 's instruction (roche, biotin protein labeling kit). purified protein samples were analyzed by electrophoresis on 10% sds - page under denaturing conditions and transferred to pvdf membrane. western blot analysis was conducted using a mouse anti - gst antibody (the scfv was coexpressed with a gst tag) as the primary antibody (millipore, 1 : 3000) and a horseradish peroxidase- (hrp-) labeled rabbit anti - mouse igg as the secondary antibody, in accordance with the manufacturer 's protocols. the sequence encoding the extracellular domain of epcam was amplified by pcr from plasmid pgex-4t-3-epcam and cloned as a 750 bp kpn i - hind iii fragment to the plasmid pqe30. the primers used were k and l. the pqe30-epcam plasmid was used to express the extracellular domain of epcam in m15 e. coli. cells were grown at 37c in a shaking incubator (220 rpm) until the culture reached an od600 of 0.60.8. protein expression was induced for 7 h at 30c by adding iptg (sigma) at a final concentration of 500 nm. the harvested pellet was ultrasonicated and analyzed via sds - page coomassie blue staining and western blot. the protein from the supernatant was purified with a nickel - affinity chromatography column, in accordance with the manufacturer 's instruction (ge). briefly, a 96-well plate was coated with 100 l 5 g / ml epcam - his recombinant protein overnight at 4c in pbs. after incubation and washing, 100 l 2a9 or immunotoxin was added to the wells at different concentrations (20, 2, 0.2, 0.02, and 0.002 g / ml) and incubated for 1 h at 37c. a mouse anti - gst primary antibody (1 : 500) and a hrp - labeled rabbit anti - mouse secondary antibody (1 : 2,500) were used to detect 2a9 or immunotoxin ; the tetramethylbenzidine (tmb) was used to develop the elisa results. colo205 and hhcc cells at 5 10 cells / ml were incubated with biotin labeled immunotoxin (20 g / ml) or antibodies against epcam (20 g / ml) for 40 minutes at 4c. the cells were washed with pbs and then incubated with the fitc labeled avidin or antibodies for 30 minutes at 4c. the fluorescence was examined by flow cytometry analysis using a facscan flow cytometer (bd). briefly, 4,000 hhcc cells were seeded in 96-well microplates in a total volume of 200 l of culture medium / well. immunotoxin (232.5 m) was added and cells were incubated for 72 h under standard cell culture conditions. then, 20 l of 5 mg / ml mtt solution was added to each well, and plates were incubated for 4 h at 37c. cell lysis and formazan solubilization were achieved by the addition of 150 l dmso, and released formazan crystals were allowed to dissolve 10 min at 37c. briefly, the hhcc cells were seeded in 24-well plates. after incubating for 8 h, biotin - labeled immunotoxin was added to the wells and incubated for different times. to localize the immunotoxin, cells were washed and fixed with 4% paraformaldehyde, and after blocking, cells were stained with primary antibody of the specific endoplasmic reticulum protein crt (prepared in our laboratory). fluorescence was measured by adding pe conjugated goat anti - mouse igg and fitc - labeled avidin. differences between groups were determined using an unpaired two - tailed student 's t - test. data analyses were performed using graphpad prism version 5.0 (graphpad software, san diego, ca). to screen the parental antibody of scfv, we compared the binding activity of two epcam mabs (fmu-2a9 and fmu-2d7) with epcam on the surface of epcam - positive cells (colo205 and hhcc) and epcam - negative cells (sw480) by flow cytometry. 2a9 had relatively higher binding ability than 2d7 with the natural epcam molecule on these two cell surfaces. three separate products generated an ~2,000 bp immunotoxin (figures 2(a) and 2(b)). the sequence of the immunotoxin (ape) was further confirmed by dna sequencing (figure 3). ape was expressed in bl21 e. coli, after sonication and purification, and samples were analyzed. sds - page and western blot results (figures 2(c) and 2(d)) indicated that the expressed gst - immunotoxin was ~95 kda, which was consistent with the predicted molecule weight. the gst tag was cut with thrombin and removed by purification, and the true molecule mass of the immunotoxin was 67 kda (figure 2(e)). to analyze the binding ability of the immunotoxin, we constructed and expressed the recombinant protein his - epcam. the plasmid pqe30-epcam was identified by restriction enzyme analysis (figure 4(a)) and dna sequencing. the expression of his - epcam was induced with 500 nm iptg at 30c for 7 h. after sonication and centrifugation of the bacteria, total protein, supernatants, and inclusion bodies were separated with 10% sds - page under reducing conditions. as shown in figure 4(b), the expression strain produced the recombinant protein in both soluble and inclusion bodies form. western blot (figure 4(c)) confirmed a novel band at the predicted molecular weight of 32 kda. immunotoxin was successfully prepared, and the binding ability of the immunotoxin to epcam was tested by flow cytometry and elisa. briefly, prepared his - epcam or bsa was coated on 96-well plates, and the immunotoxin or 2a9 was added to detect recognition to epcam. data showed (figure 5(a)) that 2a9 had relatively higher binding ability with recombinant his - epcam (2 g / ml) (unpaired t - test, p = 0.0071). in fact, the binding activity of ape with his - epcam was weaker than 2a9 at other concentrations used (20, 0.2, 0.02, and 0.002 g / ml, data not shown). flow cytometry analysis (figure 5(b)) demonstrated that the immunotoxin could efficiently recognize the epcam molecule on hhcc cells, although the binding ability was lower than 2a9. the mean fluorescent intensity of 2a9 was 25.02 3.23, while the immunotoxin intensity was 10.03 3.07. the immunotoxin could bind to epcam in carcinoma cells, but whether it was cytotoxic to cancer cells requires more study. cytotoxicity of the immunotoxin to epcam - positive (hhcc, colo205, smmc-7721, and skbr3) and epcam - negative (sw480) cells was tested by mtt assay. data show (figure 6(a)) that ape and pe both inhibited hhcc cell viability and had no other effect on other cells ' survival (data not shown). the ic50 of the immunotoxin to hhcc cells was 50 pm, and the control toxin exceeded 5,000 pm. this indicates that the immunotoxin can efficiently recognize certain cancer cells and has anticancer activity. the mechanism of cytotoxicity was studied by immunofluorescence. after staining, the localization of the immunotoxin data show that (figure 6(b)) after 6 h of incubation, the immunotoxin internalized to the hhcc cells and colocalized with crt protein in the endoplasmic reticulum where it diffused uniformly in the endoplasmic reticulum after 24 h of incubation. thus, the development of novel drugs that target the specific antigen of carcinomas is greatly needed. epcam was reported to participate in the development and progression of diverse carcinomas as well as serve as a marker of prognosis, which triggered the study of epcam - target immunotherapy. epcam - specific antibodies were designed and used to treat many cancers in vitro and in vivo [22, 23 ]. several epcam - target antibodies have been used in the clinic to treat malignant ascites and squamous cell carcinomas of the head and neck [24, 25 ], as well. these results suggest that epcam - targeted immunotoxin might be used to treat cancers. in the current study, we designed, produced, and characterized a recombinant immunotoxin ape, comprised of an epcam scfv and pe38kdel. we prepared seven epcam monoclonal antibodies, and they were used to identify cd326 at the 8th international conference on hlda (human leucocyte differentiation antigens). the sequences encoding the light and heavy chain variable regions of four antibodies have been cloned and homology comparison and analysis of the nucleoside sequences of the four variable regions were performed using genbank + embl + ddbj + pdb databases. the dnasis program was used to analyze the nucleotide sequence and deduce the amino acid sequence, which was blasted in nonredundant genbank cds translations + pdb + swissprot + pir + prf protein databases. imgt / v - quest was used to analyze the structure of variable region and determine the cdr region of the antibodies. patents have been sought for these four sequences of variable regions (antibodies were fmu - epcam-2a9, fmu - epcam-2d7, fmu - epcam-4e4, and fmu - epcam-4f6). our previous work indicated that all of the antibodies could be used to stain colon carcinoma tissues for immunohistochemistry, suggesting that they have the potential to become anticancer drugs. in this work, fcm analysis showed that 2a9 had relatively higher binding ability to epcam on the surface of two epcam - positive cells. the constructed expression vector pgex4t1-scfv2a9-pe was finally identified by dna sequencing. after purification and identification, we performed flow cytometry analysis and elisa to measure immunotoxin activity. the original pgex-4t3-epcam and the immunotoxin all have a gst tag and can be hardly distinguished by anti - gst antibody. to detect its antigen - binding activity elisa and flow cytometry analysis confirmed functionality, in which the ape can detect the epcam molecule as 2a9, though with relatively lower activity. this was consistent with flow cytometry results that 2a9 and ape can bind the natural epcam with different binding abilities. characterization of the specificity and binding affinity of ape was also carried out with a competitive binding assay with the monoclonal 2a9 antibody and ape. to confirm that ape recognizes the same extracellular epcam epitope as the 2a9 mab the results (data not shown) confirmed that ape could compete with 2a9 to certain extent, but incompletely. previous studies demonstrated that high affinity anti - epcam antibodies could cause toxic effects (phase i trials) [27, 28 ], while antibodies with moderate affinity to epcam - positive cancers efficiently mediated both antibody - dependent cellular cytotoxicity and complement - mediated cytotoxicity [2931 ]. the immunotoxin can recognize epcam, and whether it is cytotoxic to epcam - positive tumor cells must be confirmed. mtt assay demonstrated that ape induced a 50% reduction of viability (ic50) of hhcc cells at a concentration of 50 pm, compared to control pe (> 5000 pm). the immunotoxin has a c - terminal kdel motif, which can localize it to the endoplasmic reticulum. we observed this localization in hhcc cells by immunofluorescence and this suggested that the immunotoxin might internalize to cells and transport to the endoplasmic reticulum to exert its function. in addition, the internalization of the immunotoxin to colo205 was also observed by immunofluorescence, and the immunotoxin was not detectable in cells after 24 h of incubation (data not shown). the recombinant protein was expressed in e. coli cells as soluble form and as an inclusion body form (mainly). the soluble form of the protein maintained the natural structure and function and it could be used for function analysis. we purified the soluble protein from 4 l bacteria and 2 mg of purified ape was collected, a yield somewhat lower than previous reports [36, 37 ]. because the inclusion body was the main form of the immunotoxin, in follow - up work immunotoxin, comprised of scfv and toxin, has many advantages compared with other therapeutics, such as small molecular weight, fewer side effects, a simple preparation method, and low production cost. if the scfv used to construct an immunotoxin can be fully humanized, the therapeutic potential of the immunotoxin will be powerful. in conclusion, we have successfully developed an immunotoxin made of a single - chain variable fragment (scfv), derived from epcam monoclonal antibody fmu - epcam-2a9 and pe38kdel. future work will include optimization of protein production, further development and testing of immunotoxin - based targeted therapies in animal models, and modification of the immunotoxin to decrease immunogenicity and toxicity. | epithelial cell adhesion molecule (epcam) is a type i transmembrane glycoprotein overexpressed in human epithelioma but with relatively low expression in normal epithelial tissues. to exploit this differential expression pattern for targeted cancer therapy, an epcam - targeted immunotoxin was developed and its antitumor activity was investigated in vitro. an immunotoxin (scfv2a9-pe or ape) was constructed by genetically fusing a truncated form (pe38kdel) of pseudomonas aeruginosa exotoxin with an anti - epcam single - chain variable fragment (scfv). elisa and flow cytometry were performed to verify immunotoxin (scfv2a9-pe or ape) antigen - binding activity with epcam. cytotoxicity was measured by mtt assay. confocal microscopy was used to observe its cellular localization. the results of elisa and flow cytometry revealed that the immunotoxin efficiently recognized recombinant and natural epcam. its antigen - binding activity was relatively lower than 2a9. mtt assay confirmed potent reduction in epcam - positive hhcc (human hepatocellular carcinoma) cell viability (ic50 50 pm). immunofluorescence revealed that the immunotoxin localized to endoplasmic reticulum 24 h later. in conclusion, we described the development of an epcam - targeted immunotoxin with potent activity against tumor cells, which may lay the foundation for future development of therapeutic antibody for the treatment of epcam - positive tumors. |
staphylococcus aureus is an important food - borne pathogen involved in a variety of invasive diseases (1). it produces many toxins as well as non - toxic enzymes and can facilitate bacterial attack and proliferation in the body of host (2). some strains produce staphylococcal enterotoxins (ses) that can cause food poisoning if food containing preformed se is ingested. symptoms of staphylococcal food poisoning (sfp) have a rapid onset (2 to 6 h) and may include vomiting, stomach pain and diarrhea (3). enterotoxins from s. aureus strains can be classified into 18 serological types : a - u (except s, f and t)(2,4 - 9). the ses are a group of heat stable and pepsin resistant exotoxins encoded by genes in the chromosome, pathogenicity island, phages or plasmids (2). for production of sufficient amount of toxin to cause intoxication symptoms, 10 cfu / ml or cfu / g enterotoxigenic strains of bacteria are needed (10). ses are low molecular weight proteins (mw 26.900 29600 kd) (11). sea is a leading cause of food intoxication (12) and is an extremely potent gastrointestinal toxin, as little as 100 ng is sufficient to cause symptoms of intoxication (13). milk and milk products have frequently been implicated in staphylococcal food poisoning and contaminated raw milk is often involved (2, 3). s. aureus mastitis is a serious problem in dairy production and infected animals may contaminate bulk milk. human handlers, milking equipment, the environment and the udder and teat skin of dairy animals are other possible sources of bulk milk contamination (3, 14). surveys to detect classical enterotoxins and to identify enterotoxin genes in s. aureus from milk and milk products have been conducted in many counties including italy, norway, turkey, brazil and iran (tehran) (16 - 20). however, there are no published reports about presence of sea gene in milk and its products in tabriz - iran. therefore, this study was conducted to investigate the presence of sea gene of s. aureus in organic milk and cheese using pcr method in tabriz - iran. a total of 200 samples (100 milk samples, 100 cheese samples) were collected from milk collection points and food stores in tabriz, iran. the samples were collected in sterile containers, immediately kept in an ice box and transported to the laboratory. the samples were investigated microbiologically for the presence of s. aureus, according to the standard method no. 6806 - 1 of the institute of standards and industrial research of iran (isiri). the milk and cheese samples were diluted in ringer and pepton water, respectively. from each diluted solutions produced, 1 ml was transferred to brain- heart infusion broth and incubated at 37c for 24 h. baird- parker agar supplemented with potassium tellurite and egg yolk emulsion was used for isolation of s. aureus. after 24 - 48 h incubation at 37c, the bpa plates were analyzed for the presence of s. aureus, which appeared as black colonies with transparent zone. biochemical confirmation tests (gram staining, coagulase, catalase, oxidase, vp and growth on mannitol salt agar) were carried out for final identification of the suspected s. aureus isolates. for dna isolation, biochemically confirmed single colonies of s. aureus isolates on bpa were cultured on lb broth. dna extraction procedure was done by a commercial kit (cinna pure kit), according to the supplier s instructions on the bacterial cells pellet from an overnight culture in lb broth. the primers used for the detection of nuc and sea genes are listed in table 1. pcr reactions were performed in reaction buffer (10x), mgcl2 (50 mm) in a total volume of 25 l, containing 5 l of template dna, 0.75 l of each primers (10 pm), 0.25 l of dntp (10 mm), 0.2 l of taq dna polymerase (5 unit/l) and 14.05 l of ddh2o. pcr was performed under the following conditions : initial denaturation at 94c for 5 min, subsequently followed by 30 cycles of 94c for 1 min, 55c for 1 min and 72c for 1 min with a final extention of 5 min at 72c. pcr reaction was conducted like the previous test but with some changes in annealing temperature (50c for 1 min). the presence of 552 bp amplicon indicates the positive samples for sea gene in these isolates. a total of 200 samples (100 milk samples, 100 cheese samples) were collected from milk collection points and food stores in tabriz, iran. the samples were collected in sterile containers, immediately kept in an ice box and transported to the laboratory. the samples were investigated microbiologically for the presence of s. aureus, according to the standard method no. 6806 - 1 of the institute of standards and industrial research of iran (isiri). the milk and cheese samples were diluted in ringer and pepton water, respectively. from each diluted solutions produced, 1 ml was transferred to brain- heart infusion broth and incubated at 37c for 24 h. baird- parker agar supplemented with potassium tellurite and egg yolk emulsion was used for isolation of s. aureus. after 24 - 48 h incubation at 37c, the bpa plates were analyzed for the presence of s. aureus, which appeared as black colonies with transparent zone. biochemical confirmation tests (gram staining, coagulase, catalase, oxidase, vp and growth on mannitol salt agar) were carried out for final identification of the suspected s. aureus isolates. for dna isolation, biochemically confirmed single colonies of s. aureus isolates on bpa were cultured on lb broth. dna extraction procedure was done by a commercial kit (cinna pure kit), according to the supplier s instructions on the bacterial cells pellet from an overnight culture in lb broth. the primers used for the detection of nuc and sea genes are listed in table 1. pcr reactions were performed in reaction buffer (10x), mgcl2 (50 mm) in a total volume of 25 l, containing 5 l of template dna, 0.75 l of each primers (10 pm), 0.25 l of dntp (10 mm), 0.2 l of taq dna polymerase (5 unit/l) and 14.05 l of ddh2o. pcr was performed under the following conditions : initial denaturation at 94c for 5 min, subsequently followed by 30 cycles of 94c for 1 min, 55c for 1 min and 72c for 1 min with a final extention of 5 min at 72c. pcr reaction was conducted like the previous test but with some changes in annealing temperature (50c for 1 min). the presence of 552 bp amplicon indicates the positive samples for sea gene in these isolates. in the present study, s. aureus was observed in 54 (27 %) out of 200 samples : 9 from milk and 45 from cheese samples. the number of bacteria in contaminated samples by cfu / ml is shown in table 2. for further molecular confirmation of s. aureus colonies, pcr reaction for nuc gene was performed. results showed that 7 out of 54 s. aureus isolates harbored sea gene (table 2). several researchers have reported different results of the number of bacteria in contaminated dairy products by cfu / ml (10, 20, 21). variations in s. aureus count in dairy products may depend on sanitary precautions during milk processing chain. the existence of s. aureus in food and dairy products was previously confirmed by imani fooladi in iran (20). sea is the most common enterotoxin recovered from food poisoning outbreaks in the usa (77.8% of all outbreaks)(24). in the current study considering the findings of brakstad.(22), and comparing them to our study, it can be stated that the pcr for amplification of the nuc gene has potential for rapid diagnosis and confirmation of s. aureus isolates. the present study aimed to evaluate the prevalence rate of sea gene in organic milk and cheese in tabriz, iran. outside of iran, various results have been reported on the presence of s. aureus and its enterotoxins in milk and its products (28 - 31). in the current study, we found that 27% of the organic milk and cheese samples were contaminated by s. aureus. pcr results for sea gene, showed that 12.96% of the isolates possessed sea gene. similar level of incidence was reported by holeckova., (32), imani fooladi., (20) and el - jakee. this discrepancy could be attributed to the improvements in the handling and sanitary procedures during milking and its processing. it was concluded that even though the level of microorganisms in dairy products was not sufficient to cause disease, the presence of toxins could be considered a potential risk for public health. several conditions such as delay in processing, inadequate refrigeration, poor personal hygiene and post process contamination are associated with staphylococcal growth and enterotoxin production (34). therefore it is essential to ensure high safety standards for preventing staphylococcal food poisoning. in conclusion, the results of this study provides some important preliminary data about the prevalence of enterotoxigenic s. aureus in organic milk and cheese in tabriz, iran. consumption of organic milk and specially cheese is still widespread and could cause a potential risk to public health, so an effective reduction of contamination levels could be achieved by improving sanitation and hygiene procedures. further investigations are needed to evaluate the production of other toxins in milk and cheese. | background and objectivesstaphylococcal food poisoning is a gastrointestinal disease, which is caused by consumption of contaminated food with enterotoxins produced by staphylococcus aureus (ses). milk and its products are known sources of food borne diseases. this study was carried out to evaluate the prevalence of enterotoxigenic s. aureus strains in organic milk and cheese in tabriz - iran.materials and methodsa total of 200 samples (100 milk samples and 100 cheese samples) were collected from farms and milk collection points in tabriz - iran. the samples were cultured and identified by standard bacteriological methods, then pcr was performed to detect sea gene.results and conclusionstaphylococcus aureus was found in 27% of all samples (milk and cheese). results of pcr showed that 12.96% of s. aureus isolates possessed sea gene. it suggested the potential public health threat of s. aureus resulting from contamination of dairy products. so, efforts are required to improve safety standards for preventing staphylococcal food poisoning. |
bisphosphonate - related osteonecrosis of the jaw (bronj) is currently defined as an area of exposed bone in the maxillofacial region that has persisted for more than 8 weeks in a patient on previous or current treatment with a bisphosphonate and without history of radiation therapy to the jaws. despite this definition, many pathogenetic hypotheses have been put forward but none of them could explain the peculiar character of this disorder. osteoclasts are the main target of bisphosphonates, with the suppression of osteoclast - mediated bone remodelling. because remodelling is high in the jaw, remodelling suppression hypothesis has been firstly proposed. even if bronj seems to be a primarily bone condition, some studies showed a toxic effect of bisphosphonates (bp) on the oral epithelium with inhibition of normal soft tissue healing. because epithelialisation is an essential step in postintervention wound healing, it has been hypothesized that the soft tissue of the oral mucosa could be a key factor in bronj development. moreover, a relevant role has been advocate for the antiangiogenetic effect of bp, particularly for the possible failure of healing processes with exposure of bone, which could then become necrotic. other factors likely involved in the bronj etiopathogenesis are the anatomic site, bacterial infection, diabetes, smoking, concurrent medications, and genetic predisposition. bronj is a multifactorial disease and it is therefore difficult to develop an aetiological therapy. bronj management is controversial : there are no evidence - based guidelines in the literature associated with good results for a long - term followup, in particular regarding surgical procedures. the main purposes of each treatment are to reduce pain and infection and slow the progression of the disease. most of the authors privilege a noninvasive approach especially for asymptomatic stages of bronj (stage i in ruggiero'staging system) (table 1). temporary suspension of bps offers no short - term benefit, whilst long - term discontinuation may be beneficial in stabilizing sites of onj and reducing clinical symptoms. the position paper of aaoms suggested the use of oral antimicrobial rinses for stage i and systemic antibiotic therapy (penicillin, metronidazole, quinolones, clindamycin, doxycycline, and erythromycin) for symptomatic stages (stages 0, ii, and iii) (table 1). the main problem of local or systemic antibacterial therapy is the shortness of clinical results producing improvement of abscess, pain, and swelling which are usually followed by a relapse of infection and symptoms after an average of three weeks. another aspect is that these patients are usually old and under chemotherapy, are debilitated by malignancies, and are thus not able to bear the side effects of prolonged (and sometimes permanent) antibiotic schedules. furthermore, the evolution of disease and the uncontrollable transition from stage i to advanced stages of bronj are not unlikely. recently, teriparatide (n - terminal 34 amino acids of recombinant human parathyroid hormone) was reported for medical treatment of bronj. this compound increases bone density stimulating osteoblastic bone formation and as well as bone remodelling. however the treatment with such a drug should be limited to 2 years because preclinical studies showed increased risk of osteosarcoma for long - term exposure. for this reason teriparatide should not be recommended for patients with metastatic cancer [5, 6 ]. pentoxifylline and -tocopherol in addition to antimicrobial therapy induced a 74% decrease in area of bone exposure and symptoms in bronj patients also in early stages of disease. in vitro studies support the hypothesis that local or systemic treatment with geranylgeraniol (ggoh) improves viability and migration capacity of osteoblasts, fibroblasts, and endothelial cells with possible mucosal healing also in stage i of bronj. ozone therapy (ot) and hyperbaric oxygen therapy (hbo) may stimulate cell proliferation and soft tissue healing reducing pain [912 ]. laser applications at low intensity (low level laser therapy (lllt)) have been reported in the literature for the treatment of bronj. biostimulant effects of laser improve reparative process, increase inorganic matrix of bone and osteoblast mitotic index, and stimulate lymphatic and blood capillaries growth [1316 ]. ot, hbo, and lllt are in general recommended in addition to medical or surgical therapy : good clinical results are probably associated with an improvement of traditional treatments by these adjunctive therapies. surgical necrotic bone debridement or resection in combination with antibiotic therapy may offer long - term palliation with resolution of acute infection and pain. mobile segments of bony sequestrum and necrotic tissue should be removed extending surgery until unaffected bone is reached. for diffuse bronj, the resection of mandible followed by reconstruction with free fibula flaps has been proposed [1719 ]. in the case of large and complex surgical interventions a careful evaluation of the general conditions of each patient should be performed, including disease severity, age, and life expectancy. the position paper of aaoms suggested to limit surgical procedures to stage iii bronj, but many subsequent studies reported very good results of surgery also in early stages of bronj. currently, there is no agreement with regard to the treatment of choice for stage i bronj and no effective unique therapy has yet been developed. the noninvasive management of these conditions is related to the prevention of the possible extension of the necrotic process, but many authors reported better results with surgical therapy than with medical treatment alone and proposed an implementation of surgical procedures, in the cases uncontrolled by local or general therapy, to limit the risk of evolution to stage iii [2023 ] (table 2). a limited surgical approach in patients not responding to noninvasive medical or adjunctive therapy (ot, hbo, and lllt) represents a good solution. such a treatment is rapid, poorly invasive and can be performed under local analgesia in day - surgery regimen. here we report our experience of surgical conservative treatment of stage i in a cohort of cancer and noncancer patients under bpt with long - term followup. this study reports the clinical outcomes of 63 patients treated for bronj stage i (according to ruggiero 's staging system) at the oral pathology and laser - assisted surgery unit of the university of parma, italy, between january 2004 and january 2011. this study was approved by the parma hospital irb and all participants signed an informed consent agreement. in this retrospective analysis we included patients under bpt for malignancies or osteoporosis, with asymptomatic bone exposure in the maxillofacial region persisted for more than 8 weeks, without history of radiation therapy in the cervicofacial area. inclusion criteria patients under bpt for malignancies or osteoporosis with diagnosis of bronj in stage i.patients unresponsive to noninvasive treatments (namely, local antiseptics, antibiotic therapy, and low level laser therapy) for six months.patients considered sufficiently in health status to tolerate the surgical intervention (asa score 3,5).patients not in agreement with specific informed consensus for surgical intervention. presence of symptoms (pain) or clinical / radiological findings typical for different stages of bronj (erythema, purulent drainage, necrotic bone extending beyond the region of alveolar bone resulting in pathologic fracture, extraoral fistula, oral antral / oral nasal communication, or osteolysis extending to the inferior border of the mandible or the sinus floor). patients immunocompromised (white blood cells 3,5). surgical interventions were performed, under local analgesia, in patients unresponsive to a period of six months of noninvasive treatments such as cycles of local or systemic antibacterial therapy combined or not to lllt, ot, or hbo. all interventions were performed after the consultation of oncologist or physician. for all patients all exams previously performed by their specialists (blood exams, magnetic nuclear resonance, scintigraphy, pet, and moc) were obtained. specific exams for bronj were dental x - rays, orthopantomographs, and computed tomography in order to exclude metastases in the region of bone exposure and deeper involvement of bronj (maxillary sinus, mandibular body and bone fractures). the decision of bpt discontinuation before and after surgical intervention was made by the oncologist or internist. the outcome parameters of clinical success of treatment were the absence of symptoms (pain, dysesthesia, or anaesthesia) and the presence of intact mucosa in the previous site of bronj without signs of infection (swelling, abscess, and fistulas) (stage 0) (table 3) and the absence of new exposed bone near surgical area. data about patients, bronj features, and clinical outcome after surgery were summarized in tables. the aim of intervention is the complete elimination of necrotic bone followed by covering of the presumptive healthy tissue with the vascularized soft tissue of the access flap. prophylactic antibiotics were administered for 4 days before surgery (amoxicillin and clavulanic acid 1 gr twice a day and metronidazole 500 mg twice a day) and continued postoperatively for two weeks. the surgical procedure included a mucoperiosteal flap through a linear mucoperiosteal cut surrounding bone exposure without lateral incisions to limit the risk of reduction of vascularization. the inflamed margins of the mucosa were eliminated for two millimetres to obtain a better quality tissue to cover bone surgical area. necrotic bone was resected with surgical drills or evaporated with an erbium laser (er : yag laser, wave length 2940 nm, parameters : 250 mj 20 hz (vsp) with a fluence of 50 j / cm up to 300 mj, 30 hz, and fluence of 60 j / cm) until the appearance of bleeding bone under sterile saline solution irrigation (figures 1, 2, and 3). bone fragments and spikes were eliminated to obtain a smooth surface in order to avoid local traumatisms and to facilitate soft tissue healing over the surgical site. all surgical specimens underwent histopathological examination to confirm bronj diagnosis and to exclude the presence of metastasis or myeloma localization. wound closure was obtained by a tension - free mucosal flap sitting passively over the bone with silk suture. the sutures were removed 10 to 14 days after surgical intervention. in the postoperative period nonsteroid anti - inflammatory drugs (nsaid), in the case of necessity, and chlorhexidine 1% gel, four times a day, were recommended. during the post - operative follow - up each patient was visited weekly during the first month, twice a month for the two following months and once a month for the following six months. the orthopantomographs, in the cases of complete mucosal healing, were obtained after six months from the surgical intervention. in cases of worsening or relapses of bronj new imaging exams were suddenly required. for each patient, conforming to a protocol that satisfied the ethical standard as described by the azienda ospedaliero - universitaria di parma and university general hospital of valencia, spain, we collected specific informed consensus for surgical intervention. algorithm of stage i bronj management diagnosis of stage i bronj : asymptomatic bone exposure in the maxillofacial region after 8 weeks of observation without history of radiation therapy in the cervicofacial area.photographs : at the first visit and during the follow - up period.prescription of radiographic exams : endoral rx, orthopantomographs and computed tomography.noninvasive treatment : for six months medical therapy (intermittent cycles of local or systemic antibacterial therapy) combined or not to alternative therapies (lllt, ot, or hbo).evaluation of laboratory exams (blood exams including full blood count and hemostasis, epatic and renal function, magnetic nuclear resonance, scintigraphy, pet scan, moc, etc.), and consultation with specialists (oncologists, physicians) required by their specialists.evaluation of evolution of disease : age, performance status and life expectancy.collection of informed consensus for surgical intervention.bpt interruption (drug holiday) : not in every case. the decision was made by the oncologists or internists on the basis of each single condition and necessity.prophylactic antibiotic therapy : amoxicillin and clavulanic acid 2 gr a day and metronidazole 1 gr a day starting 4 days before surgery.local analgesia : articaine 4%.mucoperiosteal envelope flap through a linear cut surrounding bone exposure without lateral discharge incisions.elimination of necrotic bone : with surgical drills or erbium laser to obtain a smooth surface of bleeding bone.irrigation of surgical site : with 10% iodopovidone solution.suture : 4 zero silk, tension free mucosal flap.removing of sutures : between 10 and 14 days after surgery.postoperative medical therapy : antibiotics for two weeks postoperatively, chlorhexidine 1% gel 4 times daily, and nsaid (if necessary).histopathological analysis of bony fragment : to confirm bronj and to exclude cancer diagnosis. diagnosis of stage i bronj : asymptomatic bone exposure in the maxillofacial region after 8 weeks of observation without history of radiation therapy in the cervicofacial area. noninvasive treatment : for six months medical therapy (intermittent cycles of local or systemic antibacterial therapy) combined or not to alternative therapies (lllt, ot, or hbo). evaluation of laboratory exams (blood exams including full blood count and hemostasis, epatic and renal function, magnetic nuclear resonance, scintigraphy, pet scan, moc, etc.), and consultation with specialists (oncologists, physicians) required by their specialists. the decision was made by the oncologists or internists on the basis of each single condition and necessity. prophylactic antibiotic therapy : amoxicillin and clavulanic acid 2 gr a day and metronidazole 1 gr a day starting 4 days before surgery. elimination of necrotic bone : with surgical drills or erbium laser to obtain a smooth surface of bleeding bone. postoperative medical therapy : antibiotics for two weeks postoperatively, chlorhexidine 1% gel 4 times daily, and nsaid (if necessary). followup is as follows : once a week during the first month, twice a month for the two following months, and once a month for six months. nineteen patients were affected by multiple myeloma (mm), 29 were treated for bone metastases (bm) (48 patients, cancer group cg), and 15 were taking bps for osteoporosis (noncancer group ncg). mean bpt duration was 25.65 months for patients in cg and 90.85 months for ncg (table 4). according to oral subsite involved, 8 and 7 patients of cg had maxillary and mandibular involvement, respectively. in ncg, a number of patients with stage 0 disease and months of followup are shown in table 5. table 6 reports the number of cases in stage i, stage ii, and stage iii, subclassified according site of involvement, primary disease of the patients, and treatment modality (surgical treatment, nonsurgical treatment). number of sites as well as percentage of complete healing are reported in table 7. marx. suggested in 2007 morning fasting serum c - terminal telopeptide (ctx)-guided drug holiday protocol for planning surgical procedures in patients under bpt. nowadays ctx test represents a controversial matter because it is not reliable in the cancer or rheumatoid patients under previous treatment with methotrexate, prednisone, and raloxafene because drugs and malignancy effects on bone confound the results of the test. in fact studies showed higher level of ctx in patients with bone metastasis and lower level of ctx in patients under suppressive therapies. on the other hand different authors found normal rate of ctx or other bone turnover markers in bronj patients showing the absence of specific relationship between serum levels and severity of disease [2629 ]. some authors reported that bps discontinuation for a variable period (one to six months) before and after interventions favoured the surgical outcome. it is still unclear if long - term drug holiday can be beneficial in stabilizing sites of bronj or can improve the healing after surgical procedures. the discontinuation of bpt could result in a recurrence of bone pain, progression of metastases or osteolytic lesions, or increase of related skeletal events (rse) [31, 32 ]. based on the above - mentioned considerations we did not use bone metabolism markers in our case series. to plan surgical intervention we judged general health status and blood exams. discontinuation of bpt before surgery seems not to influence the outcome in patients with stage i disease. some authors reported that surgery is more successful in patients with osteoporosis or multiple myeloma than in those with solid tumors. in our experience, patients treated with early surgical approach had similar percentages of healing in the 2 groups. reported that surgical procedures in patients suffering from bronj (also in the cases of stage i) were made under general anaesthesia. in our experience it was possible to perform interventions in day surgery under local analgesia in all cases [30, 33 ]. laser can be used for conservative surgery whereby necrotic bone is vaporised, until healthy bone is reached. the erbium laser penetrates the hard tissue for 0.1 mm, providing safety guarantees and allowing precision. a gradual evaporation of the necrotic bone can be performed till healthy bleeding bone is seen. the minimally invasive technique of evaporation allows the sectioned bone surfaces to be regular and can be used to create microperforations at the base for stimulating new vascularization. the additional advantages of laser surgery are the bactericidal and biostimulatory actions of the laser beam with a better postoperative recovery. the percentages of clinical success in bronj treatment reported in the literature with this technique are very high in comparison to conventional surgery [3739 ]. the results in the present study confirm that the laser surgery represents a valid therapeutic option for bronj and enables the minimally invasive treatment of the early stages of the disease. when making the decision to perform surgical procedures for the treatment of bronj, the deal between benefit and potential risks according to clinical circumstances of each patient should be considered. surgical operations for advanced stages of bronj are invasive and extensive and must be performed under general anaesthesia. only few patients may undergo this type of surgery. on the other hand a minimal and faster intervention under local analgesia less invasive surgery may determine a complete mucosal healing containing the microbial infection and the risk of spread of the disease. our result confirms that treatment of patients affected by minimal bone exposition, (stage i of bronj), through conservative surgical strategies, possibly with laser, may determine a higher control of lesions in the long term. | purpose. to report the efficacy of conservative surgical treatment for stage i bisphosphonate - related osteonecrosis of the jaw (bronj). materials and methods. this study reports the clinical outcomes of 63 patients treated for bronj stage i (according to ruggiero 's staging system) at the oral pathology and laser - assisted surgery unit of the university of parma between january 2004 and january 2011. surgical interventions were performed, under local analgesia, in patients unresponsive for a period of six months to noninvasive treatments such as cycles of local or systemic antibacterial therapy combined or not to low level laser therapy, ozone therapy, or hyperbaric oxygen therapy. all interventions were performed after the consultation of oncologist or physician. results. in our experience, conservative surgical treatment is associated with the highest number of bronj healed sites in stage i disease. complete healing was observed in 92.6% of sites surgically treated. conclusions. this study confirms that treatment of patients affected by minimal bone exposition, (stage i of bronj), through conservative surgical strategies, possibly with laser, may result in a high control of the disease in the long term. |
preanalytical problems are the major source of laboratory errors, accounting for 6070% of total errors encountered within the total testing process. preanalytical errors not only may lead to spurious test results, but also, more importantly, may influence patient care, even dramatically. the immunosuppressive drugs tacrolimus (tac) and cyclosporine a (csa) are used in organ transplantation. these drugs are calcineurin inhibitors that block interleukin-2 (il-2) transcription and t lymphocyte signal transduction. they are used for prophylaxis against tissue rejection after liver, heart, and kidney transplantation. in addition, csa is used in the treatment of graft - versus - host reactions, in severe psoriasis, and after bone marrow transplantation. tac is a lipophilic drug that has variable absorption and is extensively metabolized in the liver [4, 5 ]. approximately 95% of tac is eliminated by the biliary route, while 5% is excreted unchanged in the urine. csa is a substrate of the p - glycoprotein (abcb1) efflux transporter and primarily metabolized by cyp3a4 and cyp3a5. it is nephrotoxic and causes damage to the kidney vasculature, glomerulus, and proximal tubule at high dose. csa and tac cause numerous side effects, including neurological, hepatic, renal, and immunological complications. dose adjustment or discontinuation may be necessary, because these complications occur in a significant number of patients [9, 10 ]. a significant consequence of overdosage of csa and tac is nephrotoxicity, while underdosage of these drugs can result in transplant rejection. therefore, in order to reduce the risk of organ rejection and toxicity, therapeutic drug monitoring plays a key role in maintaining therapeutic blood levels of these drugs. immunoassays methods (such as microparticle enzyme immunoassay and cloned enzyme donor immunoassay) and liquid chromatography based methods (such as high - performance liquid chromatography (hplc) with ultraviolet detection, lc - mass spectrometry (lc - ms), and lc - tandem mass spectrometry (lc - ms / ms)) are used for determination of concentrations of immunosuppressive drugs. overestimation of concentrations is a major problem because cross reactions can occur with some metabolites. the lc - ms / ms method is more sensitive and specific than immunological methods and has significant advantages over other methods. therefore this method is considered to be the gold standard in therapeutic drug monitoring [1315 ]. these drug levels are not analyzed in every hospital laboratory, but rather the samples are transferred to laboratories in other cities. therefore samples can not be analyzed immediately. it is known that prolonged storage time and inappropriate temperature may cause incorrect results for many analyses. in this study, we investigated the effect of storage time and temperature on drug concentrations in whole blood samples in order to determine the optimal storage conditions for accurate measurement of these drugs. the research protocol was approved by the local ethics committee of dicle university school of medicine. blood samples from 15 patients using tac and 15 patients using csa were included in the study. nine patients using tac had received kidney transplants, and the 6 patients had received liver transplants. all the patients using csa were patients who had received kidney transplants. patients using any other drug were excluded from the study. blood samples (2 ml) were drawn into k2edta tubes (becton dickinson company, usa) from the subjects in the morning after an overnight fast and were transferred to laboratory within 1 minute. the second aliquot was immediately analyzed and kept for 24 hours at room temperature (24c26c) and measured again. the third aliquot was kept at + 4c and analyzed 24 and 48 hours later. 0.1 m znso4 precipitation solution containing the internal standards cyclosporin d (1234/1217) and ascomycin (809.6/756.6) was prepared before sample preparation. whole blood samples were put into a tube as 100 l volume and 300 l precipitation reagent was added. after vortexing for additional 5 sec, the tubes were centrifuged for 10 minutes at 10000 rpm at 4c. three level quality control serums (qcs) were purchased from utak (valencia, ca). the lc - ms / ms was performed using an ionics 3q 120 triple quadrupole mass spectrometer (bolton, on canada) with a shimadzu ultra - fast liquid chromatograph (uflc) system. 20 l of supernatant was loaded on a porous r1/20 pretreatment column (30 2.1 mm) for on - line washing with water for 0.25 minutes at a liquid flow rate of 3 ml / min and then eluted by an imtakt cadenza cd - c18ht analytical column (50 2.0 mm, 3 m) at flow rate of 0.6 ml / min using solvent a (water : methanol = 98 : 2, v / v, with 0.1% formic acid and 10 mm ammonium acetate) and solvent b (water : methanol = 2 : 98, v / v, with 0.1% formic acid and 10 mm ammonium acetate). the sensitivity of tac and csa was 0.1 ng / ml and 1.0 ng / ml respectively. repeated measurements made from the same samples kept at different storage conditions were tested using the wilcoxon test. we did not find a significant difference between samples analyzed immediately and those kept at + 4c for 24 hours (p = 0.241) (percent change 13.78%) and 48 hours (p = 0.285) (percent change 10.4%), and there was no significant difference between samples analyzed immediately and those stored at 20c for one month (p = 0.646) (percent change 0.91%). however, there was a significant difference between samples analyzed immediately and those kept at room temperature for 24 hours (p = 0.005) (percent change 32.89%) (figure 1). cyclosporine a. we found significant differences between csa samples that were immediately analyzed and those stored under different conditions (figure 2). the results of the samples that were kept at + 4c for 24 hours (p = 0.003) (percent change 19.47%) and 48 hours (p = 0.002) (percent change 15.38%) and those kept at room temperature (p = 0.011) (percent change 9.71%) for 24 hours were significantly different. however, there was no significant difference between samples analyzed immediately and samples that were stored at 20c for one month (p = 0.173) (percent change 3.82%). in this study we evaluated the effects of different storage conditions on the detected concentrations of tac and csa that were measured in the same samples. our results showed that the stability of tac was affected by storage at room temperature for 24 hours (p = 0.005), but the samples were stable if they were stored at + 4c for one day or two days, or at 20c for 1 month (p = 0.241, p = 0.285, and p = 0.646, resp.). however, csa levels were decreased in the samples that were kept at room temperature for one day or two days and in the samples that were kept at + 4c for 1 day (p = 0.003, p = 0.002, and p = 0.011, resp.) therefore, the drug levels of samples that are left at room temperature and not stored properly will be inaccurate. organ transplant recipients must take immunosuppressant drugs to prevent rejection. to maximize drug efficacy and minimize adverse events, accurate measurements of blood immunosuppressant concentrations and dose adjustments are important. therapeutic drug monitoring must deliver a sensitive and accurate measurement of an administered drug to be a successful diagnostic instrument in patient care. therefore, the optimization of sample processing especially the run - time and storage conditions in the preanalytical period is important for the accuracy of measurements. taylor and sethi evaluated 27 biochemical analytes in their study and determined that some results of biochemical parameters changed in different conditions and storage time. reported that tumor markers (afp, cea, and ca125) are significantly affected by long - term frozen storage. however in another study repeated freezing to 70c and thawing had no meaningful effects at the plasma and serum concentrations of hormones. stored 6 whole blood samples at room temperature, + 4c and 20c for one week, and they observed that there was no change in the levels of tac. specimens were analyzed on the day of collection and repeatedly for nine to 13 days after storage at room temperature (2024c) and 37c with radioimmunoassay method and they observed no significant difference at the results. using 21 tac and 13 csa specimens stored the samples at ambient temperature and + 4c for 7 days and reported that there was no decrease in csa concentrations over a seven - day period for specimens stored at either ambient temperature or + 4c, while the concentrations of tac in whole blood stored at ambient temperature for seven days had a slight downward trend (a mean decrease of 5%). the methods were fluorescence polarization immunoassay (fpia) for csa and monoclonal antibody microparticle enzyme immunoassay for tac. observed that concentrations of tac were stable at room temperature, + 4c, and 70c for the two - week study period in their study using the microparticle enzyme immunoassay method. they also reported that the samples stored at 70c for almost one year and then reanalyzed were found to be stable. in our study, we observed that the stability of tac did not change over a two - day period for samples stored at + 4c or a one month period at 20c (table 1). however, concentrations of tac were decreased in samples that were left out at room temperature. they were unstable when they were kept at room temperature or + 4c (table 1). we used lc - ms / ms in our study because it is a rapid, specific, sensitive, and accurate reference method. studies showed that lc - ms / ms had significant reproducibility and accuracy advantages compared to fluorescence polarization immunoassay, microparticle enzyme immunoassay, and conventional hplc - uv methods for the quantitation of tac and csa concentrations in whole blood [26, 27 ]. based on these results, to accurately determine the level of csa samples should be measured immediately or stored at 20c until analysis. in conclusion, the stability of tac and csa depends on storage conditions, which must be considered for accurate measurement. furthermore, these findings can give an idea about the conditions under which the serum samples should be kept for tac and csa measurement. | tacrolimus and cyclosporine a are immunosuppressant drugs with narrow therapeutic windows. the aim of this study was to investigate the stability of tacrolimus and cyclosporin a levels in whole blood samples under different storage conditions. whole blood samples were obtained from 15 patients receiving tacrolimus and 15 patients receiving cyclosporine a. samples were immediately analyzed and then stored at different conditions (room temperature (24c26c) for 24 hours, + 4c for 24 and 48 hours, and 20c for one month) and then analyzed again. for tacrolimus, there was a significant difference between samples analyzed immediately and those kept 24 hours at room temperature (p = 0.005) (percent change 32.89%). however, there were no significant differences between the other groups. for cyclosporine a, there was a significant difference between samples analyzed immediately and those kept 24 hours (p = 0.003) (percent change 19.47%) and 48 hours (p = 0.002) (percent change 15.38%) at + 4c and those kept 24 hours at room temperature (p = 0.011) (percent change 9.71%). samples of tacrolimus should be analyzed immediately or stored at either + 4c or 20c, while samples of cyclosporine a should be analyzed immediately or stored at 20c. |
a group of 14 university hospitals participated in this study and 72 patients were recruited between 1992 and 2006. individuals with confirmed hnf1a - mutated hca who underwent curative resection of the tumor(s) were eligible for inclusion in this study. the mean age of the patients was 37.5 years (ranging from 14 to 66 years), and there were only seven male patients. among the women studied, 71% (34 of 48) had a history of oral contraception use, and 17 patients were missing this data. there were 89 hnf1a - mutated hca samples from 72 patients, although 44 samples had been reported previously (8). in 10 patients with multiple and sporadic tumors, different somatic hnf1a mutations were observed in the genotyped nodules. for all patients, a representative part of the hca nodule, as well as of the nontumor liver when it was available, was immediately frozen in liquid nitrogen and stored at 80c until used for molecular studies. the ethical committee of the saint - louis hospital (paris, france) approved the overall design of the study. in all 89 tumors, we sequenced the hnf1a gene using direct sequencing of the exons on genomic dna or rt - pcr to identify mutation, as previously described (5). all identified mutations (tables 1 and 2) were confirmed by two independent pcr amplifications of genomic dna from tumor, and corresponding nontumor tissues were systematically sequenced to search for germline mutations. in samples with mutations affecting splicing sites, we characterized the transcripts by sequence analysis of the mrna transcripts. in 37 h - hca, the coding exons of myh (exons 116) and ogg1 (exons 17) were screened for mutations by direct sequencing of pcr products. oligonucleotides used for all pcr reactions and experimental conditions are listed in supplementary tables 1 and 2 available in an online appendix at http://care.diabetesjournals.org/cgi/content/full/db09-1819/dc1. allelic frequency of an ogg1 polymorphism observed in h - hca was compared with those obtained in a control group of non - hnf1a - mutated hepatocellular tumors (58 samples) as previously described (13) and presented in supplementary table 3 (available in an online appendix). biallelic hnf1 mutations identified in hca cases of hca were previously described in bluteau. mody3 mutations were previously described in ellard and colclough (25) or bellann - chantelot. del, deletion ; fs, frameshift ; ivs, intervening sequence ; loh, loss of heterozygosity ; ins, insertion ; nm, nonmutated. germline hnf1 mutations in monoallelic mutated hca cases of hca were previously described in bluteau. mody3 mutations were previously described in ellard and colclough (25) or bellann - chantelot. total rna was extracted using the rneasy kit (qiagen, valencia, ca) from all frozen samples of available hca and nontumor liver tissues. rna isolated from 16 h - hca and 24 nontumor tissue samples was deemed to be of acceptable quality for quantitative rt - pcr experiments (23). specific assays for myh (hs01014866_g1), ogg1 (hs00213454m1), ape1 (hs00172396_m1), pol (hs00160263_m1), fabp1 (hs00155026_m1), ugt2b7 (hs00426592_m1), and r18s (rrna, hs99999901_s1) were obtained from applied biosystems (foster city, ca). the relative amount of target gene mrnas was determined using the 2 method (24). the values obtained for fabp1 and ugt2b7 were expressed as the n - fold ratio of the gene expression in a tested sample as compared with the mean of 11 nontumor tissues. only six nontumor tissues from patients with a h - hca were used with the myh, ogg1, ape1, and pol assays. the values obtained were compared with the mean of seven nontumor tissues from patients with a non - hnf1a mutated hca. western blot analyses were performed as described (9) using two primary goat polyclonal anti - hnf1 antibodies (santa cruz biotechnology), one detecting the amino terminus, and the other detecting the carboxy terminus of the protein (sc-6548 and sc-6547, respectively), used at the dilution 1:500. after centrifugation at 8,000 g for 10 min, the supernatant was assessed for reduced and total glutathione content with an apogsh glutathione colorimetric assay kit (biovision, mountain view, ca), following the manufacturer 's protocol. formalin - fixed, paraffin - embedded sections (5 m) were mounted on glass slides. sections were deparaffinized in xylene, rehydrated in a series of graded alcohol concentrations, and placed in pbs with 0.1% tween 20. immunostaining was performed using a dako envision system horseradish peroxidase (dako cytomation, carpinteria, ca) kit using primary antibody (1:2,000 dilution in pbs containing 1% bsa, incubated overnight at 4c) against 4-hydroxynonenal protein adducts (alpha diagnostics, san antonio, tx). statistical analysis was performed using graphpad prism software (version 4, graphpad software, san diego, ca). allelic frequencies of the ogg1 polymorphism in h - hca and the group control were compared using contingency tables with a fisher exact test. in all 89 tumors, we sequenced the hnf1a gene using direct sequencing of the exons on genomic dna or rt - pcr to identify mutation, as previously described (5). all identified mutations (tables 1 and 2) were confirmed by two independent pcr amplifications of genomic dna from tumor, and corresponding nontumor tissues were systematically sequenced to search for germline mutations. in samples with mutations affecting splicing sites, we characterized the transcripts by sequence analysis of the mrna transcripts. in 37 h - hca, the coding exons of myh (exons 116) and ogg1 (exons 17) were screened for mutations by direct sequencing of pcr products. oligonucleotides used for all pcr reactions and experimental conditions are listed in supplementary tables 1 and 2 available in an online appendix at http://care.diabetesjournals.org/cgi/content/full/db09-1819/dc1. allelic frequency of an ogg1 polymorphism observed in h - hca was compared with those obtained in a control group of non - hnf1a - mutated hepatocellular tumors (58 samples) as previously described (13) and presented in supplementary table 3 (available in an online appendix). biallelic hnf1 mutations identified in hca cases of hca were previously described in bluteau. mody3 mutations were previously described in ellard and colclough (25) or bellann - chantelot. del, deletion ; fs, frameshift ; ivs, intervening sequence ; loh, loss of heterozygosity ; ins, insertion ; nm, nonmutated. germline hnf1 mutations in monoallelic mutated hca cases of hca were previously described in bluteau. mody3 mutations were previously described in ellard and colclough (25) or bellann - chantelot. total rna was extracted using the rneasy kit (qiagen, valencia, ca) from all frozen samples of available hca and nontumor liver tissues. rna isolated from 16 h - hca and 24 nontumor tissue samples was deemed to be of acceptable quality for quantitative rt - pcr experiments (23). specific assays for myh (hs01014866_g1), ogg1 (hs00213454m1), ape1 (hs00172396_m1), pol (hs00160263_m1), fabp1 (hs00155026_m1), ugt2b7 (hs00426592_m1), and r18s (rrna, hs99999901_s1) were obtained from applied biosystems (foster city, ca). the relative amount of target gene mrnas was determined using the 2 method (24). the values obtained for fabp1 and ugt2b7 were expressed as the n - fold ratio of the gene expression in a tested sample as compared with the mean of 11 nontumor tissues. only six nontumor tissues from patients with a h - hca were used with the myh, ogg1, ape1, and pol assays. the values obtained were compared with the mean of seven nontumor tissues from patients with a non - hnf1a mutated hca. western blot analyses were performed as described (9) using two primary goat polyclonal anti - hnf1 antibodies (santa cruz biotechnology), one detecting the amino terminus, and the other detecting the carboxy terminus of the protein (sc-6548 and sc-6547, respectively), used at the dilution 1:500. after centrifugation at 8,000 g for 10 min, the supernatant was assessed for reduced and total glutathione content with an apogsh glutathione colorimetric assay kit (biovision, mountain view, ca), following the manufacturer 's protocol. formalin - fixed, paraffin - embedded sections (5 m) were mounted on glass slides. sections were deparaffinized in xylene, rehydrated in a series of graded alcohol concentrations, and placed in pbs with 0.1% tween 20. immunostaining was performed using a dako envision system horseradish peroxidase (dako cytomation, carpinteria, ca) kit using primary antibody (1:2,000 dilution in pbs containing 1% bsa, incubated overnight at 4c) against 4-hydroxynonenal protein adducts (alpha diagnostics, san antonio, tx). statistical analysis was performed using graphpad prism software (version 4, graphpad software, san diego, ca). allelic frequencies of the ogg1 polymorphism in h - hca and the group control were compared using contingency tables with a fisher exact test. among 89 hca samples with hnf1a alteration, mutations and deletion were biallelic in 84 (94%) samples. to further analyze the spectrum of hnf1a mutations, we included 151 hnf1a alterations with a firm somatic origin identified in 75 different hcas ; in contrast, all samples with a proven or highly suspected germline mutation were excluded from this first analysis (fig.. a : spectrum of 136 somatic hnf1a mutations observed in 75 hca samples (top) and in 364 mody3 individuals (bottom) (data from ellard and colclough)., in - frame deletion ;, in - frame duplication ;, mutation in splicing site. hca () and mody3 () histograms represent the percentage of total mutations observed in each domain ; substitutions and stops are represented in the upper part and the lower part, respectively. significant differences between hca and mody3 individuals are indicated : 0.05 > p > 0.01 ; 0.01 > p > 0.001 ; p t or ivs11 g > t mutations. b : ivs2 + 1 g > a or ivs2 + 1 del 13 bp mutations. the hnf1 transcription factor regulates expression of several key liver genes, including ugt2b7 and fabp1 (16,18). indeed, a shutdown of mrna expression for these target genes was observed in all patients with hcas tested with biallelic hnf1a mutations, as previously reported (4). an effect of monoallelic hnf1 mutants on expression of ugt2b7 and fabp1 has not been previously examined in liver tissues. our data show that monoallelic mutations did not affect expression of fabp1 and ugt2b7, which is not in favor of a dominant - negative effect (fig. however, these results can not completely exclude a subtle dosage effect or a low dominant effect. in contrast to other solid tumors, point mutations were much more frequent in hca than were chromosome deletions. the latter were found in only 10% of the patients with hcas. among the point mutations in hca, we analyzed the proportion of different hnf1a nucleotide changes and found that g - to - t transversions, accounting for 36% of the cases, were the most common type (fig. 4a). moreover, the distribution of nucleotide substitution subtypes in h - hca was strikingly different from that in mody3 (fig. 4b) but very similar to a spectrum of mutations known to be induced by genotoxic events, that is, in tp53-mutated lung cancers in smokers (fig. 4c) (26). in addition, when the hnf1a nucleotide substitutions were partitioned between the two dna strands, we observed that g - to - t transversions were significantly more frequent on a nontranscribed strand (p = 0.01) (fig. 4d). taking these results together, we suggest that hnf1a somatic mutations showed a typical spectrum of mutations induced by the genotoxic exposure targeting a specific nucleotide sequence. comparison of the mutation profiles in h - hca (67 transversions and transitions, a), mody3 (229 transversions and transitions, b), and tp53-mutated lung cancers (311 transversions and transitions, c) and smokers (26) (d). repartitioning of transition and transversion mutations between the transcribed and the nontranscribed strands in h - hca. black and white histograms indicate the number of nucleotide substitutions on the nontranscribed and the transcribed strand, respectively. significant (p = 0.01) elevation in g - to - t transversions on the nontranscribed strand. because both direct dna damage by an environmental agent and oxidative stress are known to result in g - to - t transversion mutations (27,28), we also assessed oxidative stress markers in nontumor liver from six patients with h - hca and seven patients with non - hnf1a mutated hca (supplementary fig. we observed no difference in total or reduced glutathione content, expression of four base excision dna repair genes, markers of oxidative dna damage (29), or 4-hydroxynonenal protein adducts, a marker of lipid peroxidation (supplementary fig. these data showed a lack of evidence for elevated oxidative stress in livers of patients with h - hca as a potential source of dna mutations. in addition, it is possible that a large number of g - to - t transversions could be caused by inefficient repair of dna damage due to mutations or polymorphisms in myh and ogg1, genes involved in the repair of 8-hydroxyguanine (3032). thus, we sequenced myh and ogg1 dna in 37 subjects with an hnf1a - mutated hca, and no mutations were detected in either gene. a known functional polymorphism in ogg1 (s326c) was detected in hnf1a - mutated hca subjects, albeit there was no difference in the frequency of this polymorphism compared with that in control subjects (supplementary table 3, available in an online appendix). among 89 hca samples with hnf1a alteration, mutations and deletion were biallelic in 84 (94%) samples. to further analyze the spectrum of hnf1a mutations, we included 151 hnf1a alterations with a firm somatic origin identified in 75 different hcas ; in contrast, all samples with a proven or highly suspected germline mutation were excluded from this first analysis (fig.. a : spectrum of 136 somatic hnf1a mutations observed in 75 hca samples (top) and in 364 mody3 individuals (bottom) (data from ellard and colclough)., in - frame deletion ;, in - frame duplication ;, mutation in splicing site. hca () and mody3 () histograms represent the percentage of total mutations observed in each domain ; substitutions and stops are represented in the upper part and the lower part, respectively. significant differences between hca and mody3 individuals are indicated : 0.05 > p > 0.01 ; 0.01 > p > 0.001 ; p t or ivs11 g > t mutations. b : ivs2 + 1 g > a or ivs2 + 1 del 13 bp mutations. the hnf1 transcription factor regulates expression of several key liver genes, including ugt2b7 and fabp1 (16,18). indeed, a shutdown of mrna expression for these target genes was observed in all patients with hcas tested with biallelic hnf1a mutations, as previously reported (4). an effect of monoallelic hnf1 mutants on expression of ugt2b7 and fabp1 has not been previously examined in liver tissues. our data show that monoallelic mutations did not affect expression of fabp1 and ugt2b7, which is not in favor of a dominant - negative effect (fig., these results can not completely exclude a subtle dosage effect or a low dominant effect. in contrast to other solid tumors, point mutations were much more frequent in hca than were chromosome deletions. the latter were found in only 10% of the patients with hcas. among the point mutations in hca, we analyzed the proportion of different hnf1a nucleotide changes and found that g - to - t transversions, accounting for 36% of the cases, were the most common type (fig. 4a). moreover, the distribution of nucleotide substitution subtypes in h - hca was strikingly different from that in mody3 (fig. 4b) but very similar to a spectrum of mutations known to be induced by genotoxic events, that is, in tp53-mutated lung cancers in smokers (fig. 4c) (26). in addition, when the hnf1a nucleotide substitutions were partitioned between the two dna strands, we observed that g - to - t transversions were significantly more frequent on a nontranscribed strand (p = 0.01) (fig. 4d). taking these results together, we suggest that hnf1a somatic mutations showed a