Datasets:

danieladeeko
/

proccessed_ccdv

Dataset card Data Studio Files Files and versions Community

Split (3)

train · 120k rows

article stringlengths 0 682k	abstract stringlengths 146 3.69k
the evolution of multi - cellular eukaryotic organisms from single - celled ancestors was one of the most significant transitions in the evolution of life on earth. it enabled the emergence of larger and more complex eukaryotes that could resist predation, evolve specialized tissues and higher order biological capacities, and colonize new environments. multi - cellularity evolved independently in several eukaryotic lineages and, in terms of the number of cell types per organism, animals (the metazoa) include the most complex multi - cellular eukaryotes (rokas, 2008). a key mediator of metazoan multi - cellularity is the extracellular matrix (ecm), a multi - component, proteinaceous network that bridges between cells, contributes to their spatial arrangements by binding cell - surface adhesion receptors, and supports cell survival, differentiation, and tissue organization (hynes, 2009). the advantages of increased organism size for more efficient use of nutrients and escape from predation might have acted as selection pressures for the evolution of ecm, and increases in ocean oxygen levels around 850 million years ago likely provided a favorable environment for these changes (rokas, 2008). here, we discuss the adhesome of basal metazoa, the modern animals that provide a window on the earliest - evolving ecm components, and consider the expansion of adhesome complexity that occurred in the deuterostome / chordate lineage. the pathway by which ecm components are secreted from cells is highly conserved in eukaryotes and clearly predates the metazoa (dacks., 2009). many ecm proteins are oligomeric ; the most prevalent oligomerization domains are the gxy motifs of collagens that assemble three polypeptides into a supercoiled triple helix, and the -helical heptad repeats that assemble ecm oligomers from trimers to pentamers. both the gxy motif and heptad repeat are found throughout the domains of life and in viruses (odgren., 1996,, the vwf_a domain, thrombospondin type 1 domain, or egf domain are also of premetazoan origin (whittaker and hynes, 2002, tucker, 2004, wouters., 2005). thus, many constituent domains of ecm proteins predate the origin of animals. with the benefit of recent genome sequences and expressed sequence tag databases it is possible to assess the representation of adhesome components within the metazoa (figure 1 ; supplemental tables s1s3 ; supplemental file 1). by inference, proteins represented throughout the metazoa were present in the last common metazoan ancestor and so these studies give us insight into the core molecular machinery of the ecm. ecm components that are conserved from sponges to human include the three clades of fibrillar collagens and basement membrane collagen iv (figure 1). for a gxy triple helix to be stable and assemble into higher order fibrils, additional protein domains and accessory proteins the fibrillar collagen polypeptides of sponges contain all the expected domains, namely, a triple - helical domain and n- and c - terminal propeptide domains that align three procollagen polypeptides to nucleate the triple helix (exposito., 2008, 2010). sponges also encode the n- and c - propeptidases that enable higher order assembly of triple helices into fibrils. correspondingly, collagen fibrils have been identified as macromolecular structures in sponges (garrone., 1975, exposito., 2010). of the four taxonomic groups of sponges, the homoscleromorpha also encode collagen iv and contain a basement membrane structure (boute., 1996). other key components of basement membranes, laminin and perlecan, are also present in sponges and are conserved throughout the metazoa (figure 1, table s1). fibrillin, that forms a separate microfibril system, is also universal (reber - mller., 1995, ramirez and sakai, 2010). thus, three major structural systems of the ecm appear to have originated in the metazoan ancestor. lower panels illustrate the complexity of ecm in tissues from nematostella (asterisk indicates collagen - like fibrils) or mouse (indicates collagen fibrils in longitudinal section ; + indicates collagen fibrils in cross - section). mouse dermis micrograph courtesy of douglas keene. surprisingly, ecm components such as agrin, known for its roles in synapses and at neuromuscular junctions (wu., 2010), along with thrombospondin (tsp) and sparc / osteonectin that have specialized roles in vertebrates, are also conserved in sponges (figure 1 and supplemental table s1 ; bentley and adams, 2010). the functions of these proteins in basal metazoa are unknown ; however, their strong conservation suggests wide roles in the ecm. in mammals, tsps or sparc do not self - associate into fibrils, yet they affect the packing of collagen fibrils (bornstein., 2004, halsz. in addition, two major groups of ecm proteases, the matrix metalloproteinases (mmp) and the disintegrin and metalloproteinase with thrombospondin repeats proteases (adamts), are both also conserved throughout the metazoa (nicholson., 2005, fanjul - fernndez., 2010 ; thus, the core adhesome apparently includes multiple inputs for regulation or dynamic turnover of the higher order organization of collagen fibrils. this is an important consideration for the design of synthetic, ecm - mimetic, three - dimensional environments. in contrast, with the exceptions of perlecan and agrin, basal metazoa do not encode secreted proteoglycans equivalent to those of vertebrates (observations from blast searches). nevertheless, carbohydrate - based interactions contribute to tissue organization, as in the cell cell cohesion of sponges (bucior., 2004). these functions might be conserved ; for example, a nonsulfated chondroitin of hydra stabilizes membrane tubulation during assembly of the stinging organelle of nematocytes. this activity is similar to the function of chondroitin sulfate in perineuronal ecm nets of the mammalian cns (yamada.. further investigation of proteoglycan core proteins of basal metazoa by nongenomic approaches (e.g., targeted proteomics of glycosaminoglycan - substituted proteins) is needed to assess the significance of proteoglycans in the core adhesome. the attachment of ecm components to cell surfaces is also essential for ecm function and transmission of mechanical forces. certain adhesion receptor families : integrins, syndecan, and glypican membrane proteoglycans and cd36, are present in sponges and throughout the metazoa (figure 1 and supplemental table s2) (brower., 1997, hughes, 2001, mueller., 2004, others [e.g., dystroglycan and discoidin domain receptor (ddr), a receptor tyrosine kinase that binds collagens at the same site as sparc (carafoli., 2009) ] originated later within the metazoa (supplemental table s2). the high conservation of genes encoding core ecm and adhesion receptors is especially striking for trichoplax adhaerens, a basal metazoan with four cell types in which a morphologically recognizable intercellular ecm has not been detected by transmission electron microscopy (srivastava. the high conservation of core adhesome components has raised the fascinating issue that their evolutionary origins need to be sought outside the metazoa (king, 2004, rokas, 2008). on present data, ecm proteins and most of the associated adhesome arose through a major wave of innovation that occurred in conjunction with the origin of the metazoa (figure 1). choanoflagellates are considered the closest outgroup to the metazoa (baldauf, 2003, king, 2004) and genome sequencing for the unicellular choanoflagellate monosiga brevicollis and the colonial salpingoeca rosetta has enabled the question of metazoan ecm origins to be pursued in more depth. m. brevicollis and s. rosetta each encode two proteins that contain repeated gxy motifs and several other proteins that contain collagen c - propeptide like domains (king. vital accessory proteins for collagen fibril assembly, collagen propeptidases and lysyl oxidase, are not encoded. thus, a current model is that fibrillar collagens originated at the dawn of the metazoa by domain shuffling (exposito., 2008). similarly, although some of the individual domains are present (e.g., the laminin g domain), none of the core basement membrane components are encoded in the choanoflagellates examined to date (king., 2008). intriguingly, both choanoflagellates encode a fibrillin - like protein (supplemental file 1). it will be of great interest to learn whether this protein has fibril - forming capacity. a second intriguing molecule is usherin, which in humans has specialized roles in the retina as an ecm component at photoreceptor cell synapses and in the inner ear as a transmembrane component of the usher protein network (reiners., 2006). the conservation of usherin in cnidaria (tucker, 2010) and the existence of homologues in choanoflagellates (supplemental file 1) suggests that a fundamental role in cell interactions remains to be uncovered. turning to the adhesion receptors, ddr and membrane - bound proteoglycans are not apparent outside the metazoa (supplemental file 1). a cd36-like protein is evident in m. brevicollis, the opisthokont capsaspora owczarzaki and the slime mold dictyostelium discoideum (supplemental file 1). mammalian cd36 binds collagen and thrombospondin-1 and also has roles in the internalization of long chain fatty acids, oxidized phospholipids, and lipid microparticles (silverstein and febbriao, 2009). in the sponge, cd36 contributes to the assembly of aquiferous channels that form a primitive circulation system (mueller., 2004). we speculate that cd36 evolved originally for nutritional functions, as in the uptake of prey or lipid materials, and later acquired ecm - binding capacities. remarkably, thecamonas trahens (a protist) and c. owczarzaki both encode integrin and subunits as well as key components of intracellular integrin signaling (seb - pedrs., 2010). these data place the evolutionary debut of integrin heterodimers before the metazoan / fungal divergence (considerably earlier than previous estimates) and indicate lineage - specific losses of integrins in the fungi and choanoflagellates examined to date (king., 2008, shalchian - tabrizi., 2008, the sib (similar to integrin beta) proteins of dictyostelium discoideum are intriguing for their similar function in substratum attachment, yet in structure these proteins are only similar to integrin beta by the presence of an extracellular vwf_a domain and npxy - dependent talin - binding capacity of the cytoplasmic domain (cornillon., 2006, 2008). present data do not distinguish whether sibs and integrin share a common ancestor or are of independent evolutionary origin. metazoan integrins function in phagocytosis and cell - cell interactions as well as ecm attachment, and it is plausible that integrins in single - celled organisms have pre - ecm roles in signaling cytoskeletal reorganizations during prey capture and uptake. if so, the protist integrins could be of great interest for studies of integrin structure and signaling activation mechanisms. deuterostomes in general and vertebrates in particular have many elaborations and specializations of tissue ecm distinct from those of basal metazoa and protostomes. these include novel splice variants (e.g., agrin), gene family expansions (e.g., the laminin, thrombospondin, integrin and adamts protease families ; tzu and marinkovich, 2008, huhtala., 2005, nicholson., 2005, mckenzie., 2006), and the evolutionary origin of many novel ecm components [e.g., tenascin, fibronectin (fn), ccn (cyr61, ctgf, nov) proteins, and facit collagens (fibril associated collagens with interrupted triple helices), (tucker., 2006, huxley - jones., 2007, tucker and chiquet - ehrismann, 2009a, katsube., 2009 ; these innovations exemplify shuffling of preexisting domains into novel combinations (e.g., tenascin, ccn), or inclusion of novel domains (e.g., in fibronectin the fn - i domain is deuterostome - specific and the fn - ii domain is chordate - specific) (kawashima., 2009) many adhesome components represented by single genes in invertebrate deuterostomes (sea urchin, acorn worm, or sea squirt) form a gene family in vertebrates, most likely due to the two rounds of genome - wide duplication that took place early in the vertebrate lineage (dehal and boore 2005 ; huxley - jones., 2007) (figure 1 and supplemental file 1). frequently, as exemplified by syndecan and tenascin, even larger gene families are present in bony fish that underwent a third, fish - specific genome duplication (meyer and van de peer, 2005, chakravarti and adams, 2006, tucker., 2006) the subsequent evolution of the duplicated genes has involved subfunctionalization, such that the modern paralogues are expressed under control of different regulatory pathways in distinct cell - types or tissues (e.g., sun., 2005, tucker and chiquet - ehrismann, 2009b). collectively, these molecular innovations and gene family expansions have resulted in many changes and additions to ecm network systems (figure 1). collagen fibrils are of increased size and molecular complexity, due to presence of facit collagens and the repertoire of collagen - binding proteoglycans (exposito., 2010). the evolution of hyaluronan synthase has resulted in the presence of large (225 micron long), water - retaining hyaluronan / aggrecan polymers in the cartilage and brain ecm of vertebrates (weigel and deangelis, 2007, yoneda., the predicted fn - like protein of ciona savignyi contains all three canonical domains (fn - i, fn - ii, fn - iii) but is unusual in having only one fn - i domain, lacking an rgd motif exposed for integrin - binding, and having immunoglobulin - like domains interspersed with the fn - iii domains (tucker and chiquet - ehrismann, 2009a). for vertebrate fn, fibrillogenesis is a cell - dependent process, requiring integrin - binding and cell contractility in addition to intermolecular interactions between multiple fn - i domains in the n - terminal region (mao and schwarzbauer, 2005). we hypothesize that ciona fn - like protein does not form a distinct fibril system, but would bind onto other ecm component such as fibrillin or tenascin, or cell - surface heparan sulfate proteoglycans. although information on fn in the lamprey and shark is currently missing, it is clear that the fns of bony fish have all the expected molecular features for fibril assembly (sun., 2005). the early embryonic lethality of fn gene knockout mice demonstrates the vital importance of this fibril system in vertebrates (george., 1993). deuterostomes also exemplify many innovations or neofunctions of cell - ecm adhesion receptors (figure 1 ; supplemental table s3 and supplemental file 1). whereas rgd- and laminin - binding integrins exist in both protostomes and deuterostomes, major lineage - specific novelties in chordates include the collagen - binding i domain integrin subunits and the subunit clades (hughes, 2001, ewan. although i domain containing integrins are present in ciona intestinalis, their structural and functional characteristics indicate an independent evolutionary lineage (ewan., 2005, huhtala., 2005, tulla., 2007). the major rgd - dependent, fn - binding integrin of vertebrates, 51, appeared after the divergence of tunicates and before the divergence of bony fish (ewan. the hyaluronan receptor, cd44, first appears in bony fish (supplemental table s3). these examples illustrate how innovations, domain shuffling, and coevolutionary events expanded the possibilities for tissue specificity, microenvironmental complexity and subtlety of ecm - dependent intracellular signaling and gene expression. these new potentialities contributed to major tissue and bodyplan innovations, including development of the notochord, the pharyngeal arches and neural crest cells (zhang and cohn, 2006, jeffery. the origination of cartilaginous tissue based on collagen ii provided the framework for the development of endochondrial ossification in vertebrates (wada, 2010). this is not to overlook the vast diversity of ecm that supports distinctive tissue- or species - specific functions. elastic proteins have evolved in multiple lineages as counterparts to the relatively inflexible collagen fibers (gosline., 2002). the production of mineralized bio - composites with remarkable mechanical properties that are based on collagen fibrils occurs in many phyla ; the 3-m - long silica spicules of glass sponges and the byssus material of mussels are fascinating examples. such forms of ecm are of increasing interest to bioengineers (harrington., 2010, mller., 2009). contrastingly, lineage - specific ecm components can fulfill major tissue functions, as exemplified by the role of lamprin in lamprey cartilage (robson., 1993). given the vast number of arthropod and mollusk species and the relatively low representation of these phyla from sequenced genomes, it is likely that the full extent of ecm diversity remains to be uncovered. the evolution of metazoa can not be separated from the evolution of their ecm. ecm representation in modern this viewpoint has been enabled by comparative genomics, but functional investigations in basal metazoa and choanoflagellates are now needed, complemented by proteomics to identify lineage - specific components. knowledge of the networks and hierarchies by which tissue ecms are built is relevant to stem cell biology, tissue engineering, and many clinical conditions. understanding the evolutionary history of the ecm is an important approach to deciphering these systems.	we present a perspective on the molecular evolution of the extracellular matrix (ecm) in metazoa that draws on research publications and data from sequenced genomes and expressed sequence tag libraries. ecm components do not function in isolation, and the biological ecm system or adhesome also depends on posttranslational processing enzymes, cell surface receptors, and extracellular proteases. we focus principally on the adhesome of internal tissues and discuss its origins at the dawn of the metazoa and the expansion of complexity that occurred in the chordate lineage. the analyses demonstrate very high conservation of a core adhesome that apparently evolved in a major wave of innovation in conjunction with the origin of metazoa. integrin, cd36, and certain domains predate the metazoa, and some ecm - related proteins are identified in choanoflagellates as predicted sequences. modern deuterostomes and vertebrates have many novelties and elaborations of ecm as a result of domain shuffling, domain innovations and gene family expansions. knowledge of the evolution of metazoan ecm is important for understanding how it is built as a system, its roles in normal tissues and disease processes, and has relevance for tissue engineering, the development of artificial organs, and the goals of synthetic biology.
intervertebral disc degeneration (idd) is a highly relevant individual and socioeconomic burden, which is associated to various morphological and functional disturbances. the gradual progression of the disease and the structural features, e.g., the degradation of proteoglycans with subsequent desiccation of the disc extracellular matrix, the ingrowth of blood vessels and the loss of intervertebral disc (ivd) height, can be addressed in close detail and predispose idd for regenerative strategies. direct injection of growth factors, viral vectors and cells, each alone or in combination, seek to stimulate proliferation and production of extracellular matrix. reasonable chances of success of these methods, however, are questionable [4, 5 ]. low oxygen and ph within the avascular disc represent a hostile environment for cell metabolism [2, 6, 7 ]. conversely, vascularization must not be promoted as it accelerates degeneration [8, 9 ]. furthermore, aberrant mechanical stimuli may activate catabolic remodelling, cell death and tissue breakdown [1013 ]. to reestablish a loading regime that enhances the anabolic response of resident and implanted cells and to trigger biological mechanisms of self - healing, biodegradable substitutes were designed according to the natural ideal of the ivd. as the restoration of disc height is assumed to be essential for nucleus replacements, sufficient quantities of hydrogels are intended to be injected into the ivd for an immediate restoration of disc mechanics. hyaluronic acid or polysaccharide - based hydrogels, such as gellan gum - based hydrogels, were proven to adequately support the growth and extracellular matrix deposition of cells and might therefore be suited as nucleus replacements [1719 ]. to retain avascularity of cartilaginous tissues, functionalization of scaffolds with anti - angiogenic peptides was suggested. to gain deeper knowledge on future research directions, the purpose of this study was to investigate newly developed hydrogels as nucleus replacements for the biomechanical restoration and biological regeneration of the disc. the effect of functionalization on the efficiency of hydrogels was evaluated using anti - angiogenic peptides and bone marrow derived mononuclear cells. 24 adult merino sheep (24.5 years ; 76108 kg) were operated to compare four different hydrogel configurations with nucleotomy controls. permission for the animal experiment was received from the regional commission of tbingen (reg. configuration 1 hydrogels made of ionic crosslinked methacrylated gellan gum (igg - ma ; 3b s research group, university of minho, portugal) were used as nucleus replacement. igg - ma is a microbial polysaccharide, which forms a colloidal gel in the presence of metallic ions. configuration 2 to investigate whether anti - angiogenic peptides reveal a positive effect in the prevention of idd, igg - ma was functionalized with non - cytotoxic polylysine - based vegf - blockers (igg - ma+pep) that were shown to effectively inhibit endothelial cell proliferation (school of pharmacy and biomolecular sciences, university of brighton, united kingdom). configuration 3 hydrogels made of dodecyl - amide of hyaluronic acid (ddaha ; anika therapeutics, abano therme, italy) were tested without additives. configuration 4 for the cell - based approach, ddaha was seeded with autologous bone marrow derived mononuclear cells (ddaha+bmc). a one - step surgical procedure was performed combining the harvesting of bone marrow (bm) from the iliac crest, the isolation of bmc and the orthotopic implantation of ddaha+bmc. the detailed composition of the hydrogels was previously described. in 18 animals one of four bm was harvested from the iliac crest under sterile conditions at the beginning of surgery. coagulation was prevented by 5,000 iu heparin/10 ml bm (heparin - natrium-5,000-ratiopharm, ratiopharm gmbh, ulm, germany). the cell - seeded hydrogels were prepared by adding 0.25 ml of the cell suspension containing 4 10 bmc / ml pbs to 0.5 ml of ddaha, resulting in 1 10 bmc / ddaha. for the estimation of the number of mesenchymal stem cells (msc) in bmc a colony forming units - fibroblast (cfu - f) assay was performed as previously described. all animals were operated in four levels from l1l2 to l4l5 or in case of 7 lumbar vertebrae (n = 8) from l2l3 to l5l6. general anesthesia and the retroperitoneal multisegmental approach to the spine were performed as recently described in detail. each disc was stabbed with sterile microsurgery blades and a lateral nucleotomy was performed using 1.0 and 1.5 mm rongeurs with straight and flexed jaws, respectively. (0.170.23 g) nucleus tissue was removed from each disc and treated in an alternating sequence with one of the five configurations (fig. 1). the annulus defects were closed with suture and 2-octyl - cyanoacrylate glue (dermabond, ethicon products, norderstedt, germany) and covered with a collagen sponge (lyostypt, aesculap ag, tuttlingen, germany).fig. 1alternating implantation scheme for the two hydrogels (blue, green) without (light) and with peptides or cells (dark) and the nucleotomy controls (red) alternating implantation scheme for the two hydrogels (blue, green) without (light) and with peptides or cells (dark) and the nucleotomy controls (red) eight animals were sacrificed after 6 weeks for only histological and 16 sheep after 12 weeks for histological and biomechanical analyses. the 6-week group for biomechanics was omitted because after this time period annulus healing is not to be expected. for biomechanical and histological comparison with intact discs, respectively, six native lumbar spines and six lumbar segments from independent comparable sheep were used. for the biomechanical analyses, the polysegmental specimens including all treated discs were embedded in polymethylmethacrylate (pmma, technovit 3040, heraeus kulzer, werheim, germany) and tested in a custom - made spine loading simulator [25, 26 ]. the range of motion (rom) and the neutral zone (nz) were investigated for each segment separately at 7.5 nm pure moments in the three principal motion planes flexion + extension, lateral bending right + left, and axial rotation left + right using a motion tracking system (vicon mx13, vicon, oxford, united kingdom). for qualitative and semi - quantitative histological evaluation each segment was embedded in pmma for undecalcified histology after formalin fixation. an established semi - quantitative degeneration score according to boos. was used to determine the degree of degeneration (table 1). the disc height index (dhi) was evaluated by dividing the mean value of the anterior, middle and posterior disc height from the histologic samples by the anterio - posterior diameter of the disc using imagej software. inflammation parameters, such as the presence of immune cells, regeneration of the tissue, blood vessel formation and remaining hydrogels were qualitatively evaluated under light microscopy (dmi6000b, leica, heerbrugg, switzerland).table 1modified degeneration score according to boos. degeneration parametercharacteristic featurescore (total 36)intervertebral disc cellsno proliferation/0increased cell density/1connection of two chondrocytes/2small size clones/3moderate size clones/4huge size clones5 granular changesnone / rare / intermediate / abundantly0/1/2/3 neovascularizationabsent / present0/1 rim lesionsnone / rare / intermediate / abundantly0/1/2/3 concentric tearsnone / rare / intermediate / abundantly0/1/2/3 radial tearsnone / rare / intermediate / abundantly0/1/2/3 scar formationabsent / present0/1 tissue defectsabsent / present0/1endplate cellsnone / rare / intermediate / abundantly0/1/2/3 structural disorganizationnone / rare / intermediate / abundantly0/1/2/3 cleftsnone / rare / intermediate / abundantly0/1/2/3 microfracturenone / rare / intermediate / abundantly0/1/2/3 neovascularizationabsent / present0/1 new bone formationabsent / present0/1 scar formationabsent / present0/1 tissue defectsabsent / present0/1 modified degeneration score according to boos. for statistical analysis the unpaired, two - sample wilcoxon signed rank test to a significance level of p 0.05 was used. bm was harvested from the iliac crest under sterile conditions at the beginning of surgery. coagulation was prevented by 5,000 iu heparin/10 ml bm (heparin - natrium-5,000-ratiopharm, ratiopharm gmbh, ulm, germany). the cell - seeded hydrogels were prepared by adding 0.25 ml of the cell suspension containing 4 10 bmc / ml pbs to 0.5 ml of ddaha, resulting in 1 10 bmc / ddaha. for the estimation of the number of mesenchymal stem cells (msc) in bmc a colony forming units - fibroblast (cfu - f) assay was performed as previously described. all animals were operated in four levels from l1l2 to l4l5 or in case of 7 lumbar vertebrae (n = 8) from l2l3 to l5l6. general anesthesia and the retroperitoneal multisegmental approach to the spine were performed as recently described in detail. each disc was stabbed with sterile microsurgery blades and a lateral nucleotomy was performed using 1.0 and 1.5 mm rongeurs with straight and flexed jaws, respectively. (0.170.23 g) nucleus tissue was removed from each disc and treated in an alternating sequence with one of the five configurations (fig. 1). the annulus defects were closed with suture and 2-octyl - cyanoacrylate glue (dermabond, ethicon products, norderstedt, germany) and covered with a collagen sponge (lyostypt, aesculap ag, tuttlingen, germany).fig. 1alternating implantation scheme for the two hydrogels (blue, green) without (light) and with peptides or cells (dark) and the nucleotomy controls (red) alternating implantation scheme for the two hydrogels (blue, green) without (light) and with peptides or cells (dark) and the nucleotomy controls (red) eight animals were sacrificed after 6 weeks for only histological and 16 sheep after 12 weeks for histological and biomechanical analyses. the 6-week group for biomechanics was omitted because after this time period annulus healing is not to be expected. for biomechanical and histological comparison with intact discs, respectively, six native lumbar spines and six lumbar segments from independent comparable sheep were used. for the biomechanical analyses, the polysegmental specimens including all treated discs were embedded in polymethylmethacrylate (pmma, technovit 3040, heraeus kulzer, werheim, germany) and tested in a custom - made spine loading simulator [25, 26 ]. the range of motion (rom) and the neutral zone (nz) were investigated for each segment separately at 7.5 nm pure moments in the three principal motion planes flexion + extension, lateral bending right + left, and axial rotation left + right using a motion tracking system (vicon mx13, vicon, oxford, united kingdom). for qualitative and semi - quantitative histological evaluation each segment was embedded in pmma for undecalcified histology after formalin fixation. an established semi - quantitative degeneration score according to boos. was used to determine the degree of degeneration (table 1). the disc height index (dhi) was evaluated by dividing the mean value of the anterior, middle and posterior disc height from the histologic samples by the anterio - posterior diameter of the disc using imagej software. inflammation parameters, such as the presence of immune cells, regeneration of the tissue, blood vessel formation and remaining hydrogels were qualitatively evaluated under light microscopy (dmi6000b, leica, heerbrugg, switzerland).table 1modified degeneration score according to boos. degeneration parametercharacteristic featurescore (total 36)intervertebral disc cellsno proliferation/0increased cell density/1connection of two chondrocytes/2small size clones/3moderate size clones/4huge size clones5 granular changesnone / rare / intermediate / abundantly0/1/2/3 neovascularizationabsent / present0/1 rim lesionsnone / rare / intermediate / abundantly0/1/2/3 concentric tearsnone / rare / intermediate / abundantly0/1/2/3 radial tearsnone / rare / intermediate / abundantly0/1/2/3 scar formationabsent / present0/1 tissue defectsabsent / present0/1endplate cellsnone / rare / intermediate / abundantly0/1/2/3 structural disorganizationnone / rare / intermediate / abundantly0/1/2/3 cleftsnone / rare / intermediate / abundantly0/1/2/3 microfracturenone / rare / intermediate / abundantly0/1/2/3 neovascularizationabsent / present0/1 new bone formationabsent / present0/1 scar formationabsent / present0/1 tissue defectsabsent / present0/1 modified degeneration score according to boos. for statistical analysis the unpaired, two - sample wilcoxon signed rank test to a significance level of p 0.05 was used. intra- or post - operative complications did not occur. the yields of bmc / ml bm and the frequency of msc evaluated by cfu - f assay varied considerably between the sheep. the mean sd of bmc / ml bm was 1.11 10 0.95 10. the cloning efficiency of bmc population varied between 0.00080.039 % cfu - f (mean 0.01 0.01 %). this resulted in the mean of 101 108 msc / hydrogel and varied between 8 and 390 msc / hydrogel. in average 0.20 ml (0.190.21 ml) of the cell - seeded hydrogels the estimated number of bmc injected by ddaha + bmc treatment therefore was about 270,000. after 12 weeks in vivo, nucleotomy significantly decreased rom compared to intact discs in flexion + extension (p = 0.02) and lateral bending (p = 0.04 ; fig. significant decreased rom was also found for igg - ma + pep in flexion + extension (p = 0.03) and lateral bending (p = 0.02). rom for igg - ma and ddaha was significantly lower only in flexion + extension (p = 0.04 and 0.01, respectively). 2total ranges of motion (rom) and neutral zones (nz) in flexion + extension (flex / ex), lateral bending right + left (lat bend) and axial rotation left + right (ax rot) for intact discs of separate sheep (green background) and for the five test configurations investigated in the current study. p < 0.05 total ranges of motion (rom) and neutral zones (nz) in flexion + extension (flex / ex), lateral bending right + left (lat bend) and axial rotation left + right (ax rot) for intact discs of separate sheep (green background) and for the five test configurations investigated in the current study. p < 0.05 histological sections showed marked differences between the surgically affected and intact discs 12 weeks after surgery. tissue defects within the nucleus were similar in size in nucleotomy controls and hydrogel implanted discs. huge size cell clones were located in immediate vicinity of tissue defects inside the remaining nucleus pulposus tissue. marked neovascularisation did not occur in any of the operated discs and, therefore, differences between the hydrogel implanted discs and the nucleotomy controls were not found. there was no visible formation of spondylophytes or bony endplate changes up to 12 weeks.fig. 3representative mid - sagittal histological sections of operated discs 12 weeks after surgery in comparison to an intact disc representative mid - sagittal histological sections of operated discs 12 weeks after surgery in comparison to an intact disc intact discs revealed with a median degeneration score of 3.5 only negligible degenerative changes within the disc (fig. 4). the degeneration score of all implanted and nucleotomized discs significantly differed from intact discs (p = 0.0030.005). in contrast, there was no marked difference between the implanted discs and nucleotomy controls, neither after 6 nor 12 weeks. comparing the results after 6 to results after 12 weeks, there was an obvious (although not significant) increase in the degeneration scores of nucleotomy controls (17 %) and all acellular test configurations (1335 %). in ddaha 4degeneration scores of intact discs (dashed line) were significantly less than of nucleotomy controls and hydrogel implanted discs (p = 0.003 there was no difference between nucleotomy controls and the four different material configurations both after 6 (white) and 12 weeks (grey) degeneration scores of intact discs (dashed line) were significantly less than of nucleotomy controls and hydrogel implanted discs (p = 0.003 there was no difference between nucleotomy controls and the four different material configurations both after 6 (white) and 12 weeks (grey) dhi of intact discs were with 0.19 (0.160.25) significantly higher than all operated discs at both time intervals (fig. 5). after 6 weeks dhi of nucleotomy controls fell by 28 % compared to intact discs. dhi of hydrogel implanted discs decreased in a similar range (igg - ma : 33 %, igg - mapep : 30 %, ddaha : 27 % ; ddaha + bmc 35 %). from 6 to 12 weeks post - operatively there was a progressive decrease in dhi for acellular hydrogels (igg - ma : 9 %, igg - mapep : 8 %, ddaha : 9 %). dhi in ddaha + bmc, however, seemed to be preserved (+ 2 %) even if this effect was not significant. nucleotomy controls lost 11 % of dhi between 6 and 12 weeks.fig. 5disc height indices of intact discs (dashed line) significantly differed from nucleotomy controls and hydrogel implanted discs (p = 0.003 no difference between nucleotomy controls and the different material configurations was found both 6 (white) and 12 weeks (grey) post - operatively disc height indices of intact discs (dashed line) significantly differed from nucleotomy controls and hydrogel implanted discs (p = 0.003 no difference between nucleotomy controls and the different material configurations was found both 6 (white) and 12 weeks (grey) post - operatively the yields of bmc / ml bm and the frequency of msc evaluated by cfu - f assay varied considerably between the sheep. the mean sd of bmc / ml bm was 1.11 10 0.95 10. the cloning efficiency of bmc population varied between 0.00080.039 % cfu - f (mean 0.01 0.01 %). this resulted in the mean of 101 108 msc / hydrogel and varied between 8 and 390 msc / hydrogel. in average 0.20 ml (0.190.21 ml) of the cell - seeded hydrogels the estimated number of bmc injected by ddaha + bmc treatment therefore was about 270,000. after 12 weeks in vivo, nucleotomy significantly decreased rom compared to intact discs in flexion + extension (p = 0.02) and lateral bending (p = 0.04 ; fig. significant decreased rom was also found for igg - ma + pep in flexion + extension (p = 0.03) and lateral bending (p = 0.02). rom for igg - ma and ddaha was significantly lower only in flexion + extension (p = 0.04 and 0.01, respectively). 2total ranges of motion (rom) and neutral zones (nz) in flexion + extension (flex / ex), lateral bending right + left (lat bend) and axial rotation left + right (ax rot) for intact discs of separate sheep (green background) and for the five test configurations investigated in the current study. p < 0.05 total ranges of motion (rom) and neutral zones (nz) in flexion + extension (flex / ex), lateral bending right + left (lat bend) and axial rotation left + right (ax rot) for intact discs of separate sheep (green background) and for the five test configurations investigated in the current study. histological sections showed marked differences between the surgically affected and intact discs 12 weeks after surgery. tissue defects within the nucleus were similar in size in nucleotomy controls and hydrogel implanted discs. huge size cell clones were located in immediate vicinity of tissue defects inside the remaining nucleus pulposus tissue. marked neovascularisation did not occur in any of the operated discs and, therefore, differences between the hydrogel implanted discs and the nucleotomy controls were not found. there was no visible formation of spondylophytes or bony endplate changes up to 12 weeks.fig. 3representative mid - sagittal histological sections of operated discs 12 weeks after surgery in comparison to an intact disc representative mid - sagittal histological sections of operated discs 12 weeks after surgery in comparison to an intact disc intact discs revealed with a median degeneration score of 3.5 only negligible degenerative changes within the disc (fig. 4). the degeneration score of all implanted and nucleotomized discs significantly differed from intact discs (p = 0.0030.005). in contrast, there was no marked difference between the implanted discs and nucleotomy controls, neither after 6 nor 12 weeks. comparing the results after 6 to results after 12 weeks, there was an obvious (although not significant) increase in the degeneration scores of nucleotomy controls (17 %) and all acellular test configurations (1335 %). in ddaha + bmc degeneration scores were kept almost constant.fig. 4degeneration scores of intact discs (dashed line) were significantly less than of nucleotomy controls and hydrogel implanted discs (p = 0.003 there was no difference between nucleotomy controls and the four different material configurations both after 6 (white) and 12 weeks (grey) degeneration scores of intact discs (dashed line) were significantly less than of nucleotomy controls and hydrogel implanted discs (p = 0.003 there was no difference between nucleotomy controls and the four different material configurations both after 6 (white) and 12 weeks (grey) dhi of intact discs were with 0.19 (0.160.25) significantly higher than all operated discs at both time intervals (fig. 5). after 6 weeks dhi of nucleotomy controls fell by 28 % compared to intact discs. dhi of hydrogel implanted discs decreased in a similar range (igg - ma : 33 %, igg - mapep : 30 %, ddaha : 27 % ; ddaha + bmc 35 %). from 6 to 12 weeks post - operatively there was a progressive decrease in dhi for acellular hydrogels (igg - ma : 9 %, igg - mapep : 8 %, ddaha : 9 %). dhi in ddaha + bmc, however, seemed to be preserved (+ 2 %) even if this effect was not significant. nucleotomy controls lost 11 % of dhi between 6 and 12 weeks.fig. 5disc height indices of intact discs (dashed line) significantly differed from nucleotomy controls and hydrogel implanted discs (p = 0.003 no difference between nucleotomy controls and the different material configurations was found both 6 (white) and 12 weeks (grey) post - operatively disc height indices of intact discs (dashed line) significantly differed from nucleotomy controls and hydrogel implanted discs (p = 0.003 0.013). no difference between nucleotomy controls and the different material configurations was found both 6 (white) and 12 weeks (grey) post - operatively in this study using an ovine nucleotomy model, different configurations of newly developed hydrogels for nucleus replacements were investigated for their ability to restore rom and disc height and to slow down idd. results consistently showed that none of the tested hydrogel configurations proved to be superior to nucleotomy controls. however, against expectation, the operated discs showed a smaller rom than intact discs. histology of hydrogel implanted discs (acellular and cellular) showed more signs of degeneration as intact discs. there was a slight tendency that using bmc may eventually slow down idd between 6 and 12 weeks of implantation. the higher rom of intact compared to nucleotomized discs found in this in vivo study is in contrast to in vitro data in literature, where rom significantly increased after nucleotomy both for human and for calf specimen [14, 31 ]. the same tendency was also found for ovine specimen in preliminary in vitro investigations for the current study (unpublished data). the discrepancy may be explained by general differences between in vitro conditions without healing, and the in vivo situation where collagenous bridges at the outer annulus were described 12 weeks after injury. this initial bridging and the formation of scar tissue as well as the sealant method might be the reasons for the increased stiffness observed in this in vivo study. the evaluation of the disc height index clearly proved that up to 12 weeks restoration of disc height could not be achieved using different hydrogel configurations as nucleus replacements after nucleotomy. this finding strongly indicates that relevant amounts of hydrogels were probably pressed out of the disc. this challenging problem of implant extrusion may also explain the similar disappointing degeneration scores both for the nucleotomy controls as well as for the hydrogel implanted discs. partial removal of nucleus was required for implantation of hydrogels as pure injection of a relevant amount of substitute materials into the healthy ovine disc is impossible because no cavity is available and intradiscal pressure in vivo is high. opening the annulus sealants that reliably keep nucleus replacements inside the disc are urgently needed, but still not available. in previous in vitro studies, we have shown that the best of tested sealant options was cyanoacrylate glue combined with surgical suture. under axial compression, however, this sealant still allowed for gaping of the inner annulus defect with subsequent dislocation of implanted hydrogels and loss of intradiscal pressure in ovine motion segments. to enhance the sealant efficiency in the current study, the closed defect was additionally covered with a collagen sponge. artificial closure devices, proven to be effective to restore disc mechanics in vitro, unfortunately contradict to the main objective of disc regeneration and therefore were not used in the current study [33, 34 ]. this is in contrast to other animal experiments with rodents or pigs [35, 36 ]. these different findings may be explained by the persistence of notochordal progenitor cells within the discs of these animals. because in humans and likewise in sheep this cell type disappears, conclusions from the above mentioned species should be transferred to humans with caution [37, 38 ]. similar biology as well as similar anatomy and biomechanics suggest the sheep to be a more relevant model for humans [3942 ]. the potential positive effect of bmc as additive in hydrogels for disc regeneration should be interpreted carefully. only about 25 msc / disc (range 270) provided in approximately 270,000 bmc have been implanted. the optimal number of bone marrow derived msc to be implanted into the degenerated disc to achieve a stimulating effect was found to be 10 in dogs. however, msc yields in this order of magnitude are impossible to achieve without in vitro expansion. low cell density applied is assumed to be the reason for limited observed effects. in vitro expansion of bmc prior to surgery the nevertheless promising perspectives of cell - based approaches for disc regeneration are in accordance to literature [44, 45 ]. the bmc population used in the current study is a broad mixture of cell lineages in different differentiation stages containing multipotent mesenchymal and hemopoietic stem cells. paracrine effects may cause bmc to secrete growth factors, cytokines and chemokines capable of stimulating the regeneration of injured tissue [4749 ]. in case that the slight trend found in this study can be supported with future research, the perspective of applying non - cultivated bmc for disc regeneration in humans might be promising. using the patients own and unmodified cells might be an interesting solution which would probably lead to higher compliance of this new potential therapeutic option [5052 ]. this limitation is owed to the one - step surgical procedure using bmc without in vitro cultivation. the durations of the animal study with 6 and 12 weeks may eventually have been too short to represent the regenerative capacity of the different hydrogel configurations. the results of present study indicate that because of presumed hydrogel extrusion, none of the investigated hydrogels was able to slow down idd compared to nucleotomized discs. therefore, the development of effective annulus sealants is crucial for successful nucleus replacement using hydrogels. additional studies are recommended to substantiate the effects of non - cultivated cells for disc regeneration. the results of present study indicate that because of presumed hydrogel extrusion, none of the investigated hydrogels was able to slow down idd compared to nucleotomized discs. therefore, the development of effective annulus sealants is crucial for successful nucleus replacement using hydrogels. additional studies are recommended to substantiate the effects of non - cultivated cells for disc regeneration.	purpose regenerative strategies aim to restore the original biofunctionality of the intervertebral disc. different biomaterials are available, which might support disc regeneration. in the present study, the prospects of success of two hydrogels functionalized with anti - angiogenic peptides and seeded with bone marrow derived mononuclear cells (bmc), respectively, were investigated in an ovine nucleotomy model. methodsin a one - step procedure iliac crest aspirates were harvested and, subsequently, separated bmc were seeded on hydrogels and implanted into the ovine disc. for the cell - seeded approach a hyaluronic acid - based hydrogel was used. the anti - angiogenic potential of newly developed vegf - blockers was investigated on ionically crosslinked metacrylated gellan gum hydrogels. untreated discs served as nucleotomy controls. 24 adult merino sheep were used. after 6 weeks histological, after 12 weeks histological and biomechanical analyses were conducted.resultsbiomechanical tests revealed no differences between any of the implanted and nucleotomized discs. all implanted discs significantly degenerated compared to intact discs. in contrast, there was no marked difference between implanted and nucleotomized discs. in tendency, albeit not significant, degeneration score and disc height index deteriorated for all but not for the cell - seeded hydrogels from 6 to 12 weeks. cell - seeded hydrogels slightly decelerated degeneration.conclusionsnone of the hydrogel configurations was able to regenerate biofunctionality of the intervertebral disc. this might presumably be caused by hydrogel extrusion. great importance should be given to the development of annulus sealants, which effectively exploit the potential of (cell - seeded) hydrogels for biological disc regeneration and restoration of intervertebral disc functioning.
age - related macular degeneration (amd) is the leading cause of blindness for individuals aged 60 years or older. an estimated 11 million people in the united states suffer with amd, and this number is expected to increase to 22 million individuals by 2050 because of the projected demographic expansion of the aging population. current global direct health care costs associated with amd are estimated at $ 255 billion. there are two forms of amd, dry (atrophic) and wet (neovascular), with the more prevalent dry form accounting for nearly 90% of all diagnosed cases. intravitreal anti - vegf therapies have emerged as a standard of care to treat wet amd ; however, there is currently no fda - approved treatment available for the dry form. thus, safe and effective treatment of dry amd remains a critical unmet need. atrophic (dry) form of amd represents a slowly progressing neurodegenerative disorder of the eye in which specialized retinal neurons (rod and cone photoreceptors) degenerate in the central part of the retina called macula. histopathological and clinical data suggest that photoreceptor degeneration in dry amd is triggered by abnormalities in the retinal pigment epithelium (rpe) that lies beneath photoreceptors and provides critical metabolic support to these light - sensing neuronal cells. age - dependent accumulation of lipofuscin in the rpe is frequently cited as one of the causes that may potentially contribute to the demise of the rpe in the dry amd retina. moreover, excessive accumulation of lipofuscin in the retina seems to be the sole causative factor in autosomal recessive stargardt disease, an untreatable form of inherited macular dystrophy caused by genetic mutations in the abca4 gene. rpe lipofuscin is different from that of other aging tissues, as it contains various bisretinoid fluorophores such as pyridinium bisretinoid n - retinide - n - retinylidene ethanolamine (a2e). a2e, which is derived from a nonenzymatic condensation between phosphatidylethanolamine and two molecules of all - trans retinal, elicits a myriad of cytotoxic effects such as induction of apoptosis in cultured rpe cells, inhibition of the critical lysosomal transporter, loss of membrane integrity, inhibition of phagocytosis, disruption of mitochondrial function, activation of the complement cascade, and oxidative damage. given that lipofuscin bisretinoids represent the major cytotoxic component of rpe lipofuscin, it was hypothesized that pharmacological inhibition of bisretinoid formation in the retina may provide a means by which to delay the progression of geographic atrophy in dry amd and suppress degenerative processes in stargardt disease. indeed, there are several classes of pharmacological treatments inhibiting lipofuscin bisretinoid formation in the retina under investigation for the potential treatment of dry amd and stargardt s disease. our work focuses on reducing ocular uptake of serum all - trans retinol (retinol, vitamin a) (1, figure 1) via inhibition of retinol binding protein 4 (rbp4) as a means by which to reduce the concentration of bisretinoid precursors in the retina and inhibit bisretinoid formation. retinol is an essential nutrient that plays a critical role in a wide variety of biological functions, including fueling the visual cycle. it is transported to vitamin a dependent tissues as a tertiary complex with rbp4 and transthyretin (ttr). rbp4 is a lipocalin serum protein primarily secreted from the liver and to a lesser extent from kidney and adipose tissue. because of the relatively low molecular weight of rbp4 (21 kda), the rbp4-ttr interaction is critical for maintaining serum retinol in circulation as, without complexation with ttr, rbp4-retinol is rapidly cleared from the bloodstream through glomerular filtration. rbp4-ttr complexation is retinol dependent, as apo - rbp4 interacts poorly with ttr. the visual cycle depends on a constant delivery of retinol to the rpe by rbp4. it was suggested that rbp4 ligands antagonizing the retinol - dependent rbp4-ttr interaction in circulation would lead to a dramatic reduction in serum levels of rbp4 via renal elimination of the monomeric protein. as a consequence of this renal rbp4 elimination, serum retinol levels and delivery to the rpe would also be reduced, as would the rate of bisretinoid formation in the retina. this hypothesis has been preclinically and clinically confirmed with fenretinide (2), a synthetic retinoid - based rbp4 antagonist. fenretinide is known to prevent the binding of all - trans retinol to rbp4 and disrupt the retinol - dependent rbp4-ttr interaction in vitro, as well as lower circulating plasma rbp4 levels in vivo. in addition, fenretinide also significantly reduced accumulation of lipofuscin bisretinoids in the abca4 mouse model of enhanced retinal lipofuscinogenesis. supporting the therapeutic role of rbp4 in dry amd, in extended clinical studies, fenretinide was recently confirmed to reduce serum rbp4 in amd patients. post hoc analysis of the fenretinide clinical trial data suggests efficacy in reducing the rate of the geographic atrophy growth that was achieved in a subgroup of patients wherein an approximately 70% (or greater) reduction in serum rbp4 levels was realized. prior to their application to the treatment of dry amd and stargardt disease, rbp4 antagonists were previously being considered for the treatment of diabetes. a1120 (3), a lead molecule for this indication, was previously reported by a group at amgen as was its protein - bound crystal structure. this relatively low molecular weight compound features several key structural elements ; an o - trifluoromethyl arylpiperidine linked via a carbonyl to an unsubstituted anthranilic acid residue. in a study reported elsewhere, we have shown that chronic a1120 administration reduced accumulation of lipofuscin bisretinoids by approximately 50% in the abca4 mouse model. this activity correlated with a 75% reduction in serum rbp4 and 3050% reduction in certain visual cycle retinoids. however, despite these encouraging preclinical data, a1120 suffers from poor human liver microsomal (hlm) stability (3% remaining after 30 min incubation), thus posing a significant challenge for further development. therefore, our aim was to design a novel and potent nonretinoid rbp4 antagonist capable of lowering serum rbp4 levels in vivo with comparable or superior efficacy and improved druglike characteristics that include an improved hlm metabolic profile. retinol (1), fenretinide (2), and a1120 (3). the specific protein movements and molecular interactions that mediate agonist driven rbp4-ttr interaction versus holoenzyme and/or antagonist - bound rbp4-ttr disassociation are of great interest in the design of highly potent and selective rbp4 antagonists. it is for this reason that in our program we measured compound binding affinity to the non - ttr associated rbp4 protein (spa) as well as determined the rbp4-ttr antagonist potency (htrf). from evaluation of the reported a1120-bound protein crystal structure, we speculated that variation in both the linkage and relative orientation of the o - trifluoromethylphenyl and arylcarboxylic acid fragments might further enhance rbp4 antagonist potency as well as permit tuning of the desirable adme characteristics so as to potentially improve hlm stability (figure 2). using computer - assisted drug design based around several rbp4 protein crystal structures, we designed, computationally evaluated, and synthesized illustrative examples of conformationally constrained carboxylic acid based non - retinoid antagonists. in addition, within the context of the original a1120 structural scaffold, we further explored the rbp4 antagonist activity of several acylsulfonamide carboxylic acid isosteres and arylcarboxylic acid replacements. lastly, acknowledging earlier patent disclosures of conformationally flexible rbp4 antagonists, we also included in our test set several aliphatic analogues bearing an ether - linked ortho - substituted aryl headgroup and terminal urea - linked carboxylic acid. medicinal chemistry work plan for the identification of novel, nonretinoid rbp4 antagonists. by employment of the route reported by swanson and co - workers (scheme 1), the synthesis of a1120 (3) and piperidine core intermediate 7 began with lithium halogen exchange of 1-bromo-2-(trifluoromethyl)benzene (4) followed by 1,2-carbonyl addition of the lithium salt to 1-benzylpiperidin-4-one to give tertiary alcohol 5. thionyl chloride induced dehydration of 5 to the intermediary tetrahydropyridine 6 followed by reduction of the olefin with concomitant n - benzyl deprotection using ammonium formate and 10% pd / c to afford 7 upon conversion to the hydrochloride salt. treatment of 7 with methyl 2-isocyanatobenzoate followed by saponification of the methyl ester provided a1120 (3) in good yield. our initial strategy to generate acylsulfonamide acid isosteres of 3 involved hatu - mediated activation of the carboxylic acid to be followed by acylation with various desired sulfonamides. however, we discovered that treatment of 3 with hatu in the absence of nucleophile yielded acyl -lactam 8, which was isolated via column chromatography. acyl -lactam 8 ultimately provided a convenient intermediate for the assembly of our desired acylsulfonamides 911, as it readily underwent ring - opening to the desired analogues upon treatment with preformed sulfonamide sodium salts. highlighted in scheme 2 are the synthetic routes used to access analogues bearing aliphatic carboxylic acid residues. piperidine hydrochloride 7 provided a key intermediate for the synthesis of several analogues designed to replace the acylanthranilic acid of 3 with diverse moieties potentially capable of engaging in similar rbp4 binding interactions. oxoacids 1214 were readily manufactured via acylation of 7 with the corresponding carboxylic acid ester, acid chloride, or anhydride followed by saponification of the pendent ester (if required) to give the desired compound. a racemic mixture of proline - based analogue ()-15 was generated by reaction of methyl 1-(chlorocarbonyl)pyrrolidine-2-carboxylate with 7 followed by hydrolysis of the ester to the desired acid. the synthesis of acyclic phenoxyethylamido ether analogues 20, 21, 25, and 27 is depicted in scheme 3. sn2 displacement of bromide 17 with an appropriately substituted phenol followed by tbs deprotection gave hydroxyl aryl ethers 18. treatment of intermediate 19 with methyl 2-isocyanatobenzoate followed by saponification of the methyl ester gave the desired carboxylic acid analogues 20 and 21. the syntheses of analogues 25 and 27 began with boc protection of 2-chloroethanamine 22 to give carbamate 23, which was converted to aryl ether 24 via sn2 displacement with 2-(tert - butyl)phenol. intermediate 24 was converted to analogue 25 via treatment with methyl 2-isocyanatobenzoate followed by hydrolysis of the methyl ester to the desired carboxylic acid. intermediary carbamate 23 was also used in a similar fashion to generate the 4-fluorophenyl substituted analogue 27. similar to the synthesis of a1120, the manufacture of these compounds involved treatment of a core secondary amine with methyl 2-isocyanatobenzoate followed by saponification of the resulting ester to give the desired acids. the synthesis of 3.1.0 bicyclic systems 29 and 30 followed a procedure reported by mchardy and co - workers. lastly, the aryloxy azetidine core used in the synthesis of analogue 33 followed a synthetic route outlined by pettersson and co - workers. the synthesis of azepine 28, azetidine 32, and a racemic mixture of spiroindane ()-34 began with the commercially available secondary amine cores. construction of the bicyclic { 3.3.0}-octahydrocyclopenta[c]pyrrolo analogues 43, ()-45, and 48 was achieved following routes previously reported by dart, lauffer, and guillemont (scheme 5). the synthesis began with a lialh4 reduction of commercially available dione 35 followed by n - boc protection of the resulting secondary amine to give isoindole 36 in good yield. naio4 and ruo2h2o facilitated oxidative cleavage of 36 gave ring - opened diacid 37 in good yield. subsequent dieckman condensation with concomitant decarboxylation of 37 in acetic anhydride at 120 c yielded ketone 38 in 55% yield. deprotonation of 38 with lihmds followed by treatment with 1,1,1-trifluoro - n - phenyl - n-((trifluoromethyl)sulfonyl)methanesulfonamide provided desired triflate 39, which underwent smooth conversion to alkene ()-40 in the presence of (2-(trifluoromethyl)phenyl)boronic acid under standard suzuki pd - catalyzed cross - coupling conditions. reduction of alkene ()-40 via 50 psi of h2 in the presence of 10% pd / c in ch3oh provided exclusively endo - product 41. boc deprotection of 41 followed by reaction with methyl 2-isocyanatobenzoate and subsequent saponification of the methyl ester afforded desired carboxylic acid analogue 43. the core geometry of endo - isomer 43 was confirmed via a h nmr noesy experiment, which exhibited a positive noe enhancement between the benzylic and bridging methine hydrogens. generation of exo - product 48 could only be achieved via reduction of des - boc olefin ()-44, which provided a mixture of endo- and exo - isomers 46 (free - base of 42) and 47, with endo-46 being the major isomer by hplc (10:1 endo / exo). this result was consistent with the observation reported by dart and co - workers and could be attributed to reduction readily occurring at the more accessible convex face of the olefin ()-44. the greater degree of selectivity observed for the reduction of n - boc protected intermediate ()-40 to yield exclusively endo - isomer 41 could be due to further hindrance of hydrogen delivery to the convex face of the olefin by the bulky boc group. the core geometry of exo - isomer 48 was also confirmed via a h nmr noesy experiment, which did not exhibit an noe enhancement between the benzylic and bridging methine hydrogens. related analogues of 43 were accessed via carbamoyl chloride intermediate 49, which was generated via treatment of amine hydrochloride salt 42 with triphosgene in the presence of pyridine (scheme 6). intermediate 49 was reacted with various methyl 2-amino-5-substituted benzoates, which were subsequently hydrolyzed to the desired carboxylic acid analogues 5053. carbamoyl chloride 49 could also be treated with heteroanthranilic esters to provide the pyridyl and pyridazinyl bicyclic { 3.3.0}-octahydrocyclopenta[c]pyrrolo analogues 5457 depicted in scheme 7. pyridine analogue 54 required an alternative route, which involved a pd - catalyzed amidation of the primary urea of 49 with 2-chloronicotinate. the amino acid derived analogues shown in