typical spectrum of mutations induced by the genotoxic exposure targeting a specific nucleotide sequence. comparison of the mutation profiles in h - hca (67 transversions and transitions, a), mody3 (229 transversions and transitions, b), and tp53-mutated lung cancers (311 transversions and transitions, c) and smokers (26) (d). repartitioning of transition and transversion mutations between the transcribed and the nontranscribed strands in h - hca. black and white histograms indicate the number of nucleotide substitutions on the nontranscribed and the transcribed strand, respectively. significant (p = 0.01) elevation in g - to - t transversions on the nontranscribed strand. because both direct dna damage by an environmental agent and oxidative stress are known to result in g - to - t transversion mutations (27,28), we also assessed oxidative stress markers in nontumor liver from six patients with h - hca and seven patients with non - hnf1a mutated hca (supplementary fig. 2, available in an online appendix). we observed no difference in total or reduced glutathione content, expression of four base excision dna repair genes, markers of oxidative dna damage (29), or 4-hydroxynonenal protein adducts, a marker of lipid peroxidation (supplementary fig. these data showed a lack of evidence for elevated oxidative stress in livers of patients with h - hca as a potential source of dna mutations. in addition, it is possible that a large number of g - to - t transversions could be caused by inefficient repair of dna damage due to mutations or polymorphisms in myh and ogg1, genes involved in the repair of 8-hydroxyguanine (3032). thus, we sequenced myh and ogg1 dna in 37 subjects with an hnf1a - mutated hca, and no mutations were detected in either gene. a known functional polymorphism in ogg1 (s326c) was detected in hnf1a - mutated hca subjects, albeit there was no difference in the frequency of this polymorphism compared with that in control subjects (supplementary table 3, available in an online appendix). in this study we analyzed the spectrum of hnf1a mutations in hca and showed a significant difference in pattern in comparison with individuals with mody3, both at the nucleotide and amino acid levels. in hca, location of the mutations is very restricted because almost all of the truncating mutations led to the loss of the transactivation domain and the missense mutations altered mainly the pou - h domain. when we take into account the two largest series of hnf1a screening in mody3 (21,25), only 48% of the germline mutations (117 of 720 are missense mutations in pou - h, and 227 of 720 are truncating mutations localized in the first 291 amino acids) fit the features of the hnf1a somatic mutations. this observation suggests that only a part of hnf1a mutations that are associated with diabetes could predispose to the development of a h - hca. previous analysis of the mody3 mutations showed that the age at onset of diabetes is modulated according to the position of the mutation relative to the hnf1a isoforms : missense mutations located in exons 7 to 10 that affect only a or b isoforms of hnf1a are associated with the late onset of diabetes (21,22). interestingly, these mutations are predicted to have a less severe effect on the hnf1 function and are not found in hca. similarly, we can hypothesize that frequent mody3 missense mutations located outside the pou - h domain and mutations truncating hnf1 after codon 291 are possibly less inactivating than the mutations found in hca. in contrast to mody3, in hca the lack of mutations leading to amino acid substitution in pou - s suggests that the pou - s and pou - h domains are functionally different. chi. (20) found that the pou - s domain interacts with the pou - h domain in the recognition and binding on promoter sequences ; however, the pou - s domain is not conserved in homeobox transcription factors outside the pou family. thus, based on the profile of the hnf1a mutations that occur in hca, it may be of interest to reanalyze clinical severity of the diabetes and putative associated phenotypes in patients with mody3, taking into the account only a premature stop before codon 291, missense restricted at pou - h, and mutations affecting splicing sites from exon 1 to 7. interestingly, among the five hcas with a monoallelic germline hnf1a mutation, three of them were inflammatory. we previously noted that inflammatory adenomas are associated with obesity (4), and the present observation raised the question of an association with mody3 and possibly with other subtypes of adenomas. we can hypothesize that according to the nature of their hnf1a germline mutation, patients with mody3 could be at risk of different subtypes of hca : mutations leading to a severe impaired hnf1 function predispose to the development of h - hca, whereas germline mutation with a mild functional consequence could predispose to inflammatory or - catenin activated hcas without a familial context. in consideration of the high risk of malignant transformation of the -catenin - activated hca, this observation could have important clinical consequences. our analysis of the expression of mutant hnf1 proteins in liver tissue did not reveal a detectable level of truncated proteins, and most of the mutated proteins were not expressed. moreover, mutations of both hnf1a alleles are required to observe a downregulation of the genes physiologically regulated by hnf1. these observations suggest that if a dominant - negative effect exists, as suggested by the in vitro analyses for particular hnf1a mutants (15), it is not sufficient to shut down activity of hnf1 in vivo. accordingly, other researchers (33,34), including harries. (35) showed that hnf1a transcripts harboring a premature termination codon (ptc) were less expressed in lymphoblastoid cells than the normal allele resulting from a nonsense - mediated mrna decay, which detects and degrades the transcripts with a ptc to prevent the synthesis of truncated proteins. in the present study, we observed a decrease of mrna expression for 16 of 21 different mutants leading to ptc (data not shown). altogether, in hepatocytes, a dominant - negative effect of an hnf1 mutant is unlikely in vivo. this study not only confirms, in a large series of adenomas, that the spectrum of hnf1a mutations in hca is different from that in individuals with mody3, it also supports the hypothesis that hnf1a mutations in hca arise because of a genotoxic mechanism. first, we observed a consistent hotspot mutation at the codon 206 of hnf1a in hca. hotspots of transversion identified in tumors without a repeated nucleotide sequence context were previously suggested to be a hallmark of an exposure to a genotoxic compound, such as an r249s mutation in the tp53 gene in hepatocellular carcinoma (hcc) associated with an exposure to the aflatoxin b1 mycotoxin (36,37). second, hainaut and pfeifer (26) showed that there is a significant difference in the pattern of tp53 mutations in lung cancers between smokers and nonsmokers, with a 30% frequency of g - to - t transversions in smoking - related lung cancer vs. 10% in non - smoking related lung cancer. the overabundance of g - to - t transversions in smoking - related lung cancers was consistent with the studies of dna damage and mutations due to benzo[a]pyrene and other cigarette smoke - derived carcinogens and their metabolites (38,39). our observation of an uneven distribution among hnf1a nucleotide substitutions in hca and high frequency of g - to - t transversions is in many ways similar to that in lung cancer caused by tobacco (fig. 4a). third, denissenko. (40) showed that the repair of benzo[a]pyrene diol epoxide adducts in the nontranscribed strand was slower than that in the transcribed strand and may explain the strand bias of transversions in cancer. similarly, we observed that g - to - t transversions were significantly localized to the nontranscribed strand in h - hca, an additional argument in favor of a genotoxic effect and, possibly, a presence of bulky dna adducts. we can hypothesize that it could be related to a particular genetic susceptibility and/or to an exposure to a specific toxic. according to the first hypothesis, we searched for mutations in ogg1 and myh, both genes specifically involved in the repair of 8-hydroxyguanine, a product of oxidative dna damage that can also lead to g - to - t transversions (3032). in addition, we did not observe a higher level of oxidative stress in the livers of patients with a h - hca. these results strongly suggest that exposure to an environmental agent appears to be the most likely event to explain the elevated rate of g - to - t transversions in h - hca. because hca occurrence is highly associated with oral contraception, we can hypothesize that estrogen exposure could play a role in this mechanism. this last hypothesis is supported by the facts that 1) the genotoxic activity of estrogen metabolites has been shown, particularly for catechol estrogens that may be oxidized to a reactive quinone capable of direct formation of dna adducts (41,42) ; and 2) germline heterozygous mutations of cyp1b1, a key metabolism enzyme responsible for the formation of hydroxylated and genotoxic metabolites of estrogen, contribute to the development of h - hca in women using hormonal contraception (13). in conclusion, when analyzing a large series of individuals with hcas, we observed a significant differences between hnf1a somatic mutations identified in those with hcas and the germline mutations identified in individuals with mody3. somatic mutations in hca predict a more inactivating profile, resulting in a complete loss of function of the protein when biallelic. moreover, we showed that the origin of the mutations might be the result of dna damage caused by a genotoxic agent, possibly resulting from the metabolism of estrogen that could also be associated with a genetic susceptibility that remains to be identified. | objectivematurity onset diabetes of the young type 3 (mody3) is a consequence of heterozygous germline mutation in hnf1a. a subtype of hepatocellular adenoma (hca) is also caused by biallelic somatic hnf1a mutations (h - hca), and rare hca may be related to mody3. to better understand a relationship between the development of mody3 and hca, we compared both germline and somatic spectra of hnf1a mutations.research design and methodswe compared 151 somatic hnf1a mutations in hca with 364 germline mutations described in mody3. we searched for genotoxic and oxidative stress features in hca and surrounding liver tissue.resultsa spectrum of hnf1a somatic mutations significantly differed from the germline changes in mody3. in hca, we identified a specific hot spot at codon 206, nonsense and frameshift mutations mainly in the nh2-terminal part, and almost all amino acid substitutions were restricted to the pou - h domain. the high frequency of g - to - t tranversions, predominantly found on the nontranscribed dna strand, suggested a genotoxic mechanism. however, no features of oxidative stress were observed in the nontumor liver tissue. finally, in a few mody3 patients with hnf1a germline mutation leading to amino acid substitutions outside the pou - h domain, we identified a different subtype of hca either with a gp130 and/or ctnnb1 activating mutation.conclusionsgermline hnf1a mutations could be associated with different molecular subtypes of hca. h - hca showed mutations profoundly inactivating hepatocyte nuclear factor-1 function ; they are associated with a genotoxic signature suggesting a specific toxicant exposure that could be associated with genetic predisposition. |
along with the increase in the prevalence of type 1 diabetes mellitus (t1 dm) the number of patients with chronic vascular complications will rise significantly [13 ]. many trials have also shown that the main determinants of the vessel damage in the course of diabetes are hyperglycemia and diabetes duration [79 ]. diabetic microangiopathy means worsening of the quality of life and causing disability in patients with t1 dm [10, 11 ]. it is particularly harmful when it concerns the youngest population, which often becomes debilitated already at the beginning of the adulthood. moreover, vascular complications are also seen in children and adolescents with t1 dm who suffer for more than 5 years, and the progression in this group is often more rapid than in adults [3, 12, 13 ]. in the oxford regional prospective study (orps), it has been shown that about 25% of children with t1 dm develop diabetic retinopathy within 5 years of the disease duration, but already as many as 60% and 80% after 10 years and 15 years, respectively. the results from our studies have also shown that after 5 years of diabetes duration, albuminuria was detected in 29% and nonproliferative retinopathy in 27% of children and adolescents with t1 dm [12, 14 ]. in the same study we have demonstrated that apart from the duration of diabetes, main factors influencing the development and progression of chronic vascular complications in children and adolescents with t1 dm are growth factors, including vascular endothelial growth factor (vegf) and angiogenin. however, tgf-1 has not yet been studied in this context. tgf-1 belongs to a group of factors responsible for growth, differentiation and migration of cells, creation and degradation of the extracellular matrix, and apoptosis [15, 16 ]. in addition, it stimulates the formation of blood vessels and participates in wound healing and repair by increasing the production of extracellular matrix proteins. however, its adverse activity has been shown in breast cancer, myocardial infarction, rheumatoid arthritis, osteoporosis, diabetic nephropathy, and retinopathy [1719 ]. this cytokine is present in five different isoforms, three of which, that is, tgf-1, tgf-2, and tgf-3, are coded by different genes. out of these the best known is tgf-1, produced by dendritic cells, leukocytes, and nk cells. despite extensive research on biology, genetics, and function of tgf-1, therefore, we have assumed that it would be worth evaluating serum levels of tgf-1 in different groups of children and adolescents, depending on the duration of t1 dm and the presence of vascular complications. thus, the aim of our study was to evaluate the relationship between serum tgf-1 levels and t1 dm duration in children and adolescents with t1 dm with and without vascular complications. one hundred and sixteen patients with t1 dm aged 13.3 3.9 years with diabetes duration of 9.7 3.6 years from the department and clinic of pediatrics, diabetology and endocrinology, medical university of gdask, were enrolled into the study. diabetes was diagnosed according to the polish diabetes association guidelines, which correspond with the guidelines of the american diabetes association [20, 21 ]. the inclusion criteria for children and adolescents into the group of patients with t1 dm were age less then 21 years, diabetes duration 2 years, normal arterial pressure (systolic and diastolic), and no other chronic diseases. none of the diabetic patients were taking medications other than daily doses of insulin (0.83 0.21 iu of insulin per day / kg of body weight). blood pressure was measured using a 24 h blood pressure monitoring (abpm) method. various sizes of the cuff were used according to age, weight, and arm circumference of the studied subjects. all the abpm reports which had less than 80% of technically correct measurements were excluded from the study. arterial hypertension was diagnosed when mean abpm values were above the 95th centile for the corresponding age, gender, and height. this included visual acuity tests, intraocular pressure and anterior segment estimation using the slit lamp (topcon sl-82, japan). after local administration of tropicamide (1% solution), the eye fundus was examined using the + 90 d lens (ocular instruments, usa). a digital camera (topcon imaginet 2000, japan) was used for the fluorescein angiography. the stage of retinopathy was diagnosed according to the guidelines of the international diabetic retinopathy division. twenty - four - hour urine collection was performed three times during the period of 6 months for the evaluation of the daily albumin excretion. the urinary albumin was measured with immunoturbidimetric assay using a tina - quant kit (boehringer mannheim gmbh, germany). albuminuria was diagnosed when at least two out of three urine samples displayed daily albumin excretion of between 30 and 299 mg/24 h, collected within 6 months from patients with well - controlled diabetes with no clinical or laboratory signs of ketoacidosis. glycated haemoglobin (hba1c) was measured with an immunoturbidometric method using a unimate 3 set (hoffmann - la roche ag, basel, switzerland). one hundred and sixteen patients with t1 dm were examined and divided into four groups based on the duration of diabetes. the control group consisted of 19 healthy children and adolescents (11 boys and 8 girls, age range 618 yrs). written informed consent was obtained from all the participants in the study, or from their parents or guardians. this study was approved by the ethics committee of the medical university of gdask, and the investigation was carried out in accordance with the principles of the declaration of helsinki as revised in 1996. the serum concentrations of tgf-1 were measured using the cytometric bead array (cba) as instructed by the manufacturer 's manual (plex flex single set, becton dickinson, usa). the samples were read in an lsr ii flow cytometer using facs diva software (becton dickinson, usa). prior to reading, the cytometer was calibrated using the calibration beads included in the test pack (cytometer setup beads). based on the fss / ss images, the beads were gated and fluorescence was read. the analysis was performed using an fcap array software (becton dickinson, usa). the data were screened for obvious data entry errors, missing values, and outliers. arithmetical means and standard deviations or 95% ci were used to describe continuous variables, whereas proportions were used for categorical variables. a multivariate logistic regression model was fitted to the data. during the model building phase first - order interactions between the covariates were assessed. only the interaction between serum tgf-1 concentrations and the duration of diabetes proved to be statistically significant and we assessed the marginal effects to improve the interpretation of the interaction of these two continuous covariates. all the statistical analyses were carried out using stata 11.0 (statacorp, texas, usa) statistical package. patients with t1 dm were 13.3 3.9 years old with the duration of diabetes of 9.7 3.6 years, mean arterial blood pressure of 86.0 8.0 mmhg, serum levels of hba1c 8.5 1.9%, and albumin excretion rate of 24 19 mg/24 h. the clinical and biochemical characteristics of patients with t1 dm are shown in table 1. the patients with t1 dm and the presence of microangiopathy (ma+) displayed statistically significant higher serum levels of tgf-1 (p < 0.001) as compared to the patients with t1 dm but without microangiopathy (ma). however, the patients with t1 dm but without microangiopathy had significantly higher serum tgf-1 concentrations compared to the control subjects (p < 0.001) (figure 1). in the patients with t1 dm the relative frequency of microangiopathy was 38.8% (45 cases, 95% ci : 29.8%47.8%). in order to study the association between the duration of t1 dm and the relevant variables we divided the former into four consecutive intervals. these intervals and data related to the frequency of microangiopathy are shown in table 2. we found 11 cases of isolated nephropathy, 8 cases of isolated retinopathy, and 26 cases where both nephro- and retinopathy were present. we noted a significant relationship between the duration of t1 dm and the concentrations of the tgf-1, but the hba1c levels did not differ significantly between the subgroups of diabetes duration (table 3, figures 2(a) and 2(b)). an initial multivariate logistic regression model was fitted to the data with all the relevant risk factors except for tgf-1. only the interaction between serum tgf-1 concentrations and the duration of diabetes proved to be statistically significant and was included into the final model (table 4). the final model showed to fit the data significantly better compared to the initial model ((2) = 11.5, p = 0.003). in order to estimate how tgf-1 influenced the occurrence of microangiopathy, given the significant interaction with the duration of dm we noted that the increase of tgf-1 was associated with a significant increase of the probability of microangiopathy but after the first 10 years of dm. in the following years of t1 dm duration this effect tended to be stronger (figure 3). for example, in the 15th year of dm, a 1 sd increase in tgf-1 concentration was associated with a.25 (i.e., 25%) increase in the probability of microangiopathy when remaining predictors were held constant. previous studies have shown that the development of vascular changes in the eyes and kidneys of patients with t1 dm result from many interrelated factors. apart from well - known biochemical and hemodynamic factors, particular attention has been drawn in t1 dm patients to the involvement of inflammatory factors through the production of cytokines, chemokines, and growth factors [4, 7, 2427 ]. despite the engagement of many research centers, the mechanisms leading to the development of diabetic microangiopathy in children and adolescents with t1 dm that is why further research is needed to solve the pending problem of chronic vascular complications in t1 dm patients. in the present study we have tried to evaluate the relationship between serum tgf-1 levels and the duration of t1 dm in children and adolescents. we have found significantly higher serum tgf-1 concentrations in children and adolescents with t1 dm and microangiopathy as compared with patients with t1 dm but no signs and symptoms of diabetic microangiopathy. however, we have found significantly higher serum tgf-1 in a group of patients with t1 dm but without microangiopathy as compared with the healthy control subjects. already at this stage of the study it was found that there is an increase of serum tgf-1 concentrations depending on the severity of microvascular complications in children and adolescents with t1 dm. in addition, we detected that the longer the duration of diabetes, the higher the concentration of tgf-1 in children and adolescents with t1 dm. the multivariate logistic regression model and the assessment of the marginal effect allowed to establish a relationship between various factors and the probability of microangiopathy. the interaction between serum tgf-1 concentrations and the duration of diabetes proved to be statistically significant and was included into the final model. we have shown that the increase of tgf-1 concentrations was an independent factor aggravating the likelihood of microvascular complications in our study group of children and adolescents with t1 dm. this effect was statistically significant in the patients with diabetes of at least 10 years duration. in the successive years of the disease, a further and even stronger effect of tgf-1 on the development and progression of diabetic microangiopathy was observed. for example, in the fifteenth year of diabetes duration, an increase in the serum tgf-1 concentrations by 1 sd was associated with a 25% increase in the probability of microangiopathy when the remaining predictors were held constant. what is more, in our recent study we established the limit for tgf-1 concentrations on the presence of diabetic retinopathy in children and adolescents with t1 dm. we suggest that in patients with t1 dm, tgf-1 levels may correlate with the degree of eye and kidney damage. similar results were obtained in the patients with t1 dm of over 10-year duration. a statistical correlation between diabetes duration and the severity of morphological changes in kidney biopsy has been shown. other researchers have shown higher intravitreal tgf-1 concentrations in adult t1 dm patients with pdr, which in turn may be associated with retinal angiogenesis and tissue fibrosis at the vitreoretinal interface. in summary, the results of our study indicate that serum tgf-1 levels are one of the factors that may have an impact on the progression of vascular complications in children and adolescents with t1 dm. | the aim of this study was to evaluate the relationship between serum transforming growth factor 1 (tgf-1) concentrations and the duration of type 1 diabetes mellitus (t1 dm) in children and adolescents. one hundred and sixteen patients with t1 dm and 19 healthy controls were examined. serum tgf-1 concentrations were measured using the cytometric bead array (cba). a positive association between the time of diabetes duration and higher serum tgf-1 concentrations was observed. similarly, the prevalence of microvascular complications, such as retinopathy and nephropathy, increased with the duration of diabetes. logistic regression analysis showed that serum tgf-1 concentrations and the duration of the disease are independent risk factors of microangiopathy development. higher serum tgf-1 concentrations were associated with a significant risk of microangiopathy development after 10 years of t1 dm duration. in the successive years of the disease, the effect was even stronger. the results of our study indicate that serum tgf-1 concentrations are one of the factors that may have an impact on the progression of vascular complications in children and adolescents with t1 dm. |
mesenchymal stromal cells, also referred to as mesenchymal stem cells (mscs), were first discovered in 1974. mscs are a heterogeneous group of cells mainly obtained from bone marrow (bm - msc), adipose tissue (adsc) and umbilical cord blood (ucb - msc). since the 90s, mscs have been investigated and used in cell - based therapies for several different human diseases. this extensive research has contributed identification of 3 main properties of mscs offering real potential in regenerative medicine : 1they are multipotent cells with the capacity to be differentiated in vitro and in vivo into diverse cells types including adipocytes, osteoblasts, hepatocytes, myoblasts and neuron - like cells ; 2they can be recruited to the damaged tissue by following chemotactic signals ; and 3they produce and secrete several factors into the extracellular space (cytokines, chemokines, growth factors, exosomes, microvesicles, mirna) that mediate their regenerative and immunomodulatory effects in the transplanted recipient. the number of registered clinical trials using mscs worldwide is increasing exponentially, and so is the promise of their use in daily clinical practice. at present, 588 msc - based clinical trials, either complete or ongoing, appear in the database of the us national institute of health, targeting different types of human diseases. these include : central nervous system diseases (12.5%), heart and blood diseases (10.5%), bone and cartilage diseases (10.5%), autoimmune diseases (8.5%) and liver diseases (5.4%). beneficial effects of msc - based therapies have been demonstrated in many diseases ; however, the degree of benefits in the outcomes is highly variable among individuals and not perdurable over time. in most cases, limitations in the clinical outcomes it is currently believed that even if a low count of transplanted cells are able to persist in the target tissue, they are able to mediate beneficial effects. this is explained by the repair mechanism by which mscs exert their actions. in recent years, it has been believed that mscs mediate tissue repair via a transdifferentiation process, whereby they graft, differentiate and become an integral part of the target tissue mediating regeneration. however, there has been a paradigm shift in this hypothesis, and it is currently accepted that after homing into the target tissue, mscs produce several humoral factors including cytokines and extracellular vesicles (which themselves contain many signaling peptides and receptors as well as mrna and mirna). the humoral factors secreted by mscs improve the function of the surrounding tissue and have actions in distant tissues as well, which ameliorate organ function without requiring transdifferenciation of the mscs. this paracrine hypothesis may contribute to explain why, even if the transplanted mscs reside in non - target tissues after grafting, they are still able to exert beneficial effects. based on these premises, current efforts have been made in order to enhance the survival of transplanted mscs as a priority for the treatment efficacy. if a small percentage of transplanted viable cells are able to persist in target tissues producing such beneficial effects, then increasing msc engraftment and survival seems critical for ameliorating the clinical efficacy of msc - based therapies. from the clinical point of view, some strategies have been proposed to improve cell survival and consequently, therapeutic efficacy. for instance, determination of the optimal time point for cell delivery ; optimization of methods for cell isolation and ex vivo expansion ; and evaluation of different delivery routes for msc administration (local vs. systemic). from the pre - clinical point of view, important advances in understanding the interactions between the target tissue and the transplanted mscs have been accomplished in the last decade, and these mainly relate to the mechanisms by which mscs are able to integrate in the receptor tissue. the gradual loss of organ function in almost all diseases is caused by the death of specialized cells in the tissue. this result corresponds to a variety of different malign episodes, among which the most frequent are ischemia / reperfusion, autoimmune responses or exposure to cytotoxic drugs including chemotherapeutic agents. in this context, an initial inflammatory response in the damaged tissue is characterized by increased oxidative stress, a remodelling of the extracellular matrix (ecm), and an increase in the release of chemokines to the blood flow. one of the best studied is cxcl12 or stromal cell - derived factor-1 (sdf-1), which is also involved in the homing of transplanted msc. homing is the capacity of infused cells to migrate to the injury tissue ; the migration process is classified in 3 stages : 1-chemotaxis / traffic, 2-rolling and transendothelial migration and finally and 3-integration into the parenchyma. regarding the first stage : msc express a broad range of chemokine receptors, including cxcr4 (receptor for sdf-1), which has a relevant role in msc homing. in addition, msc can express receptors for cytokines (il-6, pdgf, tgf-1, tnf-) and several growth factor receptors (igf-1r and vegfr), with their ligands being released in large quantities by damaged tissue during the inflammatory process. in the next stage, mscs interact with the endothelium through p - selectins expressed on endothelial cells, promoting msc recruitment. different surface proteins of mscs are also involved in this interaction, mainly from the integrin family. some of them are very late antigen-4 (vla-4), vascular cell adhesion molecule-1 (vcam-1) and intercellular cell adhesion molecules (icam), and they are required for the transendothelial migration phase. when msc are anchored to the endothelial cells, they express proteolytic enzymes such as metalloproteinases (mmps) in order to pass through the basal membrane and get into the parenchymal space. the third step needed to achieve msc integration into the target tissue requires the correct interaction between mscs and the ecm, and these are critical to allow cell survival and finally, the permanency of msc engraftment. the lack of cell adhesion due to inappropriate msc - ecm interaction induces an apoptotic process known as anoikis (greek word meaning homeless). ecm stimulates cell survival thorough integrin receptors activating intracellular signaling cascades such as the pi3k / akt and the mek / erk pathways. anoikis is responsible, at least in part, for the low percentage of msc engraftment of unprepared transplanted cells. other signals that decrease their survival derive from the hostile microenvironment of the target tissue, where a highly inflammatory and cytotoxic process is taking place, which aims at removing anything unnecessary in the affected area. in this review, we focus on describing different preconditioning strategies used to promote msc resistance to adverse microenvironments. we also cover the conditioning methodologies used to render the target tissue more receptive to transplanted msc (fig. 1). only the articles that demonstrated an enhanced cell engraftment by strategies conditioning mscs or the target tissues were included in this review. articles that reported a clinical benefit of the cell therapy without considering the transplanted cell engraftment were excluded. the experimental details of the described strategies were summarized and presented in table 1 (a and b). we propose that the combination of both approaches can be used to increase cell engraftment and consequently, to achieve long - term benefits of msc therapies. the red arrow represents the strategy used in clinical trials where untreated mscs have been transplanted into the target tissue in the host (hostile microenvironment symbolized as a bed of nails). blue arrows represent the strategies used in pre - clinic studies where mscs or target tissue received a preconditioning procedure to promote cell engraftment. abbreviations : esw, extracorporeal shock waves ; ipc, ischemic postconditioning ; utmd, ultrasound - target microbubble destruction. increasing tissue receptivity to mscs.amsc-resistance inductordisease animal modelmsc source / delivery route and time of administrationeffect on msc (mechanisms proposed)effect on transplant recipient (induction vs. control)grade of cell engraftment (induction vs. control) cell tracking methodreferenceshypoxia (1%, 24hs)idiopathic pulmonary fibrosis (ipf) induced by bleomycin (mice)bm - msc / intratracheal instillation, 3 days after ipf inductionhgf, vegf, ho-1collagen deposition4 fold, at 4 days / -galactosidase staining hif-1, bcl-2,inflammatory cytokines pulmonary function hypoxia (1%, 24hs)erectile dysfunction in dmt1 induced by streptozotocin (rat)adsc / intracavernous injection, 8 weeks after dmt1 induction hif-1, bfgf, vegf, ang-1collagen deposition1.5 fold, at 1 week / dii fluorescent dye sdf-1, cxr4intracavernosal pressure hypoxia (1%, 24hs)myocardial infarction (mice)bm - msc /intravenous injection 1 day after ami inductioncxr4infarct size2.5 fold, at 1 day after mi / gfp transduction cardiac function hdl(20200 g / ml, 24hs)myocardial infarction (rat)bm - msc /intramyocardial injection after 10 min of lad ligationactivation of pi3k / akt signaling pathwaycardiac function3 fold at 4 days after mi / gfp transductioncurcumin(10 m, 24hs)myocardial ischemia - reperfusion injury (rat)adsc / intramyocardial injections after 1 week of lad ligationactivation of pten / akt / p53 survival signaling pathwayinfarct size2 fold at 7 days after mi / dii fluorescent dye cardiac function neovascularization trimetazidine(10 m, 6hs)myocardial ischemia - reperfusion injury (rat)bm - msc / adsc / intramyocardial injections after reperfusion of lad ligation hif-1, bcl-2infarct size2 fold at 3 days after mi / cm - dii fluorescent dye cardiac function neovascularization atorvastatin(1 m, 24hs)myocardial infarction (rat)bm - msc / intravenous injection 1 day after mi inductioncxr4collagen deposition1.7 fold at 3 days after mi / cm - dii fluorescent dye infarct size inflammatory cytokines cardiac function melatonin(5 m, 24 hs)myocardial infarction (rat)adsc / intramyocardial injection after lad ligationactivation of srt1 and bcl-2 survival signaling pathwayinfarct size2.5 fold at 14 days after mi / bli collagen deposition cardiac function neovascularization mirna-133a (transient transfection, 50 nm)myocardial ischemia - reperfusion injury (rat)bm - msc / intramyocardial injection after lad ligationinhibition of apaf-1 / caspase 9 / caspase 3 apoptosis signaling pathwayinfarct size2 fold at 7 days after mi / iron oxide and prussian blue staining collagen deposition cardiac function prpcr (0.120%, 17 days)wound skin (rat)bm - msc / into wound margins after surgeryactivation of pi3k / akt / nf- signaling pathway% of wound closure1.2 fold during wound closure process / gfp transductionbtissue receptivity inductordisease animal modelmsc source / delivery route and time of administrationeffect on transplanted recipientmechanisms of cell engraftmentgrade of cell engraftment (induction vs. control) /cell tracking methodreferencesirradiation(x - ray, 15 gy)hepatic fibrosis induced by thioacetamide (rat)bm - msc / intravenous (portal vein) after irradiationcollagen depositiontgf-1, -sma and collagen i1.5 fold at 3 weeks post- transplantation / sry gene analysis inflammation status liver function utmddiabetic nephropathy induced by streptozotocin (rat)bm - msc / intravenous (tail vein) after microbubble injectioninflammation statusrenal interstitial capillary and vcam-1 expression 2 fold at 3 day post- transplantation / gfp transduction renal function esw (0.04 mj / mm at 1000 impulses)chronic spinal injury (rat)bm - msc / intravenous (tail vein) / 24hs post eswlocomotor activitysdf-1 and cxcr4 in tissue 1.3 fold at 4 weeks post- transplantation / pkh6 red fluorescence dyeipc(3 cycles, 30 s reperfusion and occlusion)lung ischemia - reperfusion injury (rat)bm - msc / intravenous injection after lung reperfusioninflammation statusoxidative stress damaged3 fold at 1 day post- transplantation / gfp transduction lung functionsdf-1 and vegf antioxidant enzymes remote ipc(4 cycles of 5 min reperfusion and occlusion)myocardial ischemia - reperfusion injury (rat)bm - msc / intravenous injection after 8 days of ischemia induction by lad ligationcardiac functionsdf-12 fold at 1 month post- transplantation / sry gene analysisremote ipc (3 cycles, 30 s reperfusion and occlusion)myocardial ischemia - reperfusion injury (rat)bm - msc / intramyocardial injection after ischemia induction by lad ligationcollagen depositionsdf-1 and vegf2 fold at 3 weeks post- transplantation / sry gene analysis cardiac functionantioxidant enzymes rosuvastatin(20mg / kg / day)myocardial infarction (mice)adsc / intramyocardial injection immediately after lad ligationcollagen depositionactivation of pi3k / akt and mek / erk signaling pathway in adsc 1.5 fold at 3 weeks post- transplantation / gfp - transduction and bli cardiac function bfgf (2 mg)myocardial infarction (canine)bm - msc / retrograde coronary venous infusion after 1 week of micollagen depositionneovascularization2 fold at 1 month post- transplantation / gfp - transduction infarct sizemsc in situ differentiation cardiac function summary of msc based strategies to improve cell engraftment. the red arrow represents the strategy used in clinical trials where untreated mscs have been transplanted into the target tissue in the host (hostile microenvironment symbolized as a bed of nails). blue arrows represent the strategies used in pre - clinic studies where mscs or target tissue received a preconditioning procedure to promote cell engraftment. abbreviations : esw, extracorporeal shock waves ; ipc, ischemic postconditioning ; utmd, ultrasound - target microbubble destruction. strategies to improve cell engraftment. ex vivo msc culture has been normally carried out under atmospheric oxygen tension (21% o2). in 2007, fehrer and colleagues demonstrated for the first time, that bm - msc (in their in vivo niche) proliferated with 1 - 7% oxygen. in fact, many studies have reported that manipulation of oxygen tension impacts during in vitro msc cultivation, has an effect on their properties in differentiation capacity, proliferation rate and secretome profiles. since transplanted msc will undergo hypoxia inside the inflamed tissue, the hypoxia stimulation, previous to transplant, has been investigated as a training strategy termed preconditioning, in order to improve the in situ cell survival. pre - treatment of bm - msc with hypoxia (1%) for 24 hrs. increased fourfold its engraftment in comparison to untreated cells in an animal model of idiopathic pulmonary fibrosis, improving pulmonary function and reducing tissue collagen content in the transplanted tissue. authors suggested that the enhancement of survival rate of engrafted bm - mscs is partially due to the up - regulation of hepatocyte growth factor (hgf). wang and colleagues reported that the intracavernous administration of hypoxia - preconditioned adsc (hp - adsc) was more efficient at reverting diabetic erectile dysfunction (measured by intracavernosal pressure) compared to administration of untreated adsc. a week after cell transplantation, the number of hp - adsc in the tissue was 50% higher compared to untreated adsc, probably due to the high gene expression of sdf-1 and cxcr4 inducted in adsc by hypoxic preconditioning. the beneficial effects of hypoxic preconditioning on bm - msc were also proved in an acute myocardial infarction murine model. engraftment of pre - treated bm - msc was 2.5 higher than untreated bm - msc after one day of its intravenous administration, reducing myocardial infarct size and decreasing cardiac damage. authors also suggest that high expression of cxcr4 in pre - treated bm - msc promoted cell survival in myocardial ischemic tissue. similar benefits of msc preconditioning have been observed in the homing and retention of human adipose tissue - derived mscs (hascs) after in vivo transplantation. preconditioning hascs increased their expression of cxcr4, which combined with exogenous sdf-1 delivery, allowed for further homing / retention of ascs after transplantation. importantly these results highlight that, in addition to msc preconditioning, increasing, the chemokine attraction profile of the target tissue contributes to msc retention. regarding clinical trials that explore the use of hypoxic preconditioning to enhance the stem cell therapeutic potential for myocardial repair, in 2015 hu and colleagues provided the first - in - man evidence that intracoronary administration of preconditioned - bone marrow mononuclear cells, following acute myocardial infarction, improves cardiac functional parameters without any adverse effect. antioxidants have also been used to protect mscs from the hostile microenvironment in the target tissue after transplantation. xu and colleagues investigated whether high - density lipoprotein (hdl) could protect bm - msc against oxidative stress - induced apoptosis. this study is based on the fact that hdl reduces the risk associated with cardiovascular ischemic disease, protecting endothelial cells from apoptosis induced by intracellular oxidative stress. after exposure of bm - msc to hdl (hdl - bmmsc), cells were administrated in the myocardium of an animal model of post - myocardial infarction recovery. cardiac function improvement and cell engraftment were significantly higher in the hdl - bmmsc based therapy than untreated bm - msc based therapy. in vitro studies suggested that hdl activated the antiapoptotic pi3k / akt signaling pathway. liu and colleagues demonstrated in an in vitro study that curcumin exposure activated the pro - survival signaling pathway pten / akt / p53 in adsc. indeed, cell therapy with curcumin - preconditioned adsc (c - adsc) was more efficient in attenuating myocardial damage compared with untreated adsc in a mouse model of ischemia - reperfusion injury. trimetazidine (tmz) is used to attenuate the consequence of myocardial ischemic - reperfusion injury in the clinical practice because tmz increases cell tolerance to ischemia by maintaining cellular homeostasis. preconditioning of bm - msc with tmz for 6 h induced the expression of hif-1. preconditioned cells exhibited a better engraftment capacity and therapeutic performance, increasing myocardial function and neovascularization after administration in an animal model of cardiac ischemia - reperfusion injury. statins are a group antilipidemic compounds that inhibit the enzyme hmg - coa reductase, which is involved in the production of cholesterol. however, statins have additional pleiotropic effects post - ischemia - reperfusion, including improvement of endothelial dysfunction, antioxidant properties and inhibition of inflammatory responses. for this reason, using statins is a common treatment in the clinical practices for the prevention of tissue injury after a heart or brain infarction. li and colleagues demonstrated that atorvastatin (at) preconditioning of bm - msc up - regulated cxcr4 expression, increasing cell survival and cardiac performance in an animal model of acute myocardial infarction. similarly ; melatonin, a neurohormone with anti - inflammatory and antioxidant properties, has been proved to exhibit cytoprotective effects against ischemic injury in the liver, kidneys, brain and the heart. han and colleagues demonstrated in a pre - clinic study that the pre - treatment of adsc with melatonin could facilitate adsc based therapy for myocardial infarction, possibly through promoting survival of adsc via sirt1 signaling. dua and colleagues demonstrated that epigenetic reprograming of mscs by micrornas previous to transplant rendered them more resistant to the hostile microenvironment. bm - msc were transfected with a double - stranded mir-133a, which is abundantly expressed in heart and is down - regulated in patients after myocardial infarction. apaf-1, a pro - apoptotic factor involved in intrinsic apoptosis is a target of mir-133a. bm - mscs transfected with mir-133a administered in an animal model of myocardial infarction led to a significant increase in cell engraftment, cardiac function, and decreased fibrosis compared to control bm - msc. because the processes of homing and engraftment depend on multiple variables, and their mechanisms are not fully understood, some researchers have tested a multiple stimulation / reprograming strategy to increase msc engraft capacity. platelet rich plasma (prp) has been used in human applications since the 1970s for its healing properties attributed to secreted proteins. peng and colleagues described that prp - preconditioning of bm - msc induced pi3k / akt / nf- signaling, enhancing cell survival and regenerative function in a wound healing murine model. cell - conditioned media has been used in vitro to investigate the stimuli (coming from the cellular microenvironment) that the transplanted cells receive inside the target tissue. smith and colleagues reported a cell culture - based approach to enhance hadsc engraftment in brain tumors by pre - exposing adsc to glioma - conditioned media and extracellular matrix proteins (fibronectin and laminin). this method contributes to educate the mscs in order to enhance their homing capacity and to specifically direct them to localized tumors. screening technology is a new approach to identify new molecules that could render mscs more resistant to a hostile microenvironment. recently, a novel method for screening small molecules that enhance homing of systemically administrated cells was developed. levy and colleagues screened 9000 signal transduction modulators to identify hits that increase msc surface expression of homing ligands that bind to intercellular adhesion molecule 1 (icam-1). preconditioned - mscs with ro-31 - 8425 exhibited increased homing into inflamed sites, and displayed improved anti - inflammatory properties in lipopolysaccharide - induced inflamed mouse ears. the examples presented here clearly point to the beneficial consequences of modulating mscs prior to transplantation, either via hypoxic preconditioning, drug treatment, ros attenuation, immunomodulation, chemotactic transformation and genetic programming (fig. 1). the approaches used to prepare the damaged tissue to promote the engraftment of transplanted cells are summarized in table 1b. shao and colleagues reported that regional hepatic irradiation with x - rays before bm - msc transplantation, ameliorated thioacetamide - induced liver fibrosis in rats. hepatic irradiation promoted homing of bm - msc, reducing the inflammatory status and increasing liver function. the ultrasound - target microbubble destruction (utmd) technique used to increase wall vessel permeability, favors the extravasation of cells into the parenchymal space. zhang and colleagues showed that utmd increased renal protection after intravenous administration of bm - msc, using an animal model of diabetic nephropathy. authors suggested that this protective effect is mediated by an enhancement of homing (via increasing capillary permeability) and retention of bm - msc (mediated by upregulation of vcam-1) into the kidneys. extracorporeal shock wave (esw) therapy is a non - invasive treatment for chronic tendinopathies. although the biological mechanism of this therapy is not clear, it appears to promote neovascularization and the removal of damaged ecm components. lee and colleagues described a beneficial effect on bm - msc engraftment after esw treatment in a chronic spinal cord injury rat model, presumably by up - regulation of sdf-1 and cxcr4 expression. regarding clinical studies, in the cellwave randomized clinical trial, a positive, albeit modest improvement was observed in left ventricular ejection fraction at 4 months after intracoronary infusion of bone marrow - derived mononuclear cells (bmc). patients with post - infarction chronic heart failure received esw 24 hrs before bmc transplantation. procedures to attenuate heart failure resulting from myocardial infarction have been investigated in animals and humans in the past decades. the most successful procedure to date, called post - conditioning, is based on the application of repeated vascular occlusion for brief periods at the onset of reperfusion after an ischemic event. recent studies demonstrated that ischemic post - conditioning (ipc) reduces reperfusion injury, described as cellular death induced by oxidative stress, increased inflammation levels and extracellular matrix remodeling. chen and colleagues combine, for the first time, icp with stem cell based therapy to prevent tissue damage after an ischemic episode. using an animal model of pulmonary ischemia reperfusion injury, they reported intravenous administration of bm - msc after ipc enhances pulmonary function and cell engraftment in the lungs. jiang and colleagues have also shown that remote conditioning (an alternative to conditioning where ischemia is applied to a distant tissue) enhanced cell retention and cardiac function in the myocardium after bm - msc transplantation in a myocardial ischemia - reperfusion animal model, suggesting that sdf-1 is a key molecule in the cell engraftment mechanism. in 2016, the same research group demonstrated that these beneficial effects were mainly attributed to the hospitable microenvironment for engrafted cells. as we mentioned above, statin administration attenuates the effects of an ischemic episode in the heart or the brain, mainly reducing the inflammation in the injured tissue. yang and colleagues reported that at, a member of the statin family, decreased the hostility of the cardiac microenvironment and facilitated survival of msc administration in a post - infarct in vivo model. moreover, zhang and colleagues reported that the combined therapy of rosuvastatin and mscs has a synergistic effect on improving myocardial function after infarction, improving the survival of engrafted adsc, at least in part, through the pi3k / akt and mek / erk 1/2 signaling pathways. the proliferative growth factor of b - fibroblasts (bfgf) promotes cell survival, migration and the differentiation capacity of bm - msc in vitro, and these abilities may improve bm - msc engraftment to target tissue. wang and colleagues observed that the co - administration of bfgf with bm - msc (by retrograde coronary venous infusion) in an animal model of myocardial infarction, enhanced bm - msc survival and differentiation, recovering cardiac function and preventing adverse remodelling. a summary or the reported findings in msc - based therapy in pre - clinic and clinical studies, in addition to our suggested strategy are summarized in figure 1. the first milestone to overcome during the development of msc therapy has been to guarantee the biosafety of their use in clinical trials. at present, consensus in the scientific community agrees that msc therapy is safe when its isolation, ex vivo expansion, and administration are made following good manufacturing practice (gmp) guidelines. the number of clinical studies evaluating the regenerative effect of mscs in multiple diseases is growing fast and therapeutic results are increasingly positive. however, concurrently, scientists have observed that the long - term benefit of msc therapy is restricted by the poor engraftment of transplanted cells. at present, the second milestone aims to achieve a stable msc - regenerative effect in the transplant host. the discovery of new mechanisms of cell homing and engraftment will present a stronger possibility to improve the interactions between transplanted cells and tissue cells, for instance, modulating the expression of adhesion and migration molecules in mscs. on the other hand, in order to prevent the difficulties of cell engraftment, researchers have also investigated the use of biomaterial to mimic the natural niche of mscs with encouraging results, particularly in bone and cartilage regeneration in order to draw msc - host tissue interactions. strategies of msc preconditioning or damaged tissue preconditioning have been successful in pre - clinic studies for different diseases, increasing the cell engraftment, the gain of tissue function and consequently, the efficacy of cell therapy. the successful use of statins for msc preconditioning or for damaged tissue preconditioning to increase the msc therapy efficacy in the treatment of myocardial infarction consequences after reperfusion suggests that even more powerful results of combined strategies may be achieved. therefore, we propose that using both complementary strategies will enable acceleration of the process to translate the experimental evidence from the pre - clinic studies to the daily clinical practice, reaching the next milestone (fig. 1). in addition, we call for more research in this area, in particular, we advocate research that includes various modalities of combining the strategies to produce excellent clinical results. ex vivo msc culture has been normally carried out under atmospheric oxygen tension (21% o2). in 2007, fehrer and colleagues demonstrated for the first time, that bm - msc (in their in vivo niche) proliferated with 1 - 7% oxygen. in fact, many studies have reported that manipulation of oxygen tension impacts during in vitro msc cultivation, has an effect on their properties in differentiation capacity, proliferation rate and secretome profiles. since transplanted msc will undergo hypoxia inside the inflamed tissue, the hypoxia stimulation, previous to transplant, has been investigated as a training strategy termed preconditioning, in order to improve the in situ cell survival. pre - treatment of bm - msc with hypoxia (1%) for 24 hrs. increased fourfold its engraftment in comparison to untreated cells in an animal model of idiopathic pulmonary fibrosis, improving pulmonary function and reducing tissue collagen content in the transplanted tissue. authors suggested that the enhancement of survival rate of engrafted bm - mscs is partially due to the up - regulation of hepatocyte growth factor (hgf). wang and colleagues reported that the intracavernous administration of hypoxia - preconditioned adsc (hp - adsc) was more efficient at reverting diabetic erectile dysfunction (measured by intracavernosal pressure) compared to administration of untreated adsc. a week after cell transplantation, the number of hp - adsc in the tissue was 50% higher compared to untreated adsc, probably due to the high gene expression of sdf-1 and cxcr4 inducted in adsc by hypoxic preconditioning. the beneficial effects of hypoxic preconditioning on bm - msc were also proved in an acute myocardial infarction murine model. engraftment of pre - treated bm - msc was 2.5 higher than untreated bm - msc after one day of its intravenous administration, reducing myocardial infarct size and decreasing cardiac damage. authors also suggest that high expression of cxcr4 in pre - treated bm - msc promoted cell survival in myocardial ischemic tissue. similar benefits of msc preconditioning have been observed in the homing and retention of human adipose tissue - derived mscs (hascs) after in vivo transplantation. preconditioning hascs increased their expression of cxcr4, which combined with exogenous sdf-1 delivery, allowed for further homing / retention of ascs after transplantation. importantly these results highlight that, in addition to msc preconditioning, increasing, the chemokine attraction profile of the target tissue contributes to msc retention. regarding clinical trials that explore the use of hypoxic preconditioning to enhance the stem cell therapeutic potential for myocardial repair, in 2015 hu and colleagues provided the first - in - man evidence that intracoronary administration of preconditioned - bone marrow mononuclear cells, following acute myocardial infarction, improves cardiac functional parameters without any adverse effect. antioxidants have also been used to protect mscs from the hostile microenvironment in the target tissue after transplantation. xu and colleagues investigated whether high - density lipoprotein (hdl) could protect bm - msc against oxidative stress - induced apoptosis. this study is based on the fact that hdl reduces the risk associated with cardiovascular ischemic disease, protecting endothelial cells from apoptosis induced by intracellular oxidative stress. after exposure of bm - msc to hdl (hdl - bmmsc), cells were administrated in the myocardium of an animal model of post - myocardial infarction recovery. cardiac function improvement and cell engraftment were significantly higher in the hdl - bmmsc based therapy than untreated bm - msc based therapy. in vitro studies suggested that hdl activated the antiapoptotic pi3k / akt signaling pathway. liu and colleagues demonstrated in an in vitro study that curcumin exposure activated the pro - survival signaling pathway pten / akt / p53 in adsc. indeed, cell therapy with curcumin - preconditioned adsc (c - adsc) was more efficient in attenuating myocardial damage compared with untreated adsc in a mouse model of ischemia - reperfusion injury. trimetazidine (tmz) is used to attenuate the consequence of myocardial ischemic - reperfusion injury in the clinical practice because tmz increases cell tolerance to ischemia by maintaining cellular homeostasis. preconditioning of bm - msc with tmz for 6 h induced the expression of hif-1. preconditioned cells exhibited a better engraftment capacity and therapeutic performance, increasing myocardial function and neovascularization after administration in an animal model of cardiac ischemia - reperfusion injury. statins are a group antilipidemic compounds that inhibit the enzyme hmg - coa reductase, which is involved in the production of cholesterol. however, statins have additional pleiotropic effects post - ischemia - reperfusion, including improvement of endothelial dysfunction, antioxidant properties and inhibition of inflammatory responses. for this reason, using statins is a common treatment in the clinical practices for the prevention of tissue injury after a heart or brain infarction. li and colleagues demonstrated that atorvastatin (at) preconditioning of bm - msc up - regulated cxcr4 expression, increasing cell survival and cardiac performance in an animal model of acute myocardial infarction. similarly ; melatonin, a neurohormone with anti - inflammatory and antioxidant properties, has been proved to exhibit cytoprotective effects against ischemic injury in the liver, kidneys, brain and the heart. han and colleagues demonstrated in a pre - clinic study that the pre - treatment of adsc with melatonin could facilitate adsc based therapy for myocardial infarction, possibly through promoting survival of adsc via sirt1 signaling. dua and colleagues demonstrated that epigenetic reprograming of mscs by micrornas previous to transplant rendered them more resistant to the hostile microenvironment. bm - msc were transfected with a double - stranded mir-133a, which is abundantly expressed in heart and is down - regulated in patients after myocardial infarction. apaf-1, a pro - apoptotic factor involved in intrinsic apoptosis is a target of mir-133a. bm - mscs transfected with mir-133a administered in an animal model of myocardial infarction led to a significant increase in cell engraftment, cardiac function, and decreased fibrosis compared to control bm - msc. because the processes of homing and engraftment depend on multiple variables, and their mechanisms are not fully understood, some researchers have tested a platelet rich plasma (prp) has been used in human applications since the 1970s for its healing properties attributed to secreted proteins. peng and colleagues described that prp - preconditioning of bm - msc induced pi3k / akt / nf- signaling, enhancing cell survival and regenerative function in a wound healing murine model. cell - conditioned media has been used in vitro to investigate the stimuli (coming from the cellular microenvironment) that the transplanted cells receive inside the target tissue. smith and colleagues reported a cell culture - based approach to enhance hadsc engraftment in brain tumors by pre - exposing adsc to glioma - conditioned media and extracellular matrix proteins (fibronectin and laminin). this method contributes to educate the mscs in order to enhance their homing capacity and to specifically direct them to localized tumors. screening technology is a new approach to identify new molecules that could render mscs more resistant to a hostile microenvironment. recently, a novel method for screening small molecules that enhance homing of systemically administrated cells was developed. levy and colleagues screened 9000 signal transduction modulators to identify hits that increase msc surface expression of homing ligands that bind to intercellular adhesion molecule 1 (icam-1). preconditioned - mscs with ro-31 - 8425 exhibited increased homing into inflamed sites, and displayed improved anti - inflammatory properties in lipopolysaccharide - induced inflamed mouse ears. the examples presented here clearly point to the beneficial consequences of modulating mscs prior to transplantation, either via hypoxic preconditioning, drug treatment, ros attenuation, immunomodulation, chemotactic transformation and genetic programming (fig. 1). the approaches used to prepare the damaged tissue to promote the engraftment of transplanted cells are summarized in table 1b. shao and colleagues reported that regional hepatic irradiation with x - rays before bm - msc transplantation, ameliorated thioacetamide - induced liver fibrosis in rats. hepatic irradiation promoted homing of bm - msc, reducing the inflammatory status and increasing liver function. the ultrasound - target microbubble destruction (utmd) technique used to increase wall vessel permeability, favors the extravasation of cells into the parenchymal space. zhang and colleagues showed that utmd increased renal protection after intravenous administration of bm - msc, using an animal model of diabetic nephropathy. authors suggested that this protective effect is mediated by an enhancement of homing (via increasing capillary permeability) and retention of bm - msc (mediated by upregulation of vcam-1) into the kidneys. extracorporeal shock wave (esw) therapy is a non - invasive treatment for chronic tendinopathies. although the biological mechanism of this therapy is not clear, it appears to promote neovascularization and the removal of damaged ecm components. lee and colleagues described a beneficial effect on bm - msc engraftment after esw treatment in a chronic spinal cord injury rat model, presumably by up - regulation of sdf-1 and cxcr4 expression. regarding clinical studies, in the cellwave randomized clinical trial, a positive, albeit modest improvement was observed in left ventricular ejection fraction at 4 months after intracoronary infusion of bone marrow - derived mononuclear cells (bmc). patients with post - infarction chronic heart failure received esw 24 hrs before bmc transplantation. procedures to attenuate heart failure resulting from myocardial infarction have been investigated in animals and humans in the past decades. the most successful procedure to date, called post - conditioning, is based on the application of repeated vascular occlusion for brief periods at the onset of reperfusion after an ischemic event. recent studies demonstrated that ischemic post - conditioning (ipc) reduces reperfusion injury, described as cellular death induced by oxidative stress, increased inflammation levels and extracellular matrix remodeling. chen and colleagues combine, for the first time, icp with stem cell based therapy to prevent tissue damage after an ischemic episode. using an animal model of pulmonary ischemia reperfusion injury, they reported intravenous administration of bm - msc after ipc enhances pulmonary function and cell engraftment in the lungs. jiang and colleagues have also shown that remote conditioning (an alternative to conditioning where ischemia is applied to a distant tissue) enhanced cell retention and cardiac function in the myocardium after bm - msc transplantation in a myocardial ischemia - reperfusion animal model, suggesting that sdf-1 is a key molecule in the cell engraftment mechanism. in 2016, the same research group demonstrated that these beneficial effects were mainly attributed to the hospitable microenvironment for engrafted cells. as we mentioned above, statin administration attenuates the effects of an ischemic episode in the heart or the brain, mainly reducing the inflammation in the injured tissue. yang and colleagues reported that at, a member of the statin family, decreased the hostility of the cardiac microenvironment and facilitated survival of msc administration in a post - infarct in vivo model. moreover, zhang and colleagues reported that the combined therapy of rosuvastatin and mscs has a synergistic effect on improving myocardial function after infarction, improving the survival of engrafted adsc, at least in part, through the pi3k / akt and mek / erk 1/2 signaling pathways. the proliferative growth factor of b - fibroblasts (bfgf) promotes cell survival, migration and the differentiation capacity of bm - msc in vitro, and these abilities may improve bm - msc engraftment to target tissue. wang and colleagues observed that the co - administration of bfgf with bm - msc (by retrograde coronary venous infusion) in an animal model of myocardial infarction, enhanced bm - msc survival and differentiation, recovering cardiac function and preventing adverse remodelling. a summary or the reported findings in msc - based therapy in pre - clinic and clinical studies, in addition to our suggested strategy are summarized in figure 1. the first milestone to overcome during the development of msc therapy has been to guarantee the biosafety of their use in clinical trials. at present, consensus in the scientific community agrees that msc therapy is safe when its isolation, ex vivo expansion, and administration are made following good manufacturing practice (gmp) guidelines. the number of clinical studies evaluating the regenerative effect of mscs in multiple diseases is growing fast and therapeutic results are increasingly positive. however, concurrently, scientists have observed that the long - term benefit of msc therapy is restricted by the poor engraftment of transplanted cells. at present, the second milestone aims to achieve a stable msc - regenerative effect in the transplant host. the discovery of new mechanisms of cell homing and engraftment will present a stronger possibility to improve the interactions between transplanted cells and tissue cells, for instance, modulating the expression of adhesion and migration molecules in mscs. on the other hand, in order to prevent the difficulties of cell engraftment, researchers have also investigated the use of biomaterial to mimic the natural niche of mscs with encouraging results, particularly in bone and cartilage regeneration in order to draw msc - host tissue interactions. strategies of msc preconditioning or damaged tissue preconditioning have been successful in pre - clinic studies for different diseases, increasing the cell engraftment, the gain of tissue function and consequently, the efficacy of cell therapy. the successful use of statins for msc preconditioning or for damaged tissue preconditioning to increase the msc therapy efficacy in the treatment of myocardial infarction consequences after reperfusion suggests that even more powerful results of combined strategies may be achieved. therefore, we propose that using both complementary strategies will enable acceleration of the process to translate the experimental evidence from the pre - clinic studies to the daily clinical practice, reaching the next milestone (fig. 1). in addition, we call for more research in this area, in particular, we advocate research that includes various modalities of combining the strategies to produce excellent clinical results. -sma smooth muscle actinaktserine / threonine - specific protein kinaseadscadipose derived mesenchymal stem cellsatr2angiotensin type 2 receptorbfgf-fibroblast growth factorbcl-2b - cell lymphoma 2bliin vivo bioluminescent imagingbm - mscbone marrow mesenchymal stem cellscxcr4cxc chemokine receptor type 4dmt1diabetic mellitus type 1eswextracorporeal shock wavesgfpgreen fluorescent proteingygrayhdlhigh density lipoproteinhgfhepatocyte growth factorho-1heme oxigenase-1hif-1hypoxia - inducible factor-1 ipcischemic postconditioningladleft anterior descending coronary arterypi3kphosphoinositide 3-kinaseprpcrplatelet rich plasma clot releasateptenphosphatase and tensin homologerkextracellular signal - regulated kinasemektyrosine / threonine kinasemimyocardial infarctionsdf-1stromal cell - derived factor-1alphasrt1silent mating type information regulation 2 homolog 1 or nad - dependent deacetylase sirtuin-1tgf-1transforming growth factor vcam-1vascular cell adhesion protein-1vegfvascular endothelial growth factorsrysex determining region yutmdultrasound - target microbubble destruction smooth muscle actin serine / threonine - specific protein kinase adipose derived mesenchymal stem cells angiotensin type 2 receptor -fibroblast growth factor in vivo bioluminescent imaging bone marrow mesenchymal stem cells cxc chemokine receptor type 4 diabetic mellitus type 1 extracorporeal shock waves green fluorescent protein high density lipoprotein hepatocyte growth factor hypoxia - inducible factor-1 ischemic postconditioning left anterior descending coronary artery phosphoinositide 3-kinase platelet rich plasma clot releasate phosphatase and tensin homolog extracellular signal - regulated kinase tyrosine / threonine kinase myocardial infarction stromal cell - derived factor-1alpha silent mating type information regulation 2 homolog 1 or nad - dependent deacetylase sirtuin-1 transforming growth factor vascular cell adhesion protein-1 vascular endothelial growth factor sex determining region y ultrasound - target microbubble destruction | abstractover the past 2 decades, therapies based on mesenchymal stem cells (msc) have been tested to treat several types of diseases in clinical studies, due to their potential for tissue repair and regeneration. currently, msc - based therapy is considered a biologically safe procedure, with the therapeutic results being very promising. however, the benefits of these therapies are not stable in the long term, and the final outcomes manifest with high inter - patient variability. the major cause of these therapeutic limitations results from the poor engraftment of the transplanted cells. researchers have developed separate strategies to improve msc engraftment. one strategy aims at increasing the survival of the transplanted mscs in the recipient tissue, rendering them more resistant to the hostile microenvironment (cell - preconditioning). another strategy aims at making the damaged tissue more receptive to the transplanted cells, favoring their interactions (tissue - preconditioning). in this review, we summarize several approaches using these strategies, providing an integral and updated view of the recent developments in msc - based therapies. in addition, we propose that the combined use of these different conditioning strategies could accelerate the process to translate experimental evidences from pre - clinic studies to the daily clinical practice. |
the prevalence of type 2 diabetes continues to rise and currently affects over 25 million americans and is estimated to reach 439 million adults worldwide by 2030 [1, 2 ]. along with this increase, adults aged 20 years (an estimated 79 million individuals) [3, 4 ]. furthermore, it is estimated that, among u.s. adults with undiagnosed diabetes or impaired fasting glucose, the proportion of adults with insulin resistance increased from 24.8% to 31.1% during the time periods of 19881994 to 19992002. prediabetes is indicated when blood glucose or hemoglobin a1c (a1c) levels are higher than normal, but not yet high enough to be classified as diabetes. prediabetes raises the risk of type 2 diabetes by 3- to 10-fold and it is estimated that up to 70% of people with prediabetes may develop type 2 diabetes during their lifetime [3, 6, 7 ]. a study conducted by geiss. estimates 30% of the u.s. adult population had prediabetes in 2005 - 2006, but only 7% were aware that they had the condition. insulin resistance (ir) is a condition in which the body produces insulin but does not use it effectively. when people have insulin resistance, glucose builds up in the blood instead of being absorbed by the cells, leading to type 2 diabetes or prediabetes. the american diabetes association (ada) (april 4) considers both prediabetes and insulin resistance precursors to type 2 diabetes. both the ada and the national heart lung and blood institute 's national cholesterol education program (ncep) suggest the risk factors for type 2 diabetes, prediabetes, and ir are similar and include the following (not comprehensive) : obesity, physical inactivity, family history of diabetes, race / ethnicity, high blood pressure, large waist circumference, and high triglycerides. notably, socioeconomic status is usually not included but is an important focus of this paper. socioeconomic status is a complex construct, broadly based on relative income, education, and occupation all of which have been repeatedly associated with lifestyles and behavioral risk factors. in this analysis, we use income and education as indicators of ses, since occupation has been shown to be highly correlated with education [11, 12 ]. numerous studies have identified low physical activity [1315 ], low diet quality [14, 16, 17 ], and, more recently, poor sleep quality, as associated with diabetes [1822 ]. however, it is uncertain whether these factors equally affect prediabetes and diabetes risk across the ses gradient. that is, most previous studies statistically adjust for education, income, or some other marker of ses [2325 ]. but to develop well - targeted and likely effective primary and secondary interventions it is necessary to understand how modifiable risk factors influence risk of diabetes among the different ses groups. studies have shown that while health programs and therapies exist to manage prevention of diabetes and its complications, these programs are underutilized among those in low socioeconomic groups [2628 ]. while there are many risk factors contributing to diabetes, this study seeks to identify those most likely to improve the effectiveness of primary and secondary prevention initiatives. coupled with the under - utilization of diabetes prevention programs among those with low ses [2628 ], there is a potential benefit to identifying modifiable diabetes risk factors that may contribute to prediabetes among those with low ses and to examine the different effects of diabetes risk factors operating among different ses levels. therefore, the objectives of this analysis arewithin and across each level of ses, to examine the associations between known behavioral risk factors for diabetes (low diet quality, poor sleep, low physical activity, and high waist circumference) and both prediabetes and ir;to examine these modifiable factors collectively (presence of two or more risk factors) for their potential impact on the prevalence of prediabetes and ir within and across the ses gradient. within and across each level of ses, to examine the associations between known behavioral risk factors for diabetes (low diet quality, poor sleep, low physical activity, and high waist circumference) and both prediabetes and ir ; to examine these modifiable factors collectively (presence of two or more risk factors) for their potential impact on the prevalence of prediabetes and ir within and across the ses gradient. the boston area community health (bach) survey is a longitudinal cohort study of residents of boston, ma, aged 3079 years at baseline (march 2002june 2005). briefly, a stratified two - stage cluster sample was used to recruit an approximately equal number of participants by gender, race / ethnicity (black, hispanic, white), and age group (3039, 4049, 5059, 6079). 5,502 adults participated in baseline bach i (1767 black, 1876 hispanic, 1859 white ; 2301 men, 3201 women). follow - up surveys were collected at two time points approximately 5 (bach ii 20062010) and 7 (bach iii 20102012) years later. for bach iii, completed interviews were obtained for 3155 individuals (1184 men ; 1971 women). in all surveys, data were collected during a two - hour interview in english or spanish, after obtaining written informed consent. analyses for this paper use data from the most recent interview, bach iii (20102012). education, based on years of education completed, is composed of four categories : 125 or hba1c 6.5. subjects with prediabetes are compared to diabetes unaffected subjects that is, those without diabetes (self - reported type 1 or 2 or undiagnosed) and with no prediabetes leaving an analytic sample size of 2175. a third outcome combining prediabetes and insulin resistance was created to capture the presence of prediabetes or insulin resistance among nondiabetic subjects (n = 2175). to define insulin resistance, we used the nhanes study cut - point of 2.73. bivariate associations between health factors and education were examined with wald f chi - square tests for categorical measures and wald f test p value from linear regression models for continuous measures. logistic regression models were utilized to examine the association of lifestyle / behavioral health factors with prediabetes and the combined outcome of insulin resistance or prediabetes. linear regression models were constructed to examine the association between lifestyle and behavioral factors on insulin resistance. due to positive skew, insulin resistance was log transformed in final regressions. in all regression models we stratified by education level or income group and adjusted for age, gender, race / ethnicity, family history of diabetes, and smoking status. regression models were examined for the overall healthy eating score as well as each of the 7 subscales but results are presented only for the overall score. analyses of diet were adjusted for total caloric intake to minimize measurement error by over / underreporting. separate unstratified regression models were examined to test for interactions between lifestyle and behavioral factors and ses measures income and education. all analyses were performed with sas callable sudaan 11.0 using sampling weights and stratification measures to account the complex survey design of bach. multiple imputation was used to reduce bias resulting from missing data for all exposure covariates using multivariate imputation by chained equations (mice) in r. briefly, mice imputes missing values with estimated predictions from regression models that reflect the relationships observed in the data, while considering the complex survey sampling design. age, race, and their interaction were included as predictors in each of the imputation models. in addition, mice selected important predictors for each variable and these were also included in the model. less than 5% of the covariates (age, gender, education, race / ethnicity, and income) were imputed. 28% had normal blood glucose levels (without self - reported diabetes and not prediabetic). in the sample without diabetes (n = 2379) the geometric mean of the homa - ir measure was 1.9 (se 1.0). among those with prediabetes, over half were white and reported medium levels of physical activity and 46% reported a family history of diabetes. in subjects with prediabetes or ir, 45% were male and reported a family history of diabetes. the mean waist circumference for those with prediabetes or ir is the highest at 96 cm compared to those unaffected or with prediabetes alone. in general, similar patterns were observed in the bivariate associations between study population characteristics with educational level and income (data not shown). males were more likely to have higher education (postgraduate) compared to female (51% versus 49%, p = 0.04). the < hs group also reported the highest rates of current smoking and family history of diabetes compared to all other education levels (p 0.0001 in all comparisons). regarding diabetes outcomes, subjects in the highest education group had higher rates of being in the unaffected group (34% versus 12%, p 0.0001) and lower rates of reporting prediabetes (61% versus 80%, p 0.0001) and prediabetes or ir (65% gender, current smoking, family history and diabetes, and the diabetes outcomes were associated with income with similar patterns. in unstratified models there were no significant interactions seen between education and income with lifestyle / behavioral factors (data not shown). table 2 displays the results of the insulin resistance regressions and figure 1 plots mean homa - ir for significant predictors. insulin resistance is associated with bmi and waist circumference across all levels of education and income (p ranges from 0.02 to 0.0001, table 2, models 2 and 3). the magnitudes of association with bmi and waist circumference on ir are similar across all levels of education and income. those with bmi 25 have on average a higher mean log ir score of 0.20 compared to those with bmi < 25. similarly, those with a high waist circumference have higher mean ir scores anywhere between 0.22 and 0.33 points higher than those with a smaller waist circumference. the healthy eating score, other diet components, physical activity, and sleep duration were not associated with insulin resistance. the covariate adjusted geometric means for insulin resistance in the bmi 25 group are nearly twice as high compared to the bmi < 25 group within the lowest education level < hs or ged (figure 1). the same magnitude in mean differences between the bmi categories is also seen in the hs or ged and some college group. geometric homa - ir means are also higher in those with bmi 25 compared to bmi < 25 within income levels. across both education and income groups, homa - ir geometric means are lower as one moves into higher educated or income groups. the geometric means for those with bmi 25 are 2.8, 2.2, and 1.8 for the income groups regard to waist circumference, higher mean homa - ir values are observed among subjects with large waist cm compared to small waist cm within all levels of education and income (p 0.0001 in all models). few significant associations were seen in logistic regression models of prediabetes (table 3). large waist circumference was significantly associated with increased odds of prediabetes in the college or advance degree group such that those with large waist circumference were 1.7 times as likely to develop prediabetes compared to those with lower waist circumference (or 1.68, 95% ci : 1.072.62). similarly for income, subjects with large waist cm were nearly twice as likely to have prediabetes compared to those of lower waist cm in the medium and high income strata with or 2.13 (95% ci : 1.104.10), and or 1.88 (95% ci : 1.222.92) for medium and high income respectively. as with insulin resistance, diet, physical activity, sleep duration, and the presence of multiple risk factors figures 2 and 3 display the results of the prediabetes or ir logistic regression models for strata of education and income, respectively. subjects with a large waist circumference were nearly twice as likely to develop prediabetes or ir in the higher education strata (some college and college+) and among the highest income group ($ 50,000 +). the odds ratios for large waist circumference are in the same positive direction and of similar magnitude across all education levels with a range of 1.55 to 1.88, where a larger waist circumference nearly doubles the likelihood of prediabetes or ir. however the association in the < hs and hs or ged strata is nonsignificant. the same strength of association with waist circumference is seen between income strata, where the odds ratios range between 1.69 and 2.11 and reached significance only within the highest income strata. our analysis shows that, after adjusting for ses indicators (education and income), commonly known diabetes behavioral risk factors (namely, diet quality, sleep duration, and physical activity) are poor predictors of prediabetes and insulin resistance. larger waist circumference was a consistent predictor of prediabetes and insulin resistance with large waist circumference increasing the probability of prediabetes or ir nearly twofold. while this magnitude of effect is seen across all levels of ses, it reaches significance primarily within higher ses levels. the examination of multiple risk factors revealed that the presence of two or more risk factors is not associated with prediabetes or ir. while many studies have shown significant associations between diet and diabetes risk [17, 27, 4345 ], these results have been mixed. for example, other studies have shown no association between diet quality, specifically total fat intake and red meat are not predictive of diabetes risk [46, 47 ]. other studies have shown that bmi adjustment attenuates the association between diet quality and type 2 diabetes [4850 ] which supports our findings of bmi being a significant predictor of insulin resistance across all levels of ses. the significant findings between bmi and waist circumference indicate that, independent of education and income, increased bmi and waist circumference are important predictors of prediabetes and insulin resistance. the strength of our waist circumference results is corroborated by a study which examined the interrelationships between demographic (age, income, marital, race, and education) and physical activity and poor diet on prediabetes in path models, concluding that large waist circumference had the strongest direct effect on prediabetes. in addition, findings from the nhanes 2009 - 2010 survey indicated that the significance of sleep disorders on diabetes is attenuated when bmi is added to the model, where the odds ratio for diabetes drops from 2.04 (1.40,2.95) to 1.38 (0.95,2.00). they conclude that the effect of sleep disorders on diabetes may be explained through a subject 's obesity status. while they controlled for various factors such as age, gender, ethnicity, education, and income, they did not examine other modifiable risk factors (e.g., diet and sleep). the significant association of waist circumference with both prediabetes and insulin resistance may help guide future primary and secondary prevention programs where, in addition to socioeconomic factors, subjects with high bmi and large waist circumference are likely to produce the most beneficial outcomes. the finding that waist circumference is not predictive across all education levels in prediabetes suggests that there may be different predictors of prediabetes among the lower ses groups providing new opportunities for more targeted intervention programs. on a broader level this may be explained by the fact that prediabetes is considered an early precursor state indicating likely eventual development of diabetes, and not the eventual established diabetes state itself, by which time the associated risk factors are more evident and strongly associated. moreover, while the majority of prediabetic cases may end up being diagnosed with diabetes, not all cases will be ; therefore the expected relationship of known diabetes risk factors with prediabetes is diluted. first, because it is cross - sectional ; the temporality of the relationships uncovered remains uncertain. fasting insulin was also only measured at a single time point and maybe subject to measurement error. the fact that measures are obtained at a single time point may reduce the likelihood of finding significant differences as research has shown that repeated measures of health behaviors may increase the significance and the effect size of such modifiable behaviors. physical, direct measures such as bmi and waist circumference may serve as a lifetime proxy for diet quality and level of physical activity compared to self - reported measures of health behaviors, taken at a single time point. while the reliability of self - reports of health conditions may be questioned, there is evidence that they are generally well - correlated with medical record review [5457 ]. fortunately, medication data were available and over 80% of those self - reporting diabetes were taking a diabetes - related medication. countervailing strengths of this study include use of a community - based random sample and the composition of the sample, which covers a broad age range, inclusion of both genders, and a racial / ethnic diversity, with roughly equal numbers of blacks, whites, and hispanic participants. inclusion of a broad range of recognized behavioral risk factors permitted assessment of their independent and joint influences on prediabetic states. finally, we examined a variety and combination of multiple risk factors, sleep duration, diet, and physical activity to test whether targeting multiple behaviors were predictive of prediabetes or ir. we found that, among the behavioral risk factors considered, bmi and waist circumference were consistent predictors of prediabetes outcomes independent of ses. our results have both clinical and public health significance : many different risk factors (including bmi and waist circumference) are variably associated with diabetes, prediabetes, and ir and offer variably effective opportunities for primary and secondary prevention. by identifying, among the broad range of risk factors, the most promising influences, future primary and secondary prevention initiatives can be more precisely targeted, resulting in more effective and cost efficient outcomes. | to examine whether behavioral risk factors associated with diabetes (diet, bmi, waist circumference, physical activity, and sleep duration) are also related to both prediabetes and insulin resistance (ir), we used data from boston area community health (bach) survey (20102012, n = 3155). logistic and linear regression models were used to test the association of lifestyle factors with prediabetes status, insulin resistance, and prediabetes or insulin resistance. all regression models were stratified by education and income levels (to examine whether risk factors had differential effects across socioeconomic factors) and adjusted for age, gender, race / ethnicity, family history of diabetes, and smoking status. we found that large waist circumference was consistently associated with higher levels of insulin resistance (ir) and increased odds of prediabetes. while the association between large waist circumference and ir was consistent across all levels of ses (p < 0.001), the association between large waist circumference and prediabetes was only statistically significant in the highest socioeconomic strata with odds ratios of 1.68 (95% ci 1.072.62) and 1.88 (95% ci 1.222.92) for postgraduate degree and income strata, respectively. there was no association between diet, physical activity, sleep duration, and the presence of multiple risk factors and prediabetes or ir within ses strata. |
in a quasi - experimental study carried out in 2009 - 2010 academic year and 63 medical students from isfahan university of medical sciences studying in the 3 or 4 semester were recruited. thirty two students who chose the optional course of learning and study skills, were selected as the intervention group, while 31 students attending the clinical physiology course were selected as the control group. medical students who did not have an iranian nationality were not enrolled in the study and those who did not participate in the learning and study strategies inventory (lassi) before or after the course were also excluded from the study. the lassi is a 10-scale, 77-item assessment of students awareness about and use of learning and study strategies included attitude, motivation, time management, anxiety, concentration, information processing, selecting main ideas, study aids, self - testing and test strategies. it provides students with a diagnosis of their strengths and weaknesses, compared to other college students, in the areas covered by the 10 scales. it is prescriptive in that it provides feedback about areas where students may be weak and need to improve their knowledge and skills. scale considers students diligence, self - discipline, and willingness to exert the effort necessary to successfully complete academic requirements. scale appraises students ability to direct and maintain attention on academic tasks. the information processing scale assesses how well students can use imagery, verbal elaboration, organization strategies, and reasoning skills as learning strategies to help build bridges between what they already know and what they are trying to learn and remember. the selecting main ideas scale evaluates students skill in identifying important information for further study. the study aids scale assesses students use of supports or resources to help them learn or retain information. the test strategies scale evaluates students use of test preparation and test taking strategies. each scale contains eight items except one which has five (77 items in total). for each of the 77 items, students were requested to darken the bubble containing the letter that corresponds to how well the statement describes them on a five - scale ranging from not at all like me (scale : 1) to very much like me (scale : 5). this questionnaire is a diagnostic tool to find out the learning problems in ten different domains, so the overall score is not calculated12. validity and reliability of the persian version were confirmed in previous studies.13 for the intervention group, different components of strategic learning like attitude, motivation, time management, anxiety, concentra - tion, study aids, etc. were taught during the semester in two - hour weekly sessions (16 sessions in total). the course was held as a workshop and all the students actively participated in the program. at the beginning of each session, the students presented written and oral reports about the application of the learning strategies which were introduced in the previous discussion. in each session the lecturer provided some explanation about the subject by an example and then, a discussion was held about the importance of using the learning guidelines. since the students were aware of each session 's topic and had to do some study about the topics before each session, they actively participated in the discussion. the lecturer had to provide the information and data during the discussion and conclude the topic at the end of each session while defining the assignments and resources for the next session. in the second session of the course, each student was informed about his pre - course score and became aware of his / her weaknesses. in the control group, students attended clinical physiology lectures and case presentations presented by a physiology professor. students were evaluated based on a portfolio, self - evaluation questionnaire and their progress in lassi test. portfolio was consisted of monitoring forms about the implementation of each skill in their current studies during the last week and written reports about the practice of ten study skills in preparing for midterm and final exams. finally, the students efforts during the term were evaluated by self - evaluation form via a questionnaire of seventeen questions. this questionnaire considered different domains like being on time and active in the classroom, doing homework, participating in the discussions, etc. the final scores were calculated based on their portfolio, monitoring forms, written reports of recruitment of the strategies in mid - term and final exams, classroom activity and their progress in the lassi test. demographics, the pre- and post course lassi scores as well as self - evaluation questionnaire scores for each of the seventeen questions were presented as mean standard deviation. the range of self - evaluation scores for each question was from 0 to 5. kolmogorov - smirnov test was employed to make sure the normal distribution of the data. demographic data from the two groups were compared by t - test to find out if they were similar. mean lassi scores before and after the courses were compared by paired t - test while mean difference of lassi scores before and after intervention were compared between two groups by t - test. students were evaluated based on a portfolio, self - evaluation questionnaire and their progress in lassi test. portfolio was consisted of monitoring forms about the implementation of each skill in their current studies during the last week and written reports about the practice of ten study skills in preparing for midterm and final exams. finally, the students efforts during the term were evaluated by self - evaluation form via a questionnaire of seventeen questions. this questionnaire considered different domains like being on time and active in the classroom, doing homework, participating in the discussions, etc. the final scores were calculated based on their portfolio, monitoring forms, written reports of recruitment of the strategies in mid - term and final exams, classroom activity and their progress in the lassi test. demographics, the pre- and post course lassi scores as well as self - evaluation questionnaire scores for each of the seventeen questions were presented as mean standard deviation. the range of self - evaluation scores for each question was from 0 to 5. kolmogorov - smirnov test was employed to make sure the normal distribution of the data. demographic data from the two groups were compared by t - test to find out if they were similar. mean lassi scores before and after the courses were compared by paired t - test while mean difference of lassi scores before and after intervention were compared between two groups by t - test. students were evaluated based on a portfolio, self - evaluation questionnaire and their progress in lassi test. portfolio was consisted of monitoring forms about the implementation of each skill in their current studies during the last week and written reports about the practice of ten study skills in preparing for midterm and final exams. finally, the students efforts during the term were evaluated by self - evaluation form via a questionnaire of seventeen questions. this questionnaire considered different domains like being on time and active in the classroom, doing homework, participating in the discussions, etc. the final scores were calculated based on their portfolio, monitoring forms, written reports of recruitment of the strategies in mid - term and final exams, classroom activity and their progress in the lassi test. demographics, the pre- and post course lassi scores as well as self - evaluation questionnaire scores for each of the seventeen questions were presented as mean standard deviation. the range of self - evaluation scores for each question was from 0 to 5. kolmogorov - smirnov test was employed to make sure the normal distribution of the data. demographic data from the two groups were compared by t - test to find out if they were similar. mean lassi scores before and after the courses were compared by paired t - test while mean difference of lassi scores before and after intervention were compared between two groups by t - test. considering the exclusion criteria, the data from 26 students in the intervention group and 22 students in the control group was used in the final analysis. mean age of the study population was 20.4 2.2 years in the intervention group and 20.7 0.86 years in the control group (p > 0.05). before and after study lassi scores in each of the ten scales the before and after mean difference of lassi scores was significantly higher in the intervention group for all the ten scales except for anxiety, test strategies, motivation and concentration scales (table 2). mean and standard deviation scores of self - evaluation questionnaire are summarized in table 3. learning and study strategies inventory (lassi) scores in each 10 scales before and after intervention learning and study strategies inventory (lassi) scores changes before and after intervention for each of the 10 scales scores of self - evaluation questionnaire (compared to maximum score 5) the present study investigated the efficiency of learning and study skills training course on application of the learning strategies in a population of second year medical students. analyzing the data, we detected a significant increase in the post - course lassi scores in six subscales (attitude, time management, information processing, selecting the main idea, self - testing and study aids scale) among the intervention group compared with the control group. other surveys have also demonstrated the advantages of instructing application of learning guidelines in short - term and academic success in the long - term period. in west virginia university, freshman students in a onesemester study strategies course were given individual lassi profiles and general feedback in a group setting. half of the students received additional individual feedback which consisted of specific training for improving performance on each pre - course lassi score below the 50 percentile. the results indicated that students who received extended, one - on - one feedback had significantly higher scores on seven post - course lassi subscales (attitude, motivation, time management, anxiety, concentration, selecting main ideas, and test strategies).6 in another study in southern california university, a new faculty coach role was introduced which included teaching at - risk nursing students to use learning and motivational strategies and self - management skills to improve academic success. students postcourse lassi scores demonstrated significant improvement in 5 of the 10 subscales (motivation to accept responsibility for studying, anxiety management, concentration, selecting the main idea, and test - taking skills).8 although in some subscales (attitude, selecting the main idea and time management) our results are consistent with these surveys,68 the notable finding was that motivation improvement was not prominent in our study. previous studies have demonstrated that iranian students of medicine, dentistry and pharmacy have lower motivational scores compared with the american students (below the 50 percentile).13 furthermore, the educational interventions did not improve the corresponding score.11 in another quasi - experimental study, 40 talented students attended a 20-hour workshop on learning and study skills with the main focus on theories of learning, cognition and meta - cognition, learning styles, information processing theory, effective study methods, studyplanning techniques, fast reading techniques, participatory learning methods, retention patterns and exam techniques. the post - course scores were significantly improved in five scales of selecting main ideas, study aids, information processing, self - testing and test strategies scales. the mean pre - workshop scores of students in attitude, motivation, time management, study aids and self - testing scales were below the 50 percentile, which improved to over 60 percentile after the workshop, except for the motivation scale. this finding highlights the fact that iranian students are concerned with homework and personal goals but their motivational activities are low. tension of promoting to physiopathology stage of the academic career, difficulty in adjustment and adaptation to the new roles at the university, uncertain employment and occupational status and the stress of specialty exam seem to be the most important factors in lowering the motivations of medical students. in another similar study, 1 and 2 year university students attended a study skills course during one semester, gaining knowledge about learning skills, retention techniques, time management, etc. however, no significant improvement was observed in attitude, motivation, concentration and time management scales. the author believed that such courses may improve the processing and data organizing abilities of the students in the classroom, but they have no significant effect on motivation enhancement.7 in the long - term, educational interventions affect the academic success, attrition rate and grade point improvement.810 the students who attended the course in our study, mentioned in self - evaluation form that their grades, learning rate and learning efficiency were improved due to this intervention ; while, lack of investigating long - term consequences of our intervention may be considered as a weakness. also this course was optional and students selected it based on their interests. the educational programs comparing the successful and unsuccessful students revealed that learning and study skills application was significantly different between the two groups. moreover, motivation and attitude were the two main factors of academic success,341415 which intensifies the importance of educational interventions with a focus on motivation improvement. fifty - one articles on the subject of efficiency of educational interventions in learning skills were investigated in a metaanalysis. solo taxonomy (a hierarchical model for learning outcome) was used to investigate the complexity of intervention structure, which is divided into four stages consisted of uni - structural stage (which includes a simple change such as stress reduction), multistructural stage (to learn a set of independent methods and strategies such as a study skills package), relational stage (which is centered on metacognitional and affective interventions such as academic success as a result of self - regulation) and extended abstract.16 considering this taxonomy, we included the different stages of cognition and metacognition in the survey which is a strong point in performance, monitoring and evaluation of our report which were consisted of different parts like portfolio, self - evaluation questionnaire and lassi test. in another study, a mandatory course of learning and study skills was designed in four metacognitive stages : knowledge, evaluation, planning and monitoring. it was shown that after the training course, the enrolled students were able to apply the learning strategies and manage their learning process with a high motivation.17 despite our attention to cognitive and metacognitive aspects of learning, there was no improvement in students motivation which notifies the strength of social factors. in terms of study population, freshman17 or such interventions are planned as study aid programs by means of needs assessment for higher year students,19 unsuccessful or at risk students8 and even higher levels of education such as residency programs.20 various topics including interpersonal communication skills, friends finding, presentation skills, evaluation principles and strategies, self - directed lifelong learning, personal and professional development, confidence growing, strengthening mechanisms of memory, critical thinking, problem solving, etc. are presented according to various stages of academic career and student demands.1820 in conclusion, our study demonstrated that the optional course of learning and study skills effectively improves the application of the corresponding techniques in second year medical students. the most prevalent effect of this course was on classroom activities (time management, information processing, selecting main ideas and self - testing), but it had no influence on motivation scale because of the social and occupational related stress. by analyzing the post - course self - evaluation questionnaire, it was figured out that participants in our study believed that attending the course improved their planning and performance abilities and the final term grades. for the future studies, we suggest examining the long - term effects of such educational interventions in academic success, admission to higher education and improvement of average final term grades. in addition then, the self - guided students learn the ability to manage their learning process automatically. even though, such interventions are mostly planned for the freshmen (during the high school - university transition), but they could be organized for students in other fields of medical sciences, unsuccessful students or higher grade students according to related and demanded topics. fh carried out the study, participated in the design of the study and acquisition of data. as participated in the design of the study, performed the statistical analysis and wrote the manuscript. the study is funded by isfahan medical education research center, isfahan university of medical sciences. we have no financial or other relationships that might lead to a conflict of interest. | background : it has been demonstrated that educational programs that focus on study skills could improve learning strategies and academic success of university students. due to the important role of such supportive programs aimed at the fresh students, this survey was carried out to investigate the effectiveness of an optional course of learning and study skills on learning and study skills of second year medical students.methods:this quasi - experimental research was performed on 32 eligible medical students in isfahan university of medical sciences, who chose the optional course of learning and study skills. both of intervention and control groups completed learning and study strategies inventory (lassi) at the beginning and the end of semester. students in the intervention group studied different components of reading and learning skills using team working. their final scores were calculated based on written reports on application of study skills in exams (portfolio), self - evaluation form and their progress in lassi test. the mean differences of scores before and after intervention in each of ten test scales were compared between two groups.results:the results showed that the mean difference scores in attitude, time management, information processing, main ideas selection, study aids and self - testing scales were significantly higher in the intervention group (p < 0.05 for all).conclusions : this optional course successfully improved learning strategies in the corresponding classroom activities. however, there was no improvement in the motivational scale which is tightly related to the educational success. therefore, the implementation of educational programs with an emphasis on meta - cognitional aspects of learning is recommended. |
as medical house officers who trained together in internal medicine in the 1980s, we (jnk, sal) believed we knew who provided the highest - quality care. the best interns were those who spun the urine, gram - stained the sputum, and wrote notes on late - night admissions before the sun rose the next morning. the best residents had deep funds of knowledge, provided pertinent references, and did not leave the hospital until they had checked the radiographs of all patients admitted to their service. the best attending physicians had wise judgment, impeccable integrity, and stayed late at night to discuss difficult cases with families and house officers. today, the medical profession, and society at large, defines quality in terms of the capacity of the physician s health care organization to promote health and prevent error. the physician s distinctive role is diminished ; in fact, some argue that medicine should emulate the equivalent actor model of commercial air travel, in which passengers have full confidence on boarding a flight without knowing or caring who the pilot is.1 quality today focuses on systems and organizations. the medical community identifies high - quality hospitals as those with computerized order entry systems, online alerts to prevent drug interactions, and intensive care units staffed with fellowship - trained intensivists. similarly, the present - day high - quality physician practices in a group with reminder systems for identifying patients who should have flu shots, mammograms, and cholesterol and psa screenings. increasingly, these expectations are leveraged with explicit performance measures.2,3 these ideas, many embodied in the institute of medicine s landmark report on quality, to err is human,4 have fueled initiatives to improve quality at the system level.511 quality has become an increasingly frequent concern of health policy makers and researchers. we performed a pubmed review of english language articles on quality of care in the united states and documented an increase from 6 articles per year during the period 19661979, to 55 per year from 1980 to 1994, and 207 per year from 1995 to 2005. however, the proportion of articles on quality of care that focused solely on the physician dropped from 34% in the first period (19661979) to 18% in the latter 2 periods (19802005). meanwhile, we note an increase in the number of articles on quality that focus on the implementation and use of information systems to improve safety. these findings reflect the transformation from physician - oriented to systems- and technology - oriented concepts of quality (see the appendix for the methodology of the literature review) the physician - centered concept of quality emerged from a crisis over a century ago. more than 150 schools of medicine existed in the 1800s all over the united states, with no formal accreditation. charges of charlatanism and quackery were commonplace.12 in response, the flexner report of 1910 called for dramatic reform in medical education with an emphasis on standardization, accreditation, licensing, and commitment to scientific methods.13 many medical schools closed following the flexner report. those that survived catalyzed a transformation in medical practice from craft to profession.12 as a profession, medicine enjoyed authority and autonomy through the early and middle decades of the twentieth century. during these years, physicians were largely self - governed and self - regulated. notions of quality care were based on abstract but noble ideals for doctors, including respectful personal relationships with patients.14 by the middle of the twentieth century, the profession was thriving. physicians delivered to patients groundbreaking achievements of medical science, including antibiotics, antipsychotics, cardiac revascularization, and orthopedic implants. however, the end of the twentieth century brought significant changes to the medical practice, with attendant consequences for quality. first, the locus of care shifted from the home and the small physician office to the hospital and the large multispecialty practice. second, because physicians were reimbursed on a fee - for - service basis, they had no incentive to keep costs in check. other models of risk sharing arose in response to rising costs, and with them, a corporate presence emerged in medicine. third, the aging of the population put an increasing proportion of citizens at risk for adverse effects of an ever more aggressive diagnostic and therapeutic armamentarium. fourth, reports documented an epidemic of medical errors,58,15 spurring thinking about containing and reducing these errors. the history of quality measurement in the last 30 years provides another lens into the shift from physician - based to systems - based notions of quality. many initial efforts at quality assurance focused on physician error, typically using a peer review approach. berwick16 pointed out that such efforts to identify bad apples created anxiety and defensive maneuvering among physicians but did little to improve care. a cornerstone of care improvement initiatives in the late twentieth century was the use of comprehensive information systems that have so far been unaffordable for many small practices and hospitals.17 experts in quality of care pointed to the successes in error reduction reported by u.s. and japanese industries that subscribed to continuous quality improvement techniques.9 all of these developments favored the creation of large health care delivery systems and the definition of quality as the ability to deliver timely, appropriate, safe, and evidence - based care. the physician of the mid - twentieth century worked long hours. in reality, this as the century closed, a newer generation of medical professionals was less willing to sacrifice personal and family priorities. the focus on controllable lifestyle increased as couples entered the physician workforce, both partners now needing to juggle professional and home interests.1820 the new generation of physicians favored limited working hours, shared practices, night float coverage, hospitalist care of inpatients, and other structural factors permitting them to lead more balanced lives. physicians and other scholars have written thoughtfully about the tension between caring for others and caring for themselves,21 the challenges of humanistic care,22 and the difficulty of maintaining professional standards in large health care organizations.23 for example, the physician worklife study explicitly examined relationships between characteristics of the workplace, physician stress, and physicians physical and mental health.24 collaborations between physicians and other professionals (e.g., physician assistants, nurse practitioners) represent but one approach to addressing physician overcommitment while ensuring quality care. if quality today is embodied in a system that delivers, not a physician who cares, what is the physician s role in quality ? we fully support the development of health care systems that leverage resources to deliver the right care to the right patient at the right time. however, we also wonder whether the focus on effective care systems dilutes the importance of attention to clinical nuance a patient s fearful glance, a subtle erythematous eruption, an emerging electrolyte disturbance. five years after to err is human was released, half of americans stated that they were dissatisfied with the quality of health care in the united states.25,26 patients are distraught when their physicians hurry in the office, do not look them in the eye, or send them home quickly from the hospital. they want clear explanations for their health problems and constructive suggestions on how to manage these problems. these dimensions of patient satisfaction have not been measured traditionally, but are now assessed by the national committee on quality assurance23 through the health plan employer data and information set. if physicians are held accountable for their satisfaction scores, the argument is that they will strive to improve the scores. patients are taking an active role in shaping health care delivery as well, as witnessed by the emergence of consumer - driven health care. we interpret the popularity of the boutique practice movement as a market expression of patients preferences for individualized care, and failure of the profession to deliver it. thus, the progress made in improving patient safety practices at the organizational level has not translated into patient admiration and trust in the profession. we suggest that the explanation may lie in the dichotomy discussed here between physician - based and systems - based concepts of quality. while the medical community focuses on error reduction, patients continue to seek trust, compassion, information, and reassurance from their physicians. we suggest that organizational efforts to improve quality must be coupled with a recommitment to these core values embodied in the definition of medical professionalism : hard work, mastery of a body of knowledge and skills, and empathic relationships with the patients whom physicians serve, placing patient interests above physician self interest.27 we suggest that physicians have, largely unwittingly, abdicated key elements of medical professionalism. while patients may be reassured by the increasing safety of america s hospitals, the kaiser foundation report suggests they still are disappointed with their care.25,26 in fact, many physicians share this vision and find, regrettably, that they must work increasingly hard to maintain the patient - centered care they provide. the american board of internal medicine (abim) has recognized the need to recommit to professionalism and has articulated principles and commitments to guide professionalism in medicine in the present era.24,28 these principles emphasize the primacy of patient autonomy and social justice and call for integrity, respect, and compassion among physicians. the society of general internal medicine (sgim) has also addressed these issues through working groups. we applaud the efforts of the abim, the sgim, and other organizations in this area and challenge our leaders to use technology, incentives, and other levers to reinforce fundamental patient - centered tenets of the profession. more generally, we urge that these essentially separate initiatives to reduce error in our hospitals on the one hand and to increase professionalism among physicians on the other be joined in a more comprehensive effort to improve the quality of medical care. using the pubmed search engine, we utilized the keyword quality of care to identify articles on quality. citations were excluded if they did not deal with quality of care, did not have an abstract, were not in english, or did not evaluate quality of care in the united states. within each period, we reviewed randomly selected citations until we found 50 per period that were not excluded. to estimate the number of articles dealing with quality of care in each of the 3 periods, we multiplied the total number of citations (hits) by the ratio of eligible citations we reviewed to the total (eligible plus ineligible) that we reviewed, and then divided by the number of years in the period. (for example, in the period 19801994, quality of care generated 1,792 citations. we estimate the number of citations in this period as \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ 1792 \times { { \left ({ { 50 } \mathord{\left/ { \vphantom { { 50 } { 108 } } } \right. \kern-\nulldelimiterspace } { 108 } } \right) } } \mathord{\left/ { \vphantom { { { \left ({ { 50 } \mathord{\left/ { \vphantom { { 50 } { 108 } } } \right. \kern-\nulldelimiterspace } { 108 } } \right) } } { 15\,{\text{years } } = } } } \right. \kern-\nulldelimiterspace } { 15\,{\text{years } } = } 55\,{\text{per}}\,{\text{year } } $ $ \end{document}.) we completed a detailed coding form on the abstracts of the 50 eligible citations per period. the coding form classified the abstract as addressing physician - centered aspects of quality (such as credentials, training, or volume) or systems - centered aspects of quality. | for much of the twentieth century, quality of care was defined specifically in terms of physician characteristics and behaviors. high - quality physicians were well trained, knowledgeable, skillful, and compassionate. more recently, quality of care has been defined in terms of systems of care. high - quality organizations develop and adopt practices to reduce adverse events and optimize outcomes. this essay discusses this transformation from physician - based to organization - based concepts of quality and the consequences for patient care and medical professionalism. |
according to the international headache society (ihs), classical trigeminal neuralgia (tn) is defined as a unilateral disorder characterized by brief electric shock - like pains, abrupt in onset and termination, limited to the distribution of one or more divisions of the trigeminal nerve. this is different from symptomatic tn, which is defined by ihs as pain indistinguishable from classical tn but caused by a demonstrable structural lesion other than vascular compression. patients often describe the pain as attacks or paroxysms, which may last for a few seconds to 2 min. interestingly between paroxysms there is a refractory period in which the pain can not be triggered and the patient is asymptomatic. the intensity of the pain is severe and the quality is usually described as electric shock - like, sharp, stabbing, or shooting. the pain might be triggered spontaneously or by light touch in a specific area or simply by eating or talking. tn is considered to be a rare disease with an annual incidence of 5.9/100,000 women and 3.4/100,000 men in the usa. the incidence increases with age and tends to be higher in women at all ages with a male to female ratio of 2:3. the trigeminal nerve root entry zone has been found to be compressed by an aberrant loop of artery or vein, which ultimately leads to demyelination of the trigeminal nerve. furthermore, it has been demonstrated that tn is more common in patients with multiple sclerosis and an elevated relative risk has been associated with hypertension (htn), particularly among women. it has been suggested that patients with tn have arterial tortuosity, which may lead to increased arterial pulse pressure waveforms secondary to vascular stiffness. however, very few studies have explored the relationship between htn and tn [2, 4 ]. therefore, the objective of this study was to determine the prevalence of htn in patients diagnosed with classical tn and describe the characteristics of classical tn including age, gender and race among the patient population seen at the orofacial pain and oral medicine center at the usc school of dentistry (usc ofp - om center) in los angeles, california, usa between june 2003 and august 2007. a retrospective chart review was conducted from the electronic medical record database (soapware, fayetteville, ar) at usc ofp - om center of over 3,000 patient records from june 2003 to august 2007. the study was approved by the university of southern california university park institutional review board and ethics committee (usc upirb # up-07 - 00416) and has therefore been performed in accordance with the ethical standards laid down in the 1964 declaration of helsinki. we identified all patients who were diagnosed with tn using the chart searcher function implemented in the soapware program with the appropriate search terminology. all patients were clinically diagnosed as having tn by the faculty, or residents under the supervision of faculty. a thorough history and head and neck exam was performed for every patient along with necessary radiographic investigations to rule out all potential dental and bony pathologies. brain mri with and without contrast was done for all patients prior to initiating treatment. only patients with classic tn (idiopathic) without any obvious pathology such as multiple sclerosis, plaques, tumors, and abnormalities of the skull base were considered in our study. inclusion criteria for tn included a history and clinical presentation that satisfied the international headache society criteria for classical tn. dental caries, periapical lesions, periodontal pockets with bone loss, cracked teeth, hyperocclusion, non - vital teeth and other bony pathologies were excluded with a thorough diagnostic workup. from this subset of tn patients, those currently taking anti - hypertensive medications for a minimum period of 6 months and with a diagnosis of htn (established by the patient s physician) were considered as having both tn and htn. for the control group we identified thrice the number of age- and gender - matched controls from the usc ofp - om center using the existing electronic medical record database (soapware). inclusion criteria were gender - matched and age - matched controls (matched within a 2-year range) who may or may not have a diagnosis of htn. all control patients with htn were diagnosed by their physician and were on anti - hypertensive medication. chi - square test with yates correction and fisher s exact test were performed to calculate the p value. chi - square test with yates correction and fisher s exact test were performed to calculate the p value. the study population comprised of a total of 84 tn patients (54 female ; 30 male) and age- and gender - matched controls (n = 252 ; 162 female ; 90 male) between the ages of 33 and 93 years (mean 65.3 years). the racial characteristics of our patient population were as follows : caucasian (102) ; hispanic (117) ; asian (33) ; black (38) ; american indian (3) ; others (19) and unknown (24). thirty - one patients with tn reported having htn and were taking anti - hypertensive medication, out of which 13 of these patients were males and 18 were females.. the odds ratio of having htn in tn is 1.24 (95% confidence interval, 0.72). the difference in prevalence of htn in tn cases versus controls was not found to be statistically significant using chi - square test with yates correction (p = 0.50) and fisher s exact test (p = 0.42). hispanics had the highest prevalence of htn in both tn and controls followed by caucasians.fig. 1prevalence of htn in cases versus controls ; x axis tn cases and controls ; y axis prevalence of htn prevalence of htn in cases versus controls ; x axis tn cases and controls ; y axis prevalence of htn the risk factors that predispose an individual to develop tn include age and female gender. although, arterial hypertension has been reported as a risk factor for developing tn based on the theory of increased arterial tortuosity and pulse pressure, little or no epidemiologic data exist to validate this concept. arterial stiffness has been associated with the development of htn and its association with tn has been investigated, but this relationship has not been established since studies failed to demonstrate that patients with tn have an increase in arterial stiffness. in a population - based study of tn patients conducted in rochester, minnesota, 25% (19 out 75) of the patients with tn were found to have htn with an odds ratio of 1.96 (95% confidence interval, 1.23). in our study, we have found the prevalence of htn in tn to be 37% compared to the 32% seen in the control population. the reported rates of htn in the normal population have ranged from 28.7 to 29.3% [7, 8 ]. the slight increase in the prevalence of htn in the control group might be attributed to the fact that our sample is a convenience sample. the 5% difference in the prevalence of htn between the two groups was not statistical significant. this might also be due to our sample size, which was too small to show a statistically significant difference. also, tn is a rare disease, with an overall prevalence of 0.10.2 per 1,000 and an incidence ranging from about 45/100,000/year, and therefore it is difficult to obtain a large tn patient sample. larger population - based studies might provide more evidence regarding the association between tn and htn. in our study, htn was not found to be a significant risk factor in patients with tn. the limitations of our study include the following : (1) retrospective chart review, (2) convenience sample, which will restrict the extrapolation of prevalence data to general population, and (3) lack of data regarding the duration of htn, which will be important as the vascular stiffness and nerve compression may worsen with prolonged hypertension. in general, retrospective studies are not the best way to study risk factors for diseases. therefore, further prospective studies, with an accurate clinical assessment of htn, are needed to conclusively clarify the possible relationship between htn and tn. to the best of our knowledge, our data show that hispanics had the highest prevalence of tn followed by caucasians in comparison to other races. since the los angeles area has a large population of hispanics this could explain the higher prevalence of tn noted in hispanics in this study. however, our study is comprised of a sample size with a very diverse racial composition, which prevents the racial differences from this study from being extrapolated to the general population of the united states. in conclusion, our results suggest that there is no correlation between htn and the development of tn. since, both tn and htn are seen in the elderly, it is possible that htn is simply a co - existing condition in patients with tn. this conclusion should be taken with caution as this is a retrospective study and further prospective studies, with an accurate clinical assessment of hypertension, are needed to conclusively clarify the possible relationship between htn and tn. | it is unclear whether hypertension (htn) is a predisposing factor for the development of trigeminal neuralgia (tn). the purpose of this study was to determine the prevalence of htn in tn patients and controls at the usc orofacial pain and oral medicine center. a retrospective chart review was conducted from a database of over 3,000 patient records from 2003 to 2007. we identified patients diagnosed with tn with or without htn. a total of 84 patients (54 females ; 30 males) between the ages of 33 and 93 years were diagnosed with tn ; 37% had tn with htn and 32% of controls had htn. the increased prevalence of htn in the tn patients was not statistically significant (p = 0.50). since, both tn and htn are seen in the elderly, it is likely that htn is simply a co - existing condition in patients with tn and not a risk factor for its development. |