scheme 8 were also furnished from key carbamoyl chloride intermediate 49 via treatment with the specified amino acid methyl esters followed by hydrolysis to give the desired carboxylic acids. drawing from the breadth of reported rbp4 x - ray crystallographic data available, we sought to gain better insight into key rbp4 binding interactions and conformational changes for both agonist and antagonist binding states, which would serve to evaluate our nonretinoid antagonist design proposals. with this goal in mind, we analyzed binding differences observed in the reported protein data bank (pdb) high - resolution x - ray crystal structures 1rbp (rbp4 cocrystallized with retinol),3bsz (the rbp4-ttr complex cocrystallized with retinol),1fel (rbp4 cocrystallized with fenretinide), and 3fmz (rbp4 cocrystallized with a1120). retinol binds within an internal cavity of rbp4 whereby the polyene chain is encapsulated within a -barrel core, the -ionone ring projects into a deep interior hydrophobic pocket, and the terminal hydroxyl group protrudes out of the entrance of the binding cavity toward solvent (figure 3a). the rbp4 loops 34 (residues 6368) and 56 (residues 9299) surround the opening of the binding cavity and present an interaction surface for ttr engagement. retinol binding to rbp4 induces conformational changes within these loops that facilitate complexation with ttr. the rbp4-ttr complex is further stabilized via an h - bond interaction between the hydroxyl group of retinol and gly83 of ttr subunit b. fenretinide also binds within the rbp4 cavity in a similar fashion to retinol ; however, it induces a conformational change within rbp4 loop 34 that is unfavorable for rbp4-ttr engagement (figure 3a). in addition, the fenretinide 4-hydroxyphenylamide is also believed to further disrupt rbp4-ttr complexation by projecting into the rbp4-ttr interaction interface where it presents steric clashes with ttr subunits. a1120 induces significant conformational changes in both rbp4 loops 34 and 56 that are not conducive for complexation with ttr (figure 3b). the nonretinoid antagonist binds within the -barrel cavity with the o - trifluoromethylphenyl ring projecting into the hydrophobic -ionone pocket and the anthranilic carboxylic acid fragment positioned at the opening where it engages in several key binding interactions ; the a1120 carboxamidocarbonyl oxygen atom accepts an h - bond from the backbone of leu37, and the carboxylic acid forms a salt bridge with arg121 and two h - bonds with tyr90 and gln98 (figure 4a). in addition, a edge - to - face interaction is observed between the anthranilic carboxylic acid phenyl ring of a1120 and the phenyl ring of phe96. of these key binding interactions, it appears that the a1120-gln98 h - bond and the phe96 edge - to - face interaction are potentially playing critical roles in inducing and stabilizing the conformational changes observed within loop 56 (figures 4b). relative rbp4 loop 34 and 56 conformational changes for agonist and antagonist binding. (a) comparison of the loop 34 and 56 conformations for retinol and fenretinide binding to rbp4 : overlay of protein crystal structures 1rbp (white), 3bsz (green), and 1fel (cyan). fenretinide is shown as magenta, and retinol is shown as yellow (from 1rbp) and orange (from 3bsz). (b) comparison of the loop 34 and 56 conformations for retinol and a1120 binding to rbp4 : overlay of protein crystal structures 3bsz (green) and 3fmz (red). retinol is shown as orange, and a1120 is shown as magenta. with these crystallographic data in hand, our medicinal chemistry goals were to design novel, nonretinoid antagonists that would engage in the key aforementioned binding interactions and induce conformational changes in both loops 34 and 56, thereby leading to disruption of rbp4-ttr complexation. proposed ligands were initially docked within 3fmz using standard precision (sp) mode, and the docking poses were subsequently refined using the extra precision (xp) mode of glide (version 5.8, schrdinger, llc.). we aligned the glide xp refined docking poses of all proposals to the cocrystallized conformation of a1120 and performed molecular mechanics (mm) minimization on these ligands in 3fmz using impact (version 5.8, schrdinger, llc.). these minimized poses and corresponding glide scores generated were reported as the final docking poses and glide scores (glide scores and solvation energies for each analogue are provided in the supporting information). although glide scores provided some guidance for the triaging of compounds yet to be synthesized, these crude estimates were generally limited with regard to consistently predicting relative levels of rbp4 binding affinity. we found that these scores were useful in prospectively estimating whether a compound would show affinity at rbp4 with potency (ic50) less than 1 m in the spa assay. however, detailed sar analysis showed that, as expected, the scores exhibited a poor correlation with the actual rbp4 spa assay ic50 results observed. in addition, glide would occasionally provide inconsistent binding modes for some closely structurally related analogues of a1120 (e.g., altered h - bond interactions with either leu37 or tyr90). therefore, focus shifted away from glide scores and more to the geometric docking of proposed ligands when using the model to triage novel analogue designs prior to synthesis. in this work, our retrospective computational analysis of the rbp4 spa assay sar observed for our novel analogues placed emphasis on correlations between the orientation and positioning of our ligands within the rbp4 binding cavity relative to a1120 (geometric docking poses generated) rather than on numeric agreement with the obtained glide scores. (a) overlay of protein crystal structures 3bsz (orange) and 3fmz (white). a1120 binding interactions with arg121, tyr90, leu37, and phe96 are highlighted. (b) comparison of rbp4 loop 56 conformational changes between fenretinide (1fel, yellow, white, and blue) and a1120 (3fmz, red) binding. analogue binding affinities for rbp4 were measured using our previously described scintillation proximity assay (spa). nonlinear regression analysis conducted following saturation binding of retinol to rbp4 revealed a kd of 62.5 nm in our assay conditions which is in line with the previously reported 70190 nm range of values. for compound characterization we measured the competitive displacement of radiolabeled retinol added to the reaction mix at 10 nm which roughly corresponds to the generally recommended /10 of the kd concentration of radioligand. the ic50 values were calculated from the 12-point compound titrations using a four - parameter logistic equation. compounds with appreciable rbp4 binding potency (generally, with ic50 3 m). in an attempt to reconcile the discrepancies between the docking experiments and the spa binding affinities observed for these two geometric isomers, free energy differences associated with minimized bound (docked pose) and unbound ligand conformations were calculated using macromodel (version 9.9, schrdinger, llc.) for both compounds. indeed, it was determined that the exo - isomer 48 adopts a more strained bound geometry relative to endo - isomer 43 (2 kcal / mol greater energy, data not shown) in order to optimize binding interactions with rbp4. while these calculations ignore many other possible effects, they offer a possible explanation for the higher rbp4 binding affinity observed for endo - isomer 43. overlay of minimized bound conformations of endo - isomer 43 (cyan), exo - isomer 48 (orange), and a1120 (magenta) within 3fmz. contacting residues are labeled and illustrated in stick format. in vitro pharmacological evaluation of 43 revealed a desirable profile that included no significant off - target activity at the herg channel or within a standard screening panel of 55 gpcrs, enzymes, ion channels, and transporters. in addition, 43 exhibited good solubility and metabolic stability, including significantly improved hlm stability (table 4). the compound did, however, present submicromolar inhibitory activity for cyp2c9 (ic50 = 340 nm). thus, a limited set of follow - up analogues was generated in an attempt to diminish cyp2c9 activity and further improve rbp4 potency. we initially explored the sar impact of an electron withdrawing or donating group substituted para to the urea on the arylcarboxylic acid phenyl ring (5053). fluorinated analogue 50 presented spa potency levels comparable to 43 (spa ic50 = 88.8 nm and htrf ic50 = 0.285 m) with moderate hlm stability ; however, cyp2c9 activity did not improve (ic50 = 333 nm). similarly, chlorinated analogue 52 also exhibited undesirable potency at cyp2c9 (ic50 = 548 nm) with a concomitant 4-fold diminishment in rbp4 spa potency relative to 43 (spa ic50 = 328.8 nm and htrf ic50 = 0.340 m). substitution with either methoxy (51) or methylsulfonyl (53) did lead to diminished cyp2c9 activity (ic50 of 13 and 8.7 m, respectively) ; however, the compounds were also significantly less potent for rbp4. interestingly, replacing the arylcarboxylic acid phenyl ring of 43 with either a pyridine or pyridazine moiety had a dramatic impact on rbp4 binding affinity for the series. it was initially found that the position of the pyridine nitrogen was critical for rbp4 activity, as the 2-aminopyridyl analogue 54 was essentially devoid of activity while the 4-aminopyridyl analogue 55 exhibited rbp4 potency comparable to a1120 (spa ic50 = 18.7 nm and htrf ic50 = 0.179 m). unfortunately, pyridine 55 was found to be a potent cyp3a4 inhibitor (ic50 85%) of serum rbp4 levels in both acute and chronic rodent oral dosing studies. additional work within the bicyclic { 3.3.0}-octahydrocyclopenta[c]pyrrolo series led to the discovery of pyridazine 57, which exhibited potent in vitro rbp4 antagonist activity (spa ic50 = 24 nm and htrf ic50 = 121 nm), favorable adme profiles, and improved activity at cyp2c9 (ic50 = 17 m). encouraged by these results, we have continued to focus our efforts within the bicyclic { 3.3.0}-octahydrocyclopenta[c]pyrrolo series. additional refinements have led to rbp4 antagonists possessing exquisite in vitro potency, robust in vivo serum rbp4 lowering capability, and efficacy in the abca4 mouse model. all reactions were performed under a dry atmosphere of nitrogen unless otherwise specified. indicated reaction temperatures refer to the reaction bath, while room temperature (rt) commercial grade reagents and anhydrous solvents were used as received from vendors, and no attempts were made to purify or dry these components further. 3-(2-(trifluoromethyl)phenyl)azetidine hydrochloride was purchased from small molecules [cas number 1203684 - 79 - 0 ]. 2,3,4,5-tetrahydro-1h - benzo[d]azepine was purchased from acros [cas number 4424 - 20 - 8 ]. tert - butyl 2,6-diazaspiro[3.3]heptane-2-carboxylate hemioxalate was purchased from alfa [cas number 1041026 - 71 - 4 ]. 2,3-dihydrospiro[indene-1,4-piperidine ] hydrochloride was purchased from matrix scientific [cas number 96651 - 85 - 3 ]. removal of solvents under reduced pressure was accomplished with a buchi rotary evaporator at approximately 28 mmhg pressure using a teflon - linked knf vacuum pump. visualization of tlc plates was made by observation with short wave uv light (254 nm lamp), 10% phosphomolybdic acid in ethanol or in iodine vapors. preparative thin layer chromatography was performed using analtech, 20 cm 20 cm, 1000 m preparative tlc plates. flash column chromatography was carried out using a teledyne isco combiflash companion unit with redisep rf silica gel columns. if needed, products were purified by reverse phase chromatography, using a teledyne isco combiflash companion unit with redisep gold c18 reverse phase column. proton nmr spectra were obtained on either a 300 mhz bruker nuclear magnetic resonance spectrometer or a 500 mhz bruker nuclear magnetic resonance spectrometer. chemical shifts () are reported in parts per million (ppm), and coupling constant (j) values are given in hz, with the following spectral pattern designations : s, singlet ; d, doublet ; t, triplet ; q, quartet ; dd, doublet of doublets ; m, multiplet ; br, broad. melting points are uncorrected and were obtained using a mel - temp electrothermal melting point apparatus. mass spectroscopic analyses were performed using positive mode electron spray ionization (esi) on a varian prostar lc high pressure liquid chromatography (hplc) purity analysis was performed using a varian prostar hplc system with a binary solvent system a and b using a gradient elusion [a, h2o with 0.05% trifluoroacetic acid (tfa) ; b, ch3cn with 0.05% tfa ] and flow rate of 1 ml / min, with uv detection at 223 nm. all final compounds were purified to 95% purity by the varian prostar hplc system using the following methods : (a) phenomenex c18(2) column (3.0 mm 250 mm) ; mobile phase, a = h2o with 0.05% tfa and b = ch3cn with 0.05% tfa ; gradient, 090% b (0.020.0 min) ; (b) pursuit xrs c18 column (4.6 mm 250 mm) ; mobile phase, a = h2o with 0.05% tfa and b = ch3cn with 0.05% tfa ; gradient, 090% b (0.015.0 min) ; (c) sunfire c18 5 m (4.6 mm 250 mm), mobile phase, a = h2o with 0.05% tfa and b = ch3cn with 0.05% tfa ; gradient, 0100% b (0.020.0 min). step a. to a solution of 1-bromo-2-(trifluoromethyl)benzene (4, 35.0 g, 156 mmol) in thf (350 ml) cooled to 78 c was slowly added a solution of n - buli (70.4 ml, 2.5 m in thf, 176 mmol) over a period of 15 min. the mixture was stirred at 78 c for 40 min, was allowed to warm to 0 c and then cooled back to 78 c. to this was added a solution of 1-benzylpiperidin-4-one (22.1 g, 117 mmol) in thf (80 ml) over a period of 10 min. the resulting mixture continued to stir at 78 c for 2 h. the reaction was carefully quenched with aqueous, saturated nh4cl solution (500 ml), and the mixture was extracted with etoac (300 ml). the organic extract was washed with h2o, brine, dried over na2so4, filtered, and concentrated under reduced pressure. the resulting residue was chromatographed over silica gel (isco combiflash companion unit, 330 g redisep column, 030% etoac in hexanes) to give 1-benzyl-4-(2-(trifluoromethyl)phenyl)piperidin-4-ol (5) as a light - yellow oil (29.2 g, 74%) : h nmr (500 mhz, cdcl3) 7.78 (d, j = 1.6 hz, 1h), 7.59 (m, 1h), 7.47 (m, 1h), 7.36 (m, 5h), 7.31 (m, 2h), 3.58 (s, 2h), 2.80 (m, 2h), 2.55 (m, 2h), 2.27 (m, 2h), 1.88 (m, 2h) ; esi ms m / z 336 [m + h ]. step b. a 0 c cooled solution of 1-benzyl-4-(2-(trifluoromethyl)phenyl)piperidin-4-ol (5, 29.2 g, 87.1 mmol) in thionyl chloride (60 ml) stirred for 2 h and was then diluted with ch2cl2 (250 ml). the mixture was carefully poured into a solution of aqueous, saturated nahco3 solution (200 ml). the biphasic mixture was separated, and the aqueous layer was further extracted with ch2cl2 (400 ml). the combined organic layers were washed with brine, dried over na2so4, filtered, and concentrated. the resulting residue was chromatographed over silica gel (isco combiflash companion unit, 330 g redisep column, 030% etoac in hexanes) to give 1-benzyl-4-(2-(trifluoromethyl)phenyl)-1,2,3,6-tetrahydropyridine (6) as a light - yellow oil (13.5 g, 49%) : h nmr (500 mhz, cdcl3) 7.63 (d, j = 1.6 hz, 1h), 7.48 (m, 1h), 7.39 (m, 5h), 7.28 (m, 2h), 5.56 (s, 1h), 0.68 (s, 2h), 3.14 (m, 2h), 2.70 (m, 2h), 2.39 (m, 2h) ; esi ms m / z 318 [m + h ]. step c. a mixture of 1-benzyl-4-(2-(trifluoromethyl)phenyl)-1,2,3,6-tetrahydropyridine (6, 13.6 g, 42.5 mmol), 10% pd / c (3.0 g), and ammonium formate (26.8 g, 425 mmol) in ch3oh (800 ml) was heated at reflux for 2 h. the mixture cooled to rt and was filtered over celite. the filtrate was concentrated and the resulting residue was chromatographed over silica gel (isco combiflash companion unit, 330 g redisep column, 010% ch3oh with 1% nh4oh in ch2cl2) to give 4-(2-(trifluoromethyl)phenyl)piperidine as a colorless oil (2.0 g, 21%) : h nmr (500 mhz, cdcl3) 7.61 (d, j = 1.7 hz, 1h), 7.52 (m, 2h), 7.29 (m, 1h), 3.21 (m, 2h), 3.07 (m, 1h), 2.80 (m, 2h), 2.33 (bs, 1h), 1.77 (m, 4h) ; esi ms m / z 230 [m + h ]. to a solution of 4-(2-(trifluoromethyl)phenyl)piperidine (5.6 g, 24.5 mmol) in ch3cn (30 ml) was added a 4 m solution of hcl in 1,4-dioxane (6.1 ml, 24.5 mmol) at rt. the mixture stirred for 2 h and was then concentrated under reduced pressure to give 4-(2-(trifluoromethyl)phenyl)piperidine hydrochloride (7) as a white solid (6.4 g, > 99%) : esi ms m / z 230 [m + h ]. step d. a mixture of 4-(2-(trifluoromethyl)phenyl)piperidine hydrochloride (7, 7.89 g, 29.7 mmol) and methyl 2-isocyanatobenzoate (5.27 g, 29.7 mmol) in ch2cl2 (50 ml) was stirred for 2 h and then chromatographed over silica gel (025% etoac in hexanes) to give methyl 2-(4-(2-(trifluoromethyl)phenyl)piperidine-1-carboxamido)benzoate as a white solid (8.27 g, 77%). to a solution of 2-(4-(2-(trifluoromethyl)phenyl)piperidine-1-carboxamido)benzoate (8.0 g, 19.6 mmol) in ch3oh (50 ml) and thf (50 ml) was added naoh (2 n, 20 ml). the mixture was stirred at rt for 2 h, was diluted with h2o (100 ml), and then was acidified to ph 6 with 2 n hcl. the mixture was extracted with ch2cl2 (3 150 ml), and the organic extracts were dried over na2so4, filtered, and concentrated. the residue was chromatographed over silica gel (05% ch3oh in ch2cl2) to give 2-(4-(2-(trifluoromethyl)phenyl)piperidine-1-carboxamido)benzoic acid (a1120) (3) as a white solid (7.3 g, 95%). mp 156158 c ; h nmr (300 mhz, cdcl3) 10.68 (s, 1h), 8.59 (d, j = 8.6 hz, 1h), 8.05 (dd, j = 8.1, 1.6 hz, 1h), 7.587.53 (m, 1h), 7.37 (dd, j = 7.4, 1.6 hz, 1h), 7.257.12 (m, 3h), 7.026.96 (m, 1h), 4.40 (m, 2h), 3.503.40 (m, 1h), 3.062.97 (m, 2h), 1.901.80 (m, 4h) ; esi ms m / z 393 [m + h ] ; hplc 98.5% purity (auc), tr = 12.5 min (method a). step e. to a solution of 2-(4-(2-(trifluoromethyl)phenyl)piperidine-1-carboxamido)benzoic acid (3, 0.711 g, 1.81 mmol) and i - pr2net (1.41 ml, 8.15 mmol) in dmf (12.7 ml) was added hatu (1.03 g, 2.72 mmol). the mixture stirred at rt for 1.5 h and was then diluted with aqueous saturated nh4cl (40 ml). the aqueous mixture was extracted with ch2cl2 (4 30 ml), and the combined organic extracts were concentrated under reduced pressure. the resulting residue was chromatographed over silica gel (isco combiflash companion unit, 40 g redisep column, 025% etoac in hexanes) to give 7-(4-(2-(trifluoromethyl)phenyl)piperidine-1-carbonyl)-7-azabicyclo[4.2.0]octa-1(6),2,4-trien-8-one (8) as a white solid (0.565 g, 83%) : mp 127130 c ; h nmr (500 mhz, dmso - d6) 7.91 (d, j = 7.0 hz, 1h), 7.737.65 (m, 3h), 7.647.59 (m, 1h), 7.487.38 (m, 1h), 7.23 (d, j = 8.5 hz, 1h), 7.217.17 (m, 1h), 4.534.44 (m, 2h), 3.193.07 (m, 3h), 1.921.80 (m, 2h), 1.791.73 (m, 2h) ; esi ms m / z 375 [m + h ]. step f. to a 0 c solution of methanesulfonamide (0.057 g, 0.60 mmol) in thf (1.0 ml) was added nah (60% in mineral oil, 0.024 g, 0.60 mmol), and the resulting solution was stirred at 0 c for 5 min and for an additional 15 min at rt. a solution of 8 (0.150 g, 0.40 mmol) in thf (2.0 ml) was added, and the resulting solution was stirred at rt for 72 h. the reaction was quenched with h2o and acidified to ph 4 with 2 n hcl. the resulting precipitate was collected by filtration and washed with h2o (40 ml) and hexanes (40 ml). the obtained solids were chromatographed over silica gel (isco combiflash companion unit, 40 g redisep column, 05% ch3oh in ch2cl2 with 0.05% hoac) to provide n-(2-((methylsulfonyl)carbamoyl)phenyl)-4-(2-(trifluoromethyl)phenyl)piperidine-1-carboxamide (9) as a white solid (0.035 g, 18%) : mp 220285 c ; h nmr (500 mhz, dmso - d6) 12.03 (br s, 1h), 9.76 (s, 1h), 7.83 (d, j = 7.5 hz, 1h), 7.707.60 (m, 4h), 7.517.46 (m, 1h), 7.447.39 (m, 1h), 7.097.04 (m, 1h), 4.23 (d, j = 13.0 hz, 2h), 3.32 (s, 3h), 3.123.04 (m, 1h), 2.96 (t, j = 11.5 hz, 2h), 1.831.68 (m, 4h) ; esi ms m / z 468 [m + h ] ; hplc > 99% purity (auc), tr = 14.4 min (method c). compound 10 was prepared according to a similar procedure described for the synthesis of 9. mp 195208 c ; h nmr (500 mhz, dmso - d6) 12.04 (br s, 1h), 9.96 (br s, 1h), 7.98 (d, j = 8.5 hz, 1h), 7.737.66 (m, 3h), 7.657.60 (m, 1h), 7.547.48 (m, 1h), 7.447.39 (m, 1h), 7.097.04 (m, 1h), 4.21 (d, j = 13.0 hz, 2h), 3.143.03 (m, 2h), 2.98 (t, j = 12.0 hz, 2h), 1.841.68 (m, 4h), 1.191.04 (m, 4h) ; esi ms m / z 494 [m + h ] ; hplc > 99% purity (auc), tr = 11.4 min (method a). compound 11 was prepared according to a similar procedure described for the synthesis of 9. mp 136141 c ; h nmr (500 mhz, dmso - d6) 7.997.90 (m, 3h), 7.727.63 (m, 3h), 7.627.58 (m, 1h), 7.567.49 (m, 3h), 7.487.41 (m, 2h), 7.066.99 (m, 1h), 4.154.05 (m, 2h), 3.082.98 (m, 1h), 2.902.81 (m, 2h), 1.671.55 (m, 4h) ; esi ms m / z 530 [m + h ] ; hplc > 99% purity (auc), tr = 17.8 min (method c). step a. to a solution of 4-(2-(trifluoromethyl)phenyl)piperidine hydrochloride (7, 0.140 g, 0.612 mmol) and et3n (0.171 ml, 1.22 mmol) in ch2cl2 (4 ml) was added ethyl 2-chloro-2-oxoacetate (0.100 g, 0.73 mmol) at 0 c. the mixture stirred at rt for 16 h and was concentrated under reduced pressure. the residue was chromatographed over silica gel (025% etoac in hexanes) to give ethyl 2-oxo-2-(4-(2-(trifluoromethyl)phenyl)piperidin-1-yl)acetate as a thick oil (0.190 g, 94%) : h nmr (300 mhz, cdcl3) 7.64 (d, j = 7.9 hz, 1h), 7.54 (t, j = 7.6 hz, 1h), 7.42 (d, j = 7.8 hz, 1h), 7.33 (t, j = 7.7 hz, 1h), 4.724.67 (m, 1h), 4.37 (q, j = 7.2 hz, 2h), 3.833.77 (m, 1h), 3.293.18 (m, 2h), 2.842.75 (m, 1h), 1.921.67 (m, 4h), 1.39 (t, j = 7.1 hz, 3h) ; esi ms m / z 330 [m + h ]. step b. to a solution of ethyl 2-oxo-2-(4-(2-(trifluoromethyl)phenyl)piperidin-1-yl)acetate (0.190 g, 0.57 mmol) in ch3oh (2 ml) and thf (2 ml) was added naoh (2 n, 2 ml). the mixture was stirred for 16 h, was diluted with h2o (25 ml), and was acidified to ph 4 with 2 n hcl. the mixture was extracted with ch2cl2 (30 ml), and the organic extracts were dried over na2so4, filtered, and concentrated. the residue was chromatographed over silica gel (015% ch3oh in ch2cl2) to give 2-oxo-2-(4-(2-(trifluoromethyl)phenyl)piperidin-1-yl)acetic acid (12) as a white solid (0.035 g, 20%) : mp 193196 c ; h nmr (500 mhz, dmso - d6) 7.697.55 (m, 3h), 7.42 (d, j = 7.6 hz, 1h), 4.43 (m, 1h), 3.96 (m, 1h), 3.07 (br s, 2h), 2.64 (br s, 1h), 1.691.55 (m, 4h) ; esi ms m / z 300 [m h ] ; hplc > 99% purity (auc), tr = 15.7 min (method c). step a. to a solution of 4-(2-(trifluoromethyl)phenyl)piperidine hydrochloride (7, 0.130 g, 0.56 mmol) and et3n (0.157 ml, 1.13 mmol) in ch2cl2 (10 ml) was added methyl 3-chloro-3-oxopropanoate (0.077 g, 0.567 mmol) at 0 c. the mixture stirred at rt for 16 h and was concentrated under reduced pressure. the residue was chromatographed over silica gel (040% etoac in hexanes) to give methyl 3-oxo-3-(4-(2-(trifluoromethyl)phenyl)piperidin-1-yl)propanoate (0.134 g, 71%) : h nmr (500 mhz, cdcl3) 7.63 (d, j = 7.9 hz, 1h), 7.53 (t, j = 7.5 hz, 1h), 7.40 (d, j = 7.8 hz, 1h), 7.32 (t, j = 7.7 hz, 1h), 4.854.78 (m, 1h), 3.903.84 (m, 1h), 3.78 (s, 3h), 3.603.49 (m, 2h), 3.283.14 (m, 2h), 2.752.65 (m, 1h), 1.891.64 (m, 4h) ; esi ms m / z 330 step b. to a solution of methyl 3-oxo-3-(4-(2-(trifluoromethyl)phenyl)piperidin-1-yl)propanoate (0.134 g, 0.40 mmol) in ch3oh (2 ml) and thf (2 ml) was added naoh (2 n, 2 ml). the mixture was stirred for 16 h, diluted with h2o (25 ml), and acidified to ph 4 with 2 n hcl. the mixture was extracted with ch2cl2 (30 ml), and the organic extracts were dried over na2so4 and concentrated to give 3-oxo-3-(4-(2-(trifluoromethyl)phenyl)piperidin-1-yl)propanoic acid (13) as a white solid (0.100 g, 78%) : mp 112114 c ; h nmr (500 mhz, cdcl3) 14.24 (br s, 1h), 7.66 (d, j = 7.8 hz, 1h), 7.54 (t, j = 7.6 hz, 1h), 7.387.32 (m, 2h), 4.84 (m, 1h), 3.93 (m, 1h), 3.42 (m, 2h), 3.273.21 (m, 2h), 2.832.77 (m, 1h), 1.991.93 (m, 2h), 1.761.66 (m, 2h) ; esi ms m / z 314 [m h ] ; hplc > 99% purity (auc), tr = 15.5 min (method c). a mixture of 4-(2-(trifluoromethyl)phenyl)piperidine hydrochloride (7, 0.100 g, 0.43 mmol) and dihydrofuran-2,5-dione (0.048 g, 0.48 mmol) in ch2cl2 (8 ml) was heated at reflux for 4 h and then cooled to rt and concentrated under reduced pressure. the resulting residue was chromatographed over silica gel (030% etoac in hexanes) to give 4-oxo-4-(4-(2-(trifluoromethyl)phenyl)piperidin-1-yl)butanoic acid (14) as a white solid (0.134 g, 93%) : mp 138140 c ; h nmr (500 mhz, cdcl3) 7.64 (d, j = 7.8 hz, 1h), 7.52 (t, j = 7.6 hz, 1h), 7.39 (d, j = 7.8 hz, 1h), 7.31 (d, j = 7.6 hz, 1h), 4.81 (m, 1h), 4.01 (m, 1h), 3.223.17 (m, 2h), 2.802.68 (m, 5h), 1.89 (m, 2h), 1.731.65 (m, 2h) ; esi ms m / z 330 [m + h ] ; hplc 96.5% purity (auc), tr = 15.6 min (method c). step a. to a solution of 4-(2-(trifluoromethyl)phenyl)piperidine hydrochloride (7, 0.080 g, 0.30 mmol) in ch2cl2 was added et3n (0.125 ml, 0.90 mmol), followed by methyl 1-(chlorocarbonyl)pyrrolidine-2-carboxylate (0.058 g, 0.30 mmol). the mixture stirred at rt for 6 h, was concentrated, and the resulting residue was chromatographed over silica gel (05% ch3oh in ch2cl2) to give methyl 1-(4-(2-(trifluoromethyl)phenyl)piperidine-1-carbonyl)pyrrolidine-2-carboxylate as a colorless thick oil (0.098 g, 84%) : h nmr (300 mhz, cdcl3) 7.63 (d, j = 7.8 hz, 1h), 7.49 (m, 2h), 7.29 (m, 1h), 4.604.55 (m, 1h), 4.023.90 (m, 2h), 3.75 (s, 3h), 3.603.44 (m, 2h), 3.122.82 (m, 3h), 2.332.23 (m, 1h), 2.091.64 (m, 7h) ; esi ms m / z 385 step b. to a solution of methyl 1-(4-(2-(trifluoromethyl)phenyl)piperidine-1-carbonyl)pyrrolidine-2-carboxylate (0.098 g, 0.25 mmol) in ch3oh (2 ml) and thf (2 ml) was added aqueous 2 n naoh (2 ml). the mixture stirred at rt for 4 h and was then diluted with h2o and acidified to ph 5with 2 n hcl. the mixture was extracted with etoac (3 30 ml), and the organic extracts were dried over na2so4, filtered, and concentrated under reduced pressure. the residue was chromatographed over silica gel (010% ch3oh in ch2cl2) to give 1-(4-(2-(trifluoromethyl)phenyl)piperidine-1-carbonyl)pyrrolidine-2-carboxylic acid ()-(15) as a white solid (0.086 g, 91%) : h nmr (300 mhz, cdcl3) 7.63 (d, j = 7.8 hz, 1h), 7.51 (t, j = 7.5 hz, 1h), 7.43 (d, j = 7.6 hz, 1h), 7.30 (t, j = 7.7 hz, 1h), 4.54 (m, 1h), 4.013.94 (m, 2h), 3.51 (m, 2h), 3.172.89 (m, 3h), 2.331.66 (m, 8h) ; esi ms m / z 327 [m co2 + h ] ; hplc 98.1% purity (auc), tr = 17.6 min (method a). step a. a mixture of (2-bromoethoxy)-tert - butyldimethylsilane (4.6 ml, 23.1 mmol), 2-trifluoromethylphenol (2.50 g, 15.4 mmol), ki (0.046 g, 0.27 mmol), and cs2co3 (10.0 g, 30.8 mmol) in dmf (69 ml) was heated at 50 c for 18 h. the mixture was allowed to cool to rt and was diluted with h2o (300 ml) and extracted with etoac (4 75 ml). the combined organic extracts were washed with a brine (8 50 ml) and concentrated under reduced pressure to give tert - butyldimethyl(2-(2-(trifluoromethyl)phenoxy)ethoxy)silane as a clear oil (4.34 g, 88%) : h nmr (300 mhz, cdcl3) 7.587.53 (m, 1h), 7.507.41 (m, 1h), 7.066.94 (m, 2h), 4.164.10 (m, 2h), 4.013.95 (m, 2h), 0.910.87 (m, 9h), 0.100.05 (m, 6h). step b. to a solution of tert - butyldimethyl(2-(2-(trifluoromethyl)phenoxy)ethoxy)silane (4.20 g, 13.1 mmol) in 1,4-dioxane (14 ml) was added hcl (4 m in 1,4-dioxane, 14 ml). the obtained oil was diluted with etoac (40 ml), washed with a saturated brine solution (30 ml), a 5% licl solution (2 30 ml), and concentrated under reduced pressure. the resulting residue was chromatographed over silica gel (isco combiflash rf unit, 80 g redisep column, 050% etoac in hexanes) to give 2-(2-(trifluoromethyl)phenoxy)ethanol (18a) as an impure white solid (1.88 g). step c. to a 0 c cooled solution of 2-(2-(trifluoromethyl)phenoxy)ethanol (18a, 0.800 g, 3.88 mmol) in ch2cl2 (25 ml) was added dess the mixture was stirred at rt for 18 h, then diluted with ch2cl2 (30 ml), washed with h2o (4 30 ml), and concentrated under reduced pressure. the resulting residue was chromatographed over silica gel (isco combiflash rf unit, 40 g redisep column, 050% etoac in hexanes) to give 2-(2-(trifluoromethyl)phenoxy)acetaldehyde a white solid step d. a solution of 2-(2-(trifluoromethyl)phenoxy)acetaldehyde (0.337 g, 1.65 mmol) in methylamine (2 n in ch3oh, 8.3 ml, 16.5 mmol) was stirred at rt for 18 h. the mixture was concentrated to under reduced pressure. the obtained residue was dissolved in etoh (8.3 ml) and nabh4 (0.062 g, 1.65 mmol). the mixture stirred at rt for 2 h and was concentrated under reduced pressure. the resulting residue was diluted in 2 n naoh (40 ml) and extracted with etoac (3 30 ml). the obtained residue was chromatographed over silica gel (isco combiflash rf unit, 12 g redisep column, 010% ch3oh in ch2cl2 with 0.1% nh4oh) to give n - methyl-2-(2-(trifluoromethyl)phenoxy)ethanamine (19a) as a clear oil (0.070 g, 2% for three steps) : h nmr (300 mhz, cdcl3) 7.597.52 (m, 1h), 7.517.42 (m, 1h), 7.056.93 (m, 2h), 4.16 (t, j = 5.1 hz, 2h), 3.022.97 (m, 2h), 2.51 (s, 3h), missing n h ; esi ms m / z 220 [m + h ]. step e. to a solution of n - methyl-2-(2-(trifluoromethyl)phenoxy)ethanamine (19a, 0.058 g, 0.26 mmol) and et3n (0.027 g, 0.26 mmol) in ch2cl2 (0.9 ml) was added methyl 2-isocyanatobenzoate (0.047 g, 0.26 mmol). the mixture stirred at rt for 2 h and was then diluted with h2o (30 ml) and extracted with ch2cl2 (3 30 ml). the resulting residue was chromatographed over silica gel (isco combiflash rf unit, 12 g redisep column, 050% etoac in hexanes) to give methyl 2-(3-methyl-3-(2-(2-(trifluoromethyl)phenoxy)ethyl)ureido)benzoate as a white solid (84 mg, 79%) : h nmr (300 mhz, dmso - d6) 10.41 (s, 1h), 8.43 (dd, j = 8.7, 0.9 hz, 1h), 7.94 (dd, j = 7.8, 1.5 hz, 1h), 7.667.52 (m, 3h), 7.30 (d, j = 8.7 hz, 1h), 7.137.00 (m, 2h), 4.27 (t, j = 5.4 hz, 2h), 3.85 (s, 3h), 3.76 (t, j = 5.4 hz, 2h), 3.13 (s, 3h) ; esi ms m / z 397 [m + h ]. step f. to a solution of methyl 2-(3-methyl-3-(2-(2-(trifluoromethyl)phenoxy)ethyl)ureido)benzoate (0.084 g, 0.21 mmol) in thf (4.2 ml) and ch3oh (1.9 ml) was added a solution of liohh2o (0.089 g, 2.1 mmol) in h2o (0.98 ml). the mixture stirred at rt for 4 h and was then acidified to ph 5 with 2 n hcl and diluted with h2o (20 ml). the resulting precipitate was collected by filtration to provide 2-(3-(2-(2-(tert - butyl)phenoxy)ethyl)-3-methylureido)benzoic acid (20) as a white solid (0.046 g, 57%) : mp 171173 c ; h nmr (500 mhz, dmso - d6) 13.51 (br s, 1h), 10.89 (s, 1h), 8.46 (dd, j = 8.5, 0.5 hz, 1h), 7.96 (dd, j = 8.0, 1.5 hz, 1h), 7.647.58 (m, 2h), 7.547.49 (m, 1h), 7.29 (d, j = 8.5 hz, 1h), 7.117.06 (m, 1h), 7.026.97 (m, 1h), 4.27 (t, j = 5.5 hz, 2h), 3.75 (t, j = 5.5 hz, 2h), 3.11 (s, 3h) ; esi ms m / z 381 [m h ] ; hplc 99.0% purity (auc), tr = 10.1 min (method b). compound 21 was prepared according to a similar procedure described for the synthesis of 20. mp 166169 c ; h nmr (500 mhz, dmso - d6) 13.50 (br s, 1h), 10.92 (s, 1h), 8.47 (dd, j = 8.5, 0.5 hz, 1h), 7.95 (dd, j = 8.0, 1.5 hz, 1h), 7.557.50 (m, 1h), 7.21 (dd, j = 8.5, 2.5 hz, 1h), 7.31 (d, j = 2.5 hz, 1h), 7.066.98 (m, 2h), 4.16 (t, j = 6.0 hz, 2h), 3.81 (t, j = 6.0 hz, 2h), 3.10 (s, 3h), 1.26 (s, 9h) ; esi ms m / z 405 [m + h ] ; hplc > 99% purity (auc), tr = 12.2 min (method b). step a. to a 10 c cooled suspension of 2-chloroethanamine hydrochloride (35.5 g, 0.306 mol) and nahco3 (102.8 g, 1.22 mol) in thf (450 ml) and h2o (450 ml) stirring in a 2 l, three - necked, round - bottomed flask equipped with a thermometer was carefully added a solution of di - tert - butyl dicarbonate (73.4 g, 0.336 mol) in thf (40 ml) dropwise over 30 min. the mixture was allowed to warm to rt and stirred for an additional 24 h. the mixture was diluted with h2o (200 ml) and extracted with etoac (3 150 ml). the combined organic extracts were washed with h2o (100 ml), brine (100 ml), dried over na2so4, filtered, and concentrated under reduced pressure to give tert - butyl (2-chloroethyl)carbamate (23) as a clear, colorless oil that was used as is in the next step (60.96 g, quantitative%) : h nmr (500 mhz, cdcl3) 4.89 (bs, 1h), 3.60 (m, 2h), 3.46 (m, 2h), 1.45 (s, 9h). step b. a 2 l, three - necked, round - bottomed flask equipped with a thermometer, reflux condenser, and mechanical stirrer were charged with tert - butyl (2-chloroethyl)carbamate (23, 65.28 g, 337 mmol), 2-(tert - butyl)phenol (34.0 ml, 222 mmol), ki (0.365 g, 2.20 mmol), cs2co3 (183 g, 560 mmol), and dmf (700 ml), and the mixture was heated at 60 c for 16 h. the mixture was allowed to cool to rt and was diluted with h2o (1 l) and extracted with etoac (3 200 ml). the combined organic extracts were washed with 5% aqueous licl solution (3 250 ml), brine (250 ml), dried over na2so4, filtered, and concentrated under reduced pressure. the residue was purified over a plug of silica gel (015% etoac in hexanes) to give tert - butyl (2-(2-(tert - butyl)phenoxy)ethyl)carbamate (24) as a yellow solid (53.46 g, 82%) : h nmr (500 mhz, cdcl3) 7.28 (m, 1h), 7.16 (m, 1h), 6.92 (m, 1h), 6.83 (m, 1h), 4.83 (bs, 1h), 4.07 (m, 2h), 3.59 (m, 2h), 1.39 (s, 9h). step c. to a 0 c cooled solution of lialh4 in thf (1.0 m, 367 ml, 360 mmol) in thf (350 ml) in a 3 l, three - necked, round - bottomed flask equipped with a thermometer was carefully added a solution of tert - butyl (2-(2-(tert - butyl)phenoxy)ethyl)carbamate (24, 43.06 g, 147 mmol) in thf (100 ml). upon complete addition, the mixture was allowed to warm to rt followed by heating at 60 c for 16 h. the mixture was allowed to cool back to rt and then further cooled to 0 c. the mixture was carefully quenched by slow addition of h2o (15 ml), 15% aqueous naoh solution (15 ml), followed by additional h2o (40 ml). the rate of quenching was done carefully so as to maintain an internal temperature below 25 c. the aqueous filtrate was extracted with et2o (2 150 ml), and the organic extracts were combined, dried over na2so4, filtered, and concentrated under reduced pressure. the residue was purified by flash column chromatography (isco combiflash rf unit, two 330 g redisep columns, 050% ch3oh in ch2cl2) to give 2-(2-(tert - butyl)phenoxy)-n - methylethanamine as an oil (13.4 g). this material was dissolved in et2o (250 ml) and treated with a solution of 2 m hcl in et2o (85 ml) at 0 c. the mixture stirred for 10 min at rt and was concentrated under reduced pressure to give 2-(2-(tert - butyl)phenoxy)-n - methylethanamine hydrochloride as a white solid (15.3 g, 43%) : h nmr (500 mhz, dmso - d6) 9.14 (bs, 1h), 7.25 (m, 1h), 7.18 (m, 1h), 7.04 (m, 1h), 6.94 (m, 1h), 4.29 (m, 2h), 3.36 (m, 2h), 2.65 (s, 3h), 1.34 (s, 9h). step d. to a solution of 2-(2-(tert - butyl)phenoxy)-n - methylethanamine hydrochloride (0.066 g, 0.312 mmol) and et3n (0.038 g, 0.381 mmol) in ch2cl2 (3.0 ml) was added methyl 2-isocyanatobenzoate (0.062 g, 0.352 mmol), and the mixture was stirred at rt for 18 h. the mixture was diluted with h2o (30 ml), extracted with ch2cl2 (3 30 ml), and the combined organic extracts were concentrated under reduced pressure. the resulting residue was chromatographed over silica gel (05% ch3oh in ch2cl2 with 0.01% nh4oh) to give methyl 2-(3-(2-(2-(tert - butyl)phenoxy)ethyl)-3-methylureido)benzoate as a white solid (0.057 mg, 46%) : h nmr (300 mhz, cdcl3) 10.74 (s, 1h), 8.60 (dd, j = 9.0, 1.2 hz, 1h), 8.00 (dd, j = 8.1, 1.8 hz, 1h), 7.557.47 (m, 1h), 7.307.26 (m, 1h), 7.207.12 (m, 1h), 7.026.94 (m, 1h), 6.936.86 (m, 2h), 4.23 (t, j = 5.4 hz, 2h), 3.933.87 (m, 5h), 3.27 (s, 3h), 1.38 (s, 9h) ; esi ms m / z 385 [m + h ]. step e. to a solution of methyl 2-(3-(2-(2-(tert - butyl)phenoxy)ethyl)-3-methylureido)benzoate (0.054 g, 0.142 mmol) in thf (2.7 ml) and ch3oh (1.3 ml) was added a solution of liohh2o (0.059 g, 1.41 mmol) in h2o (0.66 ml), and the mixture stirred at rt for 18 h. the mixture was acidified to ph 5with 2 n hcl, diluted with h2o (10 ml), and extracted with et2o (4 20 ml). the combined organic extracts were dried over na2so4, filtered, and concentrated to provide 2-(3-(2-(2-(tert - butyl)phenoxy)ethyl)-3-methylureido)benzoic acid (25) as a white solid (0.037 mg, 97%) : mp 136141 c ; h nmr (500 mhz, dmso - d6) 13.50 (s, 1h), 10.93 (s, 1h), 8.48 (dd, j = 8.5, 0.5 hz, 1h), 7.95 (dd, j = 8.0, 1.5 hz, 1h), 7.567.50 (m, 1h), 7.217.13 (m, 2h), 7.026.97 (m, 2h), 6.886.83 (m, 1h), 4.15 (t, j = 6.00 hz, 2h), 3.82 (t, j = 6.0 hz, 2h), 3.11 (s, 3h), 1.28 (s, 9h) ; esi ms m / z 371 [m + h ] ; hplc 98.4% purity (auc), tr = 14.3 min (method b). step a. to a solution of tert - butyl (2-chloroethyl)carbamate (23, 2.61 g, 14.5 mmol) in thf (40 ml) was added ch3i (9.0 ml, 145 mmol) at rt, followed by dropwise addition of a solution of lihmds (1.0 m in thf, 18.9 ml, 18.9 mmol) over 10 min. the reaction mixture stirred at rt for an additional 20 min and was then diluted with h2o (75 ml) and extracted with et2o (4 100 ml). the combined organics were washed with a saturated brine solution (2 30 ml), dried over na2so4, filtered, and concentrated under reduced pressure to provide tert - butyl (2-chloroethyl)(methyl)carbamate as a yellow oil (2.61 g, 92%) : h nmr (300 mhz, cdcl3) 3.683.45 (m, 4h), 2.93 (s, 3h), 1.46 (s, 9h). step b. a mixture of tert - butyl (2-chloroethyl)(methyl)carbamate (1.72 g, 8.92 mmol), 2-(tert - butyl)-4-fluorophenol (1.00 g, 5.94 mmol), ki (18 mg, 0.10 mmol), and cs2co3 (4.93 g, 15.1 mmol) in dmf (23 ml) was heated at 60 c for 100 h. the mixture was allowed to cool to rt and was diluted with h2o (100 ml) and extracted with etoac (4 80 ml). the combined organic extracts were washed with a saturated brine solution (2 50 ml) and concentrated under reduced pressure. the resulting residue was chromatographed over silica gel (isco combiflash rf unit, 40 g redisep column, 010% etoac in hexanes) to give tert - butyl (2-(2-(tert - butyl)-4-fluorophenoxy)ethyl)(methyl)carbamate (26) as an orange oil (0.490 g, 25%) : h nmr (300 mhz, cdcl3) 7.036.95 (m, 1h), 6.886.73 (m, 2h), 4.07 (t, j = 5.7 hz, 2h), 3.66 (t, j = 5.7 hz, 2h), 2.97 (s, 3h), 1.46, (s, 9h), 1.36 (s, 9h). step c. to a solution of tert - butyl (2-(2-(tert - butyl)-4-fluorophenoxy)ethyl)(methyl)carbamate (26, 0.490 g, 1.51 mmol) in ch2cl2 (6.0 ml) was added hcl (2 n solution in et2o, 6.0 ml), and the mixture stirred at rt for 6 h. the mixture was then diluted with et2o (30 ml), and the resulting solids were collected by filtration to give 2-(2-(tert - butyl)-4-fluorophenoxy)-n - methylethanamine hydrochloride as a white solid (0.185 g, 46%) : h nmr (300 mhz, dmso - d6) 8.84 (br s, 2h), 7.086.98 (m, 3h), 4.24 (t, j = 5.7 hz, 2h), 3.433.28 (m, 2h, overlaps with h2o), 2.67 (s, 3h), 1.33 (s, 9h) ; esi ms m / z 226 [m + h ]. step d. to a solution of 2-(2-(tert - butyl)-4-fluorophenoxy)-n - methylethanamine hydrochloride (0.085 g, 0.32 mmol) and et3n (0.066 g, 0.65 mmol) in ch2cl2 (1.1 ml) was added methyl 2-isocyanatobenzoate (0.064 g, 0.326 mmol). the mixture was stirred at rt for 3 h, was then diluted with h2o (10 ml), and was extracted with ch2cl2 (4 10 ml). the resulting residue was chromatographed over silica gel (isco combiflash rf unit, 12 g redisep column, 020% etoac in hexanes) to give methyl 2-(3-(2-(2-(tert - butyl)-4-fluorophenoxy)ethyl)-3-methylureido)benzoate as a white solid (0.116 g, 88%) : h nmr (300 mhz, cdcl3) 10.74 (s, 1h), 8.60 (d, j = 8.7 hz, 1h), 8.00 (dd, j = 8.1, 1.5 hz, 1h), 7.557.48 (m, 1h), 7.016.94 (m, 2h), 6.836.78 (m, 2h), 4.18 (t, j = 5.7 hz, 2h), 3.913.84 (m, 5h), 3.26 (s, 3h), 1.36 (s, 9h) ; esi ms m / z 403 [m + h ]. step e. to a solution of methyl 2-(3-(2-(2-(tert - butyl)-4-fluorophenoxy)ethyl)-3-methylureido)benzoate (0.110 g, 0.27 mmol) in thf (5.4 ml) and ch3oh (2.8 ml) was added a solution of liohh2o (0.114 g, 2.73 mmol) in h2o (1.4 ml). the mixture stirred at rt for 18 h, was then acidified to ph 5 with 2 n hcl, and was diluted with h2o (30 ml). the resulting solids were collected by filtration and washed with h2o to provide 2-(3-(2-(2-(tert - butyl)-4-fluorophenoxy)ethyl)-3-methylureido)benzoic acid (27) as a white solid (0.099 g, 93%) : mp 145150 c ; h nmr (500 mhz, dmso - d6) 13.51 (s, 1h), 10.94 (s, 1h), 8.47 (d, j = 8.5 hz, 1h), 7.95 (dd, j = 8.0, 1.5 hz, 1h), 7.557.49 (m, 1h), 7.036.93 (m, 4h), 4.14 (t, j = 5.5 hz, 2h), 3.80 (t, j = 6.0 hz, 2h), 3.10 (s, 3h), 1.26 (s, 9h) ; esi ms m / z 389 [m + h ] ; hplc > 99% purity (auc), tr = 11.6 min (method b). step a. to a solution of 2,3,4,5-tetrahydro-1h - benzo[d]azepine (0.110 g, 0.74 mmol) and et3n (0.12 ml, 0.82 mmol) in ch2cl2 (2.4 ml) was added methyl 2-isocyanatobenzoate (0.132 mg, 0.74 mmol), and the mixture stirred at rt for 2 h. the mixture was diluted with h2o (20 ml) and extracted with ch2cl2 (3 30 ml). the combined organic extracts were concentrated under reduced pressure, and the resulting residue was chromatographed over silica gel (isco combiflash rf unit, 12 g redisep column, 025% etoac in hexanes) to give methyl 2-(2,3,4,5-tetrahydro-1h - benzo[d]azepine-3-carboxamido)benzoate as a clear film (0.203 g, 83%) : h nmr (500 mhz, dmso - d6) 10.46 (br s, 1h), 8.34 (d, j = 8.0 hz, 1h), 7.94 (dd, j = 8.0, 1.5 hz, 1h), 7.587.53 (m, 1h), 7.207.16 (m, 2h), 7.157.10 (m, 2h), 7.067.02 (m, 1h), 3.89 (s, 3h), 3.683.61 (m, 4h), 3.012.94 (m, 4h) ; esi ms m / z 325 [m + h ]. step b. to a solution of methyl 2-(2,3,4,5-tetrahydro-1h - benzo[d]azepine-3-carboxamido)benzoate (0.197 g, 0.60 mmol) in thf (12.0 ml) and ch3oh (5.6 ml) was added a solution of liohh2o (0.255 g, 6.07 mmol) in h2o (2.8 ml). the mixture stirred at rt for 3 h, was neutralized with 2 n hcl, and was diluted with h2o (30 ml). the resulting precipitate was collected by filtration to give 2-(2,3,4,5-tetrahydro-1h - benzo[d]azepine-3-carboxamido)benzoic acid (28) as a white solid (0.065 mg, 34%) : mp 272278 c ; h nmr (500 mhz, dmso - d6) 14.18 (br s, 1h), 8.30 (d, j = 8.5 hz, 1h), 7.92 (d, j = 7.5 hz, 1h), 7.197.08 (m, 5h), 6.796.74 (m, 1h), 3.653.60 (m, 4h), 2.942.88 (m, 4h) missing urea n h ; esi ms m / z 309 [m h ] ; hplc > 99% purity (auc), tr = 14.8 min (method a). step a. a mixture of 2-(trifluoromethyl)benzaldehyde (5.0 g, 28.7 mmol) and hydrazine hydrate (1.43 g, 28.7 mmol) in i - proh (100 ml) was heated at reflux for 1 h. the mixture cooled to rt and was concentrated under reduced pressure providing (e)-(2-(trifluoromethyl)benzylidene)hydrazine, which was a yellow oil that crystallized upon standing (5.1 g, 94%). step b. to a solution of (e)-(2-(trifluoromethyl)benzylidene)hydrazine (5.0 g, 26.5 mmol) in 1,4-dioxane (200 ml) was added mno2 (23.1 g, 256 mmol) portionwise, and the mixture stirred at rt for 3 h. the slurry was filtered through celite and rinsed with additional 1,4-dioxane (50 ml). to the filtrate was added 1-benzyl-1h - pyrrole-2,5-dione (4.92 g, 26.5 mmol), and the mixture was stirred at rt for 48 h. the mixture was concentrated under reduced pressure and the resulting residue was chromatographed over silica gel (isco combiflash rf unit, 330 g redisep column, 05% etoac in hexanes) to give (1r,5s,6s)-3-benzyl-6-(2-(trifluoromethyl)phenyl)-3-azabicyclo[3.1.0]hexane-2,4-dione (1.52 g, 17%) as a white solid : h nmr (500 mhz, cdcl3) 7.69 (d, j = 7.8 hz, 1h), 7.52 (m, 1h), 7.49 (m, 1h), 7.407.29 (m, 5h), 7.10 (d, j = 7.8 hz, 1h), 4.58 (s, 2h) 2.90 (m, 1h), 2.82 (m, 2h) ; esi ms m / z 346 [m + h ]. step c. to a solution of (1r,5s,6s)-3-benzyl-6-(2-(trifluoromethyl)phenyl)-3-azabicyclo[3.1.0]hexane-2,4-dione (1.24 g, 3.59 mmol) in thf (20 ml) was added nabh4 (0.339 g, 8.97 mmol), and the mixture stirred at rt for 15 min. to this was added bf3et2o (1.0 m solution in thf, 5.38 ml, 5.38 mmol) dropwise (gas evolution was observed). the mixture was then heated at 50 c for 5 h. the mixture was allowed to cool back to rt and was carefully quenched by dropwise addition of h2o (added until gas evolution no longer occurred). to this was added ch3oh (60 ml), and the resulting mixture was stirred at reflux for 16 h. the mixture cooled back to rt and was concentrated under reduced pressure. the resulting residue was taken up in h2o (50 ml) and extracted with etoac (3 50 ml). the combined organic extracts were concentrated under reduced pressure, and the resulting residue was chromatographed over silica gel (isco combiflash rf unit, 12 g redisep column, 025% etoac in hexanes) to give (1r,5s,6s)-3-benzyl-6-(2-(trifluoromethyl)phenyl)-3-azabicyclo[3.1.0]hexane as a colorless, viscous oil (0.720 g, 64%) : h nmr (500 mhz, cdcl3) 7.64 (d, j = 7.8 hz, 1h), 7.45 (m, 1h), 7.357.35 (m, 4h), 7.297.21 (m, 2h), 7.08 (d, j = 7.8 hz, 1h), 3.67 (s, 2h), 3.14 (d, j = 7.8 hz, 2h), 2.71 (m, 1h), 2.49 (m, 2h), 1.74 (m, 2h). step d. a mixture of (1r,5s,6s)-3-benzyl-6-(2-(trifluoromethyl)phenyl)-3-azabicyclo[3.1.0]hexane (0.700 g, 2.20 mmol) and 10% pd / c (0.200 g) in ch3oh (50 ml) was subjected to a 50 psi atmosphere of h2 at rt for 4 h using a parr shaker apparatus. the mixture was filtered through celite and the filtrate was concentrated under reduced pressure to give (1r,5s,6s)-6-(2-(trifluoromethyl)phenyl)-3-azabicyclo[3.1.0]hexane as a viscous oil (0.478 g, 95%) : h nmr (500 mhz, cdcl3) 7.61 (d, j = 7.8 hz, 1h), 7.46 (m, 1h), 7.24 (m, 1h), 7.10 (d, j = 7.8 hz, 1h), 3.17 (d, j = 7.8 hz, 2h), 3.02 (m, 2h), 1.93 (m, 1h), 1.74 (m, 2h), 1.68 (bs, 1h). step e. to a solution of (1r,5s,6s)-6-(2-(trifluoromethyl)phenyl)-3-azabicyclo[3.1.0]hexane (0.100 g, 0.44 mmol) in ch2cl2 (10 ml) was added methyl 2-isocyanatobenzoate (0.078 g, 0.44 mmol), and the mixture stirred at rt for 2 h. the mixture was diluted with h2o (20 ml) and extracted with ch2cl2 (3 30 ml). the combined organic extracts were concentrated under reduced pressure, and the resulting residue was chromatographed over silica gel (isco combiflash rf unit, 12 g redisep column, 025% etoac in hexanes) to give methyl 2-((1r,5s,6s)-6-(2-(trifluoromethyl)phenyl)-3-azabicyclo[3.1.0]hexane-3-carboxamido)benzoate as a white solid (0.110 g, 62%) : h nmr (500 mhz, cdcl3) 10.. 55 (bs, 1h), 8.62 (m, 1h), 8.07 (m, 1h), 7.65 (m, 1h), 7.557.43 (m, 2h), 7.25 (m, 1h), 7.11 (m, 1h), 6.95 (m, 1h), 3.97 (m, 5h), 3.72 (m, 2h), 2.19 (m, 1h), 2.09 (m, 2h) ; esi ms m / z 403 [m h ]. step f. to a solution of methyl 2-((1r,5s,6s)-6-(2-(trifluoromethyl)phenyl)-3-azabicyclo[3.1.0]hexane-3-carboxamido)benzoate (0.110 g, 0.27 mmol) in thf (2 ml) and ch3oh (4 ml) was added 2 n naoh (2 ml). the mixture was stirred at rt for 3 h and was then acidified to ph 5 with 2 n hcl. the resulting precipitate was collected by filtration to 2-((1r,5s,6s)-6-(2-(trifluoromethyl)phenyl)-3-azabicyclo[3.1.0]hexane-3-carboxamido)benzoic acid (29) as a white solid (0.105 g, 98%) : mp 205208 c ; h nmr (500 mhz, dmso - d6) 13.52 (bs, 1h), 10.74 (bs, 1h), 8.49 (m, 1h), 7.97 (m, 1h), 7.70 (m, 1h), 7.61 (m, 1h), 7.55 (m, 1h), 7.42 (m, 1), 7.31 (m, 1h), 6.99 (m, 1h), 3.74 (m, 2h), 3.65 (m, 2h), 2.19 (m, 2h), 1.92 (m, 1h) ; esi ms m / z 389 [m h ] ; hplc 97.3% purity (auc), tr = 20.4 min (method a). compound 30 was prepared according to a similar procedure described for the synthesis of 29. mp 162165 c ; h nmr (500 mhz, dmso - d6) 8.06 (m, 1h), 7.87 (m, 1h), 7.65 (m, 1h), 7.49 (m, 2h), 7.32 (m, 2h), 6.85 (m, 1h), 3.70 (m, 1h), 3.50 (m, 2h), 2.31 (m, 1h), 2.11 (m, 2h), n h missing ; esi ms m / z 389 [m h ] ; hplc > 99% purity (auc), tr = 13.2 min (method a). step a. a mixture of tert - butyl 2,6-diazaspiro[3.3]heptane-2-carboxylate hemioxalate (0.200 g, 1.01 mmol), 1-bromo-(2-trifluoromethyl)benzene (0.14 ml, 1.03 mmol), pd(dba)3 (0.014 g, 0.015 mmol), rac - binap(0.140 g, 0.225 mmol), and k2co3 (0.340 g, 3.03 mmol) in toluene (5 ml) was heated at 110 c in a sealed tube for 24 h. the mixture cooled to rt and was diluted with etoac (10 ml), filtered through celite, and the filtrate was concentrated under reduced pressure. the residue was chromatographed over silica gel (isco combiflash rf unit, 40 g redisep column, 0100% etoac in hexanes) to provide tert - butyl 6-(2-(trifluoromethyl)phenyl)-2,6-diazaspiro[3.3]heptane-2-carboxylate as a tan solid (0.131 g, 38%) : h nmr (500 mhz, cdcl3) 7.507.48 (m, 1h), 7.377.37 (m, 1h), 6.816.78 (m, 1h), 6.48 (d, j = 8.5 hz, 1h), 4.054.10 (m, 8h), 1.44 (s, 9h). step b. to a solution of tert - butyl 6-(2-(trifluoromethyl)phenyl)-2,6-diazaspiro[3.3]heptane-2-carboxylate (0.131 g, 0.38 mmol) in ch2cl2(2 ml) was added 2 m hcl in et2o (2 ml), and the mixture stirred at rt for 4 h. the mixture was concentrated under reduced pressure, and the resulting residue was dissolved in ch2cl2 (4 ml). to this solution were added et3n (0.12 ml, 0.86 mmol) and methyl-2-isocyanatobenzoate (80 mg, 0.45 mmol), and the mixture stirred at rt for 24 h. the mixture was washed with saturated aqueous 2 m nahco3 solution (10 ml) and extracted with ch2cl2 (2 10 ml). the combined organic extracts were dried over na2so4, filtered, and concentrated under reduced pressure. the resulting residue was chromatographed over silica gel (isco combiflash rf unit, 24 g redisep column, 050% etoac in hexanes) to provide methyl 2-(6-(2-(trifluoromethyl)phenyl)-2,6-diazaspiro[3.3]heptanes-2-carboxamido)benzoate as an off - white solid (0.080 g, 50%) : h nmr (500 mhz, cdcl3) 8.52 (d, j = 8.5 hz, 1h), 7.997.98 (m, 1h), 7.537.44 (m, 2h), 7.367.33 (m, 1h), 6.996.96 (m, 2h), 6.71 (t, j = 7.5 hz, 1h), 4.86 (br s, 1h), 3.92 (s, 3h), 3.68 (d, j = 11.35 hz, 2h), 3.55 (d, j = 11.35 hz, 2h), 3.473.46 (m, 2h), 3.353.34 (m, 2h). step c. to a mixture of methyl 2-(6-(2-(trifluoromethyl)phenyl)-2,6-diazaspiro[3.3]heptanes-2-carboxamido)benzoate (0.080 g, 0.19 mmol) in ch3oh (3 ml) and thf (3 ml) was added liohh2o (0.080 g, 1.91 mmol) in h2o (10 ml). the mixture was stirred at rt for 3 h followed by acidification to ph 6 with 2 n hcl. the mixture was further diluted with h2o (10 ml), and the resulting precipitate was collected by filtration. the material was recrystallized from etoac and heptanes to provide (31) 2-(6-(2-(trifluoromethyl)phenyl)-2,6-diazaspiro[3.3]heptanes-2-carboxamido)benzoic acid as a white solid (0.049 mg, 64%) : mp 181184 c ; h nmr (500 mhz, dmso - d6) 11.66 (s, 1h), 7.96 (m, 1h), 7.697.66 (m, 1h), 7.457.42 (m, 2h), 7.247.18 (m, 2h), 6.926.90 (m, 1h), 6.72 (t, j = 7.5 hz, 1h), 6.076.05 (m, 1h), 4.314.21 (m, 2h), 3.863.79 (m, 4h), 3.483.45 (m, 2h) ; esi ms m / z 404 [m h ] ; hplc 96.4% purity (auc), tr = 14.7 min (method a). compound 32 was prepared according to a similar procedure described for the synthesis of 28. mp 192195 c ; h nmr (500 mhz, dmso - d6) 13.52 (br s, 1h), 10.59 (s, 1h), 8.46 (d, j = 8.5 hz, 1h), 7.977.91 (m, 2h), 7.787.71 (m, 2h), 7.577.48 (m, 2h), 7.046.98 (m, 1h), 4.474.37 (m, 2h), 4.254.17 (m, 1h), 4.154.02 (m, 2h) ; esi ms m / z 363 [m h ] ; hplc > 99% purity (auc), tr = 13.8 min (method b). step a. to a 0 c cooled solution of azetidin-3-ol hydrochloride (2.00 g, 18.21 mmol) and et3n (3.65 ml, 26.01 mmol) in ch3oh (18 ml) was added di - tert - butyl dicarbonate (2.82 g, 12.9 mmol). the resulting mixture stirred at rt for 18 h. the mixture diluted with ch2cl2 (100 ml) and washed with h2o (3 30 ml). the organic layer was dried over na2so4, filtered, and concentrated under reduced pressure to give tert - butyl 3-hydroxyazetidine-1-carboxylate as a white solid (1.74 g, 78%) : h nmr (500 mhz, dmso - d6) 5.625.58 (m, 1h), 4.394.32 (m, 1h), 4.013.93 (m, 2h), 3.603.51 (m, 2h), 1.36 (m, 9h). step b. to a 0 c cooled solution of tert - butyl 3-hydroxyazetidine-1-carboxylate (1.73 g, 9.99 mmol) and et3n (1.69 ml, 12.01 mmol) in ch2cl2 (51 ml) was added mscl (0.85 ml, 11.0 mmol). the mixture continued to stir at 0 c for 1 h. the mixture was diluted with a saturated brine solution (70 ml) and extracted with ch2cl2 (3 40 ml). the combined organic extracts were dried over na2so4, filtered, and concentrated under reduced pressure to give to give tert - butyl 3-((methylsulfonyl)oxy)azetidine-1-carboxylate as a light yellow oil (2.60 g, > 99%) : h nmr (500 mhz, cdcl3) 5.225.16 (m, 1h), 4.294.24 (m, 2h), 4.124.07 (m, 2h), 3.06 (s, 3h), 1.44 (s, 9h). step c. a mixture of tert - butyl 3-((methylsulfonyl)oxy)azetidine-1-carboxylate (2.51 g, 9.99 mmol), 2-trifluoromethylphenol (1.62 g, 9.99 mmol), cs2co3 (3.57 g, 11.0 mmol) in dmf (90 ml) was heated at 80 c for 18 h. the mixture was allowed to cool to rt and was diluted with a saturated brine solution (50 ml) and extracted with etoac (3 50 ml). the combined organic extracts were washed with a saturated brine solution (2 50 ml) and concentrated under reduced pressure. the resulting residue was chromatographed over silica gel (isco combiflash rf unit, 40 g redisep column, 060% etoac in hexanes) to give tert - butyl 3-(2-(trifluoromethyl)phenoxy)azetidine-1-carboxylate as a clear oil (1.49 mg, 47%) : h nmr (500 mhz, cdcl3) 7.60 (d, j = 7.5 hz, 1h), 7.607.43 (m, 1h), 7.087.04 (m, 1h), 6.63 (d, j = 8.0 hz, 1h), 4.984.92 (m, 1h), 4.344.29 (m, 2h), 4.084.04 (m, 2h), 1.45 (s, 9h) ; esi ms m / z 262 [m t - bu ]. step d. to a solution of tert - butyl 3-(2-(trifluoromethyl)phenoxy)azetidine-1-carboxylate (0.255 g, 0.80 mmol) in ch3oh (1.5 ml) was added 2 m hcl in et2o (1.5 ml), and the mixture was stirred at rt for 2 h. the mixture was diluted with et2o (30 ml) and the resulting precipitate was collected by filtration to give 3-(2-(trifluoromethyl)phenoxy)azetidine as a white solid (0.182 g, 89%) : h nmr (500 mhz, dmso - d6) 9.45 (s, 2h), 7.68 (d, j = 7.5 hz, 1h), 7.657.60 (m, 1h), 7.207.17 (m, 1h), 7.04 (d, j = 8.5 hz, 1h), 5.255.20 (m, 1h), 4.504.45 (m, 2h), 4.013.97 (m, 2h) ; esi ms m / z 218 [m + h ]. step e. to a mixture of 3-(2-(trifluoromethyl)phenoxy)azetidine hydrochloride (0.080 g, 0.31 mmol) and et3n (88 l, 0.63 mmol) in ch2cl2 (1.0 ml) was added methyl 2-isocyanatobenzoate (0.056 g, 0.31 mmol). the mixture stirred at rt for 18 h followed by dilution with h2o (5 ml). the mixture was extracted with ch2cl2 (3 10 ml), and the combined organic extracts were washed with a saturated brine solution (1 10 ml) and concentrated under reduced pressure. the resulting residue was chromatographed over silica gel (isco combiflash rf unit, 12 g redisep column, 050% etoac in hexanes) to give methyl 2-(3-(2-(trifluoromethyl)phenoxy)azetidine-1-carboxamido)benzoate as a white solid (92 mg, 74%) : h nmr (500 mhz, dmso - d6) 10.04 (s, 1h), 8.35 (d, j = 8.5 hz, 1h), 7.93 (dd, j = 8.0, 1.5 hz, 1h), 7.697.64 (m, 2h), 7.597.55 (m, 1h), 7.197.16 (m, 1h), 7.107.04 (m, 2h), 5.275.24 (m, 1h), 4.584.50 (m, 2h), 3.993.93 (m, 2h), 3.86 (s, 3h) ; esi ms m / z 395 [m + h ]. step f. to a mixture of methyl 2-(3-(2-(trifluoromethyl)phenoxy)azetidine-1-carboxamido)benzoate (0.090 g, 0.22 mmol) in thf (4.5 ml) and ch3oh (2.1 ml) was added a solution of liohh2o (0.095 g, 2.28 mmol) in h2o (1.1 ml). the mixture stirred at rt for 18 h, followed by neutralization with 2 n hcl, and diluted with additional h2o (30 ml). the resulting precipitate was collected by filtration to provide 2-(3-(2-(trifluoromethyl)phenoxy)azetidine-1-carboxamido)benzoic acid (33) as a white solid (0.074 g, 85%) : mp 186189 c ; h nmr (500 mhz, dmso - d6) 13.53 (br s, 1h), 10.58 (s, 1h), 8.41 (d, j = 8.5 hz, 1h), 7.95 (dd, j = 8.0, 1.0 hz, 1h), 7.697.62 (m, 2h), 7.567.52 (m, 1h), 7.17 (dd, j = 7.5, 1.0 hz, 1h), 7.097.00 (m, 2h), 5.295.22 (m, 1h), 4.564.48 (m, 2h), 3.983.91 (m, 2h) ; esi ms m / z 379 [m h ] ; hplc > 99% purity (auc), tr = 15.4 min (method a). compound ()-34 was prepared according to a similar procedure described for the synthesis of 28. mp 166170 c ; h nmr (500 mhz, dmso - d6) 13.52 (s, 1h), 10.96 (s, 1h), 8.43 (d, j = 8.5 hz, 1h), 7.95 (dd, j = 8.0, 1.5 hz, 1h), 7.567.50 (m, 1h), 7.237.19 (m, 2h), 7.177.12 (m, 2h), 7.036.99 (m, 1h), 4.114.01 (m, 2h), 3.173.05 (m, 2h), 2.89 (t, j = 7.5 hz, 2h), 2.08 (t, j = 7.5 hz, 2h), 1.811.74 (m, 2h), 1.591.48 (m, 2h) ; esi ms m / z 351 [m + h ] ; hplc > 99% purity (auc), tr = 16.7 min (method a). step a. to a 0 c cooled solution of lialh4 in thf (1.0 m, 800 ml, 800 mmol) in thf (800 ml) was carefully added (3ar,7as)-3a,4,7,7a - tetrahydro-1h - isoindole-1,3(2h)-dione (35, 53.7 g, 0.35 mol) portionwise. an exotherm of 5 c occurred upon each addition of 35. upon complete addition, the mixture was allowed to warm to rt followed by heating at 70 c for 16 h. the mixture was allowed to cool back to rt and then further cooled to 0 c. the reaction was carefully quenched by slow addition of h2o (30 ml), 15% aqueous naoh solution (30 ml), followed by another bolus of h2o (90 ml). the rate of quenching was done carefully so as to maintain an internal temperature below 25 c. the aqueous filtrate was extracted with et2o (2 100 ml), and the organic extracts were combined and concentrated under reduced pressure. the resulting residue was purified using a kugelrorh distillation apparatus to give (3ar,7as)-2,3,3a,4,7,7a - hexahydro-1h - isoindole as a clear, colorless oil (19.45 g, 44%) : h nmr (500 mhz, cdcl3) 5.29 (s, 2h), 3.88 (bs, 1h), 3.26 (m, 2h), 2.82 (m, 2h), 2.412.19 (m, 4h), 1.96 (m, 2h). step b. to a 0 c cooled solution of (3ar,7as)-2,3,3a,4,7,7a - hexahydro-1h - isoindole (11.5 g, 93.5 mmol) in ch2cl2 (200 ml) was added boc2o (24.5 g, 112 mmol), and the mixture was stirred at rt for 16 h. the mixture was washed with h2o (100 ml), brine (100 ml), dried over na2so4, filtered, and concentrated under reduced pressure. the residue was purified by flash column chromatography (isco combiflash rf unit, 330 g redisep column, 030% etoac in hexanes) to give (3ar,7as)-tert - butyl 3a,4,7,7a - tetrahydro-1h - isoindole-2(3h)-carboxylate (36) as an oil (20.10 g, 49%) : h nmr (500 mhz, cdcl3) 5.64 (s, 2h), 3.39 (m, 2h), 3.20 (m, 2h), 3.15 (m, 2h), 2.232.19 (m, 4h), 1.97 (m, 2h), 1.57 (s, 9h). step c. to a 0 c cooled mixture of (3ar,7as)-tert - butyl 3a,4,7,7a - tetrahydro-1h - isoindole-2(3h)-carboxylate (36, 66.78 g, 224 mmol) in ch3cn (600 ml), ccl4 (400 ml), and h2o (800 ml) was added naio4 (192.3 g, 899 mmol) followed by ruo2h2o (1.19 g, 8.94 mmol). the mixture was stirred at rt for 24 h with mechanical stirring and then filtered through celite. the filter cake was washed with 10% ch3oh in ch2cl2 (200 ml), and the biphasic mother liquor was separated. the aqueous phase was further extracted with ch2cl2 (3 150 ml), and the combined organic extracts were washed with h2o (100 ml), brine (100 ml), dried over na2so4, filtered, and concentrated under reduced pressure. the residue was filtered through a plug of silica gel using a ch3oh / ch2cl2 eluent system (2%10% ch3oh in ch2cl2). the filtrate was concentrated under reduced pressure to give 2,2-((3s,4r)-1-(tert - butoxycarbonyl)pyrrolidine-3,4-diyl)diacetic acid (37) as a solid (46.75 g, 72%) : h nmr (500 mhz, dmso - d6) 12.2 (s, 2h), 3.38 (m, 2h), 3.02 (m, 2h), 2.49 (m, 2h), 2.32 (m, 2h), 2.29 (m, 2h), 1.42 (s, 9h). step d. to a suspension of 2,2-((3s,4r)-1-(tert - butoxycarbonyl)pyrrolidine-3,4-diyl)diacetic acid (37, 6.97 g, 24.31 mmol) in ac2o (50 ml) was added naoac (1.99 g, 24.31 mmol), and the mixture was heated at 120 c for 3 h. the mixture cooled to rt and filtered through celite. the filter cake was washed with et2o (5 50 ml), and the mother liquor was concentrated under reduced pressure. the resulting residue was purified by flash column chromatography (isco combiflash rf unit, 120 g redisep column, 030% etoac in hexanes) to give (3ar,6as)-tert - butyl 5-oxohexahydrocyclopenta[c]pyrrole-2(1h)-carboxylate (38) as a white foam (2.17 g, 40%) : h nmr (500 mhz, cdcl3) 3.69 (m, 2h), 3.22 (m, 2h), 2.91 (m, 2h), 2.50 (m, 2h), 2.17 (m, 2h), 1.46 (s, 9h). step e. to a 78 c cooled solution of (3ar,6as)-tert - butyl 5-oxohexahydrocyclopenta[c]pyrrole-2(1h)-carboxylate (38, 22.35 g, 99.2 mmol) in thf (500 ml) was slowly added a solution of lihmds in thf (1.0 m, 129 ml). the mixture continued to stir at 78 c for 30 min, and then a solution of 1,1,1-trifluoro - n - phenyl - n-((trifluoromethyl)sulfonyl)methanesulfonamide (49.65 g, 139 mmol) in thf (150 ml) was slowly added. the mixture stirred for an additional 1 h at 78 c and was then allowed to stir at rt for 2 h. the mixture was concentrated under reduced pressure and the residue was purified by flash column chromatography (isco combiflash rf unit, 330 g redisep column, 050% etoac in hexanes) to give ()-(3as,6as)-tert - butyl 5-(((trifluoromethyl)sulfonyl)oxy)-3,3a,6,6a - tetrahydrocyclopenta[c]pyrrole-2(1h)-carboxylate (()-39) as a clear, viscous oil (1.56 g, quantitative) : h nmr (500 mhz, cdcl3) 5.58 (s, 1h), 3.62 (m, 1h), 3.53 (m, 1h), 3.46 (m, 2h), 3.19 (m, 1h), 2.95 (m, 2h), 2.46 (m, 1h), 1.47 (s, 9h). step f. to an n2 degassed mixture of ()-(3as,6as)-tert - butyl 5-(((trifluoromethyl)sulfonyl)oxy)-3,3a,6,6a - tetrahydrocyclopenta[c]pyrrole-2(1h)-carboxylate (()-39, 14.79 g, 41.4 mmol), 2-trifluoromethylphenylboronic acid (19.70 g, 104 mmol), and a 2 m aqueous solution of na2co3 (250 ml) in dme (500 ml) was added pd(pph3)4 (4.80 g, 4.16 mmol). the mixture was heated at 80 c for 6 h, then cooled to rt and diluted with h2o (500 ml). the aqueous mixture was extracted with etoac (2 200 ml), and the combined organic extracts were washed with h2o (200 ml), brine (200 ml), dried over na2so4, filtered, and concentrated under reduced pressure. the residue was purified by flash column chromatography (isco combiflash rf unit, 330 g redisep column, 010% etoac in hexanes) to give ()-(3ar,6as)-tert - butyl 5-(2-(trifluoromethyl)phenyl)-3,3a,6,6a - tetrahydrocyclopenta[c]pyrrole-2(1h)-carboxylate (()-40) as a clear, viscous oil (13.70 g, 94%) : h nmr (500 mhz, cdcl3) 7.65 (m, 1h), 7.47 (m, 2h), 7.25 (m, 1h), 5.58 (s, 1h), 3.853.42 (m, 4h), 3.23 (m, 1h), 2.98 (m, 2h), 2.49 (m, 1h), 1.47 (s, 9h). step g. a mixture of ()-(3ar,6as)-tert - butyl 5-(2-(trifluoromethyl)phenyl)-3,3a,6,6a - tetrahydrocyclopenta[c]pyrrole-2(1h)-carboxylate (()-40, 8.63 g, 24.41 mmol) and 10% pd / c (1.57 g, wet, 10% w / w) in ch3oh (50 ml) was subjected to an atmosphere of h2 gas (40 psi) using a parr shaker apparatus at rt for 16 h. the mixture was filtered through celite, and the filtrate was concentrated under reduced pressure. the resulting residue was purified by flash column chromatography (isco combiflash rf unit, 40 g redisep column, 030% etoac in hexanes) to give (3ar,5r,6as)-tert - butyl 5-(2-(trifluoromethyl)phenyl)hexahydrocyclopenta[c]pyrrole-2(1h)-carboxylate (41) as a clear, viscous oil (0.910 g, 85%) : h nmr (500 mhz, cdcl3) 7.69 (m, 1h), 7.51 (m, 2h), 7.25 (m, 1h), 3.49 (m, 5h), 2.75 (m, 2h), 2.92 (m, 2h), 1.52 (m, 2h), 1.48 (s, 9h). step h. to a 0 c cooled solution of (3ar,5r,6as)-tert - butyl 5-(2-(trifluoromethyl)phenyl)hexahydrocyclopenta[c]pyrrole-2(1h)-carboxylate (41, 7.94 g, 22.32 mmol) in ch2cl2 (60 ml) was added a 2 m hcl solution in et2o (60 ml), and the mixture was allowed to stir at rt for 24 h. the mixture was diluted with et2o (200 ml) and the precipitated product was filtered to give (3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole hydrochloride (42) as a white solid (5.90 g, 91%) : h nmr (500 mhz, cdcl3) 10.17 (bs, 1h), 8.06 (m, 1h), 7.59 (m, 1h), 7.53 (m, 1h), 7.27 (m, 1h), 3.42 (m, 2h), 3.38 (m, 3h), 3.01 (m, 2h), 2.36 (m, 2h), 1.96 (m, 2h) ; esi ms m / z 256 [m + h ]. step i. to a solution of (3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole hydrochloride (42, 0.640 g, 2.50 mmol) in ch2cl2 (50 ml) was added methyl 2-isocyanatobenzoate (0.442 g, 2.50 mmol), and the mixture was stirred at rt for 16 h. the mixture was concentrated under reduced pressure and the resulting residue was purified by flash column chromatography (isco combiflash rf unit, 40 g redisep column, 030% etoac in hexanes) to give methyl 2-((3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole-2-carboxamido)benzoate as a white solid (0.700 g, 64%) : esi ms m / z 433 [m + h ]. step j. to a solution of methyl 2-((3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole-2-carboxamido)benzoate (0.700 g, 1.61 mmol) in ch3oh (20 ml) and thf (20 ml) was added aqueous 2 n naoh (10 ml). the mixture stirred at rt for 16 h and concentrated under reduced pressure. the residue was diluted with h2o (25 ml) and acidified to ph 5with 2 n hcl, and the resulting precipitate was filtered to give 2-((3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole-2-carboxamido)benzoic acid (43) as a white solid (0.668 g, 98%) : mp 157161 c ; h nmr (300 mhz, dmso - d6) 13.46 (br s, 1h), 10.79 (s, 1h), 8.53 (d, j = 8.5 hz, 1h), 7.96 (dd, j = 8.0, 1.5 hz, 1h), 7.80 (m, 1h), 7.69 (m, 1h), 7.60 (m 1h), 7.48 (m, 1h), 7.36 (m, 1h), 6.99 (m, 1h), 3.653.62 (m, 2h), 3.473.38 (m, 3h), 2.86 (m, 2h), 2.272.22 (m, 2h), 1.661.59 (m, 2h) ; esi ms m / z 419 [m + h ] ; hplc 98.7% purity (auc), tr = 14.8 min (method a). step a. to a solution of ()-(3ar,6as)-tert - butyl 5-(2-(trifluoromethyl)phenyl)-3,3a,6,6a - tetrahydrocyclopenta[c]pyrrole-2(1h)-carboxylate (()-40, 120 mg, 0.34 mmol) in ch2cl2 (3 ml) was added a tfa (3 ml), and the resulting solution was stirred at rt for 3 h. the residue was dissolved in ch2cl2 (25 ml) and washed with saturated aqueous nahco3 solution (25 ml), brine (25 ml), dried over na2so4, filtered, and concentrated under reduced pressure to provide ()-(3as,6ar)-5-(2-(trifluoromethyl)phenyl)-1,2,3,3a,4,6a - hexahydrocyclopenta[c]pyrrole (()-44) as an off - white solid (0.146 mg, > 99%) : h nmr (300 mhz, cdcl3) 9.21 (br s, 1h), 8.18 (br s, 1h), 7.67 (d, j = 7.8 hz, 1h), 7.517.34 (m, 3h), 5.57 (s, 1h), 3.82 (br s, 1h), 3.623.54 (m, 2h), 3.393.09 (m, 4h), 2.622.56 (m, 1h). step b. a solution of ()-(3as,6ar)-5-(2-(trifluoromethyl)phenyl)-1,2,3,3a,4,6a - hexahydrocyclopenta[c]pyrrole (()-44, 159 mg, 0.43 mmol), methyl 2-isocyanatobenzoate (91 mg, 0.51 mmol), and et3n (0.14 ml, 1.0 mmol) in ch2cl2 (6 ml) was stirred at rt for 24 h. the mixture was diluted with saturated aqueous nahco3 (30 ml) and extracted with ch2cl2 (3 10 ml). the combined organic extracts were washed with brine, dried over na2so4, filtered, and concentrated under reduced pressure. the resulting residue was chromatographed over silica gel (0100% etoac in hexanes) to give ()-methyl 2-((3as,6ar)-5-(2-(trifluoromethyl)phenyl)-1,2,3,3a,4,6a - hexahydrocyclopenta[c]pyrrole-2-carboxamido)benzoate as an off - white solid (0.114 g, 62%) : h nmr (300 mhz, cdcl3) 8.66 (dd, j = 8.4, 0.9 hz, 1h), 8.027.98 (m, 1h), 7.667.64 (m, 1h), 7.547.34 (m, 4h), 6.996.93 (m, 1h), 5.67 (br s, 1h), 4.023.90 (m, 4h), 3.813.67 (m, 3h), 3.373.31 (m, 1h), 3.162.97 (m, 2h), 2.582.53 (m, 1h). step c. to a stirring solution of ()-methyl 2-((3as,6ar)-5-(2-(trifluoromethyl)phenyl)-1,2,3,3a,4,6a - hexahydrocyclopenta[c]pyrrole-2-carboxamido)benzoate (114 mg, 0.26 mmol) in ch3oh (4 ml) and thf (4 ml) was added a solution of liohh2o (110 mg, 2.62 mmol) in h2o (2 ml). the mixture was stirred at rt for 4 h, was diluted with additional h2o (10 ml), and was acidified to ph 6 with 2 n hcl. the resulting solids were collected by filtration and dried under reduced pressure to provide ()-2-((3as,6ar)-5-(2-(trifluoromethyl)phenyl)-1,2,3,3a,4,6a - hexahydrocyclopenta[c]pyrrole-2-carboxamido)benzoic acid (()-45) as a white solid (0.085 mg, 79%) : mp 148152 c ; h nmr (500 mhz, dmso - d6) 13.50 (bs, 1h), 10.74 (s, 1h), 8.50 (d, j = 8.5 hz, 1h), 7.96 (m, 1h), 7.73 (m, 1h), 7.64 (m, 1h), 7.52 (m, 2h), 7.44 (m, 1h), 7.01 (m, 1h), 5.68 (s, 1h), 3.833.79 (m, 1h), 3.643.55 (m, 3h), 3.312.96 (m, 3h) ; esi ms m / z 415 [m h ] ; hplc 97.5% purity (auc), tr = 13.6 min (method a). step a. to a solution of ()-(3as,6ar)-5-(2-(trifluoromethyl)phenyl)-1,2,3,3a,4,6a - hexahydrocyclopenta[c]pyrrole (()-44, 0.680 g, 1.92 mmol) in ch3oh (25 ml) was added pd / c (10% w / w, degussa type e101 ne / w, 0.140 g). the mixture was subjected to an atmosphere of h2 (50 psi) at rt for 6 h and was filtered through celite. the filtrated was concentrated under reduced pressure, and the resulting residue was purified by reversed phase column chromatography (isco c18 reversed phase gold column, 1030% ch3cn in h2o with 0.05% tfa). the resulting material was dissolved in ch2cl2 and washed with saturated aqueous nahco3, dried over na2so4, filtered, and concentrated under reduced pressure to give (3ar,5s,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole (46) as a white solid (0.070 g, 14%) : h nmr (300 mhz, cdcl3) 7.61 (d, j = 7.8 1h), 7.50 (m, 2h), 7.307.24 (m, 1h), 3.543.42 (m, 1h), 3.323.26 (m, 2h), 2.812.68 (m, 2h), 2.512.46 (m, 2h), 1.841.76 (m, 4h) ; esi ms m / z 256 [m + h ]. step b. to a solution of (3ar,5s,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole (46, 0.030 g, 0.12 mmol) in ch2cl2 (2 ml) was added methyl 2-isocyanatobenzoate (0.021 g, 0.12 mmol). the mixture was stirred for 2 h and then chromatographed over silica gel (050% etoac in hexanes) to give methyl 2-((3ar,5s,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole-2-carboxamido)benzoate as a white solid (0.052 g, quantitative) : h nmr (300 mhz, cdcl3) 10.53 (s, 1h), 8.67 (m, 1h), 8.01 (dd, j = 8.0, 1.6 hz, 1h), 7.627.46 (m, 4h), 7.28 (m, 1h), 6.996.94 (m, 1h), 3.92 (m, 5h), 3.793.67 (m, 1h), 3.383.33 (m, 2h), 3.07 (m, 2h), 2.111.93 (m, 4h) ; esi ms m / z 433 [m + h ]. step c. to a solution of 2-((3ar,5s,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole-2-carboxamido)benzoate (0.052 g, 0.12 mmol) in thf (3 ml) and ch3oh (1 ml) was added a solution of liohh2o (0.015 g, 0.36 mmol) in h2o (1 ml). the mixture was stirred at rt for 6 h, was acidified to ph 2 with 2 n hcl, and was poured into h2o. the mixture was extracted with ch2cl2 (30 ml), and the organic extracts were washed with brine, dried over na2so4, filtered, and concentrated under reduced pressure. the residue was chromatographed over silica gel (010% ch3oh in ch2cl2) to give 2-((3ar,5s,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole-2-carboxamido)benzoic acid (48) as a white solid (0.049 g, 98%) : mp 172174 c ; h nmr (300 mhz, cdcl3) 13.48 (bs, 1h), 10.74 (bs, 1h), 8.51 (d, j = 8.7 hz, 1h), 7.97 (d, j = 8.1 hz, 1h), 7.69 (m, 3h), 7.55 (m, 1h), 7.41 (m, 1h), 7.02 (m, 1h), 3.76 (m, 2h), 3.56 (m, 1h), 3.25 (dd, j = 10.8, 4.8 hz, 2h), 3.04 (m, 2h), 2.011.89 (m, 4h) ; esi ms m / z 419 [m + h ]. hplc > 99% purity (auc), tr = 14.7 min (method a). step a. to a solution of triphosgene (0.148 g, 0.50 mmol) in ch2cl2 (3.0 ml) under n2, cooled to 78 c, was slowly added pyridine (0.158 g, 2.00 mmol), and the resulting solution was stirred at 78 c for 10 min. a solution of (3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole hydrochloride (42, 0.292 g, 1.00 mmol) in ch2cl2 (2.0 ml) was added, and the resulting solution was stirred at 78 c for 30 min. the solution was warmed to rt and stirred for 2 h. the mixture was diluted with 1 n hcl (8 ml) and extracted with ch2cl2 (3 30 ml). the combined organic extracts were washed with saturated nahco3 solution (40 ml) and concentrated under reduced pressure. the resulting residue was chromatographed over silica gel (030% etoac in hexanes) to give (3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)hexahydrocyclopenta[c]pyrrole-2(1h)-carbonyl chloride (49) as a light yellow solid (170 mg, 53%) : h nmr (300 mhz, dmso - d6) 7.81 (d, j = 8.4 hz, 1h), 7.697.60 (m, 2h), 7.447.35 (m, 1h), 3.853.75 (m, 1h), 3.713.54 (m, 2h), 3.513.43 (m, 1h), 3.423.36 (m, 1h), 2.912.75 (m, 2h), 2.252.12 (m, 2h), 1.701.55 (m, 2h) ; esi ms m / z 318 [m + h ]. step b. to a solution of give (3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)hexahydrocyclopenta[c]pyrrole-2(1h)-carbonyl chloride (49, 0.100 g, 0.31 mmol) in thf (1.8 ml) were added i - pr2net (0.041 g, 0.31 mmol) and methyl 2-amino-5-fluorobenzoate (0.064 g, 0.37 mmol). the resulting solution was heated at reflux for 5 h. the mixture was diluted with h2o (30 ml) and extracted with etoac (4 30 ml). the resulting residue was chromatographed over silica gel (010% etoac in hexanes) to give methyl 5-fluoro-2-((3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole-2-carboxamido)benzoate as a light orange film (101 mg, crude) : esi ms m / z 451 [m + h ]. step c. to a solution of methyl 5-fluoro-2-((3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole-2-carboxamido)benzoate (0.101 g, 0.22 mmol) in thf (4.4 ml) and ch3oh (2.3 ml) was added a solution of liohh2o (0.094 g, 2.24 mmol) in h2o (1.2 ml). the mixture was stirred at rt for 18 h, was then acidified to ph 5 with 2 n hcl, and was diluted with h2o (20 ml). the aqueous mixture was extracted with etoac (3 30 ml), and the combined organic extracts were concentrated under reduced pressure. the resulting residue was chromatographed by reverse phase column (isco redisep 12 g gold c18 reverse phase column, 0100% ch3cn in h2o) to provide 5-fluoro-2-((3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole-2-carboxamido)benzoic acid (50) as a white solid (0.011 g, 12%) : mp 176180 c ; h nmr (500 mhz, dmso - d6) 13.83 (br s, 1h), 10.65 (br s, 1h), 8.578.51 (m, 1h), 7.75 (d, j = 8.5 hz, 1h), 7.697.59 (m, 3h), 7.467.36 (m, 2h), 3.673.58 (m, 2h), 3.473.36 (m, 3h), 2.902.81 (m, 2h), 2.282.20 (m, 2h), 1.681.58 (m, 2h) ; esi ms m / z 437 [m + h ] ; hplc > 99% purity (auc), tr = 11.3 min (method b). compound 51 was prepared according to a similar procedure described for the synthesis of 50. mp 176179 c ; h nmr (500 mhz, dmso - d6) 13.56 (s, 1h), 10.42 (br s, 1h), 8.43 (d, j = 9.0 hz, 1h), 7.75 (d, j = 8.0 hz, 1h), 7.677.59 (m, 2h), 7.43 (d, j = 3.0 hz, 1h), 7.427.36 (m, 1h), 7.18 (dd, j = 9.5, 3.0 hz, 1h), 3.75 (s, 3h), 3.653.58 (m, 2h), 3.463.36 (m, 3h), 2.902.79 (m, 2h), 2.282.19 (m, 2h), 1.661.57 (m, 2h) ; esi ms m / z 449 [m + h ] ; hplc > 99% purity (auc), tr = 11.2 min (method b). to a solution of methyl 2-amino-5-chlorobenzoate (0.058 g, 0.31 mmol) in dmf (2.7 ml) cooled to 10 c under n2 was added nah (60% in mineral oil, 0.019 g, 0.47 mmol), and the resulting solution was stirred at 10 c for 20 min. a solution of (3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)hexahydrocyclopenta[c]pyrrole-2(1h)-carbonyl chloride (49, 0.100 g, 0.315 mmol) in dmf (0.55 ml) was added and the mixture stirred at rt for 2 h. the mixture was carefully diluted with h2o (30 ml), made acidic to ph 2 with 2 n hcl, and was extracted with etoac (4 30 ml). the combined organic extracts were washed with brine (4 30 ml) and concentrated under reduced pressure. the resulting residue was chromatographed over silica gel (010% ch3oh in ch2cl2 with 0.1% hoac) followed by reverse phase column chromatography (isco gold redisep 12 g c18 reverse phase column, 0100% ch3cn in h2o) to give 5-chloro-2-((3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole-2-carboxamido)benzoic acid (52) as a white solid (21 mg, 23%) : mp 188193 c ; h nmr (500 mhz, dmso - d6) 13.92 (bs, 1h), 10.85 (bs, 1h), 8.56 (d, j = 9.5 hz, 1h), 7.90 (s, 1h), 7.76 (d, j = 8.0 hz, 1h), 7.687.54 (m, 3h), 7.427.35 (m, 1h), 3.673.58 (m, 2h), 3.483.35 (m, 3h), 2.902.80 (m, 2h), 2.282.19 (m, 2h), 1.671.53 (m, 2h) ; esi ms m / z 453 [m + h ] ; hplc > 99% purity (auc), tr = 12.0 min (method b). compound 53 was prepared according to a similar procedure described for the synthesis of 52. mp 175181 c ; h nmr (500 mhz, dmso - d6) 14.09 (bs, 1h), 11.09 (bs, 1h), 8.77 (d, j = 9.0 hz, 1h), 8.42 (d, j = 2.5 hz, 1h), 8.04 (dd, j = 9.0, 2.5 hz, 1h), 7.77 (d, j = 8.0 hz, 1h), 7.677.60 (m, 2h), 7.427.37 (m, 1h), 3.723.64 (m, 2h), 3.523.46 (m, 2h), 3.453.32 (m, 1h), 3.20 (s, 3h), 2.922.84 (m, 2h), 2.282.20 (m, 2h), 1.691.59 (m, 2h) ; esi ms m / z 497 [m + h ] ; hplc > 99% purity (auc), tr = 10.6 min (method b). step a. a solution of (3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)[c]pyrrole-2(1h)-carbonyl chloride (49, 0.300 g, 0.94 mmol) in 7 n nh3 in ch3oh (4.0 ml) was stirred at rt for 1 h. the mixture was concentrated under reduced pressure to provide (3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)hexahydrocyclopenta[c]pyrrole-2(1h)-carboxamide as a white solid (0.323 g, > 99%) : esi ms m / z 299 [m + h ]. step b. a mixture of (3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)hexahydrocyclopenta[c]pyrrole-2(1h)-carboxamide (0.100 g, 0.33 mmol), methyl 2-chloronicotinate (0.087 g, 0.50 mmol), cs2co3 (0.134 g, 0.47 mmol), pd(oac)2 (0.022 g, 0.033 mmol), and racemic binap (0.042 g, 0.067 mmol) in toluene (4 ml) was heated at reflux for 2 h. the mixture cooled to rt and was filtered through celite. the filtrate was washed with brine (3 30 ml) and concentrated under reduced pressure. the resulting residue was chromatographed over silica gel (05% ch3oh in ch2cl2 with 0.01% nh4oh) to give methyl 2-((3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole-2-carboxamido)nicotinate as a light orange film (0.047 g, 31%) : h nmr (300 mhz, dmso - d6) 10.41 (br s, 1h), 8.69 (dd, j = 4.8, 1.8 hz, 1h), 8.32 (dd, j = 7.8, 1.8 hz, 1h), 7.61 (d, j = 7.8 hz, 1h), 7.577.47 (m, 2h), 7.317.27 (m, 1h), 7.00 (dd, j = 7.8, 4.8 hz, 1h), 3.95 (s, 3h), 3.843.74 (m, 2h), 3.683.60 (m, 2h), 3.583.43 (m, 1h), 2.952.83 (m, 2h), 2.432.32 (m, 2h), 1.721.57 (m, 2h) ; esi ms m / z 434 [m + h ]. step c. to a solution of methyl 2-((3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole-2-carboxamido)nicotinate (0.039 g, 0.090 mmol) in thf (4.0 ml) and ch3oh (1.9 ml) was added a solution of liohh2o (0.037 g, 0.90 mmol) in h2o (1.1 ml). the mixture was stirred at rt for 3 h, was then neutralized with 2 n hcl, and was extracted with ch2cl2 (4 20 ml). the combined organic extracts were concentrated under reduced pressure and the resulting residue was chromatographed by reverse phase column chromatography (isco redisep gold 12 g c18 reverse phase column, 060% ch3cn in h2o) to give 2-((3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole-2-carboxamido)nicotinic acid (54) as a white solid (0.021 mg, 55%) : mp 129133 c ; h nmr (300 mhz, dmso - d6) 8.458.30 (m, 2h), 7.76 (d, j = 7.8 hz, 1h), 7.707.60 (m, 2h), 7.457.34 (m, 1h), 7.177.09 (m, 1h), 3.673.61 (m, 2h), 3.523.46 (m, 2h), 3.453.35 (m, 2h), 2.84 (m, 2h), 2.26 (m, 2h), 1.67 (m, 2h) ; esi ms m / z 420 [m + h ]. hplc > 99% purity (auc), tr = 13.6 min (method c). step a. to a solution of (3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)hexahydrocyclopenta[c]pyrrole-2(1h)-carbonyl chloride (49, 0.170 g, 0.53 mmol) in thf (3.0 ml) were added i - pr2net (0.064 g, 0.53 mmol) and methyl 4-aminonicotinate (0.081 g, 0.53 mmol), and the resulting mixture was heated at reflux for 4 h. the mixture was cooled to rt, was diluted with h2o (20 ml), and was extracted with etoac (3 30 ml). the resulting residue was chromatographed over silica gel (05% ch3oh in ch2cl2 with 0.1% nh4oh) to give methyl 4-((3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole-2-carboxamido)nicotinate as a white solid (0.140 g, 60%) : h nmr (300 mhz, dmso - d6) 10.46 (br s, 1h), 8.98 (d, j = 0.3 hz, 1h), 8.53 (d, j = 6.0 hz, 1h), 8.46 (d, j = 6.3 hz, 1h), 7.79 (d, j = 8.1 hz, 1h), 7.687.59 (m, 2h), 7.437.35 (m, 1h), 3.91 (s, 3h), 3.753.61 (m, 2h), 3.523.35 (m, 3h), 2.942.81 (m, 2h), 2.312.17 (m, 2h), 1.721.56 (m, 2h) ; esi ms m / z 434 step b. to a mixture of methyl 4-((3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole-2-carboxamido)nicotinate (0.138 g, 0.31 mmol) in thf (6.2 ml) and ch3oh (3.2 ml) was added a solution of liohh2o (0.130 g, 3.11 mmol) in h2o (1.6 ml). the mixture was stirred at rt for 3 h, was then acidified to ph 4 with 2 n hcl, and was diluted with h2o (50 ml). the resulting solids were collected by filtration and dried to provide 4-((3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole-2-carboxamido)nicotinic acid (55) as a light yellow solid (0.130 g, > 99%) : mp 245255 c dec ; h nmr (500 mhz, dmso - d6) 8.92 (m, 1h), 8.53 (d, j = 6.5 hz, 1h), 8.44 (d, j = 7.5 hz, 1h), 7.76 (d, j = 8.0 hz, 1h), 7.677.59 (m, 2h), 7.427.36 (m, 1h), 3.753.62 (m, 2h), 3.532.79 (m, 4h), 2.87 (m, 2h), 2.27 (m, 2h), 1.67 (m, 2h) ; esi ms m / z 420 [m + h ] ; hplc > 99% purity (auc), tr = 12.5 min (method g). step a. to a 0 c cooled solution of h2so4 (0.5 ml) in ch3oh (5 ml) was slowly added 4-amino-6-methylnicotinic acid (0.200 g, 1.31 mmol), and the mixture was heated at reflux for 16 h. the mixture was cooled to rt and was poured into ice water and neutralized with solid na2co3. the aqueous mixture was extracted with ch2cl2 (3 30 ml) and the organic extracts were dried over na2so4, filtered, and concentrated to give methyl 4-amino-6-methylnicotinate as an off - white solid (0.120 g, 54%), which was used as is in the next step. step b. to a solution of methyl 4-amino-6-methylnicotinate (0.120 g, 0.72 mmol) in dmf (10 ml) cooled to 0 c was added nah (60% in mineral oil, 0.035 g, 0.86 mmol) and the resulting solution was stirred at 0 c for 30 min. a solution of (3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)hexahydrocyclopenta[c]pyrrole-2(1h)-carbonyl chloride (2, 0.229 g, 0.72 mmol) in dmf (2 ml) was added and the mixture stirred at rt for 2 h. the mixture was carefully diluted with h2o (30 ml) and extracted with etoac (4 30 ml). the combined organic extracts were washed with brine (4 30 ml) and concentrated under reduced pressure. the resulting residue was chromatographed over silica gel (010% ch3oh in ch2cl2) to give methyl 2-(6-methyl-4-((3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole-2-carboxamido)pyridin-3-yl)-2-oxoacetate as a white solid (0.043 g, 13%). step c. to a solution of methyl 2-(6-methyl-4-((3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole-2-carboxamido)pyridin-3-yl)-2-oxoacetate (0.040 g, 0.080 mmol) in thf (3 ml) was added a solution of liohh2o (0.010 g, 0.24 mmol) in h2o (2 ml). the mixture was stirred at rt for 24 h, was then carefully neutralized with 2 n hcl, and was extracted with ch2cl2 (3 30 ml). the combined organic extracts were concentrated under reduced pressure and the resulting residue was chromatographed over silica gel (010% ch3oh in ch2cl2) to give 2-(6-methyl-4-((3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole-2-carboxamido)pyridin-3-yl)-2-oxoacetic acid (56) as a light - yellow solid (0.020 g, 52%) : h nmr (300 mhz, dmso - d6) 8.78 (m, 1h), 8.35 (m, 1h), 7.77 (m, 3h), 7.36 (m, 1h), 3.68 (m, 2h), 3.483.29 (m, 7h), 2.56 (m, 3h), 2.26 (m, 2h), 1.55 (m, 2h) ; esi ms m / z 434 [m + h ] ; hplc 97.2% purity (auc), tr = 13.9 min (method c). compound 57 was prepared according to a similar procedure described for the synthesis of 56. mp 175181 c ; h nmr (300 mhz, dmso - d6) 10.30 (bs, 1h), 9.27 (bs, 1h), 7.79 (m, 1h), 7.64 (m, 2h), 7.39 (m, 2h), 3.72 (m, 2h), 3.69 (m, 2h), 2.89 (m, 2h), 2.26 (m, 2h), 1.62 (m, 2h), 1.26 (m, 2h) ; esi ms m / z 421 [m + h ] ; hplc 95.2% purity (auc), tr = 14.9 min (method c). step a. to mixture of (3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)hexahydrocyclopenta[c]pyrrole-2(1h)-carbonyl chloride (49, 50 mg, 0.15 mmol) and et3n (60 l, 0.56 mmol) in dmf (4 ml) was added methyl 2-aminoacetate hydrochloride (24 mg, 0.189 mmol). the resulting mixture was stirred at rt for 18 h and then concentrated under reduced pressure to give crude methyl 2-((3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole-2-carboxamido)acetate (0.055 g), which was used as is in the next step : esi ms m / z 371 [m + h ]. step b. to a mixture of crude methyl 2-((3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole-2-carboxamido)acetate (0.055 g, 0.14 mmol) in thf (2 ml) was added a solution of liohh2o (57 mg, 1.35 mmol) in h2o (2 ml), and the resulting mixture was stirred at rt for 2 h. the mixture was acidified to ph 6 with 2 n hcl and extracted with ch2cl2 (3 50 ml). the combined organic extracts were dried over na2so4, filtered, and concentrated under reduced pressure. the resulting residue was chromatographed over silica gel (12 g redisep column, 010% ch3oh in ch2cl2 with 0.1% nh4oh) to give 2-((3ar,5r,6as)-5-(2-(trifluoromethyl)phenyl)octahydrocyclopenta[c]pyrrole-2-carboxamido)acetic acid (58) as a white solid (0.028 g, 55%) : 173176 c ; h nmr (300 mhz, dmso - d6) 7.747.59 (m, 3h), 7.447.35 (m, 1h), 6.29 (m, 1h), 3.613.00 (m, 7h), 2.74 (m, 2h), 2.23 (m, 2h), 1.53 (m, 2h) ; esi ms m / z 357 [m + h ] ; hplc > 99% purity (auc), tr = 16.4 min (method b). compound (s)-59 was prepared according to a similar procedure described for the synthesis of 58. mp 138141 c ; h nmr (300 mhz, dmso - d6) 7.787.56 (m, 3h), 7.497.28 (m, 1h), 6.22 (m, 1h), 3.93 (m, 1h), 3.503.23 (m, 5h), 2.86 (m, 2h), 2.20 (m, 2h), 1.56 (m, 2h), 1.341.13 (m, 3h) ; esi ms m / z 371 [m + h ] ; hplc 98.5% purity (auc), tr = 12.0 min (method b). compound (r)-60 was prepared according to a similar procedure described for the synthesis of 58. mp 141145 c ; h nmr (300 mhz, dmso - d6) 7.787.56 (m, 3h), 7.497.28 (m, 1h), 6.17 (m, 1h), 389 (m, 1h), 3.503.20 (m, 5h), 2.79 (m, 2h), 2.21 (m, 2h), 1.56 (m, 2h), 1.27 (m, 3h) ; esi ms m / z 371 [m + h ] ; hplc 97.0% purity (auc), tr = 11.9 min (method b). compound (s)-61 was prepared according to a similar procedure described for the synthesis of 58. mp 109114 c ; h nmr (300 mhz, dmso - d6) 7.67 (m, 3h), 7.49 (m, 3h), 7.34 (m, 3h), 6.55 (m, 1h), 5.06 (m, 1h), 3.503.20 (m, 5h), 2.78 (m, 2h), 2.34 (m, 2h), 1.62 (m, 2h) ; esi ms m / z 433 [m + h ] ; hplc 98.6% purity (auc), tr = 16.3 min (method b). compound (r)-62 was prepared according to a similar procedure described for the synthesis of 58. mp 109112 c ; h nmr (300 mhz, dmso - d6) 7.68 (m, 3h), 7.42 (m, 3h), 7.297.16 (m, 3h), 6.40 (m, 1h), 4.90 (m, 1h), 3.523.21 (m, 5h), 2.75 (m, 2h), 2.27 (m, 2h), 1.56 (m, 2h) ; esi ms m / z 433 [m + h ] ; hplc 98.3% purity (auc), tr = 16.3 min (method b). analogue binding affinities for rbp4 were measured using our previously reported scintillation proximity assay (spa), which measured competitive displacement of radiolabeled retinol. briefly, human rbp4 was biotinylated using the ez - link sulfo - nhs - lc - biotinylation kit from pierce (rockford, il) following the manufacturer s recommendations. binding experiments were performed in a final assay volume of 100 l per well in spa buffer (1 pbs, ph 7.4, 1 mm edta, 0.1% bsa, 0.5% chaps). the reaction mix contained 10 nm h - retinol (48.7 ci / mmol ; perkinelmer, waltham, ma), 0.3 mg / well streptavidin - pvt beads, 50 nm biotinylated rbp4. radio counts were measured using chameleon plate reader (hidex oy, turku, finland) following overnight incubation at 4 c. the ability of compounds to antagonize the retinol - dependent rbp4-ttr interaction was measured using the htrf assay. maltose binding protein - tagged rbp4 expressed in e. coli and untagged ttr were used in this assay. ttr was directly labeled with eu cryptate - nhs using the htrf cryptate labeling kit from cisbio (bedfored, ma) following the manufacturer s recommendations. the htrf assay was performed in a final assay volume of 16 l per well. the reaction buffer contained 10 mm tris - hcl, ph 7.5, 1 mm dtt, 0.05% np-40, 0.05% prionex, 6% glycerol, and 400 mm kf. each reaction contained 60 nm mbp - rbp4 and 2 nm ttr - eu along with 26.7 nm anti - mbp antibody conjugated with d2 (cisbio). the rbp4-ttr interaction was stimulated by the addition of 1 m all - trans retinol. htrf signal was measured in the spectramax m5e multimode plate reader (molecular devices, sunnyvale, ca) following the overnight 4 c incubation. fluorescence was excited at 337 nm ; emission was measured at 668 and 620 nm with 75 s counting delay. the tr - fret signal was expressed as the ratio of fluorescence intensity : (flu668/flu620) 10 000.	accumulation of lipofuscin in the retina is associated with pathogenesis of atrophic age - related macular degeneration and stargardt disease. lipofuscin bisretinoids (exemplified by n - retinylidene - n - retinylethanolamine) seem to mediate lipofuscin toxicity. synthesis of lipofuscin bisretinoids depends on the influx of retinol from serum to the retina. compounds antagonizing the retinol - dependent interaction of retinol - binding protein 4 (rbp4) with transthyretin in the serum would reduce serum rbp4 and retinol and inhibit bisretinoid formation. we recently showed that a1120 (3), a potent carboxylic acid based rbp4 antagonist, can significantly reduce lipofuscin bisretinoid formation in the retinas of abca4/ mice. as part of the nih blueprint neurotherapeutics network project we undertook the in vitro exploration to identify novel conformationally flexible and constrained rbp4 antagonists with improved potency and metabolic stability. we also demonstrate that upon acute and chronic dosing in rats, 43, a potent cyclopentyl fused pyrrolidine antagonist, reduced circulating plasma rbp4 protein levels by approximately 60%.
the dentigerous cyst initially is always associated with the crown of an impacted, embedded, or unerupted tooth. it develops around the crown of the unerupted tooth by the expansion of the follicle when fluid collects or space occurs between the reduced enamel epithelium and the enamel of an impacted tooth. the proportion of 6- to 7-year - old children affected with dentigerous cysts is only 9.1%. dentigerous cysts occur predominantly in the third molar region of the mandible, followed in frequency by maxillary canine, maxillary third molar, and rarely in relation to maxillary central incisor. a 7-year - old boy reported to the department of paediatric dentistry at our institute with the chief complaint of a painless swelling in the left upper jaw since 6 months [figure 1 ]. on asking for a detailed history, the patient 's guardian reported that the kid was treated for the same problem by a local dentist by the extraction of few teeth in the same area with no relief of problem few months back. on general physical examination, a clinical intraoral examination revealed a diffuse swelling extending from the buccal vestibule distal to the maxillary left deciduous lateral incisor to the maxillary left permanent first molar. the swelling was ill defined, firm on palpation, non - tender, and measured about 3.5 2.5 cm extending into the maxillary vestibule. these teeth were probably extracted by the local dentist assuming it as a case of dental abscess arising from these teeth. preoperative intraoral view the patient had a pre - existing lateral cephalometric radiograph and an orthopantomograph [figures 2 and 3 ]. both the radiographs revealed a partially formed and unerupted tooth resembling canine with a radiolucent area surrounding it. on aspiration of the swelling, it yielded straw - colour fluid which was sent for biochemical investigation, the result of which was consistent with the diagnosis of a cystic lesion. a provisional diagnosis of the dentigerous cyst was arrived at based on clinical and radiological features. lateral cephalometric view enucleation of the cyst was chosen as the treatment of choice as the patient 's guardians were not ready for a prolonged treatment period. the treatment consisted of extraction of the maxillary left permanent canine, along with en masse removal of the dentigerous cyst. the cystic lining was attached to the cementoenamel junction of the maxillary left permanent canine. the gross specimen consisted of an irregular, wrinkled soft grey piece of a cystic sac measuring approximately 4.5 3.5 0.5 cm, containing the developing canine tooth bud within it [figures 4 and 5 ]. the patient was asked to return for clinical follow - up once in 15 days. after 7 months, intra - oral healing was normal it [figure 6 ] and no evidence of bone resorption or radiolucent lesion were observed [figure 7 ]. the patient was advised for longer follow - up periods for prosthetic and orthodontic rehabilitation. dentigerous cysts of maxilla are commonly associated with the maxillary third molar and not with a canine tooth. in the present case, there have been previous case reports of a dentigerous cyst with a deciduous tooth and with a supernumerary tooth. a case of a large maxillary cyst involving the whole sinus and producing epiphora has been reported by atlas. dentigerous cysts are usually solitary, benign odontogenic cysts associated with the crowns of unerupted teeth. it is stated that the dentigerous cyst develops by the accumulation of fluid either between the reduced enamel epithelium and the enamel or in between layers of the enamel organ. this fluid accumulation occurs as a result of the pressure exerted by an erupting tooth on an impacted follicle, which obstructs the venous outflow and thereby induces a rapid transudation of serum across the capillary wall. toller stated that the likely origin of the dentigerous cyst is the breakdown of proliferating cells of the follicle after impeded eruption.. these cysts usually occur in the late second and third decades, are discovered on routine radiography, and predominantly involve mandibular third molars. the second type is inflammatory origin and occurs in immature teeth as a result of inflammation from a non - vital deciduous tooth. bloch suggested that the origin of the dentigerous cyst is the overlying necrotic deciduous tooth. the resultant periapical inflammation will spread to involve the follicle of an unerupted permanent successor ; inflammatory exudates ensue and result in dentigerous cyst formation. these cysts are diagnosed in the first and early part of the second decade either on routine radiographic examination or when the patient complains of swelling or pain. we believe that our case might be classified as the second type of dentigerous cyst. treatment of a dentigerous cyst depends on size, location, and disfigurement and often requires variable bone removal to ensure a total removal of the cyst. even though marsupialisation of the cyst is the treatment of choice for dentigerous cyst in children in order to give a chance to the unerupted tooth to erupt, the major disadvantage of marsupialisation is that pathologic tissue is left in situ, without a thorough histologic examination. although the tissue taken from the window created can be submitted for pathologic examination, there is a possibility of a more aggressive lesion in the residual tissue. but, in this case, as the tooth was almost displaced up to the roof of the developing maxillary sinus far from the alveolar arch with a questionable viability, enucleation with the removal of the displaced tooth was favoured. in summary, dentigerous cyst development associated with an unerupted permanent tooth is not uncommon. dentigerous cysts of maxilla are usually associated with the maxillary third molar and not with a canine tooth. in the present case, the cyst was associated with canine and was almost involving the developing maxillary sinus of the 7-year - old child. these findings are not common in dentigerous cysts, and hence, this case is reported.	dentigerous cysts are the most common odontogenic and developmental cysts arising in the jaws. in this article, we report a rare case of dentigerous cyst arising from an unerupted canine which had invaded a part of the maxilla in a 6-year - old child. the clinical features, radiographic presentation, and the treatment modality are described.
a distinct phenotype within this group is cerebellar ataxia associated with hypogonadotropic hypogonadism ; this association has been found in two diseases, gordon holmes (ghs) and boucher neuhauser syndromes. ghs (mim 212840) is a rare phenotype, first described in 1907 by holmes, and comprises adolescence or early adulthood age of onset, isolated idiopathic hypogonadotropic hypogonadism and progressive neurodegenerative manifestations including cognitive impairment, dysarthria, cerebellar ataxia. recently, mutations in genes involved in ubiquination (rnf216, otud4, stub1) were identified in families with ghs. margolin. identified mutations in the rnf216 gene either alone or in combination (digenic mutations) with mutations in otud4 as a cause of ghs. we report two patients with ghs caused by a novel rnf216 mutation as the first follow up report on rnf216-related ghs, and show interfamilial variability of phenotype supporting the previously reported rnf216-related cases. our study includes 2 out of 9 brothers of a consanguineous middle eastern parents (figure 1), presented with poor development of secondary sexual characteristics and ataxia. a 26-year - old male, presented at the age of 20 with poor development of secondary sexual characteristics, independent for his activities of daily living (adls). his examination revealed poor facial hair growth, gynecomastia hypogenitalism, and mild cerebellar ataxia. his examinations showed low serum testosterone level of 0.12 nmol / l (reference range for his age is 9.9 - 27.8 nmol), free androgen index 1.4% (14.8 - 94.8) and low luteinizing hormone level. evaluation for bone growth using hand x - ray showed that the metacarpal heads and growth plates of the phalanges are not fused yet. the bone age is about 14 years to 15 years, chronological age at time of the study was 20 years (figure 2). brain magnetic resonance imaging (mri) revealed mild cerebellar atrophy, significant subcortical white matter confluent patchy areas of hyperintensity on t2-weighted imaging and fluid - attenuated inversion recovery (flair) imaging, and partial empty sella with no mass lesions identified (figure 3). a 31 year old male, developed ataxic gait at the age of 24 with features of poor development of secondary sexual characteristics. his disease progressively worsened with clear cognitive deterioration and need for support in daily activities to the degree that he became totally dependent. his examination revealed no facial hair, hypogenitalism, gynecomastia, cognitive impairment, dysarthria, broken saccadic eye movement, appendicular and truncal cerebellar ataxia, and exaggerated deep tendon reflexes. nmol / l (9.9 - 27.8 nmol), free androgen index 1.5% (14.8 - 94.8). x - ray study of his hands at the age of 25 years showed that the growth plate of the distal radius and ulna are not fused yet where it normally starts at the age of 17 to 19 and maximally should be fused by the age of 20 (figure 2). brain mri revealed significant cerebellar atrophy, subcortical white matter patchy areas of hyperintensity on t2-weighted imaging and fluid - attenuated inversion recovery (flair) imaging, and normal pituitary gland (figure 3). reproductive endocrine evaluation in both patients revealed only low levels of lh and testosterone, no other pituitary hormones were affected. both showed good response to treatment regarding secondary sexual characteristics, in the form of facial, axillary and pubic hair growth, and deepening of voice. the shared autozygome of the two individuals was checked against known disease genes but no good candidate was identified (rnf216 had not been identified). therefore, we proceeded with whole - exome sequencing and filtered the resulting novel variants by the coordinates of the shared autozygome. this resulted in the identified of a novel splicing variant in rnf216 that is likely to abolish the canonical splice site at the junction of exon / intron 13 (nm_207111.3:c.2061g > a). this variant was absent in ~600 ethnically matched exomes, in the 1000 genomes and exac browser. the shared autozygome of the two individuals was checked against known disease genes but no good candidate was identified (rnf216 had not been identified). therefore, we proceeded with whole - exome sequencing and filtered the resulting novel variants by the coordinates of the shared autozygome. this resulted in the identified of a novel splicing variant in rnf216 that is likely to abolish the canonical splice site at the junction of exon / intron 13 (nm_207111.3:c.2061g > a). this variant was absent in ~600 ethnically matched exomes, in the 1000 genomes and exac browser. rnf216 (ring finger protein 216) is an e3 ubiquitin ligase involved in regulation of autophagy witch is a cellular process concerned with cellular homeostasis via the degradation of the cell own cytosolic components or protein aggregates. margolin. identified digenic homozygous mutations in rnf216 and otud4 in three affected siblings of a consanguineous family originally from the middle east, as well as a compound heterozygous truncating and missense mutations in rnf216 and single mutations in another family. homozygous stub1 mutation have recently been reported in a consanguineous family with ghs thus expanding the genetic heterogeneity of this condition. the phenotype of rnf216-mediated neurodegeneration have been expanded recently to include huntington - like disorder after identifying of rnf216 mutation in belgian families presented initially with prominent chorea, behavioral problems, severe dementia and low gonadotropin serum levels. the novel mutation we identified in this report further expands the allelic heterogeneity of this neurodegenerative disease. our patients presented in their early adulthood with idiopathic hypogonadotropic hypogonadism and no other pituitary abnormalities. we observed in patient 1, normal cognitive functions and only mild cerebellar ataxia consistent with the radiological evidence of mild cerebellar atrophy, although the white matter involvement was significant. in contrast, patient 2 suffered from a more progressive phenotype manifesting as dysarthria, cerebellar ataxia and cognitive impairment with radiological evidence of prominent cerebellar atrophy but paradoxically milder picture of leukodystrophy in comparison with patient 1 (figure 3). we compared the clinical features of our patients to other patients with ghs caused by rnf216 mutation reported by margolin. and we noticed that they share same age of onset, cerebellar ataxia, lack of nystagmus, cerebellar atrophy, white matter changes and normal pituitary appearance, of note that our first patient who had partial empty sella which had not been reported previously. in summary, we report two patients with ghs caused by a novel rnf216 mutation and show interfamilial variability of phenotype supporting the previously reported rnf216-related cases.	gordon holmes syndrome (ghs) is a distinct phenotype of autosomal recessive cerebellar ataxia, characterized by ataxia, dementia, reproductive defects and hypogonadism ; it has been recently found to be associated with rnf216 mutation. we performed whole - exome sequencing and filtered the resulting novel variants by the coordinates of the shared autozygome. we identified a novel splicing variant in rnf216 that is likely to abolish the canonical splice site at the junction of exon / intron 13 (nm_207111.3:c.2061g > a). we herein report two patients with ghs caused by a novel rnf216 mutation as the first follow up report on rnf216-related ghs, and show interfamilial variability of phenotype supporting the previously reported rnf216-related cases.
in malaria endemic areas, factors such as poverty and poor environmental sanitation allow survival and proliferation of malaria vector [1, 2 ]. the emergence and rapid spread of resistance both of the malaria vector (female anopheles mosquito) to insecticides and of the pathogenic plasmodia to antimalarial drugs are the major causes of increased malaria disease morbidity and mortality. the malaria vectors predominantly found in the northern and southern regions of nigeria include anopheles gambiae, anopheles arabiensis, anopheles funestus, and anopheles melas. malaria is responsible for nearly half a million deaths worldwide annually. with a view to reducing the malaria burden, the world health organization (who)/ global malaria programme (gmp) promotes personal and communal control measures against the malaria vector known as the integrated vector control (ivc). ivc comprises the use of insecticide treated nets (itn), and other control measures such as netting of house doors/ windows, regular environmental sanitation (clearing of bushes and drains/ gutters around the house) to eliminate and reduce the burden of malaria vector [1, 2, 4 ]. in nigeria, the most common methods of malaria vector control include the use of window / door mosquito screens / netting, clearing of bushes / drains, mosquito repellants / insecticides and insecticide treated - bed nets (itn) [5, 6 ]. in the last decade, the itn has been observed to be a veritable tool of malaria vector control worldwide. however, its availability and regular usage in households have been major factors against the effectiveness of this malaria vector control strategy. the nigeria malaria indicator survey (mis) report of 2010 showed an overall itn ownership of 42.0% (75.0% ownership in areas with recent mass itn distribution campaign) and usage of 23.0% (41.0% utilization in areas with recent mass itn distribution campaign). since then, there has been increased mass campaigns to improve household ownership and utilization of itn in most countries in africa including nigeria [7 - 10 ]. the use of itn has been observed to reduce malaria morbidity and mortality, however, reports from some authors in africa showed varying results. for example afoakwah. observed a reduction in under - five mortality from malaria in northern ghana, while loha. did not find any influence of free mass distribution of itns on malaria morbidity in south ethiopia. although these studies assessed only itn usage against malaria morbidity and mortality, the differences in the results have been criticized on the basis of the methods applied in establishing the association between itn usage and the outcomes. for example, sleeping under the itn the night before the survey was regarded as usage. this may not be an objective assessment as individual who possessed the itn without sleeping in it until the night before a survey will be erroneously regarded as an itn user. again none of these studies assessed the impact of other vector control methods on malaria outcome in children. to improve on the itn utilization and ivc strategy in the communities, the national malaria elimination programme (nmep) in the last 5 years preceeding this study had instituted a scaled - up awareness programme on ivc strategy at all levels. to provide insight into the progress made so far on malaria vector control programme especially with regards to itn ownership and usage, this study aimed at documenting the malaria vector control practices of caregivers, itn usage by under - fives and factors that influence the use of itn by under - fives in households. due to paucity of studies on the impact of vector control on malaria health indices of under - fives in the study locale, this study evaluated the impact of vector control methods by caregivers on malaria health indices (severe malaria prevalence and mortality) of their under - fives presenting in a tertiary health institution in nigeria. the ivc does not have favourable impact on malaria health indices (severe malaria morbidity and mortality) in under - fives. the ivc have favourable impact on malaria health indices (severe malaria morbidity and mortality) in underfives. the ivc does not have favourable impact on malaria health indices (severe malaria morbidity and mortality) in under - fives. the ivc have favourable impact on malaria health indices (severe malaria morbidity and mortality) in underfives. the state lies within the south - south region of nigeria and the topography is that of tropical rain forest where malaria transmission is holoendemic and stable throughout the year [1 - 3 ]. the vegetation is mainly rain forest with some regions of creeks and swamp which support the breeding of the malaria vector (anopheles mosquito) especially anopheles gambiae and anopheles arabiensis. it is a cosmopolitan city where most inhabitants are civil servants, traders, artisans and farmers. this was a cross - sectional descriptive study carried out from june 2012 to july 2013. the study participants included caregivers and their apparently well - nourished children (6 - 59 months) who presented with malaria in the index tertiary health institution. malaria was confirmed in each child by microscopy following standard protocols. children excluded from the study were children who had clinical and/or laboratory evidence(s) of localized infection such as acute tonsillitis, otitis media, pneumonia, and urinary tract infection. the z - scores for weight - for - age (wfa) were calculated for each child using the revised who growth charts from the centre for disease control (cdc) as reference. children with wfa z - score of minus 2 standard deviation of the reference median value were regarded as acute under - weight malnutrition. malnutrition is associated with morbidities such as diarrhoea, pneumonia, urinary tract infection and sepsis ; and has an increased mortality. the tool was validated by extensive literature review and was pre - tested on 20 caregiver / child pairs who were excluded from the final analysis. the questionnaire sought information on the study participants ' demographic features, their knowledge and attitudes on malaria vector control practices. children with clinical features in keeping with who case definition of severe malaria were classified as severe malaria while children without such features were classified as uncomplicated malaria. children with severe malaria were admitted and treated according to the national guideline for management of severe malaria while those with uncomplicated malaria received full course of artemisinin - based combination therapy (act). the family social class was determined as described by olusanya. using mother 's level of education and the father 's occupation. in this method of classification of social class, information on child 's mother 's level of education and father 's occupation is required. specific score is then allotted to the father 's occupations as follows : 1, 2, or 3 ; and mother 's educational qualifications 0, 1 or 2 as shown below. the sum of these scores i.e from father 's occupation and mother 's educational qualification scores describes the family social class as high 1, high intermediate 2, middle 3, low intermediate 4, and low 5. this is then further interpreted as follows : upper social class for scores 1 and 2, middle social class for score 3 and lower social class for scores 4 and 5. households were categorized as small if they contained 5 individuals and large if they contained 6 individuals. ethical certificate for this study was obtained from the research and ethics committee of university of benin teaching hospital, benin city, nigeria ; protocol number adm / e 22/a/ vol.vii/ 741. the data obtained in this study was analysed using the statistical package for social sciences (spss) version 16.0 (chicago, illinois, usa). further analysis was by graphpad instat software (graphpad software inc, san digeo 92130, usa) where applicable. malaria health indices sought for in this study were malaria morbidity at presentation (severe malaria prevalence) and mortality during the acute phase of the illness (within 72 hours of presentation). such associations as the relationship between regular use of itn and sociodemographic characteristics of the study participants as well as malaria vector control practices of caregivers and malaria health indices (severe malaria prevalence and mortality) of their under - fives were analyzed using chi - square and fisher 's exact test where applicable. regular use of itn for the under - fives in this study was defined as sleeping in itn every night for 6 weeks preceeding presentation in the health facility and not just necessarily sleeping in the itn a night before the survey. six weeks is the longest expected intrinsic incubation period of plasmodium falciparum which is the commonest malaria parasite in the study locale [1, 2, 3 ] sleeping in the itn a night before the survey as it is conventionally used in some other studies as demonstration of itn usage was not employed in this study because such would not give objective assessment of impact of itn usage on malaria health indices (severe malaria and mortality). all children were recruited in the study the same day of presentation at the health facility. associations with p - values 0.05 were further analyzed with binary logistic regression model to identify factors that independently influenced the outcome variables severe malaria and mortality. in order to ensure correct specification of the model and how well the model fit the data available (reliability of the model), goodness - of - fit test was performed which showed that n = 2313, correlation coefficient (r) = -0.08, 95% ci = -0.12, -0.04 and r2 (the square of the explained sum of square of test) = 0.006 ; p < 0.0001(severe malaria) and p = 0.000 (mortality) respectively. this showed that the model has good fitness and reliable in predicting the desired outcomes i.e that the logit model has no omitted variables in failing to accept the null hypothesis. the tool was validated by extensive literature review and was pre - tested on 20 caregiver / child pairs who were excluded from the final analysis. the questionnaire sought information on the study participants ' demographic features, their knowledge and attitudes on malaria vector control practices. children with clinical features in keeping with who case definition of severe malaria were classified as severe malaria while children without such features were classified as uncomplicated malaria. children with severe malaria were admitted and treated according to the national guideline for management of severe malaria while those with uncomplicated malaria received full course of artemisinin - based combination therapy (act). the family social class was determined as described by olusanya. using mother 's level of education and the father 's occupation. in this method of classification of social class, information on child 's mother 's level of education and father 's occupation is required. specific score is then allotted to the father 's occupations as follows : 1, 2, or 3 ; and mother 's educational qualifications 0, 1 or 2 as shown below. the sum of these scores i.e from father 's occupation and mother 's educational qualification scores describes the family social class as high 1, high intermediate 2, middle 3, low intermediate 4, and low 5. this is then further interpreted as follows : upper social class for scores 1 and 2, middle social class for score 3 and lower social class for scores 4 and 5. households were categorized as small if they contained 5 individuals and large if they contained 6 individuals. ethical certificate for this study was obtained from the research and ethics committee of university of benin teaching hospital, benin city, nigeria ; protocol number adm / e 22/a/ vol.vii/ 741. the data obtained in this study was analysed using the statistical package for social sciences (spss) version 16.0 (chicago, illinois, usa). further analysis was by graphpad instat software (graphpad software inc, san digeo 92130, usa) where applicable. malaria health indices sought for in this study were malaria morbidity at presentation (severe malaria prevalence) and mortality during the acute phase of the illness (within 72 hours of presentation). such associations as the relationship between regular use of itn and sociodemographic characteristics of the study participants as well as malaria vector control practices of caregivers and malaria health indices (severe malaria prevalence and mortality) of their under - fives were analyzed using chi - square and fisher 's exact test where applicable. regular use of itn for the under - fives in this study was defined as sleeping in itn every night for 6 weeks preceeding presentation in the health facility and not just necessarily sleeping in the itn a night before the survey. six weeks is the longest expected intrinsic incubation period of plasmodium falciparum which is the commonest malaria parasite in the study locale [1, 2, 3 ] sleeping in the itn a night before the survey as it is conventionally used in some other studies as demonstration of itn usage was not employed in this study because such would not give objective assessment of impact of itn usage on malaria health indices (severe malaria and mortality). all children were recruited in the study the same day of presentation at the health facility. associations with p - values 0.05 were further analyzed with binary logistic regression model to identify factors that independently influenced the outcome variables severe malaria and mortality. in order to ensure correct specification of the model and how well the model fit the data available (reliability of the model), goodness - of - fit test was performed which showed that n = 2313, correlation coefficient (r) = -0.08, 95% ci = -0.12, -0.04 and r2 (the square of the explained sum of square of test) = 0.006 ; p < 0.0001(severe malaria) and p = 0.000 (mortality) respectively. this showed that the model has good fitness and reliable in predicting the desired outcomes i.e that the logit model has no omitted variables in failing to accept the null hypothesis. age (mean sd) of the children was 20.7 14.0 months and that of their caregivers was 31.2 6.0 years. among the 329 children, 191/329 (58.1%) were males and 138/329 (41.9%) females. majority of the caregivers had secondary 128/329 (38.9%) and tertiary 121/329 (36.8%) education ; 111/329 (33.7%) belonged to the upper social class, 129/329 (39.2%) to the middle and 89/329 (27.1%) to the lower social class as shown in table i. socio - demographic characteristics of the study participants. three hundred and eighteen (96.7%) caregivers mentioned that malaria is caused by mosquitoes and 312/329 (94.8%) caregivers stated that the disease is preventable. the most common malaria vector control method mentioned by the caregivers was the use of itn by 92.0%, however, only about a quarter of these caregivers regularly used the itn for their under - fives. other methods of malaria vector control mentioned and practiced by the caregivers is shown in figure 1. malaria vector control methods mentioned and practiced by the caregivers. concerning itn ownership, 177 (53.8%) of the 329 caregivers possessed at least one itn in their homes while 152 (46.2%) did not have any itn. most of the itns (52.5%) were obtained during the itn campaign programme in the state and 18.1% purchased their itns. the mean cost of one itn was one thousand, five hundred and thirty, 95% ci (1242.8, 1817.2) naira (equivalent to usd 10.00). forty - three (24.3%) of the 177 itn owners stated that their children regularly sleep in it, while 134 (75.7%) did not regularly use the itn. the mean duration of use of itn by the children from time of acquisition of the itn to the time of this study was 13.5, (95% ci 11.7- 15.3) months. of those who did not regularly use the itn, 86/134 (64.0%) gave no reasons for not using itns while 16 (12.0%), said that it was too hot to sleep in. reasons given by caregivers for not using the insecticide treated nets for their under - fives. table ii shows factors associated with itn regular use for the children by 177 caregivers that owned the itns. significantly more caregivers from the lower social class regularly used itn when compared with caregivers from the middle and upper social classes (= 7.09, df = 2, p = 0.03). also households that owned two or more itns were statistically significantly more likely to use itn regularly when compared with households that owned only one itn (= 9.61, df = 2, p = 0.01). factors associated with regular use of insecticide treated nets for the children by 177 itn owners. odds ratio = 0.4, itn = insecticide treated nets prevalence of severe malaria in this study was 36.2%. of the 329 children, 17 (5.2%) children died ; a mortality rate of 52 per 1000. table iii shows the relationship between malaria vector control methods utilized by the 329 caregivers and the study outcomes. significantly more children whose caregivers did not use in - door insecticide spray (46.0%) (= 4.93, p = 0.03), nor had nets on the doors / windows of their houses (47.0%) (= 4.17, p = 0.04) and, who did not practice regular environmental sanitation (44.0%) (= 6.51, p = 0.01) presented with severe malaria when compared to children whose caregivers practiced these control methods. mortality was significantly lower in children who used itn regularly (p = 0.01) as well as in children whose caregivers used indoor insecticide spray (= 3.92, p = 0.048), used nets on the doors / windows of their houses (= 5.00, p = 0.03), and whose caregivers practiced regular environmental sanitation (p = 0.02) ]. the duration of use of itn was not significantly associated with severe malaria (= 5.64, p = 0.65, 95%cl = 0.58, 0.72), and, all the children that died had never slept in itn. malaria prevention methods used by the 329 caregivers and their association with study outcomes. the logistic regression model using the combined malaria vector control practices of caregivers as dependent variables and the study outcomes (severe malaria and mortality) as independent the model showed that sleeping in itn regularly, use of insecticide spray, regular environmental sanitation and netting of doors / windows used in combination by caregivers significantly predicted low prevalence of severe malaria. the final logistic regression model of malaria vector control methods utilized by the 329 caregivers and their predictor on the study outcomes (adjusting for demographic factors). or = odds ratio, = measure of itn regular use of itn, is use of insecticide spray, ndw netting of doors / windows and res regular environmental sanitation (clearing bushes and drainages around the house) ; constant for the model was -0.28 (0.8) 0.41 for severe malaria and 1.15 (3.1) 0.01 for mortality. most of the malaria vector control methods mentioned and practiced by the caregivers was similar to previous documentation by some authors in nigeria [5, 6 ]. these included netting of house doors and windows, use of insecticide sprays and environmental sanitation. the high knowledge of malaria vector control methods especially of the use of itn could be attributed to the intensified itn campaign programme by the nmep at the local, state and federal levels in nigeria [7, 10 ]. in 5 years preceeding this study, over 10 million itn including the long lasting insecticide - treated nets (llin) had been distributed to different households in nigeria through the house - to - house distribution campaign and the various antenatal/ immunization clinics in the communities [7, 10 ]. despite this positive finding on knowledge of malaria vector control methods, there is still a huge gap between knowledge and practice of these methods especially as regards to the use of itn. in this present study, there was a gap of over 50.0% between itn ownership (53.8%) and regular usage of 24.3% in under-5s. nigeria is a tropical country and the environmental temperature in the study locale usually ranged between 28oc and 38oc [3, 18 ]. this is compounded by lack of basic amenities such as electric power and good housing. sleeping in itn is usually uncomfortable in hot weather especially in absence of fans and air - conditioners as well as in overcrowded houses with its antecedent poor ventilation. the number of itn available in each household has been found to correlate positively with its use in under- 5s [20, 21 ]. although effort has been made by the nmep and other malaria control partners to improve on itn coverage within the communities, but two itns given to each household during the distribution campaign is grossly inadequate[7, 10, 19 ]. the current malaria indicator survey (mis) report still stated that the average number of llin per household in nigeria was 1.6 this value grossly falls short of the itn universal distribution goal of at least one net for every two persons. households that wished to purchase their own llin were unable to afford it due to financial constraints. this is because the mean cost of one itn observed in this study was usd 10.00 which was far beyond the reach of many of the study participants. most of the study participants were from the lower social class ; and these groups also had the lowest itn ownership rate when compared with those from middle and upper classes. these also were unlikely to access health faciies where they could obtain the llin during antenatal and immunization clinics. therefore, for effective malaria control, universal coverage of itn and intensified education on its usage for all individuals at risk of malaria in endemic regions remains the goal. it has been described in literature that p. falciparum takes 8 - 11 days to complete the mosquito phase at an optimal ambient temperature of 28c and 22 days at 20c. it suffices to say that the extrinsic incubation period of p. falciparum may be shorter at the environmental temperature of the study locale which ranged between 28.0 c and 38.0c. this assertion coupled with poor environmental sanitation and poverty enhance mosquito breeding sites, allow survival and proliferation of malaria vector and malaria parasite [1, 3, 4 ]. most children who presented with severe malaria as well as those who died from the disease in this study were from the lower social class. despite the beneficial effect of itn as a veritable tool for malaria vector control, a multi - prong approach to addressing other factors such as basic amenities, environmental sanitation and poverty the ivc / m advocated by the who includes environmental management strategies in view of eliminating mosquito breeding sites (regular environmental sanitation), use of chemicals such as use of in - door insecticide spray, physical barrier methods such as netting of doors/ windows in houses and regular use of itn [1, 3, 4 ]. these combined malaria vector control methods significantly predicted low incidence of severe malaria when compared with single vector control methods. although there is paucity of studies on relationship between ivc / m and malaria outcomes (morbidity and mortality), the observation in this study that combined malaria vector control predicted low incidence of severe malaria is in keeping with the who assertion that ivc / m truly reduces malaria outcomes (morbidity and mortality). although, most caregivers had good knowledge of malaria vector control, their proportion that possessed and used itn for malaria control was still low. ivc / m is a veritable tool for malaria vector control, there should be intensified advocacy for scaling - up of itn distribution and education on utilization of itn and these integrated malaria vector control methods.	summarybackground and aims.integrated vector control especially use of insecticide - treated bed nets have been reported as effective malaria preventive strategies. this study aimed at documenting factors that influence regular use of insecticide - treated nets in under - fives and impact of vector control methods on malaria outcome (severe malaria prevalence and mortality) in under - fives presenting in a tertiary health institution in nigeria.methods.cross-sectional study carried out from june 2012 and july 2013. data was obtained by researcher - administered questionnaire and malaria was confirmed in each child by microscopy.results.329 caregiver (31.2 6.0 years) /child (20.7 14.0 months) pair were recruited. netting of doors / windows (80.0%) was the most practiced vector control method. 177 (53.8%) caregivers possessed insecticide - treated bed nets, and only a quarter of their under-5s regularly sleep in these nets. children from lower social class statistically significantly sleep in the nets (p = 0.03), however, presence of 2 or more nets in a household independently predicted its regular use for the under-5s (= 1.09, or = 3, p = 0.02). prevalence of severe malaria was 36.2% and mortality was 52 per 1000. combination of regular use of insecticide treated nets, environmental sanitation, indoor insecticide spray and netting of household doors / windows significantly predicted low prevalence of severe malaria compared to each of the malaria vector control methods used singly by the caregivers (= 1.66, or = 5.0, p = 0.04).conclusions.integrated vector control remains the most effective method of malaria vector control at the community.