acute lymphoblastic leukemia (all) is a hematological malignant disorder caused by excessive production of leukocytes and is the most common malignancy in children, representing 2530% of all childhood malignancies. great improvements have been made in all treatment, with successful long - term survival rates of approximately 80% over the past four decades.1,2 despite the significant success rate, the remaining 20% of patients still present treatment failure. furthermore, surviving patients often present significant levels of toxicity, which warrants the need of new treatment strategies.3 all chemotherapy regimen consists of the following phases : remission - induction, consolidation, and continuation phase. other treatments such as radiation therapy, steroids, and bone marrow or stem cell transplantations can also be included. among the major drugs used during treatment phases are glucocorticoids, anthracyclines, vincristine and l - asparaginase (l - asp), which has been used for a long time in all treatment.4,5 asparaginases are enzymes derived mainly from bacteria and the three enzymes that have been used are derived from escherichia coli (e. coli - asparaginase), a pegylated form of native e. coli - asparaginase (peg - asparaginase), and an erwinia chrysanthemi - derived asparaginase (erwinia - asparaginase).6,7 a great improvement in patients overall survival was achieved by l - asp administration, making it an essential drug in all treatment protocols79 ; however, several side effects, caused by l - asp toxicity, encourage an open debate among oncologists regarding the optimal dosage and formulation of l - asp. thus, this review presents an overview on l - asp data and focuses on cellular mechanisms underlying resistance and the efficacy of different asparaginase formulations in childhood all treatment. l - asp enzyme is responsible for the conversion of l - asparagine to aspartic acid and ammonia. with the aid of l - asparagine synthetase (as), normal cells can synthesize l - asparagine, whereas tumor cells are essentially dependent on extracellular pools of l - asparagine for cell proliferation and survival. the depletion of circulating pool of asparagine reflects asparaginase antitumor effect, by inhibiting dna and protein synthesis and thus compromising tumor growth.10 since its first description as an antitumor agent, the interest in l - asp enzyme production has significantly increased. a wide range of microorganisms have presented l - asp activity and among the major producers, bacteria, filamentous fungi, yeasts, and microbial sources from soil can be listed, although only asparaginase from e. coli and e. chrysanthemi have been produced on industrial scale.11,12 as initially mentioned, three asparaginase formulations are commercially available (e. coli - asparaginase, peg - asparaginase, and erwinia - asparaginase) and the drug activity and efficacy of each one of them can be influenced by drug structure, dosing schedule, and immunology reaction through antibody production.13 several clinical studies support the use of l - asp in all therapy and its use in remission - induction and intensification phases is critical in all pediatric all protocol. l - asp treatment efficacy is closely related to all subtype and specific genetic abnormalities such as hyperdiploidia and tel - aml1 chromosomal rearrangement are the most sensitive, whereas high - risk all subtypes such as bcr - abl positive and t - all are less susceptible.14 high - dose use of l - asp and prolonged intensification have been reported as critical for reduction of relapse and complete remission including high - risk patients such as lymphoblastic lymphomas and t - derived all.4,15 additionally, drug combinations using l - asp along with corticosteroids (prednisolone and dexamethasone), and other chemotherapy agents as methotrexate, vincristine, and mercaptopurine, can potentiate l - asp activity and consequently improve patient s outcome.16,17 despite the successful role of the use of l - asp in childhood all treatment, its use is limited and constantly re - evaluated due to serious side effects mainly caused by toxicity. interestingly, most of the observed side effects arise from a second substrate specificity of asparaginase, which can also deplete the concentration of glutamine due to its structural similarity.18,19 among the side effects provoked by this glutaminase side activity of l - asp are pancreatitis, hemostasis abnormalities, thrombotic and neurological complications, and hypersensitivity reactions (eg, clinical allergy) due to antibody production. usually, children are more tolerant to l - asp - induced side effects, whereas adolescents and young adults are more sensitive and often develop significant morbidity.2022 innumerous studies have reported that delivery of concomitant vincristine and prednisone and shorter time intervals between l - asp doses reduces the probability of hypersensitivity reactions23 ; however, concomitant therapy with anthracyclines and/or steroids may increase the risk of pancreatitis.4 to overcome toxicity and severe side effects, different asparaginase formulations have been constantly modulated, and the best approach to deal with such an administration schedule has been the main focus of clinical investigation studies in the last decades. for instance, the risk for pancreatitis or thromboembolism seems to be similar among different l - asp preparations.4,24 aspects of different asparaginases formulations are listed in table 1. one of the major concerns during l - asp treatment is the development of drug resistance mechanisms which are mainly derived through antibodies production in response to l - asp, since all asparaginase sources are from a variety of microorganisms.1,7 yet, unnecessary doses are also a challenge to be defeated. repeated administration of l - asp leads to the development of specific antibodies and hypersensitivity reactions.25,26 for example, in case of allergic reactions to native e. coli - asparaginase, patients are usually switched to either peg - asparaginase or erwinia - asparaginase,27,28 although similar incidence rates of hypersensitive reactions have been reported for both native l - asp and peg - asparaginase. reactions to erwinia - asparaginase, however, may be less frequent.24 in particular cases, hypersensitivity does not have an evident clinical presentation but can still result in inhibition of asparaginase function, leading to a condition known as silent inactivation.2830 recent studies showed that children with silent inactivation of native e. coli - asparaginase are more prone to poor outcomes as they were not benefited by immediately switch to alternative asparaginase agents.31 additionally, native e. coli - asparaginase used in induction can lead to peg - asparaginase silent inactivation. as reported by tong and colleagues, a high incidence of peg - asparaginase inactivation (22% clinical allergy and 8% silent inactivation) in the intensification phase has been observed because of antibody development against native e. coli - asparaginase used in induction.32 this implies that peg - asparaginase should be used upfront during induction course instead of native e. coli - asparaginase since this approach has been shown to result in less antibody production. if antibody titers are low, peg - asparaginase may still provide adequate activity levels29 ; for example, a dose of 2500 iu / m2 given weekly has been shown to provide therapeutic levels in relapsed all patients who have previously received e. coli - asparaginase.33 it is interesting to point out that cross - reactivity between antibodies against native e. coli l - asp and its pegylated form can frequently occur, but does not affect erwinia - derived enzyme.30 thus, switching to erwinia - asparaginase in case of allergy or silent inactivation of peg - asparaginase can be an alternative to achieve effective asparaginase levels.32 in clinical practice, however, the relevance of asparaginase antibodies seems to be limited, hampered by low specificity of the tests currently available to antibody detection, and thus, monitoring the serum asparaginase activity levels is a suitable strategy.30,34 silent inactivation detection is critically important to prevent useless continuation of an inactive asparaginase product, which may lead to worse event - free survival (efs) as shown by panosyan. (2013).31,35 however, it has been recently shown that among patients initially treated with peg - asparaginase on frontline protocols (which subsequently relapsed), silent inactivation does not seem to be a significant clinical issue. nevertheless, drug monitoring is the only way to detect cases of silent inactivation of asparaginase agents and ensure adequate drug levels and toxicity management.30 despite e. coli and erwinia - derived l - asp known side effects, they are still preferred due to their considerable efficacy, economic production, and ease of process modification, optimization, and purification. however, new formulations and approaches to optimize this enzyme administration have constantly been proposed. for instance, several asparaginase formulations from different fungi strains have been reported as the search for alternative asparaginases in eukaryotic microorganisms could provide less toxic enzymes. extracellular l - asp produced by aspergillus terreus (strain pc1.7.a) and bacillus licheniformis has been purified and presented promising antitumor effects in several cancer cell lines along with low glutaminase activity and no cytotoxicity effect against normal human cells.36,37 although bacteria - derived asparaginase are relatively more stable than corresponding enzymes derived from plants or animals,12 these alternative sources have also been investigated. in plants, l - asp enzymes are required to catalyze the release of ammonia from asparagine (which is the main nitrogen - relocation molecule in these organisms), and are presented in significant amount in a variety of plant species. for example, withania somnifera, a traditionally indian medicinal plant, is an alternative source of l - asp with high specificity and potential success for future large - scale production.38,39 in another innovative attempt to optimize asparaginase activity, l - asp encapsulated within erythrocytes (graspa) has been used to enhance asparaginase half - life. a phase i / ii study has reported long - term serum asparagine depletion, good tolerance, and lower administration doses, as one single injection of 150 iu / kg of graspa provided similar activity as eight injections at 10,000 iu / m2 of native e. coli - asparaginase. this study, conducted in both children and adults in refractory all, also showed a significant reduction of allergic reactions and coagulation disorders, supporting the safety profile of graspa altogether, the findings previously described emphasize the urge for individualized dose schedule as well as careful enzyme activity monitoring in all patients undergoing repeated courses of l - asp treatment. additionally, new alternative asparaginase sources could certainly optimize the drug administration and lead to a better outcome during all treatment. the main effects induced by l - asp on in vitro leukemia cells involve suppression of protein synthesis, g1 cell cycle arrest, and apoptosis induction. however, the exact events that lead to cell death following l - asp treatment are unknown.4143 in order to understand the mechanism underlying sensitivity or resistance observed in clinical practice, several works have studied the response induced by l - asp in clinical samples and in vitro models of leukemia. this information is important since the prognosis for patients with all is closely related to the cellular resistance to chemotherapeutic agents.44,45 one of the mechanisms of l - asp resistance could be associated with as expression, which can directly modulate asparagine synthesis. different studies attempted to investigate the expression levels of this enzyme before and after l - asp treatment to address the potential role of as expression in asparaginase treatment resistance. cell line studies showed that l - asp - sensitive leukemic cells have low intracellular as activity and are dependent on the availability of extracellular asparagine.43 andrulis. demonstrated that complete asparagine depletion in vitro results in an amino acid - dependent upregulation of mrna, protein, and activity of as.46 resistance to l - asp in cell lines is in vitro - mediated by an upregulation of as expression in response to asparagine depletion of culture medium.41,47 whereas these cell line studies suggest that upregulation of as expression is an important mechanism of l - asp resistance, clinical evidence is lacking for this assumption.41 recent studies found evidence that a high baseline intracellular as gene expression is related to in vitro l - asp resistance in children with tel / aml1-negative all, but not in tel / aml1-positive children.48,49 appel. reported that although l - asp exposure induces the expression of as mrna, the upregulated gene expression does not correlate with an early clinical poor response to this drug in children with all. moreover, it is noteworthy that l - asp - induced upregulation of as mrna is not related to early in vivo blast reduction in childhood all and thus is not predictive for the short - term clinical response to l - asp.50 recently, gene expression profiling revealed that l - asp - resistant all cells overexpressed several ribosomal protein - encoding genes as well as initiation factors.45 using gene expression profiling, fine. showed that l - asp - resistant cell lines expressed more baseline as mrna than sensitive leukemic cell lines, whereas no such association was found for primary pediatric all samples.51 this study emphasizes the fact that leukemic cell lines and primary samples from leukemia patients are different from each other and cell line data can not be totally extrapolated to primary patients cells. in primary patients samples, the exposure to l - asp altered the expression of a number of genes related to protein synthesis (ie, trna synthetases and amino acid transporters). however, no genes discriminative for l - asp resistance in patient samples were found. these data point to a consistent coordinated response to amino acid starvation, which occurs regardless of the level of resistance to l - asp in patients cells. therefore, asparagine synthetase upregulation may be a consequence of amino acid deprivation by l - asp, but it is not the limiting key factor explaining resistance to l - asp in pediatric all. it is important to highlight, however, that the studies conducted so far only presented results on as expression and failed to investigate the as activity, thus limiting the data to support the hypothesis that as expression could mediate l - asp resistance. other investigation approaches have focused on identifying different mechanisms of l - asp resistance. as gene polymorphism has been described as one of the genomic determinants of asparaginase sensitivity among variations in atf5, ass1 genes as well as gene variants from aspartate metabolism pathway. suggested that a 14-bp tandem repeat sequence located in the first intron of as gene may act as a transcriptional enhancer element ; carriers of more than two repeats (> r2) may exhibit a higher expression of as.52 additionally, rousseau and coworkers reported that all pediatric patients, who were homozygous for double repeat (r2) of the first intron tandem repeat sequence of as gene, had reduced efs.53 on the other hand, pastorczak. revealed that r3 carriers with a poor response at day 15 had an increased risk of events.52 based on the results of these studies, it is likely that genetic variability in the as gene may influence the clinical outcome of children with all ; nevertheless, these data need to be confirmed by further investigations in other populations and different treatment protocols. although most studies investigating the l - asp resistance have focused on all cells, new information has been emerging from the role of stromal cells in the synthesis of as. the stromal cells, which form the microenvironment where leukemic cells grow, are basically formed by bone marrow - derived mesenchymal cells (mscs). as expression levels in mscs from all patients were on average 20 times higher than those in leukemia cells. moreover, mscs protected all cells from asparaginase cytotoxicity in co - culture experiments. this protective effect. showed that stromal cells induced the igfbp7 expression by all cells.55 igfbp7, in an insulin / igf - dependent manner, enhanced as expression and asparagine secretion by bmscs, thus providing a stromal - dependent mechanism by which igfbp7 protects all from l - asp treatment. recently, dimitriou. found that values of the as mrna of mscs seem to reach a peak at diagnosis, and tend to decline with treatment.56 besides the mscs, a study has showed the function of adipocytes in the leukemia microenvironment to protect leukemia cells during l - asp treatment.57 altogether, these results provide a new basis for understanding asparaginase resistance in all and indicate that the niche in the bone marrow have a pivotal importance in the all cells resistance to l - asp. besides genomic modulation and alterations, epigenetic changes are also investigated concerning its role in resistance to l - asp. micrornas regulate the activity of protein - coding genes including those involved in hematopoietic cancers. schotte. analyzed the expression levels of 397 mirna by stem - looped rt - qpcr mirna assays.58 the results demonstrated that different genetic subtypes of all and drug - resistant cases have unique mirna expression profiles and selected mirna was associated with the clinical outcome of all patients. but only the mir-454 was expressed at a 1.9-fold lower level in l - asp - resistant cases. microrna-196b (mir-196b) is highly expressed in mixed - lineage leukemia (mll)-rearranged all.59 it has previously been shown that both mll - rearranged and t - all pediatric all cases are more resistant to prednisolone and l - asp.60 however, schotte. did not find evidence that mir-196b contributes to resistance to these drugs since patients with high mir-196b expression were not more resistant to both drugs than patients with low mir-196b expression levels.61 despite the progress made so far, more studies are needed to find whether the molecular data can be further associated with clinical response to l - asp. moreover, understanding the mechanisms underlying resistance to l - asp treatment may bring new insights into all tumor biology and contribute to the development of more effective treatment strategies, such as individualized dose schedule as well as alternative asparaginase drug combinations and sources. | great improvements have been made in acute lymphoblastic leukemia (all) treatment in the past decades, especially due to the use of l - asparaginase (l - asp). despite the significant success rate, several side effects mainly caused by toxicity, asparaginase silent inactivation, and cellular resistance, encourage an open debate regarding the optimal dosage and formulation of l - asp. alternative sources of asparaginases have been constantly investigated in order to overcome hypersensitivity clinical toxicity. additionally, genomic modulation as gene expression profiling, genetic polymorphisms, and epigenetic changes is also being investigated concerning their role in cellular resistance to l - asp. understanding the mechanisms that mediate the resistance to l - asp treatment may bring new insights into all pathobiology and contribute to the development of more effective treatment strategies. in summary, this review presents an overview on l - asp data and focuses on cellular mechanisms underlying resistance and alternative therapies for the use of asparaginase in childhood all treatment. |
continuous ambulatory peritoneal dialysis (capd) is an important treatment option for patients with end - stage renal disease. although the rate of peritonitis has declined in recent years because of improvements in capd techniques, peritonitis remains the leading cause for discontinuation of capd. rothia muciliaginosa (r. mucilaginosa) is a component of the normal flora of the mouth and respiratory tract and is usually associated with dental plaques, cavities, and periodontal diseases. it appears that the presence of an indwelling vascular catheter and previous treatment with ciprofloxacin increase the risk of invasive infection with rothia. although cases of peritoneal dialysis (pd)-associated peritonitis caused by r. mucilaginosa have been reported worldwide, no korean cases have been reported. to the best of our knowledge, this is the first case report of peritonitis due to r. mucilaginosa as a single pathogen in korea. herein, we describe a case of pd - associated peritonitis caused by r. mucilaginosa that was cured after a 2-week course of intraperitoneal antibiotic therapy. a 58-year - old korean man, who had been treated with capd for 3 years, was admitted to our hospital because of turbid peritoneal effluent accompanied by constant abdominal pain that began 1 day before his admission. the underlying causes of his end - stage renal disease were diabetes mellitus and hypertension. he exchanged dialysis solutions of 2 l per dwell 4 times / d, with the solution remaining in the abdomen for 6 hours and had a urine output of about 200 ml / d. on admission, his blood pressure was 120/80 mmhg, heart rate was 72 beats / min, respiratory rate was 18 breaths / min, and body temperature was 37.4c. his abdomen was diffusely tender with normal bowel sounds, and infection was not found around the catheter exit site. the laboratory findings showed pd - associated peritonitis : the white blood cell (wbc) count of the peritoneal effluent was 1,620/mm with a neutrophil predominance (90%). his hemoglobin was 9.9 g / dl, wbc count was 14.510/l, and c - reactive protein was 12.53 mg / dl (normal : < 0.8 mg / dl). after the peritoneal fluid was sent for bacterial culture, a single 1 g / d dose of cefazolin and a single 1 g / d dose of ceftazidime were given intraperitoneally. two peritoneal fluid samples were inoculated into a bactec plus aerobic / f culture bottle (becton dickinson diagnostic instrument system, drogheda, ireland) and incubated in a bact / alert 3d blood culture system (biomerieux, marcy l`etoile, france). culture of the peritoneal dialysate revealed streptococcus mitis, which was susceptible to levofloxacin, clindamycin, vancomycin, and tetracycline. the peritoneal wbc count decreased to 30/mm, and the patients clinical condition improved on the 5 day after starting intraperitoneal cefazolin and ceftazidime. however, he complained of abdominal pain and turbid peritoneal effluent 3 days after termination of intraperitoneal antibiotics. the wbc count of the peritoneal effluents was 2,140/mm with a neutrophil predominance (80%). we restarted intraperitoneal cefazolin and ceftazidime, and repeated culture of the peritoneal dialysate revealed s. mitis. according to the international society for peritoneal dialysis guidelines, we recommended removal of the pd catheter, but he refused our recommendation. therefore, we maintained intraperitoneal antibiotics, and the patient improved after intraperitoneal antibiotics for 2 weeks ; however, the patient experienced turbid peritoneal effluent 10 days after cessation of the second round of intraperitoneal antibiotics. the wbc count of the peritoneal effluents was 2,080/mm with a neutrophil predominance (85%), and repeated culture of the peritoneal dialysate revealed r. mucilaginosa. the peritoneal wbc count decreased to 8/mm, and abdominal pain disappeared on the 3 day after starting intraperitoneal cefazolin and ceftazidime. the patients condition improved, and he was discharged after a 2-week course of intraperitoneal antibiotics (fig. x - ray showed a poorly defined, surface - based lesion arising from the proximal shaft of the left clavicle. computed tomography scan revealed osteolytic bony destruction and soft tissue mass formation suggesting a malignant bone tumor, such as a chondrosarcoma or osteogenic sarcoma with pathologic fracture in the proximal portion of the left clavicle (fig. pd - associated peritonitis caused by r. mucilaginosa is rare, and this coccus has not been reported as the single causative pathogen of pd - associated peritonitis in korea. here, we report a case of peritonitis due to r. mucilaginosa that recovered after intraperitoneal antibiotic therapy. a malignant bone tumor on the left clavicle was coincidentally found. r. mucilaginosa is a gram - positive, coagulase - negative, encapsulated, non spore - forming coccus considered part of the commensal flora of the oral cavity and upper respiratory tract in humans. r. mucilaginosa appears to be an opportunistic pathogen in immunocompromised patients and has been implicated in serious infections such as septicemia, endocarditis, meningitis, pneumonia, and osteomyelitis. although cases of pd - associated peritonitis caused by r. mucilaginosa have been reported previously, there are no prior reports in korea. to the best of our knowledge, this is the first case report of pd - associated peritonitis due to r. mucilaginosa in korea. the most common risk factors for rothia infection are indwelling catheter, leukemia, cancer, cardiac valvular heart disease, intravenous drug abuse, severe neutropenia, and previous treatment with ciprofloxacin. r. mucilaginosa is usually associated with the formation of dental plaque and tooth cavities. in our case, the patient did not have any recent history of dental work ; however, he had a history of treatment with ciprofloxacin 2 months earlier and had a malignant bone tumor on the left clavicle. therefore, this patient was at high risk for pd - associated peritonitis related to atypical organisms such as rothia. recommendations for treatment of r. mucilaginosa - induced peritonitis were not included in the international society for peritoneal dialysis guidelines. however, based on previous literature, all patients with pd - associated peritonitis caused by r. mucilaginosa recovered after intraperitoneal antibiotic therapy including ampicillin, rifampin, vancomycin, and cefazolin. it was reported that a patient with human immunodeficiency virus was successfully treated with intraperitoneal vancomycin. another patient who had recently lost a renal allograft and was still on immunosuppressive therapy developed coagulase - negative staphylococcal bacteremia and culture - negative peritonitis treated with ceftriaxone and ofloxacin with removal of pd catheter. two months later, she was back on pd and had another episode of peritonitis, which grew r. mucilaginosa. it responded well to intraperitoneal vancomycin with resolution of symptoms in 2 days. in our case, we did not perform an antibiotic sensitivity test because of the absence of clinical laboratory standard institute guidelines for this organism. such antibiotics could be helpful to treat r. mucilaginosa - induced peritonitis if sensitivity test results are not available. in summary, we report a case of pd - associated peritonitis caused by r. mucilaginosa that was cured after a 2-week course of intraperitoneal antibiotic therapy. intraperitoneal antibiotics should therefore be considered as treatment for pd - associated peritonitis caused by r. mucilaginosa. | rothia muciliaginosa (r. mucilaginosa) is a facultative, gram - positive coccus that is considered to be part of the normal flora of the mouth and respiratory tract. there are sporadic reports of the organism causing endocarditis in patients with heart valve abnormalities, as well as meningitis, septicemia, and pneumonia associated with intravenous drug abuse. however, it is an unusual pathogen in cases of peritoneal dialysis (pd)-associated peritonitis. although r. mucilaginosa is generally susceptible to penicillin, ampicillin, cefotaxime, imipenem, rifampicin, and glycopeptides, there are no guidelines for the treatment of pd - associated peritonitis. herein, we report a case of pd - associated peritonitis due to r. mucilaginosa that was resolved with intraperitoneal antibiotic treatment. |
the greatest association of helicobacter pylori (h. pylori) infection is with peptic ulcer disease. recently, the association between h. pylori and the development of gastric cancer is more clearly established than before, and by the announcement of the japanese society for helicobacter research, h. pylori eradication should be undertaken in all subjects who are infected [1, 2 ]. the treatment to eradicate h. pylori by a triple therapy using a proton pump inhibitor (ppi), amoxicillin (ampc) and clarithromycin (cam) was approved and covered by insurance in japan in november, 2000. in february 2003, the eradication therapy went into broad use as a result of the eradication guidelines of the japanese society for helicobacter research. the initial eradication rate was good at about 90%, but a decline in eradication rate attributable to an increase in cam resistance was pointed out. consequently, the japanese society for helicobacter research conducted sensitivity surveillance from 2002 through 2006 in order to determine the prevalence of h. pylori drug resistance in japan. the results revealed that the cam resistance rate from 2002 to 2003 was 18.9%, followed by 21.1% in 20032004, 27.7% in 20042005. the reports also demonstrated that the cam resistance rate in japan since 2003 exceeded 20%, the condition the maastricht iii consensus report recommends the triple therapy using ppi, ampc and cam. in such a situation (cam resistance rate > 20%), it is recommended that drug sensitivity tests be carried out prior to eradication, but in japan sensitivity testing is not common because eradication therapies other than the ppi, ampc, and cam triple therapy are not approved for the first - line eradication therapy. in this study, we conducted a retrospective analysis of the status of eradication rate by ppi, ampc, and cam in our hospital in japan, where the rate of cam resistance is high. we retrospectively investigated the h. pylori eradication rate over time in 750 patients, who had been diagnosed as h. pylori - infected by at least one positive result from culture test, microscopy or c - urea breath test (ubt). the 750 patients had received the triple therapy based on a ppi (omeprazole (opz) 20 mg or lansoprazole (lpz) 30 mg or rabeprazole (rpz) 10 mg twice as day), ampc (750 mg twice as day), and cam (200 mg or 400 mg twice a day) at nagoya city university hospital from january, 1997 until december, 2008. successful eradication was determined by performing a ubt following the first month after eradication, and 8 g / ml) in four terms detected at nagoya city university hospital from january 1997 until december 2008. terms were divided as follows ; term 1 : 19972000, before eradication therapy was approved and covered by insurance in japan ; term 2 : 20012003, the first half of period when only omeprazole and lansoprazole were approved, term 3 : 20042006, the latter half of period when only omeprazole and lansoprazole were approved ; term 4 : 20072008, after rabeprazole was approved. the eradication rate by type of ppi was evaluated as well. the kruskal - wallis test and 491 men and 259 women with the average age of 56.1 14.2 years were enrolled in the study. the classification of disorders were gastric ulcers (258/750, 34.4%), duodenal ulcers (188/750 25.1%), gastroduodenal ulcers (57/750, 7.6%), other gastrointestinal disorders (247/750, 32.9%). the patients with gastrointestinal disorders mainly comprised patients with atrophic gastritis or patients having undergone endoscopic treatment for a gastric tumor. 709 patients were tested by ubt to determine whether the h. pylori was eradicated, and successful eradication was assessed in 559 of these patients. we divided the study into the four terms of 1997 to 2000 (term 1), before h. pylori eradication therapy was indicated and covered by insurance in japan ; the first half of the period from 2001 to 2006, when eradication therapy was based on opz and lpz (term 2, from 2001 to 2003) ; and the second half of that (20042006, term 3) ; and 2007 and later years (term 4), when treatment with rpz was approved for insurance coverage. there were no differences based on gender or type of disorder from term 1 to term 4, but the ages were significantly higher in terms 3 and 4 compared it in term 1. eradication rates significantly declined over time from 90.6% to 80.2%, 76.0% and 74.8% between term 1 and term 4 (fig. 1). on the other hand, primary cam resistance rose significantly over time between 1997 and 2008 from 8.7% in term 1, prior to 2000 ; 23.5% in term 2 ; 26.7% in term 3 ; and 34.5% in term 4 (fig. 2). in 159 patients who were tested for cam susceptibility, the eradication rate in those with cam susceptibility was 86.7% while the eradication rate in those with cam - resistant bacteria was 25.0%, which resulted in a significant difference. therefore, the rise in primary cam resistance is considered to be a major factor leading the decline in the first - line eradication rate based on triple therapy with the ppi, ampc, and cam. we also investigated the differences over time in the eradication rate for the different types of ppis. rpz was not used for eradication treatment from 2000, when eradication therapy was approved in japan, until 2007, when rpz was approved for insurance coverage. therefore, we compared the eradication rates by rpz for term 1 with term 4. for opz and lpz, eradication rates were compared in all four terms. a significant decline over time in eradication rates by opz / lpz from terms 1 to term 4 was observed ; 91.2%, 80.2%, 76.0% and 69.0%. on the other hand, no significant difference was found in the rpz eradication rates ; 89.2% in term 1 and 79.4% in term 4 (fig. the h. pylori eradication rate by triple therapy based on a ppi, ampc and cam is thought to be affected by age, smoking habits, drug compliance, polymorphisms of the cyp2c19 gene, and drug susceptibility, and cam resistance, in particular, is viewed to have a large effect on the eradication rate [610 ]. that arises from the big deterioration in eradication rate from about 80.6%98.3% for cam - susceptible bacteria to 0%33.3% for cam - resistant bacteria iii consensus report, triple therapy based on a ppi, ampc, and cam were recommended as the primary eradication drugs in areas where cam resistance is 30% over the past two years, which resulted in the remarkable decline in eradication rate along, falling to the 70% level. triple therapy with a ppi, ampc and cam needs to be re - examined in japan. triple therapy using a ppi, ampc, and metronidazole (mnz) is used in second - line eradication, and a high eradication rate over 90% has been reported in japan [1416 ]. in addition, new approaches to improve the eradication rate by concomitant with a mucoprotective drug or lactobacillus are attempted [17, 18 ]. triple therapy using mnz as first line eradication and new regimen using quinolone like levofloxacin, gatifloxacin, sitafloxacin or garenoxacin need to be developed [19, 20 ]. mean age of patients taking significantly rose in term 3 and 4 compared to term 1 in the present study as seen in table 1. however, broutet. reported higher failure rate among young patients, therefore, the significant higher age in term 3 and 4 was considered not to have influenced the lowering eradication rate in the present study. on the other hand, the eradication rate for triple therapies is reported to depend on the degree of acid secretion suppression, in addition to cam resistance, and the importance of acid secretion suppression has also drawn attention. the effect of suppressing acid secretion by a ppi was reported to rely on a polymorphism of the cyp2c19 gene. that the eradication rates for triple therapy based on a ppi, ampc and cam differ due to polymorphisms of the cyp2c19 gene is also reported in a meta - analysis. in patients with cam - resistant bacteria, in particular, the eradication rate is reported to be greatly affected by polymorphisms of the cyp2c19 gene. it was shown that the eradication rate for a double eradication therapy of ppi and ampc is affected by the extent to which acid secretion can be suppressed, and that is thought to be because the ppi 's ability to suppress acid secretion affects the eradication rate more for cam - resistant bacteria. in japan, opz, lpz and rpz are used in the eradication treatment, but rpz is reported to be less likely affected by cyp2c19 than the other two ppis [27, 28 ]. in fact, a meta - analysis reported the less influence of cyp2c19 polymorphism on triple therapy using rpz unlike the case of opz or lpz. in japan, there is a great deal of variety in polymorphisms of the cyp2c19 gene, and that is why we investigated eradication rates in triple therapy groups and in the group using rpz and the other groups using the opz or lpz. while the eradication rates in opz and lpz groups decreased significantly over time, no apparent decline in eradication rate was seen for the rpz group. also, rpz itself is indicated to possess antibiotic effects of against h. pylori, and it might have helped as well. however, we did not conduct detailed investigations because it was a retrospective study, nor did we measure cyp2c19 polymorphisms, and h. pylori drug susceptibility tests were carried out only for some cases. in the current situation where prevalence of primary resistance to cam increased, it was difficult to ascertain the reasons why differences arose in the effectiveness of h. pylori eradication by acid secretion - suppressing agents and triple therapy based on a ppi, ampc, and cam. however, the eradication rate for large - scale triple therapy using rpz is reported to be good and to be 90%, in spite of increase in the cam resistance rate in recent years. in addition, a prospective study reported a higher eradication rate of 91% with rpz than it of 81% with lpz prior to our report. the selection of a ppi should also be important in first line eradication today, and we need to make it clearer hereafter. the present study demonstrated the evident decline in eradication rates for the triple therapy using a ppi, ampc and cam in japan, and the increase in cam resistance rate is considered to be associated with the lower eradication rate. the first line eradication with new regimens must be developed and used. at the same time, ppi from which a higher eradication rate can be obtained should be selected from current regimen as well. | a triple therapy based on a proton pump inhibitor (ppi), amoxicillin (ampc), and clarithromycin (cam) is recommended as a first - line therapy for helicobacter pylori (h. pylori) eradication and is widely used in japan. however, a decline in eradication rate associated with an increase in prevalence of cam resistance is viewed as a problem. we investigated cam resistance and eradication rates over time retrospectively in 750 patients who had undergone the triple therapy as first - line eradication therapy at nagoya city university hospital from 1995 to 2008, divided into four terms (term 1 : 19972000, term 2 : 20012003, term 3 : 20042006, term 4 : 20072008). primary resistance to cam rose significantly over time from 8.7% to 23.5%, 26.7% and 34.5% while the eradication rate decreased significantly from 90.6% to 80.2%, 76.0% and 74.8%. based on the ppi type, significant declines in eradication rates were observed with omeprazole or lansoprazole, but not with rabeprazole. a decrease in the h. pylori eradication rate after triple therapy using a ppi + ampc + cam has been acknowledged, and an increase in cam resistance is considered to be a factor. from now on, a first - line eradication regimen that results in a higher eradication rate ought to be investigated. |
patients commonly present with acute cholinergic crisis, intermediate syndrome, or delayed polyneuropathy. they may also present with pancreatitis or hepatitis. here a 75-year - old homemaker presented to our emergency department following deliberate self - harm consuming around 100 ml chlorpyrifos along with small amount of kerosene. she was known to have systemic hypertension and was not on any treatment for the same. pulse rate was 120 beats / min and irregular. rest of the examination was normal. electrocardiogram showed rate 140/min, electrical alternans, multifocal ventricular ectopics, ventricular reentrant beats, ventricular couplets, and prolonged qt interval (corrected qt = 512 ms). transtubular potassium gradient was 6.85, and urine analysis revealed inappropriately raised urinary ph (7.5) with positive urine anion gap all suggestive of distal renal tubular acidosis. however, her cholinergic symptoms subsided, and potassium values started improving once atropinization was attained. blood gas analysis, urine potassium excretion, urine ph, and urine anion gap done were normal with serum potassium 4.5 meq / l. they inhibit acetylcholinesterase enzyme reversibly as well as irreversibly producing excess of acetylcholine in neuromuscular junction. hence, usually, clinical presentation of organophosphates includes excessive muscarinic symptoms such as increased salivation, lacrimation, urination, diarrhea, gastrointestinal cramps, emesis, and nicotinic symptoms such as tachycardia, hypertension, mydriasis, fasciculation, and weakness. rarely may they present with intermediate syndrome or delayed polyneuropathy.. it may be intense sympathetic activity due to nicotinic effect producing tachycardia and hypertension or muscarinic activity producing bradycardia and hypotension. third case, they may present with polymorphic ventricular tachycardia with prolonged qt in early phase of toxicity which is attributed to rise in free fatty acid levels by some authors. however, in all studies, echocardiogram was normal showing no permanent damage to heart. cardiac injury is a strong predictor of mortality in organophosphate poisoning, and direct myocardial injury is maximum in acute early phase of severe organophosphate poisoning. potassium value if <3 meq / l is known to present with multifocal ventricular ectopics, ventricular reentrant beats, ventricular couplets, and prolonged qt interval. in our patient, cardiac arrhythmias may be due to either organophosphate poisoning or hypokalemia or both combined. our patient had severe hypokalemia which was evaluated and detected to be due to distal renal tubular acidosis. transient distal tubular acidosis may be seen in paraproteinemia, medullary sponge kidney, nephrocalcinosis, obstructive uropathy, and autoimmune diseases. there was one reported case where distal tubular acidosis was detected with accidental kerosene ingestion. however, that patient also had concomitant ingestion of metformin in a high dose which produced lactic acidosis and acute renal failure. however, in our case, very minimal amount of kerosene has been ingested which can not explain her tubular acidosis. hence, the same may be attributed to organophosphates itself as it completely improved after atropinization. toluene poisoning presenting with transient distal renal tubular acidosis was reported, which has been attributed to impaired active hydrogen ion transport and hydrogen ion back diffusion. the same mechanism may be the cause of transient distal renal tubular acidosis due to organophosphate poisoning also though conclusive proof is yet to be availed. hence, it is better to know about all atypical presentations and expected complications of its toxicity. although neurological complications are quite well described, many others such as pancreatitis, hepatitis, and cardiac toxicities are seldom accounted. we are presenting this case just to open up possibility of a rare complication of organophosphate poisoning, distal renal tubular acidosis which should be thought of in the presence of persistent hypokalemia refractory to treatment. | renal complications due to organophosphate poisoning are very rare. we are presenting a unique case of transient distal renal tubular acidosis due to organophosphate poisoning, which to the best of our knowledge is the first of its kind. an elderly female after deliberate self - harm with ingestion of chlorpyrifos had multiple ventricular arrhythmias due to hypokalemia secondary to distal renal tubular acidosis which improved completely after treatment. |
clefts of the anterior and posterior arch of the atlas are rare, but well - documented congenital anomalies [1, 2 ]. several reports attributed the aetiology of os odontoideum to an either embryologic, traumatic or vascular basis [35, 8 ]. we describe the unusual case of a combined midline cleft of the anterior and posterior arch of the atlas associated with os odontoideum leading to atlantoaxial instability with acute myelopathia after a minor trauma. a 15-year - old male patient injured his cervical spine in a hyperflexion trauma when performing a somersault on a trampoline. initial x - rays and computed tomography demonstrated a displaced os odontoideum which reduced on extension and a rostral compression of the cervical spinal cord due to a subluxation of c1 over c2 with narrowing of the spinal canal to 50%. additionally midline clefts of the anterior and posterior arch of the atlas became evident (figs. 1, 2). mri scans revealed increased cord signals at c1/c2 levels on t2-weighted images and a persistent subdental synchondrosis was visualized on t2-weighted turbo spin echo sequences (fig. the patient underwent closed reduction and posterior atlantoaxial fusion by sublaminar tension band wiring with autologous bone grafting and transarticular lag screw fixation. radiographs taken 1 year after the trauma showed a stable fusion of c1/c2 (fig. 4). the patient presented with a range of motion at 30 of extension, 40 of flexion and 50040 of rotation. he was free of symptoms and had returned to his pre - injury status regarding work and leisure activities. 1x - rays of the cervical spine in neutral position (a), flexion (b) and extension (c). 2ct scans reveal midline clefts of the anterior and posterior arch of the atlas (a). displaced os odontoideum and subluxation of c1 over c2 with narrowing of the spinal canal (b)fig. 3t2-weighted mri images with increased cord signals at c1/c2 levels and a persistent subdental synchondrosisfig. stable atlantoaxial fusion after sublaminar wiring and transarticular screw fixation in ap (a) and lateral (b) view x - rays of the cervical spine in neutral position (a), flexion (b) and extension (c). ventral subluxation of c1 over c2 in flexion (b), which reduces on extension (c) ct scans reveal midline clefts of the anterior and posterior arch of the atlas (a). displaced os odontoideum and subluxation of c1 over c2 with narrowing of the spinal canal (b) t2-weighted mri images with increased cord signals at c1/c2 levels and a persistent subdental synchondrosis follow - up x - rays 12 months after trauma. stable atlantoaxial fusion after sublaminar wiring and transarticular screw fixation in ap (a) and lateral (b) view body of the axis, lateral masses and posterior arch arise entirely from the second cervical sclerotome. the atlas is formed from three primary ossification centres, which develop during the seventh week of gestation. two centres at the lateral masses extend posteromedially to form the posterior arch usually in the fourth year. ossification of the anterior arch involves one or two ossification centres, which extend posterolaterally to fuse with lateral masses around the seventh year. the odontoid process separates from the atlas between the sixth and seventh week of intrauterine life and moves caudally to join the body of the axis (fig. 5scheme of the embryologic development of atlas and axis scheme of the embryologic development of atlas and axis os odontoideum is an oval or round shaped ossicle of variable size with a smooth cortical border. failure of fusion of ossification centres in the odontoid process has been considered to be the main aetiology. considerable evidence on cases of acquired os odontoideum indicates, that occult fractures with subsequent avascular necrosis might result in similar pathology. orahilly. studied the cervical spine of 8-weeks - old human embryos and observed that axis consists morphologically of three parts. two rostral parts form the odontoid process and a caudal part gives rise to the axis body, separated from the middle part by subdental synchondrosis. a segmentation anomaly of the two rostral parts, which never occurred in normal individuals, may result in bipartite dens. currarino reported 11 cases with complete or partial segmentation defect in mid odontoid, suggesting an embryological anomaly characterized by a complete segmentation of two rostral parts of axis which may explain the congenital os odontoideum. malformations of the atlas are very rare and include both clefts and aplasias [1, 2 ]. galindo and francis reported the incidence of anteroposterior spondyloschisis of the atlas in normal individuals as 0.3%. presented a report of bipartite atlas with anterior arch aplasia associated to an os odontoideum. they found a small projection on the anterior surface of the dens and concluded that the ossification centre of anterior arch of atlas may fail to separate from future dens resulting in anterior arch aplasia with a small tubercle attached to the anterior surface of the dens. to our knowledge no other case of bipartite atlas with os odontoideum had been reported previously in the english literature. in our case, there was a malformation of the anterior and posterior arch of the atlas and a persistent subdental synchondrosis, both likely to be a result of a congenital failure of fusion of ossification centres. the associated os odontoideum was clinically silent until a traumatic instability occurred which resulted in acute myelopathy. both the combined anterior and posterior clefts of atlas and os odontoideum are either asymptomatic or, if cervical instability arises, may develop neurological symptoms. we described a rare association of an anterior and posterior midline cleft of the atlas with an os odontoideum in an adolescent. minor trauma is commonly the cause for the onset of symptoms, which may occur immediately after the injury, be transitory and experienced repeatedly or have a delayed progressive course. if the lesion is reducible, atlantoaxial fusion is recommended. | we report on the case of a 15-year - old adolescent who presented with a transient paraplegia and hyposensibility of the upper extremities after sustaining a minor hyperflexion trauma to the cervical spine. neuroimaging studies revealed atlantoaxial dislocation and ventral compression of the rostral spinal cord with increased cord signal at c1/c2 levels caused by an os odontoideum, as well as anterior and posterior arch defects of the atlas. the patient underwent closed reduction and posterior atlantoaxial fusion. we describe the association of an acquired instability secondary to an os odontoideum with an anteroposterior spondyloschisis of the atlas and its functional result after 12 months. the rare coincidence of both lesions indicates a multiple malformation of the upper cervical spine and supports the theory of an embryologic genesis of os odontoideum. |
the population of republic of korea is aging at an unprecedented fast rate. and per capita medical utilization due to geriatric illness has increased since 2002 in accordance with an aging society. among geriatric diseases in women, there are some diseases related to menopause in this aging society.1 average menopause age and average life expectancy is 49.7 and 85.5, respectively in korean women, which means that they almost suffer from postmenopausal symptoms for two - fifth of their lives. the postmenopausal period in women has increased in accordance with increase in average life expectancy. therefore, healthcare and management for postmenopausal women has become important issues recently.2 incidence of alzheimer 's disease, one of postmenopausal diseases, rapidly increases after 65 years old in women, which is 1.5 to 3 times higher than men 's incidence. and cognitive function is decreased more when bone loss is occurred fast, which implies that there is a strong relevance between endogenous estrogen and alzheimer 's disease.3 appropriate brain action is controlled by estrogen in women. therefore, disorder in mood, memory, and cognitive function can be happened when estrogen level is dropped under estrogen setting point : for some reason, or at any time or at any age, the brain 's estrogen levels are decreased below estrogen setting point which defined as brain 's estrogen requirement level needed to modulate the brain activity.3 cholinesterase inhibitors, donepezil, rivastigmine, n - methyl - d - aspartate (nmda)-glutamate receptor, and memantine, are mainly used for the treatment of alzheimer 's disease generally. although these drugs can improve cognitive function of patients with alzheimer 's disease temporally, adverse effects and toxicity can be occurred in case of long - term use. because of these problems, interests toward hormone therapy and cell therapy have been increased.1 cell therapy can compensate the defects and limitations of existing chemical medicines and become newly developed treatment for alzheimer 's disease. besides alzheimer 's disease, it can be used as treatment for other perimenopausal symptoms. therefore, we will figure out trend of studies about cell therapy for alzheimer 's disease. estrogen deficiency caused by menopause is related to heart disease, stroke, colon cancer, osteoporosis, fracture, and alzheimer 's disease, etc. also, serotonin extinction induced by low progesterone and norepinephrine causes depression and gives negative effects on mood, sleep, and appetite. alzheimer 's disease affects patients ' daily lives and causes disorders such as decrease in memory, linguistic ability, intellectual capacity and changes in personality, depression, dromomania, anxiety, aggression, unstable sleep, dromomania at night, etc. these behavioral and mental disorders are strongly related to malfunction of neurochemicals such as gamma - aminobutyric acid (gaba), norepinephrine, dopamine, serotonin.4 sex steroid hormones like estrogen affect brain in two different ways in accordance with development process of central nervous system (cns) : organizational effect, activational effect. estrogen receptor in the cns is expressed in multiple regions like hippocampus, hypothalamus, pituitary, etc. cns is representative target organ of sex - steroid hormone. according to animal experiment and clinical studies, it negatively affects pathological pathways and estrogen production, consequently lead to behavioral disorders and diseases such as changes in mood, function of sensory organ, convulsion and pain sensitivity and parkinson 's disease, etc. estrogen is associated with the activation of acetylcholine which modulates cognition, learning and memory. when estrogen level is dropped below the estrogen setting point, which is brain 's estrogen requirement level needed to modulate the brain activity, malfunction in brain center occurred. finally, it probably causes disorder in mood, memory, and cognitive function regardless of reasons, stages and ages. generally, rapid loss of estrogen below the estrogen setting point is occurred physiologically in postmenopausal women.3 and significant changes are seen in estrogen receptors in the cns under estrogen setting point, accordingly, behavioral changes are observed as well. it increases dendritic spine and synapse of neuron by stimulating neuron formation in brain. on the other hand, progesterone, estrogen antagonist, there is no obvious study of whether estrogen levels in all postmenopausal women fall below the estrogen setting point. however, studies on relationship between estrogen and alzheimer 's disease suggest that aging and estrogen loss in postmenopausal women are possible risk factor for alzheimer 's disease : the incidence of alzheimer 's disease is particularly high in women aged over 65. body weight has also been suggested as a risk factor of alzheimer 's disease : higher body weight increases the level of blood estrogens, and lower body weight is common among patients with alzheimer 's disease. recently, a hypothesis that alzheimer 's disease is a type of postmenopausal estrogen deficiency has been raised. regarding this hypothesis, some studies suggested that postmenopausal estrogen deficiency damages specific part of the cns related to the factors affecting neuropathic changes and causing aging and alzheimer 's disease.5 melatonin, known as sleep - inducing hormone, is effective in treating alzheimer 's disease and autism, etc. the problem is that if this insufficient sleep status lasts for a long time, cognitive functions and immune functions are getting lower and lead to high risk of neurologic diseases emergence including alzheimer 's disease. at the same time, inflammatory cell response in the brain hippocampus and increased level of oxidative stress are shown. and fragile x mental retardation protein (fmrp), preventing mental retardation and autism, is decreased. lack of sleep induces oxidative stress, inflammatory response in brain cell and decreases fmrp expression, which prove that it is highly related to decreased cognitive function, neurologic diseases like alzheimer 's disease.6 when introducing cell therapy technology and its value to the general populations, diabetes mellitus and alzheimer 's disease are mainly suggested as examples that easily applicable and has a big possibility of success, although these are inveterate diseases. there is a limitation to differentiate neuron for treating alzheimer 's disease only by using biological knowledge. because of this situation, studies on adult stem cell, fetal nerve tissue in alzheimer 's disease are rarely performed, unlike in other diseases. despite that alzheimer 's association tried to verify if it is possible to replace damaged neuron with neural stem cells differentiated from bone marrow mesenchymal stem cells and apply this to alzheimer 's disease in 2002, its effectiveness in alzheimer 's disease hasn't been proved yet. however, it is expected that stem cells are well worth applying to alzheimer 's disease patients for treating. also alzheimer 's disease cell therapy using embryonic stem cells and alzheimer 's disease related mutant genes (amyloid precursor protein [app ], tau, presenilins) is currently under development. if further studies about embryonic stem cells are performed, neuroembryological and neurobiological understanding of alzheimer 's disease and its therapeutic clues can be discovered.7 when adipocyte stem cells are administrated intravenously to animal models with alzheimer 's disease, it pass through blood - brain - barrier (bbb) and move into brain. consequently, positive neuropathological effects such as improvement in scholastic skills, memory were shown. in this mechanism, up - regulated interleukin-10 and neurotrophic factors, which both are neuroprotective, were shown.8 also, level of amyloid beta and c - protein that destroying brain cells were significantly decreased due to the effect of stem cell administration, and this is because toxoprotein proteolytic enzyme were increased. also, stem cells grafted on brain induce neuronal differentiation, proliferation of endogenous neural precursor cell and its surrounding cells in hippocampus and improve dendrite safety.9 therapeutics for alzheimer 's disease have usually been developed to improve patients ' cognitive functions so far. the problem is that it just delays aggravation of symptoms, and it is impossible to expect complete recovery of alzheimer 's disease. also, variety of therapeutics for alzheimer 's disease such as natural product, stem cell therapy have been developed in south korea as well. for example, sex - steroid hormone including estrogen is expected to act on brain as well as used in the treatment of osteoporosis, breast cancer, etc.10 another example is flibanserin, which is act on brain. it controls dopaminergic and serotonergic activity neurotransmitter metabolites in brain areas including prefrontal cortex, nucleus accumbens, hypothalamus, brain stem.1112 however, it is expected that it takes long time to achieve good results. these days, research and development associated with alzheimer 's disease have been widely performed, and considerable efforts have been devoted to investigate the risk factors of alzheimer 's disease : it is mainly about neuron damages such as acetylcholine (neurotransmitter) composition decrease, amyloid beta deposition, tau protein hyper - phosphorylation. decrease in choline acetyltransferase activation in cerebral cortex, hippocampus induces decrease in acetylcholine, and causes disorder in anamnesis, cognitive function. perivascular invasion of beta - amyloid protein causes neurofibroma, nerve cell loss, blood vessel lesion, etc. secondarily, and finally lead to brain dysfunction.13 there are two kinds of drugs for alzheimer disease which got an approval from united states food and drug administration : cholinergic neuron control drug like donepezil and nmda receptor antagonist drug. however, these are only effective in relieving the symptoms, whereas it is impossible to cure underlying causes of alzheimer 's disease and prevent aggravation of symptoms. recently, pharmaceutical companies in south korea are promoting research and development (r&d) programs associated with alzheimer 's disease therapeutics using natural substances and stem cells. r&d about natural product drug, and its clinical tests have been proceed in large pharmaceutical companies. not only natural product drug, but r&d about umbilical cord blood originate mesenchymal stem cell therapy, and its clinical tests are in progress. however, causes of alzheimer 's disease, which is the most important thing, haven't been proved clearly so far. accordingly, adequate therapies haven't been developed and applied to patients with alzheimer 's disease. therefore, not merely basic clinical study, but further specialized studies and r&d are required until therapeutics for alzheimer 's disease are commercialized. | we are rapidly becoming an aging society, with the ongoing increase in challenges of the elderly. the age - related cognitive decline in accordance with aging society is of major importance in public health. recent studies have proved the impacts of sex - steroid hormone on the brain ; compliant with aging, menopause and decrease in estrogen have an effect on the occurrence and prevention of alzheimer 's disease. a new hypothesis states that alzheimer 's disease is a postmenopausal dementia, and is a negative form of estrogen deficiency. in this review article, we reckoned the cause of postmenopausal alzheimer 's disease. we further investigated new cell therapies for postmenopausal alzheimer 's disease, which are under development in some pharmaceutical companies. one remedy is cell therapy that inhibits the amyloid beta formation, and the other is the umbilical cord blood derived mesenchymal stem cell therapy. |
the wnt signaling pathway is known to play a key role in regulating cellular differentiation, proliferation, survival, and apoptosis [13 ]. wnt proteins are a highly conserved family of secreted lipid - modified cysteine - rich glycoproteins that activate signaling cascades inside the cell by binding to a member of the frizzled (fz) family of g - protein - coupled receptors on the extracellular matrix. there are 19 members of vertebrate wnts, which can be grouped into two main classes based on their ability to stabilize cytosolic -catenin : canonical and noncanonical pathway [79 ]. recent works have also shown that certain wnt ligands, like wnt5a, are able to activate more than only one wnt signaling pathway [10, 11 ], so the strictly binary classification is becoming more and more outdated. malfunctioning of wnt signaling pathway is related to several diseases like osteoporosis, crohn 's disease, alzheimer 's disease, schizophrenia, and especially cancer [1, 16 ]. the ligand wnt3a belongs to -catenin dependent (canonical) wnt signaling, which binds to frizzled transmembrane receptors. subsequently the low - density lipoprotein receptor - related protein 5 (lrp5) or lrp6 receptor complex activates cytoplasmic disheveled proteins, which trigger the inhibition of glycogen synthase kinase 3 (gsk-3). the protooncoprotein -catenin accumulates in the cytoplasm as a consequence of the disassembly of the destruction complex that is formed by adenomatosis polyposis coli (apc), axin, and gsk-3. thus, -catenin can be translocated into the nucleus where it activates the transcription of target genes mediated by t - cell specific transcription factor (tcf)/lymphoid - enhancing factor (lef). these genes are responsible to regulate essential physiological processes in embryonic and adult development such as cell proliferation, differentiation, morphogenesis, and cell adhesion. with the indication of proliferation, there is a complex interplay between the canonical wnt signaling and the cell cycle. the wnt/-catenin signaling pathway is significant in stimulating progression of g1-phase by inhibiting gsk-3, which regulates cell cycle effectors and growth regulators. one direct target gene of the wnt/-catenin signaling pathway is the protooncogene myc, which was identified as a wnt target in colon cancer cells. the transcription regulator c the cyclin d1 coding gene ccnd1 is also a target gene of the wnt/-catenin pathway, which was described in colon cancer cells [22, 23 ]. cyclin d1 as an activator of cyclin dependent kinase (cdk) 4 or cdk 6 drives the g1/s phase transition [24, 25 ]. one nonradioactive method is an immunoassay based on incorporation of 5-bromo-2-deoxyuridine (brdu) into dna to determine dna synthesis, which correlates to s phase transition and thus to cell proliferation. assay an insoluble blue formazan product is produced by mitochondrial dehydrogenases by reduction of mtt (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide). in this study we investigated the proliferation of hek293 t cells under the influence of wnt3a ligands by using the mtt as well as the brdu assay. furthermore we compare the results from these assays with mitochondrial activity of wnt3a treated cells as measured by immunostaining of the electron transport chain protein sdha (succinate dehydrogenase complex subunit a). the human embryonal kidney cells, hek293 t, were cultured in dulbecco 's modified eagle 's medium (dmem) supplemented with 10% fetal bovine serum (pan biotech, aidenbach, germany), 1% nonessential amino acids, and 1% penicillin / streptomycin (sigma aldrich, st. ten thousand cells were seeded per well and cells were stimulated with escalating doses of wnt3a (r&d systems, minneapolis, usa), namely, 0, 10, 50, 100, 150, and 200 ng / ml, for 24, 48, and 72 h. mtt (sigma - aldrich, st. louis, usa) was dissolved in pbs at 5 mg / ml and 20 l of mtt solution was added to each well followed by an incubation of three hours at 37c in 5% co2. medium with mtt was then flicked out and 200 l dmso was added. to dissolve the crystals,, mnnedorf, switzerland) at 590 nm. for brdu assay a commercial kit after addition of brdu labelling solution the cells were incubated for three hours at 37c in 5% co2. after the final washing step 100 l / well substrate solution was added to the cells and the reaction was stopped after 15 min incubation at room temperature by using sulphuric acid. plates were read out immediately by an elisa reader at 450 nm. all assays were done in triplicate (n = 12). for calibration cells were seeded in different numbers (0,1 10 to 3 10). hek293 t cells were seeded into 24-well plates and treated with 0200 ng / ml wnt3a at a confluency of 30% and fixed in 4% formaldehyde after 24, 48, and 72 h. sdha antibody (abcam, cambridge, uk) at a dilution of 1 : 200 was added and cells were incubated for one hour. z1 from zeiss, jena, germany) and the accompanying software axiovision 4.7. using the bradford - assay protein concentrations in whole - cell lysates were determined. equal protein amounts were loaded on sds - polyacrylamide gels (nupage, 412%, life technologies, carlsbad, usa). gels were run at 150 v for 1 h and transferred onto nitrocellulose membranes via the iblot system (life technologies). membranes were analysed using primary antibodies against sdha, -catenin, c - myc, cyclin d1, and -actin (cell signaling, cambridge, uk), diluted 1 : 1000 in tbs - tween with 3% milk, followed by incubation with an appropriate horseradish peroxidase - conjugated secondary antibody (dilution 1 : 2000). total rna was isolated using nucleospin rna ii (macherey - nagel, dren, germany) and 1 g rna was reverse - transcribed with verso cdna - kit (thermo fisher scientific, schwerte, germany) in a volume of 40 l. sequences of the primers (mwg, munich, germany) used for semiquantitative reverse transcriptase pcr are for gapdh 5-catggtgctgagatttgccaac-3 (forward) and 5-tcaacaccttgaccttctcatcac-3 (reverse), for myc 5-ccgagcaaggacgcgactctc-3 (forward) and 5-gcctttcagagaagcgggtcct-3 (reverse), and for ccnd1 5-gcctgaacctgaggagcccca-3 (forward) and 5-gtcacacttgatcactctgg-3 (reverse). pcr amplification was performed using my taq red mix (bioline, luckenwalde, germany) according to the manufacturer 's protocol. the reaction was performed with preliminary denaturation for 2 min at 94c, followed by 30 cycles of denaturation at 94c for 1 min, annealing at 55c (ccnd1), 57c (gapdh), or 60c (myc) for 30 sec, and extension at 72c for 1 min. western blots and agarose gels were scanned by gel documentation system quantum st4 (vilber lourmat, eberhardzell, germany). the bands were quantified by using imagej software (wayne rasband, nih, bethesda, usa). in order to prove activation of the wnt pathway, we detected the amount of -catenin protein concentration in hek293 t cells after treatment with wnt3a (figure 1). after 24 hours of treatment, -catenin protein concentration rose with increasing concentrations of wnt3a. the highest -catenin protein concentration was identified at 24 hours with a concentration of 200 ng / ml wnt3a. here points 48 and 72 hours after treatment the effect of -catenin induction is not clearly recognizable any longer. furthermore we analyzed the regulation of the wnt target genes ccnd1 and myc after treatment with wnt3a both by semiquantitative rt - pcr and by western blot (figures 2 and 3). a basal level of c - myc and cyclin d1 was detected in untreated cells. the results of rt - pcr showed marginal changes in the amount of myc cdna and an induction of ccnd1 after 24 and 48 hours with 10 ng / ml wnt3a, as well as after 72 h with a concentration of 100200 ng / ml wnt3a. a slightly increased protein level of c - myc was observed with a concentration of 50 ng / ml after 24 hours. the western blot quantification of cyclin d1 showed an increase by a factor of 1,5 with a wnt3a concentration from 50 to 200 ng / ml after 24 hours. the protein level of c - myc ascended in the same way with the concentration of 50 ng / ml wnt3a after 24 hours. to study the effects of wnt proteins on cell growth, hek293 t cells were grown in 96-well plates for 24 hours before they were treated with wnt3a protein concentrations of 0, 10, 50, 100, 150, or 200 ng / ml, respectively. after 24, 48, and 72 hours of incubation, mtt and brdu assays were performed. the brdu assays show a clear trend ; with increasing concentrations of wnt3a the associated read - out increased (figure 4(a)), in which wnt3a indicates the highest growth rate after 48 hours and a concentration of 200 ng / ml. in contrast to the brdu assays, the mtt assays did not show a correlation between wnt concentrations and cell numbers. cell numbers stayed all about the same or decline in comparison to their relevant controls (see figure 4(b)). to further substantiate the role of wnt3a relating to the mitochondrial activity in hek293 t cells, amounts of sdha protein succinate dehydrogenase (sdh) with its subunit sdha is a key component of the citric acid cycle, which is involved in complex ii of the mitochondrial electron transport chain and is responsible for transferring electrons from succinate to ubiquinone. cells were treated equally to proliferation analysis experiments and incubated with sdha antibody as described above. the results (figure 5) showed an increasing fluorescence signal and also a more intense signal at western blot relative to the control after 24 hours of wnt3a treatment. after 48 hours the protein level registered by immunofluorescence microscopy or by western blot analysis showed no significant change. after 72 hours of wnt3a treatment even a decreasing signal was observed in both experiments. the highest signal was measured after 24 hours with 50 ng / ml wnt3a. wnt proteins are involved in various cellular functions including the regulation of gene expression for cell cycle and proliferation. wnt3a is known as a promoter of proliferation and migration of human lens epithelial cells, also for proliferation of fibroblasts or as a regulator of proliferation of pancreatic nit-1 beta cells. exposed that wnt signaling activates mitochondrial biogenesis by performing a large - scale rnai screen ; they identified genes which affect mitochondrial function, amongst other myc. in this work we determined the effects of wnt3a on proliferation of hek293 t cells for this we applied two major assays, which are widely used for analysis of proliferation rates of cultured cells, namely, the mtt and the brdu assays. in doing so, the specific effects of wnt ligands on dna synthesis and mitochondrial activity were detected and compared directly. in order to establish our system and to prove the effect of wnt3a on the wnt pathway in hek293 t cells we demonstrated the induction of -catenin after 24 hours of wnt3a treatment and we analyzed the expression levels of myc and ccnd1. c - myc has a key role in g1-phase progression ; it upregulates cyclin d1 and represses p21 and p27 [34, 35 ]. cyclin d1 in turn promotes phosphorylation and inhibition of the retinoblastoma (rb) complex, which itself upregulates the cyclin e level [19, 36 ]. the enrichment of cyclin e leads to the transition of the g1/s - phase checkpoint. during g1-phase mitochondria this oxidative phase is followed by a reductive period during s-/g2-/m - phase of the cell cycle, in which replication of dna and proliferation of mitochondria take place. proliferation rates of wnt3a treated hek293 t were different, when measured by the two assays used in this study. the mtt assay measures the activity of mitochondria ; on the other hand the brdu assay detects the relative amount of newly synthesized dna. refer to a highly significant relationship between brdu and mtt in their results with canine lymphocyte proliferation, although the brdu assay is proved to be more sensitive than the mtt assay. the apparently negative effect of wnt3a on cell numbers could be explained by a decline in mitochondrial activity. the brdu assay, however, showed a promoting effect on dna synthesis in these cells. the experiments of mitochondrial activity showed that only after 24 hours of wnt3a treatment the sdha level was increased. the activation with recombinant wnt3a has probably no effect on the mitochondrial activity after 48 hours or later. according to this time - limited effect is the decreasing signal during mtt assay after 48 and 72 hours. this is also confirmed by the declining accumulation of -catenin by wnt3a after 24 hours. other publications support this assumption that wnt3a treated cells indicate an increased -catenin level only during a 24-hour period [41, 42 ]. we explain our results, which are contrary to the published proliferating effect of wnt3a by the fact that most studies used wnt3a overexpressed cells, wnt3a - conditioned medium, or serum - starved cells with recombinant wnt protein for activation wnt/-actin signaling pathway. in conclusion, results from brdu and the mtt assays are hardly comparable when measuring the effects of wnt3a on the proliferation rate of hek293 t cells. differences can be explained by their different points of application, namely, the mitochondrial activity and the synthesis of dna. in order to give definitive evidence about the cellular proliferation rate, interpretation of outcomes of one single method might be misleading. for evaluation of cell proliferation the direct counting of cells by optical methods would mirror best the real situation. it would be interesting to compare the corresponding outcomes with the results of biochemical assays like brdu and mtt. | the wnt signaling pathway has been associated with many essential cell processes. this study aims to examine the effects of wnt signaling on proliferation of cultured hek293 t cells. cells were incubated with wnt3a, and the activation of the wnt pathway was followed by analysis of the level of the -catenin protein and of the expression levels of the target genes myc and ccnd1. the level of -catenin protein increased up to fourfold. while the mrna levels of c - myc and cyclin d1 increased slightly, the protein levels increased up to a factor of 1.5. remarkably, mtt and brdu assays showed different results when measuring the proliferation rate of wnt3a stimulated hek293 t cells. in the brdu assays an increase of the proliferation rate could be detected, which correlated to the applied wnt3a concentration. oppositely, this correlation could not be shown in the mtt assays. the mtt results, which are based on the mitochondrial activity, were confirmed by analysis of the succinate dehydrogenase complex by immunofluorescence and by western blotting. taken together, our study shows that wnt3a activates proliferation of hek293 cells. these effects can be detected by measuring dna synthesis rather than by measuring changes of mitochondrial activity. |
nutrition security ensures optimal actualization of human resources and overall progress and development of a society and nation. malnutrition (both under- and overnutrition) is currently one of the biggest challenges being faced by the modern world. micronutrient deficiencies, more commonly referred to as hidden hunger, form a significant component of burden of malnutrition worldwide, more so in developing countries like india. deficiencies of iodine, iron, folic acid, vitamin a and zinc are the leading five causes of micronutrient deficiencies which constitute a global public health problem1. iodine deficiency disorders (idd) are linked to iodine deficient soil. due to glaciations, flooding, this in turn leads to deficiency of iodine in crops grown on iodine deficient soil with consequently low iodine in the diet for livestock and humans. in the past however, over the last quarter of the century, it has become increasingly clear that iodine deficiency leads to a much wider spectrum of disorders commencing with the intrauterine life and extending through childhood into adult life with serious health and social problems. the spectrum of diseases includes goitre, cretinism, hypothyroidism, brain damage, abortion, still birth, mental retardation, psychomotor defects and hearing and speech impairment2. majority of consequences of idd are invisible and irreversible but at the same time preventable. idd constitute the single largest cause of preventable brain damage worldwide leading to learning disabilities and psychomotor impairment3. children living in iodine - deficient areas on an average have lower intelligence quotient (iq), by as much as 13.5 iq points as compared to children living in iodine - sufficient areas4. idd have been shown to be associated with at least six of the eight millennium development goals5. idd are a major challenge to the health of populations the world over particularly among preschool children and pregnant women in low - income countries. globally two billion people are at risk of iodine deficiency disorders due to insufficient iodine intake6. nearly 266 million school - aged children worldwide have insufficient iodine intake. of the 130 countries which reported data for idd in 2006 (comprising 91.1% of the total global population), idd was a public health problem in 47 countries6. the 43 world health assembly held at geneva, in may 1990 recognized idd elimination as a major priority7. it adopted universal salt iodization (usi) as the preferred strategy to achieve the goal of idd elimination by 2000. the united nations world summit for children, 1990 attended by 71 heads of state and other senior officials of 15 member states, adopted a plan of action for elimination of idd by the year 20008. in 2002, in the united nations general assembly special session (ungass) on children, a new goal was adopted for idd elimination by 20059. impressive gains have been made in household - level coverage of adequately iodized salt (more than 15 part per million of iodine content) globally. currently 145 countries worldwide have implemented usi and over 71 per cent of the population worldwide consumes adequately iodized salt10. globally, india has the largest number of children born vulnerable to iodine - deficiency11. india, as one of the participants of the ungass on children had committed to the goal of idd elimination by 2005. however, india subsequently revised the idd control goal in 2006. the idd control goal in india was to reduce the prevalence of idd (i.e. total goitre rate) below 10 per cent in the entire country by 201212. this article reviews the efforts done to control idd in india with a brief outline of the historical evolution of the idd control programme in india. we look critically at the strengths, weaknesses, opportunities and the threats facing the idd control activities in india. surveys conducted by the central and state health directorates, indian council of medical research (icmr) and medical institutes since 1950s have clearly demonstrated that idd is a public health problem in all states and union territories in india. of the 325 districts surveyed in india so far, 263 districts are idd - endemic, i.e. the prevalence of idd is above 10 per cent in the population13. as per the survey conducted by the national nutrition monitoring board (nnmb) in 2000 - 2001 in rural areas of kerala, tamil nadu, karnataka, andhra pradesh, maharashtra, madhya pradesh, orissa and west bengal, the overall prevalence of total goitre rate (tgr) among six to twelve year old children was about 4 per cent14. the prevalence of goitre was highest in maharashtra (11.9%) and west bengal (9%). in india the entire population is prone to idd due to deficiency of iodine in the soil of the subcontinent and consequently the food derived from it. of these, an estimated 350 million people are at risk of idd as they consume salt with inadequate iodine (table i). every year nine million pregnant women and eight million newborns are at risk of idd in india. these estimates are based on the household - level coverage of adequately iodized salt as reported in coverage evaluation survey (ces) 2009 and extrapolated to total population estimates from census 2011 (provisional figures)1516. estimated burden of indian population at risk of idd state level idd surveys were carried out in seven states (kerala, tamil nadu, orissa, rajasthan, bihar, goa and jharkhand) from 2000 to 2006 by international council for control of iodine deficiency disorders (iccidd) in collaboration with state medical colleges, micronutrient initiative (mi) and unicef17. the surveys were carried as per the recommended guidelines of who / unicef / iccidd and used 30 cluster into 40 children sampling methodology3. children in the age group of 6 - 12 yr, women in the household, retail shop keepers and other community stakeholders constituted the study population. total goiter rate (tgr), urinary iodine (ui) concentration and iodine content of salt (household and retail shop) were studied. the household level consumption of adequately iodized salt (15 ppm) ranged from 18.2 per cent in tamil nadu to 91.9 per cent in goa (table ii). the median urinary iodine excretion ranged from 76 g / l in goa to 173.2 g / l in jharkhand. these state level idd surveys are the only sub - national level idd surveys in india where all three indicators, viz. iodine deficiency disorders (idd) status of seven states surveyed (2000 - 2006) in india as per the coverage evaluation survey 200915, 91 per cent of households had access to iodized salt, of whom 71 per cent consumed adequately iodized salt.. there are wide rural and urban variations in household coverage of adequately iodized salt (83.2% in urban areas vs. 66.1% in rural areas). wide variation was also seen across different states / uts ; with chhattisgarh (31.6%), karnataka (35.5%) and jharkhand (41.4%) being the low coverage states and manipur (98.3%), meghalaya (98%) and nagaland (97.1%) being high coverage states. further studies documenting goitre in india were done by several other researchers including stott (1931)19, and ramalingaswami (1953)20. salt - iodization as an intervention to address goiter, the then well recognized and more visible manifestation of iodine deficiency was first initiated in united states of america (usa) and switzerland in 1920s21. india was one of the first countries in the world to start a public health programme to address iodine deficiency disorders based on salt iodization. a landmark study in kangra valley region, himachal pradesh was conducted by ramalingaswami and his team from 1956 to 197222. this community based intervention study clearly demonstrated the effectiveness of iodized salt in reducing goitre prevalence in kangra valley. the study area was divided into three geographically distinct zones, zone a, zone b and zone c. salt was fortified with either potassium iodate (zone a) or potassium iodide (zone c), to deliver 200 micrograms of iodine to each study participants. zone b was the control area and received non - iodized salt. a progressive and significant decline in prevalence of goiter 1) additionally, the pattern of iodine metabolism in this population returned to within normal limits in contrast to the control population that did not consume iodized salt. from 1962 subsequent checks in 1968 and 1972 demonstrated a decline in goiter - prevalence in this population as well, which was directly attributable to the introduction of iodized salt in the diet. the results of this study have been supported by evidence from other international community - based intervention programmes as well2324. these studies from united states and switzerland clearly showed a causal link between daily consumption of iodized - salt and reduction in prevalence of goiter. decrease in goitre prevalence after salt iodization in the kangra valley study (1956 - 72). prevalence of goiter in 1952 was 40 per cent in all the three zones. in zone b (control group), intervention (iodized salt) was done in 1962. based on the success of the kangra valley study22, the government of india established the national goitre control programme (ngcp) in 1962 at the end of the second five - year plan25. the objectives of ngcp were to identify the goiter - endemic regions of the country and supplement the intake of iodine to the entire population in these regions. the ngcp primarily focused on the so called goitre belt in the country which comprised the himalayan and tarai region in north and north - eastern parts of india. subsequently, new evidence emerged that idd was not limited to a few endemic foci in india and was reported from nearly every geographical region of the country262728. based on the evidence from district idd surveys carried out as per the guidelines of ngcp, situation analysis conducted by the nutrition foundation of india (nfi) and studies carried out by the indian council of medical research (icmr) and the all india institute of medical sciences (aiims), new delhi team, it was decided to expand the activities of ngcp29. in 1983 in the annual meeting of central council of health, it was decided that all edible salt in india would be iodized by 199230. the process of iodization salt was started in a phased manner in the country from april, 1986. iodized salt was brought under the revised prevention of food adulteration (pfa) act of 198831. there was a growing realization that iodine deficiency is not limited to goiter alone but could mani - fest in several other ways with far serious consequences. available scientific evidence both from across the world and from india showed significant impact of iodine deficiency on early brain development, cognition and learning abilities of children4323334. according to a study by kochupillai, the incidence of neonatal hypothyroidism in one of the idd endemic regions of india was one of the highest reported in the world. the incidence of neonatal hypothyroidism varied from 0.1 per cent in an iodine sufficient region of india to 13.3 per cent in iodine - deficient region. in populations with high incidence of neonatal hypothyroidism, increased nerve deafness and low iq were observed27. these effects of mild brain damage suggested that nutritional iodine deficiency could manifest in ways other than goiter or cretinism. the world summit for children in 1990 endorsed the concept of idd as a spectrum of diseases and set up a target of global elimination idd by year 2000. the government of india reiterated its commitment to achieve usi by 1995 at the second south asian association for regional cooperation (saarc) conference on children in south asia, held in colombo, sri lanka, in september 199235. following the saarc conference, the government of india introduced an amendment in the national plan of action for children to include universal access to iodized salt by 1995 as a specific goal36. the nomenclature of the ngcp was changed to national idd control programme (niddcp) in 1992 to emphasize the wider implications of iodine deficiency. the identified objectives of the niddc programme were to conduct surveys to assess the magnitude of the idd, supply of iodated salt in place of common salt, resurvey after every five years to assess the extent of idd and the impact of iodated salt, laboratory monitoring of iodized salt and urinary iodine excretion and health education and advocacy37. the niddcp identifies usi as the primary strategy to eliminate idd as a public health problem in the country. in 1998 after consultation with all stakeholders policy guidelines for niddcp were formulated37. the policy guidelines were revised in 2006 and clearly delineated the administrative structure, idd survey guidelines and financial outlay of the programme12. concomitant with the evolution of the idd control programme in india, the idd control goals also went through various stages of revision and reformulation (box 1). case study of rajiv gandhi mission for elimination of iodine deficiency disorders, madhya pradesh, 1994 to 1996 idd control programme in india is a public health success story. we have come a long way from a district - centric approach of ngcp in 1962 to having a national - level programme today covering the whole country. nearly 91 per cent of households in the country have access to iodized salt with 71 per cent consuming adequately iodized salt15. iodized salt production in india was less than two hundred thousand metric tons (mt) per year in 1980s, of which 50 per cent was exported to nepal. currently, the total iodized salt production is 5.82 million mt per year, well in excess of the national requirement of 5.2 million mt per year38. the key factors contributing to this remarkable progress of the idd control programme in india are effective translation from research to policy, political commitment, involvement of the private sector in production of iodized salt, legislation to ensure iodization of salt and catalytic role played by the troika of academic institutes, civil society and international agencies. translation from research to policy : the dynamic evolution of niddcp in india demonstrates the successful translation of research to policy to programme. the land mark kangra valley study22 (research) was the genesis of idd control the researchers used the results of the study effectively to reach a consensus and formulate a policy to combat idd in india. further studies carried out in tarai region of india and from other regions led to evolution of niddcp from ngcp. sustained political commitment : after initial efforts to reach consensus on idd control, the need to upscale and mainstream the idd control efforts was felt. (indian council of medical research, directorate general of health services, health council, ministry of health and family welfare, etc.) and informal (political leaders, civil society groups, etc.) institutional structure for decision making were adopted. the resultant sustained political commitment to the idd control policy was borne out by the inclusion of idd control in the 20-point programme of the government of india in 198340. the commitment of the government of india (goi) and senior political leadership to the goal of idd control was reaffirmed by active participation by india in the world summit on children in 1990, saarc children summit in 1992 and ungass on children, 20028935. increased production of iodized salt and involvement of the private sector : the indian salt industry has made rapid progress over the last three decades with increase in both quantity and quality of iodized salt produced in the country. this increase in iodized salt production is primarily due to the contribution of the private sector. currently 98 per cent of total iodized salt production in india is from the private sector38. this is a classic example of responsive and responsible participation by the private sector in a major national public health programme. institution of legislation to ensure iodization of salt : after sustained advocacy, goi notified a ban on sale of non - iodized edible salt in 1997 under the prevention of food adulteration act 195441. the imposition of ban gave a huge impetus to the promotion of adequately iodized salt in the country. the withdrawal of the ban had adverse effects on household - level coverage of adequately iodized salt. this underscored the need to have a mandatory legislation to ensure usi in india, and the ban was reinstated in 200543. catalytic role played by the troika of academic institutes, civil society and international agencies : government of india and its nodal ministries - ministry of health and family welfare and ministry of industry undoubtedly have the central and primary role in implementation of niddcp and usi in india. all india institute of medical sciences, new delhi, has provided leadership for research policy and advocacy towards idd control and usi programme in the country. civil society and international agencies such as global alliance for improved nutrition (gain), international council for control of iodine deficiency disorders (iccidd), micronutrient initiative (mi), unicef, world food programme (wfp) and who have not only acted as important partners for idd control initiatives in the country, but also as vocal advocates for reinstatement of the ban on the scale of non - iodized salt. the goal of idd control programme in india was to reduce the prevalence of idd (i.e. tgr) below 10 per cent in the country by 2012. the recent coverage evaluation survey (ces) 2009 has reported 91 per cent population coverage of iodized salt in india, of which 71 per cent population is consuming adequately iodized salt and another 20 per cent is consuming salt with some added iodine (40 yr old64. iih is believed to occur only in subjects with pre - existing autonomous nodular goiter or in patients with latent graves disease, i.e. iodine supplementation merely unmasks the underlying thyroxicosis. current available evidence linking iodine supplementation with ait is unequivocal with no study conclusively proving increased incidence of ait after iodine supplementation65. ait is a disease of multifactorial aetiology which includes genetic predisposition, environmental factors, and endogenous factors66. iodine intake may be one of the multiple environmental factors like low birth weight (lbw), viral / bacterial infection, selenium deficiency, radiation, stress, etc. however, iodine intake leads to an increase in the ratio of papillary (less malignant) to follicular (more malignant) thyroid carcinoma thus having an overall favourable effect. another critical issue in addressing idd control in india is devising a strategy to offset the harm caused by the change in idd control policy and legislations. serious effects of changes in legislation regulating salt iodization was seen when the government of india lifted the ban on sale of non - iodized salt in 2000. the iodized salt coverage declined from 49 per cent in 1998 - 199949 to only 30 per cent in 2002 - 200351 and subsequently plateauted at 51 per cent in 2005 - 200650. a brief mention also needs to be made about iodine nutrition in light of the recent nuclear radiation accident in japan70 and mitigating the adverse effects of the same. india is at risk from radiation fallout due to nuclear power plant accidents and threat of nuclear warfare70. the risk from nuclear radiation accidents in india is increased by the region being endemic for iodine deficiency as adverse effects following a nuclear radiation fallout like thyroid cancer are significantly higher in iodine deficient populations71. there is a need to institute disaster preparedness measures to mitigate the damage in case of a nuclear accident. surveys conducted by the central and state health directorates, indian council of medical research (icmr) and medical institutes since 1950s have clearly demonstrated that idd is a public health problem in all states and union territories in india. of the 325 districts surveyed in india so far, 263 districts are idd - endemic, i.e. the prevalence of idd is above 10 per cent in the population13. as per the survey conducted by the national nutrition monitoring board (nnmb) in 2000 - 2001 in rural areas of kerala, tamil nadu, karnataka, andhra pradesh, maharashtra, madhya pradesh, orissa and west bengal, the overall prevalence of total goitre rate (tgr) among six to twelve year old children was about 4 per cent14. the prevalence of goitre was highest in maharashtra (11.9%) and west bengal (9%). in india the entire population is prone to idd due to deficiency of iodine in the soil of the subcontinent and consequently the food derived from it. of these, an estimated 350 million people are at risk of idd as they consume salt with inadequate iodine (table i). every year nine million pregnant women and eight million newborns are at risk of idd in india. these estimates are based on the household - level coverage of adequately iodized salt as reported in coverage evaluation survey (ces) 2009 and extrapolated to total population estimates from census 2011 (provisional figures)1516. estimated burden of indian population at risk of idd state level idd surveys were carried out in seven states (kerala, tamil nadu, orissa, rajasthan, bihar, goa and jharkhand) from 2000 to 2006 by international council for control of iodine deficiency disorders (iccidd) in collaboration with state medical colleges, micronutrient initiative (mi) and unicef17. the surveys were carried as per the recommended guidelines of who / unicef / iccidd and used 30 cluster into 40 children sampling methodology3. children in the age group of 6 - 12 yr, women in the household, retail shop keepers and other community stakeholders constituted the study population. total goiter rate (tgr), urinary iodine (ui) concentration and iodine content of salt (household and retail shop) were studied. the household level consumption of adequately iodized salt (15 ppm) ranged from 18.2 per cent in tamil nadu to 91.9 per cent in goa (table ii). the median urinary iodine excretion ranged from 76 g / l in goa to 173.2 g / l in jharkhand. these state level idd surveys are the only sub - national level idd surveys in india where all three indicators, viz. iodine deficiency disorders (idd) status of seven states surveyed (2000 - 2006) in india as per the coverage evaluation survey 200915, 91 per cent of households had access to iodized salt, of whom 71 per cent consumed adequately iodized salt.. there are wide rural and urban variations in household coverage of adequately iodized salt (83.2% in urban areas vs. 66.1% in rural areas). wide variation was also seen across different states / uts ; with chhattisgarh (31.6%), karnataka (35.5%) and jharkhand (41.4%) being the low coverage states and manipur (98.3%), meghalaya (98%) and nagaland (97.1%) being high coverage states. further studies documenting goitre in india were done by several other researchers including stott (1931)19, and ramalingaswami (1953)20. salt - iodization as an intervention to address goiter, the then well recognized and more visible manifestation of iodine deficiency was first initiated in united states of america (usa) and switzerland in 1920s21. india was one of the first countries in the world to start a public health programme to address iodine deficiency disorders based on salt iodization. a landmark study in kangra valley region, himachal pradesh was conducted by ramalingaswami and his team from 1956 to 197222. this community based intervention study clearly demonstrated the effectiveness of iodized salt in reducing goitre prevalence in kangra valley. the study area was divided into three geographically distinct zones, zone a, zone b and zone c. salt was fortified with either potassium iodate (zone a) or potassium iodide (zone c), to deliver 200 micrograms of iodine to each study participants. zone b was the control area and received non - iodized salt. a progressive and significant decline in prevalence of goiter 1) additionally, the pattern of iodine metabolism in this population returned to within normal limits in contrast to the control population that did not consume iodized salt. from 1962 subsequent checks in 1968 and 1972 demonstrated a decline in goiter - prevalence in this population as well, which was directly attributable to the introduction of iodized salt in the diet. the results of this study have been supported by evidence from other international community - based intervention programmes as well2324. these studies from united states and switzerland clearly showed a causal link between daily consumption of iodized - salt and reduction in prevalence of goiter. decrease in goitre prevalence after salt iodization in the kangra valley study (1956 - 72). prevalence of goiter in 1952 was 40 per cent in all the three zones. in zone b (control group), intervention (iodized salt) was done in 1962. based on the success of the kangra valley study22, the government of india established the national goitre control programme (ngcp) in 1962 at the end of the second five - year plan25. the objectives of ngcp were to identify the goiter - endemic regions of the country and supplement the intake of iodine to the entire population in these regions. the ngcp primarily focused on the so called goitre belt in the country which comprised the himalayan and tarai region in north and north - eastern parts of india. subsequently, new evidence emerged that idd was not limited to a few endemic foci in india and was reported from nearly every geographical region of the country262728. based on the evidence from district idd surveys carried out as per the guidelines of ngcp, situation analysis conducted by the nutrition foundation of india (nfi) and studies carried out by the indian council of medical research (icmr) and the all india institute of medical sciences (aiims), new delhi team, it was decided to expand the activities of ngcp29. in 1983 in the annual meeting of central council of health, it was decided that all edible salt in india would be iodized by 199230. the process of iodization salt was started in a phased manner in the country from april, 1986. iodized salt was brought under the revised prevention of food adulteration (pfa) act of 198831. there was a growing realization that iodine deficiency is not limited to goiter alone but could mani - fest in several other ways with far serious consequences. available scientific evidence both from across the world and from india showed significant impact of iodine deficiency on early brain development, cognition and learning abilities of children4323334. according to a study by kochupillai, the incidence of neonatal hypothyroidism in one of the idd endemic regions of india was one of the highest reported in the world. the incidence of neonatal hypothyroidism varied from 0.1 per cent in an iodine sufficient region of india to 13.3 per cent in iodine - deficient region. in populations with high incidence of neonatal hypothyroidism, increased nerve deafness and low iq were observed27. these effects of mild brain damage suggested that nutritional iodine deficiency could manifest in ways other than goiter or cretinism. the world summit for children in 1990 endorsed the concept of idd as a spectrum of diseases and set up a target of global elimination idd by year 2000. the government of india reiterated its commitment to achieve usi by 1995 at the second south asian association for regional cooperation (saarc) conference on children in south asia, held in colombo, sri lanka, in september 199235. following the saarc conference, the government of india introduced an amendment in the national plan of action for children to include universal access to iodized salt by 1995 as a specific goal36. the nomenclature of the ngcp was changed to national idd control programme (niddcp) in 1992 to emphasize the wider implications of iodine deficiency. the identified objectives of the niddc programme were to conduct surveys to assess the magnitude of the idd, supply of iodated salt in place of common salt, resurvey after every five years to assess the extent of idd and the impact of iodated salt, laboratory monitoring of iodized salt and urinary iodine excretion and health education and advocacy37. the niddcp identifies usi as the primary strategy to eliminate idd as a public health problem in the country. in 1998 after consultation with all stakeholders policy guidelines for niddcp were formulated37. the policy guidelines were revised in 2006 and clearly delineated the administrative structure, idd survey guidelines and financial outlay of the programme12. concomitant with the evolution of the idd control programme in india, the idd control goals also went through various stages of revision and reformulation (box 1). case study of rajiv gandhi mission for elimination of iodine deficiency disorders, madhya pradesh, 1994 to 1996 we have come a long way from a district - centric approach of ngcp in 1962 to having a national - level programme today covering the whole country. nearly 91 per cent of households in the country have access to iodized salt with 71 per cent consuming adequately iodized salt15. iodized salt production in india was less than two hundred thousand metric tons (mt) per year in 1980s, of which 50 per cent was exported to nepal. currently, the total iodized salt production is 5.82 million mt per year, well in excess of the national requirement of 5.2 million mt per year38. the key factors contributing to this remarkable progress of the idd control programme in india are effective translation from research to policy, political commitment, involvement of the private sector in production of iodized salt, legislation to ensure iodization of salt and catalytic role played by the troika of academic institutes, civil society and international agencies. translation from research to policy : the dynamic evolution of niddcp in india demonstrates the successful translation of research to policy to programme. the land mark kangra valley study22 the researchers used the results of the study effectively to reach a consensus and formulate a policy to combat idd in india. further studies carried out in tarai region of india and from other regions led to evolution of niddcp from ngcp. sustained political commitment : after initial efforts to reach consensus on idd control, the need to upscale and mainstream the idd control efforts was felt. concerted efforts, focusing on both formal (indian council of medical research, directorate general of health services, health council, ministry of health and family welfare, etc.) and informal (political leaders, civil society groups, etc.) institutional structure for decision making were adopted. the resultant sustained political commitment to the idd control policy was borne out by the inclusion of idd control in the 20-point programme of the government of india in 198340. the commitment of the government of india (goi) and senior political leadership to the goal of idd control was reaffirmed by active participation by india in the world summit on children in 1990, saarc children summit in 1992 and ungass on children, 20028935. increased production of iodized salt and involvement of the private sector : the indian salt industry has made rapid progress over the last three decades with increase in both quantity and quality of iodized salt produced in the country. this increase in iodized salt production is primarily due to the contribution of the private sector. currently 98 per cent of total iodized salt production in india is from the private sector38. this is a classic example of responsive and responsible participation by the private sector in a major national public health programme. institution of legislation to ensure iodization of salt : after sustained advocacy, goi notified a ban on sale of non - iodized edible salt in 1997 under the prevention of food adulteration act 195441. the imposition of ban gave a huge impetus to the promotion of adequately iodized salt in the country. the withdrawal of the ban had adverse effects on household - level coverage of adequately iodized salt. this underscored the need to have a mandatory legislation to ensure usi in india, and the ban was reinstated in 200543. catalytic role played by the troika of academic institutes, civil society and international agencies : government of india and its nodal ministries - ministry of health and family welfare and ministry of industry undoubtedly have the central and primary role in implementation of niddcp and usi in india. all india institute of medical sciences, new delhi, has provided leadership for research policy and advocacy towards idd control and usi programme in the country. civil society and international agencies such as global alliance for improved nutrition (gain), international council for control of iodine deficiency disorders (iccidd), micronutrient initiative (mi), unicef, world food programme (wfp) and who have not only acted as important partners for idd control initiatives in the country, but also as vocal advocates for reinstatement of the ban on the scale of non - iodized salt. the goal of idd control programme in india was to reduce the prevalence of idd (i.e. tgr) below 10 per cent in the country by 2012. the recent coverage evaluation survey (ces) 2009 has reported 91 per cent population coverage of iodized salt in india, of which 71 per cent population is consuming adequately iodized salt and another 20 per cent is consuming salt with some added iodine (40 yr old64. iih is believed to occur only in subjects with pre - existing autonomous nodular goiter or in patients with latent graves disease, i.e. iodine supplementation merely unmasks the underlying thyroxicosis. current available evidence linking iodine supplementation with ait is unequivocal with no study conclusively proving increased incidence of ait after iodine supplementation65. ait is a disease of multifactorial aetiology which includes genetic predisposition, environmental factors, and endogenous factors66. iodine intake may be one of the multiple environmental factors like low birth weight (lbw), viral / bacterial infection, selenium deficiency, radiation, stress, etc. however, iodine intake leads to an increase in the ratio of papillary (less malignant) to follicular (more malignant) thyroid carcinoma thus having an overall favourable effect. another critical issue in addressing idd control in india is devising a strategy to offset the harm caused by the change in idd control policy and legislations. serious effects of changes in legislation regulating salt iodization was seen when the government of india lifted the ban on sale of non - iodized salt in 2000. the iodized salt coverage declined from 49 per cent in 1998 - 199949 to only 30 per cent in 2002 - 200351 and subsequently plateauted at 51 per cent in 2005 - 200650. a brief mention also needs to be made about iodine nutrition in light of the recent nuclear radiation accident in japan70 and mitigating the adverse effects of the same. india is at risk from radiation fallout due to nuclear power plant accidents and threat of nuclear warfare70. the risk from nuclear radiation accidents in india is increased by the region being endemic for iodine deficiency as adverse effects following a nuclear radiation fallout like thyroid cancer are significantly higher in iodine deficient populations71. there is a need to institute disaster preparedness measures to mitigate the damage in case of a nuclear accident. idd control programme in india is one of the success stories of public health in the country. the current 91 per cent household level coverage of iodized salt in india, of which 71 per cent is adequately iodized salt, is a big achievement. a mission approach is required with effective and efficient coordination amongst all stakeholders of idd control efforts in india to achieve and sustain the idd control goal. | iodine deficiency disorders (idd) constitute the single largest cause of preventable brain damage worldwide. majority of consequences of idd are invisible and irreversible but at the same time these are preventable. in india, the entire population is prone to idd due to deficiency of iodine in the soil of the subcontinent and consequently the food derived from it. to combat the risk of idd, salt is fortified with iodine. however, an estimated 350 million people do not consume adequately iodized salt and, therefore, are at risk for idd. of the 325 districts surveyed in india so far, 263 are idd - endemic. the current household level iodized salt coverage in india is 91 per cent with 71 per cent households consuming adequately iodized salt. the idd control goal in india was to reduce the prevalence of idd below 10 per cent in the entire country by 2012. what is required is a mission approach with greater coordination amongst all stakeholders of idd control efforts in india. mainstreaming of idd control in policy making, devising state specific action plans to control idd, strict implementation of food safety and standards (fss) act, 2006, addressing inequities in iodized salt coverage (rural - urban, socio - economic), providing iodized salt in public distribution system, strengthening monitoring and evaluation of idd programme and ensuring sustainability of idd control activities are essential to achieve sustainable elimination of idd in india. |
the isolation of pure, intact, and high - quality dna is very crucial for any molecular studies. however, dna isolation from plants is usually compromised by excessive contamination by secondary metabolites. the dna isolation methods need to be adjusted to each plant species and even to each plant tissue because of the presence of these metabolites, unlike animals and microbes. the search for a more efficient means of extracting dna of both higher quality and yield has led to the development of several protocols for isolating dna from plants containing high levels of secondary metabolites [37 ]. the mangroves and salt marsh are specially adapted to harsh environment such as marshy anoxic anaerobic soil and fluctuating salinity of the water bodies. to avoid these stress conditions mangroves and salt marsh plants synthesize high amounts of polysaccharides, polyphenols, and other secondary metabolites such as alkaloids and flavanoids which impede dna extraction [9, 10 ]. degradation of dna due to endonucleases is one such problem encountered in the isolation and purification of high molecular weight dna from plant, which directly or indirectly interfere with the enzymatic reactions. polysaccharides may be particularly problematic when present in dna samples, as their presence may also inhibit enzymatic activity. presence of polysaccharides has been shown to inhibit taq polymerase activity and restriction enzyme activity. the presence of polysaccharides in the dna sample is characterized by formation of a highly viscous solution. the oxidized form of polyphenols covalently binds to dna giving a brown colour and reduces maintenance time, making it useless for molecular studies. apart from traditional extraction approaches, several commercial kits are also accessible to extract genomic dna from plants with sufficient quality. for extracting genomic dna an initial mechanical grinding of the leaf sample is carried out in the presence of liquid nitrogen, where the ultimate aim is to access the nuclear material without degradation. numerous dna isolation protocols use phenol to separate cellular molecules and debris from the dna which is toxic, hazardous, expensive, and require special containment facilities to maximize personnel safety and minimize environmental concerns. however, the convenience provided by the above - mentioned methods may be cost prohibitive when considering experiments with limited financial resources. several researchers have attempted to eliminate the use of hazardous chemicals, expensive kits, equipment, and labour - intensive steps for high throughput dna extraction. however, these methods do have demerits such as limited shelf life, low purity, low recovery, and poor amplification [17, 18 ]. mostly the dna extraction protocols recommend fresh leaf samples for genomic dna isolation, but it seems impractical when the samples are collected from remote and rare locations. these situations necessitate the development of the protocols for isolating dna from dried leaf samples. the objective of this study was to develop a simple method to isolate dna in an open laboratory environment, a method that eliminates the need to use liquid nitrogen and toxic phenol. the resulting optimized ctab (cetyl trimethylammonium bromide) protocol enables the isolation of high quality genomic dna amenable to rapd (random amplified polymorphic dna), restriction digestion, and amplification of plant barcode genes (matk and rbcl) with reduced cost and health concerns. young, tender, and unbruised leaves of mangroves (rhizophora mucronata, rhizophora apiculata, aegiceras corniculatum, lumnitzera racemosa, lumnitzera littorea, bruguiera gymnorrhiza, bruguiera cylindrica, scyphiphora hydrophyllacea, avicennia marina, avicennia officinalis, and xylocarpus mekongensis) and salt marsh (suaeda maritima and sesuvium portulacastrum) were collected from pichavaram mangrove forest, tamil nadu, india and stored in 80c until use. the leaves were preferred for dna extraction due to their continued availability whole year round. a minimum of ten accessions were taken for each genus. dried leaves of rhizophora and avicennia sp. plant genomic dna extraction kit (genei), ctab dna extraction method by porebski., j. j. doyle and j. l. doyle, and saghai - maroof. were employed for extracting dna from the study plants. among all the tested protocols, saghai - mahroof method yielded convincing results. therefore, this method was taken and optimized for dna extraction by varying the concentration of tris - hcl, nacl (sodium chloride), -mercaptoethanol, and pvp (polyvinyl pyrrolidone). (i) preheat suspension buffer (ph 8) containing 50 mm edta, 120 mm tris - hcl, 1 m nacl, 0.5 m sucrose, 2% triton - x 100, and 0.2% -mercaptoethanol (to be freshly added just before use) in water bath at 60c.(ii) grind 80c stored leaves (1 g) to fine powder in ice cold condition in the presence of 250 mg pvp (polyvinyl pyrrolidone, mr 10,000) by using pre chilled mortar and pestle (40c/80c). preheat suspension buffer (ph 8) containing 50 mm edta, 120 mm tris - hcl, 1 m nacl, 0.5 m sucrose, 2% triton - x 100, and 0.2% -mercaptoethanol (to be freshly added just before use) in water bath at 60c. grind 80c stored leaves (1 g) to fine powder in ice cold condition in the presence of 250 mg pvp (polyvinyl pyrrolidone, mr 10,000) by using pre chilled mortar and pestle (40c/80c). note : to avoid usage of liquid nitrogen, this method is successfully employed. lower the temperature and lower will be the chances of dna degradation (nuclease activity). appearance of brown colour indicates dna degradation.(iii) transfer the content in 2 ml microcentrifuge tubes and suspend in two volumes of suspension buffer.(iv) invert and mix gently and incubate at 60c for 40 min.(v) centrifuge the suspension at 10,000 rpm for 15 min at room temperature.(vi) add 1.5 ml of extraction buffer containing 20 mm edta, 100 mm tris - hcl, 1.5 m nacl, 2% ctab, 1% -mercaptoethanol and incubate at 60c for 30 min.(vii) centrifuge at 12,000 rpm for 15 min at room temperature.(viii) carefully transfer the aqueous phase into a new tube. transfer the content in 2 ml microcentrifuge tubes and suspend in two volumes of suspension buffer. centrifuge the suspension at 10,000 rpm for 15 min at room temperature. add 1.5 ml of extraction buffer containing 20 mm edta, 100 mm tris - hcl, 1.5 m nacl, 2% ctab, 1% -mercaptoethanol and incubate at 60c for 30 min. note : use wide - bore tips for transferring the aqueous phase to avoid mechanical damage to dna.(ix) add double volume of chloroform : isoamyl alcohol (24 : 1), and invert gently 15 to 20 times and centrifuge at 12,500 rpm for 15 min. add double volume of chloroform : isoamyl alcohol (24 : 1), and invert gently 15 to 20 times and centrifuge at 12,500 rpm for 15 min. note : if the aqueous layer appears translucent, repeat the step until the solution is transparent.(x) add double volume of chilled isopropanol and keep at 20c for one hour to precipitate the dna. add double volume of chilled isopropanol and keep at 20c for one hour to precipitate the dna. note : the longer the chilled incubation, the more the precipitation.(xi) centrifuge at 12,000 rpm for 15 min and discard the supernatant.(xii) to the pellet, add 70% chilled ethanol and spool out the pellet carefully and centrifuge again at 12,000 rpm for 15 min.(xiii) discard the supernatant and vacuum dry or air dry the pellet at room temperature. centrifuge at 12,000 rpm for 15 min and discard the supernatant. to the pellet, add 70% chilled ethanol and spool out the pellet carefully and centrifuge again at 12,000 rpm for 15 min. discard the supernatant and vacuum dry or air dry the pellet at room temperature. note : make sure that there is no residual ethanol, this is very critical especially if the dna is to be used directly for pcr. overdrying should also be avoided as it makes the pellet difficult to resuspend.(xiv) add 100 l of high salt te buffer (0.5 m nacl, 10 mm tris - hcl, 1 mm edta (ph 8).(xv) add 3 l rnase (10 mg / ml) and keep at 37c for 30 min followed by chloroform : isoamyl alcohol extraction and ethanol precipitation in the presence of 3 m sodium acetate (ph 5.2).(xvi) spool out the dna, wash in 70% ethanol, air or vacuum dry.(xvii) add 30 to 50 l (depending upon the pellet) of te buffer (10 mm tris - hcl, 1 mm edta, ph 8) to dissolve the precipitate. m nacl, 10 mm tris - hcl, 1 mm edta (ph 8). add 3 l rnase (10 mg / ml) and keep at 37c for 30 min followed by chloroform : isoamyl alcohol extraction and ethanol precipitation in the presence of 3 m sodium acetate (ph 5.2). spool out the dna, wash in 70% ethanol, air or vacuum dry. add 30 to 50 l (depending upon the pellet) of te buffer (10 mm tris - hcl, 1 mm edta, ph 8) to dissolve the precipitate. dna in te should be suitably diluted before use in such reactions.(xviii) store at 20c/40c till further use. the dna yield was measured by using a uv - visible spectrophotometer (perkin elmer) at 260 nm. polysaccharide contamination was assessed by calculating the absorbance ratio a260/230. for quality and yield assessments, electrophoresis was done of all dna samples in 0.8% agarose gel, stained with ethidium bromide and bands were observed in gel documentation system (alpha innotech). the pcr amplification reaction was carried out with five random decamer primers (rpl1 to rpl5) obtained from genei (bangalore) in a 25 l reaction volume containing 10 mm tris - hcl, ph 8.3, 2.5 mm mgcl2, 1 mm dntp mix, 0.2 m of each primer, 1 u of taq dna polymerase, and 15 to 40 ng of template dna. rapd - pcr was performed in a thermalcycler (tech gene) for 40 cycles consisting of denaturation at 94c for 30 sec, annealing at 45c for 30 sec, and extension at 72c for 60 sec. the amplified product was checked in 1.5% agarose gel electrophoresis and bands were observed in gel documentation system (alpha innotech). briefly, the reaction mixture was prepared by adding 10 l of extracted dna, 15 l of 2x assay buffer, 10 l of bsa, and 3 l of restriction enzyme (bam hi, ecori and psti). the gels were fixed in 50 ml of fixing solution (diluted five times with 30.4 ml double - distilled water and 9.6 ml ethanol) for 30 min and silver - impregnated (with 1x staining solution) for another 30 min. this was followed by washing the gels in double - distilled water for 1 to 2 min. after removing the staining solution the gels were then kept in the developing solution in dark for 10 min. when the bands were dark enough, the developing solution was poured out and the stopping and preserving solution was immediately added. pcr amplification of matk (trnk - f : gggttgctaactcaatggtagag ; trnk - r : tgggttgcccggggccgaac) and rbcl (rbcl - f : actgtagtaggtaaacttgaaggtgaacg ; rbcl - r : gaaccttcctcaaaaaggtctaaggggta) were carried out in 25 l reaction containing 1.0 u taq dna polymerase, 1 mm dntps - mix, 1xtaq buffer, 2.5 mm mgcl2, 20 mm of each amplification primer, and 1050 ng of template dna in a one - step touchdown pcr - program (1 cycle at 90 sec at 96c, 60 sec at 50c, 120 sec at 68c, 35 cycles at 30 sec at 95c, 60 sec at 48c, 120 sec at 68c, subsequent final elongation of 20 min at 68c). annealing temperature (ta) ranged from 47 to 50c with respect to different plant species. the amplified products were separated by electrophoresis in 1.5% agarose gel buffered with 1x tae. gels were stained with ethidium bromide, and bands were observed in gel documentation system (alpha innotech). plant genomic dna extraction kit (genei) did not show promising results for mangroves and salt marsh species as evident by the presence of sticky polysaccharides in the pellet and sheared band in the agarose gel. we encountered many difficulties from the very first step of cell lysis to dna separation in the supernatant and subsequent reactions when the ctab dna extraction method of porebski. and highly viscous and sticky pellets were difficult to handle and the brownish pellet, indicated contamination by phenolic compounds. the amount of dna obtained with these protocols was very low, and the quality was also poor for most of the samples. a260/a280 ratio was less than 1.6, that is, below the optimal limit of 1.8 making the dna nonamenable for molecular studies.. gave better dna yield in terms of quality and quantity from the study plants. hence, this method was considered for the purpose of standardization at varying concentration of tris - hcl, -mercaptoethanol, nacl, and pvp (figure 1). the success of the optimized extraction method in obtaining high - quality genomic dna from all the tested mangrove and salt marsh species demonstrated the broad applicability. dna concentration of the extraction method ranged from 8.8 to 9.9 g l. the use of prechilled mortar and pestle and 40c/80c stored leaf sample successfully substituted the use of costly liquid nitrogen. therefore, high concentration of -mercaptoethanol was used which made the protocol good for extraction of high - quality dna. the addition of nacl at concentrations higher than 0.5 m, along with ctab, is known to remove polysaccharides during dna extraction [24, 27 ]. the concentration of nacl varied with plant species in a range between 0.7 m to 6 m. in the present study, higher level of nacl (1.5 m) in the extraction buffer further improved the quality of the extracted dna. the high quality of obtained dna could also be attributed to the use of a higher concentration of pvp (2.5%) with lower molecular weight (10,000) rather than 40,000. a number of workers [30, 31 ] have recommended the use of pvp with molecular weight of 10,000 at 2% (w / v) to address the problem of phenolics. pvp with low molecular weight has less tendency of precipitating with the nucleic acids as compared to pvp with high molecular weight thus yielding sufficient amount of polyphenol - free dna. purity of extracted dna was excellent as evident by a260/a280 ratio ranging from 1.78 to 1.84 and a260/a230 ratio was > 2, suggesting that the preparations were sufficiently free of proteins and polyphenolics / polysaccharide compounds. the extracted dna was also amenable for rflp study and amplification of plant barcode genes as evident in figures 3 and 4, respectively. the successfully amplified barcode genes sequences were sequenced and submitted to genbank (accession numbers : jq433951, jq421082, jq511854, and jq421083) fresh and young leaf materials are the first choice to obtain good - quality dna. however, mature leaves contain higher quantities of polyphenols and polysaccharides, which makes it very difficult to isolate dna of good quality. however, availability of young leaves for the molecular studies is quite challenging for some species. overcoming this issue using the present optimized protocol yielded better quality dna even from the dried - leaf samples. no dna fragmentation due to shearing of dna during extraction procedure it has been reported previously that shearing of dna during extraction can directly or indirectly interfere with the enzymatic reactions during different molecular studies, that is, pcr, rflp, and rapd and so forth. this protocol could also be useful in other plant species with high polysaccharide and secondary metabolites during the dna extraction process. here we have described a simple, safe, reliable, and cost - efficient ctab dna extraction method that provides high - quality dna from recalcitrant mangroves and salt marsh plants containing elevated concentrations of polysaccharide and polyphenolic compounds. this method eliminates the need to use expensive liquid nitrogen and environmentally hazardous phenol to obtain high - quality genomic dna. the proposed method enables the extraction of dna even from dried leaves of mangroves and saltmarsh. the resulting optimized ctab protocol enables the isolation of high quality genomic dna amenable to rapd, rflp, and amplification of plant barcode genes (matk and rbcl). therefore this method is recommended even in low - technology laboratories for high - throughput sample preparation suitable for various molecular analytical techniques. | mangroves and salt marsh species are known to synthesize a wide spectrum of polysaccharides and polyphenols including flavonoids and other secondary metabolites which interfere with the extraction of pure genomic dna. although a plethora of plant dna isolation protocols exist, extracting dna from mangroves and salt marsh species is a challenging task. this study describes a rapid and reliable cetyl trimethylammonium bromide (ctab) protocol suited specifically for extracting dna from plants which are rich in polysaccharides and secondary metabolites, and the protocol also excludes the use of expensive liquid nitrogen and toxic phenols. purity of extracted dna was excellent as evident by a260/a280 ratio ranging from 1.78 to 1.84 and a260/a230 ratio was > 2, which also suggested that the preparations were sufficiently free of proteins and polyphenolics / polysaccharide compounds. dna concentration ranged from 8.8 to 9.9 g l1. the extracted dna was amenable to rapd, restriction digestion, and pcr amplification of plant barcode genes (matk and rbcl). the optimized method is suitable for both dry and fresh leaves. the success of this method in obtaining high - quality genomic dna demonstrated the broad applicability of this method. |
the recent medical developments, including the increased use of chemotherapy drugs, white blood cell stimulants, and broad spectrum antibiotics, have improved the prognosis and life span of pediatric patients with neoplastic diseases. consequently, these patients often face lengthy periods of low immunity, undergo longer hospital stays, and there is a greater chance that they will require central venous catheterizations, urinary catheterizations, endotracheal intubations, and intravenous feeding tubes. these factors moreover put patients at an increased risk of contracting nosocomial infections (nis) and substantially increase morbidity and mortality rates as well as treatment costs [13 ]. nosocomial infections in patients with malignancies can be caused by bacteria, fungi, and viruses and can occur in the bloodstream ; urinary, respiratory, and digestive tracts ; as well as soft tissues. the previous studies have been done among both adult and pediatric patients with neoplastic diseases reporting a high risk of nis [47 ] and showing incidence rates of nis ranging from 1.08 to 1.77 times/100 days of hospitalization [811 ]. in addition, the previous studies among pediatric patients with neoplastic diseases found that nis were associated with the use of devices [611 ]. for example, a us surveillance among pediatric patients with neoplastic diseases found that bacteremia occurred 6.6 times/1000 days of central venous catheterization, urinary tract infections 4 times/1000 days of urinary catheterization, and pneumonia 2.9 times/1000 days of endotracheal intubation. causal organisms related to nis vary according to settings and study populations. in germany, simon. identified gram - positive bacteria as the common causal organism of nis (83.3%) among pediatric patients with central venous catheterization. in contrast, a study by frank. in israel found gram - negative bacteria (54.3%) more common than gram - positive bacteria (36.6%) among children and adolescents in intensive care settings. most nis have a significant effect since they lengthen hospital stays, increase mortality, and increase complications [811 ]. at present, studies of nis in pediatric patients with neoplastic diseases are under reported in thailand. to determine (1) the incidence of nis among pediatric patients with neoplastic diseases, (2) sites of nis, (3) causal organisms, and (4) outcomes of nis. the study was conducted in the 32-bed pediatric hematology / oncology ward of the chiang mai university hospital, chiang mai, thailand. patients in this ward are up to 15 years old and all have neoplastic diseases. we excluded those patients who (1) had fever of unknown origin, since we could not find any other clinical or radiological signs of infection as well as isolate any causative organisms and therefore could not classify them as having an ni with certainty, (2) received any antibiotic prophylaxis, and (3) had viral - related illness diagnosed by clinicians. the clinical symptoms of each patient were monitored daily from admission until hospital discharge by pediatricians and nurses. the findings were recorded during admission on a data extraction form that included demographic data, discharge diagnoses, intrinsic risk factors, extrinsic risk factors, causal organisms, and treatment outcomes. the definitions for nis were based on the criteria outlined by the us centers for disease control and prevention in 2004. neoplastic diseases in pediatric patients were classified as follows : hematologic neoplasia (acute lymphoblastic leukemia (all), acute myeloid leukemia (aml), non - hodgkin 's lymphoma, hodgkin 's disease), solid tumors (bone tumors, rhadomyosarcoma, central nervous system tumors, neuroblastoma, and wilm 's tumor), and others (schwanoma, hepatoblastoma, and lymphangioma). the data were analyzed by calculating ni rates per 1000 days of hospitalization and per 100 admittances. the relationship between ni rates and various extrinsic factors was analyzed using a chi - square test when there was a need to compare proportional data, using a level of 95% confidence interval. we collected data of 707 admissions (6561 days of hospitalization) during the study period (table 1). fifty - four percent were males with a mean age of 6.9 years (range : 3 months15 years ; sd = 4 years). eighty - seven percent of patients had leukopenia, 52.2% had an absolute neutrophil count of less than 500/mm, and 58.7% had thrombocytopenia. nosocomial infections were reported among 46 admissions (6.5/100 admission episodes ; 7 episodes/1000 days of hospitalization). there were 13 episodes of urinary tract infections per 1000 days of urinary catheterization, 21 episodes of pneumonia per 1000 days of endotrachial intubation, and no episodes of bacteremia among patients who had central venous catheterization. episodes of nis were most frequent among patients with all (41.3%), and patients with aml (34.8%). the most common sites of nis were the blood stream (30.5%) and the ear / nose / throat (19.6%) (table 2). the most common were gram - negative bacteria (47.1%), followed by gram - positive bacteria (29.4%), and fungi (14.7%) (table 3). patients who developed nis were more likely to have had endotracheal intubation (mean duration : 10.2 days ; range : 115 days), urinary catheterization (mean duration : 5.8 days ; range : 110 days), nasogastric tube (mean duration : 4.9 days ; range : 117 days), and central venous catheterization (mean duration : 1.7 days ; range : 1 - 2 days) (p <.001) (table 4). the mean time from admittance until time of diagnosis of an ni was 22 days (range : 2126 days ; sd : 23 days). the majority of nis (74%) occurred between the 2nd and the 30th day of hospitalization. nine patients died (19.6%) : 4 with all (44.4%), 4 with aml (44.4%), and 1 with an astrocytoma brain tumor. four patients (44.4%) had bacteremia, 3 (33.4%) had soft tissue infections, 1 (11.1%) had pneumonia, and 1 had both bacteremia and pneumonia. three patients (33.4%) were infected with gram - positive bacteria, 2 (22.2%) with gram - negative bacteria, 2 (22.2%) with fungal organisms, and 1 patient (11.1%) was found to be infected with gram - positive bacteria and a fungal organism. forty - six episodes of nis were reported (the incidence of nis was 6.5/100 admission episodes ; 7 episodes/1000 days of hospitalization). a previous study of pediatric patients with neoplastic diseases in germany by simon. found a rate of nis of 5.2 cases per 100 admittances and of 10.8 cases per 1000 days of hospitalization, which is similar to the results obtained by our study. a study of urrea. among pediatric patients with neoplastic diseases in spain found an ni rate of 1.77 cases per 100 days of hospitalization. the incidence of nis in our study was relatively low in comparison to the study of urrea. this may be because our study excluded patients with fever of unknown origin and those who had viral infections. in addition, in our study patients appeared to have lower rates of central venous catheterizations than patients in previous studies [5, 10, 11 ]. patients with all who represented 59% of the sample population had the highest ni rate (41.3%) in our study. since the percentage of all patients in our study was higher than that reported in other studies [10, 11 ], it could represent a skewed population. in regards to sites of nis, most infections in our study occurred in the blood stream (30.5%), as in other studies by simon. regarding causal organisms of nis, studies from eastern countries found that gram - negative bacteria were most common, like in our study. our study found 47.1% gram - negative bacteria and 29.4% gram - positive bacteria while the study by frank. in israel from 1992 to 2001, which focused particularly on bacteremia in pediatric wards, found 54.3% gram - negative bacteria and 36.6% gram - positive bacteria. however, our study focused on children with neoplastic diseases while frank 's. in contrast, studies from european countries were more likely to report gram - positive bacteria to be more common. for example, the study by simon. found up to 83.3% gram - positive and 11.1% gram - negative bacteria, and the study by urrea. reported up to 78.6% gram - positive bacteria. the higher rate of gram - positive bacteria as causal organisms for nis in european countries could be due to the fact that in european countries central venous catheterization is more common than in eastern countries, such as in thailand. in addition, in our study we found 3 cases of salmonella enteritidis infections. salmonella enteritidis is unlikely to be a causal organism of nis since it is normally found in community settings. we think that these patients may have been colonized with this organism outside the hospital and then developed symptoms when their immunity level was low after chemotherapy. furthermore, our study found that fungal infections accounted for 14.7% of infections, while in the previous two studies by simon. and urrea. however, in the israeli study, fungal infections also occurred, most of which were bloodstream infections. therefore, among pediatric patients with neoplastic diseases who suffer from a low white blood cell count for a long period of time, care should be taken to guard against fungal infections as well. concerning procedures that can make patients vulnerable to nis, we found that endotracheal intubation, nasogastric tube insertion, urinary catheterization and central venous catheterization significantly increased the incidence of nis (p - value <.001). patients who were exposed to more invasive procedures such as endotracheal intubation (mean duration : 4.9 days) and central venous catheterization (mean duration : 1.7 days) also more quickly developed nis than patients who were exposed to less invasive procedures such as nasogastric tube insertion (mean duration : 10.2 days). we therefore recommend that the more invasive procedures should be carried out only when necessary in order to reduce the incidence of nis. first, it is a prospective study in which ni episodes were carefully monitored and the data collection carried out according to a given research plan. second, according to our best knowledge, it is the first study of ni episodes among pediatric patients with neoplastic diseases in thailand. first, the period of data collection was relatively short. a longer period of data collection would be able to provide a clearer picture of ni episodes among this group. second, care should be taken when comparing the incidence rates of nis of our study with those of other institutions and countries, since we have excluded patients who had fever of unknown origin and viral related illnesses. third, we also have not recorded the types of chemotherapy regimens these patients received as well as their cancer stages, which may have some impact on episodes of nis. fourth, our study also did not investigate the relationship between the incidence of nis and other intrinsic factors, including the presence of other underlying diseases as well as level of anemia and white blood cell counts. | background. pediatric patients with neoplastic diseases are more likely to develop nosocomial infections (nis). nis may prolong their hospital stay, and increase morbidity and mortality. objectives. the objectives of this study were to determine : (1) the incidence of nis, (2) sites of nis, (3) causal organisms, and (4) outcomes of nis among pediatric patients with neoplastic diseases. methods. this study was a prospective cohort study of pediatric patients with neoplastic diseases who were admitted to the chiang mai university hospital, thailand. results. a total of 707 pediatric patients with neoplastic diseases were admitted. forty - six episodes of nis in 30 patients were reported (6.5 nis/100 admission episodes and 7 nis/1000 days of hospitalization). patients with acute lymphoblastic leukemia had the highest number of nis (41.3%). the most common causal organisms were gram - negative bacteria (47.1%). patients who had undergone invasive procedures were more likely to develop nis than those who had not (p <.05). the mortality rate of patients with nis was 19.6%. conclusion. pediatric patients with neoplastic diseases are more likely to develop nis after having undergone invasive procedures. pediatricians should be aware of this and strictly follow infection control guidelines in order to reduce morbidity and mortality rates related to nis. |
force measurements on a scaled hair - bundle model respected the physiological character of the liquid flow. the finite - element method provided approximate solutions to partial differential equations reflecting the hair bundle 's geometry. the velocity variable of the liquid was substituted by the time derivative of the displacement ; fluid pressure was approximated by linear shape functions and the displacements of liquid and solid by quadratic ones. the hydrodynamic forces between stereocilia were estimated analytically by solving the stefan - reynolds equations under the lubrication approximation, which is valid when the gaps between adjacent stereocilia are much smaller than their diameter. stochastic simulations based on these results were performed for a system of linearly coupled dynamic variables following a langevin description with gaussian white noise at room temperature. the integration procedure was validated by choosing time steps small enough to assure that the results were independent of the increment. we tested the effects of inertia and of the estimated top - connecter stiffness and confirmed the validity of our conclusions for mammalian hair bundles. dual - beam differential interferometry was used to record stereociliary motions with sub - nanometre spatial and sub - millisecond temporal resolution. fourier analysis of the records was performed with the multitaper method to obtain coherence spectra as well as stiffness and drag coefficients. these results were used to verify the predictions of the numerical model and to measure directly the relative mode of motion between stereocilia. | the detection of sound begins when energy derived from an acoustic stimulus deflects the hair bundles atop hair cells1. as hair bundles move, the viscous friction between stereocilia and the surrounding liquid poses a fundamental physical challenge to the earfs high sensitivity and sharp frequency selectivity. part of the solution to this problem lies in the active process that uses energy for frequency - selective sound amplification2,3. here we demonstrate that a complementary part of the solution involves the fluid - structure interaction between stereocilia and the liquid within the hair bundle. using force measurement on a dynamically scaled model, finite - element analysis, analytical estimation of hydrodynamic forces, stochastic simulation, and high - resolution interferometric measurement of hair bundles, we characterize the origin and magnitude of the forces between individual stereocilia during small hair - bundle deflections. we find that the close apposition of stereocilia effectively immobilizes the liquid between them, which reduces the drag and suppresses the relative squeezing but not the sliding mode of stereociliary motion. the obliquely oriented tip links couple the mechanotransduction channels to this least dissipative coherent mode, whereas the elastic horizontal top connectors that stabilize the structure further reduce the drag. as measured from the distortion products associated with channel gating at physiological stimulation amplitudes of tens of nanometres, the balance of viscous and elastic forces in a hair bundle permits a relative mode of motion between adjacent stereocilia that encompasses only a fraction of a nanometre. a combination of high - resolution experiments and detailed numerical modelling of fluid - structure interactions reveals the physical principles behind the basic structural features of hair bundles and shows quantitatively how these organelles are adapted to the needs of sensitive mechanotransduction. |