in recent years, various thermoplastic materials have been developed for the fabrication of no - clasp removable prostheses and complete dentures. the flexural and impact strength of polyamide polymers are higher than those of heat - cured denture base materials.12345 nevertheless, the repair strength of auto - polymerized resins to polyamide polymers is too weak, and the repair mostly requires laboratory procedures.6789 denture base repair or relining is mandatory for the prolonged service life of the prosthesis. auto - polymerized reline resins are based on poly (methyl methacrylate) (pmma) or poly (ethyl methacrylate) (pema) copolymer, which can effectively bond to heat - cured denture base materials due to the relatively similar chemical compositions.10111213 polyamide is a thermoplastic material produced by a condensation reaction between a diamine and a dibasic acid.714 the chemical resistance of polyamide polymers is due to their high degree of crystallinity ; the penetration of monomer molecules and other resin primers into the polymers is difficult.3815 therefore, nylon polymers do not provide sufficient bond strength to auto - polymerized resins for repairing fractured denture or replacing dislodged denture teeth.89 despite the different existing surface treatment methods used to improve the bond strength of auto - polymerized reline materials to common heat - cured denture base resins, researches dealing with the creation of new polyamide polymers with an improved adhesion properties continue to be active.11011121316 previous studies89 indicated that silica coating followed by silanization increased the bond strength between auto - polymerized resin and polyamide polymers. in air blast, the collision of the accelerated silica - coated alumina particles with the substrate results in the kinetic energy transfer and microscopic melting of the substrate, leading to particle penetration and retention by adhesive force.17 although, the initial bond is reported to exhibit satisfying strength, it is n't reliable since the strength is decreased after aging procedures.918 therefore, it is essential to find a broadly applicable and cost - effective approach to overcome such problems and to promote bonding. the solvent - assisted bonding is another method for bonding two substrates that has been widely studied and utilized for repairing thermosetting acrylic resins.11016 although polyamide is a particularly chemical - resistant material, the presence of amide groups (-nhco-) makes it prone to absorb water or other solvents and form hydrogen bonds.1920 it is well recognized that the plasticization of polyamide matrix occurs in the presence of small amounts of polar molecules capable of hydrogen bonding.2122 the softening enhances the chain mobility and disrupts the hydrogen bond network of polyamides.151923 although acetic acids, propionic acids, and butyric acids with low dissociation constant are non - solvents, they promote the reaction through hydrogen bonding. in addition, they cause hydrolysis that breaks the cross - links and provides swelling generally similar to those of solvents.24 the hydrolytic degradation of polyamide in different environments has been extensively studied.20222526 acidic conditions have been observed to facilitate amide hydrolysis. the chemical effects that acid has on the hydrolysis of polyamide are amine scavenging and acid catalysis. according to previous studies,2027 polyamide hydrolysis reaches an equilibrium molecular status in the absence of oxygen. serpe.22 and chaupart.28 showed that significant degradation was achieved in strong acids, but the presence of oxygen was uncontrollable. moreover, no equilibrium was observed in the hydrolysis of polyamide chain leading to less swelling. the reports by hocker.24 showed that the hydrolysis of polyamide caused by small organic acids was accelerated significantly. the objective of the present study was to evaluate the effect of surface treatment with acetic acid on the bond strength of auto - polymerized resin to polyamides. the null hypothesis was that the application of acetic acid would not affect the bond strength of auto - polymerized resin to polyamide denture base material. a thermoplastic denture base material, a hard chairside reline resin, and an auto - polymerized acrylic resin were selected. 84 polyamide cylinders with the dimensions of 15 mm diameter and 5 mm height were processed, following the manufacturer 's instructions, using an injection method at 254. the surface of the samples was finished successively using 600, 800, 1000, and 1200 grit silicon carbide papers (shanghai hangli co., shanghai, china), ultrasonically cleaned, and stored in distilled water at 37 for a week. the samples were randomly divided into three groups (n = 28) according to the type of surface treatment : tribochemical silica coating was performed using rocatec plus (110-m grain size) under a pneumatic pressure of 0.28 mpa at a distance of 10 mm for 10 seconds. the silica - coated specimens were further treated with a silane coupling agent for 60 seconds. the samples were treated with a solution of 5% acetic acid in aqueous ethanol (30/70, v / v). after 10 minutes, the samples were prepared for bonding to auto - polymerized resin. the surface roughness and topographical characterization of the samples were evaluated by atomic force microscopy (nanosurf mobile s ; liestal, switzerland) operated in non - contact mode. data were acquired on a 100 m linear scanner using high resonance frequency (f0 = 260 khz) cantilever with a silicon probe having 47 n / m force constant. atr - ftir was performed to detect the functional groups formed on the surface of the acid treated polyamide. the infrared spectra of the treated and untreated polyamide samples were recorded in the region 400 - 4000 cm on a shimadzu ftir-8400s spectrophotometer (shimadzu ftir-8400s ; shimadzu, japan) at a spectral resolution of 4 cm. after preparing the surface, the polyamide samples were embedded in tubes filled with auto - polymerized resin (elite sc tray ; zhermack, badia polesine, italy). according to the type of autopolymerizing resin materials, each group (n, s, and a) was further divided into two subgroups (g for gc reline resin, t for triplex reline resin ; n = 14). then, the samples were prepared for bonding the auto - polymerized resins to the polyamide samples. a layer of gc resin primer was applied on the polyamide surfaces in ng, sg, and ag groups. however, the samples in nt, st, and at groups were prepared for bonding without further modification. a piece of double sided adhesive tape with a central hole of 3 mm diameter was utilized to mark the bonding area. a stainless steel cylinder with an inner diameter of 3 mm was placed on the demarcated bonding area and the auto - polymerized resin was built up within the cylinder by using paint - on - brush technique. the samples were stored in distilled water at 37 for one week and then subjected to 5000 thermal cycles at 5 - 55 with a 15-seconds dwell time to simulate thermal fluctuations in the oral environment. the samples were mounted on a universal testing machine (hounsfield test equipment ; model h5-ks, surrey, uk), and then shear force was applied at a crosshead speed of 0.5 mm / min until failure (fig. the maximum failure loads were recorded in newtons (n) and converted into megapascals (mpa) by dividing the values (in n) by the bonding areas (in mm). the kolmogorov - smirnov test was used for the normality of the bond strength values. the means and standard deviations (sd) of shear bond strength were analyzed with a two - way analysis of variance (anova) followed by tukey 's multiple comparison test. the bond strength values of surface treatment samples were compared with those of untreated groups. according to the two - way anova, surface treatments, auto - polymerized resin types, and their interactions were statistically significant (p <.001) (table 2). the mean shear bond strength values, standard deviations, and statistical differences between surface treatment and resin groups are presented in table 3. the bond strength values of a and s were significantly higher than those of n (p <.001 for both). although the bond strength values of group a was higher than those of group s, the difference was not statistically significant (p =.234). at yielded the highest bond strength value (33.20 7.11 mpa), which was significantly higher than that observed in subgroup ag (p <.001). comparison of the results using independent student 's t - test revealed no significant difference between st and sg groups (p =.119) and between nt and ng (p =.502). surface morphology and root mean square roughness (rms) of the treated specimens were assessed by atomic force microscopy (afm). the darker contrasts correspond to the lower areas of the surface and the lighter contrasts correspond to the higher parts. the rms roughness of group n was 51.354 nm, which was increased to 92.637 nm and 259.96 nm after acid acetic treatment and blasting, respectively. the broad peak around 3000 - 3500 cm indicates the existence of hydroxyl stretching vibration (-oh), which confirms the hydrolysis and the abundance of carboxylic groups. the peak at ~1650 cm is attributed to the c = o stretching vibration of carboxylic and amide group. the peaks at ~1100 and 1400 cm represents the c - o and c - n stretching vibrations, respectively. the present study evaluated the bond strength of auto - polymerized resin to thermoplastic denture base materials with surface modification by acetic acid. the application of acid treatment prior to bonding increased the shear bond strength between auto - polymerized resins and thermoplastic denture base materials ; thus, the null hypothesis was rejected. various laboratory test methods have been used to evaluate the bond strength between reline resins and denture base materials, and bond strength characteristics differ in accordance with the applied methods.29 however, the shear test is a widely adopted test to assess the bond interface and simulates the clinical environments better than tensile force.1112 in consistence with previous studies,89 silica coating and subsequent application of silane coupling agent increased the bond strength between thermoplastic and auto - polymerized resins. the polyamide polymers are easily affected by heat due to their low thermal characteristics.2314 the high collision energy of accelerated silica - coated alumina particles softens the surface of thermoplastic polymer and causes the silica particles to be embedded into the surface of polymer.17 therefore, silica coating provides not only micromechanical retention but also sites for chemical reaction, enhancing the bond strength of the relining material to the silanized polyamide substrate.1530 however, it is noteworthy to mention that nylon polymer is more flexible and softer than metal or ceramics. thus, blasting the small surface area leads to substantial substance loss.18 moreover, covering the large and complex surface areas tribochemically is not practical in most cases and results in the formation of a non - continuous silica layer on the surface.1831 consequently, the distribution of siloxane (si - o - si) bonds created by silane application is heterogeneous and concentrated in local regions.31 the results of the present study revealed that surface modification by acetic acid increased the bond strength of both of the auto - polymerized resins compared with the control group. it has been reported that the bond strength between a reline resin and denture base material is influenced by the nature of the two resins. the auto - polymerized reline resin easily bonds to the thermosetting denture base materials due to an almost similar chemical composition.101112 the resin monomers are bound to the remaining functional groups, and the covalent bond forms between the freshly added reline resin and the existing heat - cure denture base material. previous studies1101216 have provided evidence that chemical surface treatment of heat polymerized resin materials with conditioning liquids disintegrated the bonding surface, improved monomer diffusion, and finally increased the bond strength of repaired resin materials. however, thermoplastic polymer belongs to the class of polyamides with a semi - crystal structure in which the amide groups are intercalated along linear alkane chains.22432 the polymer has significant chain - chain interaction arising from hydrogen bonds between the adjacent amide groups.23 it is generally accepted that the polyamides are strongly resistant to chemical agents due to high degree of crystallinity.222528 thus, they are hard to react with monomers and resin primers of relining materials. this is proved with the observation of adhesive failures between auto - polymerized resins and polyamide.8 the ability of a solvent or a mixture of solvents in dissolving polyamide is strongly affected by the presence of polar amide groups (-conh-).19 molecular dissolution of polyamide requires a strong interaction between a solvent and the amide groups, which would lead to the disruption of the inter - amide hydrogen bonding. concurrently, the methylene sequences loosen as a consequence of polymer swelling.192123 the hydrolytic breakdown of amide bonds in strong acids is problematic since it would lead to relative decrease in molecular weight of the polymer, severe destruction, and loss of surface integrity.2228 moreover, the rate constant of acid hydrolysis depends on acid concentration ; in the presence of concentrated acids, the reaction rate is decreased due to reduced water activity.202225 hocker.24 showed that the rate of polyamide hydrolysis in solutions containing small weak organic acid was twice that of a water hydrochloric acid solution at the same ph. it was observed that the rates of the hydrolysis were accelerated as the acid strength decreased. measuring the concentration of acid in polyamide revealed that polyamide has preferential tendency towards small organic acids.202224 therefore, in the present study, dilute acetic acid solution was applied to induce polyamide hydrolysis. the acidic hydrolysis of polyamide is a bimolecular reaction of oxygen protonized amide with water and the formation of the tetrahedral intermediate.2022242526 mechanical degradation leads to the formation of the radicals affecting the structure of the amide groups and accelerating hydrolysis.26 random chain scissions of amide bonds that are accordingly positioned between adjacent chains enable higher chain mobility.222325 the dissociation of polyamide involves cleavage of the c - n bond between amide (-nh) and carbonyl (= c = o) groups.24 as the reaction rate is considerably low at room temperature, it was expected that short - term exposure to acid would not give rise to detectable ir changes ; but the atr - ftir spectroscopy revealed an increased intensity of amide and carbonyl bands. the increase in the n - h deformation and c = o stretching bands at ~1540 cm and ~1650 cm, respectively, confirmed the amide bond dissociation. additionally, the emergence of a broad band between 3000 and 3500 cm corresponded to hydroxyl absorption. acid dissociates in the matrix of water - swollen polyamide and moves around under the influence of chemical potential and the electric field of ionic movement.192228 reduction of the ph in the polymer inhibits re - polymerization of cleaved amide bond and results in softening of the polymer. it seems that the plasticization of the polymer is accompanied by phase inflation, which facilitates the diffusion of monomer into denture base material, cross - linking with auto - polymerized resin, chain entanglements, and the formation of interpenetrating polymer network (ipn).1920212225262833 ipn refers to a specific class of polymer mixtures consisting of two or more polymers in a network form when one of the polymers is synthesized or crosslinked in the presence of the others.34 ipns are prepared by different methods. the semi - ipn is an intermediate system in which a thermosetting polymer network is formed and crosslinked within a thermoplastic matrix.3435 although none of these definitions are exactly consistent with the condition of the present study, entanglements of polymer chains serve as a type of crosslink. the swelling and plasticization of polymer increase the structural mobility of polymer chains, and therefore a larger number of hydrophilic functional groups are exposed.36 in this regard, the diffusion theory of adhesion may be extended to the interface bonding of polymers. based on the theory, adhesion is achieved by mutual penetration of both the substrate and the adhesive.15 the mobile polymer chains diffuse across the solvated layer of polyamide, leading to extensive intertwining of chains between the surfaces and resulting in strong bonds.32333536 in the present study, the acid - swollen polymer is believed to be responsible for the enhanced diffusion of monomer molecules in polymers with inter diffusion of polymer chains between the surfaces. the present study showed a significant increase in bond strength of auto - polymerized reline resin for group at compared with that for ag, while the results were not significantly different between sg and st. the auto - polymerized reline resins are categorized into two groups : monomer - containing methyl methacrylate and high - molecular - weight methyl methacrylate.6 the bonding of reline resins to denture base materials is achieved by penetration and diffusion of monomers into denture base resin and depends on various variables such as temperature, concentration, morphology, molecular weight, and degree of crystallinity of the polymer.1101236 higher diffusion rate of resin monomers in a swollen polymer may cause higher bond strength between the reline and denture base resins.36 the diffusion of high - molecular - weight methyl methacrylate molecules can, however, be impeded to a greater degree than that of small mma monomer molecules, leading to an apparent lower infusion of monomer into acid swollen polymer matrix. the afm analysis represented an increased surface roughness of grit blasted specimens compared with that of acid treated specimens. therefore, nanoscale roughness can not solely explain the improved bond strength of auto - polymerized resin to polyamide. the increased bond strength appears to be related mostly to chemical reactions occurring at the interface rather than the surface morphology. however, more detailed investigations should be conducted to obtain more accurate information regarding the precise effects of acid treatment and its durations on various thermoplastic polymers. generally, it is concluded that treatment of polyamide surface by acetic acid evidently enhances the bond between reline resins and polyamide polymer, which is comparable to those obtained with tribochemical silica coating. therefore, procedures for denture base repairing or relining can be performed at the same appointment without any need of sophisticated equipment or sending the prosthesis to the responsible laboratory. within the limitations of this study, it was concluded that both of the surface treatment methods influenced the shear bond strength (p <.001). although the bond strength of auto - polymerized resin to acid treated polyamide polymer was higher than that to polymer with tribochemical silica coating and further application of silane, the difference was not statistically significant (p =.234). also, it appeared that acetic acid surface treatment had the greatest effect on the bond strength of mma based reline resin.	purposepolyamide polymers do not provide sufficient bond strength to auto - polymerized resins for repairing fractured denture or replacing dislodged denture teeth. limited treatment methods have been developed to improve the bond strength between auto - polymerized reline resins and polyamide denture base materials. the objective of the present study was to evaluate the effect of surface modification by acetic acid on surface characteristics and bond strength of reline resin to polyamide denture base.materials and methods84 polyamide specimens were divided into three surface treatment groups (n=28) : control (n), silica - coated (s), and acid - treated (a). two different auto - polymerized reline resins gc and triplex resins were bonded to the samples (subgroups t and g, respectively, n=14). the specimens were subjected to shear bond strength test after they were stored in distilled water for 1 week and thermo - cycled for 5000 cycles. data were analyzed with independent t - test, two - way analysis of variance (anova), and tukey 's post hoc multiple comparison test (=.05).resultsthe bond strength values of a and s were significantly higher than those of n (p<.001 for both). however, statistically significant difference was not observed between group a and group s. according to the independent student 's t - test, the shear bond strength values of at were significantly higher than those of ag (p<.001).conclusionthe surface treatment of polyamide denture base materials with acetic acid may be an efficient and cost - effective method for increasing the shear bond strength to auto - polymerized reline resin.
functional gastrointestinal disorder (fgid) is one of the commonest digestive disease entities, which is characterized by recurrent gastrointestinal symptoms with no identifiable organic pathology. in recent years, a bio - psycho - social pathophysiological model has been implicated for the pathogenesis of fgid, which emphasizes the importance of biological, social, environmental and psychological factors in development of fgid.1 this paper aimed to review the epidemiology, mechanism and psychological intervention of fgids. the observations on the association between psychological disorders and fgid used to be considered conflicting, and it was generally regarded as biased observations that were limited to more severe patients seen in referral center setting. an early study conducted in a gastroenterology clinic reported a very high lifetime prevalence of generalized anxiety disorder of 34% in newly referred irritable bowel syndrome (ibs) patients.2 in another study that involved patients with anxiety or depressive disorders, ibs symptoms were found to be associated with severity of anxiety and depressive symptoms. however, patients with depression in remission had no associated ibs symptoms.3 in a study of primary care patients referred for endoscopy, however, there was no difference between patients with functional or organic dyspepsia in the prevalence or risk of mental distress as determined by questionnaire.4 talley reported that dyspepsia patients who present for investigation were more likely to be neurotic, anxious, and depressed than non - dyspepsia controls. using the gold standard diagnostic method with psychiatrist - conducted structured clinical interview for diagnostic statistical manual of mental disorders - iv axis i disorders, we have reported that anxiety disorders are diagnosed in 38% of patients with functional dyspepsia compared with 4% in the general population.6 depression, anxiety, phobia and somatization are strongly correlated with severity of dyspeptic symptoms in a group of patients from tertiary center.7 somatization is more commonly seen in patients with co - morbid fgid and psychological disorder.8 it has also been observed that ibs patients with psychiatric morbidity are characterized by low rectal distension pain thresholds, high rates of healthcare consultations, interpersonal problems and sexual abuse.9 in recent years, there are mounting evidence showing that similar association between fgids and psychological disorders also exists in the community and primary care setting, suggesting a genuine relationship between psychological co - morbidity and fgid rather than biased observations in referral centers. in a community - based study in sweden, anxiety but not depression is linked to functional dyspepsia with postprandial distress syndrome but not to epigastric pain syndrome.10 in a population - based study in hong kong, the prevalence of generalized anxiety disorder is significantly higher in subjects reporting ibs symptoms compared to those reporting these symptoms (16.5% vs 3.3%, p t polymorphism in 5-ht3a receptor, compared with t carrier status, is associated with increased anxiety and amygdala responsiveness as well as the severity of ibs symptoms.25 early life adversity, particularly psychological stress, has been speculated to play an important role of pathogenesis of fgid. it has been shown that self - reported sexual and physical abuse are more common in community and clinic subjects with gastrointestinal symptoms such as ibs and functional dyspepsia.26 - 28 other social and environmental factors, such as exposure to war time conditions, infantile and childhood trauma, and social learning of illness behavior are predictors of the ibs in adulthood.29,30 in animal models, it has been shown that early life psychological stress such as neonatal maternal separation results in the development of visceral hyperalgesia and anxiety features.31 there are a number of putative mechanisms that mediates the development of these pathophysiologic changes induced by early life stress. these include hyper - responsiveness of serotonergic system in both central and enteric nervous systems,32 increased sympathetic and decreased parasympathetic activities,33 increased expression of crf type 1 receptors and transient receptor ion channel 1 (trpv1).34,35 the resultant visceral hyperlagesia is likely related to central sensitization at both brain and spinal levels.36,37 in recent years, a positive association between psychological stress and abnormal immunity has also been implicated in the pathophysiologic mechanism of ibs. ibs patients have coexisting hyperactivity of the hypothalamic - pituitary - adrenal axis and increase in pro - inflammatory cytokine levels.38 chronic psychological stress leads to maladaptive increase in mucosal permeability and decrease in secretory response of intestinal epithelium to luminal stimuli.39 it has been shown that the change in intestinal mucosal permeability is mediated by crf.40 there is ample evidence supporting the therapeutic role of psychotropic agents in the treatment of fgid. most of these trials were conducted in patients with ibs and non - cardiac chest pain. antidepressant is the most extensively evaluated psychotropic agent for treatment of fgids. in the recent cochrane database systematic review, there is an unequivocal beneficial effect for antidepressants over placebo for improvement of abdominal pain (54% for antidepressants compared to 37% of placebo : relative risk [rr ], 1.49 ; 95% ci, 1.05 - 2.12 ; p = 0.03 ; number needed to treat [nnt ] = 5), global assessment (59% for antidepressants compared to 39% of placebo : rr, 1.57 ; 95% ci, 1.23 - 2.00 ; p t polymorphism in 5-ht3a receptor, compared with t carrier status, is associated with increased anxiety and amygdala responsiveness as well as the severity of ibs symptoms.25 early life adversity, particularly psychological stress, has been speculated to play an important role of pathogenesis of fgid. it has been shown that self - reported sexual and physical abuse are more common in community and clinic subjects with gastrointestinal symptoms such as ibs and functional dyspepsia.26 - 28 other social and environmental factors, such as exposure to war time conditions, infantile and childhood trauma, and social learning of illness behavior are predictors of the ibs in adulthood.29,30 in animal models, it has been shown that early life psychological stress such as neonatal maternal separation results in the development of visceral hyperalgesia and anxiety features.31 there are a number of putative mechanisms that mediates the development of these pathophysiologic changes induced by early life stress. these include hyper - responsiveness of serotonergic system in both central and enteric nervous systems,32 increased sympathetic and decreased parasympathetic activities,33 increased expression of crf type 1 receptors and transient receptor ion channel 1 (trpv1).34,35 the resultant visceral hyperlagesia is likely related to central sensitization at both brain and spinal levels.36,37 in recent years, a positive association between psychological stress and abnormal immunity has also been implicated in the pathophysiologic mechanism of ibs. ibs patients have coexisting hyperactivity of the hypothalamic - pituitary - adrenal axis and increase in pro - inflammatory cytokine levels.38 chronic psychological stress leads to maladaptive increase in mucosal permeability and decrease in secretory response of intestinal epithelium to luminal stimuli.39 it has been shown that the change in intestinal mucosal permeability is mediated by crf.40 there is ample evidence supporting the therapeutic role of psychotropic agents in the treatment of fgid. most of these trials were conducted in patients with ibs and non - cardiac chest pain. antidepressant is the most extensively evaluated psychotropic agent for treatment of fgids. in the recent cochrane database systematic review, there is an unequivocal beneficial effect for antidepressants over placebo for improvement of abdominal pain (54% for antidepressants compared to 37% of placebo : relative risk [rr ], 1.49 ; 95% ci, 1.05 - 2.12 ; p = 0.03 ; number needed to treat [nnt ] = 5), global assessment (59% for antidepressants compared to 39% of placebo : rr, 1.57 ; 95% ci, 1.23 - 2.00 ; p < 0.001 ; nnt = 4) and symptom score (53% of antidepressants compared to 26% of placebo : rr, 1.99 ; 95% ci, 1.32 - 2.99 ; p = 0.001 ; nnt = 4).41 tricyclic antidepressant has been shown to attenuate stress induced visceral hypersensitivity with suppressed brain activation, suggesting a mechanism of central pain modulating effect that is independent of antidepressive effect.42 in patients with functional dyspepsia, amitriptyline has been shown to be superior to placebo in reducing dyspeptic symptom score especially nausea but there is no effect on drinking capacity and postprandial symptoms in the drink tests.43 selective serotonin reuptake inhibitor (ssri), another class of antidepressant with superior safety and side effect profile, has been shown to reduce pain symptoms in patients with non - cardiac chest pain in addition to ibs.44 acute administration of citalopram leads to reduction in chemical and mechanical esophageal sensitivity in healthy volunteers.45 ssri reduces somatization and improves affective response to chronic visceral pain.46,47 these effects are independent of its anti - depressive actions but patients who have concomitant anxiety or depression and somatization tend to have better symptom response to psychotropic agents.47,48 however, its therapeutic benefit in non - depressed ibs patients has not been substantiated.49 the serotonin - norepinephrine reuptake inhibitor, or snri, is a newer class of antidepressant with faster onset of action in the treatment of depression. its use in functional dyspepsia is limited by the lack of efficacy and gastrointestinal upset. it has been shown that venlafaxine is not superior to placebo for treating functional dyspepsia in a randomized controlled trial. furthermore, there is a short - term worsening of dyspepsia.50 yet, venlafaxine has been shown to be more effective than placebo in improving pain control and emotional well - being in patients with non - cardiac chest pain in a small randomized controlled trial.51 apart from antidepressants, other psychotropic agents have also been evaluated for treatment of fgid. for example, the combination formulation of flupentixol and melitracen (deanxit) has been shown to be useful for acute symptom control of dyspepsia.52 trazodone has been shown to be useful for treatment of non - cardiac chest pain due to esophageal hypersensitivity.53 pregabalin, a new class of drug known as alpha-2-delta ligand, increases distension sensory thresholds to normal levels in ibs patients with rectal hypersensitivity.54 despite the promising results on the efficacy, none of the above mentioned psychotropic agents have been approved by the regulatory authority such as fda for the treatment of fgid. therefore, these agents can only be used in patients with co - morbid psychological disorders or as off - label use with consents obtained from the patients. in addition to the effectiveness in the management of anxiety and depressive disorders, psychological intervention alone or in combination with psychotropic agent has also been shown to be useful in treatment of patients with fgid. cognitive behavioral therapy has been most extensively evaluated for treatment of fgid.55 psychodynamic - interpersonal psychotherapy has also been shown to be effective in alleviating dyspeptic symptoms, and the effects are enduring after cessation of the psychotherapy.56 combination of sertraline and pain coping skill training has been shown to be more effective than either modality alone in the treatment of non - cardiac chest pain.57 in patients with refractory functional dyspepsia, combination of intensified medical therapy with psychological intervention yields superior long - term - outcomes. cognitive behavioral therapy gives additional benefits to concomitant anxiety and depression.58 in a recent randomized controlled trial, mindfulness training has a substantial therapeutic effect on bowel symptom severity, health - related quality of life, and reduces distress in ibs patients.59 the strong association between psychological disorders and fgid has been increasingly recognized and there is mounting evidence that supports the causative relationship with biological plausibility. however, the detection and management of concomitant psychological disorder in patients with fgid remains far from satisfactory. most patients lack the awareness of their psychological symptoms and most primary care clinicians and gastroenterologists lack the vigilance and skills in screening for these common co - morbid conditions. a good doctor - patient rapport, therapeutic relationship and psychoeducation are essential so that psychological intervention can be implemented with patient 's acceptance. psychotropic agents should be judiciously used in fgid patients with co - morbid psychological conditions as intolerance and poor adherence are common owing to their lack of awareness and hypervigilance to side effects. further studies are needed to evaluate the impact of early detection and management of co - morbid psychological disorders on the long - term clinical outcome and disease course of fgid.	functional gastrointestinal disorder (fgid) is one of the commonest digestive diseases worldwide and leads to significant morbidity and burden on healthcare resource. the putative bio - psycho - social pathophysiological model for fgid underscores the importance of psychological distress in the pathogenesis of fgid. concomitant psychological disorders, notably anxiety and depressive disorders, are strongly associated with fgid and these psychological co - morbidities correlate with severity of fgid symptoms. early life adversity such as sexual and physical abuse is more commonly reported in patients with fgid. there is mounting evidence showing that psychological disorders are commonly associated with abnormal central processing of visceral noxious stimuli. the possible causal link between psychological disorders and fgid involves functional abnormalities in various components of the brain - gut axis, which include hypothalamic - pituitary - adrenal system, sympathetic and parasympathetic nervous system, serotonergic and endocannabinoid systems. moreover, recent studies have also shown that psychological distress may alter the systemic and gut immunity, which is increasingly recognized as a pathophysiologic feature of fgid. psychotropic agent, in particular antidepressant, and psychological intervention such as cognitive behavioral therapy and meditation have been reported to be effective for alleviation of gastrointestinal symptoms and quality of life in fgid patients. further studies are needed to evaluate the impact of early detection and management of co - morbid psychological disorders on the long - term clinical outcome and disease course of fgid.
stroke is characterized by a sudden, non - convulsive, focal neurological deficit caused by a brain lesion stemming from a non - traumatic vascular mechanism due to arterial or venous embolism leading to cerebral ischemia or hemorrhage2. the most common manifestations of stroke are sensory, cognitive and motor impairments, such as hemiparesis, spasticity, an abnormal movement pattern3 and physical deconditioning4, 5. any force exerted on the jaws should be identified as a triggering factor of a functional imbalance in the masticatory system6. according to saliba.7, upper limb impairment is one of the most common complaints of stroke survivors with hemiparesis. it is estimated that 70% of such individuals suffer residual disability that compromises dexterity during activities of daily living8. individuals with hemiparesis exhibit slow movements during activities that involve the upper limbs, such as reaching and grasping, due to limited range of motion, segmented movements and a lack of coordination among the joints4, 9. normal upper limb function involves the capacity for directed reach, grasping and manipulation of objects, which make up the motor skills required for the performance of activities of daily living6 that allow an individual to lead an independent life with self - esteem8. the execution of proper oral hygiene, for example, requires adequate motor control of the upper limbs9. compromised upper limb function exerts an impact on the degree of disability experienced by stroke survivors, with a significant influence on functional performance and negative consequences regarding personal, familial and social relationships as well as quality of life10. despite the gradual return of motor function resulting from a combination of spontaneous recovery and physical therapy, the use of the paretic limb is often less than its normal potential in daily living11. depending on the degree of upper limb impairment, the maintenance of adequate oral health among stroke survivors can be hindered3, 8. moreover, inadequate oral hygiene can compromise both oral health and quality of life. considering the high prevalence rates of functional limitations to the paretic arm7, the aim of the present study was to evaluate the relationship between upper limb impairment and oral health impact in individuals with hemiparesis stemming from a stroke. this study received approval from the local human research ethics committee under process number 259.239. all participants received an explanation about the study and authorized participation by signing a statement of informed consent in compliance with resolution 466/2012 of the brazilian national board of health. the participants were recruited from the physical therapy clinic of nove de julho university (brazil). a descriptive, cross - sectional study was conducted of a sample of 27 stroke survivors with complete or partial hemiparesis with brachial or crural predominance. individuals with cognitive deficit, those with dentofacial deformities, those receiving dental treatment and those with sensitivity abnormalities or quadriparesis were excluded from the study. the 14-item short version of the oral health impact profile (ohip-14)12 was used to evaluate perceptions of oral health13. this questionnaire has seven subscales, each with two questions : functional limitation, physical pain, psychological discomfort, physical disability, psychological disability, social disability and social handicap. however, to eliminate limitations related to the function of the paretic upper limb, the questionnaire was administered in interview form (the researchers read the questions aloud and marked the respondents answers). the brazilian version of the stroke specific quality of life scale (ssqol - brazil)14, 15 was used to evaluate perceptions regarding quality of life. this scale has 49 items distributed among 12 subscales (energy, family roles, language, mobility, mood, personality, self care, social roles, reasoning, upper extremity function, vision and work / productivity). each item has five response options referring to function in the previous week. the score of each item ranges from 1 to 5 points and the total ranges from 49 (worst perception of quality of life) to 245 (best perception). in the present study, only the upper extremity function subscale was employed to analyze its association with oral health impact. although upper extremity function on this questionnaire is evaluated based on actions such as fastening a button and opening / closing a zipper, ssqol - brazil was chosen for use in the present study due to the lack of specific questionnaires in the literature for the evaluation of upper limb function in relation to oral self - care and even the function of feeding oneself. the shapiro - wilk s test was used to determine whether or not the data had a normal distribution. pearson s correlation coefficients were calculated to determine the magnitude, direction and significance of associations between variables related to upper limb function and oral health impact. the strength of the associations was classified as weak (correlation coefficient : 0.1 to 0.3), moderate (correlation coefficient : 0.4 to 0.6) or strong (correlation coefficient : 0.7 to 1). a level of significance of 5% (p < twenty - seven individuals with hemiparesis stemming from a stroke participated in the present study. the female accounted for 37.1% (n = 10) of the sample and the male accounted for 62.9% (n = 17). the mean age of the subjects was 60.5 12.7 years (range : 30 to 85 years) and the mean time since the occurrence of stroke was 28.5 29.6 months (range : 2 to 108 months). a total of 51.8% of the sample (n = 14) had right side hemiparesis and 48.2% had left side hemiparesis ; 63% (n = 17) had complete hemiparesis and 37% (n = 10) had partial hemiparesis ; 55.5% (n = 15) had brachial predominance and 44.4% (n = 12) had crural predominance. a statistically significant association was found between the upper extremity function subscale of the ssqol - brazil and the impact of oral health evaluated using the ohip-14, with a strong correlation found for the physical pain subscale (0.707), moderate correlations with the functional limitation (0.502), psychological discomfort (0.474), physical disability (0.461), social disability (0.549) and social handicap (0.555) subscales, as well as a weak correlation with the psychological disability subscale (0.393). all correlations were negative (table 1table 1.correlations between the upper extremity function (uef) subscale of ssqol - b and ohip-14 scales among individuals with hemiparesis stemming from a strokeuef (ssqol) x ohip-14nrfunctional limitation270.502physical pain 270.707psychological discomfort270.474physical disability270.461psychological disability270.393social disability270.549social handicap270.555ohip-14270.722). for the evaluation of oral health impact on quality of life, the responses received codes, which were multiplied by the respective weight of the question : 0 = never or i do nt know ; 1 = hardly ever ; 2 = occasionally ; 3 = fairly ofen ; and 4 = very often. thus, the maximum score for each dimension was 4 points and the impact of each dimension was classified as weak, moderate or strong. a score of 0 to 9 indicated weak impact, 10 to 18 indicated moderate impact and 19 to 28 indicated strong impact (i.e., higher scores denoted greater negative oral health impact on quality of life). the same was true for each dimension, for which the scores ranged from 0 to 4. among the 27 individuals in the present sample, the mean overall ohip-14 score was 4.63 with a standard deviation (sd) of 6.6 (range : 0.00 to 24.27). oral health status exerted a weak impact on the quality of life of the subjects (table 2table 2.distribution of impact of oral health conditions per ohip-14 subscale among individuals with hemiparesissubscalemeansdimpactfunctional limitation0.741.2weakphysical pain0.661.1weakpsychological discomfort1.061.3weakphysical disability0.570.9weakpsychological disability 0.671.0weaksocial disability0.471.1weaksocial handicap0.451.0weaksum of subscales 4.636.6weak). analyzing the ohip-14 scores with regard to the impact of oral health on quality of life, the most frequent classification was weak impact (n = 24 ; 88.8%), with small rates of moderate (n = 1 ; 3.70%) and strong (n = 2 ; 7.40%) impact (table 3table 3.classification of answers to ohip-14 questionnaire according to the general impact of oral health on quality of lifeimpactn%weak2488.8moderate13.70strong27.40total27100). in the present study, we found that compromised upper limb function exerts an impact on the degree of disability experienced by stroke survivors. in the present study, hemiparesis with brachial predominance affected 55.5% of the sample, which may explain the strong association found between physical pain and upper limb function. hemiparesis leads to instability in movements of the trunk and limbs, thereby compromising performance of activities of daily living, such as oral hygiene, which depend on adequate motor control of the upper limbs16,17,18,19. hemiplegia may impact on a person s ability to carry out oral care procedures and reduce mobility after stroke20. age is another factor that may have influenced the subjects ability to perform self - care in the present sample, as the mean age was 60.5 years. silvestre.21 reported approximately 40% of individuals aged 60 years or older need some type of assistance to perform at least one instrumental activity of daily living and 10% need assistance to perform basic tasks, such as bathing, dressing and other aspects of self - care. according to hunt.22 and slade. the combination of the negative consequences of ageing and stroke leads to a substantial reduction in quality of life. the total ohip-14 score in the present study was low (4.6 points). in contrast, reed.23 found that 137 older adults at an extended care facility had a poor perception of their oral health status. many older adults seem not to be bothered by poor oral health, which demonstrates a certain cultural resignation24. indeed, oral problems are often minimized in comparison to other adverse health conditions25. numerous clinical conditions, such as poor posture and malocclusion may be related to the muscles of mastication, the temporomandibular joint and associated structures, and may change orofacial functions26. thus, when evaluating quality of life, older adults often perceive poor oral health as normal or acceptable for someone at an advanced age. despite this resigned attitude, the association between oral health and quality of life indicates that oral problems exert a negative impact on the emotional well being of this population. in the present study, a negative correlation was found between social disability (ohip-14) and quality of life (ssqol - b), as individuals with higher social disability scores stemming from oral problems had lower quality of life scores. these findings are in agreement with data reported by marin.27 and tatematsu.28, who stated oral pain and problems with eating, chewing, smiling and speaking tend to affect an individual s wellbeing substantially. for individuals with hemiparesis, adequate oral health may mean reintegration into society and a significant improvement in quality of life therefore, the rehabilitation of the paretic upper limb and orofacial function can lead to an improvement in the quality of life of such individuals. compromised upper limb function and self - perceived poor oral health, whether due to cultural resignation or functional disability, exert a negative impact on the quality of life of individuals with hemiparesis stemming from a stroke.	[purpose ] the aim of the present study was to evaluate the relationship between upper limb impairment and oral health impact in individuals with hemiparesis stemming from a stroke. [subjects and methods ] the study subjects were conducted with a sample of 27 stroke survivors with complete or partial hemiparesis with brachial or crural predominance. the 14-item short version of the oral health impact profile was used to evaluate perceptions of oral health. the brazilian version of the stroke specific quality of life scale was used to evaluate perceptions regarding quality of life. [results ] a statistically significant association was found between the upper extremity function subscale of the ssqol - brazil and the impact of oral health evaluated using the ohip-14, with a strong correlation found for the physical pain subscale, moderate correlations with the functional limitation, psychological discomfort, physical disability, social disability and social handicap subscales as well as a weak correlation with the psychological disability subscale. analyzing the ohip-14 scores with regard to the impact of oral health on quality of life, the most frequent classification was weak impact, with small rates of moderate and strong impact. [conclusion ] compromised upper limb function and self - perceived poor oral health, whether due to cultural resignation or functional disability, exert a negative impact on the quality of life of individuals with hemiparesis stemming from a stroke.
as an auditory rehabilitation device, the auditory brainstem implant (abi) has been used to treat deafness in individuals with neurofibromatosis type 2 since the first device was implanted in 1979. in the following years, progressively more effective multichannel abis have been developed to palliate the deficits due to loss of integrity of the auditory nerves. furthermore, the indications for abi have also been expanded to other treatments, such as the treatments for nontumor patients, ossification or major cochlear malformations, aplasia or avulsion of the cochlear nerves, vestibular schwannoma on the only hearing ears, and bilateral temporal bone fractures. thus, an increasingly greater number of patients have acquired auditory perception again with the help of abi, and their quality of life has improved. despite the enormous potential of this increasingly applied treatment, the auditory performance of many implanted patients is limited, and the variability between cases hinders a complete understanding of the roles played by the multiple parameters related to the efficacy of the implant. although several researchers have committed to improve the efficacy of the implant, the predicament has not been resolved. to solve this problem, we attempted to establish a large animal model for abis in a rhesus macaque monkey to explore the array of the cochlear nucleus (cn) complex, which would thus lay the foundation for the investigation of the mechanisms of auditory recovery after implant surgery. the care and handling of animals were conducted in compliance with the chinese animal welfare act, the guidance for animal experimentation of capital medical university, and the beijing guidelines for the care and use of laboratory animals. this study was approved by the animal ethics committee of beijing neurosurgical institute, capital medical university (no. 20131114). the animals were in good medical condition at the time of testing and had no history of exposure to known ototoxic drugs. all monkeys were treated in the same way (e.g., diet and cage status). they were maintained in individual cages in a controlled environment of 120 cm (h) 80 cm (w) 75 cm (d). the front, roof, and walls were composed of organic glass, whereas the bottom of the cage was composed of metal net. the monkeys were routinely released into a semi - closed environment that had environmental enrichment objects, such as toys, branches and climbing materials, mirrors, and tvs, as well as other objects. in the abi surgical procedure, general anesthesia was induced via intramuscular injections of ketamine (15 mg / kg, gutian pharmaceutical co., ltd., china), midazolam (0.5 mg / kg, enhua pharmaceutical co., ltd., china) and atropine (0.02 mg / kg, jinyao amino acid co., ltd., orotracheal intubation was performed after an intravenous (iv) injection of fentanyl (0.001 mg / kg, astrazeneca ltd., uk) and rocuronium (0.3 mg / kg, n.v. organon, the netherlands). lumbar puncture and urethral catheterization were performed prior to surgery. during the surgery, the electrocardiogram, blood pressure, pulse rate, spo2, end - tidal carbon dioxide partial pressure and temperature were monitored. for the magnetic resonance imaging (mri), computed tomography (ct) scanning, auditory brainstem response (abr), electrical abr (eabr) or lumbar puncture, the monkeys were initially anesthetized with intramuscular ketamine (15 mg / kg), midazolam (0.5 mg / kg) and atropine (0.02 mg / kg). all of these experiments were performed under iv propofol (propoflo, abbott laboratories, usa) anesthesia with an initial bolus of 1.5 mg / kg and a continuous infusion of 0.5 mgkgmin. the electrode pad was comprised by medical silicone, slightly elliptical, and measured 12 mm 4 mm 2 mm. the 24 surface electrodes were attached to one side, and the other side was covered with a 1-cm - diameter polyethylene terephthalate mesh pad for stabilization purposes. we performed mri / ct scanning for all six monkeys prior to the surgery to evaluate the intracranial status and gasification degree of the mastoid, and to obtain a reference for surgical planning ; abr testing was conducted to assess auditory function. a lumbar puncture was performed, the cerebrospinal fluid (csf) was tested, and the results were subsequently reserved as a baseline. general anesthesia was performed via endotracheal intubation, and a left bench - park position was subsequently placed. a postauricular inverted l - shaped skin incision was performed under aseptic technique, and a right modified suboccipital retrosigmoid (rs) craniotomy was performed from the level of the superior nuchal line down to the foramen magnum. after the bone flap was removed, the transverse sinus, sigmoid sinus, and their intersection were exposed, and the foramen magnum was also opened [figure 1 ]. a line incision was then performed on the dura mater along the sigmoid sinus. under surgical microscopic guidance, the nerves in the cerebellopontine angle (cpa) (xi, x, ix, viii, and vii) were detected and distinguished from bottom to top [figure 2 ]. the abr was used again to verify the normality of neural function. the right cochlear nerve (viii) was subsequently cut under intraoperative neuromonitoring. by the anatomic markers of the glossopharyngeal nerve (ix), choroid plexus of the fourth ventricle and brainstem stub of cochlear nerve, the right luschka 's foramen of the fourth ventricle once the anatomical location was confirmed, the electrode assays were implanted in the lateral recess through luschka 's foramen. the electrode assays were subsequently fixed with autologous muscle, followed by dural closure, bone replacement and suturing of muscles and skin. at the end of the surgery, eabr and head ct were used to evaluate the validity of the electrophysiological function and anatomical placement. during the operation, the prophylactic use of iv ceftriaxone sodium when the animals awoke from the anesthesia, they were transported to the observation room for postoperative monitoring. (a) an intra - operative bone window (marked with bold black line marked in figure b), the solid arrow points to the transverse sinus, and the sigmoid sinus is marked with hollow arrow. the stars point to viii cranial nerve, the solid arrow points to vii cranial nerve, and the hollow arrow points to xi, x and ix cranial nerves. the animals were housed in a separate cage and monitored for food intake, skin wound healing condition, behavioral and neurological changes, and postoperative complications. the modified tarlov classification and the modified canada disability scale were used for neural defects and general status evaluation, respectively. intramuscular ceftriaxone sodium 10 mg / kg was administered for the first 3 postoperative days. a lumbar puncture was again performed during the 1 week postoperation or as indicated by signs of intracranial infection. abr and eabr testing were performed every 2 weeks from the 1 month after the implant surgery as the brain edema subsided. neural function in the monkeys was assessed using abr before and 1-month after the abi surgery. the animal 's ear canals were inspected and cleaned of debris if necessary, and the condition of the tympanic membrane was determined. following sedation, the skin was wiped clean with alcohol wipes, and 0.22 gauge skin electrodes were placed subcutaneously behind each ear, on the forehead, and on the back of the neck the electrode impedance was checked after placement into the skin and was below 2 k ohm for all recordings. the abr recordings were obtained using a bio - logic auditory evoked potentials system (version 6.2.0, natus medical incorporated, usa) controlled by a laptop computer. the evoked responses were amplified 100 k times, and our physiological filters were set to pass at 100500 hz. for the abr recordings, rarefaction clicks were delivered through insert earphones (er-3a, etymotic research, inc., il, usa) at a rate of 13.3 stimuli / s and at a level of 80 db nhl (peak sound pressure level). the abr waveforms were averaged over a minimum of 1500 repetitions. clicks and tone bursts were presented at 80 db nhl and decreased in 10 db nhl increments from 80 to 30 db nhl and 5 db nhl until the abr response was no longer detectable. the latencies and amplitudes of peaks i, ii, and iv were measured at 80 db nhl. the monaural responses were recorded for each monkey and averaged (biologic traveler express) in a 10 ms time window. the averages for 1000 sweeps were collected, and the responses were replicated to determine the waveform reliability. the first eabr test was conducted every 2 weeks since the 1 month after the abi procedure. the noninverting electrode was placed at the midline (cz), and the inverting electrode was placed subcutaneously behind the ipsilateral ear. the recording electrodes were passed through an external low pass filter (fc = 32 khz) in an attempt to eliminate the frequency - modulated signal sent from the external to internal components of the abi. frequencies outside the 1003000 hz range were filtered out, and the response was sampled at 20,000 hz, which provided data points at 0.05 ms intervals and interpolation between the points. the waveforms were marked using the bio - logic auditory evoked potentials system, which provided the latency values to the 0.01 ms. signal averaging was performed between 5 ms and 80 ms relative to the stimulus onset ; however, a more limited time window of 210 ms was used for the analyses. sweeps that contained large signals between 2 ms and 80 ms latency were rejected from the average. at least 500 sweeps were typically averaged, and the responses were recorded at least twice. monopolar pulses (mp 1 + 2) were delivered by the multichannel implants at the basal end of the array. the stimulation levels were increased in steps of 1030 clinical units until the maximum levels were reached ; in most cases, the eabrs recorded at least three increasing levels during this process. the measurement data were presented as the mean standard deviation (sd). for the analysis of the comparison of latencies and amplitudes of peaks i, ii and iv between the bilateral ears in the abr test, a dependent samples t - test was used. a paired samples t - test the p level was set to 0.05 for all analyses to determine the statistical significance. the care and handling of animals were conducted in compliance with the chinese animal welfare act, the guidance for animal experimentation of capital medical university, and the beijing guidelines for the care and use of laboratory animals. this study was approved by the animal ethics committee of beijing neurosurgical institute, capital medical university (no. 20131114). the animals were in good medical condition at the time of testing and had no history of exposure to known ototoxic drugs. all monkeys were treated in the same way (e.g., diet and cage status). they were maintained in individual cages in a controlled environment of 120 cm (h) 80 cm (w) 75 cm (d). the front, roof, and walls were composed of organic glass, whereas the bottom of the cage was composed of metal net. the monkeys were routinely released into a semi - closed environment that had environmental enrichment objects, such as toys, branches and climbing materials, mirrors, and tvs, as well as other objects. in the abi surgical procedure, general anesthesia was induced via intramuscular injections of ketamine (15 mg / kg, gutian pharmaceutical co., ltd., china), midazolam (0.5 mg / kg, enhua pharmaceutical co., ltd., china) and atropine (0.02 mg / kg, jinyao amino acid co., ltd., orotracheal intubation was performed after an intravenous (iv) injection of fentanyl (0.001 mg / kg, astrazeneca ltd., uk) and rocuronium (0.3 mg / kg, n.v. organon, the netherlands). lumbar puncture and urethral catheterization were performed prior to surgery. during the surgery, the electrocardiogram, blood pressure, pulse rate, spo2, end - tidal carbon dioxide partial pressure and temperature were monitored. for the magnetic resonance imaging (mri), computed tomography (ct) scanning, auditory brainstem response (abr), electrical abr (eabr) or lumbar puncture, the monkeys were initially anesthetized with intramuscular ketamine (15 mg / kg), midazolam (0.5 mg / kg) and atropine (0.02 mg / kg). all of these experiments were performed under iv propofol (propoflo, abbott laboratories, usa) anesthesia with an initial bolus of 1.5 mg / kg and a continuous infusion of 0.5 mgkgmin. the pulse rate, spo2, respiratory rate and temperature were monitored. the electrode pad was comprised by medical silicone, slightly elliptical, and measured 12 mm 4 mm 2 mm. the 24 surface electrodes were attached to one side, and the other side was covered with a 1-cm - diameter polyethylene terephthalate mesh pad for stabilization purposes. we performed mri / ct scanning for all six monkeys prior to the surgery to evaluate the intracranial status and gasification degree of the mastoid, and to obtain a reference for surgical planning ; abr testing was conducted to assess auditory function. a lumbar puncture was performed, the cerebrospinal fluid (csf) was tested, and the results were subsequently reserved as a baseline. general anesthesia was performed via endotracheal intubation, and a left bench - park position was subsequently placed. a postauricular inverted l - shaped skin incision was performed under aseptic technique, and a right modified suboccipital retrosigmoid (rs) craniotomy was performed from the level of the superior nuchal line down to the foramen magnum. after the bone flap was removed, the transverse sinus, sigmoid sinus, and their intersection were exposed, and the foramen magnum was also opened [figure 1 ]. a line incision was then performed on the dura mater along the sigmoid sinus. under surgical microscopic guidance, the nerves in the cerebellopontine angle (cpa) (xi, x, ix, viii, and vii) were detected and distinguished from bottom to top [figure 2 ]. the abr was used again to verify the normality of neural function. the right cochlear nerve (viii) was subsequently cut under intraoperative neuromonitoring. by the anatomic markers of the glossopharyngeal nerve (ix), choroid plexus of the fourth ventricle and brainstem stub of cochlear nerve, the right luschka 's foramen of the fourth ventricle once the anatomical location was confirmed, the electrode assays were implanted in the lateral recess through luschka 's foramen. the electrode assays were subsequently fixed with autologous muscle, followed by dural closure, bone replacement and suturing of muscles and skin. at the end of the surgery, eabr and head ct were used to evaluate the validity of the electrophysiological function and anatomical placement. during the operation, the prophylactic use of iv ceftriaxone sodium when the animals awoke from the anesthesia, they were transported to the observation room for postoperative monitoring. (a) an intra - operative bone window (marked with bold black line marked in figure b), the solid arrow points to the transverse sinus, and the sigmoid sinus is marked with hollow arrow. the stars point to viii cranial nerve, the solid arrow points to vii cranial nerve, and the hollow arrow points to xi, x and ix cranial nerves. the animals were housed in a separate cage and monitored for food intake, skin wound healing condition, behavioral and neurological changes, and postoperative complications. the modified tarlov classification and the modified canada disability scale were used for neural defects and general status evaluation, respectively. intramuscular ceftriaxone sodium 10 mg / kg was administered for the first 3 postoperative days. a lumbar puncture was again performed during the 1 week postoperation or as indicated by signs of intracranial infection. abr and eabr testing were performed every 2 weeks from the 1 month after the implant surgery as the brain edema subsided. neural function in the monkeys was assessed using abr before and 1-month after the abi surgery. the animal 's ear canals were inspected and cleaned of debris if necessary, and the condition of the tympanic membrane was determined. following sedation, the skin was wiped clean with alcohol wipes, and 0.22 gauge skin electrodes were placed subcutaneously behind each ear, on the forehead, and on the back of the neck the electrode impedance was checked after placement into the skin and was below 2 k ohm for all recordings. the abr recordings were obtained using a bio - logic auditory evoked potentials system (version 6.2.0, natus medical incorporated, usa) controlled by a laptop computer. the evoked responses were amplified 100 k times, and our physiological filters were set to pass at 100500 hz. for the abr recordings, rarefaction clicks were delivered through insert earphones (er-3a, etymotic research, inc., il, usa) at a rate of 13.3 stimuli / s and at a level of 80 db nhl (peak sound pressure level). clicks and tone bursts were presented at 80 db nhl and decreased in 10 db nhl increments from 80 to 30 db nhl and 5 db nhl until the abr response was no longer detectable. the latencies and amplitudes of peaks i, ii, and iv were measured at 80 db nhl. the monaural responses were recorded for each monkey and averaged (biologic traveler express) in a 10 ms time window. the averages for 1000 sweeps were collected, and the responses were replicated to determine the waveform reliability. the first eabr test was conducted every 2 weeks since the 1 month after the abi procedure. the noninverting electrode was placed at the midline (cz), and the inverting electrode was placed subcutaneously behind the ipsilateral ear. the recording electrodes were passed through an external low pass filter (fc = 32 khz) in an attempt to eliminate the frequency - modulated signal sent from the external to internal components of the abi. frequencies outside the 1003000 hz range were filtered out, and the response was sampled at 20,000 hz, which provided data points at 0.05 ms intervals and interpolation between the points. the waveforms were marked using the bio - logic auditory evoked potentials system, which provided the latency values to the 0.01 ms. signal averaging was performed between 5 ms and 80 ms relative to the stimulus onset ; however, a more limited time window of 210 ms was used for the analyses. sweeps that contained large signals between 2 ms and 80 ms latency were rejected from the average. at least 500 sweeps were typically averaged, and the responses were recorded at least twice. monopolar pulses (mp 1 + 2) were delivered by the multichannel implants at the basal end of the array. the stimulation levels were increased in steps of 1030 clinical units until the maximum levels were reached ; in most cases, the eabrs recorded at least three increasing levels during this process. the measurement data were presented as the mean standard deviation (sd). for the analysis of the comparison of latencies and amplitudes of peaks i, ii and iv between the bilateral ears in the abr test, a dependent samples t - test was used. a paired samples t - test was applied for the pre- and post - operative csf analysis. the p level was set to 0.05 for all analyses to determine the statistical significance. the average time for the abi procedure was 5.2 h (range, 4.56 h), which included nearly half of the time for the eabr testing. the preoperative abrs indicated that all animals possessed adequate auditory function, and the thresholds were 515 db nhl [figure 3 ]. the peaks i, ii and iv in the abr testing were distinguished at 80 db nhl, and their latencies and amplitudes are shown in table 1. the latency and amplitude of peaks i, ii and iv in the abr testing for six monkeys (mean sd) the left ears were tested twice, and one for the right ; p : comparison between left and right ears. only one - peak eabr waves were induced during the abi operation [figure 4 ]. however, both one - peak and two - peak eabr waves were observed during the postoperative testing [figure 5 ]. the intra- and post - operative eabr waves confirmed that the devices were accurately placed where the stimulus could excite the complete auditory pathway. for both one - peak and two - peak eabr waves, the latencies did not appear to change with the stimulus intensity ; however, the amplitudes had a positive correlation with the intensity. the postoperative ct scans confirmed the anatomic site of the implant electrode arrays [figure 6 ]. throughout the eabr testing, all monkeys remained stable, and no abnormal changes in the pulse rate, spo2, respiratory rate, or abnormal limb movements were identified. the one intra - operative electrical auditory brainstem response wave (ep i) followed a stimulus artifact (sa), and the stimulus intensity from top to bottom of the five lines were 200, 150, 100, 50 and 0 current levels. (a) one - peak postoperative electrical auditory brainstem response (eabr) wave (ep i), the stimulus intensities from top to bottom were 120, 100, 80, 50, 30 and 0 current levels (cls) ; (b) two distinguishable eabr waves (ep i and ii), the stimulus intensities from top to bottom were 150, 150, 150, 120, 110, 100, 80, 50 and 30 cls. a group of bone windows in postoperative computed tomography scans showed auditory brainstem implants (arrows) in the lateral recess of the fourth ventricle, which was the target anatomic location. all wounds healed well, and no csf leakage, subcutaneous hydrops, wound infection, intracranial infection, or death occurred. according to the tarlov classification the animals recovered to preoperative health status in 5.7 days (range, 57 days), which was evaluated by the modified canada disability scale. by the time of the last test, no monkeys had died or were sacrificed ; they were all maintained for use in a subsequent study. one animal presented with transient facial nerve paralysis postoperation, which was evidenced by a reduced ipsilateral less blink, a shallow forehead, and facial wrinkles. the csf samples of the monkeys at different time points were colorless and clear, with a negative reaction in pandy 's test. the csf items were not significant differents between the pre- and post - operative tests, including intracranial pressure (80.0 mmh2o vs. 81.7 mmh2o, p = 0.742), chloride (118.0 mmol / l vs. 120.0 mmol / l, p = 0.522), glucose (2.3 mmol / l vs. 2.4 mmol / l, p = 0.771), protein (17.2 mmol / l vs. 17.6 mmol / l, p = 0.946), and cells (1.7 cells / visual field vs. 0.3 cells / visual field, p = 0.184). the average time for the abi procedure was 5.2 h (range, 4.56 h), which included nearly half of the time for the eabr testing. the preoperative abrs indicated that all animals possessed adequate auditory function, and the thresholds were 515 db nhl [figure 3 ]. the peaks i, ii and iv in the abr testing were distinguished at 80 db nhl, and their latencies and amplitudes are shown in table 1. the latency and amplitude of peaks i, ii and iv in the abr testing for six monkeys (mean sd) the left ears were tested twice, and one for the right ; p : comparison between left and right ears. only one - peak eabr waves were induced during the abi operation [figure 4 ]. however, both one - peak and two - peak eabr waves were observed during the postoperative testing [figure 5 ]. the intra- and post - operative eabr waves confirmed that the devices were accurately placed where the stimulus could excite the complete auditory pathway. for both one - peak and two - peak eabr waves, the latencies did not appear to change with the stimulus intensity ; however, the amplitudes had a positive correlation with the intensity. the postoperative ct scans confirmed the anatomic site of the implant electrode arrays [figure 6 ]. throughout the eabr testing, all monkeys remained stable, and no abnormal changes in the pulse rate, spo2, respiratory rate, or abnormal limb movements were identified. the one intra - operative electrical auditory brainstem response wave (ep i) followed a stimulus artifact (sa), and the stimulus intensity from top to bottom of the five lines were 200, 150, 100, 50 and 0 current levels. (a) one - peak postoperative electrical auditory brainstem response (eabr) wave (ep i), the stimulus intensities from top to bottom were 120, 100, 80, 50, 30 and 0 current levels (cls) ; (b) two distinguishable eabr waves (ep i and ii), the stimulus intensities from top to bottom were 150, 150, 150, 120, 110, 100, 80, 50 and 30 cls. a group of bone windows in postoperative computed tomography scans showed auditory brainstem implants (arrows) in the lateral recess of the fourth ventricle, which was the target anatomic location. all wounds healed well, and no csf leakage, subcutaneous hydrops, wound infection, intracranial infection, or death occurred. according to the tarlov classification the animals recovered to preoperative health status in 5.7 days (range, 57 days), which was evaluated by the modified canada disability scale. by the time of the last test, no monkeys had died or were sacrificed ; they were all maintained for use in a subsequent study. one animal presented with transient facial nerve paralysis postoperation, which was evidenced by a reduced ipsilateral less blink, a shallow forehead, and facial wrinkles. the csf samples of the monkeys at different time points were colorless and clear, with a negative reaction in pandy 's test. the csf items were not significant differents between the pre- and post - operative tests, including intracranial pressure (80.0 mmh2o vs. 81.7 mmh2o, p = 0.742), chloride (118.0 mmol / l vs. 120.0 mmol / l, p = 0.522), glucose (2.3 mmol / l vs. 2.4 mmol / l, p = 0.771), protein (17.2 mmol / l vs. 17.6 mmol / l, p = 0.946), and cells (1.7 cells / visual field vs. 0.3 cells / visual field, p = 0.184). to the best of our knowledge, this is the first report regarding the rhesus macaque monkey (m. mulatta) implanted with abi placement. the successful induction of an abi model in the rhesus macaque monkey paves the way for future studies. an appropriate surgical approach is vital for the exposure of the implant site and following abi implantation. two approaches have been used in clinical practice for abis : the translabyrinthine (tl) and rs approaches. the tl approach was originally advocated by edgerton. and is currently the only method approved by the us food and drug administration (fda) in abi clinical trials. however, an anatomical study by kuroki and moller on cadaver specimens has demonstrated that the tl approach to the cpa offers a limited view ; thus, it is necessary to medically retract the sigmoid sinus to obtain a medial view of the root entry zone of the cochlear nerve. in another anatomical investigation, friedland and wackym have demonstrated that the rs approach provides excellent visualization of the lateral recess of the fourth ventricle when a 30 endoscope is used, which provides a more direct appreciation of the implant site compared with the tl approach. previous studies have proven that the rs approach has various advantages, such as the adequate control of bleeding, dissection of the entire tumor under direct view, easy identification of the facial and cochlear nerves at their root entry zone and the distal end in the internal auditory canal, and adequate exposure of the foramen of luschka. in addition, the rs approach provides a unique opportunity for real - time intraoperative monitoring by direct recording of cochlear nerve action potentials, which could prove useful in attempts at hearing preservation. compared with humans, the rhesus macaque monkey possesses a more flat, smaller (approximately 2 cm 1.5 cm on one side) posterior fossa and relatively strong, thick head and neck muscles. the regular linear postauricular incision can not provide satisfactory posterior fossa bone exposure, which, therefore, makes it difficult to distinguish nerves during the abi procedure. after considering the advantages of the two approaches, the modified rs approach was adopted for this study. the inverted l - shaped flap and muscles, which had been fully freed, were turned outward, and the external occipital protuberance, middle line, superior nuchal line, part of superior border of the foramen magnum and mastoid process were completely exposed. during the nerve identification stage, the lower cranial nerves were recognized first, followed by the cochlear and facial nerves. the choroid plexus of the fourth ventricle and luschka 's foramen could then be located by anatomic landmarks. prior to electrode array implantation, the cerebellum and brainstem were separated from the bottom to top, which proved to be easier than the operation on the locale of luschka 's foramen. the experiences with the six monkeys suggested that the modified approach is feasible for multichannel abi implantation. several researchers have studied auditory evoked potentials in rhesus macaque monkeys. they have concluded that peak i in rhesus macaque monkeys (which is analogous to peaks i and ii in humans) was generated by eighth nerve fibers, whereas peak ii (that is analogous to peak iii in humans) was generated by the cn. the neural generator of peak iii (which is analogous to peak iv in humans) was not determined by a specific near - field recording, although the researchers assumption was that this peak had its origin in the superior olivary complex. finally, peak iv in monkeys (which is analogous to peak v in humans) was determined to originate from the contralateral lateral lemniscus. in our study, the latencies and amplitudes of peaks i, ii and iv were accurately calculated. the latencies of the waves were similar to a previously published study ; however, the amplitudes appeared lower than the data from the same research. intraoperative electrophysiology during abi implantation demonstrated that electrical stimulation from the implanted electrode elicits a response from the ascending auditory pathway, which is reflected in the recorded eabr. as the full surface of the cn is not visible, even an experienced neurosurgeon may have difficulty placing the electrode array into an optimal position every time. in our study, preoperative abr in the rhesus macaque monkey contains three explicated waves [figure 3 ] ; however, only one - peak eabr waves can be observed during surgery [figure 4 ], and one - peak or two - peak eabr waves can be observed postoperatively [figure 5 ]. in humans, the eabr elicited by the electrical stimulation of the cn is similar to the abr ; however, it typically does not contain components that correspond to peaks i or ii in the abr. the latencies of the peaks that are generated in the cn and the lateral lemniscus are shorter than the abr. referred the relevant information of humans and analyzed the waves in the abr and eabr of rhesus monkey, we concluded that the eabr waves in rhesus macaque monkeys do not contain components that correspond to peak i in abr, and ep i and ep ii [figures 4 and 5 ] correspond to peaks ii and iv [figure 3 ], respectively. furthermore, peaks ii and iv were generated in the cn and contralateral lateral lemniscus. in addition, the latencies of ep i and ep ii were less than peaks ii and iv [figures 4 and 5, and table 1 ]. of particular note was that the waveform of the recorded eabrs differed considerably among individuals. during testing, we could observe that as the stimulus intensity increased, the amplitude of the eabr wave in the same electrode also increased in a certain scope. however, no similar correlation was identified between the latency and stimulus intensity. in the current study, we successfully established an abi animal model in the rhesus macaque monkey, and short - term data supported its feasibility and safety. however, the long - term survival state and electrophysiology of monkeys with implants requires further investigation. although eabr testing and postoperative ct could prove the effectiveness of this procedure in electrophysiology and anatomy, respectively, relevant behavioral studies should be considered in future implantations. any disorder that affects the secretion, absorption or transportation will cause changes in the components of the csf and/or neural activity. the short recovery time and stable csf components of all animals may demonstrate the safety of the abi. we concluded that the rhesus macaque monkey is a valid abi model, and the modified suboccipital rs approach can provide sufficient exposure for the implant surgery. during the intra- and post - operation of abis, the eabr test can guide us to the optimal implant sites, and the postoperative ct can confirm the implant location. ep i and ep ii of eabr wave were generated in the cn and contralateral lateral lemniscus. numerous studies have clearly established this species as an essential model for neurophysiologic investigations in conjunction with sophisticated behavior. we suggested that the demonstration of the feasibility of abi procedures in the macaque monkey opens a promising field of research regarding the mechanisms of auditory recovery after abi surgery.	background : the auditory brainstem implants (abis) have been used to treat deafness for patients with neurofibromatosis type 2 and nontumor patients. the lack of an appropriate animal model has limited the study of improving hearing rehabilitation by the device. this study aimed to establish an animal model of abi in adult rhesus macaque monkey (macaca mulatta).methods : six adult rhesus macaque monkeys (m. mulatta) were included. under general anesthesia, a multichannel abi was implanted into the lateral recess of the fourth ventricle through the modified suboccipital - retrosigmoid (rs) approach. the electrical auditory brainstem response (eabr) waves were tested to ensure the optimal implant site. after the operation, the eabr and computed tomography (ct) were used to test and verify the effectiveness via electrophysiology and anatomy, respectively. the subjects underwent behavioral observation for 6 months, and the postoperative eabr was tested every two weeks from the 1st month after implant surgery.result:the implant surgery lasted an average of 5.2 h, and no monkey died or sacrificed. the averaged latencies of peaks i, ii and iv were 1.27, 2.34 and 3.98 ms, respectively in the abr. one - peak eabr wave was elicited in the operation, and one- or two - peak waves were elicited during the postoperative period. the eabr wave latencies appeared to be constant under different stimulus intensities ; however, the amplitudes increased as the stimulus increased within a certain scope.conclusions:it is feasible and safe to implant abis in rhesus macaque monkeys (m. mulatta) through a modified suboccipital rs approach, and eabr and ct are valid tools for animal model establishment. in addition, this model should be an appropriate animal model for the electrophysiological and behavioral study of rhesus macaque monkey with abi.