thromboembolic stroke is a known complication of non - valvular atrial fibrillation (af). therefore, the need to prevent such occurrence is of paramount importance when treating patients with af. to aid in the assessment of stroke risk, several risk stratification schemes or clinical prediction rules the two most common risk stratification schemes validated for predicting stroke risk in non - valvular af patients are chads2 (congestive heart failure, hypertension, age 75 years old, diabetes, prior tia or stroke or thromboembolism) and the cha2ds2vasc, which is a modification of the chads2 that added three additional risk factors : age 6574, female sex and history of vascular disease. current guidelines recommend antithrombotic or anticoagulant therapy to protect af patients from stroke based on these risk stratification algorithms. although not included in these stroke risk predictors, chronic kidney disease (ckd) has been demonstrated to be an independent risk factor for stroke in af patients in several studies. a study by go. examined how ckd, evidenced either by reduced glomerular filtration rate (gfr) or proteinuria, related to stroke risk in patients with af without anticoagulation therapy. from this study, they have shown a graded, progressive risk of stroke associated with progressively lower level of estimated gfr. ckd is also an independent risk factor for cardiovascular disease (cvd) outcomes, such as hypertension, heart failure and myocardial infarction. the mechanisms by which ckd causes cvd outcomes are still not fully elucidated, but may include predisposition to early atherosclerosis. in the reasons for geographic and racial differences (regards) study, ckd was also shown to be associated with increased prevalence of af in a large population - based sample of 27 000 us adults. the prevalence was highest in those with ckd stages 4 and 5, and the association persisted even after multivariable adjustment. however, the incidence of stroke was significantly higher in af patients with ckd than in those with af alone. in a large cohort study of 132 372 patients with non - valvular af from the danish national registry revealed that the risk of stroke or systemic embolism was higher in those af patients with non - end - stage ckd compared with those who did not have renal disease and even higher in those requiring dialysis. ckd patients, therefore, are at an increased risk of stroke. despite this evidence, ckd is not a component of widely used current predictors for stroke risk in patients with non - valvular af. the commonly used clinical prediction rules, the chads and chadsvasc, do not consider decline in renal function. the main reason for this is that patients with decreased gfr were excluded in those cohorts from which these clinical prediction rules were derived, making them not optimal for ckd patients. few studies have included renal dysfunction in their risk stratification scheme for stroke. in one study that did assess ckd as part of the risk stratification scheme, piccini. validated the r2chads2 scoring system (where r for renal dysfunction was measured by creatinine clearance with inclusion of those 30 ml / min) in the rocket af and atria study cohorts. the authors concluded that reduced creatinine clearance was a strong independent predictor for stroke, second only to prior stroke and transient ischemic attack and that r2chads2 improved net reclassification index by 6.2% compared with cha2ds2vasc and 8.2% compared with chads2. this study, however, excluded more advanced ckd patients with creatinine clearance of 160 mmhg, vascular disease as the presence of peripheral arterial disease, carotid artery disease, or coronary arterial disease. treatment was categorized either as warfarin, aspirin, heparin, or no - treatment group. the average creatinine over 6 months was used to measure the egfr using the 4-variable modification of diet in renal disease (mdrd) equation, which includes age, sex, race and creatinine in the computation. for inpatients with acute kidney injury, defined as an increase in the creatinine by 0.3 stage 1 included egfr > 90 ml / min, stage 2 egfr 6089 ml / min, stage 3 egfr 3059 ml / min, stage 4 egfr 1529 and stage 5 egfr 75, diabetes, previous stroke) and chadsvasc (chads plus vascular disease, age 6574, and female as sex category) clinical prediction rules were collected and considered for inclusion in the multivariate analyses for primary and secondary endpoints and stroke alone. congestive heart failure is defined as left ventricle systolic ejection fraction of 160 mmhg, and vascular disease as pad, chd, or cad. the presence of each disease was given 1 point while a prior cerebrovascular accident (cva), defined as ischemic stroke or tia, conferred 2 points. when chadsvasc was used 2 points were given for age > 75 and 1 point for age 6574. the r2chads was calculated by the addition of renal risk factor that confers a score of 2 if the gfr 9071810.1% ref681113.9% ref gfr 60901862612.3%0.611763617.0%0.53 stage 3a395357.6% 75 no2298226.4%20610533.8% yes1506329.6%0.421328138%0.32diabetes no2548725.5%22511634% yes1255831.7%0.131137024.7%0.33prior cva no3499220.9%31113029.5% yes305363.9% 9071810.1% ref681113.9% ref gfr 60901862612.3%0.611763617.0%0.53 stage 3a395357.6% 75 no2298226.4%20610533.8% yes1506329.6%0.421328138%0.32diabetes no2548725.5%22511634% yes1255831.7%0.131137024.7%0.33prior cva no3499220.9%31113029.5% yes305363.9%<0.0001275667.5%<0.0001vascular no29010118.2%26113033.2% yes894433.1%0.11775642%0.07treatment none712727.6%0.58603838.8%0.94 aspirin only992721.4%0.06933326.20.02 warfarin2038930.5% ref18011238.4% ref others (including heparin)6225.0%15360%1medianmedianp - valuemedianmedianp - valueage (continuous)70720.0670720.04 risk factors and characteristics of the cohort in the multivariable analysis only two variables were significantly associated with an increased risk of stroke, tia, or other central thromboses. the risk for a primary outcome was higher in patients with a history of previous cva and those with ckd. the presence of advanced ckd increased the risk for a primary outcome by 1.3 times (adjusted rr 1.30, 95% ci 1.011.67) while a history of previous stroke increased risk for a subsequent stroke, tia or other central thrombosis by almost three times (rr 2.9, 95% ci 2.263.71). of note, chf, hypertension, age older than 75, diabetes, vascular disease, female as sex, or treatment with warfarin figures 13 show the areas under the curve (auc) of the r2chads for a primary outcome (stroke, tia and central thrombosis) compared with chads and chadsvasc. we used ckd levels as cutoffs in determining the groups for our analyses of the predictive power of the three clinical prediction rules group 1 includes all patients, group 2 excludes patients with advanced ckd, and group 3 includes only patients with advanced ckd. n = 98 table 2 shows the c statistics for the three clinical prediction rules in the three groups analyzed. in group 1 the c statistics for the new clinical prediction rule r2chads were higher at 0.718 than for chads and chadsvasc, which are only 0.605 and 0.602, respectively. in addition, when patients with advanced ckd were excluded (group 2) the c statistics for r2chads were still the highest, at 0.724 versus 0.584 and 0.579 for chads and chadsvasc, respectively. however ; in group 3, the r2chads has a c statistics of 0.631 versus 0.629 for chads and 0.623 for chadsvasc. the c statistics for chadsvasc, when compared with that of chads, were not statistically higher in the three groups, as evidenced by the overlapping confidence intervals. in the first two groups, r2chads outperformed chads and chadsvasc, although there was no statistical difference in the performance of r2chads versus chads or chadsvasc in group 3. table 2.c statistics of clinical prediction rules for a primary outcomec statistics / roc curvestandard error95% confidence intervalgroup 1 : all patients, n = 524chads0.6050.02530.560.65chadsvasc0.6020.02550.550.65r2chads0.7180.0260.670.76group 2 : egfr < 30 excluded, n = 426chads0.5840.0290.530.64chadsvasc0.5790.0290.520.64r2chads0.7240.0260.670.77group 3 : patients with egfr < 30, n = 98chads0.6290.0250.520.74chadsvasc0.6230.0250.510.73r2chads0.6310.0230.520.74with statistically significant difference.no statistical significant difference. c statistics of clinical prediction rules for a primary outcome with statistically significant difference. no statistical significant difference. the rocket af study results showed that moderate renal failure is an independent risk factor for stroke among af patients. in addition, a new clinical prediction rule that incorporated the renal risk proved to have a better discriminatory power than the chads and chadsvasc scoring systems. the rocket af study, however, excluded patients with advanced renal failure, those with egfr < 30 ml / min. in this retrospective cohort study we aimed to determine whether the r2chads clinical prediction rule can be applied to include patients with gfr < 30 ml / min. in this study, advanced ckd (defined by egfr < 30 ml / min), along with a prior cva, is one of the variables that increase the rate for stroke, tia and other central thromboses in non - valvular af. this is consistent with other studies that place a strong emphasis on ckd as a risk factor for thromboembolic phenomena. the exact mechanism as to how ckd increases risk for thromboembolic disease is not known but may involve a more rapid progression of atherosclerotic events, apart from other complications, such as difficult to control htn. it is also important to note that ckd, in itself, is usually a complication of other cardiovascular risks, such as uncontrolled diabetes and hypertension, which are major factors in development of atherosclerosis and thromboembolic complications. this rate is substantially higher when compared with previously reported rates of stroke in af patients with or without ckd. the presence of ckd and af confers a stroke rate that ranges from 17% in non - ckd to as high as 35% in dialysis patients [11, 12 ]. our result may be explained by the fact that our cohort is exclusively inpatient, representing a sicker population and a significant fraction of our patient population includes stroke patients who are admitted to the acute inpatient rehabilitation unit. several studies have attempted to incorporate ckd in the clinical prediction rules for stroke in af patients with varying results. in a study involving 978 patients, incorporating ckd in the traditional chads and chads - vasc did not result in an improved integrated discrimination index (idi) or c - statistics. another study compared chads, chadsvasc and r2chads in patients who underwent catheter ablation for af (the leipzig heart center af ablation registry). the results showed superiority of chadsvasc score over the other two clinical prediction models ; however, the study 's patient population of 2069 only included a total of 27 patients with renal failure, with an average egfr of 100 34 for controls and 88 25 for cases. the result of our study may have differed from those of the leipzig study because (i) our population included more patients with advanced renal failure (18 versus 1%), (ii) the median egfr for our cases was 50 ml / min (iqr 3060) and 68 ml / min (iqr 4968) for the controls, and (iii) there were no patients in our study who underwent ablation, which is known to treat the arrhythmic source in af. the clinical prediction rule r2chads, based on its published report, had a net reclassification index of 17.4%. we attempted to extend its clinical use to patients with advanced renal failure, a population excluded in the original calculation of this new risk scoring system. we calculated the area under the curve or auc using three groups based on ckd stages. in the first two groups (entire cohort and cohort excluding advanced ckd) the auc curve of r2chads was consistently greater than those of chads and chadsvasc. based on our results, r2chads showed good discriminatory power across all ckd levels without a decrease in c - statistics even when patients with egfr < 30 were included (0.718 versus 0.724). group 2 reflected the same cohort used in the rocket af study and our result is consistent with what they published : r2chads outperformed chads and chadsvasc even in patients with moderate ckd. interestingly there was no statistically significant difference in the c statistics for the three clinical prediction rules when only the advanced ckd patients were analyzed this lack of difference could be explained by (i) the relatively similar r2chads scores in these patients and (ii) that our small sample size is not adequately powered to detect a difference. the management of stroke in af begins with proper risk stratification of the patients. since the decision to anticoagulate depends on the risk perceived using clinical prediction rules, it is imperative that clinicians use a clinical prediction rule that has a good discriminatory power. currently, the commonly used clinical prediction rules for stroke in af are, at best, moderate in their discriminatory power. this problem is further magnified in ckd patients since ckd itself is an independent risk factor for stroke, with or without af, and for bleeding, on or off anticoagulation. first it showed that ckd, as well as advanced ckd, is an independent risk factor for stroke in af patients. second it further supports the use of r2chads as a better clinical prediction rule for the risk of stroke in af patients. lastly our results showed that r2chads may be used even in patients with advanced ckd without being inferior or superior to already available clinical prediction rules chads and chadsvasc. again, the lack of statistical difference in the discriminatory power of r2chads when compared with chads and chadsvasc in patients with advanced ckd may be explained by their homogenous risk profiles or by the small sample size. in this study, advanced ckd (defined by egfr < 30 ml / min), along with a prior cva, is one of the variables that increase the rate for stroke, tia and other central thromboses in non - valvular af. this is consistent with other studies that place a strong emphasis on ckd as a risk factor for thromboembolic phenomena. the exact mechanism as to how ckd increases risk for thromboembolic disease is not known but may involve a more rapid progression of atherosclerotic events, apart from other complications, such as difficult to control htn. it is also important to note that ckd, in itself, is usually a complication of other cardiovascular risks, such as uncontrolled diabetes and hypertension, which are major factors in development of atherosclerosis and thromboembolic complications. this rate is substantially higher when compared with previously reported rates of stroke in af patients with or without ckd. the presence of ckd and af confers a stroke rate that ranges from 17% in non - ckd to as high as 35% in dialysis patients [11, 12 ]. our result may be explained by the fact that our cohort is exclusively inpatient, representing a sicker population and a significant fraction of our patient population includes stroke patients who are admitted to the acute inpatient rehabilitation unit. several studies have attempted to incorporate ckd in the clinical prediction rules for stroke in af patients with varying results. in a study involving 978 patients, incorporating ckd in the traditional chads and chads - vasc did not result in an improved integrated discrimination index (idi) or c - statistics. another study compared chads, chadsvasc and r2chads in patients who underwent catheter ablation for af (the leipzig heart center af ablation registry). the results showed superiority of chadsvasc score over the other two clinical prediction models ; however, the study 's patient population of 2069 only included a total of 27 patients with renal failure, with an average egfr of 100 34 for controls and 88 25 for cases. the result of our study may have differed from those of the leipzig study because (i) our population included more patients with advanced renal failure (18 versus 1%), (ii) the median egfr for our cases was 50 ml / min (iqr 3060) and 68 ml / min (iqr 4968) for the controls, and (iii) there were no patients in our study who underwent ablation, which is known to treat the arrhythmic source in af. the clinical prediction rule r2chads, based on its published report, had a net reclassification index of 17.4%. we attempted to extend its clinical use to patients with advanced renal failure, a population excluded in the original calculation of this new risk scoring system. we calculated the area under the curve or auc using three groups based on ckd stages. in the first two groups (entire cohort and cohort excluding advanced ckd) the auc curve of r2chads was consistently greater than those of chads and chadsvasc. based on our results, r2chads showed good discriminatory power across all ckd levels without a decrease in c - statistics even when patients with egfr < 30 were included (0.718 versus 0.724). group 2 reflected the same cohort used in the rocket af study and our result is consistent with what they published : r2chads outperformed chads and chadsvasc even in patients with moderate ckd. interestingly there was no statistically significant difference in the c statistics for the three clinical prediction rules when only the advanced ckd patients were analyzed this lack of difference could be explained by (i) the relatively similar r2chads scores in these patients and (ii) that our small sample size is not adequately powered to detect a difference. the management of stroke in af begins with proper risk stratification of the patients. since the decision to anticoagulate depends on the risk perceived using clinical prediction rules, it is imperative that clinicians use a clinical prediction rule that has a good discriminatory power currently, the commonly used clinical prediction rules for stroke in af are, at best, moderate in their discriminatory power. this problem is further magnified in ckd patients since ckd itself is an independent risk factor for stroke, with or without af, and for bleeding, on or off anticoagulation. first it showed that ckd, as well as advanced ckd, is an independent risk factor for stroke in af patients. second it further supports the use of r2chads as a better clinical prediction rule for the risk of stroke in af patients. lastly our results showed that r2chads may be used even in patients with advanced ckd without being inferior or superior to already available clinical prediction rules chads and chadsvasc. again, the lack of statistical difference in the discriminatory power of r2chads when compared with chads and chadsvasc in patients with advanced ckd may be explained by their homogenous risk profiles or by the small sample size. the researchers were able to include only patients with follow - up in at least 1 year, as reflected in the electronic medical record, in the final analysis. those who did not follow - up for any other reason (i.e. non - compliance, admission in other institution, death, etc.) within the specified time frame were excluded. this was done to address the issue of missing outcomes or drop - outs which, in a prospective study, would have been solved by intention - to - treat analysis. because of this, however, the population size was reduced, consequently decreasing the power of the study. increasing the time frame used to collect more samples might be done in the future to address this issue. despite adjusting for confounding variables, residual effects of these variables may have affected our results. many of a priori risk factors for stroke in af patients did not prove to be statistically significant in our results. risk factors such as diabetes, vascular disease, age and sex were more prevalent in those with a primary endpoint but their associations were not statistically significant. a possible explanation is that our sample size is underpowered to detect a statistical significance in the risk for stroke in the presence of these risk factors. in addition, our population is homogenously inpatient and thus may limit the generalizability of our results. patients who did not need any admission represent a healthier population and may have less risk for developing stroke. the chads, chadsvasc and the r2chads were calculated from populations that were predominantly white and racial difference is being increasingly recognized as a risk factor in stroke and other vascular diseases. advanced ckd is associated with an increased risk of stroke and other primary outcomes in non - valvular af patients. adding ckd in r2chads to predict risk for stroke in non - valvular af results in a higher predictive and discriminatory power compared with chads and chadsvasc in this retrospective study. the use of r2chads in predicting stroke risk in non - valvular af will likely include more patients to be considered for primary or secondary stroke prevention, but, because of the increased risk for bleeding, the decision to anticoagulate would need careful decision - making on the part of the physician, balancing the risk - benefit obtained from such treatment. | backgroundthe r2chads2 is a new prediction rule for stroke risk in atrial fibrillation (af) patients wherein r stands for renal risk. however, it was created from a cohort that excluded patients with advanced renal failure (defined as glomerular filtration rate of < 30 ml / min). our study extends the use of r2chads2 to patients with advanced renal failure and aims to compare its predictive power against the currently used chads and cha2ds2vasc.methodsthis retrospective cohort study analyzed the 1-year risk for stroke of the 524 patients with af at metropolitan hospital center. auc and c statistics were calculated using three groups : (i) the entire cohort including patients with advanced renal failure, (ii) a cohort excluding patients with advanced renal failure and (iii) all patients with gfr < 30 ml / min only.resultsr2chads2, as a predictor for stroke risk, consistently performs better than chads2 and cha2ds2vsc in groups 1 and 2. the c - statistic was highest in r2chads compared with chads or chadsvasc in group 1 (0.718 versus 0.605 versus 0.602) and in group 2 (0.724 versus 0.584 versus 0.579). however, there was no statistically significant difference in group 3 (0.631 versus 0.629 versus 0.623).conclusionour study supports the utility of r2chads2 as a clinical prediction rule for stroke risk in patients with advanced renal failure. |
in europe, many countries will be confronted with aging populations in the coming decades. for example, it is estimated that in 2020, 28% of the french population will be over 60. a great way to resolve partially this difficulty is to encourage old people to be cared for in their own homes. this strategy presents two main advantages : the elderly want to stay at home as long as possible ; they keep the privacy they do not want to lose, it is less expensive than a place in a collective accommodation. the elderly want to stay at home as long as possible ; they keep the privacy they do not want to lose, it is less expensive than a place in a collective accommodation. it aims to help professional home - care teams in their job by thinking up innovative software technologies, more precisely : by increasing the number of old people looked after in their homes with an adaptive and nonintrusive remote assistance, by reassuring family circle. the system ensures that the monitored person is secure ; so, people around him feel at ease, andby contributing towards its democratization. the use of simple elements (e.g., basic sensors) minimizes the initial cost of a monitoring system. we made a study of systems having the same aim the following section describes three well - known and relevant european systems in the home - care domain. these systems focus on individuals (they are user - centred) : a system surveys only one person ; thus, there is a duplication for each individual looked after. nevertheless, patterns of monitored people could be used to estimate the status of someone in relation to their community or to integrate new comings. by increasing the number of old people looked after in their homes with an adaptive and nonintrusive remote assistance, by reassuring family circle. the system ensures that the monitored person is secure ; so, people around him feel at ease, and by contributing towards its democratization. the use of simple elements (e.g., basic sensors) minimizes the initial cost of a monitoring system. we propose a multiagent system that is able to generalize, which builds a classification of monitored people. an indicator is data about daily activities, positions, and physiological information. in a first step, the agent applies a local - classification method and obtains an incomplete patterns ' partition. next, the partial partitions are compared with each other in order to build a complete classification. we conceived an open system : new people or / and new indicators bring in new agents or / and new patterns. in section 3, we present the architecture of the system and how it runs. this dynamically updated classification has the following three main uses : to find certain similarities with the existing tools for evaluating the dependence dependence grid of the social services, for example, to get global statistical data about old people looked after in their own homes, andto generate specialized alarms depending on the detected event. once the classification is set up and people status is known, decisions can be taken to personalize the process of monitoring someone activated sensors, generated alarms, and danger zone. these aspects are discussed in the last section. to find certain similarities with the existing tools for evaluating the dependence dependence grid of the social services, for example, to get global statistical data about old people looked after in their own homes, and to generate specialized alarms depending on the detected event. once the classification is set up and people status is known, decisions can be taken to personalize the process of monitoring someone activated sensors, generated alarms, and danger zone. the use of computers to help people stay at home has been the subject of many research projects. some of them are quite ambitious and regroup many partners. in this section, we describe a selection of three projects designed to assist people in their living environment. we expect to give the reader an overview of the advancement in this area and also the bases our project is laying on. the selection shows different hardware and software problematics (communication networks, system interoperability, data analysis, emergency handling, and alerts filtering). the prosafe project [2, 3 ] attempts to automatically identify the daily activities of the monitored person. the processing of collected data is carried out on doctor 's request with an adapted interface. the final operational objective is to detect any abnormal behaviour such as a fall, a runaway, or an accident. the research objective is to gather characteristic data about the nightly or daily activities of the patient. more precisely, the system can describe events that took place during monitoring time time spent in bed or in the toilets, entering or leaving the bedroom, moving inside the home, build a database with all abnormal situations detected, andbuild statistics about past activities. at the hardware level, the system configuration uses a ground network (a mobile version is also usable). currently acquisition and data processing are local, and monitoring is both local and distant. describe events that took place during monitoring time time spent in bed or in the toilets, entering or leaving the bedroom, moving inside the home, build a database with all abnormal situations detected, and build statistics about past activities. the interface for nurses allows them visualizing the patient state and abnormal situations (alerts and alarms) in the bedroom. as soon as an alarm is raised, a beeper calls a nurse. in the same time, doctors can access a database updated in real time with statistical data about the patient behaviour. experiments have been made to gather data about the daily activities of patients in hospitals, especially during the night. experimental sites have been set up in two hospitals and three more are being installed in elderly people residences. to conclude, let us say that one of the main features of this project is to be based on real - time analysis of data. the ailisa project [4, 5 ] (intelligent apartments for effective longevity) is an experimental platform to evaluate remote care and assistive technologies in gerontology. this ambitious project regroups specialists of smart homes, networks and computing, electronics, and signal processing. more precisely, the project sets up a monitoring platform composed of a home equipped with a set of sensors and health devices (presence detectors, wrist arterial pressure sensors, and pulse oximeter),a smart shirt developed by the french company tam with several sensors and electronics embedded in the textile to detect falls, a smart assistant robot for ambulation to secure the displacements and assist the person during transfers, anda software system to gather and analyze the sensors output. the project aims to set up an interdisciplinary platform for the evaluation of the technologies at the three following levels : technical, medical, and ethical. a home equipped with a set of sensors and health devices (presence detectors, wrist arterial pressure sensors, and pulse oximeter), a smart shirt developed by the french company tam with several sensors and electronics embedded in the textile to detect falls, a smart assistant robot for ambulation to secure the displacements and assist the person during transfers, and a software system to gather and analyze the sensors output. the e - vital project (cost - effective health services for interactive continuous monitoring of vital signs parameters) is a modular and ambulatory telemedicine platform. the developed device allows staff to take measurements and data collected to be sent to the resident doctor. this doctor can remotely diagnose whether there is a problem that needs them to visit or that requires the resident to receive hospital treatment. by way of a personal digital assistant (pda), the server is a multiagent system where each agent focuses on a specific task related to the medical stored data. for example, an alert manager is specialized for the raising of alert messages, a profile manager for access management and a schedule manager for healthcare scheduling. the e - vital project is mainly hardware and tries to solve the interoperability problems between non compatible devices. these objectives (care protocol, devices interoperability) are different from ours but the approach is similar : e - vital is an open system with several interconnected modules, one of which being a multiagent system. the difference resides on the application level : when our system is a group - centred system, e - vital is a patient - centred system (it does not use the patient 's record to develop generic profiles). we presented three systems which are able to monitor the elderly in their own homes. all three projects seek to gather information about people by the way of hardware and software solutions. they differ in the type of collected data, in the way they use it, and in their objectives. from the simple gathering of health information for caregivers, to the complete profiling of people, resources are quite different. in all cases, the patient is an isolated person, installed in the centre of these systems ; systems which have mainly a local vision of situations. these works have inspired more recent projects ; these projects are in progress so their results can not be analysed yet. this is the case of the gerhome project, led by two french research centers. let us also talk of the european oldes project, which tackles the problem of the elderly people access to the new technologies. it tries to create low - cost hardware with very easy - to - use interfaces. our research is based on the progress and technologies developed in all these projects, especially those that gather information about the monitored person, whatever granularity this information can have. for example, the information can be the cardiac output, or something of higher level like behaviour information. this data is the raw material of our system and is used to generate several categories of people. then these categories are used to make global assumptions about people belonging to the same class. so our problematic is to collect the results of a large number of individual monitoring and to draw several categories. this classification provides several reusable classes of people. for that, we deploy a classification framework, usable in a large - scale configuration, and based on multiagent technology. we propose a system able to carry out a generalization of profiles ' patterns and to propose a classification of monitored people. s(ma)d (multiagent system for keeping elderly people in their own homes) is a multiagent framework in which agents use a restricted cooperation protocol to collectively perform classifications. we chose a multiagent approach because these systems proved their adequacy in many health problems. in this field, medical knowledge to solve a problem can be distributed in various places. for example, to establish the medical file of a patient, it is necessary to have analyzes and tests coming from several hospitals. agents work in various places, each agent managing a part of the knowledge. multiagent architecture is particularly adequate if the problem - solving implies the coordination of various specialized people (e.g., units of a hospital must collaborate to establish patient scheduling). then, the agents have cooperative skills to communicate and to build together a solution progressively. moreover, many medical problems are complex and often standard solutions are not easy to find. a multiagent problem - solving is based on decomposition in subproblems. let us take for example organ transplants : when a new organ is available, the more appropriate recipient must be found very quickly. moreover, each hospital keeps the data of its patients ; they are in the waiting list depending on the type of organ. it would be difficult to conceive and apply a complex centralized system to solve this coordination problem (e.g., a standard decision aid expert system). a great quantity of medical knowledge is available on the internet, and it is necessary to access to the most suitable information. the agents can be employed to play the mediators between doctors and patients, or between medical resources. these agents seek information issued from various sources, analyze selected data, and choose useful information according to the profiles of the consultants. to conclude, the agents ' autonomy is an adequate paradigm to deploy systems, in which each component models the behaviour of an independent entity ; this entity has its own knowledge, skills, and individual goals. the system is based on a bunch of sensors carried by monitored people or installed in their homes. those sensors are, for example, presence and movement sensors or medical measuring apparatus. some indicators can also come from human information : notes of a nurse or patient 's answers to a questionnaire. the set of sensors and this software layer are out of the scope of our work. it is important to note that the functioning of the system is independent of the type and the number of indicators. indicators are collected by classification agents constituting the system. because the system is strongly distributed, there can also be some overlaps, if the same information is collected by several agents. thus, classification agents aj have indicators ik concerning several individuals pi (figure 1). with its indicators, each agent calculates a local, partial classification. this classification does not take into account all the indicators and is related to a reduced sample of the population. since the data inputs are numerical values, any statistical classification method is applicable. to refine this classification, they congregate in acquaintances network according to the similarity of the produced partitions. more precisely, each agent seeks the other agents which made a classification close to its own. to compute the classes of the collaboratively determined partition, we designed a restricted cooperation protocol in three steps : call for participation / acquaintance 's group constitution / multiagent classification. they constitute parallel classifications : they are views of the same monitored people but according to various criteria (figure 2). these values can be normalized by several methods as (i) normalization between [0 1 ] (1)ij = ijijminijmaxijmin, where ij (resp., ij) is the minimum value (resp., maximum value) of indicator number j, and (ii) linear normalization(2)ij = ij - ijj, where ij is the average values of indicator number j for a given agent, and j is the standard deviation of the indicator number j for a given agent (3)j = vj, vj=1nk=1n(ijkij)2, where vj is the variance of indicator number j for a given agent ; n is the number of people monitored by an agent ; ij is the indicator number j of the person number k. thereafter we apply our proposal on an example of 3 agents, 3 behaviour indicators, and 11 people. suppose i1 is the body temperature, i2 is the number of getting up / sleeping in one night, and i3 is the number of entries to the toilets each day. the following table shows the distribution of people (pi) and indicators (ij) on the agents (ak) of the system. table 2 shows that agent a1 monitors 2 indicators i1 and i2 on people p1, p2, p3, p4, p5, and p11. agent a2 monitors 2 indicators i2 and i3 on people p4, p5, p6, p7, p8, and p11. a3 monitors 2 indicators i1 and i3 on people p3, p6, p9, p10, and p11. this table also shows that people do not have the same indicators (it will often happen in real situations). for example, p1 has only two indicators because for this person it is not necessary to test the number of entries to the toilets. we assume that the sensors send data to the system on a daily basis. in reality there are indicators that are more important than others, for example, body temperature is more important than the outside temperature, so we give a weight for each indicator ; this weight will help us later to form the groups of agents and to calculate the distance between classes in our case we give to i1 (body temperature) the weight 3, i2 the weight 2, and i3 the weight 1 (which is the default value). by applying a local classification method (e.g., isodata) the process to constitute agents groups for each agent ai is as follows : ai sends its indicators to other agents;ai receives the indicators from other agents;for each other agent, ai calculates the sum of the weights of common indicators (calling s1), and the sum of the weights of noncommon indicators (calling s2);if s1s1ai responds to the agent concerned;the agents of a group are agents who have exchanged messages between them. in our case, a1 sends i1 and i2. as the weight of i1 is greater than i2 and i3, a1 chooses a3 to form a group. the first group is formed by a1 and a3, and the second is formed by a2. ai sends its indicators to other agents ; ai receives the indicators from other agents ; for each other agent, ai calculates the sum of the weights of common indicators (calling s1), and the sum of the weights of noncommon indicators (calling s2) ; if s1s1ai responds to the agent concerned ; the agents of a group are agents who have exchanged messages between them. the agents of a group measure the distances between their classes using the weighted euclidean distance : (5)dw(c, c)=(1jnwj(dj(c, c))2)1/2. in which c and c are two classes, wj is the weight of the indicator number j, n is the number of common indicators between the two classes, and dj(c, c) is the distance between the two midvectors of the two classes according to the indicator number j. we can apply this formula on the actual values or normalized values of indicators. in this example the agent a1 seeks to each of its classes, the closest classes of its group among other agents. calculation of distances between classes : (6)dw(ca11,ca31)=3 ; dw(ca11,ca32)=0;dw(ca12,ca31)=0 ; dw(ca12,ca32)=3;dw(ca13,ca31)=3 ; dw(ca13,ca32)=23. after the calculation of distances, we find that the class ca1 should be merged with ca3, and that ca1 should be merged with ca3 by contrast, ca1 should not be merged with ca3 because there is another class from a1 nearest to ca3. these vectors are the averages of the indicators values of people belonging to the same class. for example, p3 is classified by a1 and a3 in a class by itself according to i1 and i2, and it is classified with p2, p5, p6, and p10, according to i1, i2, and i3. as prospects, we intend to set a minimum threshold for the distance between classes. this threshold will be based on indicators and their weights. if the distance between two classes is greater than this threshold, they will not merge, even if they are close in the sense described above. this classification is actually multiagent because the classification result is not the work of a simple agent, as it is the case in other multiagent systems (choice of the most skilled). this multiagent classification answers to the problem of the search of patterns in an open and dynamic environment. classical methods do not make it possible to increase the system scale : for example, when the number of entries changes (with the addition of a new indicator), all calculation and generation of classes must be made again. thus, our method satisfies the requirements of our application because it does not depend on the type of the indicators and does not require preliminary categories. the management of the monitored people continues throughout the functioning of the system, as the agents collect more indicators values. thus patterns evolve and the class of people can change. also an indicator can be deactivated : it corresponds to a data for which it is not essential to monitor this type of people. our system builds dynamic classifications of monitored people according to indicators that depend on the application. the first is the dynamic evolution of classifications if needed, new data and new indicators can be added at any moment, and the system is able to reconfigure its classes and generate new classification patterns. the second is that the system is generic with respect to indicators and, thus, is able to function on any type of applications having strongly distributed entries. such a system is likely to bring solutions to several current problems in the home - monitoring field. organizations of assistance to elderly people often use an evaluation grid of the dependence degree to determine the service needed by people. the result of this evaluation is also used to evaluate the cost of taking charge of someone. the use of our classification system will make it possible to see whether there is an adequacy between the evaluation of monitored people by the grid and the produced profile classes. the matching of the two evaluation ways would validate our approach but also could consolidate the relevance of the grid criteria. in the contrary case, it will be necessary to re - examine the classification method and/or the selected indicators. after validation, the system will be able to follow the evolution of the dependence degree of someone. thus, somebody leaving his original pattern to enter a new one could be re - evaluated by the helper organization, and the assistance could be adapted to his new behaviours. the migration of a lot of people from a class toward another or the modification of certain characteristics of a class should indicate a collective event which affects several people ; this can happen, for example, during a heat wave or an epidemic. this help is for already detected people, suffering of cardiac and pulmonary insufficiencies, asthma, or alzheimer disease. the possibility of having a global vision of several monitored people can bring richer and more relevant information on the follow - up ; the distribution in classes and the historic of the patterns evolution (system training) should allow new people entering the system to get a better service ; in particular, more appropriate alerts according to the incurring risk should be generated. in the long term, with the evolution of life ways, we can consider the monitoring of healthy people with personal or family antecedents relating to a disease or a medical event. the system will make it possible to identify evolution diagrams of health parameters and life way (e.g., state - of - the - immune system, sleeping, nutrition, activity, etc.) who will indicate high risks to develop diseases. we chose to tackle the home - monitoring issue in a more global way rather than in an only individual - centred way. this collective vision makes it possible to release individuals ' patterns who will allow the system answering current health problems. this large - scale and global solution (uninterrupted monitoring of hundreds of people) requires setting up a strongly distributed and dynamic system. because classical classification methods are not adapted to this context, we had to propose a new distributed classification method., we randomly generated a great number of numerical vectors of values and we observed the formation of classes. one of our professional partners cvital (platform of coordination of care and services to the person) is making a study about people whom this organism follows. this study will make it possible to define the number and the types of main indicators. | this research takes place in the s(ma)2d project which proposes software architecture to monitor elderly people in their own homes. we want to build patterns dynamically from data about activity, movements, and physiological information of the monitored people. to achieve that, we propose a multiagent method of classification : every agent has a simple know - how of classification. data generated at this local level are communicated and adjusted between agents to obtain a set of patterns. the patterns are used at a personal level, for example to raise an alert, but also to evaluate global risks (epidemic, heat wave). these data are dynamic ; the system has to maintain the built patterns and has to create new patterns. so, the system is adaptive and can be spread on a large scale. |
according to the definition of world health organization (who), quality of life (qol) is the individual 's perception of his / her position in life in the context of the culture, value systems in which he / she lives, and in relation to his / her goals, expectations, standards and concerns. studies have identically shown that patients with multiple sclerosis (ms) experience lower qol compared to healthy control group. in addition to the chronic nature of the disease, lack of prognosis and a definitive therapy besides suffering from it from early adulthood causes several psychological symptoms among which depression, anxiety, and stress are the most common. in recent years, there has been an increase in the number of studies on the relationship between these factors and qol in ms. overall, these studies have demonstrated significant relationship between fatigue and psychological symptoms with qol dimensions. in these studies, low qol has been predicted by fatigue and psychological symptoms, especially depression and anxiety. there is skepticism about the relative importance of these predictors, especially fatigue and depression, as with regard to qol of ms patients, some researches in which fatigue and depression were studied simultaneously have proved fatigue to be the more powerful predictor and some others have proved depression to be the stronger variable, while anxiety has been relevant only in some qol studies and in others it has not emerged as a significant predictor of qol. moreover, there is a shortcoming in the studies of stress in relation to qol of ms patients. for example, researchers have focused more on the effects of stress on exacerbations and relapses, new brain magnetic resonance imaging (mri) lesions, inflammation, radiological disease activity, and depressive symptoms of ms patients and mainly are marginalized the role of stress in reducing the physical and psychological aspects of patients qol. but in a cross - sectional investigation, we have demonstrated that qol has a negative correlation with all three symptoms of depression, anxiety, and stress (sequenced based on the degree of significance). thus, the major weakness of previous studies is the existence of inconsistency in the findings about the contribution of each of the symptoms of fatigue, depression, anxiety, and stress in predicting the physical and psychological aspects of qol of ms patients. furthermore, some of the studies on qol of ms patients have not attempted to control the confounding factors or have chosen very small sample size of patients. hence, the present study aims to evaluate the role of each of the mentioned symptoms in predicting the qol of people with ms. verbal information about the research study was provided for patients and written informed consent was given by patients. patients also informed about their right to withdraw from the study at any time if they so desired. this study was conducted in 2010 by descriptive cross - sectional method in patients with ms supported by the ms society of guilan province (north of iran). one hundred and sixty - two patients were selected by consecutive sampling as the study sample. inclusion criteria included patients diagnosed with ms disease based on mcdonald criteria, with the diagnosis confirmed by a neurologist. the existence of ms disease was determined by the symptoms and clinical characteristics of the patient and also by the clinical evidence of lesion in two or more regions of the central nervous system (cns). in order to confirm the damage, paraclinical measures such as mri, evoked potential (ep), and cerebrospinal fluid (csf) levels were used and patients who had a record at ms society were confirmed of the diagnosis of the disease based on the mentioned findings. the exclusion criteria were : (a) occurrence of severe ms attack, (b) presence of severe cognitive problems due to which the patient was not able to fill in the tools and answer the interviewer, and (c) existence of any debilitating disease or physical issue associated with ms. this research was conducted in the ms society of guilan province and imam reza specialized and sub - specialized clinic. at the beginning of sampling, patients who satisfied the inclusion criteria were contacted and referred to the clinic. during the initial assessment, an explanation about the objectives of the study and the methods of research had been given to the patient and his / her family or companion. also, patients were assured of the confidentiality of the measurements. finally, after the patient and his / her family or companion signed the consent form, the patient entered the study. data collection was with the help of a questionnaire and scale which included a section for demographic information and other sections for qol assessment, fatigue severity, and psychological symptoms of ms patient. subjects were asked to first fill up the demographic information list and then fill up the questionnaire and scale under the supervision of a psychologist who was present at the study location. in this study, based on the demographic characteristics of patients, data related to age, sex, marital status, education level, personal and family background of visiting a psychologist or a psychiatrist, and duration of ms (in months) were collected. it includes 36 questions and provides two general measures of function : physical component summary (pcs) and mental component summary (mcs). each question is scored from 1 to 100 and scores close to 100 indicate better qol. in this regard, a study was conducted to confirm the validity and reliability of the persian translation of short - form health survey questionnaire (sf-36). in general, the findings showed that persian translation of sf-36 is an appropriate measuring tool for assessing health perceptions. this tool, which was initially created by krupp to measure the fatigue level of ms patients, is a nine - item scale that examines the amount of fatigue with scores ranging from 1 to 7. the criterion validity of this tool has been reported as 0.68 and the internal consistency coefficient as 0.81. by examining different aspects of the persian version of fatigue severity scale (fss), it has been proved that the persian version is an appropriate psychometric tool for assessing ms patients. persian version of this instrument which was originally presented by lovibond and lovibond has been used to assess depression, anxiety, and stress of patients. have also recommended the use of tools that measure several symptoms in the cases of neurological disorders with psycho - neuro symptoms. this scale has 21 questions and each of three sub - scales includes seven questions, the scores of which are obtained by summing up the scores of related questions. evidences confirm the preliminary reliability and preliminary construct validity of the persian translation of depression, anxiety, stress scale-21 (dass-21). to describe the data in this study, descriptive statistical indicators like percentiles, mean, and standard deviation were used. in the inferential statistics section, we applied pearson correlation analysis to test the relation hypotheses. also, hierarchical regression was used in order to measure the influence of fatigue, depression, anxiety, and stress on pcs and mcs components. finally, based on the results of this statistical analysis which included non - standardized coefficient (b), standard deviation coefficient (seb), beta coefficients (), r square (r), and f values, prediction models of pcs and mcs were derived for the psychological symptoms and fatigue. verbal information about the research study was provided for patients and written informed consent was given by patients. patients also informed about their right to withdraw from the study at any time if they so desired. this study was conducted in 2010 by descriptive cross - sectional method in patients with ms supported by the ms society of guilan province (north of iran). one hundred and sixty - two patients were selected by consecutive sampling as the study sample. inclusion criteria included patients diagnosed with ms disease based on mcdonald criteria, with the diagnosis confirmed by a neurologist. the existence of ms disease was determined by the symptoms and clinical characteristics of the patient and also by the clinical evidence of lesion in two or more regions of the central nervous system (cns). in order to confirm the damage, paraclinical measures such as mri, evoked potential (ep), and cerebrospinal fluid (csf) levels were used and patients who had a record at ms society were confirmed of the diagnosis of the disease based on the mentioned findings. the exclusion criteria were : (a) occurrence of severe ms attack, (b) presence of severe cognitive problems due to which the patient was not able to fill in the tools and answer the interviewer, and (c) existence of any debilitating disease or physical issue associated with ms. this research was conducted in the ms society of guilan province and imam reza specialized and sub - specialized clinic. at the beginning of sampling, patients who satisfied the inclusion criteria were contacted and referred to the clinic. during the initial assessment, an explanation about the objectives of the study and the methods of research had been given to the patient and his / her family or companion. also, patients were assured of the confidentiality of the measurements. finally, after the patient and his / her family or companion signed the consent form, the patient entered the study. data collection was with the help of a questionnaire and scale which included a section for demographic information and other sections for qol assessment, fatigue severity, and psychological symptoms of ms patient. subjects were asked to first fill up the demographic information list and then fill up the questionnaire and scale under the supervision of a psychologist who was present at the study location. in this study, based on the demographic characteristics of patients, data related to age, sex, marital status, education level, personal and family background of visiting a psychologist or a psychiatrist, and duration of ms (in months) were collected. it includes 36 questions and provides two general measures of function : physical component summary (pcs) and mental component summary (mcs). each question is scored from 1 to 100 and scores close to 100 indicate better qol. in this regard, a study was conducted to confirm the validity and reliability of the persian translation of short - form health survey questionnaire (sf-36). in general, the findings showed that persian translation of sf-36 is an appropriate measuring tool for assessing health perceptions. this tool, which was initially created by krupp to measure the fatigue level of ms patients, is a nine - item scale that examines the amount of fatigue with scores ranging from 1 to 7. the criterion validity of this tool has been reported as 0.68 and the internal consistency coefficient as 0.81. by examining different aspects of the persian version of fatigue severity scale (fss), it has been proved that the persian version is an appropriate psychometric tool for assessing ms patients. persian version of this instrument which was originally presented by lovibond and lovibond has been used to assess depression, anxiety, and stress of patients. have also recommended the use of tools that measure several symptoms in the cases of neurological disorders with psycho - neuro symptoms. this scale has 21 questions and each of three sub - scales includes seven questions, the scores of which are obtained by summing up the scores of related questions. evidences confirm the preliminary reliability and preliminary construct validity of the persian translation of depression, anxiety, stress scale-21 (dass-21). in this study, based on the demographic characteristics of patients, data related to age, sex, marital status, education level, personal and family background of visiting a psychologist or a psychiatrist, and duration of ms (in months) were collected. it includes 36 questions and provides two general measures of function : physical component summary (pcs) and mental component summary (mcs). each question is scored from 1 to 100 and scores close to 100 indicate better qol. in this regard, a study was conducted to confirm the validity and reliability of the persian translation of short - form health survey questionnaire (sf-36). in general, the findings showed that persian translation of sf-36 is an appropriate measuring tool for assessing health perceptions. this tool, which was initially created by krupp to measure the fatigue level of ms patients, is a nine - item scale that examines the amount of fatigue with scores ranging from 1 to 7. the criterion validity of this tool has been reported as 0.68 and the internal consistency coefficient as 0.81. by examining different aspects of the persian version of fatigue severity scale (fss), it has been proved that the persian version is an appropriate psychometric tool for assessing ms patients. persian version of this instrument which was originally presented by lovibond and lovibond has been used to assess depression, anxiety, and stress of patients. have also recommended the use of tools that measure several symptoms in the cases of neurological disorders with psycho - neuro symptoms. this scale has 21 questions and each of three sub - scales includes seven questions, the scores of which are obtained by summing up the scores of related questions. evidences confirm the preliminary reliability and preliminary construct validity of the persian translation of depression, anxiety, stress scale-21 (dass-21). to describe the data in this study, descriptive statistical indicators like percentiles, mean, and standard deviation were used. in the inferential statistics section, we applied pearson correlation analysis to test the relation hypotheses. also, hierarchical regression was used in order to measure the influence of fatigue, depression, anxiety, and stress on pcs and mcs components. finally, based on the results of this statistical analysis which included non - standardized coefficient (b), standard deviation coefficient (seb), beta coefficients (), r square (r), and f values, prediction models of pcs and mcs were derived for the psychological symptoms and fatigue. based on the inclusion and exclusion criteria, 162 patients of age between 16 and 58 years and with a mean age of 34.07 9.44 years were included in this study. of these, 29.6% were males and 70.4% were females (ms is more common in women). marital status indicated that 21% were single, 75.9% married, 0.6% widowed, and 2.5% were divorcees. moreover, 7.4% of patients had primary school education and 14.7%, 49.7%, and 28.2% had pre - high school, high school, and university education, respectively. furthermore, findings show that 17.3% of ms patients had records of psychologist or psychiatrist appointments and 10.5% of ms patients stated that one of their family members had visited experts. finally, average duration of disease in these patients was 56.94 56.08 months. in order to test the hypothesis of supposed relations between pcs, mcs, fatigue, depression, anxiety, and stress, table 1 indicates the mean, standard deviation, and intercorrelation between variables of the study. as can be seen, there was a high intercorrelation between the variables included in the study (p < 0.01). mean, standard deviation, and intercorrelation between variables (n=162) hierarchical regression analysis was applied to assess the effects of entered variables on pcs and mcs [tables 2 and 3 ]. results of hierarchical regression to assess the effects of included variables on pcs results of hierarchical regression to assess the effects of included variables on mcs it can be seen in table 2 that the total variance of all entered variables was 0.53 (r) in the third step (p < 0.001, f = 15.95). yet, it has to be considered that additional variance in the final step, after controlling demographic variables such as age, sex, marital status, education level, personal and family background of visiting a psychologist or a psychiatrist, and duration of ms (in months), was estimated to be 0.33. it means that the main variables of the study have explained 33% of pcs variance, although it has to be noted that among the predictor variables, in the final step, only stress had not emerged as a significant variable (= 0.07), whereas anxiety was the largest predictor variable at this stage (= -0.46, p < 0.001) [table 2 ]. table 3 indicates that by considering all included variables, the total variance for mcs of third step was 0.51 (r) (f = 15.26, p < 0.001), although additional variance at this step and after controlling demographic variables was 0.38. also, it has to be noted that among the predictor variables of the study and after controlling demographic factors, only depression stood as the significant predictor for mcs. this shows that depression alone has explained 38% of mcs variance (= -0.39, p < 0.001) [table 3 ]. hierarchical regression analysis was applied to assess the effects of entered variables on pcs and mcs [tables 2 and 3 ]. results of hierarchical regression to assess the effects of included variables on pcs results of hierarchical regression to assess the effects of included variables on mcs it can be seen in table 2 that the total variance of all entered variables was 0.53 (r) in the third step (p < 0.001, f = 15.95). yet, it has to be considered that additional variance in the final step, after controlling demographic variables such as age, sex, marital status, education level, personal and family background of visiting a psychologist or a psychiatrist, and duration of ms (in months), was estimated to be 0.33. it means that the main variables of the study have explained 33% of pcs variance, although it has to be noted that among the predictor variables, in the final step, only stress had not emerged as a significant variable (= 0.07), whereas anxiety was the largest predictor variable at this stage (= -0.46, p < 0.001) [table 2 ]. table 3 indicates that by considering all included variables, the total variance for mcs of third step was 0.51 (r) (f = 15.26, p < 0.001), although additional variance at this step and after controlling demographic variables was 0.38. also, it has to be noted that among the predictor variables of the study and after controlling demographic factors, only depression stood as the significant predictor for mcs. this shows that depression alone has explained 38% of mcs variance (= -0.39, p < 0.001) [table 3 ]. hierarchical regression analysis was applied to assess the effects of entered variables on pcs and mcs [tables 2 and 3 ]. results of hierarchical regression to assess the effects of included variables on pcs results of hierarchical regression to assess the effects of included variables on mcs it can be seen in table 2 that the total variance of all entered variables was 0.53 (r) in the third step (p < 0.001, f = 15.95). yet, it has to be considered that additional variance in the final step, after controlling demographic variables such as age, sex, marital status, education level, personal and family background of visiting a psychologist or a psychiatrist, and duration of ms (in months), was estimated to be 0.33. it means that the main variables of the study have explained 33% of pcs variance, although it has to be noted that among the predictor variables, in the final step, only stress had not emerged as a significant variable (= 0.07), whereas anxiety was the largest predictor variable at this stage (= -0.46, p < 0.001) [table 2 ]. table 3 indicates that by considering all included variables, the total variance for mcs of third step was 0.51 (r) (f = 15.26, p < 0.001), although additional variance at this step and after controlling demographic variables was 0.38. also, it has to be noted that among the predictor variables of the study and after controlling demographic factors, only depression stood as the significant predictor for mcs. this shows that depression alone has explained 38% of mcs variance (= -0.39, p < 0.001) [table 3 ]. the main objective of the present study was to find the role of psychological factors of depression, anxiety, and stress, and also fatigue in pcs and mcs components (in sf-36) of ms patients. previous research evidences show that fatigue and psychological symptoms associated with ms are related to decrease in qol of these patients. the findings of these researches are in accordance with the results of this study, as there was a significant relationship between physical and mental aspects of qol with the factors of fatigue and psychological symptoms [table 1 ]. the main interpretation of this finding is that fatigue can strongly influence performing the daily activities and become a major reason for unemployment, as the findings of mccabew and de judicibus indicated that the pressures lead to changes in the economic situation and dealing with these pressures is momentous for qol of ms patients. furthermore, psychological symptoms can affect the self - efficiency and self - worthiness perception of the ms patient because these symptoms can undermine the coping resources of the person. moreover, results show that fatigue, depression, and anxiety are the major predictors of pcs for ms patients, while stress has not turned out to be a significant predictor [table 2 ]. a recent study conducted on two groups of patients suffering from chronic fatigue syndrome (cfs) and ms indicated that in both groups, worse pcs in sf-36 was significantly associated with higher fatigue severity, though for none of these groups, mcs was not associated with fatigue severity. results of this study also revealed that fatigue can only predict pcs and not mcs [tables 2 and 3 ]. in accordance with our findings, papuc and stelmasiak found that fatigue and depression are the most powerful predictors for qol of ms patients. a basic explanation for fatigue can be the link between physical damages and fatigue, especially its physical aspects, since because of damage to different regions of brain, thinking and activities demand higher energy than before. on the other hand, muscles with spasticity work against each other ; therefore, more force is needed to perform physical activities. it has to be considered that fatigue is caused by cellular ms and is the result of disease process. in fact, the increase in neuronal activity in cellular tissues, which occurs to compensate the problems, gradually leads to weakness of physical abilities and subsequently results in depletion of pcs in ms patients. besides, one of the outcomes of depression is the feeling of lack of energy and illness that prevents the patient to endure physical pressures. moreover, depression is probably associated with focal demyelinating lesions and malfunction of immune system. these complications can lead to functional limitations and generalized disorder in the pcs of patients. yet, in this study, anxiety has been identified as the strongest significant predictor for pcs. in an earlier study, chylova. assessed the psychological situation of two groups of ms patients (using sf-36) and stated that anxiety was associated with the physical health situation of younger patients of ms. although the findings of our study contradict the results of some studies, the differences can be attributed to the tools used in studies. in the latter study, zung anxiety rating scale (zars) was used as a separate tool to measure anxiety, whereas in this investigation, dass, which assesses the psychological pathology of depression, anxiety, and stress, has been used. this could have affected the quality of findings, although it has to be noted that recent publications of ms have emphasized on the use of multi - symptom measuring tools. yet, the anxiety of ms patients can be explained by natural etiology theory or by bio - behavioral approaches that consider anxiety as an endogenous product which is created to confront hazardous stimuli and is naturally produced in situations wherein self is endangered - a mechanism that leads to drop in physiological functions and, therefore, decrease in indicators associated with qol in patients. also in this study, stress has not been identified as a significant variable for pcs. to explain this finding, it could be said that stress plays a common role in most of the personal and social behaviors of ms patients. therefore, patients describe stress as routine symptom, so that whenever encountered a question from the stress sub - category in dass, such as i tended to over - react to situations, they answered it as an usual experience or with low intensity. it must be noted that personal interpretations of the symptoms by patients play a critical role in their answers and ultimately their level of stress reported. our data showed that only depression is a significant predictor for mcs [table 3 ]. one of these studies showed depression as the most statistically significant predicting characteristic for mcs in sf-36. moreover, fvesi. also found that depressed ms patients had their qol become worse in a significant way. based on an interpretation of this finding, depression impairs motivation, interest, and collaboration of the patient ; this consequently can affect vitality, social function, mental health, and generally mcs. another interpretation is that depression can distort the viewpoints of people on the world and their health, and change it in a way that deteriorates their evaluation of self. overall, the findings revealed the role of anxiety, fatigue, and depression in physical aspects and the role of depression in mental aspects of lives of ms patients. clinical application of this finding is to suggest rehabilitation interventions that reduce fatigue and destructive mental symptoms and consequently improve the qualitative aspects of life. in this regard, qol - based psychotherapy, a non - drug, non - attack, and economical therapy toward promotion of physical and mental dimensions of life, can be utilized. by these psychotherapies, we can target the anxiety and fear of progress of the disease in patients and improve their knowledge of the nature of ms and ways to manage it. moreover, cognitive restructuring programs, training programs for accommodating with physical damages, and cognitive behavioral therapy can be conducted. note that in these kinds of psychotherapies, ms patients should be encouraged to do more exercises and active pleasurable physical activities. it should be noted that (a) fatigue is described as a multi - dimensional construct with symptoms such as decline in activity, decrease in energy, and slowness of organs and (b) greater extent of functional limitations predicts negative psychological symptoms overtime. it has been previously revealed that exercise program and aerobics can decrease fatigue and depression, improve positive thinking, and enhance participation in social acts, and ultimately have a positive effect on qol of patients. it is necessary to remember that ms is a progressive and changing disorder, so patients suffering from it experience numerous transforming symptoms. samples of this study were not homogenous in terms of level of care, disease severity, amount of hospital measures, quality of care after affliction (especially in family environment), and social support style. further, in this study, we did not consider the role of drugs that the patients were taking. this issue can play a role in the appearance of symptoms assessed in this research. also, the presented data are self - reported and this can increase the possibility of biased and tampered answers in several tools. our data stressed the importance of the factors of fatigue and psychological symptoms in physical and mental aspects of lives of ms patients. therefore, our study suggests that future researches assess the treatment of fatigue and its psychological symptoms and its effect on qol. also, studies should aim more clearly at the possible contributing mechanisms in decreasing qol of ms patients, such as immunomodulatory drugs, organic brain lesions due to disease, employment, and levels of coping. finally, we suggest the use of experimental or longitudinal plans which provide the induction of causal relations between qol and clinical and psychological factors in future researches. this study revealed that pcs and mcs have significant negative relationships with any of the symptoms of fatigue, depression, anxiety, and stress. the results of the statistical analysis, after controlling for demographic and clinical variables, showed that fatigue, depression, and anxiety were the variables that significantly predicted pcs while anxiety appeared to have the strongest significance as a predictor. these results further highlight the impact of fatigue and psychological symptoms on qol dimensions of patients with ms. thus, based on the findings, management of patients psychological and clinical symptoms to improve their qol through programs such as psychotherapy interventions, exercise, and aerobics is recommended. | background : although studies have demonstrated significant negative relationships between quality of life (qol), fatigue, and the most common psychological symptoms (depression, anxiety, stress), the main ambiguity of previous studies on qol is in the relative importance of these predictors. also, there is lack of adequate knowledge about the actual contribution of each of them in the prediction of qol dimensions. thus, the main objective of this study is to assess the role of fatigue, depression, anxiety, and stress in relation to qol of multiple sclerosis (ms) patients.materials and methods : one hundred and sixty - two ms patients completed the questionnaire on demographic variables, and then they were evaluated by the persian versions of short - form health survey questionnaire (sf-36), fatigue survey scale (fss), and depression, anxiety, stress scale-21 (dass-21). data were analyzed by pearson correlation coefficient and hierarchical regression.results:correlation analysis showed a significant relationship between qol elements in sf-36 (physical component summary and mental component summary) and depression, fatigue, stress, and anxiety (p < 0.01). hierarchical regression analysis indicated that among the predictor variables in the final step, fatigue, depression, and anxiety were identified as the physical component summary predictor variables. anxiety was found to be the most powerful predictor variable amongst all (= 0.46, p < 0.001). furthermore, results have shown depression as the only significant mental component summary predictor variable (= 0.39, p < 0.001).conclusions : this study has highlighted the role of anxiety, fatigue, and depression in physical dimensions and the role of depression in psychological dimensions of the lives of ms patients. in addition, the findings of this study indirectly suggest that psychological interventions for reducing fatigue, depression, and anxiety can lead to improved qol of ms patients. |