many fungi have yet to be collected and named, and it appears that the number of undescribed species is at least 1.4 million and probably as many as 3 million (hawksworth 2012a). it is anticipated that many of these species are to be found in the tropics, and this poses particular constraints to their formal description. until the 1990s, tackling this task was generally by opportunist, short - stay visits to the tropics by european and north american mycologists ; something that can be likened to smash - and - grab raids. the material is often retained in the collector s institution though, where possible, some mycologists have split, and diligently repatriated, at least some of the specimens. as there were few centres anywhere in the tropics where fungal material could be deposited and safeguarded for examination by future generations of mycologists in the 18 and 19 centuries, this situation was unavoidable in those times. in the last few decades in particular, the situation has changed. there has been a remarkable expansion in systematic mycology in universities, research institutions, and museums located in some tropical regions, especially in parts of asia, south america, and southern africa. in endeavouring to check if a previously named fungus is the same as one recently collected, or when undertaking revisionary work or preparing monographs, it is often necessary to consult material at institutions in europe and/or north america. this is particularly so in the case of the name - bearing type material where original descriptions, especially from the 19 century, are meagre and lack information on characters essential for interpretation today ; and they may not be accompanied by photomicrographs or line drawings. personal visits to the holding institutions are ideal, but may be prohibitively expensive for those lacking secure funding. at the same time, collection curators are increasingly reluctant to dispatch material around the world. this is understandable as there are instances where irreplaceable types have been lost or damaged in the postal systems, or even destroyed at points of entry by customs officials. also, the problems of loss or damage in transit are not confined to tropical countries ; for example, i know of cases where type material, dispatched to the uk from institutions in poland and russia, failed to arrive at all. in the case of microfungi in particular, there is often an additional problem of few or even single sporocarps being present on a specimen. there are concerns at their being destroyed in examination, with no permanent preparations having been made, or being used in abortive attempts to extract dna. some institutions have developed a policy of sending only a portion of the material at one time, with the remainder sent only when the first part has been returned. further, to minimise destructive sampling, whenever slides had been prepared, these were often also included and loaned with the type material to preclude the necessity for more preparations. the splitting of samples and slides was a practice adopted at the former international mycological institute (kew and egham, uk) in the 1980s and 1990s. that institute was anxious to promote the study of tropical fungi in universities and other institutions in tropical regions. many european and north american institutions, however, have policies of only lending material to other established institutions, and not to individuals or institutions lacking collections or curators. others, especially ones with collections dating from the early 19 century and before, will no longer lend material under any circumstances, generally as a result of unfortunate experiences in the past. however, in some cases, where the lending of type material is not allowed, curators of collections have been pleased to supply photographs, and prepare microscopic preparations instead which may be sufficient in some cases. an increasing number are actively preparing digital images of the specimens they hold, and making the images available through the worldwide web. however, although digital macroscopic images can be excellent for studying vascular plants, they are of limited value for studying most fungi. there is also a category of institutions that are willing, in principle, to lend material, but have neither the appropriately experienced staff to look out, pack, and dispatch material, nor the funds to cover the costs of secure postal services. the loan issue is particularly acute and frustrating where it is known that the desired name - bearing type material is in existence in a collection, but which can not be examined for any of the reasons summarized above. this is a conundrum that has the potential to shackle, frustrate, and delay progress in systematic studies in regions with the highest proportions of yet undescribed fungi and where many of those able to undertake that work are now located. this is not a new situation, indeed the mycologist and botanical polymath corner (1946) observed that there is no reason why research should be held up because the [mycologist ] is unable to consult earlier investigations. young [mycologists ] brazenly to face the situation and to ignore, of necessity, what they can not possibly obtain, through distant libraries. he went on to remark that following the destruction of so many libraries and collections in world war ii, few will be able to consult the early periodicals, the early books, and the type specimens. his suggestion was to produce encyclopaedic works and, in effect, treat those as new starting points for future work. i suspect he would have been a strong supporter of the changes enacted in july 2011 to establish protected lists of names of fungi (hawksworth 2012b, mcneill.. he would also be pleased to see that increasing amounts of early mycological literature are becoming available free of charge through the biodiversity heritage library (bhl ; http://www.biodiversitylibrary.org/) and cyberliber (http://www.cybertruffle.org.uk/cyberliber/) initiatives. the issue of access to name - bearing types unfortunately remains a constraint almost seven decades on. a pragmatic approach has to be adopted to alleviate this particular constraint on systematic mycology, especially in the tropics. each case must be considered individually, and no generalization can be made, but some guidelines may prove helpful to mycologists when confronted with the frustrating situation of not being able to examine name - bearing type material which is known still to exist in some collection. request either a member of staff in the collection (or the institution in which it is housed), or another mycologist living near the holding institution, or a visiting mycologist, to take high - power digital images, make measurements or notes, or prepare microscopic slides that can be sent on loan. see if any duplicate material (isotypes) of the desired name - bearing type is available in collections of other institutions known to house material of the author or the collector, as these might be willing lend material. information on where material of deceased authors of fungal names is held is included in hawksworth (1974) and taxonomic literature (tl-2 ; stafleu & cowan 19762009). in some cases, there will be evidence in the published literature that later mycologists have examined a specimen, and these may have provided a detailed description and/or illustrations. in such instances the type collection may be cited but with n.v. (non vide ; i.e. not seen), added after the collection acronym to show it was not examined. this is a common practice where a taxon is well established, and the circumscription is not controversial. request photocopies of the labels to verify the status of the located specimens to confirm that they qualify as holotypes, or be potential material for lectotypification. the label should give locality and date of collection, or other indications on the packets, such as orig. mat., sp. nov., or typus, in the author s handwriting. if there is no such evidence, it is possible that material which had been previously considered to be the name - bearing type, proves not to be when the provenance is studied more critically. for example, a specimen with no date, even though made by the describing author and from the original locality, may have been collected after the date of effective publication of the name. this would mean that there was no obstacle to designating some other collection that was available for study as a neotype. a neotype does not have to be of material ever seen by the original author but, ideally, should be from the same geographical area of collection and, where appropriate, from the same host or substrate. in cases, where it is really necessary to clarify an ambiguous situation and fix unequivocally the application of a name, and where a holotype / lectotype / neotype exists, but can not be studied, an interpretative type, termed an epitype could perhaps be justified. this would be a broad interpretation of the phrase can not be critically identified for purposes of the precise application of the name of a taxon that epitype would stand unless, and until, it was shown that an epitype and the type it supports differ taxonomically (art. 9.20). when designating an epitype, the extant name - bearing type which it acts as an interpretative type for has to be stated. this is, however, a somewhat controversial interpretation of the code, where the material might be identifiable were it studied. consequently, such a step should not be undertaken without the most careful consideration, and this issue will be explored further in a separate paper currently being prepared by kevin d. hyde and colleagues. however, this may be the most appropriate solution, and justifiable, where cryptic species (ones that are morphologically indistinguishable) are involved, and where dna sequence data are not available for the extant (but unexamined) name - bearing type, but are for the proposed epitype. as an epitype is an interpretive type linked to the name - bearing type, if there are syntypes that are not accessible it would be necessary first to select one of those as a lectotype and to base the epitype on that. the article (art.) numbers of the code used in this contribution are those of the melbourne code (mcneill. 2012), some of which differ from those allocated to the same points in previous editions. as an epitype is an interpretive type linked to the name - bearing type, if there are syntypes that are not accessible it would be necessary first to select one of those as a lectotype and to base the epitype on that. the article (art.) numbers of the code used in this contribution are those of the melbourne code (mcneill. 2012), some of which differ from those allocated to the same points in previous editions. for names that are not in current use, the name can simply be listed as of uncertain application, and not be adopted but this procedure should not be followed for names in use today as that could lead to new undesirable names shaving to be adopted. now that mechanisms for the protection of fungal names through the adoption of lists of accepted names (i.e. protected names) and rejected names (i.e. suppressed names) have been incorporated into the code (arts 14.13, 56.3), the importance of fixing the application of all proposed names is reduced. while it is desirable that all names are typified and discussed in systematic work, older names subsequently discovered to pre - date ones in use may be listed either as synonyms in an accepted list, or alternatively added to a rejected list. for names in current use, where it is not clear whether any name - bearing type material definitely exists, for example because of uncertainty of the provenance of a specimen previously considered as the type, or not being able to check the describing author s collections, designate a particular, freshly studied specimen and use a phrase such as representative specimen or pragmatype and protype, as used in zoology, are both better avoided as their meaning is closer to that of epitype (hawksworth 2010). a proxy type, although an unofficial designation, would remain available for selection in the future as a neotype if it later became clear that no holotype or original material eligible for lectotypification was extant. where there is no holotype, a lectotype has not previously been designated, and the name was introduced prior to 1 january 2007, in some cases an illustration may be available for use (art. this situation arises where the original material consists of both one or more candidate specimens that can not be studied and also an illustration, there is no obstacle under the code to selecting the illustration as lectotype, and not the specimen. the illustrations can be unpublished, or published either before or with the validating diagnosis (art. it would then be possible to designate another specimen or metabolically inactive culture as epitype. 13.1(d)), no holotype of the name - bringing epithet exists, and a lectotype has not previously been designated from amongst existing original material (which can not be studied), a lectotype which is available for examination may be selected from among elements associated with either the original protologue or the sanctioning treatment (art. this is only likely to be a potential solution in a small number of cases as all specimens cited in sanctioning works may also be unavailable for examination. however, if one or more illustrations are cited in the sanctioning work they may be available for designation as lectotypes in which case the procedure noted in (8) above could be considered. bearing in mind the current problems over access to name - bearing types addressed here, mycologists can take some action to preclude, or at least minimise any future difficulties when designating a holotype, or any other official category of type. deposit the name - bearing type (holotype) in a public collection in the country of origin where there is a fungal curator. many types of fungi are deposited in collections located in countries other than that in which they were collected ; this was the case for 41 % of the name - bearing types of fungi described in the period 199194 (hawksworth & kirk 1995). this situation should not be exacerbated where alternative public collections exist in the countries of origin. deposit duplicates (isotypes) of the name - bearing type in one or more different public collections located in other countries where the specimens are sufficiently large to enable them to be subdivided. where material can not be split, where possible deposit duplicates of other collections cited in the original publication (paratypes) instead. where a name - bearing type (holotype) is a permanently preserved and metabolically inactive culture, it is prudent to deposit subcultures prepared from that (ex - type cultures) in at least three service collections of fungal cultures from which they can be obtained. provide as detailed and comprehensive description as possible of the fungus and accompany it with photomicrographs and line drawings, and note the advice in seifert & rossman (2010). along with the designated type material, deposit permanent microscopic slide preparations which show essential features. where dna sequence data have been obtained, deposit them in genbank, or a similar public repository. when designating a lectotype, neotype, or epitype of a name, remember that this, as other nomenclatural acts, has to be published ; an annotation on a label attached to a specimen does not constitute effective typification. mention any designations of a lectotype, neotype, or epitype in the abstract of the paper in which these are published. such later typifications are otherwise easily overlooked by other mycologists. also, record such published typifications in a nomenclatural database if possible. i understand that this facility will be available in mycobank shortly, and in the future i personally would wish to see this become mandatory for the recognition of later typifications under the code. in view of the scant and fragile nature of many older type specimens examination of types is essential in the course of revisionary or monographic studies, or to confirm differences from a newly discovered taxon, but inappropriate in the case of routine identifications except where ex - type cultures are available. mycologists today sometimes need to consult specimens collected in the 18 and even the 17 centuries ; unnecessary handling and slide - making may jeopardize the value of the specimens to future generations. any microscopic preparations from specimens should only be made when essential, and the slides made from the material should be permanently preserved along with the type material from which they were derived. destructive sampling of dried specimens for dna extraction should only be undertaken with the prior permission of the curator concerned. this is not, however, a problem where ex - type cultures are available. any type material received on loan should always be packed carefully and returned using secure delivery services and within the specified period of the loan. the recommendations in this contribution are based on my personal opinions and experience, good taxonomic practice, and questions which i have been asked by other mycologists, particularly ones based in the tropics. the recommendations do not necessarily reflect the views of the nomenclature committee for fungi (ncf), the international commission on the taxonomy of fungi (ictf), or the international mycological association (i m a). further, the options presented are not claimed to be exhaustive and other possibilities may be appropriate in some instances. in each case as the code is now such a complex and even forbidding document, a valuable guide to it and its operation has recently been prepared by turland (2013) ; that work merits a place on the shelves of all systematic mycologists.	access to name - bearing type material can be a particular frustration for those mycologists in the tropics, or working outside established institutions, where the specimens are known to exist but can not be examined. they can be inaccessible because of loans policies and the inability of mycologists to make personal visits. each case has to be considered separately, but a pragmatic nine - point approach is presented which may provide some guidance as to what can be done in such instances. a postscript draws attention to 12 points to consider when designated or handling name - bearing types.
the global pharmaceutical industry has grown at a tremendous pace reaching up to $ 956 billion and is expected to rise to nearly $ 1.2 trillion in 2016, representing a compound annual growth rate of 36 percent the world over (1). with this aggressive growth and ever increasing competition the marketing strategies of pharmaceutical and some dental / medical equipment companies are becoming ethically questionable (24). although the pharmaceutical industry is sponsoring a lot of research worldwide, the major portion of their budget is allocated to promotional activities (4, 5). the usual promotional activities are obliging doctors by minor gifts, like stationery items, donating equipments, kits and even invitations for dinners, or sponsoring participation in seminars and training programs. this brings about a conflict between the physician s financial interest and the welfare of the patient (413). in medicine, awareness of the ethical implications of such gifts has been raised for the past few decades and a code of ethics has been formulated for interaction between medical practitioners and pharmaceutical companies. in dentistry, the need to realize the ethical implications of such interactions is greater than medicine because of the more active involvement of device industry and material manufacturers. the interactions of dentists include those with pharmaceutical, biotech, medical device and research equipment industry. however, with the growing competition amongst the pharmaceutical industry, device industry and material manufacturers, the unethical marketing practices are also growing. the present study was undertaken to assess the attitudes and practices of fresh dental graduates, faculty members and private practitioners in dentistry towards pharmaceutical gifts, and consequently the need for implementation of guidelines and a code of ethics in the dental fraternity in pakistan. another purpose of this study was to assess the difference in perception of fresh graduates, residents, faculty members and private practitioners. the study sample included dentists of various categories : fresh graduates, residents / demonstrators, faculty members and private practitioners. the assessment tool was a questionnaire that was designed based on previously published studies in india (15) and norway (16). it was handed out at various teaching and training dental institutions, clinics and dental conferences, and was filled in anonymously. the teaching & training institutions included in this study were de montmorency college of dentistry, sharif medical and dental college, lahore medical and dental college and fatima memorial dental college and hospital. all the data was compiled and analyzed using microsoft excel (windows 7) and spss (version 17). for testing significance, since the data was predominantly qualitative in nature, chi square test was applied at a p value of 0.05 or less. a total of 220 participants were requested to fill a study instrument, 209 (95 %) completed it and were included for data analysis. the participants included fresh graduates (fg), demonstrators (d), faculty members (fm) and private practitioners (pp) working in dentistry. the demographic data of the study participants are summarized in table 1 and figure 1. the response of the four different groups to the pharmaceutical representative (pr) is shown in tables 2 and 3. it appeared that private practitioners (pp) were more frequently contacted by the prs. during the previous 3 months a similar trend was observed in the offering of gifts, with the highest percentage of gifts being offered to private practitioners (over 75%) as against 61.1% to fresh graduates, demonstrators and faculty members. when gifts were offered, the pps accepted in higher proportion (69.0%) than faculty (43.1%). from the ethical point of view of accepting gifts, a very high percentage (92%) of faculty members declared that accepting gifts from pharmaceutical industry was unethical while 58.2% of fresh graduates, 70.1% of demonstrators and 65% of private practitioners considered the acceptance of gifts as unethical. an interesting observation was that almost 69% of private practitioners accepted gifts from the prs but 65% of them considered it unethical at the same time. an average of 44% of the fresh graduates, demonstrators and private practitioners revealed that their prescriptions were affected by their interaction with the prs while only 7.6% of the faculty members considered their interaction with prs to affect their prescribing habit. it was interesting to note that both fresh graduates and demonstrators were offered gifts and accepted them in the ratio of 1.4 : 1, while the academic staff accepted gifts to a lesser degree, the ratio between gifts offered and accepted being 2.2 : 1.0. in the additional question on commenting about the gift as ethical or unethical, the academic group by far declared them as unethical and the ratio of labeling it as unethical was faculty : demonstrators : fresh graduates : 1.6 : 1.2 : 1. in terms of accepting and declaring it as unethical, the academic staff provided a ratio of 4 declaring unethical : 1 accepting. this ratio was much narrower in the other groups. in the entire study group 75% of the subjects who were offered gifts this study gave an insight on the impact of pharmaceutical industry s interaction with dental surgeons at various levels from fresh graduates to faculty members and private practitioners. historically, pharmaceutical industry has been trying to influence doctors prescribing habits and has often not adhered to ethical principles (17). in dentistry, interaction with device industry and material manufacturers is also a necessary evil along with the pharmaceutical industry. this renders a dentist more susceptible to their marketing strategies than a physician (13). pharmaceutical industry exploits the fact that long term habits are developed early in a doctor s career, so they make special efforts to stay in constant touch with the fresh graduates and students along with the senior members of the dental fraternity (18). these efforts of the pharmaceutical industry create a conflict of interest in ethical practices (812). the pharmaceutical industry seems to focus significantly more on private practitioners than on fresh graduates, demonstrators or the faculty members of different teaching institutions. private practitioners showed the highest percentage of accepting gifts offered to them and they also appeared to disregard the ethical considerations, and their approach was mainly more focused on the business and commercial aspects of their relationship with the pharmaceutical industry. in comparison, faculty members were offered 10% less gifts than private practitioners, while their gift acceptance rate was almost 63% less than private practitioners. this contrast in percentage of accepting gifts can be attributed to the difference in the level of education of private practitioners and faculty members, since most of the private practitioners are general dentists while faculty members invariably have some postgraduate qualification. according to a study, physician response to the pharmaceutical industry may vary by practice settings. a more ethically aware environment in a university setting leads to better ethical practices, while professional isolation of private practice may lead to being influenced by the information provided by the pharmaceutical representatives (19). this trend was also reported in a very recent study conducted in libya (20). the results showed some confusing responses especially in fresh graduates and demonstrators who accepted gifts regardless of considering them as unethical. this finding is similar to one of the recent studies in which it was concluded that although physicians understood the concept of conflict of interest, their interaction with the pharmaceutical industry led to psychological dynamics that influenced their reasoning (2). in some of the earlier studies, however, no statistically significant differences were found in the responses of the faculty members and residents (5). such trends probably indicate inadequacies in the training and curricula in terms of professional ethics. one limitation of the present study was an absence of control over the validity of the responses since it could not be ascertained whether the respondents were trying to project certain concepts or simply report their actual practices. true evaluation for built - in validity assessment could be a blend of knowledge, attitudes and practices. the majority of fresh graduates, demonstrators and private practitioners seemed to have their prescribing habits affected by gifts ; however, only a very small percentage of faculty members appeared to be influenced by gifts. this difference can again be attributed to the latter s academic qualifications and their awareness of ethical implications. on the other hand the present study highlights the need for regulations to be imposed by the government, but laws alone can not reinforce ethical practice, and physicians themselves need to abstain from the negative commercial influences of marketing (22). the present study indicates lack of awareness on ethical implications of interaction with the pharmaceutical industry in the undergraduate and postgraduate training. pakistan medical and dental council has laid clear guidelines on interaction with the pharmaceutical industry, but unfortunately most of the medical and dental graduates are unaware of even the existence of such a document. these guidelines should be updated with the changing trends and implemented at all levels in the noble profession of health care. continuing dental education should also have an ethical component and pakistan medical and dental council should implement a mandatory component on ethics for renewal of practicing license in order to reinforce ethical considerations periodically.	interaction of pharmaceutical companies (pc) with healthcare services has been a reason for concern. in medicine, awareness of the ethical implications of these interactions have been emphasized upon, while this issue has not been highlighted in dentistry. this study undertook a cross - sectional rapid assessment procedure to gather views of dentists in various institutions towards unethical practices in health care and pharmaceutical industry. the purpose of this study was to assess the need for the formulation and implementation of guidelines for the interaction of dentists with the pharmaceutical and device industry in the best interest of patients.a group of 209 dentists of lahore including faculty members, demonstrators, private practitioners and fresh graduates responded to a questionnaire to assess their attitudes and practices towards pharmaceutical companies marketing gifts.the study was conducted during 2011 and provided interesting data that showed the pharmaceutical industry is approaching private practitioners more frequently than academicians and fresh graduates. private practioners accepted the gifts but mostly recognized them as unethical (over 65%). both groups considered sponsoring of on - campus lectures as acceptable (over 70%).respondents are not fully aware of the ethical demands which are imperative for all health care industries, and there is a dire need of strict guidelines and code of ethics for the dentist s interaction with the pharmaceutical and device industry so that patient interest is protected.
pituitary adenomas (pas) are nonmetastasizing neoplasm which consist adenohypophysial cells. although they usually occur in the sella - turcica, they may occasionally be ectopic. they are relatively common benign neoplasms with different clinical features. according to the who classification in 2004, endocrine pituitary tumors are clinically classified as functioning (mainly secrete adrenocorticotropic hormone [acth ] with cushing 's disease ; growth hormone [gh ] with acromegaly and prolactin [prl ] with amenorrhea galactorrhea) and nonfunctioning (mainly luteinizing hormone [lh ] and follicle - stimulating hormone [fsh ]) tumors. considering the small size of many pituitary tumors and their tendency to exist without symptoms, estimation of their accurate prevalence of pas is challenging in the general population. pituitary tumors present with a diversity of clinical manifestations that include symptoms of excessive hormone secretion by the tumor, signs of hormone shortage by the normal pituitary gland and those related to pressure effects due to development of the tumor mass. tumors that expand more quickly, even if they are hormonally inactive, are more likely to cause signs of an intracranial mass, including visual field disturbances. the main purpose of this study was to present retrospective information on the epidemiology, clinical, and demographic presentation in patients with pas with the surgical indication. a retrospective survey of pas was organized in the loghman hakim hospital, a main teaching and general hospital that is characterized as one of the highly qualified centers for diagnosis and treatment of pituitary tumors in iran, affiliated to shahid beheshti university of medical sciences. the study was approved by the research ethics committee of shahid beheshti university of medical sciences. each medical record related to a patient with confirmed pa, who underwent surgery between 2001 and 2013 were included and reviewed. loghman hakim is a tertiary center and all the patients in this study were referred to this center for surgical procedures. patients characteristics including data on demographics, diagnosis, initial symptoms, hormonal profiles, radiological data and applied therapies were gathered from patients medical records, hospital case information, and other important clinical records. diagnosed symptoms linked to pituitary mass (e.g., headache and visual disturbance) and hormone excess (gigantism or acromegalia, hyperprolactinemia and cushing 's disease) were investigated and recorded. basically, baseline assessment included the followings : clinical review, serum levels of gh, thyrotropin thyroid stimulating hormone (tsh), prl, lh, fsh, cortisol, and perimetry to assess visual field defects. descriptive analysis was used in which categorical variables are expressed by frequency (percentages), and continuous variables were expressed as mean standard deviation (sd). comparison of means between subgroups was performed using independent t - test and one - way analysis of variance. a retrospective survey of pas was organized in the loghman hakim hospital, a main teaching and general hospital that is characterized as one of the highly qualified centers for diagnosis and treatment of pituitary tumors in iran, affiliated to shahid beheshti university of medical sciences. the study was approved by the research ethics committee of shahid beheshti university of medical sciences. each medical record related to a patient with confirmed pa, who underwent surgery between 2001 and 2013 were included and reviewed. loghman hakim is a tertiary center and all the patients in this study were referred to this center for surgical procedures. patients characteristics including data on demographics, diagnosis, initial symptoms, hormonal profiles, radiological data and applied therapies were gathered from patients medical records, hospital case information, and other important clinical records. diagnosed symptoms linked to pituitary mass (e.g., headache and visual disturbance) and hormone excess (gigantism or acromegalia, hyperprolactinemia and cushing 's disease) were investigated and recorded. basically, baseline assessment included the followings : clinical review, serum levels of gh, thyrotropin thyroid stimulating hormone (tsh), prl, lh, fsh, cortisol, and perimetry to assess visual field defects. descriptive analysis was used in which categorical variables are expressed by frequency (percentages), and continuous variables were expressed as mean standard deviation (sd). comparison of means between subgroups was performed using independent t - test and one - way analysis of variance. in this study, 278 patients with confirmed pas who underwent trans - sphenoidal surgery with a mean age of 41 14 years were included. one hundred and sixty patients (57.5%) were male, and 118 (42.4%) were female. there was no significant difference in mean age between men and women (42 15 and 39 13-year - old in men and women, respectively ; p : 0.262). the majority of the patients were aged between 40 and 50 years (30% in males and 26.3% in females). the chief complaint was pressure effect due to a pituitary tumor in 153 cases (55.2%) and hormonal disorders in 128 cases (44.8%). in comparison between genders, male patients tended to initially present with mass effect symptoms (66.9%) while hormonal symptoms were the most commonly observed complaints among women (61%). main symptoms originated from pressure effects of a pituitary tumor were : headache (n = 37, 13.3%), visual field defects (n = 69, 24.8%) and coincidence of headache and visual field defects (n = 44, 15.8%) [table 1 ]. main symptoms caused by hormonal disorder included : acromegaly (n = 72, 25.9%), symptoms of both acromegaly and galactorrhea (n = 10, 3.6%), hypopituitarism resulted after pituitary apoplexy (n = 5, 1.8%), and amenorrhea (n = 6, 2.1%) [table 2 ]. there was a significant relationship between patients age and the initial manifestations of the disease. the mean age of patients who presented with hormonal symptoms was 35 10 years while patients with mass effect were significantly older (mean age of 45 15 years old ; p < 0.0001). the time interval from initial disease manifestations to diagnosis was 16 months in 65 cases (22.6%), 612 months in 51 cases (18.2%), 12 years in 59 cases (20.8%), 210 years in 82 cases (29.14%) and more than 10 years in 21 cases (7.2%) [table 1 ]. baseline characteristics and the most commonly detected mass effect symptoms in patients with pituitary adenoma with surgical indication prevalence of different signs and diagnosis in patients with hormonal imbalance complaints pituitary tumors were categorized based on whether or not they generate hormones and the sorts of produced hormones (who categorization in 2004). the prevalence of different types of pa according to who classification, which was observed in this investigation were as follows : prolactinomas (29.1%), gh - producing tumors (25%), nonfunctioning pas (nfpas) (28.4%), acth - producing tumors (2.1%), tsh - producing tumors (0.7%), mixed gh / prl adenomas (13.6%), mixed gh / acth adenomas (0.3%) and tsh / acth adenomas (0.3%) [table 3 ]. while prolactinoma was the most prevalent type in females, nfpa was the most prevalent type of pa in men [table 3 ]. four of these patients had prolactinoma (36.4%), five had nfpa (45.5%), one had mixed gh / prolactinadenoma (9.1%) and one case had mixed tsh / acth adenoma (9.1%). hormonal disorders found in radio - immunoassays were hyperthyroidism (3.9%), hypothyroidism (8.6%), hyperprolactinemia (41%), high lh (2.5%), high fsh (2.8%), and high cortisol (6.8%). type of adenoma in patients with pa moreover, there was a significant difference in size of tumors between genders and adenoma type. macroadenomas were more prevalent in male patients compared to women (p = 0.001). furthermore, gh producing tumors were mostly microadenomas, while prolactinomas and nfpa 's presented as macroadenomas more often (p < 0.001). considering recurrent adenomas, 57 patients had more than one surgery. recurrent adenomas with surgical indication occurred mostly among men (n = 34, 59.6%). common types of adenomas which required surgical process included : prolactinoma (21.1%), nfpa (36.8%), gh adenoma (26.3%), mixed gh / prl adenoma (12.3%, acth adenoma and tsh adenoma (1.8%) [table 4 ]. no significant differences were found between the type of adenoma in patients with recurrent and nonrecurrent adenomas (p = 0.639). twenty - four (42.1%) patients with recurrent pa were diagnosed with microadenomas whereas 33 (57.9%) had macroadenomas, and the difference between these groups was not significant either (p = 0.881). in this study, the most common types of pas with surgical indications in iran have been identified by reviewing medical files of patients during 12 years. pituitary tumors are known to be the most frequent intracranial neoplasms, affecting 1/1000 of the worldwide population. in the present study the registered data (i.e., the symptoms caused by the mass effect and similar presentations of the disorder over time) were analyzed. the majority of patients with pas with surgical indications are men with the most prevalent adenoma type of prolactinoma. in a meta - analysis, ezzat. reported that the whole estimated prevalence of pas was 16.7% (22.5% in radiologic studies and 14.4% in autopsy studies). in iran, a cross - sectional descriptive study was carried out on a total of 485 cadavers to estimate the prevalence of pituitary incidentaloma. pituitary glands were removed from cadavers and evaluated. of the 485 investigated cadavers, 61 (12.6%) did not find any statistically significant difference between the mean age, sex, and body mass index of the cadavers with and without concealed tumors. they estimated the prevalence of the concealed pas was 12.6%. in a cross - sectional study performed in iran on 250 patients by asadi - lari. our study showed that prolactinoma was the most prevalent pa with surgical indication among women and the second commonly observed pa among men which are in line with asadi 's report. furthermore, acromegaly was reported in about 7% of patients by asadi - lari. here, since we recruited those patients with surgical indication, the prevalence of acromegaly was much higher and reached 58%. one reason for the low prevalence of acth - secreting pa in our study is that we only included those patients who required surgical intervention. in fact, the most common indication for surgical intervention is mass effect symptoms in which the most prevalent type of pa is nonfunctioning adenomas. given the small size of many pituitary tumors and lack of existence of clinical symptoms in many cases of pa, estimation of the accurate prevalence of pa is challenging. in this regard, another study in iranian population showed that among 3437 cases who were hospitalized with brain tumors, pa was diagnosed in 488 cases (14.2%). here, the most prevalent type of pa among those patients with confirmed pa who underwent trans - sphenoidal surgery was assessed. the findings of this study does not illustrate the most prevalent types of pa among the whole population with pituitary tumors, but these outcomes demonstrate that among patient with clinical symptoms of pa probable necessity for surgical intervention, which manifestations of disease are more probable to be observed. according to terada. study, there is usually a female predominance in tumor occurrence, who typically present at a younger age and have a higher incidence of acth - secreting tumors and prl - secreting adenomas, whereas men were likely to present in middle or older age with clinically nonfunctioning tumors. in sanno study, 506 patients with incidentally originated pituitary masses also were included, among which 204 were male, and 292 were female. in a study of annegers. in minnesota in 1978, the investigators reported the incidence of pas to be as high as 7.1 per 100,000/year in women of child - bearing age, decreasing thereafter, in contrast to men whose pa incidence increased with age. ferrante. in a retrospective registration of nfpa patients, reported from 295 patients, daly. in a study that was conducted in several regions of the province of lige, belgium, identified 68 patients with clinically related pas in a population of 71,972 individuals, who were 67.6% female ; the mean (sd) prevalence was evaluated to be 94 19.3 cases per 100,000 population (95% confidence interval, 72.2115.8). all these literature have shown the probability of the existence of a gender polymorphism when addressing the prevalence of pas. our study showed that there is a gender difference in the most prevalent type of pa with surgical indications. in fact, male individuals are more probable to have nfpa, whereas prolactinoma is the most frequently observed pa among women. our results suggest that gender can be predictive of a specific type of pa or recurrent tumors. according to present results, the highest incidence of pas was in the 4060-year age group. the most common subtype of pas was the prolactinomas (29.1%) followed by gh - secreting adenomas (25%) and nfpa (24.8%). considering these findings, the current study is consistent with previous reports. in a population - based study during 19601966 in israel, leibowitz. reported the highest incidence of pas in the 4069-year age group, which was declined in older ages. reported that the most common subtypes of pas were the prolactinomas (46.2%), nfpa (34.2%) and gh - secreting adenomas (16.5%) with prevalence rates of 34.96, 25.86 and 12.45/100,000, respectively. prolactinomas have a much higher incidence in these studies, which is due to the fact that most prolactinoma cases are treated medically. since, our study investigated only those cases with adenomas who underwent surgery, the prevalence of prolactinomas was relatively lower. furthermore, ezzat. reported that pas arisen in pooled autopsy and radiological series have a frequency of 14.4% (range : 135%) and 22.5% (range : 140%), respectively. among autopsy specimens that undertook immunohistochemical analysis, 2541% of cells were prl positive which is illustrative of the high prevalence of prolactinoma. the results of this study indicated that the most common mass effect symptom among pas with surgical indication is visual field defect which is followed by a headache. consistent with our results, hennessey and jackson demonstrated that visual defects and headache are the most common clinical symptoms due to intracranial mass effects of pas. in line with our study, reported that the most common presenting feature in pas patients was a headache, presented in approximately 40% of cases, followed by menstrual irregularities and visual impairment. according to ferrante study on patients with nfpas, mass - correlated symptoms, such as a headache (41.4%) and visual deficit (67.8%) were most frequently reported. visual field changes were observed in the majority of patients and impairment of visual acuity in about one - third. in line with these investigations, our study confirms that major clinical mass effect symptoms are defects of visuals field and headache. in a study by mccomb., no adenohypophyseal hormones were identified in 50% of the adenomas, whereas prl was presented in 42%. in our study, main symptoms caused by the hormonal disorder was acromegaly which contradict with previous studies indicating prolactinoma as the most commonly observed hormonal disorders among patients with pas. one reason for this discrepancy can be due to differences in the study population. since the majority of prolactinoma cases are treated medically, the prevalence of prolactinoma was lower in our study, in which only patients with surgical indication were included. in present study, pituitary apoplexy was found in 11 patients ; in one case it was occurred during pregnancy, while all other 10 patients were male, which shows a significant dominance of pituitary apoplexy in male patients. pituitary apoplexy is an acute clinical syndrome characterized by an array of presenting features including sudden onset of a headache, nausea, vomiting and sometimes altered consciousness. the clinical appearance of pituitary apoplexy may be highly variable, and the diagnosis can often be delayed especially given that the majority of apoplectic patients have no knowledge of preexisting pituitary disease. pituitary apoplexy is rare in pregnancy, and only a few cases were published in the previous literature. according to raappana. study classical pituitary apoplexy with dramatic general symptoms was a rare occurrence (n = 20 in nfi ; 0.17 episodes/100,000/year). about recurrent adenomas, the present study showed, 57 patients had more than one surgery, which were mostly male. these surgeries were due to incomplete resolution of symptoms in 21 patients, and recurrence of symptoms in 36 cases. (n = 34, 59.6%). the mean age of these patients was 40 12, which did not show any significant difference between patients who were undergone of theirfirst surgery (p = 0.159). no significant differences were found between the type of adenoma in patients with recurrent and nonrecurrent adenomas. laws and jane showed long - term results of trans - sphenoidal surgery in a series of 4020 patients with pas treated over three decades. between their patients with nonfunctioning adenomas, our study showed a recurrence rate of 20% which is similar to the rate reported by laws and jane. our study shows that nonfunctioning adenomas are more likely to be resistant to medical treatment and therefore, they are more susceptible to become recurrent after trans - sphenoidal surgery. in conclusion, the data collected in our study provided an overview of the patients with pas in the case of clinical data. by studying this well - defined population, we confirmed recent findings on the epidemiology of pas in iran. we suggest further studies in other centers (especially centers with active endocrinology ward) to confirm the results of this research. this study illustrates the prevalence of different types of pas among patients with the surgical indication. the prevalence of all types of pa (including those without surgical indication) needs to be determined in future investigations. since this study was a retrospective investigation, the obtained data were limited to those indexed in medical files. therefore, it is recommended to assess the short- and long - term complications of trans - sphenoidal surgery in the future studies. the data about immunohistochemistry of most of the patients were not available, and we recommend this matter be considered in future studies.	background : pituitary adenomas (pas) are abnormal benign tumors that develop in the pituitary gland. this study aimed to assess the prevalence of different types of pas with an indication for trans - sphenoidal surgery in a well - defined population referred to loghman hakim hospital during 20012013.subjects and methods : in this retrospective study, the prevalence rate and symptoms associated with pituitary mass and hormone excess in operated patients were investigated. the diagnosis was verified after retrieval of clinical, hormonal, radiological, and pathological data. demographic data were collected in all cases. descriptive analysis, t - test, one - way analysis of variance and fischer exacts test were used.results:a total of 278 patients with pas who underwent surgical interventions were evaluated. most of the patients were aged 4050 years with an average of 41 14. the most prominent complaint was pressure effect, which was detected in 153 cases (55.2%). at the second place, hormonal disorders were observed in 125 cases (44.8%). type of pituitary tumors were : prolactinomas (29.1%), growth hormone (gh)-producing tumors (25%), nonfunctioning pas (28.4%), adrenocorticotropic hormone (acth)-producing tumors (2.1%), thyroid stimulating hormone (tsh)-producing tumors (0.7%), gh / prolactin (13.6%), gh / acth (0.3%), and tsh / acth (0.3%). fifty - seven patients presented with recurrent adenomas. pituitary apoplexy was found in 11 patients. one case of sheehan syndrome was recorded among these. the correlations between clinical symptoms and patients, age and sex were not significant.conclusion:the overview of demographic characteristics in iranian patients with pas with surgical indication has been discussed in the present investigation. the prevalence of different types of pas and the most common clinical symptoms have been demonstrated.
the study was approved by the danish data protection agency (2007 - 58 - 0015/local j.nr. register - based studies in which persons can not be identified do not need ethics approval in denmark. all danish citizens are medically covered by a tax - financed system that provides each citizen with equal health care free of copayment. for administrative purposes, the government has kept records of all hospitalizations (in - hospital and outpatient visits) since 1978 (in the danish national patient registry) and records of all prescription claims from danish pharmacies since 1995 (in the danish register of medicinal product statistics). furthermore, registration of all births and deaths, including dates of occurrence, has been complete for all citizens since 1968 (in the national population register). because all danish citizens are given a permanent personal civil registration number at time of birth or immigration, they can be followed up by individual - level linkage of the registers. for the present study, we included all persons in denmark between 1997 and 2011 who were aged 70 years at the time when they claimed their first prescription of antipsychotic medication and who had previously been treatment - nave (ie, allowing for a look back to 1995, when the danish register of medicinal product statistics was established). we identified comorbidities throughout the whole observational period by continuous screening of the danish national patient register. because most diagnoses were for chronic conditions, people were classified as having the disease from the first day of diagnosis. for all diagnoses but dementia, schizophrenia, and parkinson s disease, only validated in - hospital diagnoses were considered.16 in addition to previously validated chronic comorbid diagnoses, we retrieved information on acute delirium based on in - hospital diagnoses. because the diagnoses of dementia, parkinson s disease, and schizophrenia are often based on outpatient visits, diagnoses from both in - hospital and outpatient visits were considered for these comorbidities. the primary outcomes were mace, comprising the first occurring nonfatal acute myocardial infarction (international classification of diseases, 10th revision [icd-10 ] code i21) or nonfatal ischemic stroke (icd-10 codes i63 and i64 [i64 denotes unspecified stroke, of which the majority are of ischemic origin])17 and cardiovascular mortality (icd-10 codes i00 to i99) and non cardiovascular - related mortality (causes of mortality were obtained from the danish causes of death register). from the national register of medicinal product statistics, we identified exposure to the individual aps outlined in table1. for these agents and for vitamin k antagonists (b01aa03), clopidogrel (b01ac04), low - dose aspirin (b01ac06), and loop diuretics (c03ca01, c03ca02), treatment was updated continuously, that is, patients were considered to be exposed only while covered by claimed prescriptions. to determine treatment length and average daily dosages, we created an algorithm for each agent in which minimum, maximum, and typical daily dosages of used medication were defined. for patients first claimed prescriptions, the typical daily dosage was assigned, and treatment length was calculated by dividing the amount of claimed medications by that daily dosage. for patients who were covered by a previous prescription at the time of claiming a new prescription, the daily dosage was reset, and a new daily dosage was calculated as the amount of claimed medications during the previous period divided by time between prescription claims (based on up to 3 previous prescriptions without treatment breaks). if calculated dosages exceeded the predefined highest daily dosages, patients were assigned the maximum dosages, and exceeding tablets were assumed to be stored and consumed during the immediate period following the end of the last prescription. classification of the different antipsychotic agents for other medications (ie, dementia medications [atc code n06da ], beta blockers [c07 ], thiazides [c03a ], calcium channel blockers [c08 ], digoxin [c01aa ], renin - angiotensin system inhibitors [c09 ], aldosterone blockers [c03d ], and statins [c10aa ]), treatment status was updated every 30 days for the whole observational period. persons were considered to be in treatment with the different medications if they claimed at least 1 prescription during the preceding 4 months (this pragmatic method was applied because of computational limitations). all patients were followed from the date of first claimed prescription until date of death, emigration, or december 31, 2011. the incidence rate ratios (irrs) associated with exposure to aps were analyzed using multivariable poisson regression models. the following variables were included as time - dependent variables : treatment with antipsychotic medications ; all comorbidities (schizophrenia, parkinson s disease, dementia, acute delirium, prior cerebrovascular disease, heart failure, acute myocardial infarction, peripheral vascular disease, chronic obstructive pulmonary disease, atrial fibrillation, moderate or severe renal disease, diabetes, cancer, and cancer with metastases ; for icd-10 codes, see table2) ; age ; and use of warfarin, aspirin, clopidogrel, loop diuretics, thiazides, renin - angiotensin system blockers, aldosterone antagonists, statins, beta blockers, calcium channel blockers, or digoxin. all models were adjusted for the aforementioned variables and for actual calendar year and sex. use of antipsychotic medications was included as a time - dependent multilevel categorical variable for which people using > 1 medication for a given time were grouped in a separate use of multiple medication category. people who were not covered by a claimed prescription were assigned to a no treatment category. for all comparisons, use of risperidone as monotherapy served as the referent group (because this group was the largest quantitatively)., we created 3 different categorical variables for antipsychotic use according to time elapsed since first treatment because time dependency for risks was present (p for interaction between time elapsed and associated risks 365 days after treatment initiation). after having explored the irrs among different medications in different time periods, the differences appeared to be rather small between the periods ; therefore, in subsequent models, we included a variable reflecting only time since first treatment initiation to account for time dependency in risks. in the second models, we tested for effect modification between the different treatment groups and prevalent dementia (diagnosis or use of dementia medications) and cvd (myocardial infarction, congestive heart failure, stroke, or peripheral vascular disease) by inclusion of an interaction term between the categorical treatment variable and cvd or dementia, respectively. because these were highly significant, we created a categorical dummy variable stratifying use of medications by the prevalence of the different diseases. icd-10 codes for various medical conditions icd-10 indicates international classification of diseases, 10th revision. for the present study, we included all persons in denmark between 1997 and 2011 who were aged 70 years at the time when they claimed their first prescription of antipsychotic medication and who had previously been treatment - nave (ie, allowing for a look back to 1995, when the danish register of medicinal product statistics was established). we identified comorbidities throughout the whole observational period by continuous screening of the danish national patient register. because most diagnoses were for chronic conditions, people were classified as having the disease from the first day of diagnosis. for all diagnoses but dementia, schizophrenia, and parkinson s disease, only validated in - hospital diagnoses were considered.16 in addition to previously validated chronic comorbid diagnoses, we retrieved information on acute delirium based on in - hospital diagnoses. because the diagnoses of dementia, parkinson s disease, and schizophrenia are often based on outpatient visits, diagnoses from both in - hospital and outpatient visits were considered for these comorbidities. the primary outcomes were mace, comprising the first occurring nonfatal acute myocardial infarction (international classification of diseases, 10th revision [icd-10 ] code i21) or nonfatal ischemic stroke (icd-10 codes i63 and i64 [i64 denotes unspecified stroke, of which the majority are of ischemic origin])17 and cardiovascular mortality (icd-10 codes i00 to i99) and non cardiovascular - related mortality (causes of mortality were obtained from the danish causes of death register). from the national register of medicinal product statistics, we identified exposure to the individual aps outlined in table1. for these agents and for vitamin k antagonists (b01aa03), clopidogrel (b01ac04), low - dose aspirin (b01ac06), and loop diuretics (c03ca01, c03ca02), treatment was updated continuously, that is, patients were considered to be exposed only while covered by claimed prescriptions. to determine treatment length and average daily dosages, we created an algorithm for each agent in which minimum, maximum, and typical daily dosages of used medication were defined. for patients first claimed prescriptions, the typical daily dosage was assigned, and treatment length was calculated by dividing the amount of claimed medications by that daily dosage. for patients who were covered by a previous prescription at the time of claiming a new prescription, the daily dosage was reset, and a new daily dosage was calculated as the amount of claimed medications during the previous period divided by time between prescription claims (based on up to 3 previous prescriptions without treatment breaks). if calculated dosages exceeded the predefined highest daily dosages, patients were assigned the maximum dosages, and exceeding tablets were assumed to be stored and consumed during the immediate period following the end of the last prescription. classification of the different antipsychotic agents for other medications (ie, dementia medications [atc code n06da ], beta blockers [c07 ], thiazides [c03a ], calcium channel blockers [c08 ], digoxin [c01aa ], renin - angiotensin system inhibitors [c09 ], aldosterone blockers [c03d ], and statins [c10aa ]), treatment status was updated every 30 days for the whole observational period. persons were considered to be in treatment with the different medications if they claimed at least 1 prescription during the preceding 4 months (this pragmatic method was applied because of computational limitations). all patients were followed from the date of first claimed prescription until date of death, emigration, or december 31, 2011. the incidence rate ratios (irrs) associated with exposure to aps the following variables were included as time - dependent variables : treatment with antipsychotic medications ; all comorbidities (schizophrenia, parkinson s disease, dementia, acute delirium, prior cerebrovascular disease, heart failure, acute myocardial infarction, peripheral vascular disease, chronic obstructive pulmonary disease, atrial fibrillation, moderate or severe renal disease, diabetes, cancer, and cancer with metastases ; for icd-10 codes, see table2) ; age ; and use of warfarin, aspirin, clopidogrel, loop diuretics, thiazides, renin - angiotensin system blockers, aldosterone antagonists, statins, beta blockers, calcium channel blockers, or digoxin. all models were adjusted for the aforementioned variables and for actual calendar year and sex. use of antipsychotic medications was included as a time - dependent multilevel categorical variable for which people using > 1 medication for a given time were grouped in a separate use of multiple medication category. people who were not covered by a claimed prescription were assigned to a no treatment category. for all comparisons, use of risperidone as monotherapy served as the referent group (because this group was the largest quantitatively). in the first, we created 3 different categorical variables for antipsychotic use according to time elapsed since first treatment because time dependency for risks was present (p for interaction between time elapsed and associated risks 365 days after treatment initiation). after having explored the irrs among different medications in different time periods, the differences appeared to be rather small between the periods ; therefore, in subsequent models, we included a variable reflecting only time since first treatment initiation to account for time dependency in risks. in the second models, we tested for effect modification between the different treatment groups and prevalent dementia (diagnosis or use of dementia medications) and cvd (myocardial infarction, congestive heart failure, stroke, or peripheral vascular disease) by inclusion of an interaction term between the categorical treatment variable and cvd or dementia, respectively. because these were highly significant, we created a categorical dummy variable stratifying use of medications by the prevalence of the different diseases. icd-10 codes for various medical conditions icd-10 indicates international classification of diseases, 10th revision. we identified 91 774 persons (mean age 827 years, 35 474 [39% ] were men). numbers of those ever exposed to the different aps are presented in table3, along with the baseline characteristics for different exposure groups. the different exposure groups had comparable age, sex, and comorbidity burdens, although patients receiving levomepromazine and haloperidol had higher prevalence of cancers (30% versus 10% for the other groups). numbers are presented as counts (%) for discrete variables and means (sd) for continuous variables. total exposure time, mace, and noncardiovascular mortality for each treatment group are given in tables4 and 5. crude event rates were lowest for flupentixol and chlorprothixen compared with the other ap groups. as seen in the tables, for all agents, we observed a highly increased incidence rate of mace and noncardiovascular mortality during the first month after initiation, with a subsequent decline for longer treatment durations. associated adjusted irrs were increased for treatment with levomepromazine or haloperidol and treatment with multiple medications, whereas treatment with flupentixol, ziprasidone, chlorprothixen, or quetiapine was associated with a significantly lower irr compared with treatment with risperidone, as shown in figure1 (mace) and figure2 (noncardiovascular mortality). for longer treatment duration, levomepromazine and use of multiple medications were no longer associated with increased risks compared with risperidone monotherapy (figures1c and 2c). the risks associated with use of different antipsychotic medications differed for patients with and without cvd and were greater among patients with established cvd (p for interaction between treatment group and cvd 365 days. multivariable - adjusted risks of noncardiovascular mortality for different treatment regimens in different time periods after treatment initiation : (a) first 30 days, (b) 31 to 365 days, (c) > 365 days. multivariable - adjusted risks of (a) mace and (b) noncardiovascular mortality stratified by prevalent cvd. cv indicates cardiovascular ; cvd, cardiovascular disease ; mace, major adverse cardiovascular events. multivariable - adjusted risks of (a) mace and (b) noncardiovascular mortality stratified by prevalent dementia. in this danish study of all persons without prior use of aps who were aged 70 years, we investigated the association between different aps and risks of mace and noncardiovascular mortality. in general, we observed that use of haloperidol or levomepromazine and treatment with multiple medications were associated with similar or greater irrs than use of risperidone, whereas treatment with flupentixol, ziprasidone, chlorprothixen, or quetiapine was associated with significantly lower irrs compared with treatment with risperidone. the absolute event rates were highest shortly after treatment initiation and declined with long - term use. after findings of increased risk of cerebrovascular events associated with use of second - generation aps,10,18,19 the us food and drug administration (fda) issued a warning in 2005 against use of second - generation aps in dementia.18,20 in 2008, the fda extended this warning to include use of first - generation aps in dementia.21 several studies have since demonstrated increased mortality with use of aps in dementia,8,10,22 and some studies have shown increased mortality in elderly patients regardless of dementia status.9,11,19 previous studies have also suggested that the use of aps is associated with increased risk of myocardial infarction among older patients with treated dementia13 and that exposure to aps may be a trigger for stroke.11 furthermore, a cochrane review estimated the risk of cerebrovascular events to be > 3-fold higher in risperidone- versus placebo - treated elderly patients with dementia.23 our observations suggest that medications belonging to the second- and first - generation classes of aps may be associated with more or less comparable risk in elderly patients with or without dementia, although flupentixol, chlorprothixen, and quetiapine may be particularly associated with lower mace and mortality rates than risperidone. for all drugs, we found that the incidence rates of mace and noncardiovascular mortality were highest during the first 30 days of treatment and declined with longer exposure time. this finding is consistent with the findings of other studies.11,22,24 when elderly patients are prescribed aps, it may be due to neuropsychiatric symptoms in dementia or to delirium as part of a somatic disease that carries a high mortality risk. because we were unable to accurately control for several diseases in our study, it can not be excluded that the higher risks observed, especially among nondemented elderly people who were treated, may be partly due to confounding by indication. delirium, however, is an acute disease with high short - term mortality ; therefore, associations with long - term use may be less prone to confounding than the analyses of short - term use. worth emphasizing in this context is that the relative risk of mortality with levomepromazine and haloperidol shortly after treatment initiation was higher than that observed for other aps. a very high proportion of patients using these drugs had diagnosed cancer ; therefore, we can not rule out that the irr for the first period after treatment initiation was driven by confounding by indication. even when excluding patients with a preexisting cancer, haloperidol has been shown to be associated with the highest risk of death among aps users in nursing homes.24 second - generation aps have been promoted for having a low risk of extrapyramidal symptoms compared with first - generation aps. previous studies suggest that both first- and second - generation aps can lower blood pressure, leading to increased risk of falls and to a varying extent to prolonged qt interval, which might lead to arrhythmia and death.2528 another problem related to second - generation aps is adverse influence on glucose metabolism, diabetes, and blood lipid composition, leading to increased cardiovascular risks with long - term use.29,30 several prior observational studies have compared the safety of first- versus second - generation aps6,8,9,11,22,19,3133 and generally have indicated that the risk of death and/or mace when using second - generation aps is at least as high as that for first - generation aps.21 at least 1 retrospective cohort study has suggested that in older adults with dementia, second- and first - generation aps were associated with comparable risks of ischemic stroke.31 a larger retrospective cohort study in 2009 also suggested a comparable dose - related increased risk of sudden cardiac death for first- and second - generation aps.12 the main strength and novelty of this study is that we compared mace and noncardiovascular mortality risk among individual aps across the first and second generations in a rather large group of patients aged 70 years. moreover, because medical care is offered to all danish citizens without copayment and because medications are reimbursed by the government, selection bias related to socioeconomic status and, for example, prior participation in the labor market is likely less pronounced compared with many other observational studies. another strength of our study was the sample size, which allowed us to examine the effect of individual drugs, although it must be acknowledged that we might still have lacked power to firmly conclude anything about some of the individual drugs (particularly ziprasidone). we lacked data on several clinical variables including blood pressure, hematological profiles, electrocardiograms, and indication for treatment. all of these variables may have influenced clinicians decisions of whether to prescribe a particular agent. after findings of increased risk of cerebrovascular events associated with use of second - generation aps,10,18,19 the us food and drug administration (fda) issued a warning in 2005 against use of second - generation aps in dementia.18,20 in 2008, the fda extended this warning to include use of first - generation aps in dementia.21 several studies have since demonstrated increased mortality with use of aps in dementia,8,10,22 and some studies have shown increased mortality in elderly patients regardless of dementia status.9,11,19 previous studies have also suggested that the use of aps is associated with increased risk of myocardial infarction among older patients with treated dementia13 and that exposure to aps may be a trigger for stroke.11 furthermore, a cochrane review estimated the risk of cerebrovascular events to be > 3-fold higher in risperidone- versus placebo - treated elderly patients with dementia.23 our observations suggest that medications belonging to the second- and first - generation classes of aps may be associated with more or less comparable risk in elderly patients with or without dementia, although flupentixol, chlorprothixen, and quetiapine may be particularly associated with lower mace and mortality rates than risperidone. for all drugs, we found that the incidence rates of mace and noncardiovascular mortality were highest during the first 30 days of treatment and declined with longer exposure time. this finding is consistent with the findings of other studies.11,22,24 when elderly patients are prescribed aps, it may be due to neuropsychiatric symptoms in dementia or to delirium as part of a somatic disease that carries a high mortality risk. because we were unable to accurately control for several diseases in our study, it can not be excluded that the higher risks observed, especially among nondemented elderly people who were treated, may be partly due to confounding by indication. delirium, however, is an acute disease with high short - term mortality ; therefore, associations with long - term use may be less prone to confounding than the analyses of short - term use. worth emphasizing in this context is that the relative risk of mortality with levomepromazine and haloperidol shortly after treatment initiation was higher than that observed for other aps. a very high proportion of patients using these drugs had diagnosed cancer ; therefore, we can not rule out that the irr for the first period after treatment initiation was driven by confounding by indication. even when excluding patients with a preexisting cancer, haloperidol has been shown to be associated with the highest risk of death among aps users in nursing homes.24 second - generation aps have been promoted for having a low risk of extrapyramidal symptoms compared with first - generation aps. previous studies suggest that both first- and second - generation aps can lower blood pressure, leading to increased risk of falls and to a varying extent to prolonged qt interval, which might lead to arrhythmia and death.2528 another problem related to second - generation aps is adverse influence on glucose metabolism, diabetes, and blood lipid composition, leading to increased cardiovascular risks with long - term use.29,30 several prior observational studies have compared the safety of first- versus second - generation aps6,8,9,11,22,19,3133 and generally have indicated that the risk of death and/or mace when using second - generation aps is at least as high as that for first - generation aps.21 at least 1 retrospective cohort study has suggested that in older adults with dementia, second- and first - generation aps were associated with comparable risks of ischemic stroke.31 a larger retrospective cohort study in 2009 also suggested a comparable dose - related increased risk of sudden cardiac death for first- and second - generation aps.12 the main strength and novelty of this study is that we compared mace and noncardiovascular mortality risk among individual aps across the first and second generations in a rather large group of patients aged 70 years. moreover, because medical care is offered to all danish citizens without copayment and because medications are reimbursed by the government, selection bias related to socioeconomic status and, for example, prior participation in the labor market is likely less pronounced compared with many other observational studies. another strength of our study was the sample size, which allowed us to examine the effect of individual drugs, although it must be acknowledged that we might still have lacked power to firmly conclude anything about some of the individual drugs (particularly ziprasidone). we lacked data on several clinical variables including blood pressure, hematological profiles, electrocardiograms, and indication for treatment. all of these variables may have influenced clinicians decisions of whether to prescribe a particular agent. there is an important but limited role for antipsychotic treatment of severe neuropsychiatric symptoms.23 our study demonstrated high incidence rates of mace and noncardiovascular mortality associated with use of individual aps in elderly persons with or without dementia and with and without cvd. this underscores that aps should be used with caution in elderly patients, regardless of dementia status, at the lowest possible dose and for shortest possible time. a particular focus on risks and benefits is warranted among people with prevalent cvd because these patients seem to have the highest risks associated with aps. our study further suggested some diversity in risks associated with individual aps but no systematic differences between first- and second - generation aps. randomized placebo - controlled studies are warranted to confirm our findings and to identify the safest agents. until then, the antipsychotic benefit in people with and without dementia must be considered against the risks of adverse events. finally, in denmark, restrictions on the use of aps are focused predominantly on people with dementia. dr andersson was funded by an independent research grant from the danish agency for science, technology and innovation (grant number fss-11 - 120873). none of the funding sources had any influence on design and conduct of the study ; collection, management, analysis, and interpretation of the data ; and preparation, review, or approval of the manuscript. sahlberg (none), holm (none), gislason (none), torp - pedersen (reports grants and personal fees from cardiome, grants and personal fees from merck, grants and personal fees from sanofi, grants and personal fees from daiichi, grants from bms, outside the submitted work), kber (none), andersson (reports grants from danish agency for science, technology and innovation, grants from astrazeneca, during the conduct of the study).	backgrounddata from observational studies have raised concerns about the safety of treatment with antipsychotic agents (aps) in elderly patients with dementia, but this area has been insufficiently investigated. we performed a head - to - head comparison of the risk of major adverse cardiovascular events and noncardiovascular mortality associated with individual aps (ziprasidone, olanzapine, risperidone, quetiapine, levomepromazine, chlorprothixen, flupentixol, and haloperidol) in danish treatment - nave patients aged 70 years.methods and resultswe followed all treatment - nave danish citizens aged 70 years that initiated treatment with aps for the first time between 1997 and 2011 (n=91 774, mean age 827 years, 35 474 [39% ] were men). incidence rate ratios associated with use of different aps were assessed by multivariable time - dependent poisson regression models. for the first 30 days of treatment, compared with risperidone, incidence rate ratios of major adverse cardiovascular events were higher with use of levomepromazine (3.80, 95% ci 3.43 to 4.21) and haloperidol (1.85, 95% ci 1.67 to 2.05) and lower for treatment with flupentixol (0.54, 95% ci 0.45 to 0.66), ziprasidone (0.31, 95% ci 0.10 to 0.97), chlorprothixen (0.76, 95% ci 0.61 to 0.95), and quetiapine (0.68, 95% ci 0.58 to 0.80). relationships were generally similar for long - term treatment. the majority of agents were associated with higher risks among patients with cardiovascular disease compared with patients without cardiovascular disease (p for interaction < 0.0001). similar results were observed for noncardiovascular mortality, although differences in associations between patients with and without cardiovascular disease were small.conclusionsour study suggested some diversity in risks associated with individual aps but no systematic difference between first- and second - generation aps. randomized placebo - controlled studies are warranted to confirm our findings and to identify the safest agents.