in recent years, we have witnessed a profound revolution in the way we approach and treat renal cell carcinoma (rcc). in a relatively short time (10 years, approximately), we have gone from a very limited range of therapeutic options [essentially limited to interferon (ifn) and, for the few patients fit enough to receive it, high - dose interleukin-2 (il-2) or, more recently, allogeneic bone marrow transplant ] to almost a plethora of effective agents (at least 6 drugs currently approved for the treatment of advanced rcc and more to come shortly), that has led to define the uncertainties in treatment choices as the ' embarrassment of the riches '. such a revolution stems from a much improved understanding of rcc biology, predominantly at the cancer cell level, that has led to the recognition of common molecular themes underlying rcc pathogenesis and to the identification of relevant therapeutic targets, such as the activation of pro - angiogenic and of the mammalian target of rapamycin (mtor) pathways 1. successful pharmacological targeting of these pathways has dramatically improved the management of patients with metastatic rcc, who have now access to many different treatment choices across multiple lines of treatment, resulting in a striking prolongation of disease control, in most cases compatible with an acceptable quality of life, as well as in a life expectancy that approaches three years from the diagnosis of metastatic disease in the majority of patients. as a consequence, rcc has gone from a ' orphan ' disease to a paradigm for the successful development of biology - driven therapies and currently constitutes a unique case among solid tumors, as the management of metastatic disease is entirely based on different classes of molecularly targeted drugs. exciting successes notwithstanding, several issues remain to be addressed in the treatment of advanced rcc : 1) even in patients who obtain striking clinical responses early in the course of treatment, disease will ultimately escape control and progress to a treatment - resistant state, leading to therapeutic failure ; 2) prolonged disease control usually requires ' continuous ' treatment, even across different treatment lines, making the impact of chronic, low - grade, toxicities on quality of life greater and precluding, for most patients, the possibility of experiencing ' drug - free holidays ' ; 3) although we have successfully identified classes of drugs (or molecular mechanisms of action) that are effective in a substantial proportion of patients, we still fall short of molecular predictive factors that identify individual patients who will (or will not) benefit from a specific intervention and still proceed on a trial - and - error basis, far from a truly ' personalized ' therapeutic approach ; 4) finally (and perhaps most importantly), even in the best case scenario, currently available treatments inevitably fail to definitively ' cure ' metastatic rcc patients. one of the possible avenues to address such issues, possibly leading to further improvements in the management of advanced rcc, is to better understand the interplay between cancer cell biology, host response, and treatment - induced changes. indeed, the presence of rcc actually shapes host response (e.g. in terms of immune reaction and microenvironmental changes), which, in turn, influences tumor biology (e.g. in terms of pathway activation), in a complex interplay that is just starting to emerge ; in addition, targeted therapies modify both cancer biology and host response, thereby adding a further level of complexity that we are only beginning to appreciate. unraveling such complex interactions may hold the key to future advances in the comprehension of rcc biology and in the treatment of patients with this disease. the term rcc encompasses a highly heterogeneous group of malignancies, from both a morphological and a molecular point of view, but emerging evidence indicates that common molecular paths to renal carcinogenesis do exist and may justify, to some extent, shared approaches to the clinical treatment of different rcc subtypes 2. although most of rcc cases occur in a sporadic form, both clear cell and non - clear cell rcc can occur in the context of inherited cancer syndromes, whose molecular genetics has shed light on potentially common molecular pathogenetic themes 3 - 4. this is probably best exemplified by von hippel - lindau disease (vhl) and tuberous sclerosis (ts), two autosomal dominant inherited syndromes with variable penetrance that carry a high lifetime risk of developing clear cell rcc 5 - 6. the vhl gene, which targets hypoxia inducible factor (hif)-1 for degradation by the proteasome, is mutated or silenced in up to 75% of sporadic clear cell rcc, suggesting that genetic abnormalities involved in inherited rcc syndromes (and subsequent alterations in downstream intracellular signaling cascades) may also play a central role in sporadic rcc. in tumors carrying a mutated vhl, increased levels of hif-1 play a critical oncogenic role by stimulating the transcription of many crucial downstream effectors, including vascular endothelial growth factor (vegf), platelet - derived growth factor (pdgf), c - met, transforming growth factor (tgf)-, and the stromal - derived factor (sdf)-1/cxcr4 ligand / receptor pair, among others 7. of note, signaling pathways initiated by such effectors, vegf and pdgf in particular, are the therapeutic targets of monoclonal antibodies and small - molecule kinase inhibitors (tkis) that currently constitute the mainstay of clinical rcc treatment. ts, on the other hand, is an autosomal dominant disorder with 95% penetrance, caused by mutations in either the tsc1 (9q34) or the tsc2 (16p13.3) genes, encoding for the hamartin and tuberin proteins, respectively. hamartin and tuberin physically interact to form a complex, which, through the gap activity of tuberin, inactivates the small g - protein rheb, thereby relieving rheb - mediated mtor inhibition. therefore, genetic inactivation of tsc1/2 results in the uncontrolled activation of the mtor pathway, leading, among other effects, to increased synthesis and accumulation of hif, even in the absence of hypoxia, and transcription of hif - dependent genes 8 - 9. indeed, activated mtor, may exacerbate the loss of vhl function (or the effects of hypoxia) by further elevating hif-1 through increased translation, thus providing a direct link between the hif / angiogenesis and the mtor paths to renal carcinogenesis. because unregulated angiogenesis is a prominent feature of rcc, the inhibition of mtor is relevant clinically and may inhibit angiogenesis through a mechanistic approach that differs from that of vegf receptor - targeted agents. in addition to clear cell rcc, the spectrum of renal manifestations in ts also includes development of multiple angiomyolipomas, renal cysts, and non - clear cell rcc (papillary and chromophobe carcinomas). other hereditary rcc syndromes involving non - clear cell rcc have also been identified and characterized in terms of the underlying genetic lesions ; interestingly, increased hif expression and transcriptional activity activation of the mtor pathway both appear to be central to the development of different renal manifestations of disease, including benign (angiomyolipomas, renal cysts, oncocytomas), borderline (hybrid oncocytic tumors), and frankly malignant (papillary and chromophobe rcc) lesions 10. genetic aberrations in tsc1/2 and birt - hogg - dub (bhd) directly impinge on the activation of the mtor pathway, leading to the development of an array of renal lesions that can be partially reversed by rapamycin - mediated inhibition of mtor, both in preclinical models and human patients with tsc ; in the highly aggressive papillary type 2 rcc observed in hereditary leiomyomatosis and renal cell cancer (hlrcc), fumarate hydratase (fh) deficiency creates a pseudohypoxic intracellular environment 9, leading to hif accumulation ; from a molecular standpoint, this situation is similar to that observed in vhl mutant rcc cells, where hif-1 translation and accumulation can be prevented by mtor inhibition, thereby rendering hif - overexpressing cells particularly prone to the growth inhibitory effects of mtor inhibitors, both in vitro and in vivo. more recently, computational analysis of gene expression data derived from papillary rcc revealed that a transcriptional signature indicative of myc pathway activation is present in high - grade type 2 papillary rcc. the myc signature was associated with amplification of chromosome 8q and overexpression of myc that maps to chromosome 8q24 and, reflective of the association of an active myc signature component with papillary type 2, the presence of this pathway signature component was also associated with a highly aggressive clinical behavior and poor overall survival 11. recent evidence indicates the existence of an important growth - regulatory crosstalk between the myc, hif, and the mtor pathway : indeed, both hif-1 and hif-2 may directly or indirectly control myc activity, on one hand, and tuberin loss may de - repress myc protein, on the other, positioning the connection between these two growth regulators to act as a feed - forward loop that would amplify the oncogenic effects of decreased tuberin or increased myc expression 12. overall, both genetic and molecular data strongly indicate that common avenues do exist in renal carcinogenesis and that hif accumulation and mtor activation represent common molecular themes across a spectrum of both benign renal lesions and different rcc subtypes, including both clear cell and non - clear cell forms, and thus constitute widespread therapeutic targets in both sporadic and familial rcc. understanding (and overcoming) primary and/or acquired resistance to both hif / vegf- and mtor - targeted agents is perhaps the most important issue to address, in order to make further clinical progresses in the management of advanced rcc. while the molecular mechanisms of primary resistance are still elusive, clues to the development of acquired resistance in patients that initially respond favorably to vegf / vegf receptor - targeted agents are starting to emerge 13 - 14. first, the pathway may be incompletely blocked, due to an intrinsically low potency of the agent employed as first - line or to an adaptive response that leads to increased drug metabolism / extrusion, with consequently reduced effective drug levels, or to increased signaling through the same ligand / receptor pairs that are being targeted (in most cases vegf / vegfrs and pdgf / pdgfrs) ; such a resistance mechanism would explain the clinical finding of incomplete cross - resistance between vegf / vegfr - targeted drugs, particularly when crossing over to a second - line agent more potently targeting the same pathway. second, under the selective pressure of prolonged treatment with anti - angiogenic agents (mostly targeting the vegf axis), rcc may ultimately resume an angiogenic state either by increasing hif - mediated transcription of vegf and pdgf or through alternative, non hif - mediated pro - angiogenic factors, such as fibroblast growth factor (fgf), interleukin-8 (il-8), placental - derived growth factor (plgf), angiopoetins, etc. ; in these cases, the tumor would still depend on its ability to stimulate angiogenesis, thus targeting hif directly or the alternate angiogenic pathway(s) in sequence could still lead to disease control. third, rcc cells may adapt to an intrinsically hypoxic, anti - angiogenic, microenvironment by activating intracellular signaling pathways, such as the mtor pathway, that would help them coping with a state of high metabolic stress, while maintaining their ability to grow ; the development of resistance through this molecular mechanism actually constitutes the rationale for sequential (or alternating) vegf / mtor pathway targeting, that is becoming increasingly popular in the clinical setting (see below). in addition to cancer cell - centered mechanisms of resistance, a potentially important and relatively unexplored area of research is the contribution of host - derived microenvironment to the ability of tumors to adapt to prolonged blockade of vegf - mediated angiogenesis and escape from anti - angiogenic drug mediated growth control 15. for example, increased host - derived pericyte coverage and recruitment of bone marrow - derived cell populations (that are ' normal ' in nature) may protect tumor blood vessels and endorse restored neo - vascularization, even in the presence of continuous vegf blockade ; interestingly, activity of the hif family of transcription factors appears to play a crucial role not only in the biology of the rcc cell itself, but also in orchestrating the response of host - derived cells to prolonged anti - angiogenesis, thereby constituting a potential therapeutic target whose direct inhibition may simultaneously hit both the cancer cell and the surrounding microenvironment. finally, in the presence of a hostile, anti - angiogenic, microenvironment the rcc cell may acquire a more motile, invasive, phenotype that allows it escaping nutrient and oxygen deprivation by metastasizing to different organs where they could hijack host - derived protective mechanisms to create a more favorable environment 16. studies conducted in tumors that have become resistant to sunitinib - mediated anti - angiogenesis, indeed, indicate that resistant tumor cells acquire a ' sarcoma - like ' phenotype, with decreased cytokeratin and increased vimentin expression (indicative of an epithelial - to - mesenchymal transition - emt), invade surrounding tissues, and display decreased vascular density 17. metabolic adaptation to stress conditions is an important mechanism involved in tumor progression and development of resistance mechanisms. a solid tumor can outstrip its nutrient and oxygen supply as it grows, resulting in metabolic stress. as a consequence, tumor cells must undergo a period of metabolic adaptation to survive this stress or undergo apoptosis ; angiogenesis and neovascularization is one strategy of metabolic adaptation used by tumors to relieve this stress, while maintaining their capacity to grow indefinitely 18. by blocking angiogenesis for prolonged periods of time, as it is usually the case for the first - line treatment of metastatic rcc, the tumor is put back in a state of metabolic stress, to cope with which it must activate alternative relief mechanisms. given its strategic position in the regulation of cell growth, metabolism, and angiogenesis, the mtor pathway is a likely candidate to be a crucial regulator of ' metabolic adaptation ' in situations in which the vegf - based angiogenic switch is pharmacologically inhibited. indeed, mtor senses availability of aminoacids, metabolic fuel, and energy (essential for protein synthesis, cell growth, proliferation, and survival) and its activation supports growth and survival by increasing cell access to nutrients and metabolic fuels, through increased expression of nutrient transporters. it is, therefore, reasonable to speculate that alternating agents with different modes of action would actually turn tumor 's ability to activate either neo - angiogenesis or mtor signaling to cope with situations of metabolic stress to our advantage : indeed, after prolonged exposure to vegf / vegfr - targeted agents, rcc cells may activate mtor to cope with metabolic stress and survive ; if mtor is blocked at this stage, tumor cells would be most sensitive to its action and would go back to a neo - angiogenesis driven response to metabolic stress, again becoming sensitive to vegf - targeted strategies. although such hypothesis remains to be tested, both experimentally and clinically, solid clinical evidence indicates that mtor inhibitors are effective after progression to vegf / vegfr - targeted strategies and initial reports suggest that rechallenge with a vegfr tki (even the same agent used as first - line) after an mtor inhibitor may lead to substantial clinical benefit. another dimension, that is only now starting to emerge from the literature, is the complex interplay between the cancer cell(s), the host immune system, and the molecularly targeted agents that are used for treatment. it is relatively well known that the presence of a tumor may shape host immune response by creating an immunosuppressive environment ; in the specific case of rcc, which is characterized by prominent activation of the hif / vegf axis, vegf itself and/or other cytokines produced by tumor cells exert profound immunosuppressive effects by impairing dendritic cell maturation from myeloid progenitors, increasing treg - mediated suppression of t - cell responses, and shifting the balance towards a th2 type of response with secondary production of il-10, il-4, and il-6. not only tumors, including rcc, may effectively suppress tumor - specific immune responses, but they can also hijack host - derived cell populations, turning them into powerful allies that help creating a pro - angiogenic, tumor - promoting microenvironment 19 : indeed, tumor - infiltrating macrophages, neutrophils, dendritic cells (dcs), and natural killer cells may shift from the production of anti - angiogenic / tumor suppressing cytokines, such as ifn- and il-12, to the secretion of vegf, plgf, fgf, pdgf, il-8, matrix metalloproteases (mmps), cyclooxygenase-2 (cox-2), and arginase ; moreover, in the tumor microenvironment myeloid progenitor cells may be forced to differentiate into myeloid - derived stromal cells (mdscs), that potently support tumor - driven vasculogenesis and help protecting tumor - associated neo - vessels from anti - angiogenic therapeutic attack. the immune - modulatory effects of therapeutic agents (mostly vegf / vegfr and mtor inhibitors) commonly used to treat rcc are only beginning to surface 20. for example, two commonly used anti - angiogenic multi - kinase inhibitors, such as sorafenib and sunitinib, clearly differ in their ability to, directly or indirectly, influence immune response : indeed, sorafenib appears to impair, while sunitinib stimulates, terminal dc maturation and ability to co - stimulate t - cell responses ; sunitinib, but not sorafenib, inhibits mdsc immune - suppressive activity, reduces both mdsc and treg circulating numbers, and corrects th2 bias. it would be even more interesting to understand the immunomodulatory effects of rapamycin derivatives, such as temsirolimus and everolimus, in the specific context of rcc treatment, considering their well - established alternative use as immunosuppressants in organ transplantation. in the past ten years we have made exceptional progresses in the understanding of rcc biology, particularly by recognizing the crucial pathogenetic role of activation of the hif / vegf and mtor pathways. this has resulted in the successful clinical development of anti - angiogenic and mtor - targeted drugs, which have profoundly impacted on the natural history of the disease and have improved the duration and quality of rcc patient lives. however, further improvements are still greatly needed, particularly in the quest for ' curative ' treatments, currently lacking in the setting of advanced rcc. as highlighted above, unraveling the complex mechanisms by which rcc shapes host microenvironment and immune response and therapeutic treatments, in turn, shape both cancer cell biology and tumor - host interactions may hold the key to future advances in such a complex and challenging disease. | in the past ten years we have made exceptional progresses in the understanding of rcc biology, particularly by recognizing the crucial pathogenetic role of activation of the hif / vegf and mtor pathways. this has resulted in the successful clinical development of anti - angiogenic and mtor - targeted drugs, which have profoundly impacted on the natural history of the disease and have improved the duration and quality of rcc patient lives. however, further improvements are still greatly needed : 1) even in patients who obtain striking clinical responses early in the course of treatment, disease will ultimately escape control and progress to a treatment - resistant state, leading to therapeutic failure ; 2) prolonged disease control usually requires ' continuous ' treatment, even across different treatment lines, making the impact of chronic, low - grade, toxicities on quality of life greater and precluding, for most patients, the possibility of experiencing ' drug - free holidays ' ; 3) although we have successfully identified classes of drugs (or molecular mechanisms of action) that are effective in a substantial proportion of patients, we still fall short of molecular predictive factors that identify individual patients who will (or will not) benefit from a specific intervention and still proceed on a trial - and - error basis, far from a truly ' personalized ' therapeutic approach ; 4) finally (and perhaps most importantly), even in the best case scenario, currently available treatments inevitably fail to definitively ' cure ' metastatic rcc patients. in this review we briefly summarize recent developments in the understanding of the molecular pathogenesis of rcc, the development of resistance / escape mechanisms, the rationale for sequencing agents with different mechanisms of action, and the importance of host - related factors. unraveling the complex mechanisms by which rcc shapes host microenvironment and immune response and therapeutic treatments, in turn, shape both cancer cell biology and tumor - host interactions may hold the key to future advances in such a complex and challenging disease. |
our initial sample consisted of 87 hcv+ participants who were recruited from several hepatology clinics and infectious disease clinics located throughout the greater los angeles catchment area. controls (n = 21) were recruited from the community through advertisements and flyers. all procedures received prior approval by the university of california, los angeles and va greater los angeles healthcare system institutional review board committees for studies involving human subjects. all hcv+ patients participating in this study met clinical criteria for initiating hcv therapy but had not yet begun treatment. all data reported in the current study were collected at participants ' baseline visit. as part of procedures outlined in the parent study, there were no statistically significant differences between hcv+ participants who underwent neuroimaging and those who did not on key demographic variables such as age, sex, ethnicity, past drug abuse, current drug use, model for end - stage liver disease (meld) score, and psychiatric functioning (all p values > 0.05). inclusion criteria were as follows : (1) 18 years of age, (2) able to read and write in english, (3) and completed at least 6th grade education. exclusion criteria were as follows : (1) decompensated cirrhosis / liver failure (detected by blood tests or liver biopsy) with meld scores > 12 ; (2) current or past psychotic spectrum disorder ; (3) significant depression as judged by the study psychiatrists / psychologists (defined as current moderate or severe major depressive disorder) or suicidal ideation (factors that were controlled for initiating interferon treatment) ; (4) history of learning disability, seizure disorder, closed - head injury with loss of consciousness in excess of 30 minutes, or any other neurologic disease ; (5) evidence of any other cns opportunistic infection or neoplasm ; (6) hepatitis b infection ; (7) diagnosis of hiv infection as evidenced by hiv antibody testing ; (8) recent illicit drug use (confirmed by urine toxicology) ; and (9) contraindications for mri (for the nested cohort who underwent neuroimaging). after applying exclusion criteria, our final sample (those eligible for analysis) included 76 hcv+ participants and 20 controls. ten hcv+ participants were determined to be ineligible due to liver cirrhosis, and 1 control participant tested positive for stimulants at study visit. brain mri was performed using a 3-tesla trio mri scanner (siemens medical system, erlangen, germany). high - resolution mri included t1-weighted images using a magnetization - prepared rapid acquisition gradient - echo sequence using the following parameters : repetition time (tr)/echo time (te) = 2,220/2.2 msec, inversion time = 900 msec, average = 1, matrix size = 256 256, field of view (fov) = 240 240 mm, slice thickness = 1 mm, number of slices = 176. dti was acquired using a single - shot echo planar dual spin echo sequence with ramp sampling. the b - factor was set to 1,000 s / mm, tr = 9,600 msec, te = 90 msec, flip angle = 90, and averages = 1. a total of 71 axial sections were acquired using an image matrix of 130 130, a slice thickness of 2 mm with no interslice gap, and an fov of 256 256 mm. proton spectra were collected using the 2d proton magnetic resonance spectroscopy imaging (mrsi) technique with the volume of interest (voi) preselected by means of point - resolved spectroscopy (press). volume - selective 2d mrsi was performed on a 20-mm slab superior to the ventricles with te of 30 msec and tr of 2,000 msec. the nominal voxel size was 2.82 cm (16 16 phase encode steps over an 18 20 cm fov). outer - volume saturation bands were applied to all 6 sides of the voi localized by the press sequence to suppress the lipid contamination. we assessed attention using the wechsler adult intelligence scale - third edition (wais - iii) letter - number sequencing subtest and the paced auditory serial addition test (only the first 50 trials) ; processing speed using the wais - iii digit symbol and symbol search subtests, trail making test part a, and stroop color naming and word reading ; learning and memory using the hopkins verbal learning test - revised and the brief visuospatial memory test - revised ; verbal / language fluency using the controlled oral word association test, executive functioning using trail making test part b and stroop color - word interference test ; and motor speed using the grooved pegboard test. raw scores were converted into demographically adjusted t scores, grouped by neurocognitive domain, and averaged to create domain t scores. the vas contains 18 visual analogue lines with bipolar anchors with descriptors relating to energy and fatigue. internal consistency of the vas in our sample was high (cronbach = 0.86). the total score from the vas - fatigue subscale was examined in the current study. we used roieditor for preprocessing procedures according to a modified version of the active contour method and diffeomap. white matter parcellation map was used to segment the brain into 130 regions based on anatomical labeling, which included both the gray and white matter. once these regions were extracted, the cortex and the surrounding white matter were segmented using an fa threshold of 0.25. we focused our analyses on regions of the corona radiata, insula, internal capsule, external capsule, striatum, fronto - occiptial fasciculus, cingulum, thalamus, hippocampus, and amygdala based on prior studies. for mrsi, metabolites were quantitated in each voxel using the frequency - domain fitting routine called lc - model algorithm, which analyzes the in vivo brain spectrum as a linear combination of individual simulated metabolite spectra that constitute the basis set or prior knowledge. we were able to quantify total naa_naag (naa + naa glutamate), total choline (gpc_pch), mi, and glutamate / glutamine (glu_gln) for regions of frontal white and gray matter, parietal white and gray matter, and basal ganglia (see figure 2). the accuracy of the quantitation was characterized using cramer - rao lower bound (crlb), and metabolite ratios with crlb 0.05). groups also did not differ in current drug use. between - groups analysis of variance (anova) was used to examine differences between hcv and control groups on our 31 outcome variables of interest : neuroimaging (23 variables), neurocognitive assessment (7 variables), and fatigue (1 variable). outcome variables were all analyzed on a continuous scale and assumptions for performing anova and pearson correlations were checked prior to running analyses. demographic and drug use characteristics of the sample we used the false discovery rate (fdr) to correct for multiple comparisons with our outcome measures. fdr is sometimes preferred over family - wise error rate methods (e.g., bonferroni) because it provides greater statistical power and reduces the chance of making type ii errors. given our available sample size of 96 for the neurocognitive and fatigue data, adjusted level of 0.01 (for multiple comparisons), and power of 0.80, we had enough power to detect medium effects (f = 0.31). this is consistent with effect sizes reported in previous investigations that have examined neurocognitive differences between hcv+ patients and controls. for neuroimaging analyses, with a sample of 49 this is also consistent with the effect sizes reported by neuroimaging studies that have compared hcv+ patients to controls. all procedures received prior approval by the university of california, los angeles and va greater los angeles healthcare system institutional review board committees for studies involving human subjects. all hcv+ patients participating in this study met clinical criteria for initiating hcv therapy but had not yet begun treatment. all data reported in the current study were collected at participants ' baseline visit. as part of procedures outlined in the parent study, there were no statistically significant differences between hcv+ participants who underwent neuroimaging and those who did not on key demographic variables such as age, sex, ethnicity, past drug abuse, current drug use, model for end - stage liver disease (meld) score, and psychiatric functioning (all p values > 0.05). inclusion criteria were as follows : (1) 18 years of age, (2) able to read and write in english, (3) and completed at least 6th grade education. exclusion criteria were as follows : (1) decompensated cirrhosis / liver failure (detected by blood tests or liver biopsy) with meld scores > 12 ; (2) current or past psychotic spectrum disorder ; (3) significant depression as judged by the study psychiatrists / psychologists (defined as current moderate or severe major depressive disorder) or suicidal ideation (factors that were controlled for initiating interferon treatment) ; (4) history of learning disability, seizure disorder, closed - head injury with loss of consciousness in excess of 30 minutes, or any other neurologic disease ; (5) evidence of any other cns opportunistic infection or neoplasm ; (6) hepatitis b infection ; (7) diagnosis of hiv infection as evidenced by hiv antibody testing ; (8) recent illicit drug use (confirmed by urine toxicology) ; and (9) contraindications for mri (for the nested cohort who underwent neuroimaging). after applying exclusion criteria, our final sample (those eligible for analysis) included 76 hcv+ participants and 20 controls. ten hcv+ participants were determined to be ineligible due to liver cirrhosis, and 1 control participant tested positive for stimulants at study visit. brain mri was performed using a 3-tesla trio mri scanner (siemens medical system, erlangen, germany). high - resolution mri included t1-weighted images using a magnetization - prepared rapid acquisition gradient - echo sequence using the following parameters : repetition time (tr)/echo time (te) = 2,220/2.2 msec, inversion time = 900 msec, average = 1, matrix size = 256 256, field of view (fov) = 240 240 mm, slice thickness = 1 mm, number of slices = 176. dti was acquired using a single - shot echo planar dual spin echo sequence with ramp sampling. the b - factor was set to 1,000 s / mm, tr = 9,600 msec, te = 90 msec, flip angle = 90, and averages = 1. a total of 71 axial sections were acquired using an image matrix of 130 130, a slice thickness of 2 mm with no interslice gap, and an fov of 256 256 mm. proton spectra were collected using the 2d proton magnetic resonance spectroscopy imaging (mrsi) technique with the volume of interest (voi) preselected by means of point - resolved spectroscopy (press). volume - selective 2d mrsi was performed on a 20-mm slab superior to the ventricles with te of 30 msec and tr of 2,000 msec. the nominal voxel size was 2.82 cm (16 16 phase encode steps over an 18 20 cm fov). outer - volume saturation bands were applied to all 6 sides of the voi localized by the press sequence to suppress the lipid contamination. we assessed attention using the wechsler adult intelligence scale - third edition (wais - iii) letter - number sequencing subtest and the paced auditory serial addition test (only the first 50 trials) ; processing speed using the wais - iii digit symbol and symbol search subtests, trail making test part a, and stroop color naming and word reading ; learning and memory using the hopkins verbal learning test - revised and the brief visuospatial memory test - revised ; verbal / language fluency using the controlled oral word association test, executive functioning using trail making test part b and stroop color - word interference test ; and motor speed using the grooved pegboard test. raw scores were converted into demographically adjusted t scores, grouped by neurocognitive domain, and averaged to create domain t scores. the vas contains 18 visual analogue lines with bipolar anchors with descriptors relating to energy and fatigue. internal consistency of the vas in our sample was high (cronbach = 0.86). the total score from the vas - fatigue subscale was examined in the current study. we used roieditor for preprocessing procedures according to a modified version of the active contour method and diffeomap. white matter parcellation map was used to segment the brain into 130 regions based on anatomical labeling, which included both the gray and white matter. once these regions were extracted, the cortex and the surrounding white matter were segmented using an fa threshold of 0.25. we focused our analyses on regions of the corona radiata, insula, internal capsule, external capsule, striatum, fronto - occiptial fasciculus, cingulum, thalamus, hippocampus, and amygdala based on prior studies. for mrsi, metabolites were quantitated in each voxel using the frequency - domain fitting routine called lc - model algorithm, which analyzes the in vivo brain spectrum as a linear combination of individual simulated metabolite spectra that constitute the basis set or prior knowledge. we were able to quantify total naa_naag (naa + naa glutamate), total choline (gpc_pch), mi, and glutamate / glutamine (glu_gln) for regions of frontal white and gray matter, parietal white and gray matter, and basal ganglia (see figure 2). the accuracy of the quantitation was characterized using cramer - rao lower bound (crlb), and metabolite ratios with crlb 0.05). groups also did not differ in current drug use. between - groups analysis of variance (anova) was used to examine differences between hcv and control groups on our 31 outcome variables of interest : neuroimaging (23 variables), neurocognitive assessment (7 variables), and fatigue (1 variable). outcome variables were all analyzed on a continuous scale and assumptions for performing anova and pearson correlations were checked prior to running analyses. demographic and drug use characteristics of the sample we used the false discovery rate (fdr) to correct for multiple comparisons with our outcome measures. fdr is sometimes preferred over family - wise error rate methods (e.g., bonferroni) because it provides greater statistical power and reduces the chance of making type ii errors. given our available sample size of 96 for the neurocognitive and fatigue data, adjusted level of 0.01 (for multiple comparisons), and power of 0.80, we had enough power to detect medium effects (f = 0.31). this is consistent with effect sizes reported in previous investigations that have examined neurocognitive differences between hcv+ patients and controls. for neuroimaging analyses, with a sample of 49 this is also consistent with the effect sizes reported by neuroimaging studies that have compared hcv+ patients to controls. there were statistically significant group differences in fa in the striatum (f1,48 = 8.49, p 0.05). higher fatigue scores correlated with higher levels of mi in frontal white matter (r29 = 0.53, p 0.05). higher fatigue scores correlated with higher levels of mi in frontal white matter (r29 = 0.53, p 40). again, because of the use of stringent inclusion / exclusion criteria, this group may not be fully representative of the general hcv+ population. despite the potential recruitment of higher - functioning hcv+ individuals, we still found the poorer performance in the cognitive domains of processing speed and verbal fluency (relative to controls) that has been reported across other studies, and this performance was independent of such factors as liver fibrosis and history of substance abuse. participants also reported greater fatigue than controls, which was associated with abnormalities in frontal white matter, whereas poorer cognitive performance was associated with abnormalities in both frontal white matter and subcortical structures. these results suggest that hcv - associated neurologic complications that are specific to changes in frontal - subcortical structures give rise to both reduced cognitive performance and fatigue. the specific cognitive deficits observed in verbal / language fluency and information processing speed are all regulated by frontal - striatal structures. in our sample, verbal fluency demonstrated the greatest degree of performance difference between hcv+ and control groups and the strongest correlation with elevated levels of mi in frontal white matter. first, while structural neuroimaging methods are helpful in identifying microstructural pathology that may not be detected on standard mri, they do not provide a clear understanding about the functions of these neural circuits. hence, existing disruptions in a neural circuit may make a patient more vulnerable to developing symptoms such as fatigue. second, although we attempted to control for a number of demographic variables between hcv patients and controls, we recognize that there are a myriad of psychosocial differences (e.g., stress, past drug use) that may account for the reduced cognitive performance and structural brain differences that were observed in the current study. for instance, we were unable to examine past drug abuse differences between our hcv+ and control groups because information on past drug abuse was not collected from the controls. we recognize that in order to precisely rule out the effects of past drug abuse we would have needed to recruit a sample of past drug abusers who were hcv. however, considering that 61% of our hcv+ patients reported a lifetime history of cocaine or opiate use, we attempted to address this concern by examining the effects of past drug abuse within this subgroup. while we did not find significant differences in our neuroimaging or neurocognitive data as a function of past drug abuse (all p values > 0.10), we can not rule out the residual confounding effects of distant substance use on neurologic function. despite these limitations, the current study represents a significant extension of the extant literature on hcv 's effects on neurologic and neurobehavioral functioning by demonstrating how abnormalities in frontal / parietal and subcortical structures have independent and overlapping relationships with cognitive performance and fatigue. it has long been known that hcv is hepatotoxic ; increasingly there is reason to believe that it is neurotoxic as well. while the precise pathophysiologic mechanism remains unclear, findings from the current study as well as while advances in the pharmacologic treatment of hcv hold incredible promise, there remain millions of hcv - infected adults in the united states and approximately 100 million worldwide. thames was involved in the study design, was responsible for conducting statistical analyses of study hypotheses, assisted with processing of neuroimaging data, and drafted the initial version of the manuscript. dr. castellon was involved in the conceptualization of the parent study ; provided scientific input on study design, data collection, and interpretation ; provided consultation for statistical analyses in the current study ; provided critical revisions to the write - up of study findings ; and gave final approval of the manuscript for submission. dr. singer was involved in the conceptualization of the parent study design, provided scientific input on clinical and medical data collection and interpretation, provided critical revisions to the write - up of study findings, and gave final approval of the manuscript for submission. nagarajan was involved in the study design of the mr spectroscopy data acquisition and mr spectroscopy postprocessing, provided critical revisions to the write - up of mr spectroscopy findings and interpretation, and gave final approval of the manuscript for submission. sarma was involved in the study design of the diffusion tensor imaging data acquisition and processing, assisted with the analyses, provided critical revisions to the write - up of diffusion tensor imaging findings and interpretation, and gave final approval of the manuscript for submission. smith was involved in the interpretation of clinical data, provided critical revisions to the manuscript draft, and gave final approval of the manuscript for submission. thaler assisted with statistical analyses of the neuropsychological data, assisted with the write - up of results, provided critical revisions to manuscript drafts, and gave final approval of the manuscript for submission. truong provided scientific input on medical data acquisition, provided critical revisions to the manuscript draft, and gave final approval of the manuscript for submission. schonfeld was involved in data acquisition, formatted the tables and figures, assisted with the write - up of the methods for the manuscript, and gave final approval of the manuscript for submission. thomas was responsible for the conceptualization and study design of the neuroimaging data, provided scientific input on sequence parameters and data analysis, provided critical revisions to manuscript drafts, and gave final approval of the manuscript for submission. dr. hinkin is the pi of the parent project and was responsible for the conceptualization of the study design, provided scientific oversight for all study phases, provided critical portions of manuscript drafts, and gave final approval of the manuscript for submission. funding support for the current study was provided through the nih (ro1mh083553, pi : c.h. thames has received research support from the nimh and the american psychological association society for clinical neuropsychology. e. singer is on the nih study section advisory board, is a reviewer for orau grants, and receives funding from nimh, minds, and nida. | objective : this study examined neurologic abnormalities (as measured by proton magnetic resonance spectroscopy imaging and diffusion tensor imaging), neurocognitive performance, and fatigue among a sample of adults with hepatitis c virus (hcv). we hypothesized that hcv+ individuals would demonstrate structural brain abnormalities and neurocognitive compromise consistent with frontostriatal dysfunction as well as increased fatigue compared to controls.method:participants were 76 individuals diagnosed with hcv and 20 controls who underwent a comprehensive neurocognitive evaluation and clinical assessments. a subset of the hcv+ participants (n = 29) and all controls underwent mri.results:individuals diagnosed with chronic hcv infection demonstrated greater fractional anisotropy in the striatum as well as greater mean diffusivity in the fronto - occiptal fasciculus and external capsule compared to hcv controls. hcv+ participants also demonstrated lower levels of n - acetylaspartate in bilateral parietal white matter and elevations in myo - inosital (mi) in bilateral frontal white matter compared to hcv controls (all p values < 0.05). hcv+ participants also demonstrated significantly poorer neuropsychological performance, particularly in processing speed and verbal fluency. hcv+ patients reported higher levels of fatigue than controls, and fatigue was significantly correlated with diffusivity in the superior fronto - occipital fasciculus, elevations in mi in frontal white matter, and overall cognitive performance.conclusions:our results suggest that hcv - associated neurologic complications disrupt frontostriatal structures, which may result in increased fatigue and poorer cognitive performance, particularly in those cognitive domains regulated by frontostriatal regions. |
castleman 's disease (cd) or giant lymph node hyperplasia is a rare disorder first explained by castleman., in 1954. it can be unicentric or multicentric and mostly involves mediastinum (60%), retroperitoneum (11%), and axilla (4%). multicentric castleman 's disease (mcd) is manifested by generalized lymphadenopathy, hepatosplenomegaly, and polyclonal hypergammaglobulinemia, high erythrocyte sedimentation rate (esr), anemia, thrombocytopenia, and constitutional symptoms. human herpes virus 8 (hhv-8) infection has been identified in nearly 100% of hiv - positive and 50% of hiv - negative mcd patients. this virus predisposes patients to much higher risk of other malignancies, including kaposi 's sarcoma (ks) (13%) and non - hodgkin 's lymphoma (18%). kaposi 's sarcoma is a vascular neoplasm with a compound and unknown histogenesis in which most of the spindle cell lesions express cd31 and cd34. castleman 's disease is histologically divided into three types : hyaline vascular type or angiofollicular type, plasma cell (pc) type, and mixed type. co - incidence of mcd with ks and some common features of them led us to report this case. it is unknown whether ks is a consequence of immunosuppression caused by mcd or ks is a clinical feature of mcd. a 77-year - old man was admitted to our dermatology clinic with fever, anorexia, weight loss, generalized pruritus, and multiple cutaneous lesions on the legs. the patient 's complaints started 1 year ago ; however, the legs edema was developed during the recent 6 months. a physical examination revealed cachexia, pallor, xerosis with excoriation marks, skin lesions, and generalized lymphadenopathy. the lymph nodes were discrete, mobile, firm, and non - tender ranging in size from 0.5 to 6 cm. cutaneous lesions were violaceous indurated papules and plaques on the anterior aspects of both legs in the previous site of saphenous vein angioplasty from 3 years ago. these lesions clinically resembled ks [figures 1 and 2 ]. additionally, laboratory findings showed anemia (hb : 9.6 mg / dl), increased esr (98 mm / h), elevated wbc count (11100 mm) with 12% eosinophilia, and also negative viral markers (hhv-8, hiv, hcv, hbv). notably, chest ct scan demonstrated extensive bilateral axillary adenopathy, pretracheal and antrosuperior mediastinal adenopathy, subpleural wedge - shaped consolidation on the base of the left lung, and subpleural nodules on the right lung recommended to rule out of lymphoma. abdominopelvic ultrasound revealed mild hepatosplenomegaly with a hyperechoic solid mass in the mid portion of spleen suggesting hemangioma whereas retroperitoneal lymphadenophathy was not detected. also, bone marrow aspiration was normal. brown - bluish papules and nodules of kaposi 's sarcoma violaceous indurated lesions on the legs in the previous location of saphenous angioplasty a skin biopsy of the lesions showed hypercellular neoplasm composed of proliferated spindle - shape cells arranged in a whorled and fascicular pattern with slit - like spaces containing red blood cell with extravasation [figure 3 ]. an axillary lymph node biopsy demonstrated follicular hyperplasia with marked vascular proliferation, hyalinization, and few tight concentric layers of lymphocytes, arranged in onion skin appearance [figure 4 ]. the patient was treated with granulocyte colony - stimulating factor (g - csf) for four sessions, alpha interferon 2b (ifn-2b) subcutaneously for 5 months and vinblastin weekly. eventually, patient 's pruritus relieved after 2 months, lymphadenopathy regressed, general condition became good, and also, the patient went into the clinical remission. moreover, radiotherapy within 5 months and ks lesions regressed. the patient received 30 sessions of irradiation on the skin lesions resulting in complete regression. proliferation of spindle cells arranged in a whorled and fascicular pattern with slit - like spaces containing red blood cell extravasation (hematoxylin and eosin40) follicular hyperplasia with prominent vascular proliferation, hyalinization and few tight concentric layers of lymphocytes, arranged in onion skin appearance (hematoxylin and eosin100) castleman 's disease is divided into localized and multicentric type and histologically, almost the entire multicentric variants are pc type. the standard curative treatment of localized cd is surgical excision with a 5-year survival rate of 100% and excellent prognosis. additionally, corticosteroids, chemotherapic agents and radiation therapy are the other modalities for the treatment of mcd. in 2003, boller., reported simultaneous of mcd and ks in a 17-year - old patient after treatment with cyclosporine for nephropathy. in addition, de rosa. described a woman affected by mcd and complicated by ks. they discussed that mcd and ks might be presented in a same immunologically patient or ks was a consequence of immunosuppression. our patient shared many similarities to the previous literature reports and demonstrated mcd findings such as fever, anorexia, weight loss, peripheral and mediastinal lymphadenopathy, and also hepatosplenomegaly. he had simultaneously violaceous papules and plaques over both legs and the histopathology findings were consistent with co - existence of mcd and ks. notably, mcd has been reported in adults usually before age 30 and shows an association with hhv-8 and hiv infections. in contrast, our patient was a 77-year - old man and compared with the prior literature findings, he had hhv-8 and hiv - negative serology. co - incidence of mcd with ks in our case report can be interpreted that mcd may be complicated by ks or the latter is a manifestation of mcd. finally, mcd should be kept in mind as a differential diagnosis in a patient with ks. mcd should be kept in mind as a differential diagnosis in a patient with ks. | castleman 's disease (cd) or giant lymph node hyperplasia is a rare disorder that can be unicentric or multicentric. multicentric castleman 's disease (mcd) is manifested by generalized lymphadenopathy, hepatosplenomegaly, polyclonal hypergammaglobulinemia, hematological abnormality, and constitutional symptoms. human herpesvirus 8 (hhv-8) infection is present in nearly 100% mcd associated with hiv-1 infection, but in about 50% of cases of hiv negative. herein, we report a 77-year - old man with systemic involvement and skin lesions on the anterior aspect of both legs in the previous site of saphenous vein angioplasty. co - existence of mcd with kaposi 's sarcoma (ks) led us to present this rare case. |
hepatocellular carcinoma (hcc) in adult men is the 5th most frequently diagnosed cancer worldwide, and is the 2nd leading cause of cancer - related death in the world. in adult women, it is the 7th most commonly diagnosed cancer and the 6th leading cause of cancer death. in the united states (us), the annual incidence of hcc was at least 6 per 100,000 in 2010. hcc is typically an aggressive tumor that arises in the setting of underlying chronic liver disease in most cases. although the preferred therapy is surgical resection, the majority of patients are not eligible because of tumor extent or underlying liver dysfunction. for patients who are not eligible for resection or liver transplantation, treatment options include percutaneous ethanol injection (pei), radiofrequency ablation (rfa), transarterial chemoembolization (tace), transarterial radioembolization (tare), radiotherapy (rt), and doxorubicin. pei and rfa are considered curative treatments (cts) for early - stage hcc. the selection of treatment is determined by the severity of underlying liver disease, the size and distribution of the intrahepatic tumors, the vascular supply, and the patient 's overall performance status. in taiwan, hcc is still the 2nd leading cause of death from cancer. the etiology differs from those in the west, as in asia, it is more frequently related to hepatitis b virus (hbv) infection. since hbv infections are endemic in asia, more than 80% of cases are encountered in this region. a large proportion of the population is at risk of developing chronic liver disease and, therefore, hcc. in addition to surgery, therapeutic modalities such as pei and rfa are also potentially curative. it should be noted that the term curative in this sense is meant to imply resulting in complete local control of the original lesion. recently, 2 cochrane analyses concluded that there was insufficient evidence to determine whether segmental resection was more effective than rfa or pei because of the limited quality of the evidence. on the contrary, rt, chemotherapy, and liver tace should be considered palliative, which implies that it statin use for preventing hcc risk was reported in hbv and hepatitis c virus (hcv) carriers. however, it is well - known for preventive use, not for treatment or an additive effect with other medical treatments. numerous previous epidemiologic studies showed the chemopreventive effects on the hcc risk, and some basic studies demonstrated the mechanism of the anticancer effect on hcc cells or animal models. but to the present, there are no clinical or epidemiologic data clarifying the effect of statins and cts such as surgery, rfa, or pei. if hcc patients receive cts (rfa, pei, or surgery), statin use might still be a question. our study estimated the effect of statin use in hcc patients who received different cts and attempted to answer the aforementioned question. two cohorts from the taiwan national health insurance (nhi) database and cancer registry databases were combined for the analysis. hcc patients treated from january 1, 2001 to december 31, 2010 were included in the study. the follow - up duration was from the index day to december 31, 2012. research - oriented datasets were released through the collaboration center of health information application (cchia) that include all of the original claims data and registration files for beneficiaries enrolled under the cchia from the bureau of nhi in taiwan. more than 99% of the population of taiwan was covered in 2012, and taiwan launched the cchia program in 1995. therefore, the researchers have been allowed to trace all utilizations of medical services from cchia for all hcc patients in taiwan. our protocols were reviewed and approved by the institutional review board at taipei medical university (tmu - jirb no. there is rich cancer information in the cancer registry database such as the clinical stage, treatment modalities, pathologic data, and death from specific diseases. all enrolled patients were confirmed by the nhi and cchia, and fresh hcc patients had no other cancers or distant metastases. the inclusion criteria were having hbv carrier - related or -unrelated hcc (international classification of diseases [icd ], 9th revision, clinical modification codes [icd-9 codes ] 070.2, 070.3, and v02.61) (identified according to the icd-9, clinical modification [icd-9-cm ] codes 155.0 and 155.2, and the icd for oncology, 3rd edition [icd - o-3 ] codes c22.0 and c22.1), being aged > 20 years, and having undergone surgical resection, rfa, or pei as a ct. all hbv subjects without a subsequent outpatient visit or emergency visit for a diagnosis of hbv within 12 months were excluded because they were considered not to have chronic hepatitis disease. the index day of hcc was the beginning date of the 1st treatment for hcc patients, such as surgical resection, rfa, pei, tace, rt, or chemotherapy. exclusion criteria were : diagnosed with cancer before hcc was confirmed, undergone tace, rt, or chemotherapy as palliative - intent treatment, a liver transplantation, one 's gender not known, distant metastasis, hcc has been diagnosed before hbv, statin use only before hcc was diagnosed, and younger than 20 years. the aim of our study was to evaluate the effects of statin use in hcc patients who received ct such as surgery, rfa, or pei. secondary endpoints were survival benefits if statins were used in surgical treatment or nonsurgical treatment. the defined daily dose recommended by the who is a unit for measuring a prescribed amount of a drug. it is the assumed average maintenance dose per day of a drug consumed for its main indication in adults. to examine the dose - effect relationship, we categorized statin into 4 groups in each cohort as our previous protocols. possible confounding factors of comorbidities included hbv (icd-9 0702 and 0703, and a - code v0261), hcv (icd-9 07041, 07044, 07051, and 07054, and a - code v0262 and 0707), other viral hepatitis (icd-9, and a - code v0269), alcohol - related disease (icd-9 291, 303, 305, 5710, 5711, 5712, and 5713, and a - code a213, a215, and a347), acute coronary syndrome (icd-9 410414), cerebrovascular accident (icd-9 430438), chronic obstructive pulmonary disease (copd) (icd-9 490496), diabetes mellitus (icd-9 250, and a - code a181), liver cirrhosis (icd-9 571.2, 571.5, 571.6, 572.2, 572.3, 572.4, 572.8, and 573.0), liver failure (icd-9 570), renal failure (icd-9 584586), hypertension (icd-9 401405), hyperlipidemia (icd-9 272.0272.2), and peptic ulcers (icd-9 531534). comorbidities were included within 6 months before and after the index date of hcc, as the main diagnosis code for the 1st admission or more than 2 repeated main diagnosis codes in an outpatient department. the age, gender, american joint committee on cancer clinical cancer stage, comorbidity condition, metformin, aspirin, acetylcholinesterase (ace) inhibitors, and anti - hbv or anti - hcv drugs were also adjusted for or stratified in the analysis. the cumulative incidence function of death was estimated by the kaplan meier method, and statin use and nonuse among ct modalities were compared by a log - rank test. the time dependent cox proportional hazard model was used to calculate hazard ratios (hrs) for death among hbv - related hcc patients with ct modalities with / without statin use. the hrs were adjusted for age, gender, baseline comorbidities, metformin, aspirin, ace inhibitors, anti - hbv or anti - hcv drugs, and clinical stage in the multivariate analysis. a stratified analysis was conducted to evaluate the effect of statin use between hbv- and non - hbv - related hcc patients of a similar age or clinical stage. 9.3 (sas, cary, nc). a value of p 50% reduction in hcc deaths). analogously, in the current data, table 3 also shows that the ahrs of all - cause deaths and hcc deaths were lower in hcc patients who received palliative treatment with statin use compared to those who received no treatment (ahrs of 0.45, 0.160, 0.590, and 0.70, respectively, for stages i iv). the cumulative incidence function of death was determined by the kaplan meier method (fig. 1 c), and statin use and nonuse among non - ct modalities were compared by a log - rank test. only one - half of patients initially thought to be resectable and referred for surgery actually have resectable tumors. unfortunately, most rcts showed that rfa and pei had inferior results compared to surgery. in our study, the ahrs of all - cause deaths increased in hcc patients who received rfa / pei compared to those who received surgery (p < 0.0001 and p < 0.05, with ahrs of 1.81 and 1.16, respectively, for hbv and non - hbv hcc). figure 1 a shows that surgery was significantly superior to nonsurgical treatments in the overall survival of hcc patients (p < 0.0001, p < 0.0001, and p = 0.005, respectively, for stages i iii). in a nonstage - stratified analysis, however, if hcc patients received nonsurgical cts (rfa or pei) with statins, the advantages of surgery disappeared. there are few articles that discussed how to improve outcomes of nonsurgical, locoregional therapies for hcc patients. our results suggest that if a patient can not tolerate surgical resection, rfa or pei might be insufficient. the addition of statin use with rfa or pei could improve outcomes and increase the survival rate of hcc patients, for both hbv and non - hbv patients. limitations of this study are that the actual statin dose and duration were not measured, so the actual dose - response effect was unclear. different kinds of statins were not separated in the analysis, and the potential effects of specific statins are unknown. ultimately, it will take a large randomized trial with a suitable regimen in well - selected patients comparing standard approaches to obtain this important information. additionally, the diagnoses of hcc and all other comorbid conditions were completely dependent on icd codes. nonetheless, charts and interview patients have been randomly reviewed by the nhi bureau of taiwan and cchia to verify the accuracy of the diagnoses. subsequent heavy penalties for malpractice or discrepancies would be done when hospitals with outlier chargers or practice may undergo an audit. finally, there are no information on tobacco use, alcohol consumption, dietary habits, socioeconomic status, laboratory data, educational level, or the body - mass index in the databases, which may also be risk factors in the survival analysis. however, these limitations are unlikely to have compromised the results, given the magnitude and statistical significance of the observed effects in the current study. if hcc patients can not meet the surgical criteria, the addition of statin use with rfa or pei might improve their survival. | abstractstatins are associated with a reduced risk of hepatocellular carcinoma (hcc) and have the potential to be an adjuvant agent for hcc. in this study, we examined whether statin use is associated with additional benefits among patients who received curative treatments (cts) such as surgery, percutaneous ethanol injection (pei), and radiofrequency ablation (rfa).we conducted a cohort study using the taiwan national health insurance research data linked to the taiwan cancer registry in 2001 to 2012. the patient cohort consisted of those who received different treatments, and we compared patients who received statins with those who did not. statin users were defined as patients who received > 28 cumulative defined daily doses after their hcc diagnosis. we used a time - dependent cox proportional method to model the time from the hcc diagnosis to any death and hcc death between men who received statins and those who did not after adjusting for confounders. data on statin prescriptions were collected every 6 months to define the user status.in total, 18,892 patients were included, and the mean follow - up duration was 1.74 years. the adjusted hazard ratio (ahr) of all - cause deaths increased in hcc patients who received rfa / pei compared to those who received surgery (p < 0.0001 and p < 0.05, with ahrs of 1.81 and 1.16, respectively, for hepatitis b virus [hbv ] or non - hbv hcc). however, with the addition of statin use to rfa or pei, the overall survival was statistically equal.surgical resection is still superior over other therapies. if hcc patients can not meet the criteria for surgery, the addition of statin use to rfa or pei might improve hcc survival. |
patients with mild copd often use inhaled corticosteroids without a need for them. a clinical audit including spirometry was useful for identifying overuse of inhaled corticosteroids. asthma and chronic obstructive pulmonary disease (copd) are two separate diseases in terms of aetiology and pathophysiology, with different diagnostic and management strategies (1,2). in clinical practice stable asthmatics usually have normal spirometry findings and hyper - responsiveness testing with histamine or methacholine is rarely performed in general practice (4,5). the frequency and clinical impact of the overlap between asthma and copd have been emphasized (6). in chronic asthma, long - term inflammation over time may lead to a remodelling of the lower respiratory tract quite similar to that seen in copd. this can impair respiratory function as measured by spirometry, i.e. less reversibility after inhalation of a beta2-agonist (79). therefore, there may be considerable overlap between the two diagnoses, particularly in elderly patients (1,10,11). inhaled corticosteroids (ics) are generally not recommended for copd except for patients with severe copd and frequent exacerbations, and there are good reasons to withhold the treatment in mild or moderate stages of copd (1,12). however, ics have been marketed heavily, and in situations with diagnostic uncertainty, it may be tempting for a general practitioner (gp) to add ics to the medication list for patients with pulmonary obstruction. however, overtreatment with ics is problematic because of both unnecessary costs and possible side - effects including dysphonia, thrush, cough, osteoporosis, adrenal suppression and adverse ocular effects (13,14). ics therapy also increases the risk of pneumonia in patients with stable copd (15). in norway in 2006, separate reimbursement codes for asthma and copd were introduced and it became mandatory for drug cost reimbursement that the diagnoses should be confirmed by spirometry. the principle became that costs for ics, alone or in combination with long - acting beta2-agonist (laba), should only be reimbursed with a diagnosis of asthma. patients with severe copd (with forced expiratory volume in one second (fev1) less than 50% predicted by spirometry) could also be reimbursed, but only after a special and individual application. physicians were, therefore, urged to reconsider their prescribing practice for patients with obstructive lung diseases to bring their prescription practice into accordance with the new regulations. as clinicians, it was a challenge to comply with the new reimbursement regulations because of difficulties in identifying copd patients who also suffered from asthma or who might benefit from using ics for other reasons (16). identification of copd patients and discontinuation of ics might not be a clinically straightforward decision. therefore, a quality assurance project was undertaken, a clinical audit, in a gp group practice, focusing on middle - aged and elderly patients who were using ics (ics / laba included), intending to comply with the new regulations. the aim of this study was to investigate how the implementation of the new reimbursement terms affected gps use of diagnoses for patients using ics. the study was undertaken in one group practice just outside oslo, norway, where approximately 8 100 patients were listed with six gps. from the shared electronic patient record (epr) database, all patients of 50 years and over were identified who had been prescribed ics (including ics in combination with long - acting beta2-agonist) during a one - year period before the regulation was put into practice (1 october 2006). in october 2006, all identified ics users were sent a letter informing them about the new reimbursement regulations and an invitation to a tailored consultation with their gp to assess their respiratory illness. tailored consultations, undertaken in october to december 2006, included the patients history, physical examination and spirometry with reversibility testing. patients were instructed not to use any inhaled medications on the day of investigation prior to spirometry. the spirometry was carried out by trained staff in accordance with the criteria of the american thoracic society and the european respiratory society (17). the spirometer used was a microloop ii with spirare software and the european coal and steel community reference for spirometry was used (18). reversibility was defined as increased forced expiratory volume in one second (fev1) of 12% and 200 ml (2). the spirometry criterion for copd was based on the gold guidelines and was a ratio of fev1 to forced vital capacity (fvc) less than 0.7 after bronchodilation (1). based on predicted fev1%, patients were categorized to copd stage based on the gold guidelines (1). the decision about follow - up of findings was left to individual gps in collaboration with their patients. in april 2008, one year and three months after the audit was completed ; a retrospective epr data search was performed regarding gps diagnoses and prescribing patterns for patients who had participated in the clinical audit. all patients signed an informed consent giving the opportunity to analyse and publish the results at an aggregated level that did not compromise patients anonymity. the study was presented to the regional committee for medical and health research ethics, south - east norway, who judged this to be a clinical audit project, and therefore, without the need for formal approval by the committee. the study was undertaken in one group practice just outside oslo, norway, where approximately 8 100 patients were listed with six gps. from the shared electronic patient record (epr) database, all patients of 50 years and over were identified who had been prescribed ics (including ics in combination with long - acting beta2-agonist) during a one - year period before the regulation was put into practice (1 october 2006). in october 2006, all identified ics users were sent a letter informing them about the new reimbursement regulations and an invitation to a tailored consultation with their gp to assess their respiratory illness. tailored consultations, undertaken in october to december 2006, included the patients history, physical examination and spirometry with reversibility testing. patients were instructed not to use any inhaled medications on the day of investigation prior to spirometry. the spirometry was carried out by trained staff in accordance with the criteria of the american thoracic society and the european respiratory society (17). the spirometer used was a microloop ii with spirare software and the european coal and steel community reference for spirometry was used (18). reversibility was defined as increased forced expiratory volume in one second (fev1) of 12% and 200 ml (2). the spirometry criterion for copd was based on the gold guidelines and was a ratio of fev1 to forced vital capacity (fvc) less than 0.7 after bronchodilation (1). based on predicted fev1%, patients were categorized to copd stage based on the gold guidelines (1). the decision about follow - up of findings was left to individual gps in collaboration with their patients. in april 2008, one year and three months after the audit was completed ; a retrospective epr data search was performed regarding gps diagnoses and prescribing patterns for patients who had participated in the clinical audit. all patients signed an informed consent giving the opportunity to analyse and publish the results at an aggregated level that did not compromise patients anonymity. the study was presented to the regional committee for medical and health research ethics, south - east norway, who judged this to be a clinical audit project, and therefore, without the need for formal approval by the committee. the search of the shared epr database revealed that 164 patients of 50 years and older (mean age : 66 years, range : 5088 years) had been prescribed ics the year before the 2006 regulation. of the 164, 114 (69.5%) of the 50 non - attendees, 14 no longer used ics ; three were too ill to participate ; two were deceased ; two had changed to a gp in another practice ; one was followed up by the pulmonary clinic at the hospital, and one letter was returned because of an unknown address. of the remaining 27 non - responders (mean age : 73, range : 5094 years ; females 44%), 13 had received only a single ics prescription. the mean age of the 112 patients included in the analysis was 65 years (range : 5088 years) ; 57% were women ; 46% were daily smokers, 35% previous smokers and 19% never smokers. post - bronchodilator spirometry revealed copd (fev1/fvc < 0.7) in 55 patients (table 1). reversibility 12% and 200 ml was found in 13 patients, of whom eight also met the spirometry criteria for copd (table 1). fifteen of the copd patients met the criteria for gold stage 34 (severe or very severe copd) ; 30 were in stage 2 (moderate copd), and 10 were in stage 1 (mild copd). spirometry findings in 112 patients treated with inhaled corticosteroids (ics) in primary care, and the continuation and discontinuation of ics after the spirometry results were known to the gp. the clinical outcome of this exercise as recorded in retrospect was discontinuation of ics in 31 (27.7%) of the 112 patients (table 1), of whom 20 (64.5%) had mild to moderate copd, seven (22.6%) had no history, symptoms or signs indicating obstructive lung disease and the remaining four (12.9%) had episodic asthma without the need for long - term ics treatment. one year and three months after this audit, we reviewed the electronic patient records (eprs) of these 31 patients and ics had been restarted in only one because of relapse of asthma. the distribution of the gps diagnoses recorded in eprs changed significantly after the implementation of the new reimbursement terms (table 2). the proportion of patients who were diagnosed with asthma more than doubled. among the 112 patients, 25 were labelled as asthmatic before the 2006 regulation compared with 62 afterwards, of whom 25 in fact, had spirometry findings suggesting copd. the proportion with a copd diagnosis increased only slightly (table 2) while formerly used diagnoses such as chronic bronchitis, chronic cough, or pulmonary fibrosis had become considerably less common. diagnosis given to 112 patients who had been using inhaled corticosteroids (ics) for pulmonary problems before and after the 2006 regulation stating that ics costs would be reimbursed for asthma but in general not for copd. diagnoses other than asthma and copd, i.e. chronic bronchitis, chronic cough, breathing problems, pulmonary fibrosis. while underdiagnosis and undertreatment of asthma or copd in primary care have been highlighted in the literature (20,21), over - diagnosis and overtreatment are rarely addressed (11). the results suggest that the incidence of overtreatment with ics may have been significant as it was possible to discontinue ics treatment in more than a quarter of the treated patients. re - introduction of ics was only necessary in one patient during the following year. this supports the notion that withdrawal of ics can be safe as underlined in a recent meta - analysis (22). findings revealed that physicians tend to give a diagnosis that fits with the treatment given, rather than vice versa. when an asthma diagnosis became a prerequisite for prescribing ics, the number of ics - using patients with this diagnosis increased considerably. with spirometry, the diagnoses of asthma and/or copd in only about half of the ics users were confirmed. this group may in part represent patients previously categorized as copd in gold stage 0 (i.e. chronic airway symptoms with normal spirometry) (23). this stage has been omitted from the copd classification because of lack of evidence that it predicted further copd development, a decision that may be questioned (1,20). a large fraction of those patients with normal spirometry were probably asthmatics in stable periods without current airway obstruction. according to the global initiative for asthma (gina), a positive reversibility test is an important criterion for asthma, but detecting this often requires several tests over time (2). in norwegian general practice, the diagnosis of asthma is commonly established based on patients symptoms and history without confirmation by spirometry (24). about one in seven of the copd patients had a positive reversibility test, which may partly represent long - lasting asthma with irreversible structural changes and permanent airway obstruction (6,2527). persistent asthma may also have been present in some patients with post - bronchodilator fev1/fvc < 0.7 and a negative reversibility test. bronchodilator reversibility is also found in moderate to severe copd, and the distinction of chronic asthma with limited reversibility, therefore, remains notoriously difficult (28). a dramatic shift in the gps use of diagnostic labels after the 2006 regulation was observed. probably reflects that physicians tend to give a diagnosis that fits with a treatment rather than vice versa. first, the 2006 regulation was controversial, and some gps did not agree with the health authorities in this case. second, this regulation was not at all welcomed by the ics manufacturers, and the industry plays an important role in shaping physicians opinions about medication - related issues (29). use of costly ics that is easily available without personal cost only for patients with confirmed asthma may, therefore, have significant economic implications for patients who did not meet the new reimbursement terms. fourth, gps diagnostic behaviour may be explained by concerns related to preserving the gp patient relationship, leading to unwillingness to admit previous inappropriate prescribing and an eagerness to please their patients. a fifth and maybe the most important explanation may be that gps often find it hard to distinguish asthma from copd, particularly in older patients. prescribing ics may, therefore, represent a therapeutic strategy to play safe in a clinical situation characterized by diagnostic uncertainty. misdiagnoses are known to occur for primary care patients with respiratory problems (30). after this audit, in january 2011, the norwegian terms for ics cost reimbursement were changed again. from this time, ics / laba may be prescribed without individual application for patients with moderate and severe copd if they have had several exacerbations and a predicted fev1 less than 60% (before a reversibility test) on spirometry. this quality assurance project within one group practice has several limitations that must be taken into account when interpreting the results. however, as one of the gps (sr) has a long - term interest in obstructive pulmonary diseases, it is believed the performance in this field is not inferior to the average norwegian general practice. however, all staff who conducted the spirometry investigations had been trained for the task (32). therefore, it is regarded as unlikely that the spirometry done in the practice was below the average standard seen in primary care. the spirometric gold criteria for defining and grading of copd in elderly people have been questioned because age - related changes in the fev1/fvc ratio are not taken into account (33). this may lead to increasing numbers of false - positives with advancing age (32). this is probably relevant here because of the average age of 66 years in participating patients. only one patient who had ics treatment discontinued had to restart this medication within the following year. restart of ics prescribed by doctors outside the group practice could in theory have taken place, but would probably be recorded in the epr. worsening of symptoms because of discontinuation of ics was, therefore, a minor problem. while underdiagnosis and undertreatment of asthma or copd in primary care have been highlighted in the literature (20,21), over - diagnosis and overtreatment are rarely addressed (11). the results suggest that the incidence of overtreatment with ics may have been significant as it was possible to discontinue ics treatment in more than a quarter of the treated patients. re - introduction of ics was only necessary in one patient during the following year. this supports the notion that withdrawal of ics can be safe as underlined in a recent meta - analysis (22). findings revealed that physicians tend to give a diagnosis that fits with the treatment given, rather than vice versa. when an asthma diagnosis became a prerequisite for prescribing ics, the number of ics - using patients with this diagnosis increased considerably. with spirometry, the diagnoses of asthma and/or copd in only about half of the ics users were confirmed. this group may in part represent patients previously categorized as copd in gold stage 0 (i.e. chronic airway symptoms with normal spirometry) (23). this stage has been omitted from the copd classification because of lack of evidence that it predicted further copd development, a decision that may be questioned (1,20). a large fraction of those patients with normal spirometry were probably asthmatics in stable periods without current airway obstruction. according to the global initiative for asthma (gina), a positive reversibility test is an important criterion for asthma, but detecting this often requires several tests over time (2). in norwegian general practice, the diagnosis of asthma is commonly established based on patients symptoms and history without confirmation by spirometry (24). about one in seven of the copd patients had a positive reversibility test, which may partly represent long - lasting asthma with irreversible structural changes and permanent airway obstruction (6,2527). persistent asthma may also have been present in some patients with post - bronchodilator fev1/fvc < 0.7 and a negative reversibility test. bronchodilator reversibility is also found in moderate to severe copd, and the distinction of chronic asthma with limited reversibility, therefore, remains notoriously difficult (28). a dramatic shift in the gps use of diagnostic labels after the 2006 regulation was observed. probably reflects that physicians tend to give a diagnosis that fits with a treatment rather than vice versa. first, the 2006 regulation was controversial, and some gps did not agree with the health authorities in this case. second, this regulation was not at all welcomed by the ics manufacturers, and the industry plays an important role in shaping physicians opinions about medication - related issues (29). use of costly ics that is easily available without personal cost only for patients with confirmed asthma may, therefore, have significant economic implications for patients who did not meet the new reimbursement terms. fourth, gps diagnostic behaviour may be explained by concerns related to preserving the gp patient relationship, leading to unwillingness to admit previous inappropriate prescribing and an eagerness to please their patients. a fifth and maybe the most important explanation may be that gps often find it hard to distinguish asthma from copd, particularly in older patients. prescribing ics may, therefore, represent a therapeutic strategy to play safe in a clinical situation characterized by diagnostic uncertainty. misdiagnoses are known to occur for primary care patients with respiratory problems (30). after this audit, in january 2011, the norwegian terms for ics cost reimbursement were changed again. from this time, ics / laba may be prescribed without individual application for patients with moderate and severe copd if they have had several exacerbations and a predicted fev1 less than 60% (before a reversibility test) on spirometry. this quality assurance project within one group practice has several limitations that must be taken into account when interpreting the results. however, as one of the gps (sr) has a long - term interest in obstructive pulmonary diseases, it is believed the performance in this field is not inferior to the average norwegian general practice. however, all staff who conducted the spirometry investigations had been trained for the task (32). therefore, it is regarded as unlikely that the spirometry done in the practice was below the average standard seen in primary care. the spirometric gold criteria for defining and grading of copd in elderly people have been questioned because age - related changes in the fev1/fvc ratio are not taken into account (33). this may lead to increasing numbers of false - positives with advancing age (32). this is probably relevant here because of the average age of 66 years in participating patients. only one patient who had ics treatment discontinued had to restart this medication within the following year. restart of ics prescribed by doctors outside the group practice could in theory have taken place, but would probably be recorded in the epr. worsening of symptoms because of discontinuation of ics was, therefore, a minor problem. results suggest that the incidence of overtreatment with ics may be significant in middle - aged and elderly patients. although a diagnosis of copd and/or asthma could be confirmed in only half of the ics - using patients, reassessing the gps clinical diagnoses by a tailored consultation including spirometry was an effective measure to allow revised treatment in more than a quarter of the patients on ics therapy. this audit also highlights how gps diagnoses are challenged by formal regulations and that this may result in a tendency to adjust the diagnosis to the treatment given, instead of vice versa. lgd planned and directed this trial and is responsible for data analysis and preparation of the initial manuscript. sr had the original idea for this project and performed the study together with lgd. | background : inhaled glucocorticosteroids (ics) are first - line anti - inflammatory treatment in asthma, but not in chronic obstructive pulmonary disease (copd). to restrict ics use in copd to cases of severe disease, new terms for reimbursement of drug costs were introduced in norway in 2006, requiring a diagnosis of copd to be verified by spirometry.objectives : to describe how gps diagnoses and treatment of patients who used ics before 2006 changed after a reassessment of the patients that included spirometry.methods : from the shared electronic patient record system in one group practice, patients 50 years prescribed ics (including in combination with long - acting beta2-agonists) during the previous year were identified and invited to a tailored consultation including spirometry to assure the quality of diagnosis and treatment. gps diagnoses and ics prescribing patterns after this reassessment were recorded, retrospectively.results : of 164 patients identified, 112 were included. post - bronchodilator spirometry showed airflow limitation indicating copd in 55 patients. of the 57 remaining patients, five had a positive reversibility test. the number of patients diagnosed with asthma increased (from 25 to 62) after the reassessment. a diagnosis of copd was also more frequently used, whereas fewer patients had other pulmonary diagnoses. ics was discontinued in 31 patients ; 20 with mild to moderate copd and 11 with normal spirometry.conclusion : altered reimbursement terms for ics changed gps diagnostic practice in a way that made the diagnoses better fit with the treatment given, but over - diagnosis of asthma could not be excluded. spirometry was useful for identifying ics overuse. |
steroid - responsive encephalopathy associated with subacute thyroiditis has, to our knowledge, not been reported previously. a 49-year - old woman was found collapsed and brought to our institution with decreased mentality, dysarthria, and gait disturbance. brain magnetic resonance imaging and angiography were normal but blood tests revealed thyroid - autoantibody - negative thyrotoxicosis. results of a technetium - pertechnetate scan were compatible with the thyrotoxic phase of subacute thyroiditis. recurrent encephalopathy was found 2 months after the initial admission, which was also effectively treated with steroid. we speculate that steroid - responsive recurrent encephalopathy associated with subacute thyroiditis is a subtype of hashimoto 's encephalopathy, and consider that steroid treatment should not be delayed in suspected patients. acute encephalopathy can result from various causes, including stroke, seizure, metabolic disturbance, toxic material, and infection.1 - 4 hashimoto 's encephalopathy (he) is also one of the causes of treatable encephalopathy. since the first report of brain.,1 there have been more than 100 patients reported with he, which has also been termed steroid - responsive encephalopathy with autoimmune thyroiditis (sreat) in a recent report.2,5 he or sreat is known to be associated with autoimmune thyroid disease (aitd). however, to our knowledge steroid - responsive encephalopathy associated with subacute thyroiditis has never been reported. here we report a case of steroid - responsive recurrent encephalopathy that manifested simultaneously with subacute thyroiditis. a 49-year - old woman was brought to our institution due to decreased mentality, dysarthria, and gait disturbance. she had been found collapsed and confused in her bedroom by her daughter. she had experienced an upper respiratory infection 4 weeks before admission, and had also suffered from hypertension. her highest level of education was elementary school and she was right - handed. on admission the neurologic examination revealed somnolence, memory impairment, dysarthria, right - hand weakness, and gait disturbance. however, the results of brain magnetic resonance imaging (mri) including diffusion - weighted imaging and angiography were normal. her serum levels of total t3, free t4, and thyroid - stimulating hormone (tsh) were 392 ng / dl (reference range : 80 - 180 ng / dl), 2.82 ng / dl (reference range : 0.8 - 1.8 ng / dl), and < 0.01 mu / l (reference range : 0.3 - 5.0 mu / l), respectively. the serum and cerebrospinal fluid (csf) were negative for both antithyroglobulin antibody and antimicrosomal antibody, and tsh - binding inhibiting immunoglobulin was at 5% (reference range:-10% to 10%). thyroid ultrasound revealed a mildly enlarged thyroid and heterogeneous hypoechogenicity with a lobulating contour in both thyroids. 1), and fine - needle - aspiration cytology revealed multinucleated giant cells in the background of inflammatory cells (fig. the csf examination was normal except for positivity for 14 - 3 - 3 proteins. venereal disease research labo (vdrl) was nonreactive and lupus erythematosus (le) cells were not found. antineutrophil cytoplasmic antibodies (anca), antiphospholipid antibody, anticardiolipin antibody, lupus anticoagulant, antinuclear antibody, anti - dsdna, anti - sm, anti - rnp, anti - ro, anti - la, anti - scl-70, anti - jo-1, and anti - ss - ro52 were all within normal limits. single - photon - emission computed tomography demonstrated no perfusion abnormality. on the second day of admission, she was given a nonselective beta - blocker (propranolol), but there was no clinical improvement during the following 5 days. the score on the korean mini mental status examination (kmmse) was 21/30 on the fifth day of admission. on the sixth day of admission she was started on oral prednisolone (30 mg / day) in addition to the propranolol for 7 days. five days after beginning steroid treatment, she could walk with assistance, at which time a thyroid function test (tft) indicated that her serum levels of total t3, free t4, and tsh were 128 ng / dl, 0.93 ng / dl, and < 0.01 it became difficult for her daughter to understand her speech and she could not walk without assistance. a repeated tft demonstrated hypothyroidism, with serum total t3 at 42 ng / dl, free t4 at 0.59 ng / dl, and tsh at 73.9 mu / l. these changes in tft results were attributed to the typical natural course of subacute thyroiditis, and 50 g of thyroxine replacement was initiated and then gradually increased to 100 g. four weeks later, tft results showed improvement of hypothyroidism, with serum total t3 at 85 ng / dl, free t4 at 0.74 ng / dl, and tsh at 43.0 mu / l. steroid pulse therapy (methylprednisolone, 1 g / day) was given for 3 days, after which oral prednisolone was prescribed. two weeks later, gait disturbance and dysarthria were improved and she complained of only mild numbness on the right side. to our knowledge this is the first reported case of steroid - responsive recurrent encephalopathy associated with subacute thyroiditis, which was diagnosed by thyroid tenderness, markedly decreased uptake of technetium - pertechnetate on the thyroid scan, and thyrotoxicosis followed by hypothyroidism on tft. after we excluded vascular, toxic, metabolic, and infectious disease, our patient was tentatively diagnosed as steroid - responsive recurrent encephalopathy of unknown cause. it was very interesting that the clinical manifestations were similar to those of he. however, there was no evidence of aitd. various clinical manifestations of he or sreat have been reported.2,5 - 11 cognitive impairment, high serum concentrations of thyroid autoantibodies, and good responsiveness to steroid treatment have been described as common clinical features and accepted as diagnostic criteria of he or sreat.1,2,5 - 9,12,13 however, it is questionable that aitd is necessary in the diagnosis of he or sreat since there is no conclusive evidence that this encephalopathy is caused by hashimoto 's thyroiditis or other autoimmune thyroiditis.2 aitd is prevalent in the general population,6 and there are no consistent correlations between the clinical severity and the type of thyroid antibody, or the clinical severity and the serum concentration of thyroid autoantibodies.2,5,6,9,12 it has been suggested that thyroid autoantibodies are not the cause of encephalopathy, but rather simply a marker of some autoimmunity affecting the brain, such as humoral immunity by antineuronal antibody as detected in one patient with he.5,11 therefore, it appears unreasonable to assume that thyroid autoantibodies are required for a diagnosis of he. the clinical manifestations of our case were similar with those of he except for the absence of thyroid autoantibodies.2,5,6 considering that thyroid autoantibodies have played no pathogenic role in patients with he and that he is a syndrome entity rather than a disease, we tentatively diagnosed our patient as he without aitd. however, tests for the definitive diagnosis of he do not exist, and hence our hypothesis could not be verified in this single case. our case showed dramatic neurological improvements following steroid treatment, which is one of the typical clinical characteristics of he.2,5,6,9 - 12 despite considerable debate about whether steroid responsiveness can be used in the diagnostic criteria of he,2,5 a beneficial response to a steroid might be the only evidence of autoimmunity6 or the only feature differentiating he from creutzfeldt - jakob disease, especially in patients with 14 - 3 - 3 proteins in the csf.14,15 the 14 - 3 - 3 proteins comprise about 1% of total soluble protein in brain16 and are known to be involved in certain neurological disorders such as creutzfeldt - jakob disease, he, influenza - associated encephalopathy, and steroid - responsive encephalopathy.7,15 - 17 examination of the csf in our case revealed positivity for 14 - 3 - 3 proteins, which suggested that the encephalopathy was not associated with a functional disorder, but rather with neuronal damage in the brain.17 considering the responsiveness to steroid treatment, steroid should be given as soon as possible to patients with suspected he since delaying treatment might lead to irreversible brain deficits. there has been considerable debate about whether thyroid dysfunction can cause encephalopathy in patients with he.5,7,9,11,12 although there is one report of thyrotoxicosis preceding clinical relapse of encephalopathy, antithyroid medication did not improve neurologic deficits and variable thyroid functions including hyperthyroidism, hypothyroidism, and euthyroidism in patients with he.5,7,9 however, to our knowledge there has been no report of encephalopathy associated with both thyrotoxicosis and hypothyroidism. subacute thyroiditis occurred simultaneously with encephalopathy in our case, and the encephalopathy was unlikely to have been caused by the thyroid dysfunction induced by subacute thyroiditis since the encephalopathy occurred both in the thyrotoxic and hypothyroid states. furthermore, the neurologic deficits were not improved for management of thyrotoxicosis during the thyrotoxic phase and thyroid hormone replacement during the hypothyroid phase of subacute thyroiditis. on the contrary, our observation was compatible with thyroid dysfunction not being the cause of neurologic deficits, and hence another mechanism might have played a role in the pathogenesis of encephalopathy. a common underlying pathomechanism such as common autoantibody to thyroid and brain is another possible explanation of our case, although we did not detect any abnormal autoantibody levels in the patient 's serum.11 to the best of our knowledge, this is the first case report of steroid - responsive encephalopathy associated with subacute thyroiditis. in conclusion, steroid treatment should not be delayed in suspected patients since the encephalopathy is associated with neuronal damage. | backgroundsteroid - responsive encephalopathy associated with subacute thyroiditis has, to our knowledge, not been reported previously.case reporta 49-year - old woman was found collapsed and brought to our institution with decreased mentality, dysarthria, and gait disturbance. brain magnetic resonance imaging and angiography were normal but blood tests revealed thyroid - autoantibody - negative thyrotoxicosis. results of a 99mtechnetium - pertechnetate scan were compatible with the thyrotoxic phase of subacute thyroiditis. 14 - 3 - 3 proteins were detected in cerebrospinal fluid. her mental status began to improve from the day following steroid administration. recurrent encephalopathy was found 2 months after the initial admission, which was also effectively treated with steroid.conclusionswe speculate that steroid - responsive recurrent encephalopathy associated with subacute thyroiditis is a subtype of hashimoto 's encephalopathy, and consider that steroid treatment should not be delayed in suspected patients. |
evaluation of athletic hip pain routinely includes radiographs and magnetic resonance imaging (mri). computed tomography (ct) is applied at some centers and in certain clinical scenarios. although mri (arthrogram) alone can clearly define changes to labrum or cartilage, osseous pathology may be underappreciated. we present the case of an unrecognized osteoid osteoma in a patient with femoral acetabular impingement (fai), cam morphology, and labral injury to emphasize the need to maintain a high index of clinical suspicion for this atypical cause of hip pain. a 19-year - old male soccer player presented with hip pain unresponsive to non - steroidal anti - inflammatory drugs (nsaids) and physical therapy. range of motion demonstrated 10 loss of internal rotation and muscle weakness (4+/5 hip flexion) was present. radiographs revealed cam morphology (angle = 74) with slight acetabular retroversion (+ cranial crossover sign) (fig. (c) ct of patient s right hip revealing osteoid osteoma at the lesser trochanter. (d, e) right hip ct scan in prone position with needle and radiofrequency ablation system at level of the osteoid osteoma. (c) ct of patient s right hip revealing osteoid osteoma at the lesser trochanter. (d, e) right hip ct scan in prone position with needle and radiofrequency ablation system at level of the osteoid osteoma. incidentally noted was the atypical appearance of the lesser trochanter attributed to lesser trochanter apophysitis. mri arthrogram confirmed labral tear, partial thickness chondral injury with mild iliopsoas tendonitis with bone marrow edema at the lesser trochanter. one year later the patient returned with buttock pain but denied anterior hip or groin pain. repeat radiographs and mri arthrogram revealed well healed labrum and no evidence of heterotopic ossification. ct with 3d reconstruction confirmed extent of bony resection but also clearly defined the osteoid osteoma nidus at the lesser trochanter (fig. salicylic acid failed to relieve pain and the patient was referred for radiofrequency ablation. under ct guidance, via a posterolateral approach, a 10-gauge bone biopsy needle was advanced to the nidus of the osteoid osteoma and through the reactive bone. radiofrequency ablation was performed at the proximal and distal termini of the nidus and surrounding periosteum using a dfine, inc. post - procedure recovery was uneventful and at 3 months the patient returned to all activities denying further hip pain. our case emphasizes the value of advanced imaging in the setting of any incompletely defined bony changes of the proximal femur or acetabulum. due to limitations of radiographs and mri, bony changes were inaccurately attributed to apophysitis versus osteoid osteoma. we also draw attention to the complete lack of response to nsaids for the entirety of this patient s treatment. recent literature has shown that clinical response to nsaids in osteoid osteoma may be overstated. the lack of response certainly does not exclude osteoid osteoma as the cause of pain [3, 4 ]. the authors report no funding or external sponsors relevant in the authorship and publication of this clinical vignette formal conflict of interest statement : the authors report no conflict of interest or disclosures relevant in the authorship and publication of this clinical vignette. | femoro - acetabular impingement is a common cause of hip pain in young athletes. evaluation typically includes radiographs and magnetic resonance imaging. it is important to appreciate uncommon diagnoses and the role of complimentary imaging. this clinical vignette emphasizes the need complete imaging with ct in select case of atypical hip pain.we present a 19-year old soccer player who underwent seemingly successful arthroscopic fai surgery but returned with pain. computed tomography (ct) revealed osteoid osteoma of the lesser trochanter. the lesion was successfully treated with percutaneous ct guided radiofrequency ablation. |
despite its world - wide omnipresence in soil, a. fumigatus had been considered asexual until studies of an aspergillus - like anamorph isolated from brazilian soil revealed a heterothallic breeding system, and the teleomorph neosartorya fumigata was described. we describe the first reported case of acute respiratory distress syndrome (ards) attributed to neosartorya udagawae. the mold grew rapidly in culture of both sputum and bronchoalveolar lavage (bal) fluid from a previously healthy 43-year - old woman with ards, which developed as the consequence of an acute febrile illness that progressed over 5 days. but despite appearance of fluffy white, non - sporulating mold on a variety of culture media, the colonies did not produce conidiophores, and phenotypic identification was not possible. the conidia of n. udagawae require longer incubation in the laboratory to germinate, and misidentification of neosartorya sp. n. udagawae has been emerging as a cause of invasive infections in humans, but our case is the first report of ards associated with neosartorya infection and describes a new clinical entity. a 43-year - old woman presented to an outlying hospital with complaints of fever and progressive shortness of breath that developed over 5 days. the patient had a past medical history significant for depression managed with sertraline 50 mg per day, and tobacco use (cigarettes). she was brought to her local hospital by the emergency medical service after developing profound weakness, with inability to get out of bed. she was intubated due to respiratory decline and initially required mechanical ventilation with 100% fio2 and positive end - inspiratory pressure (peep) of 12 mm / h2o. she was unable to achieve adequate oxygen saturations with mechanical ventilation and required extra corporeal membrane oxygenation (ecmo) at the time of transfer to our facility. upon arrival at our facility, the patient was hypothermic (35.9 c). she was intubated and sedated with a set respiratory rate on mechanical ventilation at 14 breaths / min. her pulse and blood pressure were 79 beats / min and 86/52 mmhg, respectively ; the fio2 was 99% ; her weight was 93 kg (204 lbs). endotracheal and nasogastric (ng) tube, foley catheter, and ecmo cannula were in place. neurologic exam was consistent with medically induced paralysis ; muscle tone, corneal and pupil responses were all normal. complete blood count was notable for leukocytosis of 17.810 wbc/l (78% neutrophils), and normocytic anemia (hgb=10.7 g / dl). the complete metabolic panel was normal, outside of elevated chloride ; hypokalemia (k=3.1 mg / dl) and depressed protein and albumin (5.4 and 2.6 mg / dl, respectively). an arterial blood gas revealed acidosis and hypoxemia : ph=7.31 ; paco2=43 pao2=45 ; sao2=80%. semi - upright portable ap chest x - ray was notable for diffuse alveolar opacities. endotracheal aspirate and three sets of blood cultures and a urine sample were submitted to the microbiology lab for culture. she was empirically started on oseltamivir 75 mg q 24 h via the ng, along with intravenous azithromycin and ceftriaxone initiated at the outlying hospital. during the patients first 24 h in the icu, she progressed from hypothermia to a febrile state (39.1 c), resolving leukocytosis (10.910 wbc/l), and an unchanged physical exam. hiv elisa, mycoplasma serology, and fungal immunodiffusion antibody testing for aspergillosis, histoplasmosis, blastomycosis, and coccidiomycosis were performed, and all returned negative / non - reactive. a nasopharyngeal swab for multiplex pcr for respiratory viral and intracellular bacterial pathogens (film array, biofire, inc.) day two, the patient was noted to have a normal body temperature, but remained on paralytics in a medically induced coma. one additional blood culture was obtained, and ebv and cmv serologies were performed ; all returned negative. cultures of an endotracheal tube aspirate (eta) that were obtained on admission were notable for growth of a fluffy, sterile white mold with yellow center on standard blood agar media. on hospital day four, endoscopic bronchoscopy was performed. bal fluid was collected from the left and right lower lobes (lll & rll) of the lung and submitted for gram and gomori methenamine silver (gms) staining, which were negative. histoplasma and legionella antigen testing on the bal fluid was negative, but an aspergillus galactomannan antigen was positive (> 3.75 ng / ml). pcr for influenza (cepheid genxpert) as well as multiplex pcr for respiratory pathogens (film array, biofire, inc.) were both negative. again, within 48 h, a similar appearing fluffy, white mold grew in cultures of both lll and rll bal fluid samples on all media (blood agar, sabouraud agar, and mycosel agar (becton dickinson) ; a selective medium containing cycloheximide and chloramphenicol to inhibit bacterial growth). potato dextrose agar (pda) was inoculated with a sample of mold, but serial lactophenol cotton blue prep exams of the non - sporulating cultures were non - diagnostic, although clearly not consistent with mucormycosis. empiric treatment with lipid formulation of intravenous amphotericin b was initiated on hospital day 5 due to failure to improve on broad spectrum empiric antibiotic treatment. over the next 48 h respiratory status was unchanged and oxygenation parameters and radiographic imaging showed no improvement. on hospital day 7, following two iv doses of liposomal amphotericin b, repeat bronchoscopy was performed. gram and gms stains, and histoplasma antigen testing were repeated, and returned negative for yeast, pneumocystis or fungal elements. methylprednisolone 125 mg iv every 8 h was added to the empiric iv amphotericin b for treatment of possible allergic bronchopulmonary aspergillosis (apba). mold was not cultured from either bal fluid sample on pda or sabouraud agar after 45 days of incubation at 30 c, or blood agar at 37 c. our patient slowly improved and intravenous (iv) methylprednisolone was tapered from 125 mg every 8 h to 40 mg twice a day over a 7 day period. on hospital day 15, methylprednisolone was discontinued and empiric antifungal treatment was changed from iv amphotericin b to voriconazole 40 mg iv every 12 h. on hospital day 18, ecmo treatment was terminated, and our patient was weaned successfully from mechanical ventilation and extubated. she was continued on voriconazole, but developed transaminitis prompting cessation of the drug due to hepatotoxicity. further antifungal treatment or steroid treatments were not administered. on hospital day 27, our microbiology laboratory and a state reference laboratory independently identified our mold as aspergillus fumigatus employing phenotypic criteria (fig. partial calmodulin, -tubulin, and its gene sequences were obtained via pcr amplification of genomic dna extracted from our clinical isolate. based on dna sequencing, the mold was identified as the morphologically identical but phylogenetically distinct species neosartorya udagawae (tables 13). as a result of profound deconditioning, our patient was transferred on day 28 to an inpatient unit to complete intensive physical therapy. subsequently, she returned to work and had no evidence of recurrent infection on follow - up examination. neosartorya spp. are the complementary mating types of aspergillus and are required for sex to occur. although neosartorya infections are uncommon, cases of neosartorya infection misidentified as a. fumigatus are well represented in the literature, suggesting the incidence of neosartorya infections may be higher than suspected. in a retrospective evaluation of specimens banked from patients diagnosed with invasive pulmonary aspergillosis at nih between 2000 and 2008, vinh. conducted multilocus dna sequencing to re - examine 36 cases of infection attributed to a. fumigatus based on phenotypic identification. of these, four cases were found to be caused by n. udagawae ; three were seen in patients with chronic granulomatous disease, and one was in a patient with myelodysplastic syndrome. the median duration of illness was approximately seven times longer than that typically observed for illness caused by a. fumigatus. the mics of various antifungals for the n. udagawae isolates were higher than those for a. fumigatus, and the disease caused by n. udagawae was refractory to standard therapy. to make a precise identification of the mold cultured from our patient, dna was extracted and partial its, -tubulin and calmodulin genes were amplified with touchdown pcr with the annealing temperature running from 55 to 45 c, and sequences were generated. an ncbi blast query of the 798 bp partial -tubulin gene sequence against the ncbi genbank nr / nt nucleotide database returned six n. udagawae isolates with 100% similarity, and returned 28 n. udagawae and seven aspergillus sp. sequences at the 99% similarity level (table 1). a query of the 373 bp partial its gene sequence returned seven n. udagawae with 100% similarity (table 2). a query of the 743 bp partial calmodulin gene sequence returned five aspergillus sp. with 100% similarity, and 10 n. udagawae and one aspergillus sp. hits at 99% similarity (table 3). sequences from type strains of species near n. udagawae, high similarity sequences found in the blast search, and the sequences from our clinical isolate were aligned and analyzed with mega 5.2. 2) show large diversity among n. udagawae isolates and reveal that our isolate is in the n. udagawae clade. the aspergillus sp. sequences with identical or high similarity sequences to n. udagawae represent asexual colonies of this heterothallic species. because the species is heterothallic the morphology of the aspergillus phase is very similar to a. fumigatus and the definitive identification is through dna sequencing and phylogenetic analysis (tables 13). histopathology and culture, ideally in combination, are the current basis for diagnosis and identification of fungal infections. our patients isolate only produced diagnostic conidiophores after 12 days of incubation, and then it was misidentified as aspergillus fumigatus by two microbiology laboratories. although it took a week to grow the mold in culture and extract dna to definitively identify the isolate as n. udagawae using its, -tubulin and calmodulin sequence data, the identification could have been done in 23 days if genomic dna had been extracted directly from the original slant culture. prompt identification of invasive molds directly from clinical specimens is not feasible by conventional microbiologic techniques, but molecular methods for rapid detection of molds directly from bal fluid offer the potential opportunity to direct antifungal treatment and guide evaluation of underlying host susceptibility. pcr / esi - ms is capable of rapid identification of fungal pathogens directly from clinical specimens. institutional irb approval was obtained for submission of samples of our patients bal fluid for testing by pcr / esi - ms, as described by shin.. bal fluid from the first bronchoscopy was fixed for cytology testing and unavailable for pcr / esi - ms testing. pcr / esi - ms was performed on bal fluid from the second bronchoscopy, which was performed on hospital day 7, 48 h after initiation of amphotericin b treatment. pcr / esi - ms detected a neosartorya sp. from both rml and left lingular bal fluid specimens. although airborne conidia of neosartorya sp. are conceivably capable of causing an apba - like syndrome that is seen with a. fumigatus in asthmatic patients, this has not been described. our patient did not have a history of asthma, nor did her laboratory testing exhibit peripheral eosinophilia or elevated ige titers suggestive of apba. her response to steroid treatment is consistent with what would be expected in patient with the fibroproliferative stage of ards. infection has not been previously described. due to uncertainty about the species of mold responsible for the pulmonary infection in our patient, she was unnecessarily exposed to toxic empiric antifungal treatment with amphotericin b. more timely identification of the pathogen would have resulted in earlier initiation of pathogen specific directed therapy. while colonization is always a concern with clinical cultures from intubated patients, identification of n. udagawae by gene sequencing of mold grown from multiple lobes in both lungs and by pcr / esi - ms directly from bal fluid samples taken after initiation of antifungal treatment strongly supports the biologic plausibility of n. udagawae as the etiology of ards in our patient. finally, given that the mics of most antifungals for n. udagawae isolates are higher than for a. fumigatus, and that disease caused by n. udagawae can be refractory to standard therapy, rapid recognition of n. udagawae as the cause of disease can be critical. presently, it is unclear how often neosartorya udagawae and other species within aspergillus section fumigati cause invasive pulmonary or sinus infections, or allergic bronchopulmonary or sinus manifestations. as molecular modalities such as -tubulin and calmodulin sequencing, and pcr / esi - ms become integrated into diagnostic clinical microbiology laboratories, detection of putatively less common invasive molds such as neosartorya sp. causing pulmonary disease may increase, thereby providing a more detailed picture of the spectrum of mycoses that infect humans and other animals. r. sampath and k.s. lowery are salaried employees of ibis biosciences, a division of abbott. | we describe the first reported case of acute respiratory distress syndrome (ards) attributed to neosartorya udagawae infection. this mold grew rapidly in cultures of multiple respiratory specimens from a previously healthy 43-year - old woman. neosartorya spp. are a recently recognized cause of invasive disease in immunocompromised patients that can be mistaken for their sexual teleomorph, aspergillus fumigatus. because the cultures were sterile, phenotypic identification was not possible. dna sequencing of its, calmodulin and -tubulin genes supported identification of neosartorya udagawae. our case is the first report of ards associated with neosartorya sp. infection and defines a new clinical entity. |
nowadays, laboratory services play a major role in optimizing patient care. in some circumstances, increased laboratory use is allowed such as : 1. the duration of the patient s hospitalization can be shortened (1 - 4). previous test results are not available or the physician does not know about them (5 - 8), nevertheless, information technology can display previous test results and reduce useless repeat testing (9,10). a performed test, repeats again for the patient after admission to hospital (11). 3. pre - analytic errors occur and there is a need for re - sampling the specimen (12,13). in the early decades of 1970, lundberg and his colleagues at the los angeles county / university of southern california medical center introduced the term panic values for those kinds of laboratory results that can predict high risk danger for the patients and be life - threatening unless the physicians do some immediate possible intervention. after some criticism that physicians should not be panic for any cause, they changed it to critical values (12,13,16). in time, reporting of critical laboratory test values became an important operation of clinical laboratory utilization and has been adapted worldwide including some laboratory accreditation agencies, such as the college of american pathologists (cap) and the joint commission on accreditation of healthcare organizations (jcaho) that have made it part of the requirements for laboratory accreditation (17,18). they require laboratories to define their own list of critical test values according to their national safety conditions and an authentic system to report of such results to patient s caregivers (18 - 20). the jcaho announced improving the process of critical value reporting a national patient safety goal for the years 2004 through 2006. also it has defined critical test results as not only laboratory tests but also imaging, electrocardiograms, and other diagnostic proceedings (17). in the early years of automatic laboratory procedures, there were no advanced laboratory information system (lis) technology and instruments with sensitive level sensors and clot detectors. therefore, it was acceptable to repeat critical test values to prevent inaccurate results created due to common problems such as misidentification of the sample, fibrin clots, or insufficient samples. but nowadays repeating them is necessary only when we have uncertain results otherwise it is an unnecessary work to do (21). as a recent summary of data from a college of american pathologists (cap) q - probes survey shows that pre - analytic and post analytic errors representing 85% to 92% of all clinical laboratory related errors, while analytic issues include only 8% to 15% of them (22,23). it also approved that 60.8 percent of laboratories still repeat critical values in chemistry, and 52.6 percent always repeat critical values in hematology (24). on the other hand, unnecessary tests may have some disadvantages such as : 1. performing inappropriate treatments. 2. causing fear and anxiety in patients by false positive results, or inducing a large number of further unnecessary testing (25,26). 3. increased costs for the patients and health care system which could lead to other incompetencies in health care delivery (27 - 31).4. delay reporting to caregiver for example, the cap q - probes survey expressed that laboratory routine repeat testing can delay reporting by 10 to 14 minutes without increasing the accuracy of the results (24,31,32). so far, several studies have been conducted recently about the routine repeat testing of critical values in laboratories and its possible effect on increasing accuracy of the results, such as : 1. chima s study in 2007 on 580 repeated tests in hematology, coagulation, and chemistry testing (21). 2. toll s study in 2010 on 500 consecutive critical results in 5 different hematology and coagulation tests (31). 3. deetz s study in 2011 on 3162 critical results (33). they all reported that routine repeating critical test values did not offer any advantage over single testing in improving results accuracy. there has not been any study about determining the effect of routine repeat testing of critical values in laboratory tests in iran. moreover, the international studies on this subject mostly cover a limited range of laboratory tests. therefore, we conducted our research in a way that covers various tests to overcome this shortcoming of existing literature. another incentive for our research is the fact that the majority of laboratories in iran, especially the ones in educational hospitals apply routine repeat testing of critical values as their regular method. this method is time consuming and expensive, so unless they add significant prognostic information they can be avoided. our goal was to determine the effect of routine repeat testing of critical values in 13 different hematology, coagulation, and routine chemistry tests. specialty services at our hospital include internal medicine, cardiology, neurology, neurosurgery, pediatrics, ophthalmology, ent, gynecology and obstetrics and emergency. in our hospital we repeat critical laboratory test values routinely to verifying them to ensure their accuracy before reporting them to the physician. this repeating can be performed on the same collected specimen or on the re - collected one. tests examined were hemoglobin (hgb), white blood cell count (wbc), platelet count (plt), international normalized ratio (inr), partial thromboplastin time (ptt) for hematology laboratory and glucose (glc), potassium (k), sodium (na), phosphorus (p), magnesium (mg), calcium (ca), total bilirubin (total bil) and direct bilirubin (direct bil) for chemistry laboratory. hematology tests were performed on ethylenediaminetetraacetic acid (edta) -anticoagulated blood specimens on the sysmex kx 21 analyzer. for sodium and potassium tests we used ion selective electrode (ise) method on microlyte analyzer. chemistry tests were performed on serum specimens on the hitachi 902 analyzer, and coagulation tests were performed on citrated blood specimens and analyzed by manual method. we created a report to retrieve only the repeated critical values tests not any repeated testing. the data captured in these reports included date, patient i d, age and gender of patients, initial result, repeated result, repeated test was performed in which sample : the same collected specimen or on the re - collected one. we collect these data for over a year from august 22, 2011 to august 22, 2012. medical laboratory staff was highly qualified and they have had over five years of experience. we also directed them on the way that the tests results should be collected and reported. the critical laboratory test values were collected from patients with a wide variety of clinical complaints including malignancies, infections, autoimmune disorders, traumas, etc. the absolute value and the percentage of change between the 2 test runs for each critical value were calculated and averaged for each test category and then compared to the college of american pathologists / clinical laboratory improvement amendments (cap / clia) allowable errors. if the absolute difference or the percentage of change between the repeated value and the initial result was greater than cap / clia allowable error, it was assumed an outlier. the cap/ clia allowable errors and critical values for the tests are shown in table 1. absolute difference, mean, and percentage of change were calculated as follows : absolute diffrence=|ininitial test valuerepeated test value| mean = initial test value+repeated test value2 percentage of change = absolute diffrence initial test valueinitial test value100 all statistical analysis was done by spss19. absolute difference, mean, and percentage of change were calculated as follows : absolute diffrence=|ininitial test valuerepeated test value| mean = initial test value+repeated test value2 percentage of change = absolute diffrence initial test valueinitial test value100 hemoglobin (hgb) : among the 348 hgb critical values, the repeat values of 122 specimens (35.06%) had equal results to the initial test run. white blood cell count (wbc):among the 469 wbc critical values, the repeat values of 171 specimens (36.46%) had equal results to the initial test run. the repeat values of 95 specimens (30.74%) had equal results to the initial test run. international normalized ratio (inr) : among the 104 inr critical values, the repeat values of 27 specimens (25.96%) had equal results to the initial test run. in this category, 69 repeating tests (66.35%) were performed on the re - collected sample. partial thromboplastin time (ptt):among the 126 ptt critical values, the repeat values of 13 specimens (10.32%) had equal results to the initial test run. in this category, 86 repeating tests (68.25%) were performed on the same collected sample, and 40 repeating tests (31.75%) were performed on the re - collected sample. phosphorus (p):among the 82 p critical values, the repeat values of 52 specimens (63.4%) had equal results to the initial test run. glucose (glc):among the 109 glc critical values, the repeat values of 17 specimens (15.6%) had equal results to the initial test run. potassium (k):among the 118 k critical values, the repeat values of 62 specimens (52.5%) had equal results to the initial test run. magnesium (mg):among the 87 mg critical values, the repeat values of 56 specimens (64.37%) had equal results to the initial test run sodium (na):among the 124 na critical values, the repeat values of 76 specimens (61.29%) had equal results to the initial test run. calcium (ca):among the 106 ca critical values, the repeat values of 36 specimens (33.96%) had equal results to the initial test run. total bilirubin : among the 131 bil total critical values, the repeat values of 22 specimens (16.8%) had equal results to the initial test run. direct bilirubin : among the 120 bil direct critical values, the repeat values of 20 specimens (16.67%) had equal results to the initial test run. the mean absolute difference and percentage of change between two testing runs for each test category and subgroups of them are tabulated in table 2. hgb, hemoglobin ; wbc, white blood cell ; plt, platelet ; inr, international normalized ratio ; ptt, partial thromboplastin time ; p, phosphorus ; glc, glucose ; k, potassium ; mg, magnesium ; na, sodium ; ca, calcium ; bil, bilirubin ; sec, seconds. the lowest absolute difference was 0.05 mg / dl, obtained for the mg and p results, and the highest absolute difference was 1747.57 per / ml, obtained for the plt results. among the subgroups the lowest absolute difference was 0.03 mg / dl, obtained for the mg950000 results. the lowest percentage of change was 0.37%, obtained for the na results, and the highest percentage of change was 7.99%, obtained for the p results. among the subgroups the lowest percentage of changewas 0.21%, obtained for the na>150 mmol / l results and the highest absolute difference was 7.99%, obtained for the p results. there was 1 outlier (0.2%) in the wbc test category with the absolute difference of 200 per / ml, and a mean value of 1400 per / ml, 9 (2.9%) in the plt test category with the absolute differences in the range of 1000 to 4000 per / ml, and the mean values in the range of 3500 to 18000 per / ml. 5 (4.8%) in the inr test category with the absolute differences in the range of 0.8 to 1, and the mean values in the range of 5.6 to 6.5. 5 (4%) in the ptt test category with the absolute differences in the range of 17 to 18 seconds, and the mean values in the range of 115.5 to 127 seconds, and none in other 9 test categories. out of 20 (100%) samples with significant difference (outlier) only two (10%) of them were among the tests performed on recollected samples, the rest were performed on the same samples. both of these cases belong to ptt test which means two of 126 tests (1.6%) and two of 40 recollected samples of this test (5%) showed significant differences. therefore, we do not have enough evidence to conclude whether recollecting samples have significant effects on the results. international normalized ratio (inr) : among the 104 inr critical values, the repeat values of 27 specimens (25.96%) had equal results to the initial test run. in this category, 69 repeating tests (66.35%) were performed on the re - collected sample. partial thromboplastin time (ptt):among the 126 ptt critical values, the repeat values of 13 specimens (10.32%) had equal results to the initial test run. in this category, 86 repeating tests (68.25%) were performed on the same collected sample, and 40 repeating tests (31.75%) were performed on the re - collected sample. phosphorus (p):among the 82 p critical values, the repeat values of 52 specimens (63.4%) had equal results to the initial test run. glucose (glc):among the 109 glc critical values, the repeat values of 17 specimens (15.6%) had equal results to the initial test run. potassium (k):among the 118 k critical values, the repeat values of 62 specimens (52.5%) had equal results to the initial test run. magnesium (mg):among the 87 mg critical values, the repeat values of 56 specimens (64.37%) had equal results to the initial test run sodium (na):among the 124 na critical values, the repeat values of 76 specimens (61.29%) had equal results to the initial test run. calcium (ca):among the 106 ca critical values, the repeat values of 36 specimens (33.96%) had equal results to the initial test run. total bilirubin : among the 131 bil total critical values, the repeat values of 22 specimens (16.8%) had equal results to the initial test run. direct bilirubin : among the 120 bil direct critical values, the repeat values of 20 specimens (16.67%) had equal results to the initial test run. the mean absolute difference and percentage of change between two testing runs for each test category and subgroups of them are tabulated in table 2. hgb, hemoglobin ; wbc, white blood cell ; plt, platelet ; inr, international normalized ratio ; ptt, partial thromboplastin time ; p, phosphorus ; glc, glucose ; k, potassium ; mg, magnesium ; na, sodium ; ca, calcium ; bil, bilirubin ; sec, seconds. the lowest absolute difference was 0.05 mg / dl, obtained for the mg and p results, and the highest absolute difference was 1747.57 per / ml, obtained for the plt results. among the subgroups the lowest absolute difference was 0.03 mg / dl, obtained for the mg950000 results. the lowest percentage of change was 0.37%, obtained for the na results, and the highest percentage of change was 7.99%, obtained for the p results. among the subgroups the lowest percentage of changewas 0.21%, obtained for the na>150 mmol / l results and the highest absolute difference was 7.99%, obtained for the p results. there was 1 outlier (0.2%) in the wbc test category with the absolute difference of 200 per / ml, and a mean value of 1400 per / ml, 9 (2.9%) in the plt test category with the absolute differences in the range of 1000 to 4000 per / ml, and the mean values in the range of 3500 to 18000 per / ml. 5 (4.8%) in the inr test category with the absolute differences in the range of 0.8 to 1, and the mean values in the range of 5.6 to 6.5. 5 (4%) in the ptt test category with the absolute differences in the range of 17 to 18 seconds, and the mean values in the range of 115.5 to 127 seconds, and none in other 9 test categories samples with significant difference (outlier) only two (10%) of them were among the tests performed on recollected samples, the rest were performed on the same samples. both of these cases belong to ptt test which means two of 126 tests (1.6%) and two of 40 recollected samples of this test (5%) showed significant differences. therefore, we do not have enough evidence to conclude whether recollecting samples have significant effects on the results. as we mentioned before, recent studies showed that the routine repeat testing of critical test values does not have any advantage with recent year s laboratory automated equipments (21,31). in a recent study, chima collected a total of 580 repeated tests for potassium, glucose, platelet count, and activated partial thromboplastin time and expressed that 95.3% of repeated testing for critical values was within their acceptable difference (21). another study examined 500 consecutive critical results for 5 different hematology / coagulation tests. by using their laboratory s acceptable tolerance limits for reruns (atlr), toll expressed that 0% to 2.2% of the repeated values for these tests were outside of their acceptable range (31). also, in 2011 deetz examined 2162 critical results in chemistry laboratory and they found that 2.8% of the repeated values were outside of the cap / clia total allowable errors (33). they all concluded that repeated testing for critical values did not offer an advantage in hematology, chemistry, and coagulation settings. to determine the effect of routine repeat testing of critical values, we examined 2233 specimens from 13 different hematology, coagulation, and chemistry tests (348 hgb critical results, 469 wbc critical results, 309 plt critical results, 104 inr critical results, 126 ptt critical results, 82 p critical results, 109 glc critical results, 118 k critical results, 87 mg critical results, 124 na critical results, 106 ca critical results, 131 total bilirubin critical results, and 120 direct bilirubin critical results). we calculated the absolute difference and the percentage of change between the initial and repeated value for each of them and then compared with cap / clia total allowable errors. if the absolute difference or the percentage of change between the repeated value and the initial result was greater than cap / clia allowable error, it was assumed an outlier. from 2233 repeated test values, a total of 20 outliers were detected (99.1%) in which the difference between 2 testing runs exceeded the cap / clia limits for allowable error. the test results outside this range included : there was only one outlier (0.2%) in the wbc test category, 9 (2.9%) in the plt test category, 5 (4%) in the ptt test category, 5 (4.8%) in the inr test category and none in other test categories. the significant difference between the initial result and the repeated result in the ptt test category might be attributed to instability of specimens from patients on heparin therapy. sometimes, heparin inhibition by platelet factor 4 (released by activated platelets in the specimen) makes these patient s results poor reproducible (34). in the plt test category, it might be attributed to clot formation in the testing process, and that would decrease the count initially, but because of the poor strength of the clot, it will get a higher count the second time. another problem with platelet counting is when you get down to really low levels ; debris in the sample (e.g. ruptured cells, membranes, etc.) become a significant problem and interferes with the measurement system (24). on the other hand, hemolysis due to the breakdown of red blood cells is important to the laboratory because it can have an effect on laboratory results by increasing them falsely. despite our effort, first of all, the fact that all of our samples were collected from a single medical laboratory means that our results could be affected by the quality of its instruments, kits and reagents. secondly, collected data for some tests such as phosphorus and magnesium were limited which could have made some biasness in our results. finally, recollected samples were not available for all of our tests (they were only available for ptt and inr). therefore, we are not able to make a comprehensive comparison between initial samples and recollected ones. as a result of limited time and resources it will be beneficial for further studies to collect data from different laboratories, which would be more representative. at the end, we can say that the result of our observations is similar to previous studies. nowadays, with advanced laboratory equipments, the routine repeat testing of critical values has no effect on increasing the accuracy of the results of these tests. repeat testing may be helpful in some situations, such as when the physician doubts about the accuracy of a result, or when the test result is not consistent with the patient 's condition. by ignoring the routine repeat testing of critical values we can accelerate the result reporting to caregiver, in addition to, we can reduce the additional test costs. | background : routine repeat testing of critical laboratory values is very common these days to increase their accuracy and to avoid reporting false or infeasible results. we figure that repeat testing of critical laboratory values has any benefits or not. methods : we examined 2233 repeated critical laboratory values in 13 different hematology and chemistry tests including : hemoglobin, white blood cell, platelet, international normalized ratio, partial thromboplastin time, glucose, potassium, sodium, phosphorus, magnesium, calcium, total bilirubin and direct bilirubin. the absolute difference and the percentage of change between the two tests for each critical value were calculated and then compared with the college of american pathologists / clinical laboratory improvement amendments allowable error. results : repeat testing yielded results that were within the allowable error on 2213 of 2233 specimens (99.1%). there was only one outlier (0.2%) in the white blood cell test category, 9 (2.9%) in the platelet test category, 5 (4%) in the partial thromboplastin time test category, 5 (4.8%) in the international normalized ratio test category and none in other test categories. conclusion : routine, repeat testing of critical hemoglobin, white blood cell, platelet, international normalized ratio, partial thromboplastin time, glucose, potassium, sodium, phosphorus, magnesium, calcium, total bilirubin and direct bilirubin results does not have any benefits to increase their accuracy. |
Subsets and Splits