many adolescents often lack strong and stable relationships with their parents or other adults which are necessary to openly discuss reproductive health concerns. therefore, many teenagers do not have access to reliable information regarding their rh needs. in most cultures, parents and family members are an influential source of knowledge, beliefs, attitudes, and values for children and young people. parents often have the power to guide children 's development in sexual health matters, encouraging them to practice reasonable sexual behavior and develop good personal decision making skills [13 ]. researches indicated that increased parent - child communication leads to a raised awareness and reduction in risk taking behaviors. however, when young people feel unconnected to home and family, they may become involved in activities that put their health and wellbeing at risk [1, 5, 6 ]. even though parents are main sources of information on rh issues studies have shown that only 46%, 20%, and 20% of parents in usa, lesotho, and ethiopia, respectively, had discussed such issues with their adolescents. in china, only one - third of female youths talked to their mothers about sexual matters [1, 79 ]. as a result, most adolescents ' patchy knowledge on rh issues often comes from information shared by their same sex peers, who may or may not be well informed. this can lead to misinformation and the persistence of damaging myths, making young people vulnerable to unprotected sex, unwanted pregnancy, sexually transmitted diseases, and unsafe abortions. the consequences of adolescent sexual behavior are an enormous burden both for the adolescent and for society. the problem is not that teens are sexually active but rather that they are inadequately prepared and guided in developing responsible sexual behaviors. the family, the major socializer of other behaviors, is not powerful in shaping adolescents ' sexual behavior because of the socio - cultural, religious beliefs and sense of morality barriers affecting discussion of sexual and reproductive health issues with their adolescents [79 ]. factors affecting parent - adolescent discussion of a country should be taken into account during planning of rh programs. therefore, this study was conducted to assess factors that affect parent - adolescent discussion on rh issues with their adolescents in harar town, harari region, ethiopia, in may 2010. the study was conducted in harar town, capital city of the harari national regional state, located 525 km away east of addis ababa. according to the 2007 census the projected population of the town in 2010 the town is divided into six woredas (districts) with a total of 19 kebeles (the smallest administrative unit). in the town there are two government, one military, one police, and two private hospitals and eight health centers. there is also one youth clinic which provides adolescent health services under the family guidance association of ethiopia. the study was a cross - sectional design in nature using a mixed method in the view of the sensitivity and complexity of reporting sexual and reproductive health. a qualitative method was used to better understand about underlying behaviors, attitudes, perceptions and culture about reproductive health from perspectives of parents and adolescents [11, 12 ]. the participants for the qualitative studies were selected purposively and were not participating in the quantitative study. the source populations for this study were all parents living in harar having a child between 10 and 19 years of age (adolescent). all parents / guardians living in the selected kebeles of the randomly selected woredas were the study population. the sample size was estimated based on the assumption of a 20% discussion rate in ethiopia, a 4% margin of error, a 95% confidence level, and design effect of 2. the number of households to be included in each kebele was determined in proportion to the total number of households in each kebele. a systematic sampling method was then employed to select the households and household heads (parents) were interviewed based on the objective of the study. in case no eligible candidate was identified in a selected household, the interview was conducted in the next household where there was eligible candidate. selection of parents was made as per the recommendation of school directors and health extension workers working in the community based on their involvement of school affairs in the school - community relationship and community health activity. the adolescents were selected from the youth center of the family guidance association of ethiopia 's model clinic. trained nurses have collected the data by face to face interview using a structured standard questionnaire that was previously used in ethiopia using the local language (amharic). the questionnaire consisted of sociodemographic characteristics, knowledge about rh, attitude towards reproductive health, and discussion of rh related question. the interview was conducted in a private place and under supervision of the principal investigators. sociodemographic characteristics relating to parents knowledge, attitude, sociocultural norms, time constraints, and perceptions of initiating discussion about sex were used as independent variables, whereas discussion was used as dependent variable. the data collectors were trained for two days in the objective of the study, the handling of study participants, and other ethical issues. a discussion guide adapted from previous similar studies was used to lead the qualitative data collection with probing as appropriate. the fgd for females was moderated by a female moderator with master 's degree and similar experience to ease discussion among the females. after cleaning and checking the questionnaire for completeness, data was entered into computer and spss version 15.0 was used to analyze the data. the results were summarized by using descriptive statistics, together with an odds ratio with 95% confidence intervals and multiple logistic regressions were employed to describe the strength of association between the selected study variables by controlling the effect of possible confounders. knowledge of reproductive health issues was assessed using a set of 20 standard questions and average score was calculated after the responses have been coded. respondents who scored more than average were considered as having good knowledge while the remaining participants were classified as having poor. analysis of the qualitative data was accomplished based on the predetermined themes and adding the context of additional information provided by the respondents. ethical clearance for the proposed research was obtained from haramaya university college of health and medical science institutional research ethics review committee (irerc) and informed consent from every participant was obtained before the interview. from total of 768 parents identified, 751 (97.8%) parents had participated in the study and 17 (2.2%) parents were nonrespondents due to different reasons. majority of the respondents were females (76.3%), housewives (50.2%), and orthodox christians (56.5%) and are illiterate (21.84%) (table 1). respondents ' knowledge of rh issues was assessed by asking a set of closed ended questions adapted from previous study. respondents were asked if they knew rh and 506 (67.38%) of them reported they knew what it means. specific components of rh mentioned by the parents included std (64.45%), family planning (50.20%), and early marriage (49.40%) (figure 1). when asked about consequences of unprotected sex, the majority (90.01%) mentioned std followed by unwanted pregnancy (64.85%) and unsafe abortion (38.75%). only 14% of the respondents correctly mentioned the correct age for early marriage in ethiopia. responses about behavioral and physical changes during puberty showed, 701 (93.34%) breast enlargement and 703 (93.61%) beginning of menstruation in females and change in voice for males (89.35%). after all the responses to knowledge have been summed up and scored, 268 (35.68%) of the respondents scored below average and demonstrated poor knowledge of rh issues. attitude of parents towards discussion on rh issues was measured by a set of questions using the likert scale. the majority of the parents (94.14%) agreed on the need to discuss rh matters. parents should encourage their adolescents to ask questions related to their rh needs as reported by 88.75% of the respondents. however, around 21.84% of parents think that discussion with adolescents will make them promiscuous and only 16.11% of parents approved the use of family planning by their adolescents. in general a combined score for the four questions indicated that 604 (80.43%) of parents had positive attitude towards reproductive health and its discussion. overall, only 216 (28.76%) of the respondents had reported discussion about at least two components of rh matters in the last six months prior to the study. it was found that most of the parents who reported discussions with their adolescents were males (35.92% versus 26.52%) compared to females. the study indicated that the majority of female respondents prefer to discuss with their daughters (50.7%) while male parents preferred to discuss with both boys and daughters (53.1%). the major topics of the discussions were std, 209 (96.76%) ; early marriage, 138 (63.89%) ; unsafe sex, 108 (50.02%) ; and unwanted pregnancy, 92 (42.6%) (figure 2). the most common reason for not talking with adolescents is lack of awareness of rh (60.75%) followed by the fear of discussion (51.40%) and perceiving that it would initiate adolescent 's sexual practice (33.08%) (figure 3). a total of 35 discussants participated in the four fgds conducted with both parents and adolescents. males and females from both groups have participated in different groups. in the two fgds conducted with parents, similar to the findings from the survey, the majority of the parents have shown positive attitude towards importance of discussing rh matters with their adolescents. in the discussion most of the parents think that their adolescents are not sexually active and in practice only few of them have reported discussing the matter. most of the parents participated in the discussion think that they have limited knowledge about rh so that they are unable to initiate discussion regarding the rh matters. this is evident from the response, we are supposed to tell our adolescents everything that has to do so with reproductive health. but i do not feel that we know all information they need, a 50-year - old male discussant. parents are also found to be more directive and strict about the information to tell or not. i have to tell my daughter only the information that i think are important to her because she will become more promiscuous if she received more information about it, a 39-year - old female parent. feeling ashamed by parents and/or their adolescents is another reason stated as challenging the occurrence of discussion between parents and adolescents : i can not discuss with my child about sex because it is shame for me. he will not understand me as he feels shame too, a 42-year - old male parent. from the discussants, if i start to discuss with my adolescent children about this issue, it means that i am saying that this is the way to the issue of discussing rh issues is bound by several sociocultural norms and expectations : in our culture discussing about sexual matter is rare. discussing with your child, husband - wife discussion on this issue is not practiced. these culture, taboo and traditions are passing from generation to generation. we were brought up like this and are doing it today, a 56-year - old male parent. similar findings from the fgd conducted with adolescents indicated that discussion of reproductive health issues rarely occurs between them and their parents. the reason they mentioned were as follows : parents are not knowledgeable ; they prefer to discuss with peers and at school with their teacher ; they consider it as sociocultural taboo ; they worried about their parents ' reaction ; and the parents will think they have had sex or are going to have sex. they consider their parents as not knowledgeable about the subject matter : both my mother and father are illiterate, so for what topics i am talking about ? a 17-year - old adolescent replied and said that he prefers to discuss with his peers. some of the respondents also strengthened the effect of cultural norms preventing them from talking with parents : there is no trends and experience for discussion on such issues in my family and even in the community since it is considered culturally unacceptable and socially embarrassing, a response of a 15-year - old male youth. the fear about reaction of their parents towards their request or need for discussing the issue if i will ask my parents about what is this and what to do about, they will consider my request as if i would be engaged in the activity, a 14- year - old son. when i asked my mother about what could cause changes as breast enlargement, she told me that it is nothing and told me to focus on my studies, an 18-year - old female discussant, indicating that adolescents are not given right responses even on request. most of the adolescents also indicated that parents prefer to discuss rh indirectly by taking impersonal examples than referring to their child. this is evident by the response given by 19-year - old girl : you know ms x 's daughter. she has got hiv from going to many boys, she is a bad girl. adolescents also indicated that parents want to be more directive, monitoring rather than creating an open environment in which adolescents are asking and getting responses as required. as shown in table 2, the probability of discussion was found to be significantly higher among parents who had completed some form of education compared with parents who had no formal education : grades 58 (aor 3.79, 95% ci : 1.877.71), grades 9 - 10 9(aor 8.74, 95% ci : 3.9119.56), and grade 10 and above (aor 17.35, 95% ci : 8.236.63). parents who reported a monthly income of above 1000 ethiopian birr had a twofold increase in the odds of discussing rh issues with their children (aor 2.14, 95% ci : 1.124.00) compared to parents with a monthly income less than 400 birr. housewives demonstrated a 50% lower tendency to discuss rh issues compared with government employees (aor 0.48, 95% ci : 0.280.84). parents who have demonstrated good rh knowledge and positive attitude towards rh are almost six times and seventy percent (aor 5.69, 95% ci : 3.678.82 ; aor 1.70, 95% ci : 1.082.68) higher in discussing rh with their adolescents than their counterparts, respectively. a principal means for transmitting sexual values, beliefs, expectation, and knowledge between parents and their adolescents is through discussion. this discussion is most likely to promote healthy sexual development and reduce sexual risks when parents are open, skilled, and comfortable in their discussion of sex - related topics. this study has examined the occurrence of parent - adolescent discussion of reproductive health issues and factors affecting its occurrence. though there is evidence that teenagers prefer to receive information about sexuality from their parents, in reality few have this privilege. similarly, in this study, even though the majority of the parents approved the importance of discussion, only 28.76% of parents have reported discussing rh issues. this is also true in other studies conducted in ethiopia and abroad [6, 7, 9, 14, 15 ] which reveal that the discussion rarely occurs despite accepting its importance. but it is lower than other findings from hawassa and nekemte, ethiopia [16, 17 ] and usa. it can be argued that most parents are focusing on the negative aspects of rh rather than working on the preventive aspects. parents who attended higher level and primary level education were more likely to discuss reproductive health issues with their adolescent children when compared to parents who received no formal education. this finding is consistent with the studies conducted in usa and selected regions of ethiopia [2, 1618 ]. parents also indicated various reasons highlighting why they do not discuss reproductive health issues with their children. the majority (60.7%) of respondents claimed lack of awareness regarding rh issues as a reason followed by difficulty to initiate discussion due to fear and shyness (51.40%). twenty - five percent (24.9%) of parents worried about their culture, which was a lower proportion of the total respondents than the study conducted in other administrative regions of ethiopia [2, 16 ]. however, it is similar to studies conducted in china, kenya, and sweden [1, 6 ]. in addition, 33.1% of parents perceive that discussing sexual matters with their adolescents might encourage the children to engage in premarital sex. this finding is proportionately lower than the findings of the study conducted in the selected region of ethiopia. this finding from the fgd showed that parents have realized the importance of discussing rh issues with their children. but many of the parents indicated that they are unable to do so because it is culturally unacceptable ; they can not deliver the subject because of lack of knowledge or they felt embarrassed. the majority of the parents also reported that their adolescents might not take it seriously and felt that they could not answer their question regarding rh or std / hiv / aids. this finding is true also in the studies conducted in ethiopia and nigeria [7, 1517, 19 ]. findings from the fgd with adolescents have indicated the importance of parents ' involvement in socialization of adolescents about sexuality and rh. however, most adolescents prefer to discuss with their peers rather than their parents because they think that their parents are not knowledgeable about the subject matter or they may face challenges since it is embarrassing for both the adolescents and their parents. this finding indicates that adolescents are seeking advice from individuals who are knowledgeable or are not decision maker in the adolescent 's life. evidences indicated that supportive communication between parents and children enables young people to make a safe and confident transition to adulthood. but in this study the proportion of parent - adolescent discussion about reproductive health was found to be low and is bound by traditional norms, lack of information, and limited skills of discussion and creating supportive environment for adolescents. most of the adolescents who participated in the fgds thought their parents have no knowledge about rh issues and prefer discussing with their peers. the sociocultural norms and traditions about discussion on rh among families should be considered for better rh outcomes.	background. open family discussion on reproductive health (rh) issues often leads to increased awareness on rh matters and reduces risky behaviors among adolescents. this study was conducted to assess factors affecting parent - adolescent discussion on rh issues in harar, ethiopia. methods. a cross - sectional survey using face to face interview supplemented with focus group discussion (fgd) was conducted on 751 randomly selected parents of 1019-year - old adolescents. data was analyzed using spss version 15. results. more than one - fourth (28.76%) of parents reported discussing rh issues with their adolescents during the last six months. in the logistic regression, parents who have demonstrated good rh knowledge and positive attitude towards rh were almost six times and seventy percent (aor 5.69, 95% ci : 3.678.82 ; aor 1.70, 95% ci : 1.082.68) higher in discussing rh with their adolescents than their counterparts, respectively. conclusion. parent - adolescent discussion about rh issues rarely occurs and is bounded by lack of knowledge, sociocultural norms, and parental concern that discussion would encourage premarital sex. reproductive health programs should target on improving awareness of parents and addressing sociocultural norms surrounding reproductive health issues.
increasing data support a role of gut microbiota and dietary ingestion of phosphatidylcholine (pc or lecithin) in the pathogenesis of atherosclerosis.1, 2 pc is the major dietary source of choline, which often is found in the western diet, such as red meat, eggs, and meat products. production of trimethylamine noxide (tmao) by gut microbiota metabolism of dietary pc has been associated with the development of atherosclerosis in animals and in humans.1, 2, 3 increased levels of plasma tmao are associated with an enhanced number of diseased major coronary vessels,1 as well as increased risk of major adverse cardiac events in patients undergoing elective coronary angiography.3, 4 peripheral artery disease (pad) is a common manifestation of systemic atherosclerosis and is associated with significantly increased cardiovascular death and mortality.5, 6 it affects over 27 million people across europe and north america.7 an estimated 8.5 million americans aged 40 years carry the diagnosis of pad.8 despite its association with high prevalence and extremely poor prognosis, pad remains undiagnosed and rarely receives attention in the scientific literature compared to patients with coronary artery disease (cad) and other atherosclerotic conditions.7, 9 to date, predictors of mortality and underlying pathophysiology in patients with pad are not well defined, which may be a contributing factor to why the mortality risk and ischemic amputations in pad patients remained high.10 therefore, there is a need to find new prognostic markers that may provide insight into underlying pathophysiology, improve longterm clinical risk prediction incremental to traditional risk factors, and suggest avenues for therapeutic development in pad. the primary objective of this study was to determine the clinical prognostic value of plasma tmao levels in a contemporary cohort of patients with established but stable pad. this is a singlecenter prospective cohort study approved by the cleveland clinic institutional review board, and all participants gave written informed consent. we enrolled sequential consenting patients who underwent elective, nonurgent coronary angiographic evaluation at the cleveland clinic between 2001 and 2007, as previously described. all patients were seen by a cardiologist at cleveland clinic before the left heart catheterization. enrolled subjects were directly asked by research personal about past history of noncad cardiovascular disease and/or history of or repair of aortic dissection / aneurysm. we carefully reviewed the electronic medical record (including angiographic data) for validation of diagnosis subtypes of pad. a confirmed diagnosis of pad was based primarily on the type of pad, based on reporting evidence of stenosis at the corresponding vasculature (table 1).11, 12, 13 allcause mortality was prospectively tracked over 5 years for all participants with medical chart review and confirmed by followup contact and the social security death index. in this analysis, we included those with a documented history of pad. criteria diagnosis of pad based primarily on the type of pad reporting of > 20% stenosis with plaque visible by carotid dus in common carotid artery (cca) or internal carotid artery (ica). or reporting evidence of > 20% stenosis in11 cca or ica by mra or catheterbased angiography, measured according to nascet criteria. or history of prior angioplasty, stenting, or surgical open carotid endarterectomy abi 50% stenosis at least 1 lower extremity by dus, mra, cta, or catheterbased angiography. or history of prior angioplasty, stenting, or open surgical bypass procedure reporting of aaa or dissection by dus, mra, or cta. or history of or repair of aaa or dissection reporting of > 50% stenosis or hemodynamically significant stenosis by dus, mra, catheterbased angiography, or abdominal aortography. or history of prior angioplasty or stenting reporting of hemodynamically significant stenosis by angiography. or history of prior angioplasty or stenting abi indicates ankle brachial index ; cta, computed tomography angiography ; dus, duplex ultrasound ; mra, magnetic resonance angiography ; nascet, north american symptomatic carotid endarterectomy trial ; pad, peripheral artery disease. determining percentage stenosis based on internally developed diagnosis criteria in the noninvasive vascular laboratory of the cleveland clinic. peripheral artery disease is defined by american college of cardiology / american heart association as a group of clinical disorders that includes abdominal aortic aneurysm, renal artery stenosis (ras), mesenteric artery stenosis (mas), and lower extremity peripheral artery disease (lead).6, 12 however, the european society of cardiology uses the term pad to include several vascular sites, including extracranial carotid artery stenosis (cas) and vertebral artery diseases, upper extremity artery stenosis, mas, ras, and lead, but diseases of the aorta are not covered.13 in our cohort, the term pad is used to indicate the majority of noncoronary arterial territories including cas, upper extremity artery stenosis, mas, ras, and lead, while diseases of the aorta were not included. in this analysis, we defined noncas if the primary diagnosis was not cas (which included lead, ras, upper extremity artery stenosis, and mas). after informed consent was obtained from all patients, fasting blood samples were collected using edta tubes at the time of cardiac catheterization, immediately prior to heparin injection. samples were maintained on ice or at 4c, immediately processed within 3 hours of collection, and frozen at 80c until analysis. myeloperoxidase was determined by the cardiompo assay (cleveland heart labs, cleveland, oh). tmao, choline, and betaine levels in plasma were determined using stable isotope dilution highperformance liquid chromatography with online electrospray ionization tandem mass spectrometry on shimadzu lcms8050 cl triple quadrupole mass spectrometer (shimadzu corp, kyoto, japan) using d9(trimethyl)labeled internal standards as described previously.1, 14 continuous data are presented as mean (sd) or median (interquartile range) and compared with student t test and anova or nonparametric alternatives (kruskal wallis test) when appropriate. categorical variables are presented as number (%) and compared between groups with tests. kaplan meier analysis with cox proportional hazards regression was used for the timetoevent analysis to determine hazard ratios (hr) and 95% ci for 5year allcause mortality stratified according to tmao as a continuous variable (logtransformed per sd increase), as well as according to quartiles. adjustments were made for individual traditional cardiovascular risk factors (age, sex, systolic blood pressure, diabetes mellitus, lowdensity and highdensity lipoprotein cholesterol levels, triglyceride levels, and smoking status) and for logtransformed highsensitivity creactive protein (hscrp), logtransformed estimated glomerular filtration rate (egfr), logtransformed myeloperoxidase, apolipoprotein a1 and apolipoprotein b, history of cad, and statin use, to predict allcause mortality. categoryfree net reclassification improvement, integrated discrimination improvement, and area under the receiveroperating characteristic curve were calculated to quantify improvement in model performance according to mortality risk estimated using cox models adjusted for the abovementioned traditional risk factors with versus without tmao, as previously described.15 subgroups were stratified according to diagnosis subtypes of pad (lead, cas, and noncas) as well as other baseline clinical and laboratory subgroups that might be affecting mortality risks. all analyses were performed used r 2.15.1 (r foundation for statistical computing, vienna, austria). a p value 20% stenosis with plaque visible by carotid dus in common carotid artery (cca) or internal carotid artery (ica). or reporting evidence of > 20% stenosis in11 cca or ica by mra or catheterbased angiography, measured according to nascet criteria. or history of prior angioplasty, stenting, or surgical open carotid endarterectomy abi 50% stenosis at least 1 lower extremity by dus, mra, cta, or catheterbased angiography. or history of prior angioplasty, stenting, or open surgical bypass procedure reporting of aaa or dissection by dus, mra, or cta. or history of or repair of aaa or dissection reporting of > 50% stenosis or hemodynamically significant stenosis by dus, mra, catheterbased angiography, or abdominal aortography. or history of prior angioplasty or stenting reporting of hemodynamically significant stenosis by angiography. or history of prior angioplasty or stenting abi indicates ankle brachial index ; cta, computed tomography angiography ; dus, duplex ultrasound ; mra, magnetic resonance angiography ; nascet, north american symptomatic carotid endarterectomy trial ; pad, peripheral artery disease. determining percentage stenosis based on internally developed diagnosis criteria in the noninvasive vascular laboratory of the cleveland clinic. peripheral artery disease is defined by american college of cardiology / american heart association as a group of clinical disorders that includes abdominal aortic aneurysm, renal artery stenosis (ras), mesenteric artery stenosis (mas), and lower extremity peripheral artery disease (lead).6, 12 however, the european society of cardiology uses the term pad to include several vascular sites, including extracranial carotid artery stenosis (cas) and vertebral artery diseases, upper extremity artery stenosis, mas, ras, and lead, but diseases of the aorta are not covered.13 in our cohort, the term pad is used to indicate the majority of noncoronary arterial territories including cas, upper extremity artery stenosis, mas, ras, and lead, while diseases of the aorta were not included. in this analysis, we defined noncas if the primary diagnosis was not cas (which included lead, ras, upper extremity artery stenosis, and mas). after informed consent was obtained from all patients, fasting blood samples were collected using edta tubes at the time of cardiac catheterization, immediately prior to heparin injection. samples were maintained on ice or at 4c, immediately processed within 3 hours of collection, and frozen at 80c until analysis. myeloperoxidase was determined by the cardiompo assay (cleveland heart labs, cleveland, oh). tmao, choline, and betaine levels in plasma were determined using stable isotope dilution highperformance liquid chromatography with online electrospray ionization tandem mass spectrometry on shimadzu lcms8050 cl triple quadrupole mass spectrometer (shimadzu corp, kyoto, japan) using d9(trimethyl)labeled internal standards as described previously.1, 14 continuous data are presented as mean (sd) or median (interquartile range) and compared with student t test and anova or nonparametric alternatives (kruskal wallis test) when appropriate. categorical variables are presented as number (%) and compared between groups with tests. kaplan meier analysis with cox proportional hazards regression was used for the timetoevent analysis to determine hazard ratios (hr) and 95% ci for 5year allcause mortality stratified according to tmao as a continuous variable (logtransformed per sd increase), as well as according to quartiles. adjustments were made for individual traditional cardiovascular risk factors (age, sex, systolic blood pressure, diabetes mellitus, lowdensity and highdensity lipoprotein cholesterol levels, triglyceride levels, and smoking status) and for logtransformed highsensitivity creactive protein (hscrp), logtransformed estimated glomerular filtration rate (egfr), logtransformed myeloperoxidase, apolipoprotein a1 and apolipoprotein b, history of cad, and statin use, to predict allcause mortality. categoryfree net reclassification improvement, integrated discrimination improvement, and area under the receiveroperating characteristic curve were calculated to quantify improvement in model performance according to mortality risk estimated using cox models adjusted for the abovementioned traditional risk factors with versus without tmao, as previously described.15 subgroups were stratified according to diagnosis subtypes of pad (lead, cas, and noncas) as well as other baseline clinical and laboratory subgroups that might be affecting mortality risks. all analyses were performed used r 2.15.1 (r foundation for statistical computing, vienna, austria). in our study cohort, a total of 935 subjects had reported a history of pad. of these, confirmed diagnosis data were not available for 14 patients, and 100 patients with a diagnosis of aortic aneurysm were excluded. baseline characteristics of the 821 participants are shown in table 2. in our study cohort, mol / l), which was similar between patients with cas and noncas (figure 1). subjects with elevated plasma tmao levels were more likely to be older, with diabetes, with elevated hscrp, as well as with lower egfr. in contrast, prior history of cad, smoking status, myeloperoxidase levels, apolipoprotein b levels, and medication use, were similar across tmao levels. baseline characteristics of pad cohort values expressed in meansd, %, or median (interquartile range). ace indicates angiotensinconverting enzyme ; apoa1, apolipoprotein a1 ; apob, apolipoprotein b ; arb, angiotensinreceptor blocker ; cad, coronary artery disease ; egfr, estimated glomerular filtration rate ; hdl, highdensity lipoprotein ; hscrp, highsensitivity creactive protein ; ldl, lowdensity lipoprotein ; mpo, myeloperoxidase ; pad, peripheral artery disease ; tmao, trimethylamine noxide ; wbc, total leukocyte count. comparison of fasting trimethylaminenoxide (tmao) levels between patients with carotid artery stenosis and non carotid artery stenosis. tmao concentration was not significantly different between patients with carotid artery stenosis (cas) and non carotid artery stenosis (noncas). of the 821 subjects included, 371 had diagnosis of cas confirmed by duplex ultrasonography (83%), magnetic resonance angiography (2.7%), catheterbased radiocontrast angiography (4.0%), prior endovascular intervention (3.8%), and open carotid endarterectomy (6.5%) ; 421 patients had lead confirmed by the following : ankle brachial index 20%) of tmao levels.21 thus, gut microbial generation of tmao from dietary nutrients such as pc may represent an attractive target for intervention in subjects with pad. patients with pad show a 2 to 6fold increased risk of death from cardiovascular causes and mortality relative to those without pad.6, 8 data from the reduction of atherothrombosis for continued health (reach) registry have shown that pad is strongly associated with concomitant cad and atherosclerosis in multiple vascular beds, and indicated that these patients have poorer prognosis than patients with just 1 territory affected.22 it is also recognized that the majority of patients with pad die from cad.5 there are a number of proven therapies to reduce mortality among patients with pad including antiplatelet agents, lipidlowering therapy with the statins, and aggressive cardiovascular risk factor modification.6 unfortunately, lifesaving medications are underprescribed among patients with pad, particularly in comparison with patients with cad,23 and also the true atherosclerosis burden and mortality risk of pad are underestimated.9, 10 in contrast, the overall rate of use of cardioprotective medication for secondary prevention in our study cohort was relatively high ; at baseline 70% were on statins, 76% on aspirin, 69% on blockers, and 60% on angiogensinconverting enzyme inhibitor / angiotensinreceptor blockers. yet, despite patients having received optimal cardioprotective medication, the 5year allcause mortality rate in our study cohort remained high, with 27% deaths. these higher event rates may be driven by a large proportion of patients with cad (90%). interestingly, these data are consistent with findings from the reach registry, which has a large percentage of patients with pad combined with cad and is associated with high mortality rates.22 therefore, accurate risk prediction and identification for underlying pathophysiology in patients with pad is critically meaningful. our findings suggest a link between plasma tmao, a metabolite formed by gut microbiota metabolism of the choline group of pc, and prognosis risk prediction. they may be a new prognostic marker for risk stratification and suggest avenues for therapeutic development to reduce future allcause mortality in patients with pad. our findings may be important to understand a potential pathophysiological contribution of intestinal microbiota in the development of atherosclerosis and adverse prognosis in patients with pad, including the majority of noncoronary territories. since occult atherosclerotic plaque burden in extracoronary territories is a common issue hindering pad diagnosis, and given the mechanistic links between tmao and atherosclerosis development and progression, the present studies suggest that plasma tmao level measurements could be used to identify patients in whom more detailed pad surveillance efforts are needed given the heightened adverse prognosis risk associated with higher tmao levels. an improvement in understanding of the pathophysiology linking gut microbes, tmao, and pad development may serve to help improve selection of highrisk pad patients who need more aggressive and specific dietary and pharmacologic therapy. this was a single, tertiary care center study that recruited patients at the point of cardiac evaluation for coronary angiography ; therefore, there was a higher proportion of patients with cad. our population consisted of a heterogeneous subgroup of patients with pad, yet we believe that the confirmed diagnoses were carefully captured individually. also, we lacked complete information regarding new york heart association functional class, claudication symptom, and disease severity, but we addressed this issue by enrolling patients in stable condition, confirmed by careful review of the electronic medical record individually. we also acknowledge that many factors may have influenced tmao levels, including increased age, diabetes, elevated hscrp, or low egfr. all of these factors can contribute to increased mortality in this population, and we do not have an external validation cohort to confirm our findings. despite these limitations, our findings are the first report to point to novel insights that provide a mechanistic link between gut microbiota associated metabolism involved in tmao formation and pad, and substantially improved risk stratification for adverse prognosis in patients with pad. this was a single, tertiary care center study that recruited patients at the point of cardiac evaluation for coronary angiography ; therefore, there was a higher proportion of patients with cad. our population consisted of a heterogeneous subgroup of patients with pad, yet we believe that the confirmed diagnoses were carefully captured individually. also, we lacked complete information regarding new york heart association functional class, claudication symptom, and disease severity, but we addressed this issue by enrolling patients in stable condition, confirmed by careful review of the electronic medical record individually. we also acknowledge that many factors may have influenced tmao levels, including increased age, diabetes, elevated hscrp, or low egfr. all of these factors can contribute to increased mortality in this population, and we do not have an external validation cohort to confirm our findings. despite these limitations, our findings are the first report to point to novel insights that provide a mechanistic link between gut microbiota associated metabolism involved in tmao formation and pad, and substantially improved risk stratification for adverse prognosis in patients with pad. elevated plasma tmao levels, a proatherogenic metabolite formed by gut microbiota metabolism of the choline group of pc, portend stronger incident risk of major adverse cardiovascular events and allcause death in patients with pad, independent of traditional risk factors. this research was supported by grants from the national institutes of health (nih) and the office of dietary supplements (r01hl103866, p20hl113452, r01dk106000). the genebank study has been supported by nih grants p01hl076491, p01hl098055, r01hl103931, and the cleveland clinic clinical research unit of the case western reserve university ctsa (ul1tr000439). dr wang was partially supported by nih grant r01hl130819. mass spectrometry studies were performed on instruments housed in a facility supported in part by a center of innovations award by shimadzu. drs wang and hazen are named as coinventors on pending patents held by the cleveland clinic relating to cardiovascular diagnostics and therapeutics. dr wang has received royalty payment for inventions or discoveries related to cardiovascular diagnostics from cleveland heartlab. dr hazen has received research funds from abbott, p&g, pfizer inc, roche diagnostics, and takeda. dr hazen has received royalty payments for inventions or discoveries related to cardiovascular diagnostics or therapeutics from cleveland heartlab, siemens, esperion, and frantz biomarkers, llc. the other authors have reported that they have no relationships relevant to the contents of this paper to disclose.	backgroundproduction of the proatherogenic metabolite, trimethylamine noxide (tmao), from dietary nutrients by intestinal microbiota enhances atherosclerosis development in animal models and is associated with atherosclerotic coronary artery disease in humans. the utility of studying plasma levels of tmao to risk stratify in patients with peripheral artery disease (pad) has not been reported.methods and resultswe examined the relationship between fasting plasma tmao and allcause mortality (5year), stratified by subtypes of pad and presence of coronary artery disease in 935 patients with pad who underwent elective angiography for cardiac evaluation at a tertiary care hospital. median plasma tmao was 4.8 mol / l (interquartile range, 2.98.0 mol / l). elevated tmao levels were associated with 2.7fold increased mortality risk (fourth versus first quartiles, hazard ratio 2.86, 95% ci 1.823.97, p<0.001). following adjustments for traditional risk factors, inflammatory biomarkers, and history of coronary artery disease, the highest tmao quartile remained predictive of 5year mortality (adjusted hazard ratio 2.06, 95% ci 1.363.11, p<0.001). similar prognostic value for elevated tmao was seen for subjects with carotid artery, non carotid artery, or lower extremity pad. tmao provided incremental prognostic value for allcause mortality (net reclassification index, 40.22% ; p<0.001) and improvement in area under receiver operator characteristic curve (65.7% versus 69.4% ; p=0.013).conclusions tmao, a proatherogenic metabolite formed by gut microbes, predicts longterm adverse event risk and incremental prognostic value in patients with pad. these findings point to the potential for tmao to help improve selection of highrisk pad patients with or without significant coronary artery disease, who likely need more aggressive and specific dietary and pharmacologic therapy.
in many real world queueing systems, the server may be unavailable for a random period of time when there is no customer in the waiting line at a service completion instant. this random period of server absence is often called server vacation ; see doshi and tian and zhang. the classical vacation scheme with bernoulli - schedule (bs) discipline was introduced and studied by keilson and servi. various aspects of bernoulli - schedule vacation models for single server queueing systems have been studied by servi and ramaswamy and servi. servi and finn introduced a class of semivacation policies known as working vacation (wv) wherein a customer is served at a slower rate rather than keeping completely inactive during a vacation. at a service completion epoch during a regular busy period if the queue length is empty, the server may take multiple working vacations (mwv). the analysis of gi / m/1 queue with mwv is carried out by baba using the matrix - analytic method. analysis of finite buffer gi / m/1 queue with mwv can be found in banik.. in order to utilize the server effectively, vacation interruption (vi) has become an important aspect, where the server interrupts the vacation and resumes regular service if at least one customer is present in the queue at a service completion epoch during a vacation. li and tian studied a markovian queue with vacation interruption. the gi / m/1 queue with bernoulli - schedule vacation interruption (bs - vi) has been analyzed by tao.. using the matrix - analytic method, they have obtained the steady state distributions for the queue length, waiting time, and sojourn times. for some controllable queueing systems with vacations, it is usually assumed that the server is available or unavailable completely depending upon the number of customers present in the system. whenever the system is empty, the server goes on vacation. in the instant at which the server returns back from a vacation and finds at least n customers in the system this type of control policy is also called n - policy for the queueing systems with vacations. a brief analysis on finite buffer gi / m/1 queue with n - policy has been given by ke and wang and ke. investigated a quorum queueing system with a random setup time under n - policy and with bs vacations. an infinite buffer markovian queue with mwv and n - policy state dependent queues are dependent on the queue size, arrivals, and their service times. this is applicable in many areas like cellular manufacturing cells, routers, and switches that regulate the transmission of information packages having finite buffer capacity. in many of these applications, the arrival and service rates depend on the state of the queue. these queues have applications on arrivals and service rates which yield less waiting time in the system. chao and rahman have analyzed an n - policy g / m(n)/1/k queue with state dependent vacations. an efficient algorithm for the state dependent services and state dependent mwv for gi / m(n)/1/n has been presented by goswami.. recently, a computational algorithm for the steady state probabilities in a gi / m(n)/1/n / swv - vi queue has been presented by laxmi.. the present paper is an extension of the work of [10, 16 ] wherein our aim is to include n - policy and bs - vi in a finite buffer gi / m(n)/1 queue. the analysis of such state dependent service models has not been carried out so far to the best of our knowledge. further, the inclusion of n - policy with bs - vi utilizes the server more and decreases the waiting lines effectively in order to economize operating cost and energy consumption. motivated by the above observations, this paper aims to contribute to the theory of bs - vi models with n - policy. the service times during service period, vacation period, and vacation times are exponentially distributed. we provide a recursive method using the supplementary variable technique and treating the remaining interarrival time as the supplementary variable, to develop the steady state system length distributions at prearrival and arbitrary epochs. some performance measures such as blocking probability, the expected queue length, and the expected waiting time have been evaluated. section 5 contains some numerical results to show the effectiveness of the model parameters followed by conclusions in section 6. in this paper, we consider a gi / m(n)/1/k queue with working vacations and bs - vi under n - policy, where k is the finite buffer space. we assume that the interarrival times of successive arrivals are independent and identically distributed (i.i.d.) random variables with cumulative distribution function a(x), probability density function a(x), x 0, and laplace - stieltjes transform (l.- s. t) a() with mean interarrival time 1/ = a(0), where h(0) is the first derivative of h() evaluated at = 0. whenever the system becomes empty, the server takes a wv. during a wv, a customer is served at a rate generally lower than the regular service rate. at a service completion epoch during wv, if there are at least n customers present in the queue, the server interrupts the vacation with probability q=1-q and switches to regular service and otherwise continues the vacation with probability q. the service times during regular busy period and during wv period are exponentially distributed with rates n and n, 1 n k, respectively, if there are n customers present in the system before the beginning of a service. let,, and be the mean service rates during a regular busy period, during wv period and mean vacation rate respectively. they are given by = n=1n / k, = n=1n / k, and = n=1n / k. the traffic intensity is given by = /. let us define the state of the system at time t as ns(t) denoting the number of customers present in the system including the one in service, u(t) is the remaining interarrival time for the next arrival, and (1)(t)=0,if the server is in wv period,1,if the server is in regular busy period. the joint probabilities denoted by i,0(x, t) and i,1(x, t) are defined as (2)n, jx, tdx = limtpnstn, xutx+dx,t = j, x0, jnk, j=0,1. the system length distributions at prearrival epoch are obtained by developing differential - difference equations at steady state. treating the remaining interarrival time as supplementary variable, we write the equations as (3)0,0(1)(x)=11,1(x)+11,0(x),n,01x=nn,0x+axn1,00+n+1n+1,0x, 1nn1,n,01x=nn,0x+axn1,00+qn+1n+1,0(x), nnk1,k,01x=kk,0x+axk1,00+k,00,1,11x=11,1x+22,1x,n,11x=nn,1x+n+1n+1,1x+a(x)n1,1(0), 2nn1,n,11x=nn,1x+n+1n+1,1x+qn+1n+1,0(x)+nn,0x+axn1,10, nnk1,k,11x=kk,1x+kk,0x+axk1,10+k,10, where n = n + n, n, j(0), j = 0,1, are the respective rates of arrivals ; that is, an arrival is about to occur. let us define the laplace transforms of n, j(x) as n, j() = 0en, j(x)dx, re 0. hence, n, j n, j(0) are the joint probabilities that there are n customers in the system and the server is in state j, j = 0,1. multiplying the above set of equations by e and integrating with respect to x from 0 to yield (4)0,0()=11,1()+11,0()0,0(0),(5)nn,0=n+1n+1,0+an1,00n,00, 1nn1,(6)nn,0=qn+1n+1,0+an1,00n,00, nnk1,(7)kk,0=ak1,00+k,00k,00,(8)(1)1,1()=22,1()1,1(0),(9)nn,1=n+1n+1,1+an1,10n,10, 2nn1,(10)nn,1=n+1n+1,1+qn+1n+1,0+nn,0+an1,10n,10, nnk1,(11)kk,1=kk,0+ak,10+k1,10k,10. further, adding (4) to (11) and taking limit as 0, we obtain the following result : (12)n=0kn,00+n=1kn,10=. the left hand side denotes the mean number of entrances into the system per unit time and is equal to the mean arrival rate. solving the set of equations from (5) to (11) in a backward recursion we get the following expressions. substituting = n in (7) to (6) and = n in (5), we get (13)k1,00=1akakk,00,n1,00=n,00qn+1n+1,0nan, n = k1,,n,n1,0(0)=n,00n+1n+1,0nan, n = n1,,1, where, for n and n, the unknowns n,0() are obtained from (7) to (5) as (14)k,0=aakkakk,00,n,0=qn+1n+1,0+an1,00n,00n, n = k1,,n,n,0=n+1n+1,0+an1,00n,00n, n = n1,,2. substituting = n in (11) to (9) we get (15)k1,10=1akakk,10kakk,0k,n1,10=n,10ann+1n+1,1nanqn+1n+1,1nannn,0nan, n = k1,,n,n1,1(0)=n,10ann+1n+1,1nan, n = n1,,2. for n, n,1() are given by the following : (16)k,1 = kk,0+ak1,10+k,10k,10k,n,1=nn,0+qn+1n+1,0+n+1n+1,1n+a()n1,1(0)n,1(0)(n), n = k1,,n,n,1=n+1n+1,1+an1,10n,10n, n = n1,,2,1,1()=22,1()1,101. differentiating (5) to (7) and setting = k in (7), = n in (6), and = n in (5), we obtain, respectively, (17)k,0k=a1kk1,00+k,00,(18)n,0n=qn+1n+1,01n+a1nn1,00, n = k1,,n,(19)n,0n=n+1n+1,01n+a1nn1,00. similarly, differentiating (11) to (8) and setting = n (1 n k), the expressions are given by (20)k,1k=kk,01(k)+a1kk1,10+k,10,n,1n=nn,01n+qn+1n+1,01n + n+1n+1,01n+a1nn1,10, n = k1,,n,n,1n=n+1n+1,01n+a1nn1,10, n = n1,,2,1,11=22,111. using the above expressions one can evaluate n, j(0), (j n k, j = 0,1, be the arbitrary and joint probabilities that there are n customers in the system and the server is in state j, j = 0,1, and let n, j denote the prearrival epoch probabilities. applying bayes ' theory and the result (12), we have (21)n, j=n, j0, jnk, j=0,1. to obtain the arbitrary epoch probabilities, we develop relations between prearrival and arbitrary epoch probabilities. setting = 0 in (7) to (5) and (11) to (9) and using (21), we obtain (22)k,0=kk1,0,n,0=nn1,0+qn+1n+1n+1n,0j = n+1k1 + j = n+1k1qj+1j+1j+1s = n+1jqsss,0, n = k1, k2,,n,n,0=nn1,0+nnn1,0+qn+1n+1n+1n,0j = n+1k1 + j = n+1k1qj+1j+1j+1s = n+1jqsss,0, n = n1,,1,k,1=kkkk1,0+k1,1,n,1=nn1,1+nnn1,0j = nk1qj+1j+1j+1 j = n+1k1s = njqsnsss,0, n = k1, k2,,n,n,1=nn1,1+nnn1,0j = nk1qj+1j+1j+1 j = n+1k1s = njqsisss,0, n = n1, n2,,2,1,1=1nnn1,0j = nk1qj+1j+1j+1 j = n+1k1s = njqsisss,0. using the normalization condition, the only unknown 0,0 is obtained as (23)0,0=1n=1kn,0+n,1. some models available in the literature are deduced as special cases of our model by taking specific values of the parameters n, q, n, n, and n. case 1. if q = n = 1, our model reduces to finite buffer gi / m(n)/1 queue with mwv. in this case our results are found to match with the results available in goswami.. if q = n = 1, our model reduces to finite buffer gi / m(n)/1 queue with mwv. in this case our results are found to match with the results available in goswami.. if n 0, the model becomes gi / m(n)/1/k with n - policy ; our results are in accordance with chao and rahman. if n 0, the model becomes gi / m(n)/1/k with n - policy ; our results are in accordance with chao and rahman. if n, n =, n, n 0, q = 1, the model reduces to gi / m/1/k queue and the results match with the results available in ke and wang. if n, n =, n, n 0, q = 1, the model reduces to gi / m/1/k queue and the results match with the results available in ke and wang. in this section, some operating characteristics such as the average number of customers in the queue (lq) (system (ls)), the average waiting time of a customer in the queue (wq) (system (ws)), and the blocking probability of the server (ploss) are evaluated. they are, respectively, given by (24)lq=n=1kn1n,0+n=1kn1n,1,ls=n=1knn,0+n=1knn,1,ploss=k,0+k,1,wq = lq^, ws = ls^, where ^=(1-ploss) is the effective arrival rate. in this subsection, we formulate an expected cost model, in which mean service rate during vacation is the decision variable. let us define the following : c cost per unit time during regular busy period, c cost per unit time during working vacation period, clq cost per unit time for a customer waiting in the queue, cploss cost per unit time when a customer is lost due to blocking.the total expected cost function per unit time is given by (25)minimize : f=c+c+clqlq+cplossploss. our objective is to determine the optimal mean service rate during vacation to minimize the cost function f(). we employ the qfsm to solve the above optimization problem, as the computation of derivatives of the above expected cost function is a nontrivial task. c cost per unit time during regular busy period, c cost per unit time during working vacation period, clq cost per unit time for a customer waiting in the queue, cploss cost per unit time when a customer is lost due to blocking. given a 3-point pattern, we can fit a quadratic function through corresponding functional values that has a unique minimum, x, for the given objective function f(x). quadratic fit uses this approximation to improve the current 3-point pattern by replacing one of its points with approximate optimum x. the unique optimum x of the quadratic function agreeing with f(x) at 3-point operation (x, x, x) occurs at (26)xq12fxlxm2xh2+fxmxm2xh2+fxhxlxm1 xh2xl2+fxhxl2xm2 fxlxmxh+fxmxhxlxm2xh2 xm2xh2+fxhxlxm1. to validate the results obtained earlier, some numerical computations have been done and some of them are presented in the form of tables and graphs. the parameters of the system are taken as k = 10, n = 5, the traffic intensity = 0.5, n = ln(n + 0.4), n = ln(n + 0.2), and n = ln(n + 0.3) with mean values = 1.617224, = 1.566202, and = 1.592235, respectively, unless otherwise mentioned separately in the respective graphs and tables. the various cost parameters are taken as c = 20, c = 18, clq = 30, and cploss = 10. it can be observed that as q increases, the system characteristics increase and model with vi (q = 0) performs better than the model without vi (q = 1) as expected in practice. figure 1 depicts the effect of on the expected queue length (lq) in models with and without vi for he2 interarrival time distribution with 1 = 0.381248, 2 = 3.2, 1 = 0.4, and 2 = 0.6. further, in both models (mwv and mwv - vi) lq converges to the same value as approaches. figure 2 shows the impact of threshold value n on wq when interarrival time is exponentially distributed. it is clear from the figure that wq increases with the increase of n. this is because as n increases more customers are required for the service start - up that results in increase of waiting time. further, the average waiting time in case of queues without vi is higher as compared to queues with vi particularly for smaller n values. a similar observation of above figure can be made from figure 3 where the effect of on lq for two different threshold values of n is shown. it is clear that as n increases, difference between two models for lq reduces. moreover we can observe that mwv - vi (q = 0) model gives us the better expected queue lengths. the effect of on the total expected cost function (f()) is shown in figure 4, with constant service rates during regular busy period and during working vacation period and constant vacation rates. the state independent rates are chosen as = 2.8, = 0.9, and = 1.5. with the information of figure 4, qfsm is applied by choosing the stopping tolerance = 10 and the initial 3-point pattern as (,,) = (2.5,2.6,2.7). after six iterations, table 2 shows that the minimum expected operating cost per unit time converges to the solution f() = 124.2712 for = 2.583980. table 3 describes the sensitivity analysis of cost function and the queue lengths between mwv and mwv - vi models for different and n values. the minimum expected cost and the average queue lengths increase with n and in both the models and the model with vi has lower queue lengths when the arrival rate is lower. the above observations highlight the fact that the model with mwv - vi has better performance than the mwv model for lower threshold value n and for <. in this paper, we have carried out an analysis of a renewal input state dependent n - policy queue with bernoulli - schedule vacation interruption that has potential applications in production, manufacturing, traffic signals, telecommunication systems, and so forth. the bernoulli - schedule parameter q enables combined study of the models with and without vi. using the supplementary variable technique we have developed a recursive method to obtain the steady state system length distributions at various epochs. various performance measures are evaluated and a cost optimization problem is considered using quadratic fit search method. the method and analysis used in this paper can be applied to multiserver gi / m(n)/c and map / m(n)/c queues.	we study a finite buffer n - policy gi / m(n)/1 queue with bernoulli - schedule vacation interruption. the server works with a slower rate during vacation period. at a service completion epoch during working vacation, if there are at least n customers present in the queue, the server interrupts vacation and otherwise continues the vacation. using the supplementary variable technique and recursive method, we obtain the steady state system length distributions at prearrival and arbitrary epochs. some special cases of the model, various performance measures, and cost analysis are discussed. finally, parameter effect on the performance measures of the model is presented through numerical computations.
the recognition of noise as a serious health hazard as opposed to a nuisance is a recent development and the health effects of hazardous noise exposure are now considered to be an increasingly important public health problem. noise exposure in the workplace is a common reality in qubec (province of canada) and worldwide. in the usa, it is estimated that 22 million workers (17%) are exposed to hazardous noise. in qubec, two recent surveys have estimated that 7% and 10%, respectively, of qubec 's workers reported being currently exposed often or always to loud workplace noise such that it is difficult to maintain a conversation a few feet away, even when shouting. in addition, among them at least 4,300 workers are exposed to daily noise levels of 100 dba or more in over 500 workplaces. the assumption of a causal or contributive impact of occupational noise on the occurrence of occupational accidents has been addressed in several studies. recent publications except one suggest an exposure - response relationship between noise exposure or hearing impairment and accident risk. according to three explanatory models and empirical data, there is a biological plausibility for a causal relationship between noise exposure and occupational accident risk. nevertheless, the extent to which noise does act as a causal or contributive factor in fatal workplace accidents remains unclear and is subject to debate. potential effects of occupational noise on the risk of injuries based on interaction between the worker and his / her workplace [institut national de sant publique du qubec (inspq), adapted from htu 1993, wilkins 1981 and le cocq 2010 ] through a review of work - related fatality reports, this study sought to : 1. determine the number of instances when noise was identified as one of the potential causes and retained as such, 3. determine the number of instances when noise could have been identified as one of the potential causes, and 4. though not presented in this paper, the fifth aim was to determine the worth of fatality reports as a potential surveillance data source. the assumption of a causal or contributive impact of occupational noise on the occurrence of occupational accidents has been addressed in several studies. recent publications except one suggest an exposure - response relationship between noise exposure or hearing impairment and accident risk. according to three explanatory models and empirical data, there is a biological plausibility for a causal relationship between noise exposure and occupational accident risk. nevertheless, the extent to which noise does act as a causal or contributive factor in fatal workplace accidents remains unclear and is subject to debate. potential effects of occupational noise on the risk of injuries based on interaction between the worker and his / her workplace [institut national de sant publique du qubec (inspq), adapted from htu 1993, wilkins 1981 and le cocq 2010 ] through a review of work - related fatality reports, this study sought to : 1. determine the number of instances when noise was identified as one of the potential causes and retained as such, 3. determine the number of instances when noise could have been identified as one of the potential causes, and 4. though not presented in this paper, the fifth aim was to determine the worth of fatality reports as a potential surveillance data source. similar to a multiple case studies design, this population - based descriptive study is based on a thorough analysis of the content found in the 788 fatal accident reports completed by various inspectors from the commission de la sant et de la scurit du travail du qubec [workers compensation board (wcb) ] during the 1990 - 2005 period. for the investigation of the causes of a fatal injury, was adopted in 2000, the reports were divided into the following two blocks : main block covering accident reports issued between 2000 and 2005 (n = 284) and a complementary block assessing those in the 1990 - 1999 period (n = 504). in brief, the assigned inspectors are responsible for gathering all interesting and relevant facts from various sources (witnesses, simulations, etc.), classifying the information into essential and secondary items, identifying the potential causes to be further analyzed, and reaching a plausible conclusion as to the causes of the fatal event. in this study, assessment of the noise factor was based on the written information found in the publicly available reports regarding the essential contextual and technical elements used to assess the noise - accident relationship. the underlying framework for analyzing each accident report is presented with the results in figure 2. accidents were deemed to have occurred in a noisy environment wherever it was clearly indicated that at least one source of noise was operating within the victim 's work area at the time of the accident irrespective of the noise level. to be classified a report had to contain at least one key word relating to the following categories : masking noise, warning signal, hearing loss, or hpds. when mentioned explicitly, noise was classified as treated directly when analyzed as a potential cause per se, indirectly when analyzed within another potential cause, and in a general manner when merely mentioned in the description of the fatal event. lastly, reports in which noise was identified as an explanatory factor of the fatal event by the inspectors were classified as noise as an explanatory factor in the qubec wcb fatal accidents reports in the 1990 - 2005 period (n = 788) when noise was mentioned explicitly, an in - depth content analysis was first carried out separately by at least two expert authors (audiologists or acoustic engineers) to examine the methods used by the inspectors to analyze the noise factor. thereafter, during a meeting to discuss individual reports, a consensus was reached by all the authors regarding the inspectors choice of noise measurements and whether their analyses and conclusions were appropriate. the number of reports to be analyzed in depth was determined by reaching saturation in the information of interest relative to the study 's objectives. all the reports not thoroughly analyzed were reviewed summarily by one of the authors to check for any new relevant information. a comprehensive analysis of accident reports from the main block in which noise was not mentioned explicitly was also carried out to determine if noise could have been considered as a potential cause. to reach such a conclusion, the accident must have occurred in a noisy environment and involved a victim being struck by a vehicle since noise is more likely to interfere with communication in this context. while reports from the main block were scrutinized for information relative to all four objectives, those from the complementary block were analyzed only when noise was mentioned explicitly (objectives 2 and 4). from the 788 work - related accident reports covering the 1990 - 2005 period, noise was mentioned explicitly in 67 (32 + 35/788 = 8.5%) reports [figure 2 ]. among those, noise was treated directly in 21 (2.7%) reports, indirectly in 15 (1.9%) reports, and in a general manner in 31 (3.9%) reports. moreover, inspectors concluded that noise was one of the causes in the fatal event in 17 (2.2%) out of 21 reports in which noise was analyzed directly. from the 67 reports in which noise was mentioned explicitly, 50 were analyzed comprehensively, including 28 out of 32 from the main block and 22 out of 35 from the complementary block. the analysis revealed the following four noise assessment methods used by the inspectors : a)qualitative assessment [21 (42%) ], 19 of which also included quantitative measures;b)event simulations [13 (26%) ], two of which were with expert consultants;c)quantitative measures only [six (12%) ] ; andd)general description only [10 (20%) ]. qualitative assessment [21 (42%) ], 19 of which also included quantitative measures ; event simulations [13 (26%) ], two of which were with expert consultants ; quantitative measures only [six (12%) ] ; and general description only [10 (20%) ]. from the available information and despite poor data in some cases (i.e., incomplete noise assessments and technical flaws), the authors concluded that the inspectors had reached adequate conclusions in 24 (48%) cases. however, a more thorough investigation of the fatal event could have yielded a different conclusion relative to the noise factor in three cases (6%). finally, 23 (46%) reports contained insufficient information for the authors to assess the validity of the inspectors conclusions. during the 2000 - 2005 period (main block of reports), 161 fatal accidents took place in noisy work environments characterized by various noise sources (trucks, concrete saws, wood saws, conveyor belts, etc.) although in most cases (122/161), the noise source was directly involved in the accidental event, noise per se was retained as a cause in 4.3% (7/161) of cases. construction (31/161) and forestry (28/161) workers accounted for 36.6% of the victims. struck by a vehicle in 47 (29.2%) cases, hit / crushed by an object in 38 (23.6%) cases, or wedged / dragged in 34 (21.1%) cases. the remaining 42 (26.1%) victims fell or were injured by some other mechanism. over the same period (2000 - 2005), noise was not explicitly mentioned in 129 reports investigating fatal accidents in noisy work environments including 29 (22.5%) accidents involving a worker being struck by a vehicle. following a comprehensive content analysis of these 29 reports, the authors concluded that noise could have been considered in five (3.9%) reports because of sufficient circumstantial evidence of possible interference of ambient noise in the communication between workers or in the perception of warning signals. however, the available written information did not make it possible to conclude if noise was actually a cause or not. in all other reports involving a worker being struck by a vehicle (24/29), the authors agreed with the inspectors findings that noise did not need to be considered as other identified causes were sufficiently obvious to explain the event irrespective of the noise levels. noise was explicitly stated as one of the explanatory factors in 2.2% (17/788) of the fatal accident reports. although qualitative methods are more typically designed to explain phenomena than to explore causal relationships, the goal of the inspectors inquiries was to gather all relevant information in order to reach conclusions with regard to the causes of a fatal event. the content analysis of 788 reports spanning a 16-year period argues strongly in favor of, although it can not prove, a causal relationship between noise and fatal accidents in the 17 cases identified by the inspectors. given the methodological limitations (i.e., access to written reports but not to inspectors notes, limited data in some reports, and review of fatal accident reports only) and inspectors constraints during investigations, this result (2.2%) most likely underestimates the proportion of workplace accidents explained at least partly by noise. in all the 17 cases in which inspectors identified noise as a cause (15 involving a worker being struck by a moving vehicle), one aspect of communication was impaired. indeed, the content analysis revealed that the warning device either failed or could not be heard over the ambient noise. interestingly, noise was identified as a cause in 11 cases during the 1990 - 1999 period, a time when inspectors were not, to the authors knowledge, specifically trained to carry out noise assessments and during which the causal relationship between noise and accidents was not yet well known or established. as inspectors gathered information from witnesses and other sources to understand the circumstances surrounding a fatal accident, the hypothesis of noise acting as an essential factor in cases where communication was at stake likely emerged intuitively. so did the interference with communication as a noise - related cause of accidents. in one case, the use of hpds at the time the accident occurred was considered to have interfered with the recognition of the backup alarm and warning shouts. for the 21 cases in which noise was analyzed directly as a potential cause, shortcomings in work methods and work organization were also identified in all but four reports (data not shown). lack of adequate training, poor visibility, and faulty or absent safety measures were among the other identified modifiable causes, providing useful insight into the occurrence of fatal accidents within noisy work settings. such factors could be considered potential confounders, along with other known factors such as age in epidemiological studies investigating the relationship between noise and workplace accidents. other known adverse effects of noise may also contribute to fatal accidents including reduced vigilance, precision, and visual span. since inspectors only include essential elements in their analysis to conclude on potential causes, noise is not identified as a cause in situations where these adverse effects come into play. this may partly explain why the impact of noise, measured in terms of relative risk or attributable fraction reported in some epidemiological studies, is greater than the findings that the current study suggests. however, some epidemiological studies report an association between noise and nonfatal accidents. given a causal relationship between noise and accidents, noise would likely contribute to a significantly greater number of accidents than these findings suggest if nonfatal injuries were also included. author consensus was achieved relative to the inspectors choice of noise measurements, analyses, and conclusions. access to the full range of information gathered by the inspectors (including notes, simulations, and interviews) might have yielded a different judgment. inferences were often necessary to determine if the fatal accident had occurred in a noisy environment since most reports did not contain noise measurement data. noise may affect communication at various levels as its effect consists of a complex interaction between different factors according to htu 's and wilkins models. nevertheless, a conservative approach was used in this study to define a noisy environment in order to minimize overestimation. a rather conservative approach was also used by the authors in deciding that noise could have been mentioned in cases when it was not explicitly stated by the inspectors. this may partly explain the rather low percentage of such reports (3.9%) in the 2000 - 2005 subset. however, the authors judged that noise was considered as a potential cause by the inspectors in the vast majority of events in which it should have been. the findings of this study suggest that noise should be systematically considered as a potential cause in all investigations of work - related accidents where vehicular movement or communication between workers is involved. as noise may also interfere with vigilance and other risk factors for accidents, it may be a much more important contributing factor to accidents than previously thought and than what is suggested by the findings of the current study. given the omnipresence of noise and its plausible effects on worker safety, it should be a key component in the prevention of occupational accidents. in addition to reducing the risk of hearing loss, published results suggest that reducing workplace noise can yield beneficial effects on communication, worker comfort, and potentially, vigilance. further studies, particularly those exploring the contexts of impaired communication such as warning sound perception and interaction between noise and other risk factors for accidents, are needed to better understand the ways in which noise may cause or contribute to accidents as well as increase the effectiveness of accident prevention efforts.	noise exposure in the workplace is a common reality in qubec, canada as it is elsewhere. however, the extent to which noise acts as a causal or contributive factor in industrial work - related accidents has not been studied thoroughly despite its plausibility. this article aims to describe the importance or potential importance, during investigations looking into the specific causes of each work - related fatal accident, of noise as an explanatory factor. the written information contained in the accident reports pertaining to contextual and technical elements were used.the study used multiple case qualitative content analysis. this descriptive study was based on the content analysis of the 788 reports from the commission de la sant et de la scurit du travail du qubec [workers compensation board (wcb) ] investigating the fatal work - related accidents between 1990 and 2005. the study was descriptive (number and percentages). noise was explicitly stated as one of the explanatory factors for the fatal outcome in 2.2% (17/788) of the fatal accidents, particularly when the work involved vehicular movement or the need to communicate between workers. noise was not typically considered a unique cause in the accident, notably because the investigators considered that the accident would have probably occurred due to other risk factors (for example, disregard of safety rules, shortcomings in work methods, and inadequate training). noise is an important risk factor when communication is involved in work. since noise is ubiquitous and may also interfere with vigilance and other risk factors for accidents, it may be a much more important contributing factor to accidents than is currently recognized.
	the catalytic asymmetric synthesis of alkyl fluorides, particularly -fluorocarbonyl compounds, has been the focus of substantial effort in recent years. while significant progress has been described in the formation of enantioenriched secondary alkyl fluorides, advances in the generation of tertiary alkyl fluorides have been more limited. here, we describe a method for the catalytic asymmetric coupling of aryl alkyl ketenes with commercially available n - fluorodibenzenesulfonimide (nfsi) and c6f5ona to furnish tertiary -fluoroesters. mechanistic studies are consistent with the hypothesis that the addition of an external nucleophile (c6f5ona) is critical for turnover, releasing the catalyst (ppy) from an n - acylated intermediate. the available data can be explained by a reaction pathway wherein the enantioselectivity is determined in the turnover - limiting transfer of fluorine from nfsi to a chiral enolate derived from the addition of ppy to the ketene. the structure and the reactivity of the product of this proposed elementary step, an -fluoro - n - acylpyridinium salt, have been examined.
hyponatremia, characterized by a serum sodium level that is less than 135 meq / l, is one of the most commonly diagnosed electrolyte disorders in clinical medicine1). although sodium deficiency leads to hyponatremia, this condition is more commonly caused by solute dilution resulting from excessive consumption of water. severe hyponatremia, where serum sodium level falls below < 125 meq / l, occurs in approximately 3% of all hospitalized patients2). additionally, a rapid drop in serum sodium levels to 110 - 120 meq / l leads to cerebral edema and brain herniation1). since it is often an indicator of underlying disease, timely diagnosis of hyponatremia is of great importance in preventing potential morbidity and mortality3). approximately one - third of all hyponatremic patients are diagnosed with euvolemic hyponatremia, a condition commonly caused by the syndrome of inappropriate antidiuretic hormone secretion (siadh)4). under normal physiological conditions, antidiuretic hormone (adh ; also known as vasopressin) is secreted from the posterior pituitary gland in response to hyperosmolality in a process called osmotic adh secretion. nonosmotic adh secretion, associated with hypovolemia, pain, nausea, and use of certain drugs, also leads to hyponatremia5). although nonosmotic adh secretion can be a normal biological response when caused by hypovolemia or low effective arterial blood volume, it can also be a symptom of siadh3). siadh is characterized by euvolemia, high urinary sodium excretion (natriuresis), and elevated urine osmolality in the absence of diuretics. this syndrome is often associated with pituitary insufficiency, adrenal or renal dysfunctions, thyroid disorders, and edema3). adh binds to the vasopressin-2 receptors in the renal collecting duct and stimulates a cyclic adenosine monophosphate - signaling cascade that leads to the insertion of preformed aquaporin-2 water channels into the apical plasma membrane, thereby resulting in the transcellular movement of water6). the development of hyponatremia is associated with various inflammatory diseases including pneumonia, severe acute respiratory distress syndrome, tuberculosis, meningitis, encephalitis, human immunodeficiency virus infection, and malaria5). recent research revealed that inflammatory cytokines such as il-1 and il-6 are involved in the development of hyponatremia associated with inflammatory conditions, and that this process is related to adh secretion5,7,8). landgraf.9) reported that il-1 stimulated both central and peripheral release of vasopressin in rats. in addition, palin.10) reported that treatment of wistar rats with lipopolysaccharide (lps) resulted in reduced diuresis, elevated plasma arginine - vasopressin (avp) levels, and an increase in the activity of avp neurons. these authors also reported that a brain injection of il-6 increased the activity of avp neurons in a manner similar to that observed after peripheral lps treatment. accordingly, a brain injection of anti - il-6 antibodies prevented the lps - induced activation of avp neurons. therefore, these authors suggested that il-6 induces an early activation of avp neurons in response to a lps injection10). most notably, mastorakos.11) demonstrated that avp levels were elevated 2 hours after il-6 injection in all the six patients studied, suggesting that il-6 activated the magno - cellular avp - secreting neurons and that it may be involved in the development of an inappropriate avp secretion syndrome. endothelial cells, smooth muscle cells, and blood brain barrier (bbb) pericytes secrete il-6 in response to il-1 and lps stimulation12,13). circulating il-6 can be transported across the bbb or may simply diffuse across the bbb in the circumventricular organs5). a number of studies have demonstrated that hyponatremia is associated with various inflammatory conditions7,14 - 18). very frequently, meningitis has been identified to be a cause of siadh15). patwari.15) reported that siadh was diagnosed in 22 of 60 patients (36.7%) with bacterial meningitis on admission, and found that siadh is significantly correlated with the severity of meningeal inflammation. although there are no reports that address the possible mechanisms underlying the relationship between siadh and meningitis, we speculate that elevated levels of inflammatory cytokines such as il-1 or il-6, as observed in this disease, may lead to hyponatremia by augmenting adh secretion. riikonen.16) showed that high c - reactive protein (crp) levels were associated with low serum sodium concentrations and that an elevation in crp levels is an early indicator of bacteremia in neutropenic children. ohta and ito7) also reported four cases of hyponatremia arising from siadh that appeared to be related to inflammation. these authors reported the presence of increased concentrations of avp and il-6 in patients, and found that intravenous administration of il-1 increased avp and urinary sodium excretion. therefore, il-1 may have a significant role in the development of siadh and hyponatremia associated with inflammation7). watanabe.17) reported that coronary artery lesions and increased serum crp levels were significantly more common in patients diagnosed with both kawasaki disease and hyponatremia. in the light of their findings, these authors suggested that hyponatremia occurs in kawasaki disease patients having severe inflammation. we hypothesize that il-1 and il-6 are involved in the development of hyponatremia that is associated with siadh in kawasaki disease18). recently, lim.14) conducted a study that supported our hypothesis regarding the consequences of inflammation in kawasaki disease patients. these authors found that the serum sodium concentrations were inversely correlated with the percentage of neutrophils, crp, and n - terminal - pro brain type natriuretic peptide levels. additionally, serum il-6 and il-1 levels were higher in a section of kawasaki disease patients who were also diagnosed with hyponatremia14). increased levels of plasma adh are found in kawasaki disease patients diagnosed with siadh14). further, the increase in adh concentrations positively correlated with the levels of il-6 and il-1, suggesting that these cytokines may augment adh secretion, leading to siadh and hyponatremia in kawasaki disease14). recently, we extended this hypothesis to a febrile urinary tract infection (uti) model, and identified that hyponatremia was associated with renal cortical defects. using 99m - technetium - dimercaptosuccinic acid scintigraphy, we determined the serum sodium concentrations. the results showed that serum sodium concentration was negatively correlated with the white blood cell count (r=-0.156, p=0.011) and crp levels (r=-0.160, p=0.028). our results showed that hyponatremia is significantly correlated with the degree of inflammation in children with febrile utis19). based on our findings, we suggest that hyponatremia may be a potential marker of severe inflammation in general19). hyponatremia in febrile uti can occur in association with other underlying disorders including pseudohypoaldosteronism (renal tubular unresponsiveness to aldosterone) and proximal tubular dysfunction19). siadh also leads to hyponatremia under conditions of more severe inflammation by reducing the expression and inhibiting the function of the apical epithelial sodium channel and/or, sodium potassium adenosine triphosphatase at the basolateral membrane of renal epithelial cells via the action of proinflammatory cytokines such as il-1 and tumor necrosis factor-19). it was suggested that patients who may be producing adh due to acute inflammatory diseases or subtle volume depletion may be more safely treated by administering fluids that contain higher concentrations of sodium, by a decrease in fluid rate, or by employing a combination of these strategies20,21). it was also suggested that patients who are at risk for producing persistent adh (siadh) should receive smaller quantities of maintenance fluid to avoid hyponatremia. patients with possible subtle volume depletion may receive 20 ml / kg (maximum of 1 l) of isotonic fluid (normal saline or ringer lactate) over 1 - 2 hours to restore their intravascular volume22). the patient can then be switched to a 5% dextrose solution in half - normal saline (0.45% nacl)+20 meq / l kcl as a standard maintenance fluid regimen, rather than routinely receiving fluids with 0.2% nacl22). in conclusion, available data indicate that inflammatory cytokines such as il-1 and il-6 have an important role in the nonosmotic release of adh. under inflammatory conditions, understanding the physiological mechanisms of adh release and antidiuresis during inflammation, monitoring patient sodium levels, and selecting the appropriate intravenous fluid regimen with a suitable infusion rate will all be important aspects of future patient care.	timely diagnosis of hyponatremia is important for preventing potential morbidity and mortality as it is often an indicator of underlying disease. the most common cause of eurvolemic hyponatremia is the syndrome of inappropriate antidiuretic hormone (siadh) secretion. recent studies have demonstrated that proinflammatory cytokines such as interleukin (il) 1 and il-6 are involved in the development of hyponatremia, a condition that is associated with severe inflammation and is related to antidiuretic hormone (adh) secretion. serum sodium levels in hyponatremia are inversely correlated with the percentage of neutrophils, c - reactive protein, and n - terminal - pro brain type natriuretic peptide. additionally, elevated levels of serum il-6 and il-1 are found in inflammatory diseases, and their levels are higher in patients with hyponatremia. because it is significantly correlated with the degree of inflammation in children, hyponatremia could be used as a diagnostic marker of pediatric inflammatory diseases. based on available evidence, we hypothesize that hyponatremia may be associated with inflammatory diseases in general. understanding the mechanisms responsible for augmented adh secretion during inflammation, monitoring patient sodium levels, and selecting the appropriate intravenous fluid treatment are important components that may lower the morbidity and mortality of patients in a critical condition.
however, the role played by each of several acceleration and loss mechanisms is not yet established observationally [millan and thorne, 2007 ]. precipitation into the atmosphere is considered to be one of the major electron loss mechanisms, which can completely deplete the radiation belts of electrons during the main phase of some geomagnetic storms [o'brien., 2004 ; selesnick, 2006 ]. using data from balloon - borne x - ray detectors, foat., lorentzen., and millan. have reported precipitating relativistic electrons in the dusk sector. these duskside precipitation events occur over a variety of magnetic activity levels [lorentzen., 2000 ; kokorowski., 2008 ] and a broad radial distribution ranging from l=38 [millan., 2013 ]. the energy spectrum has been found to be well fit by an exponential distribution with an e - folding energy ranging from 0.5 to 3.6 mev [millan., 2002 ]. based primarily on the fact that all these events were found at dusk, the cause has been suggested to be the gyroresonant scattering by electromagnetic ion cyclotron (emic) waves. emic waves are observed throughout the inner magnetosphere but predominantly on the duskside and dayside [anderson., 1992a, 1992b ; meredith, 2003 ; erlandson and ukhorskiy, 2001 ; fraser., 1996, 2006 ; usanova., 2012 ]. they are excited by anisotropic ring current ions injected into the inner magnetosphere [e.g., jordanova., 2008 ] or by compressions of the magnetopause [e.g., anderson and hamilton, 1993 ]. the linear growth rate of emic waves maximizes in high - density regions such as the duskside plasmapause or plasmaspheric drainage plume due to reduced resonant energies [cornwall., 1970 ; horne and thorne, 1993 ] and wave guiding by steep density gradients near the plasmapause [horne and thorne, 1993 ; jordanova. field - aligned emic waves interact with relativistic electrons through the gyroresonance condition 1where e is electron gyrofrequency, is the relativistic factor, k\|\| and v\|\| are components of the wave propagation vector particle velocity along the direction of the ambient magnetic field. emic waves are expected to effectively scatter relativistic electrons of geophysically interesting energies, preferably in duskside high - density regions, where the minimum energy limit is relatively low and the diffusion rate is close to the strong diffusion limit [thorne and kennel, 1971 ; albert, 2003 ; summers, 2003 ]. duskside simultaneous proton and relativistic electron precipitation has also been observed, supporting the theory of precipitation caused by emic wave scattering [e.g., bortnik., quasi - linear theory [kennel and petschek, 1966 ] has been the dominant treatment ; however, recent work shows that nonlinear effects can be very significant and even reverse the conclusions [albert and bortnik, 2009 ]. therefore, it is important to establish when and where each approach is applicable and to test these models with observations. existing theoretical discussions on emic waves as a possible loss mechanism mainly focus on the evolution of the trapped electron flux and its timescale. however, directly measured by balloon detectors is the energy spectrum of the bremsstrahlung x - rays produced by the precipitating electrons, and many satellites also measure the energy of the precipitating electrons [millan., 2007 ]. it is very important to understand the energy dependence of the precipitating flux driven by emic waves, as well as the time evolution of this dependence in order to test the theory with observations. this paper uses the quasi - linear formulation to evaluate the energy and time dependence of rep, and investigates how different parameters affect the diffusion coefficients and the energy spectrum. when applied with input wave and particle data from satellites (e.g., van allen probes, goes), the results from our model can be directly compared with balloon (e.g., balloon array for rbsp (radiation belt storm probes) relativistic electron losses) and low - altitude satellite (e.g., solar anomalous and magnetospheric particle explorer (sampex) and polar - orbiting operational environmental satellites (poes)) measurements to investigate the role of emic waves in causing rep as well as the effectiveness of the adopted theoretical model. we use quasi - linear diffusion theory to model the evolution of the distribution of electrons due to interactions with emic waves. radial and energy diffusion are ignorable because the frequency of the emic waves is well above the drift frequency and well below the gyrofrequency of the resonant particles [kennel, 1966 ]. the bounce - averaged diffusion equation for pure pitch angle scattering can be written as [davidson and walt, 1977 ; lyons, 1973 ; lyons and williams, 1984 ; shao., 2009 ] 2where t(0)=1.38020.3198(sin(0)+ sin1/2(0)) is the normalized bounce time, f0 is the trapped electron phase space density, 0 is the equatorial pitch angle, d(0,e) is the bounce - averaged pitch angle diffusion coefficient, and atm is the timescale for losses to the atmosphere. assuming that losses occur only from within the loss cone and that the loss cone is emptied twice per bounce period, we take atm to be half of the bounce period inside the loss cone and infinite outside the loss cone [lyons, 1973 ; davidson and walt, 1977 ; lyons and williams, 1984 ; shao., the differential flux is related to the phase space density through the electron momentum p as j0=pf0. to capture the feature of the isotropic flux distribution in the loss cone in the many strong diffusion cases in our parameter studies, we set the boundary conditions to be. for weak diffusion cases, although does not have to be zero, the loss cone is essentially empty and a small number of electrons in the loss cone does not significantly affect the diffusion [shprits.,, 2009 ] 3with an arbitrary scaling outside the loss cone and j0(t=0)=0 inside the loss cone. here e is the particle energy in mev and 0l is the equatorial loss cone angle given by sin2(0l)=(4l3l) at a particular l shell. we calculate the bounce - averaged diffusion coefficient using the same method as summers and summers. for parallel - propagating emic waves in a multi - ion (h, he, and o) plasma. the diffusion coefficient is corrected with a factor of 2 [albert, 2007 ]. the earth 's magnetic field is assumed dipolar, the wave amplitude is taken to be 1 nt, and the wave frequency spectrum is assumed to be a truncated gaussian, namely, 4where m is the center frequency, with lower frequency limit 1=m and upper frequency limit 2=m+. is a measure of the bandwidth. the emic waves are assumed to be confined to 15% in latitude and 10% of the electron drift orbit, propagating in a cold plasma of a storm time ion composition 70% h, 20% he, and 10% o [meredith, 2003 ]. the wave dispersion relation is 5where k is the wave number k1 5 mev are not shown in the figure) ; d(0,e)m increases at low energies and decreases at high energies only with increasing 2 while increases at low energies and approaches the same values at high energies with decreasing b0 or increasing n0 or 1 (variations at > 5 mev are not shown in the figure). lastly, the minimum resonant energy emin decreases while 0u increases with decreasing b0 or increasing n0 or 2, but emin and 0u are unaffected by 1. (first to fourth rows) d(00,e), d(0,e)m, 0 m, and 0u are shown, respectively. (fifth row) precipitating flux at t=1 s derived from initial distribution equation 9. (left column) varying b0, n0=100 cm, 1=2.4 o+, 2=3.4 o+ ; (middle column) varying n0, b0=100 nt, 1=2.4 o+, 2=3.4 o+ ; and (right column) varying, b0=100 nt, n0=100 cm are shown. applying the results for the diffusion coefficients from section 3, we solve equation 2 for the trapped equatorial electron flux j0(0,e, t). as we can see, the loss cone fills up quickly (e.g., the first 60 s in figure 3) before gradually being depleted as the total flux drops due to loss to the loss cone. evolution of the pitch angle distribution of the trapped flux of 4 mev electrons in the simulation time 0 to 5 min. b0, n0, 1, and 2 are the same as figure 1(c). at b0=200 nt (l6.7), the loss cone is 2.3. at 0 min, the trapped flux distribution is the initial maxwellian flux distribution equation 3. the omnidirectional flux at any latitude on a dipole field line can be expressed in terms of equatorial flux and pitch angles as [lyons and williams, 1984 ], 7where. if we take to be the latitude where the field line intersects the atmosphere boundary, then b/b0=(4l3l), =0lc and no particle bounces back to the equator. the omnidirectional relativistic electron precipitation (rep) flux measured at the atmosphere boundary will then be 8jrep plotted versus e is then the energy spectrum of the precipitating electrons. to study how the jrep(e, t) energy spectra are affected by the diffusion coefficients, we first apply an energy - independent initial distribution 9and examine the precipitation spectrum in the first second, i.e., jrep(e, t=1s) (figure 2, fifth row). these plots strongly resemble those of d(00,e) (figure 2, first row), indicating that the precipitation at the outset is largely controlled by the diffusion coefficients at small pitch angles. next, we again use the maxwellian initial distribution equation 3 and study how the spectrum is affected by time. we found two types of spectra (figure 4) : in most cases, the spectrum is singly peaked (figure 4a), but occasionally, increasing wave frequency can induce another peak (figure 4b). as shown in the figures, initially, both spectra resemble maxwellian distributions with a lower cutoff at the minimum resonant energy. the precipitation quickly builds up from zero within the first second as the loss cone is being filled. shortly after, the rep flux near the minimum resonant energies largely drops and the rep flux starts to gradually decrease as the loss cone is being depleted. this rapid increase and slow decrease of the precipitation is consistent with many balloon observations [millan., 2007 ]. however, in figure 4a, the peak of the rep flux keeps moving toward higher energies and the curves flatten out. in figure 4b, the peak stays at a roughly constant energy, followed by another peak forming at a later time at a higher energy and moving toward even higher energies. the hardening of both spectra with time is due to the fact that 1 with increasing energy, diffusion becomes increasingly dominated by particles with larger pitch angles (0 m and 0u both increase with energy) and they are scattered into the loss cone more slowly than the ones with smaller pitch angles ; 2 over time, with fewer particles left to interact with the waves, the precipitation is largely reduced at lower energies associated with shorter lifetimes (larger diffusion coefficients) and therefore the spectrum becomes harder and more isotropic (flatter) in energy. furthermore, as we discussed in the previous section, the increase of the diffusion coefficient at the peak energy from surrounding energies is significantly enhanced with frequency. when the increase is sharp enough, the precipitation of the particles with the highest diffusion coefficients can drastically reduce the flux and a trough can form in the middle of the spectrum. in figure 4b, no rep flux is produced above 4 mev since the diffusion coefficients in the loss cone are zero (figure 1d). the energy distribution of the precipitating electrons at time 1 s to 50 min and the time evolution of the energies of the rep peaks assuming maxwellian initial distribution equation 3. (a and b) b0, n0, 1, and 2 are the same as figures 1c and 1d, respectively. note the x axis left end in figure 4a is higher than 100 kev for better visualization. in figure 5, we show the variation of the spectra of rep at 30 min for the full range of parameters. in the first few seconds (not shown), similar to the case of an initial distribution uniform in energy, with decreasing b0 or increasing n0, 1, or 2, jrep increases at low energies but decreases at high energies. but at 30 min, in the case of lower b0 or higher n0, 1, or 2, the rep flux curves become fairly flat or doubly peaked, and sometimes intersect and fall below the curves of higher b0 or lower n0, 1, or 2 (e.g., the precipitation with b0=125 nt is lower than that of 175 nt at 2.6 mev in figure 5a ; the precipitation with =3.4 - 3.9 o+ is lower than any other precipitation curve of 2=3.9 o+ at below 1 mev in figure 5c). when this happens, the role played by the changing parameter at these energy ranges is different than at early times. our simulation also shows that increasing n0, or decreasing b0 lowers the energies of the peaks in both single- or double - peak spectra. energy spectra of precipitating electron flux at t=30 min with maxwellian initial distribution, plotted with the same parameters and color codes adopted in figure 2. (c) the rep flux of 3.43.9 o+ is zero above 3.6 mev where diffusion coefficients are zero in the loss cone. in figure 6, we integrate jrep in the energy ranges 0.10.3, 0.31, and 15 mev and vary two of the three parameters b0, n0, and simultaneously. these spectra can be compared with satellites with similar energy channels (e.g., poes and sampex) [yando., the curves of the same color (for the same fixed parameter) get shorter and shorter, and can completely disappear when the energy of the channel is below the minimum resonant energies. with an increase in n0 or or a decrease in b0, the rep flux increases, except occasionally at late times when the roles played by the parameters reverse (explained in the previous paragraph), in which case strong initial scattering results in the significant decrease of the precipitation as the loss cone is depleted. precipitating electron flux in energy channels (a) 1=2.4 o+, 2=3.4 o+, b0=751150 nt, color - coded in n0 ranging from 25 to 1000 cm. (b) n0=100 cm, b0=751150 nt, color - coded in ranging from 1.93.9 o+. (c) b0=100 nt, n0=11000 cm, color - coded in ranging from 1.9 to 3.9 o+. the goal of this paper is to investigate the shape of the energy spectrum of relativistic electron precipitation (rep) due to quasi - linear interactions with emic waves, and how it varies with time and changing parameters such as background magnetic field strength b0, cold plasma density n0, and wave frequency. the key results can be summarized as follows : 1. the rep energy spectrum is generally peaked, with a lower cutoff at the minimum resonant energy. over time the second peak appears later at a higher energy and moves toward even higher energies.3. in both single- and double - peak cases, the precipitating flux first rapidly increases as the loss cone is being filled, and then slowly decreases as the loss cone is being depleted.4. increasing n0,, or decreasing b0 lowers the minimum resonant energy and the energies of the peak(s). it causes the precipitation to increase at low energies and decrease at high energies. over time, when strong scattering slows down, the role played by the changing parameter is altered.5. we study how it is affected by changing parameters through varying two parameters at the same time. the integrated flux monotonically increases with increasing n0 and and decreases with increasing b0, except at the energies where the role of the parameter reverses when strong scattering causes a large reduction of the particles interacting with the waves (figure 6). the rep energy spectrum is generally peaked, with a lower cutoff at the minimum resonant energy. over time, the peak moves toward higher energies and the spectrum flattens (gets harder). the second peak appears later at a higher energy and moves toward even higher energies. the precipitating flux first rapidly increases as the loss cone is being filled, and then slowly decreases as the loss cone is being depleted. 4. increasing n0,, or decreasing b0 lowers the minimum resonant energy and the energies of the peak(s). it causes the precipitation to increase at low energies and decrease at high energies. over time, when strong scattering slows down, the role played by the changing parameter is altered. we study how it is affected by changing parameters through varying two parameters at the same time. the integrated flux monotonically increases with increasing n0 and and decreases with increasing b0, except at the energies where the role of the parameter reverses when strong scattering causes a large reduction of the particles interacting with the waves (figure 6). to better explain the variation of the precipitation energy spectrum, we show how the spectrum is affected by three deterministic factors the diffusion coefficient, the initial trapped flux, and time. the diffusion coefficient is determined by the gyroresonance condition, the wave dispersion relation, and the wave frequency distribution and is a function of pitch angle. we calculate the diffusion coefficient for a range of input parameters b0, n0, and and characterize the pitch angle dependence of the diffusion coefficient with d(00,e), the upper pitch angle limit 0u, and the maximum diffusion coefficient d(0,e)m along with its corresponding pitch angle 0 m. we show that the diffusion coefficient maximizes at increasing pitch angles with increasing energy and the upper limit 0u also increases. we also show that low b0, high n0 and high lower the minimum resonant energy, increase the diffusion coefficients of low energy particles and reduce the diffusion coefficients of high energy particles, and further increase the precipitation at low energies and decrease the precipitation at high energies at the beginning. the number of particles scattered into the loss cone per unit of time increases with the number of initially trapped particles. therefore, when we switch the initial trapped flux energy distribution from uniform to maxwellian, the spectrum becomes slanted with an enhancement at the lower energies, and the peak of the spectrum shifts to the left. therefore, in the beginning, the precipitation is strongly affected by the diffusion coefficients at low pitch angles. since the diffusion coefficients tend to extend out and maximize at higher pitch angles with increasing energy, the precipitating flux of high energies has a growing relative significance over time, and the precipitation energy spectrum gets harder. in addition, if the scattering at a certain energy is initially strong, the particles at that energy are quickly lost and the precipitation will be largely reduced over time, and this also results in the rapid decrease of the precipitation at lower energies and the formation of the trough regions in the doubly peaked spectra. it is worth noting that thermal heating [anderson and fuselier, 1994 ; thorne., 2006 ] and the high plasma beta in the outer edge of the ring current during storm times [lui., 1987 ] may render the cold dispersion relation impractical. several studies [isenberg, 1984 ; chen., 2011 ; silin., 2011 ; chen., 2013 ] in which the hot dispersion relation is adopted suggest that at the vicinity of the ion cyclotron frequencies, the finite - beta effect may lead to the damping of the emic waves and the increase of the minimum resonant energies of relativistic electron scattering. based on their conclusions, in the situations where the warm / hot ions are abundant, we should expect to see a higher minimum resonant energy cutoff in our rep energy spectrum if the wave frequencies are just below the helium gyrofrequency. whether the doubly peaked spectra will still exist is uncertain because in our simulations, they usually only happen at high frequencies close to the helium gyrofrequency where the diffusion coefficient is significantly modified by the finite - beta effect. these model energy spectra show what we should expect to observe given various wave and geomagnetic environmental conditions if the precipitation is caused by emic wave scattering and can be simulated by the adopted diffusion model. further work will include event studies in which we will take the input data from satellites (e.g., van allen probes and goes) and compare the simulated precipitating flux spectra with those detected by conjugate balloons (e.g., barrel) and low altitude satellites (e.g., sampex and poes).	[1]previous studies on electromagnetic ion cyclotron (emic) waves as a possible cause of relativistic electron precipitation (rep) mainly focus on the time evolution of the trapped electron flux. however, directly measured by balloons and many satellites is the precipitating flux as well as its dependence on both time and energy. therefore, to better understand whether pitch angle scattering by emic waves is an important radiation belt electron loss mechanism and whether quasi - linear theory is a sufficient theoretical treatment, we simulate the quasi - linear wave - particle interactions for a range of parameters and generate energy spectra, laying the foundation for modeling specific events that can be compared with balloon and spacecraft observations. we show that the rep energy spectrum has a peaked structure, with a lower cutoff at the minimum resonant energy. the peak moves with time toward higher energies and the spectrum flattens. the precipitating flux, on the other hand, first rapidly increases and then gradually decreases. we also show that increasing wave frequency can lead to the occurrence of a second peak. in both single- and double - peak cases, increasing wave frequency, cold plasma density or decreasing background magnetic field strength lowers the energies of the peak(s) and causes the precipitation to increase at low energies and decrease at high energies at the start of the precipitation.
severity of disease of hospitalized patients has increased over the past decade, and advanced techniques have allowed such patients to stay alive. it is well - known that advances in medicine and biomedical technology have created the likelihood for medical treatment to be continued beyond a point, of which it offers no advantage to the patient and may lengthen suffering. it is widely recognized that continued care may not always be advantageous, and this concept has given rise to frequent limitation of life support treatment (lst). the concept of limitation of lst which includes do - not - resuscitate (dnr) and withdrawal of lst (wlst) has examined medical practices to avoid use of treatment which lengthen the patient 's life and does not improve the patient 's outcomes. in north america and europe, 2865% of all pediatric intensive care unit (picu) in contrast to the west, where limitation proceeds up to 90% of deaths ; the rate in india is 2250%, in iran 6.7%, and in saudi arabia 34%. different cultures, religions, philosophic, legal, and professional attitudes may in part explain these differences. in the context of pakistan, the cost of intensive care is high and affordable only by middle - high income groups.. we could not find any published reports from pakistan on patterns of mortality among critically ill children in picu. therefore, our aim was to conduct a retrospective review on mortality patterns over a 6-year period in a picu and to compare the results with published data from other countries. we retrospectively reviewed the medical records for all children aged 1-month to 16 years old admitted in the picu from january 2007 to december 2012. the picu is a tertiary care private - sector teaching hospital in karachi, the most populous city of pakistan. it is a 4- bedded closed, multidisciplinary, medical - surgical unit with about 350 admissions per year. trends of mortality were categorized into 4 groups : (1) failed cardiopulmonary resuscitation (cpr), (2) dnr, (3) brain death, and (4) wlst. the decision of dnr was made by the attending physician after detail discussion and informed consent from parents / guardians. the wlst was done with the involvement of a hospital ethical committee and the attending consultant after obtaining informed consent from parents / guardians. we have hospital ethical committee, having members, who are trained with accredited ethical fellowship program. other data collected from the medial records included patient demographics (i.e. age, sex, admission source such as the emergency room [er ] or operating theatre,) along with the admitting diagnosis. a total of 1919 children were admitted to the picu over the 6 years period, of which 248 children died with mortality rate of 12.9%. most of the children who died were male 60.5% (n = 150) with a median age of 2.8 years (interquartile range 0.48 years), and 65% of children who died were under 5 years old. overall, the incidence of admission was highest from the er (57.7%, n = 143) [table 1 ]. characteristics of children who died in pediatric icu most of the children died with a sepsis or sepsis - related diagnosis (17.3%, n = 43) followed by central nervous system (cns) involvement. in 63.7% (n = 158) children, death was followed by some kind of limitation of lst, which involved dnr and wlst with dnr being more prevalent while in 28.2% of children (n = 70) full resuscitative procedures were carried out. we also found an increasing trend of limitation of lst (dnr) over the period of 6 years [figure 2 ]. modes of death among critically ill pediatric patients in pediatric intensive care unit pattern of modes of death over 6 years study period among critically ill pediatric population in pediatric intensive care unit we report the pattern of mortality among critically ill children admitted to the picu over a period of 6 years. the mortality rate in our cohort was higher to those reported in us (46.2%), canada (7.3%), uk (5.1%), and europe (5.8%). however, one study reported a mortality rate of 13.7%, which was similar to the present findings. the median age of child mortality in the picu in our report was 2.8 years which is similar to other studies ranging from 0.8 to 3.1 years, with mostly children under 1-year of age (27.9%) as in our cohort 37.5%. most of these critically ill children were admitted through the er (57.7%) which is similar to other study. the most common primary admitting diagnosis was sepsis followed by cns in our cohort whereas acute respiratory failure and cns were being the most common primary diagnosis in other studies. there is a wide variation in the patterns of mortality among critically ill pediatric population in picus worldwide as shown in table 2. we identified limitation of lst 63.5% (dnr and wlst) as the most frequent cause of mortality which is consistent with the majority of data from international studies followed by the failed cpr. published articles on mode of deaths in pediatric icu do - not - resuscitate is considered by most authors as an intermediate option between full support of patient and wlst. dnr was the most frequently used form of limitation of lst in our cohort. however, failed cpr was reported as most common mode of death in other parts of the world. the variation in the rate of active decision making at end - of - life (eol) care may reflect either differences in attitudes and clinical behavior with respect to the active management of dying or may be due to variation in cultures or resources based on the picu admission criteria whereby children with poor prognosis are not admitted in icus. our results echoed those from canada, usa, and the uk where parental involvement and consultation in decision - making regarding limitation of lst is common, and where parental sovereignty and informed consent are highlighted. their doctors take up a more authoritarian role in the decision - making process with little or no family consultation. studies have shown that children who die after limitation of lst are more likely to have chronic diseases as in our cohort where 72.5% of patients with chronic diseases had limitation of lst, probably because these children have sufficiently recognized disease, with poor prognosis, and lengthening their lives would sometimes result in unnecessary treatment and needless suffering. one study showed that parents of children who had chronic disease were more likely to be satisfied with eol care compared with parents whose children had undergone sudden or acute insults. the families of children with chronic conditions may have more time to respond and accept an outcome of death. advances in biology, science, and medical technology have intensely altered the medical landscape and our place in it. the capacity to extend life beyond the point of which it may appear to have little or no benefit has forced us to scrutinize difficult questions regarding human identity, personhood, rights, and responsibilities with regard to access to medical care, the goals of health care, and the way managing dying patients. more commonly, patients die not only as a result of the natural course of the disease but because of an active decision to limit the lst. however, such decisions are always challenging. they are mostly complex, both clinically and morally, in relation to the care of neonates and children for the reason that there is often substantial diagnostic and prognostic ambiguity in these patients, and it may be challenging to assess accurately and predict the quality - of - life and functional capacity. first, it is a retrospective study which may have some recall and interpretation bias that could lead to incomplete data. second, we did not examine the discussion between physician and families about eol care. third, the number of children died in the ward or at home after discharge with a terminal disease, and the patients who stayed alive in spite of limitation of lst (dnr order or wlst) are unknown. fourth, this study might represent the reality in just one tertiary care center and, therefore, other studies are necessary to assess eol circumstances in the picus all over the country. we found limitation of lst (dnr + wlst) as the most common cause of death in our picu. we also found an increasing trend of limitation of lst (dnr) over the 6-year period of the study.	background and aim : advances in biomedical technology have made medical treatment to be continued beyond a point, at which it does not confer an advantage but may increase the suffering of patients. in such cases, continuation of care may not always be useful, and this has given rise to the concept of limitation of life - sustaining treatment. our aim was to study mortality patterns over a 6-year period in a pediatric intensive care unit (picu) in a developing country and to compare the results with published data from other countries.materials and methods : retrospective cohort study was conducted in a picu of a tertiary care hospital in pakistan. data were drawn from the medical records of children aged 1-month 16 years of age who died in picu, from january 2007 to december 2012.results:a total of 248 (from an admitted number of 1919) patients died over a period of 6 years with a mortality rate 12.9%. the median age of children who died was 2.8 years, of which 60.5% (n = 150) were males. the most common source of admission was from the emergency room (57.5%, n = 143). the most common cause of death was limitation of life - sustaining treatment (63.7%, n = 158) followed by failed cardiopulmonary resuscitation (28.2%, n = 70) and brain death (8.1%, n = 20). we also found an increasing trend of limitation of life - sustaining treatment do - not - resuscitate (dnr) over the 6-year reporting period.conclusion:we found limitation of life support treatment (dnr + withdrawal of life support treatment) to be the most common cause of death, and parents were always involved in the end - of - life care decision - making.
heart failure (hf) is a complex clinical syndrome where the ability of the heart to supply physiological perfusion to organs is impaired, either by acquired or inherited disease. the key biomarker for measuring heart failure is the left ventricular ejection fraction (lvef) but a low ejection fraction and hf are not synonymous. common causes are ischemic heart disease, hypertensive heart disease, valvular heart disease, diabetes, myocarditis, cardiomyopathies, tachycardia - induced cardiomyopathy, and systemic diseases with cardiac involvement. in most hf presentations hf represents one of the most important problems for both modern medicine and society with massive impact on individuals and a major annual cost for health systems. the annual costs for hf care exceed $ 40 billions in the us, with the majority spent on hospitalizations for hf [13 ]. damage the heart and the whole organism responds upregulated renin - angiotensin system changes, haemodynamic and skeletal muscle changes are the most well known. however, it is the myocardial response that is the most fundamental that of the myocytes and fibroblast (the most prevalent cells in the myocardium), and extracellular space changes. these changes may be initially adaptive but may progress to be maladaptive. common features of this remodelling process are cardiomyocyte hypertrophy, extracellular matrix expansion and composition alteration. calcium handling, energy metabolism, contractile function, vasculature and cell viability may also change. these processes although deeply interwoven may combine into characteristic myocardial phenotypes which, if we can measure them, may permit us to split hf up in a subtypes, opening the door for tailored therapy according to the precise myocardial phenotype. there is no denying the significant advances in treatment strategies for hf, including drug and device therapy, cardiac transplantation, and mechanical circulatory support. however, despite these, the prognosis has not improved in worsening chronic hf, de novo hf and advanced or end - stage hf, which continue to have high mortality and re - admission rates [26 ]. whilst the basic biology has pointed to a host of potential therapeutic targets with successful phase 2 trials, few of firstly, we measure the wrong thing the ejection fraction in defining hf, despite the fact that 40 % of hf has a preserved lvef. secondly, we group all types of hf together, thereby ignoring personalised differences in myocardial disease biology. thirdly, our early phase trial surrogate endpoints (such as short term symptoms improving) are not well tied to important outcomes such as mortality. what is needed is a better practical understanding and measurement of disease biology fibrosis and myocyte response to split heart failure into different groups, with these biomarkers being tied to specific therapies [2, 3, 7 ]. this review focuses on a novel technique using standard cardiovascular magnetic (cmr) scanner, t1 mapping, to do this and its potential to act as a disease (rather than syndrome) biomarker, as a surrogate endpoint in trials and as a way of monitoring and tailoring therapy once implemented for better patient outcomes. in the last 10 years, cmr has provided two key technologies for hf : anatomical and functional assessment using cine imaging and tissue characterization for focal abnormalities, particularly scar imaging using the late gadolinium enhancement technique (lge). cine imaging provided a more accurate and reproducible quantification of lvef, size and mass, particularly in hearts that were geometrically distorted. the lge technique for the first time allowed visualization of focal scar. when integrated, there was a step change, but perhaps not a revolution in our understanding of hf. scar pattern, particularly in early disease provided insights into the underlying causes of myopathy, whilst the extent of scar was prognostic and incrementally so over lvef. the lack of scar in particular predicted functional recovery following intervention with resynchronisation (discoordination), revascularization (hibernation) or with time (stunning). additional techniques such as t2-weighted imaging for edema and t2 imaging for iron quantification added in selected circumstances. however, a gap still remained : the lge technique could not detect global myocardial changes such as occur in diffuse fibrosis. in addition, all scars looked the same whether there was 50 % or 100 % myocyte loss in a region. magnetic resonance of protons varies between tissues, depending on the macromolecular environment that water finds itself in. the t1 relaxation time (longitudinal relaxation time, measured in milliseconds) is a tissue - specific magnetic property and is determined by how rapidly protons re - equilibrate their spins within their environment after been excited by radiofrequency pulse. regional difference in t1 can be visualized by t1-weighted sequences following an intravenous bolus of extracellular contrast, gadolinium, to evaluate myocardial scar or focal fibrosis. gadolinium is an extracellular agent not able to enter through intact cell membrane and cleared from the blood pool after minutes. in tissue with damaged or dead cells, these kinetic effects are delayed and there is a higher accumulation of contrast due to ruptured cell membranes allowing gadolinium to passively diffuse into the cellular compartment. if at this point, a t1-weighted inversion recovery sequence is performed, with the inversion time (ti) set manually by the operator to null normal the lge technique is now the gold standard test for the detection of scar across the spectrum of cardiac disease. its assessment is reproducible and scar visualization provides a good indicator of disease etiology whilst scar extent carries prognostic information, which in many diseases is incremental to conventional prognostic markers. in hf, the lge technique reduces diagnostic dilemmas but raises new ones : for example, it used to be a clinical conundrum that burnt out hypertrophic cardiomyopathy (hcm) could mimic dilated cardiomyopathy. however, within the hcm spectrum, whilst in early disease, the lge pattern may point to the underlying etiology (e.g. sarcomeric protein disease, fabrys etc.) by end stage, all the diseases start to look the same and scarred out. lge prognostication is incrementally useful : in a large study (n > 1000), lge was associated with first hospitalizations for hf after cmr, death or both across the range of ejection fractions including preserved ef. furthermore, even if lvef was severely decreased, those without lge appeared to have less risks of hospitalization for heart failure or death. the extent of lge is difficult as different techniques produce different results, particularly in non - ischemic cardiomyopathy. the technique is black and white within lge areas, complete replacement scar looks the same as 50 % myocyte loss ; and conversely background this latter point means the lge technique misses global myocardial pathologies for example lge is an uncommon finding in pressure or volume overload disease, systemic condition with cardiac involvement, cardio - toxic effect of different agents, diabetes or hypertension cardiac effect even though all are known to have diffuse fibrosis. rapid technical innovations in cmr have generated a novel parametric mapping field addressing these shortcomings. these methodologies permit the routine acquisition of quantitative measure of underlying tissue - specific t1 relaxation rather than relative signal intensities. after recent technical improvements, t1 measurement (multi - breath - hold or multiple images requiring curve fitting and processing) has been replaced by t1 mapping. in a single breath - hold, using various approaches, a t1 colour relaxation map is made [1113 ]. within the map, each given pixel value directly corresponds its underlying relaxation time that can be seen (in colour) or more formally measured, standardized, calibrated to histology [14, 15, 16 ], compared across diseases and with normal reference ranges. there are two key ways of using t1 mapping : without or before contrast (native t1 mapping) ; and with contrast, typically by subtracting the pre and post maps with hematocrit correction to generate the extracellular volume fraction (ecv) (fig. 1t1 maps (using molli [39 ], short axis view) in a healthy volunteer pre - contrast (left) and post - contrast (centre), both measured in milliseconds. for the ecv map (right), each pixel has a value of the interstitial volume as it was calculated from the two t1 maps. the region of interest (white) showing a normal ecv of 27 % t1 maps (using molli [39 ], short axis view) in a healthy volunteer pre - contrast (left) and post - contrast (centre), both measured in milliseconds. for the ecv map (right), each pixel has a value of the interstitial volume as it was calculated from the two t1 maps. myocardial native (non - contrast) t1 measures the t1 values from the extracellular and intracellular compartments. measurement requires no exogenous contrast administration, making it feasible even in patients with severe kidney dysfunction. t1 increases with pathologies where increased water is present such as edema [18, 19 ] (fig. 2b) [22, 23 ]. using a short, single breath - hold, t1 mapping sequence to obtain native t1 values may complement in diseases where the lge technique works (such as infarction) [18, 19, 24, 25 ] but more importantly may detect pathology otherwise missed by lge technique, such as a pan - myocarditis. in other diseases, the changes may be very large indeed two exemplar diseases with gross but opposite t1 changes are informative.fig. 2native t1 maps (using shmolli), all with the same colour scale. (a) healthy volunteer : the myocardium appears homogenously green and the blood is red ; low t1 values (blue) from iron overload (c) and lipid storage in fabry s disease (c) (except the infero - lateral wall which is high) ; (d) and (e) represent with high t1 values (red) in amyloid (d) and in myocarditis (d) ; infarcted (acute infarction) area appears red f) here basal anter - septum native t1 maps (using shmolli), all with the same colour scale. (a) healthy volunteer : the myocardium appears homogenously green and the blood is red ; low t1 values (blue) from iron overload (c) and lipid storage in fabry s disease (c) (except the infero - lateral wall which is high) ; (d) and (e) represent with high t1 values (red) in amyloid (d) and in myocarditis (d) ; infarcted (acute infarction) area appears red f) here basal anter - septum in anderson - fabry disease (afd), where mutations of the -galactosidase gene result in intracellular lipid accumulation and left ventricular hypertrophy (lvh), the native t1 falls, and falls by many standard deviations (fig. this fall appears to be a direct measurement of myocyte lipid storage, which had not previously been measurable. in every other cause of lvh so far explored (hcm, amyloid, aortic stenosis (as), hypertension) t1 increases, meaning that a low t1 absolutely distinguishes afd from all other causes of lvh with no apparent overlap, and with superior discrimination to other factors. in afd patients without lvh, up to half of patients have a low t1, suggesting that t1 is a marker of early cardiac involvement. one caveat of interest is that these findings are in the septum in afd patients without heart failure. in the basal infero - lateral wall a large number of patients have an area of high t1 in the area that lge is found, with a surrounding area of normal t1, suggesting a four step pathological progression from normal to low to pseudo - normalized to high t1. whether this is true (perhaps the infero - lateral wall is never low) and whether this is a pan - myocardial process leading to heart failure is currently unknown. combined, these observations raise the possibility of t1 mapping for early diagnosis, as a surrogate endpoint in therapy trials and to monitor therapy, but much more work is needed. in cardiac al amyloidosis (fig. 2d), clinically observed cardiac involvement is associated with marked elevations in native t1. these correlate with markers of lv mass, lv systolic dysfunction and markers of diastolic dysfunction (e / e and e deceleration time). clinically, al amyloid cardiac involvement is classified by echocardiography and biomarkers into absent, possible and definite involvement. t1 is elevated not only in the definite cardiac involvement patients, but also in the possible and no cardiac involvement patients, at a lower level, suggesting both that t1 measurement may add value, but also that amyloid infiltration is an earlier phenomenon in this systemic disease than was previously thought. the other main type of ventricular myocardial amyloid is associated with transthyretin amyloid (ttr ; attr for amyloid from ttr). in attr these elevations are far higher than fibrotic diseases such as in as, but appear not as high as in al amyloid. however, there are some specific hurdles to be overcome for clinical utility. whilst pathology influences t1, these differences between approaches may be higher than the differences between health and disease pathology. therefore at this time whilst technical developments are progressing at pace, normal reference ranges are needed for each approach and ideally for every centre. moreover, the use of an extracellular contrast agent adds another dimension to t1 mapping and the ability to distinguish and quantify intracellular and extracellular compartment. measuring the t1 time, following the administration of an extracellular contrast agent (gadolinium chelates), generates the possibility to dichotomize the myocardium into its cellular and extra - cellular components. in early studies, the absolute value of t1 post - contrast was used but this has some limitations. this value is affected by renal clearance, gadolinium dose, body composition, acquisition time post bolus and hematocrit. measuring the ratio of t1 changes pre and post contrast administration in the myocardium and blood provides the partition coefficient, if a sufficient equilibrium of contrast was reached between blood and myocardium. when corrected by hematocrit the myocardial extracellular volume (ecv) is derived, biologically representing the myocardial space fraction between cells ; more specifically, the space between all cells, including interstitial fluid and plasma between red cells in the myocardial capillaries. three basic methods have been used : a primed continuous infusion of contrast to reach a definitive equilibrium of distribution between plasma and interstitium ; a bolus only approach with sufficient time to elapse post bolus for sufficient equilibrium ; and serial time point to curve fit. currently, it appears that the bolus only approach offers the simplest approach, but further work is needed to clarify whether any incremental benefit of the other two approaches is of sufficient merit [32, 33 ]. expansion of the myocardial ecv represents a nonspecific increase in free space between cells and occurs in a variety of pathologies (table 1). to distinguish, the degree of ecv change and the clinical context is important. cardiac al amyloid has a higher ecv than any other diseases generating diagnostic specificity above a certain threshold and seems to detect cardiac involvement earlier than other current tests and better than native t1. in absence of amyloid, the increased ecv value expansion is mainly due to edema or increased myocardial collagen. ecv imaging can quantitatively characterize infarcted scar and atypical fibrosis, diffuse myocardial abnormalities even when not clinically apparent on lge images and also the small changes occurring in myocardium with aging, even if near to detection limit [35, 36].table 1t1 mapping, ecv and cardiac diseases. summary of t1 values and ecv for different cardiac diseasescardiac diseasenative t1 (msec)ecv (%) healthy volunteersevere aschronic mi - lgechronic mi - remote??myocarditisamyloidhcm - lgehcm - remoteafdiron overload?legend : normal orincreased ordecreased t1/ecv ; ? (as yet) not knowndata from the septum of afd patients without heart failuredata currently only in abstract form t1 mapping, ecv and cardiac diseases. summary of t1 values and ecv for different cardiac diseases legend : normal orincreased ordecreased t1/ecv ; ? (as yet) not known data from the septum of afd patients without heart failure data currently only in abstract form for low ecv expansion diseases, biases from blood pool partial volume errors need to be meticulously addressed. nevertheless, even modest ecv changes appear prognostic. in 793 consecutive patients (excluding amyloid and hcm, measuring outside lge areas) followed over 1 year, global ecv predicted short term - mortality (fig. the same group also found (n ~ 1000) higher ecvs in diabetics associated with adverse outcome, including mortality and heart failure hospitalization. 3the ecv in non - scar areas (lge excluded) is associated with all - cause mortality even after relatively short follow - up in all - comers to a cmr service[37 ] the ecv in non - scar areas (lge excluded) is associated with all - cause mortality even after relatively short follow - up in all - comers to a cmr service[37 ] the continuous technical implementation has generated automated parametric ecv maps, now available directly on the scanner, where each pixel carries directly the ecv value improving clinical utility and increasing the possibility to integrate them in clinical protocol (fig. 4a severe aortic stenosis patient with moderate concentric lvh and patchy scar on lge imaging (a). pre - contrast (b) and post - contrast t1 maps (c) and derived ecv map (d) add information : rv insertion point native t1 elevation is seen (b) and there is diffuse extracellular expansion, with an ecv of 32 % a severe aortic stenosis patient with moderate concentric lvh and patchy scar on lge imaging (a). pre - contrast (b) and post - contrast t1 maps (c) and derived ecv map (d) add information : rv insertion point native t1 elevation is seen (b) and there is diffuse extracellular expansion, with an ecv of 32 % t1 mapping is an exciting and novel tool and transition from early development work to standardized methodologies is crucial. differences between vendors, sequences, field strength and methodology generate confusion but also innovation, so the early standardization steps are in the form of consensus statements rather than guidelines and emphazise areas where research is needed more so than approaches not to pursue [40 ]. accordingly, icv represents intact myocardial cellular component proving a way to measure the cell volume. again it is necessary to clarify that there is a bias because, even if icv mainly represent myocytes, it also includes fibroblasts, blood cells, macrophage, etc. icv provides incremental information. in severe as patients ecv has been found to be elevated but interestingly lv hypertrophy regression after valvular replacement at 6 months had no change in the ecv, but the icv fell showing non - invasively that early lvh regression was cellular rather than fibrosis regression. for hf the ability to measure diffuse fibrosis and partition the myocardium into cellular and extracellular compartments is promising. specifically, it may allow to personalise therapeutic approaches and to develop new therapies targeted either to interstitial or intracellular pathways, but which may otherwise fail if early development applies them indiscriminately to an uncharacterised hf cohort. drug development strategies for hf have produced few positive results over the last decade and hf continues to represent an important problem in medicine with considerable impact for health system cost. to ensure success in mortality reduction a better understanding of disease pathways cmr has established itself as the gold standard for non - invasive myocardial tissue characterization and t1 mapping takes the technology a step further, firstly, by measuring key processes in rare diseases (iron, fat, amyloid), and secondly, by measuring diffuse fibrosis, allowing us to dichotomize the myocardium into its cellular and extra - cellular components, providing new frontiers for pathologies understanding and identifying two different therapeutic targets, cells and interstitium, with high potential impact into our understanding of hf.	heart failure (hf) is a major and growing cause of morbidity and mortality. despite initial successes, there have been few recent therapeutic advances. a better understanding of hf pathophysiology is needed with renewed focus on the myocardium itself. a new imaging technique is now available that holds promise. t1 mapping is a cardiovascular magnetic resonance (cmr) technique for non - invasive myocardial tissue characterization. t1 alters with disease. pre - contrast (native) t1 changes with a number of processes such as fibrosis, edema and infiltrations. if a post contrast scan is also done, the extracellular volume fraction (ecv) can be measured, a direct measure of the interstitium and its reciprocal, the cell volume. this dichotomy is fundamental and now measurable promising more targeted therapy and new insights into disease biology.
while aortic valve replacement (avr) is the treatment of choice for several aortic valve disorders ; it is important to recognize some complications post this surgical procedure. most importantly, these include valve dehiscence, conduction abnormalities, thrombosis, infective endocarditis, fistulas, and left ventricular outflow tract (lvot) pseudoaneurysms, among others. current imaging modalities such as echocardiography, computed tomography (ct), and magnetic resonance imaging have allowed us to detect these potential complications during follow - up of postoperative patients. in this case report, we present the case of a patient with three previous surgical bioprosthetic avrs who presented to our institution for an additional surgical opinion. a 45-year - old nigerian female was seen in our emergency department complaining of chest pain. her history was remarkable for having three bioprosthetic avr procedures in the preceding year at another institution, the most recent being 6 months prior to the presentation. the initial indication for avr was aortic regurgitation and her previous valve surgeries were noted to be complicated by endocarditis. her past medical history is remarkable for childhood malarial and typhoid infections ; all completely treated. she complained of dyspnea on exertion, chest discomfort, orthopnea, and the need for supplemental oxygen at home ; therefore, she requested a second opinion regarding any remaining surgical options to treat her disabling symptoms. during her hospital course, an echocardiogram was obtained that demonstrated the sewing ring to be positioned higher than it normally is above the sinuses of valsalva [figure 1, videos 3 and 4 ]. a small mass was also noted on the posterior portion of the sewing ring with a fibrinous strand going to the base of the native aortic annulus [figure 1 ]. a mild perivalvular leak was also noted [figure 2 and video 5 ]. more interestingly, there appeared to be a 2 cm perforation in the lvot and a large clear space in the lateral pericardial wall consistent with a pseudoaneurysm [figure 3 ]. contrast was used to opacify the chambers and the pseudoaneurysm is clearly seen [figure 4, videos 1, 2 and 6 ]. rheumatology, allergy and immunology, as well as infectious diseases services were consulted to assist with management of this case and determine if there was any underlying process contributing to her bioprosthetic avr failure and development of the postsurgical pseudoaneurysm. they were unable to demonstrate any underlying systemic process as contributing to her cardiac disease. parasternal long view showing the sewing ring to be positioned higher than it normally is above the sinuses of valsalva (arrow) and a small mass was also noted on the posterior portion of the sewing ring with a fibrinous strand going to the base of the native aortic annulus. lv = left ventricle, la = left atrium parasternal long view showing mild perivalvular leak apical 4-chamber showing 2 cm perforation in the left ventricular outflow tract and a large clear space in the lateral pericardial wall consistent with a pseudoaneurysm. rv = right ventricle, psa = pseudoaneurysm apical 4-chamber with contrast demonstrating the pseudoaneurysm clearly the high - velocity blood flow in the lvot enters the tear formed by the suture and a pseudoaneurysm develops. barbetseas and colleagues used echocardiography for evaluation of aortic aneurysms after avr. even though transthoracic echocardiography clearly documented the presence of the pseudoaneurysm that formed postoperatively in our case ; cardiac ct was ordered for confirmatory purposes to reach a final therapeutic decision. in our patient 's case,	we present a case of a pseudoaneurysm arising from the left ventricular outflow tract / aortic root as a complication of aortic valve surgery. a 45-year - old nigerian female presented to our institution 's emergency department with chest discomfort. she had three bioprosthetic aortic valve replacements in the preceding year at an outside institution for aortic regurgitation and wanted a second opinion on remaining surgical options. the learning points relevant to this case are as follows : (1) recognizing potential complications postmultiple valve surgeries, (2) screening patients for chronic infections and rheumatologic conditions that can contribute to failed valve surgeries.
the most common organisms causing mucormycosis belong to the genera rhizopus, lichtheimia, and mucor. physicians should maintain a high index of suspicion while encountering nonmycobacterial cavitary lesions not responding to antibiotic therapy. a 44-year - old man presented to us with the chief complaints of on and off fever, cough with expectoration, dyspnea, new york heart association grade 2 and two episodes of hemoptysis since 2 months. on asking leading questions, he admitted of having a right sided pleuritic chest pain. there was no history of diabetes mellitus, hypertension, or any other chronic illness. physical examination revealed temperature of 101.0f, pulse 104/min, respiratory rate 28 cycles / min, with pallor and grade 1 clubbing. respiratory system examination revealed cavernous bronchial breathing, crackles, and egophony at the right lung base. chest radiograph showed nonhomogeneous opacity of the right lower zone with a large cavity in lower and mid zone [figure 1 ]. high resolution computed tomography thorax revealed a well - defined thick walled lesion with air fluid level and multiple air foci within it in the apical and posterior segment of the right lower lobe and lateral segment of the right middle lobe. posteriorly, the lesion abutted the posterior chest wall and anteriorly, it extended to the hila and was surrounded by ground glass opacity [figure 2 ]. chest x - ray posterior - anterior view showing a non - homogeneous opacity of the right lower zone with large cavity high resolution computed tomography thorax showing a well - defined thick walled lesion with air fluid level and multiple air foci within it in the apical and posterior segment of right lower lobe and lateral segment of right middle lobe lower and mid zone histopathologic examination revealed evidence of mycotic infection in the segmental bronchioles with peribronchial destruction at places infiltrating into the lung connective tissue [figure 3 ]. the mycotic elements were broad, branching aseptate hyphae belonging to zygomycetes family suggestive of mucormycosis. fungal culture of the exudate inoculated on to sabourad 's dextrose agar (sda) media yielded white cottony colonies with no reverse pigmentation in 7 days. treatment was started with amphotericin b deoxycholate 1.5 mg / kg / day for 6 weeks. h and e stained slide (40) showing pleomorphic, irregular, broad, branching aseptate hyphae with characteristic budding at right angles suggestive of mucormycosis mucormycosis agents being angioinvasive have a potential to cause infarction and necrosis of the affected tissues. diagnosis of pulmonary mucormycosis can be challenging because of its rarity. on chest imaging, pulmonary mucormycosis may present with focal consolidation, lung masses, pleural effusions, cavities, or multiple nodules. effective management requires a 3-pronged combination of medical and surgical modalities along with the correction of the predisposing underlying condition(s). amphotericin b or its newer lipid formulation liposomal amphotericin - b along with the extensive surgical debridement to remove the necrotic tissue, remains the mainstay of therapy.	cavitary lung lesions have a specific array of differential diagnosis. among rare causes is mucormycosis that should not be overlooked. a high index of suspicion is necessary for a correct diagnosis and aggressive management. it usually occurs in immunosupressed patients. it is a life - threatening, rapidly progressive, and angioinvasive fungal infection. we present a case of pulmonary mucormycosis presenting as a cavity in an immunocompetent middle aged male.
innate immune responses provide four anatomical, physiological, phagocytic, and inflammatory barriers. among these barriers, macrophages produce proinflammatory cytokines and other signaling molecules such as interleukins (ils), tumor necrosis factor (tnf)-, and prostaglandins (pgs), all of which are essential for the initial inflammatory response. thus, the initial activation of macrophages is a significant event in inflammatory processes. to activate the inflammatory response, macrophage surface receptors such as toll - like receptors (tlrs) interact with their cognate ligands. activated macrophages consequently upregulate intracellular signaling pathways to activate the nuclear factor (nf)-b pathway and the activator protein- (ap-) 1 pathway, leading to the expression of inflammatory genes [46 ]. to cure inflammatory diseases, effective regulation of the inflammatory response therefore, targeted inhibition of intracellular inflammatory - related signaling pathways has been considered to be a promising therapeutic strategy for treating various immunological diseases such as cancer, septic shock, diabetes, and atherosclerosis [711 ] biological hydrogels consisting of self - assembling peptide nanofibers have been shown to have a broad range of potential applications [1215 ]. self - assembling peptides consist of short peptides with 8 to 16 residues that are 2.5 to 5 nm in length, depending on conditions such as ph and ionic strength. these structural features have made self - assembling systems an attractive option for tissue culture - based and tissue - based research into the mechanisms that control various cellular processes. although recent studies have indicated that self - assembling peptides have potential applications in drug delivery as a nanomedicine platform, the molecular mechanisms underlying these applications are not yet fully understood. in our previous study, we determined the immune - regulatory functions of a self - assembling peptide, k5, radaradaradarada - kkkkk. in the present study, we investigated another peptide named s5, radaradaradarada - sssss, with 5 serine resides, which was developed to investigate polarity effects on self - assembling property, plasma protein interactions, and platelet activation. while the k5 peptide exhibits lysine residue - driven net positive charge at a ph of 7.4, disadvantageous in terms of membrane permeability, s5 peptide only maintains free hydroxyl group. considering chemical property of s5, it is hypothesized that the penetration of s5 into cytoplasmic compartment in a cell might be better than k5. in this study, we aimed to demonstrate the immunopharmacological improvement of the s5 peptide in cellular and molecular inflammatory responses. tetrazole (3 - 4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (mtt), prednisolone and indomethacin, and lipopolysaccharide (lps, e. coli 0111:b4) were purchased from sigma chemical co. (st. louis, mo, usa). enzyme immunoassay (eia) kits and enzyme - linked immunosorbent assay (elisa) kits for determining the levels of pge2 and tnf- were purchased from thermo scientific (nyse : tmo) and amersham (little chalfont, buckinghamshire, uk). fetal bovine serum (fbs), rpmi1640 and dmem media were purchased from thermo scientific (nyse : tmo). raw264.7 and hek293 cells were obtained from atcc (rockville, md, usa). phospho- and total protein antibodies against c - jun, extracellular signal - related kinase (erk), c - jun n - terminal kinase (jnk), p38, map kinase kinase 3/6 (mkk3/6), tgf- activated kinase 1 (tak1), lamin a / c, and -actin were purchased from cell signaling (beverly, ma, usa) and santa cruz (santa cruz, ca, usa). male icr mice (6 weeks old, 17 to 21 g) were purchased from daehan biolink (chungbuk, korea) and housed in plastic cages under conventional conditions. water and food pellets (samyang, daejeon, korea) were supplied ad libitum. all studies were carried out in accordance with the guidelines established by the institutional animal care and use committee of sungkyunkwan university (approval i d : skkubbi 12 - 6 - 2). bone marrow- (bm-) derived macrophages were obtained from icr male mice (6 weeks old, 17 to 21 g) by severing the bone of the femoral region. bone marrow - derived macrophages were flushed out into petri dishes with pbs. after harvesting bone marrow cells by centrifugation at 1,200 rpm for 5 minutes at 4c finally, bone marrow - derived macrophages (1 10 cells / ml) were seeded in 100 mm tissue culture dishes and grown for 4 h at 37c in a humidified atmosphere with 5% co2. primary cells (bone marrow - derived macrophages) and cell lines (raw264.7 and hek293 cells) were cultured with rpmi1640 medium supplemented with 10% heat - inactivated fbs, glutamine, penicillin, and streptomycin at 37c under 5% co2. raw264.7 cells and bone marrow - derived macrophages (1 10 cells / ml) were preincubated for 18 h, after which cells were treated with the s5 peptide (0 to 100 g / ml) or standard compounds (prednisolone and indomethacin) for 30 min and then additionally treated with lps (1 g / ml) for 24 h. production and the release of pge2 and tnf- were determined by eia and elisa kits, as described previously. bone marrow - derived macrophages or raw264.7 cells (1 10 cells / ml) were treated with s5 peptide (0 to 100 g / ml) for 24 h. cytotoxic effect of s5 peptide was evaluated by conventional mtt assay as described previously [21, 22 ]. to evaluate inflammatory gene mrna expression levels, raw264.7 cells pretreated with s5 peptide (0 to 100 g / ml) for 30 min were incubated with lps (1 g / ml) for 6 h. total rna from the cells was then isolated with trizol reagent (gibco brl) according to the manufacturer 's instructions and stored at 70c until use. the levels of il-1, tnf-, and cox-2 mrna expression levels were quantified by real - time reverse transcriptase - polymerase chain reaction (rt - pcr) with sybr premix ex taq according to the manufacturer 's instructions (takara, japan). reactions were run in a real - time thermal cycler (bio - rad, usa), as reported previously [23, 24 ]. results are expressed as relative ratios of gene expression normalized to the internal control gapdh. primers were ordered from bioneer (seoul, korea) and their sequences are listed in table 1. preparation of total lysates and nuclear extracts from lps - treated raw264.7 cells pretreated with s5 peptide was used, a method previously published. immunoblotting analysis of phosphorylated and total protein [c - jun, lamin a / c, mapk (erk, p38, and jnk), mkk3/6, mek1/2, mkk4/7, mkk4, tak1, lamin a / c, and -actin ] levels was performed, according to published methods. for immunoprecipitations, cell lysates were generated from raw264.7 cells (1 10 cells / ml) that had been treated either with or without lps (1 g / ml) for 90 min. lysates containing equal amounts of protein (500 g) were precleared with 10 l protein a - coupled sepharose beads (50% v / v) (amersham, uk) for 1 h at 4c. immune complexes were captured with 10 l protein a - coupled sepharose beads (50% v / v) by rotation for 3 h at 4c. data (figures 1 and 2) are expressed as means standard deviations (sds) and were calculated from one of two independent experiments. the data shown in this paper are representative of three independent experiments, each of which yielded similar results. for statistical comparisons, results were analyzed using analysis of variance / scheffe 's post hoc test and the kruskal - wallis / mann - whitney tests. we previously reported that the self - assembling k5 peptide, applied as 3d scaffolds for tissue engineering or drug delivery [18, 27 ], downregulates the macrophage - mediated inflammatory responses. the s5 peptide is part of a family of self - assembling peptides that includes the k5 peptide. however, in contrast to the k5 peptide, the s5 peptide lacks positive charge in this backbone. since these two peptides exhibit reasonably similar structures with only a minor difference, we hypothesized that the s5 peptide would also exert anti - inflammatory effects. similar to the pharmacological profiles of k5 peptide, the s5 peptide appears to be a promising therapeutic molecule for dampening the inflammatory response. for instance, the s5 peptide decreased the production of pge2 (figure 1(a)) and tnf- (figure 1(b)) in both malignant raw264.7 cells and in bm - derived lps - activated macrophages in a dose - dependent manner as seen in the cases of standard compounds prednisolone and indomethacin (figure 1(c)) ; importantly, no cytotoxicity was observed in these cells (figure 1(d)). these data raised a possibility that s5 peptide can be a peptide drug with anti - inflammatory property as previously suggested with synthetic tip - like peptide ap318, peptides from bovine -casein, cathelicidin, and n15p polypeptide [2931 ]. since elucidating the molecular mechanisms of these effects is important for initiation of drug discovery process, we next examined the anti - inflammatory mechanism of the s5 peptide. to examine the effects of the s5 peptide on the inflammatory response on the transcriptional level, the mrna levels of cox-2 (figure 2(a)), tnf- (figure 2(b)), and il-1 (figure 2(c)) were measured by real - time pcr in cells that had been stimulated with lps. these experiments showed that the s5 peptide (100 g / ml) downregulated the expression of cox-2, tnf-, and il-1. to investigate whether the s5 peptide regulates dna promoter activity, a luciferase reporter assay was used that resulted in cell luminescence. the s5 peptide remarkably decreased ap-1-mediated transcriptional activation in response to pma, myd88, or trif ; moreover, this effect was dose - dependent (figures 3(a), 3(b), and 3(c)). activation of the inflammatory response is known to result in nuclear translocation of the ap-1 transcription factor, which results in transcription of ap-1-driven target genes. to examine the nuclear translocation of c - jun in the inflammatory response, we determined the levels of c - jun in the nuclear fractions of lps - treated raw264.7 cells. interestingly, these experiments showed that the s5 peptide prevented the nuclear translocation of c - jun at 60 and 90 min (figure 3(d)). this result implies that the s5 peptide may regulate the ap-1 signaling pathway. to investigate the activation status of upstream signaling molecules in the ap-1 pathway, the phosphorylation of various mapks (erk, p38, and jnk) was analyzed by western blotting. the phosphorylation of p38 and jnk was decreased at 30 and 15 min, while erk phosphorylation was not decreased by the s5 peptide (figure 4(a)). interestingly, the s5 peptide only prevented phosphorylation of mkk3/6, an upstream kinase of p38, whereas the s5 peptide did not prevent the phosphorylation of the upstream molecule jnk, which is downstream of mkk4/7. phosphorylation of tak1, a kinase that is upstream of the mkks, was also decreased by the s5 peptide (figure 4(b)). to determine whether the effects of the s5 peptide were recapitulated in primary cells, peritoneal macrophages were harvested from icr mice and the phosphorylation status of various signaling molecules was investigated by western blotting. this experiment revealed that the s5 peptide decreased the phosphorylation of c - jun, p38, and mkk3/6 in lps - driven signaling (figure 4(c)). moreover, the s5 peptide also dramatically blocked the interaction of phospho - p38 with c - jun and its phosphoform, as revealed by immunoprecipitation and immunoblotting analyses (figure 4(d)). based on these results, we conclude that the s5 peptide is capable of preventing ap-1 signaling events. some of strong anti - inflammatory remedies such as medicinal plant - derived extracts including dryopteris crassirhizoma and archidendron clypearia and their individual components including andrographolide, ginsenosides, curcumol, and lutein are known to suppress ap-1 function in their pharmacological actions [3438 ], suggesting that ap-1 could play a critical role in inflammation - regulatory functions. due to their size and charge, most hydrophobic small chemicals are much assessable to be penetrated into the membrane and display higher possibility to directly interact with cytosolic target enzymes. however, chemical drugs showing effective inhibition property toward important signaling enzymes are faced to have another side effect causing nonspecific toxicity. in this respect, peptide drugs are considered to be favorable in terms of drug development, due to their selectivity. previously, we reported that peptide k5 is able to suppress tnf- production in lps - treated raw264.7 cells up to 48% at 100 g / ml. on the other hand, chemically modified s5 peptide having free oh groups exhibited stronger activity (80% inhibition at 100 g / ml) under the same conditions (figure 1(b)), implying that membrane permeability of peptide s5 could be more improved than k5. nonetheless, the fact that k5 was revealed to block the release of tnf- and pge2 between 50 to 100 g / ml is still raising a possibility that some of peptide receptor such as pept1, oatp2ba, or oarp1b3 [39, 40 ] could contribute to the uptake of peptides k5 and s5 into cytoplasm. the point that s5 peptide exhibits higher anti - inflammatory property under improved membrane permeability seems to impose s5 peptide to be developed as anti - inflammatory peptide drug. indeed, some peptides such as glp and its analogs, extracellular matrix protein - derived peptides, and integrin - binding n - terminal peptides are closed to be developed as antitumorigenic remedy, although the therapeutic use of these peptides is still limited due to high cost, poor stability, and mediocre pharmacokinetics. in cases of the s5 and k5 peptides, these are known to be self - assembling nanopeptides forming a hydrogel applied for drug delivery system and have been shown to be nonimmunogenic and noninvasive in the filling of cavities [15, 18, 43 ]. according to our results, these peptides are found to have anti - inflammatory properties which can give additional benefits when they are used as carrier to deliver immunomodulatory drugs. since the s5 peptide itself suppresses events in the tlr4 signaling pathway, including activation of mapk and ap-1, it may exert a synergetic effect if carrier molecules are nf-b - targeted anti - inflammatory drugs. to sum up these results, here we showed that the s5 peptide dampens various components of the tlr4-mediated inflammatory response, such as the production of pge2 and tnf-. in addition, the s5 peptide reduces ap-1 signaling by preventing the phosphorylation of mkk3/6 and tak1, as summarized in figure 5. since the s5 peptide is a self - assembling peptide that could be used for drug delivery, it is possible that the s5 peptide could be loaded with therapeutics that target ap-1 or other compounds that synergize with inflammatory molecules. future studies will test the efficacy of the s5 peptide as a drug carrier and as an anti - inflammatory agent in an animal model. these experiments have the potential to contribute to the development of an efficacious and novel drug delivery system.	peptide - based therapeutics have received increasing attention in medical research. however, the local delivery of such therapeutics poses unique challenges. self - assembling peptides that use decorated nanofibers are one approach by which these therapeutics may be delivered. we previously found that the self - assembling k5 peptide affects the anti - inflammatory response. the aim of the present study was to investigate another self - assembling peptide, s5. unlike the k5 peptide which has a positive charge, the s5 peptide has a free hydroxyl (-oh) group. we first examined whether the s5 peptide regulates the inflammatory response in primary cells and found that the s5 peptide reduced the production of prostaglandin e2 (pge2) and tumor necrosis factor (tnf)- in lipopolysaccharide- (lps-) treated bone marrow - derived macrophages. moreover, the s5 peptide significantly downregulated cyclooxygenase- (cox-) 2, tnf-, and interleukin- (il-) 1 expression by blocking the nuclear translocation of c - jun. consistent with this finding, the s5 peptide diminished the activation of inflammatory signaling enzymes related to p38. the s5 peptide also inhibited the formation of the p38/c - jun signaling complex in raw264.7 cells. similarly, p38 and mkk3/6 were inhibited by the s5 peptide in lps - activated peritoneal macrophages. taken together, these results strongly suggest that the s5 peptide could exert anti - inflammatory effects by inhibiting the c - jun / p38 signaling pathway.
intestinal pseudo - obstruction is a clinical syndrome that involves bowel obstruction without any mechanical cause.1 it can be either acute or chronic and may occur in the small bowel or the colon. chronic intestinal pseudo - obstruction (cip) usually exhibits a relapsing clinical course and may either be idiopathic or occur due to other systemic disorders. pregnancy can be a precipitating factor of colonic pseudo - obstruction.2 recently, we experienced a case of a woman with intractable colonic pseudo - obstruction that was aggravated after pregnancy. endoscopic decompression could delay surgical treatment until a gestational age of 21 weeks and finally a full - term delivery could be achieved. a 31-year - old woman presented with abdominal pain, distension, and constipation at a fetal gestational age of 17 weeks. the patient 's symptoms aggravated at fetal gestational age of 10 weeks and her last pregnancy was aborted 2 years earlier at another hospital due to severe intestinal obstruction. she had suffered from unexplainable obstructive symptoms 5 years earlier and was diagnosed with cip because of repetitive obstructive symptoms without any visible obstructive lesion observed on abdominopelvic computed tomography (ct), barium enema, or colonoscopy (fig. she was most recently admitted to our hospital 5 months ago because of recurrent obstructive symptoms. because the intravenous administration of neostigmine was not effective, colonoscopic decompression was performed at that time. laboratory examination revealed a white blood cell count of 8,120/mm, a hemoglobin level of 9.9 g / dl, a platelet count of 281,000/mm, a blood sugar level of 99 mg / dl, a blood urea nitrogen level of 12.2 mg / dl, a creatinine level of 1.1 mg / dl, a sodium level of 139 meq / l, a potassium level of 3.8 meq / l, a chloride level of 104 meq / l, a calcium level of 8.7 mg / dl, a phosphorous level of 3.6 mg / dl, and a magnesium level of 1.8 mg / dl. neither radiologic study nor neostigmine administration could be performed because of the risk to the fetus. colonoscopy was performed to provide decompression because the patient 's pain and distension worsened after 5 days of conservative care. the colonoscope was passed just beyond the splenic flexure, at which point the lumen was found to be obstructed by a large fecal bezoar (fig. 2). attempts to break the fecal bezoar with an endoscopic snare (olympus disposable electrosurgical snare sd-210u-10 ; olympus medical systems corp., tokyo, japan) met with limited success. after suctioning the retained gas and contents of the proximal colon, a drainage catheter (enbd-7-liguory, 7 fr, 250 cm ; cook medical inc., winston - salem, nc, usa) was placed through the working channel of the endoscope. the catheter was irrigated periodically with normal saline to prevent obstruction and ensure that the intestinal contents and gas were drained effectively. the patient 's symptoms improved for a few days after decompression but recurred soon thereafter. additional two attempts at endoscopic decompression were made and a new drainage catheter was inserted in each of the attempts until surgery could be performed. subtotal colectomy with endileostomy was performed electively at a fetal gestational age of 21 weeks. ileorectal anastomosis could not be performed due to the enlarged uterus and was postponed until after delivery. the proximal portion from the cecum to the descending colon was dilated up to 16 cm in diameter and a focally narrowed transitional zone was observed around the sigmoid colon (fig. full colonic sections were obtained for histopathological analysis, which revealed no apparent histopathological alteration in the muscularis propria or neural plexuses (fig. however, immunohistochemistry for c - kit (cd 117) revealed fewer interstitial cells of cajal (iccs) in dilated portions of the colon compared to the undilated part (fig. stool passage was normalized after surgery and pregnancy was maintained and resulted in a full - term delivery. pregnancy was one of the most important precipitating factors contributing to cip in this case. elevated progesterone, prostaglandin, and glucagon levels as well as the pressure of the gravid uterus are suggested as factors that exacerbate the pseudo - obstruction experienced by the patient during pregnancy.2 constipation, progressive abdominal pain, and abdominal distension are common symptoms in pregnancy and may delay the diagnosis of pseudo - obstruction. moreover, abdominal radiographs and ct scans, which may be required for evaluation and are typically diagnostic, may be limited in the case of a pregnant woman due to the desire to limit radiation exposure to the fetus.3 fortunately, our patient had already been diagnosed with cip. intravenous administration of neostigmine is recommended in patients who do not show improvement after conservative management. neostigmine may lead to resolution of acute colonic pseudo - obstruction and may also be effective in acute exacerbations of cip.4,5 in this case, the patient 's unresponsiveness to neostigmine 5 months earlier and the possible risks to the fetus deterred the authors from using it again. endoscopic decompression can be another option for treating colonic pseudo - obstruction when neostigmine is not effective or contraindicated.6 efficacy of endoscopic decompression is increased when a cecal tube is inserted at the time of colonoscopy. although the cecum could not be intubated due to a large fecal bezoar in our case, placements of a decompression tube beyond the obstruction site was available. tubes for colorectal decompression include commercial tubes specifically aimed for decompression, tubes for enteroclysis, and nasogastric tubes. however, commercial tubes for colorectal decompression are not currently available in korea. moreover, all the tubes above should be inserted by seldinger technique under fluoroscopic guidance. in contrast, nasobiliary tubes can be easily inserted through the working channel of endoscopy without fluoroscopy. radiation exposure should be avoided since our patient was pregnant.7 although the small diameter of nasobiliary tubes limits effective decompression, periodic irrigation can prevent plugging of the tube and ensure effective drainage. colonoscopy may be relatively safe without large fetal risks during the second trimester with limited data during the other trimesters.8 repetitive colonoscopic decompression was able to relieve the patient 's symptoms until the second trimester of pregnancy when surgery was available. cip can be classified into three major categories based on the underlying pathological abnormality : enteric visceral myopathy, neuropathy, and mesenchymopathy.9 this classification is based on the involvement of smooth muscle cells, the enteric nervous system, and iccs, respectively. choe.10 examined the surgical specimens of patients who received surgery for intractable constipation and found that a substantial number of patients presented with a distinct transitional zone with segmental hypoganglionosis. another study by do.11 suggested a novel classification of hypoganglionosis patients into two groups : type i with a focally narrowed transition zone and type ii without a transition zone. our patient showed dilation of the proximal to mid colon with distinct narrowing around the sigmoid colon. however, pathologic studies of the narrowed segment did not reveal any abnormality in the ganglion cells or the neural plexuses. the only pathologic abnormality were marked reduction of iccs in multifocal areas of the dilated colon. it has been speculated that alterations in the icc network may result in impaired control of peristalsis resulting in cip. however, the diagnostic criteria of mesenchymopathic type of cip is poorly defined with reference to the mean number of iccs and distribution of the iccs. it is also not clear whether the multifocal decrease of iccs in our patient is the primary cause of cip or secondary to continuous colon dilation. in summary, we have reported a case of cip which was aggravated severely by pregnancy. however, in such cases, radiologic studies and administration of neostigmine may be limited due to the associated fetal risks. endoscopic decompression can be performed repetitively with minimal fetal risks until elective surgery can be performed.	chronic intestinal pseudo - obstruction is a rare clinical syndrome which is characterized by intestinal obstruction without occluding lesions in the intestinal lumen and pregnancy is one of the important aggravating factors. here, we report a case of a woman with intractable intestinal pseudo - obstruction that was precipitated by pregnancy. she could not make any stool passage for more than 4 weeks until a fetal gestational age of 17 weeks was reached. however, the patient could be maintained by repetitive colonoscopic decompressions and finally total colectomy could be performed successfully at a fetal gestational age of 21 weeks.
it s the most common solid tumor and is responsible for 15% of all cancer - related deaths in childhood. this tumor accounts for more than 7% of malignancies in patients fewer than 15 years of age. nb tumors from these patients are often characterized by deregulation of many key signaling pathways regulating growth, proliferation, survival, and apoptosis, with concomitant resistance to chemotherapy. the acquisition of multidrug resistance upon treatment with anti - cancer drugs is a common phenomenon for nbs. this is a major reason for the high frequency of fetal outcome of the disease. recently, there are strong epidemiological evidence and laboratory studies that are naturally occurring terpenes may exert cytotoxic effects against nb cells. guaiazulene (1,4-dimethyl-7-isopropylazulene gyz, figure 1)is a bicyclic sesquiterpene derived from different plants, guaiac wood oil, callis intratropica blue and matricaria chamomilla l and has attracted much attention due to its beneficial biological activities. moreover, previous reports indicated that gyz has antioxidant, antifungal, antimicrobial, anti - inflammatory, anti - spasmodic, anti - ulcer, antitumoral activities and relaxant properties [12 - 18 ]. although it has been demonstrated to have interesting biological effects, gyz has been not proven to be cytotoxic, genotoxic and antioxidant / oxidant effects on neuron and nb cell lines. therefore, the aim of the present study was to firstly evaluate the cytotoxic / antiproliferative (3-[4,5 dimetylthiazol -2-yl]-2,5 diphenlytetrazolium bromide [mtt ] assay), cytogenetic (single cell gel electrophoresis [scge ] assay)and oxidative effects (total antioxidant capacity [tac ] and total oxidative stress [tos ] analysis)of gyz on neuron and nb cell cultures for its possible use in the complementary and alternative medicine practices. chemical structure of guaiazulene gyz (cas 489 - 84 - 9, c15h18), dulbecco modified eagles medium, sodium phosphate (nah2po4), potassium phosphate monobasic (kh2po4), ethylenediaminetetraacetic acid (edta), dimethylsulfoxide (dmso), triton - x-100, tris, low melting point agarose, normal melting point agarose, ethidium bromide were purchased from sigma - aldrich (steinheim, germany). briefly, a total of nine new - born sprague dawley rats were used in the study. the rats were decapitated by making a cervical fracture in the cervical midline, and the cerebral cortex was dissected and removed. the cerebral cortex was placed into 5 ml of hank s balanced salt solution (hbss, sigma - aldrich, steinheim, germany), which had already been placed in a sterile petri dish and macromerotomy was performed with two lancets. this composition was pulled into a syringe and treated at 37c for 25 - 30 min as 5 ml hbss plus 2 ml trypsin - edta (0.25% trypsin- 0.02% edta)and chemical decomposition was achieved. 8 l of dnase type 1 (120 u / ml), was added to this solution, treated for 1 - 2 min, and centrifuged at 800 rpm for 3 min. after having thrown away the supernatant, 31.5 ml of neurobasal medium (life technologies, inc.)and 3.5 ml fetal calf serum (sigma - aldrich, steinheim, germany)were added to the residue. the single cell which was obtained after physical and chemical decomposition was divided into 3.5 ml samples in each of 10 flasks coated with poly - d - lysine formerly dissolved in phosphate buffer solution. the flasks were then changed with a fresh medium of half of their volumes every 3 days until the cells were branched and had reached a certain maturity. further in vitro experiments were performed 8 days later. this study was conducted at the medical experimental research centre in ataturk university (erzurum, turkey). we employed a cell line, n2a - nb, used widely as a model for brain cancer. the rat brain nb cell line n2a was obtained from turkey fmd institute, ankara, turkey. gyz was applied into cultures at concentrations of 10, 25, 50, 75, 100, 150, 200 and 400 mg / l for 24 h. the concentrations were selected according to the work of si.. the cells were seeded in 96-well plastic plates at a density of 1104 cells / well and incubated in a humidified atmosphere of 5% co2 at 37c for 24 h. cell viability assay was performed using the mtt cell proliferation kit (cayman chemical company, usa). pure water was added in the control group. at the end of the experiment, the neurons, and n2a - nb cells were incubated with 20 l of mtt for 30 min at 37c. after washing the blue formazan was extracted from cells with isopropanol / formic acid (955)and was photometrically determined at 570 nm. the automated tac and tos assays were carried out by commercially available kits (rel assay diagnostics, turkey)on cell cultures of gyz - treated cultures for 24 h. after the application of coverslips, the slides were allowed to gel at 4c for 30 - 60 min. the coverslip was removed, and the slide was immersed in cell lysis solution (2.5 m nacl, 0.1 m na2-edta, 1% na - sarcosinate, 10 mm tris - hcl (ph 10.0), 10% dmso, and 1% triton x-100)for 1 h. and refrigerated overnight followed by alkali treatment (1 mm na2-edta and 0.3 m naoh, ph > 12.0), electrophoresis (at 1.6 v cm1 for 20 min, 300 ma)and neutralization (0.4 m tris, ph 7.5). the dried slides were then stained using ethidium bromide (20 lg / ml)after appropriate fixing for 10 min. dna damage analysis was performed at a magnification of 100 using a fluorescence microscope (nikon eclips e6600, japan)after coding the slides by one observer (togar b.). a total damage score for each slide was derived by multiplying the number of cells assigned to each grade of damage by the numeric value of the grade and summing over all grades (giving a maximum possible score of 400, corresponding to 100 cells at grade 4). statistical analysis was performed using spss software (version 18.0, spss, chicago, il, usa). gyz (cas 489 - 84 - 9, c15h18), dulbecco modified eagles medium, sodium phosphate (nah2po4), potassium phosphate monobasic (kh2po4), ethylenediaminetetraacetic acid (edta), dimethylsulfoxide (dmso), triton - x-100, tris, low melting point agarose, normal melting point agarose, ethidium bromide were purchased from sigma - aldrich (steinheim, germany). briefly, a total of nine new - born sprague dawley rats were used in the study. the rats were decapitated by making a cervical fracture in the cervical midline, and the cerebral cortex was dissected and removed. the cerebral cortex was placed into 5 ml of hank s balanced salt solution (hbss, sigma - aldrich, steinheim, germany), which had already been placed in a sterile petri dish and macromerotomy was performed with two lancets. this composition was pulled into a syringe and treated at 37c for 25 - 30 min as 5 ml hbss plus 2 ml trypsin - edta (0.25% trypsin- 0.02% edta)and chemical decomposition was achieved. 8 l of dnase type 1 (120 u / ml), was added to this solution, treated for 1 - 2 min, and centrifuged at 800 rpm for 3 min. after having thrown away the supernatant, 31.5 ml of neurobasal medium (life technologies, inc.)and 3.5 ml fetal calf serum (sigma - aldrich, steinheim, germany)were added to the residue. the single cell which was obtained after physical and chemical decomposition was divided into 3.5 ml samples in each of 10 flasks coated with poly - d - lysine formerly dissolved in phosphate buffer solution. the flasks were then changed with a fresh medium of half of their volumes every 3 days until the cells were branched and had reached a certain maturity. further in vitro experiments were performed 8 days later. this study was conducted at the medical experimental research centre in ataturk university (erzurum, turkey). we employed a cell line, n2a - nb, used widely as a model for brain cancer. the rat brain nb cell line n2a was obtained from turkey fmd institute, ankara, turkey. gyz was applied into cultures at concentrations of 10, 25, 50, 75, 100, 150, 200 and 400 mg / l for 24 h. the concentrations were selected according to the work of si.. the cells were seeded in 96-well plastic plates at a density of 1104 cells / well and incubated in a humidified atmosphere of 5% co2 at 37c for 24 h. cell viability assay was performed using the mtt cell proliferation kit (cayman chemical company, usa). pure water was added in the control group. at the end of the experiment, the neurons, and n2a - nb cells were incubated with 20 l of mtt for 30 min at 37c. after washing the blue formazan was extracted from cells with isopropanol / formic acid (955)and was photometrically determined at 570 nm. the automated tac and tos assays were carried out by commercially available kits (rel assay diagnostics, turkey)on cell cultures of gyz - treated cultures for 24 h. after the application of coverslips, the slides were allowed to gel at 4c for 30 - 60 min. the coverslip was removed, and the slide was immersed in cell lysis solution (2.5 m nacl, 0.1 m na2-edta, 1% na - sarcosinate, 10 mm tris - hcl (ph 10.0), 10% dmso, and 1% triton x-100)for 1 h. and refrigerated overnight followed by alkali treatment (1 mm na2-edta and 0.3 m naoh, ph > 12.0), electrophoresis (at 1.6 v cm1 for 20 min, 300 ma)and neutralization (0.4 m tris, ph 7.5). the dried slides were then stained using ethidium bromide (20 lg / ml)after appropriate fixing for 10 min. dna damage analysis was performed at a magnification of 100 using a fluorescence microscope (nikon eclips e6600, japan)after coding the slides by one observer (togar b.). a total damage score for each slide was derived by multiplying the number of cells assigned to each grade of damage by the numeric value of the grade and summing over all grades (giving a maximum possible score of 400, corresponding to 100 cells at grade 4). statistical analysis was performed using spss software (version 18.0, spss, chicago, il, usa). for statistical analysis of obtained data duncan mtt assay, a colorimetric method for determining the number of viable cells in proliferation, was used to examine the inhibitory activities of gyz on cell proliferation. cell viability measured by mtt test after 24 h was significantly decreased in neuron, and n2a - nb cells tested at therapeutically relevant gyz concentrations up to 150 g / ml [figure 2 ]. compared with control, p 0.05 the scoring criteria for determining damage levels in cultured neurons (a) class 0 (undamaged) ; (b) class 1 (slightly damaged) ; (c) class 3 (damaged) ; (d) class 4 (highly damaged) ; (e) class 5 (very highly damaged) ; (f) class 6 (extremely damaged) this paper describes a comprehensive in vitro cytotoxicity, genotoxicity and antioxidant / oxidant capacity assessments of gyz on rat neuron and n2a - nb cells for the first time. mtt assay, based upon the ability of living cells to reduce mtt into formazan, was used to measure the cytotoxic effect of gyz on neuron and n2a - nb cells. the results clearly demonstrate that high concentrations of gyz induced significant cytotoxic effect on the cultured neurons and n2a - nb cell lines. these results conducted to previous studies investigated the cytotoxic effect of gyz and azulene derivate toward gingival fibroblast, pulp cell, periodontal ligament fibroblast and human tumor cell lines including submandibular gland carcinoma, oral squamous cell carcinoma (hsc-2, hsc-3), promyelocytic leukemia (hl-60. our findings are also in agreement with the results that have reported that zingiberene (a monocyclic sesquiterpene)exhibited strong antiproliferative effect against n2a - nb cell line by mtt assay. in addition, turkez. demonstrated that the copaene (a tricyclic sesquiterpene), showed cytotoxic effect in n2a - nb cells. oxidative stress is likely to be the common triggers of molecular events underlying its antiproliferative effects. the results of our study indicate that the cytotoxic activity is related to the state of pro - oxidation of gyz. in our study, the antioxidant / oxidant effects of gyz were assessed in this study by the means of tac and tos assays. the high concentrations of gyz caused significant increases (p < 0.05)of tos levels in both cells without changing the tac levels. in contrast to our findings, the previous studies showed that gyz has been found to inhibit rat hepatic microsomal membrane peroxidation in vitro. similarly, the in vitro and in vivo effect of gyz were investigated on rat hepatic cytochrome p450 (cyp)and reported that gyz inhibited cyp1a2 activity. furthermore, vinholes. reported that gyz showed higher scavenger capacity against dpph in vitro caco-2 cell models. our findings indicate gyz is neither genotoxic nor mutagenic on healthy neurons and n2a - nb cells since the observed mean values of the total scores of cells showing dna damage was not found significantly different from the control values on both cells. in vitro or in vivo genotoxicity of several sesquiterpenes but therefore, we discussed its genotoxic potential in comparison with other sesquiterpenes. in similar to our findings, turkez. reported that the alpha - copaene did not induce genotoxicity in cultured neuron cell lines. in addition, zingiberene did not induce genotoxic damage in cultured neuron and n2a - nb cells. furthermore, in our recently published paper, using the scge assay, we have demonstrated that tricyclic sesquiterpene a - copaene has neither genotoxic nor mutagenic effect neuron and n2a - nb cells. in contrast to the findings, aquino. demonstrated that artesunate (a sesquiterpene lactone)induced significant dna damage in liver cells and high doses of artesunate caused an increase in the mean number of micronucleated polychromatic erythrocytes.. reported that gossypol showed genotoxic effect in cultured mouse bone marrow cells (as shown by micronuclei index), and human lymphocyte cells (revealed by sister chromatid exchange index). these divergent results suggest the relevance of the chemical structure in the biological effect of sesquiterpenes and indicate as well the importance of using various test models to reach a valid conclusion. in conclusion, our in vitro studies suggest that high concentrations of gyz could be cytotoxic on both cells. the efficacy of anti - cancer chemotherapy is limited by the cytotoxic effect on healthy neuron cells because of a lack of selectivity of gyz and poor uptake of the therapeutics by n2a - nb cells.	aim : neuroblastoma (nb)cells are often used in cancer researches such as glioblastoma cells since they have the potential of high mitotic activity, nuclear pleomorphism, and tumor necrosis. guaiazulene (gyz 1,4-dimethyl-7-isopropylazulene)is present in several essential oils of medicinal and aromatic plants. many studies have reported the cytotoxic effect of gyz ; however, there are no studies that compare such effects between cancer cell lines and normal human cells after treatment with gyz.materials and methods : in this study, we aimed to describe in vitro antiproliferative and/or cytotoxic properties (by 3-[4,5 dimetylthiazol -2-yl]-2,5 diphenlytetrazolium bromide [mtt ] test), oxidative effects (by total antioxidant capacity [tac ] and total oxidative stress [tos ] analysis)and genotoxic damage potentials (by single cell gel electrophoresis)of gyz.result:the results indicated that gyz have anti - proliferative activity suppressing the proliferation of neuron and n2a - nb cells at high doses. in addition, gyz treatments at higher doses led to decreases of tac levels and increases of tos levels in neuron and n2a - nb cells. on the other hand, the mean values of the total scores of cells showing dna damage were not found different from the control values.conclusion:from this study, it is observed that gyz has in vitro cytotoxic activity against neuron and n2a - nb cells.
, it may be fatal in there is injury caused to the cardiac cavity, an intercostal artery, pulmonary vessels, or intraabdominal organs 2, 3. in this situation, invasive management such as emergency surgery and transcatheter arterial embolization (tae) may be required 4, 5, 6. however, if there is no severe adverse event immediately after injury of vital organs by the tube insertion, emergency treatment may not be required 7. here, we describe successful noninvasive management for iatrogenic penetrating splenic injury caused by chest tube insertion. a 61yearold japanese male visited the internal medicine department complaining of a tenday episode of fatigue and left chest pain. he had a high fever (body temperature, 40.0c), but was lucid with stable vital signs (heart rate, 96 beats / min ; blood pressure, 119/70 mmhg). blood examination showed an elevated inflammatory response (white blood cell, 12,350 cells/l ; creactive protein, 35.1 mg / dl). chest xray and computed tomography (ct) scan showed an accumulation of a large amount of fluid in the left thoracic cavity. a chest tube was immediately inserted, and a further 800 ml of purulent pleural effusion was drained. additionally, he was administered antibiotics. on hospital day 7, the chest tube was removed as the amount of drainage had decreased. on hospital day 13, he developed exacerbation of empyema and the chest tube was inserted again. under local anesthesia, a 20french trocar tube was inserted through the 9th left intercostal space at the posterior axillary line after the location of the empyema cavity was confirmed by ultrasonography. it was gathered that fluid in the empyema cavity was too sticky to be drained. the patient was subsequently transferred to our department due to the persistent empyema despite drainage and antibiotics, and videoassisted thoracoscopic decortications for left empyema were performed on hospital day 17. thoracoscopic observation revealed that the chest tube was not in the thoracic cavity and was therefore left intact during operation. after the operation, ct revealed that the chest tube was malpositioned into the abdominal cavity as it had penetrated through the spleen (fig. his vital signs were stable (heart rate, 89 beats / min ; blood pressure, 99/63 mmhg ; body temperature, 36.2c), and there was no drop in his hemoglobin level. the chest tube was malpositioned into the abdominal cavity as it had penetrated through the spleen. there were no severe adverse events such as massive bleeding immediately after accidental insertion of the tube into the spleen. a substantial time had elapsed between the accidental insertion of the tube and the diagnosis of tube malpositioning. furthermore, his condition was stable with no evidence of bleeding at the time of diagnosis of iatrogenic splenic injury by ct. a treatment plan was developed to remove the malpositioned tube penetrating through the spleen 2 weeks after insertion. the treatment for empyema was continued with antibiotics and drainage, while abdominal findings were examined and the drainage fluid from the malpositioned tube was checked every day. on hospital day 27 (14 days after insertion of the malpositioned tube), contrast study through the malpositioned tube showed that only a tube track was visualized without spreading of the contrast into the abdominal cavity, suggesting that formation of a fistula around the tube had occurred (fig. 2). as there was a potential of bleeding in the fistula after removal, a radiologist was prepared and ready to perform tae if severe bleeding occurred. the malpositioned tube was successfully removed through a slow, stepwise withdrawal with careful attention paid to bleeding. 3). the patient 's empyema was cured, and he was discharged on hospital day 34. only the tube track was visualized, without spreading of the contrast into the abdominal cavity. we provided a sufficient explanation and an apology concerning iatrogenic splenic injury caused by chest tube insertion for a patient and family. if splenic injury unfortunately occurs as a complication after chest tube insertion, it often develops into a critical situation such as severe bleeding and shock and requires emergency treatment. in emergency surgery for iatrogenic splenic injury, attempts to preserve the spleen must be made because of the risk of overwhelming postsplenectomy infection syndrome 8. successful hemostasis with splenic preservation by some materials, such as fibrin glue, argon beam coagulation, and absorbable mesh wrapping, has been reported 9, 10, 11. angiographic embolization of splenic bleeding has been reported as a noninvasive emergency management for iatrogenic splenic injury 12. if there is no severe adverse event immediately after injury of spleen by the tube insertion, emergency treatment may not be required. there have been two reported methods of conservative treatment for iatrogenic penetrating splenic injury 13, 14, 15, 16. in one method, thrombin hemostatic sealant and an absorbable gelatincompressed sponge along the transsplenic tube tract 13, 14. in the second method that was the most noninvasive management, the penetrating tube was removed about 2 weeks after the insertion without any treatment 15, 16. our case is the first report in noninvasive management with delayed removal of the tube for iatrogenic splenic injury after chest tube insertion. noninvasive treatments require a long hospital stay but provide the advantage of a less invasive treatment for patients who unfortunately suffer an iatrogenic injury. in the present case, we chose a noninvasive management with delayed removal of the malpositioned tube. first, the hemorrhage from the damaged spleen had to be restrained by compression of the transsplenic track of the tube. as the tube had only a few lateral holes near the tip, these lateral holes were located outside of the spleen and consequently no bleeding from the spleen occurred. however, there was a potential of severe bleeding from the spleen if the tube was removed too early. therefore, an attempt was made to restrain the hemorrhage through compression of the transsplenic track of the malpositioned tube for an extended duration. there was a risk of intraabdominal bleeding from the spleen even if the tube was removed after compression for an extended duration. if a fistula was formed around the tube, removal of the tube might result in bleeding in the fistula, but without intraabdominal bleeding. a time of 2 weeks was estimated for granulation and fistula formation around the malpositioned tube. in the present case, a radiologist was prepared and ready to perform tae during the delayed removal of the malpositioned tube. in conservative management, it is important to make preparations to control for any unexpected bleeding. it should be kept in mind that conservative management may fail. to prevent this serious complication on chest tube insertion, the most important thing is to use ultrasonography to demonstrate a good site for insertion with the patient in the same position as insertion. in the present case, ultrasonography was used prior to chest tube insertion. however, the 9th left intercostal space was very low for chest tube insertion, so it was inferred that the internal medical doctor who inserted chest tube misidentified a spleen as the empyema cavity and did not make a count of ribs. ultrasonography to demonstrate a good site for insertion prior to chest tube insertion must be performed or witnessed by a clinician who has familiarity with positional relationship between ribs and thoracic cavity. we report a case of iatrogenic penetrating splenic injury that was successfully treated with noninvasive management and subsequent removal of the malpositioned tube 2 weeks after insertion. if a patient who unfortunately suffers an iatrogenic injury is hemodynamically stable, noninvasive management with delayed removal of the malpositioned tube may be considered. ko, rh, rc, mm, ss, ys, tl and ns treated the patient. rh, rc, mm, ss, ys, tl, ns, kk and ym helped to draft the manuscript.	key clinical messagesplenic injury is one of the most critical complications of chest tube insertion and often requires invasive emergency management. however, noninvasive management such as delayed removal of the malpositioned tube may be considered for a stable patient without severe adverse event.
tracheal intubation with the aid of a rigid laryngoscope, although a gold standard in securing a definitive airway, triggers adverse haemodynamic stress response. in instances when the procedure or the patient need not be subjected to endotracheal intubation, which is an invasive technique, the use of supraglottic airway devices is a superior alternative. the use of supraglottic airway device has also proven to be lifesaving in the management of airway crisis. since the introduction of laryngeal mask airways, an array of supraglottic airway devices have been designed and some of these devices have been modified to be used as conduits for endotracheal intubation. the air - q intubating laryngeal airway (ila, cookgas llc, mercury medical, clearwater, fl, usa) was introduced by daniel cook in 2005 as an aid for airway maintenance and as a conduit for tracheal intubation during general anaesthesia. at present, the air - q ila is available in 7 sizes (0.5, 1, 1.5, 2, 2.5, 3.5 and 4.5) in both disposable as well as the reusable form. the aim of this study was to evaluate the efficacy of air - q ila with respect to ease of insertion, characteristics of ventilation, intubating conditions, haemodynamic response to endotracheal intubation and identifying any airway morbidity subsequent to its use. a prospective observational study of new supraglottic airway device, air - q ila was undertaken in our medical college hospital. after obtaining institutional ethics committee approval, along with informed consent, 60 patients of either sex presenting for routine elective surgery under general anaesthesia were randomly selected. inclusion criteria consisted of patients belonging to american society of anaesthesiologists physical status i and ii, weighing 50 - 100 kg in the age group of 18 - 70 years with mallampatti airway classification class i and class ii. exclusion criteria included subjects with unknown nil per oral status, patients posted for emergency surgery, pregnant females, patients with pathology of oropharynx and larynx and patients with pre - existing comorbid conditions such as endocrine, cardiac and hypertensive disorders. a detailed clinical assessment of the patient including that of the airway was done the previous day. ranitidine 150 mg the night before the proposed surgery. on arrival in the operating theatre, a multi - channel monitor was connected to record electrocardiography, non - invasive blood pressure, capnograph and pulse oximetry. patients were positioned supine with a pillow under the head. after securing intravenous (iv) cannula, ondansetron 4 mg, injection glycopyrrolate 0.2 mg, injection midazolam 0.02 mg / kg, injection fentanyl 2 g / kg administered iv. the appropriate size of the air - q was selected for each patient, size 3.5 for patients weighing 50 - 70 kg and size 4.5 for 70 - 100 kg. the ila was prepared by completely deflating the cuff and application of 2% lignocaine jelly on the posterior surface of the mask bowl. size 7.0 endotracheal tube for air - q 3.5 and size 8.0 endotracheal tube for air - q sized 4.5 was selected and was pre - lubricated with 2% lignocaine jelly before induction of general anaesthesia. all patients were pre - oxygenated for 3 min with 100% oxygen using a fresh gas flow of 8 l / min using a conventional facemask and bain circuit. general anaesthesia was induced with injection propofol 2 mg / kg iv and muscle relaxant injection succinylcholine 1.5 mg / kg iv was administered. after achieving an adequate depth of anaesthesia and muscle relaxation, patient 's mouth was opened and the tongue displaced using a disposable sterile wooden tongue depressor to facilitate the passage of the air - q. air - q ila was introduced with a gentle inward and downward pressure using the curvature of the device as a guide till a fixed resistance to further advancement was felt. the cuff was inflated with air as per manufacturer 's recommendation, 18 ml for size 3.5 and 25 ml for size 4.5. the proximal connector of the air - q ila was connected to etco2 probe along with the breathing circuit. initiating positive pressure ventilation, proper insertion of device was confirmed by observing bilateral chest rise along with audible breath sounds on auscultation and capnographic trace on the monitor. the vital parameters (pulse rate, blood pressure, peripheral oxygen saturation [spo2 ]) were recorded after successful insertion of the air - q ila. the pre - lubricated appropriate size endotracheal tube was then advanced through the air - q ila blindly to intubate the trachea. the endotracheal tube was then connected to etco2 probe along with the breathing circuit and placement of the endotracheal tube in trachea was again confirmed by auscultation of breath sounds along with bilateral chest rise and capnographic trace. on the first attempt, if trachea was not intubated, the endotracheal tube was withdrawn up to 18 cm mark for number 7.0 endotracheal tube and 20 cm mark for number 8.0 endotracheal tube followed by re - advancement of the endotracheal tube with adequate external laryngeal manoeuvre over the cricoid cartilage. after confirmation of endotracheal placement, the connector of endotracheal tube was removed and the tube was stabilised using the air - q removal stylet. the cuff of the air - q was deflated and air - q withdrawn over the endotracheal tube - stylet assembly. the placement of endotracheal tube was reconfirmed to rule out endobronchial advancement and then the tube was secured. after removal of air - q following tracheal intubation, the device was observed for visible macroscopic blood stains to rule out airway trauma. the following data were recorded : number of attempts to insert air - q, post - insertion heart rate (hr), blood pressure and spo2, number of attempts to intubate the trachea, post - intubation hr, systolic (sbp), diastolic (dbp) and mean arterial pressures (map) recorded at 1 min, 3 min and 5 min intervals and airway trauma and post - operatively, airway morbidity was recorded. failure to intubate the trachea was defined as the inability to advance the endotracheal tube into the trachea on manipulation respectively. in patients where intubation with air - q as a conduit was unsuccessful, the patients were intubated with direct laryngoscopy using macintosh laryngoscope. repeated measure anova was used to analyse the variations in hr sbp, dbp and map. chi - square test was used to assess the number of attempts for tracheal intubation and analysis of airway morbidity associated with the use of the air - q ila. the demographics of the study group was as follows : age (33.63 10.78 years), weight (58.73 9.88 kg) and 18 male and 42 female subjects. as assessed during pre - operative airway examination 27 patients had grade i and 33 had grade ii mallampati grading. based on american society of anesthesiologists (asa) risk grading, 49 patients belonged to asa grade i, and 11 patients to asa grade ii. the air - q was successfully inserted in all the patients (100%) [figure 1 ]. the first attempt for insertion of the air - q was successful in 53 patients and in 7 patients, a second attempt was required. ventilation was found to be adequate in all patients in our study with size 3.5 and 4.5 air - q ila [table 1 ]. overall, 34 patients (56.7%) were successfully intubated in the first attempt ; figure 2 shows the analysis for the successful tracheal intubation with size 3.5 and size 4.5 air - q ila, wherein we observed that frequency of successful intubation at second attempt was higher when size 4.5 air - q ila was used to pass size 8.0 mm endotracheal tube. number of attempts for successful insertion of the air - q laryngeal mask airway rate of succesful endotracheal intubation haemodynamic response to insertion of air - q ila and tracheal intubation [table 2 ] showed significant reduction of sbp, dbp and map after the induction of general anaesthesia and insertion of the air - q compared to the pre - induction values (p < 0.0001). the rise in hr after insertion of the air - q and 1 min after intubation was significant (p < 0.0001) when compared with pre - induction values of hr. perioperative haemodynamic response immediately after tracheal intubation, there was a significant rise in the systolic, diastolic and map compared to the pre - intubation values. a gradual decline was observed between 1 min, 3 min and 5 min post - intubation. three patients (5%) had minor airway trauma as deduced by observation of macroscopic blood on the device after its removal and 6 patients (10%) reported having sore throat after removal of the endotracheal tube at the end of surgery [figure 3 ]. tracheal intubation with the aid of a rigid laryngoscope, although a gold standard in securing a definitive airway, is an invasive technique. the stimulus of direct laryngoscopy to visualise the vocal cords triggers adverse haemodynamic stress response in the form of tachycardia and hypertension. although the severity of this response depends on the duration of laryngoscopy, operator expertise and the level of anaesthesia, it can prove hazardous in patients with myocardial insufficiency and cerebrovascular disease, especially in the geriatric age group. the air - q intubating laryngeal airway (ila, cookgas llc, mercury medical, clearwater, fl, usa) is a new supraglottic airway device designed for airway maintenance and also as a conduit for endotracheal intubation during general anaesthesia. the major advantage of the device design is that conventional pvc endotracheal tube can be passed through the air - q ila to intubate the trachea (up to 7.5 and 8.5 mm i d through air - q size 3.5 and 4.5, respectively) without the use of conventional laryngoscope. air - q design when compared to lma unique includes a shorter airway tube with an integrated bite block and a larger inner diameter enabling passage of larger standard cuffed tracheal tubes, ensuring tracheal tube cuff placement below the level of the vocal cords in the mid - trachea and also facilitating safe removal of the air - q ila after endotracheal intubation. the advancement of appropriately sized endotracheal tube is also favoured by the absence of grill at the ventilating orifice which is in the form of a keyhole shaped aperture. the absence of grill at the ventilating orifice also favours the utility of device for fibreoptic endoscope assisted endotracheal intubation. air - q does not have an epiglottis elevating bar which is an important factor in prevention of haemodynamic stress response caused by stimulation of the epiglottis and the periepiglottic structures, an advantage over the lma fastrach. in case of failure to intubate the trachea, the air - q ila can be used as a definitive airway, also a major advantage over the lma fastrach. furthermore, lma fastrach requires a special expensive silicon endotracheal tube and it is not available in paediatric sizes. air - q ila when compared to other supraglottic airway devices such as lma classic excel and lma unique provides a better fibreoptic view of the larynx and also provides a conduit for larger diameter endotracheal tube. the use of predictive scores in a scenario of anticipated difficult airway does not include any parameter that has been validated for predicting difficulties in blind intubation through a ila. thus, the development of more specific parameter awaits further development. in this study, in a 70-year - old female patient with loose and maloccluded teeth, air - q ila was successfully inserted in a single smooth attempt, thus supporting the fact that insertion of air - q is not hindered by less than optimal mouth opening [video 1 ]. the manufacturer recommended optimal mouth opening for successful supraglottic placement of the device is 23 mm for size 3.5 and 25 mm for size 4.5 air - q ila. the successful tracheal intubation (56.7%) in the first attempt and overall (76.7%) is comparable to the results obtained by e.j. bakker. in their pilot study where it was 58% and 74%, respectively. the use of this manoeuvre along with conventional endotracheal tube 's rigid tip pushing against the anterior portion of the glottis may have led to the observed incidents of airway trauma and/or failed intubation. there was no statistically significant difference in the occurrence of airway trauma based on the size of air - q used. there was no incidence of any nerve injury often associated with use of supraglottic airway device. in a comparative study of cobra perilaryngeal airway (pla) and air - q ila, the cobra pla showed a significantly higher incidence of airway trauma and post - operative sore throat. after the introduction of the air - q ila, there has been further refinement in the design of the device and newer modifications have been introduced. the air - q sp has a self - pressurising cuff which inflates to adequate pressure during positive pressure ventilation thus eliminating the adverse effects of cuff over inflation associated with the use of supraglottic airway device with an inflatable cuff. the air - q blocker is another recent modification which has an integrated channel which allows the passage of a naso - gastric tube thereby reducing the risk of pulmonary aspiration of gastric content. the learning curve associated with the operative understanding of a novel airway device caused initial failures in attempts at blind tracheal intubation with air - q ila as a conduit. with increasing experience and practice, the air - q ila proved to be a reliable supraglottic airway device with an added advantage of its utility as a conduit for tracheal intubation. the selection of size of the air - q for an individual as recommended by the manufacturer is based on the body weight and mouth opening. this aspect needs to be further validated based on the physiology and anatomy of the patient and the selection needs to be individualised for each patient. this would reduce the incidence of airway morbidity associated with the use of air - q ila. the air - q ila is designed to cause minimal stimulation of the periglottic structures ; as a conduit for blind endotracheal intubation, it attenuates the haemodynamic stress response associated with intubation. air - q ila is a reliable supraglottic airway device ensuring adequate ventilation consistently and could also prove to be a lifesaving alternative as a rescue device in difficult airway scenario. it provides a conduit for endotracheal intubation thereby providing a valuable alternative to conventional laryngoscopy - aided tracheal intubation. the safety of air - q ila in regular management of the airway needs further assessment considering the number of second attempts required for successfully intubating the trachea.	background and aims : air - q intubating laryngeal mask airway (ila) is used as a supraglottic airway device and as a conduit for endotracheal intubation. this study aims to assess the efficacy of the air - q ila regarding ease of insertion, adequacy of ventilation, rate of successful intubation, haemodynamic response and airway morbidity.methods:sixty patients presenting for elective surgery at our medical college hospital were selected. following adequate premedication, baseline vital parameters, pulse rate and blood pressure were recorded. air - q size 3.5 for patients 50 - 70 kg and size 4.5 for 70 - 100 kg was selected. after achieving adequate intubating conditions, air - q ila was introduced. confirming adequate ventilation, appropriate sized endotracheal tube was advanced through the air - q blindly to intubate the trachea. placement of the endotracheal tube in trachea was confirmed.results:air-q ila was successfully inserted in 88.3% of patients in first attempt and 11.7% patients in second attempt. ventilation was adequate in 100% of patients. intubation was successful in 76.7% of patients with air - q ila. 23.3% of patients were intubated by direct laryngoscopy following failure with two attempts using air - q ila. post - intubation the change in heart rate was statistically significant (p < 0.0001). 10% of patients were noted to have a sore throat and 5% of patients had mild airway trauma.conclusion:air-q ila is a reliable device as a supraglottic airway ensuring adequate ventilation as well as a conduit for endotracheal intubation. it benefits the patient by avoiding the stress of direct laryngoscopy and is also superior alternative device for use in a difficult airway.
this study included 40 cases of lung adenocarcinoma treated with surgery alone or surgery and postoperative adjuvant therapy at our institute between 2000 and 2011. selected patients had ais, mia, or small adenocarcinoma (sad) and no other malignant tumors within five years of their diagnosis of lung adenocarcinoma. patients were defined as ever - smokers if they had smoked > 20 packs of cigarettes or 12 oz of tobacco in their lifetime, or smoked > 1 cigarette / day or > 1 cigar / wk for 1 year.9 the clinical records reviewed included data on age, gender, smoking history, tumor size, pathologic stage, operative mode, and mortality outcomes. the tumor sections were examined, with special attention to the following details : classification of the pulmonary adenocarcinoma according to the new iaslc / ats / ers classification system, presence or absence of lepidic growth, extent of invasion, predominant invasive pattern including acinar, papillary, solid, or micropapillary growth, presence or absence of solid or micropapillary growth using a 5%-cutoff, presence or absence of lymph node metastasis, lymphatic invasion, and tumor necrosis. in accordance with the updated iaslc / ats / ers classification system, ais cases were selected according to the following criteria : localized sad (2 cm) with growth of neoplastic cells along pre - existing alveolar structures ; lack of stromal, vascular, or pleural invasion ; absence of papillary or micropapillary patterns ; and absence of intra - alveolar tumor cells. tumors were subclassified as mia in cases with a small solitary adenocarcinoma (2 cm) with a predominantly lepidic pattern and 5 mm invasion in the greatest dimension of any one focus. the invasive component to be measured in mia was defined as follows : histological subtypes other than a lepidic pattern (i.e., acinar, papillary, micropapillary, or solid) or tumor cells infiltrating myofibroblastic stroma. the invasive component was measured morphometrically and a 5-mm cutoff was used to distinguish mia from lepidic predominant adenocarcinoma (lpa). for cases that contained multiple tumor foci, mia was excluded if the tumor invaded the lymphatics, blood vessels, pleura, or contained tumor necrosis. lpa and non - lepidic adenocarcinoma with > 5 mm and 2 cm invasion in diameter were classified as sad and were divided further into acinar, papillary, and micropapillary based on their predominant invasive pattern. forty cases of lung ais and adenocarcinoma measuring 2 cm in its widest dimension were analyzed for nkd1 expression after selecting one representative section of tumor from each case. for immunohistochemistry, 4 m - thick sections were deparaffinized using immunoautostainer (leica bond - max, leica, newcastle upon tyne, uk) hydrated through graded alcohols to water, and washed in distilled water. antigen retrieval was performed by immersing slides in citrate buffer (ph 6.0), heating for 20 minutes, and cooling for 10 minutes. after washing in distilled water, endogenous peroxidase activity slides were then washed in distilled water, placed in tris - buffered saline, incubated for 30 minutes with monoclonal antibody to nkd1 (epitomics, burlingame, ca, usa) at a 1:400 dilution, and then washed in buffer. slides were washed, incubated with polymers (bond polymer refine kit, leica) for 30 minutes, washed in buffer again, and counterstained with hematoxylin. the expression of nkd1 was classified into five groups according to percentage of positively stained cells : 0, negative ; 1, 1 - 25% ; 2, 26 - 50% ; 3, 51 - 75% ; 4, 76%. the staining intensity was evaluated as follows : 0, negative ; 1, weak ; 2, moderate ; and 3, strong. cases with faintly stained cytoplasms were categorized as " weak, " whereas deeply stained were considered to be " strong, " and intermediate ones " moderate. " the expression of nkd1 in normal lung parenchyma was evaluated after randomly selecting ten cases with normal lung tissue with at least 2 cm distance from the tumor. in a normal lung, alveolar pneumocytes were weakly stained in the cytoplasm, whereas bronchial epithelium were weakly to moderately stained in the cytoplasm, especially in the apical portions. scores from normal lung tissue ranged from 3 to 6 (mean, 4.3) as indicated in fig. there were two cases with a score of 3, four cases with a score 4, five cases with a score 5, and one case with a score 6. on the basis of these results, a score of 3 or less was considered to be " reduced expression, " 4 or 5 were " normal expression, " and scores of 6 or more were regarded as " overexpression. " the overall survival rate was evaluated using the kaplan - meier method, and statistical differences in survival times were determined using log - rank testing. this study included 40 cases of lung adenocarcinoma treated with surgery alone or surgery and postoperative adjuvant therapy at our institute between 2000 and 2011. selected patients had ais, mia, or small adenocarcinoma (sad) and no other malignant tumors within five years of their diagnosis of lung adenocarcinoma. patients were defined as ever - smokers if they had smoked > 20 packs of cigarettes or 12 oz of tobacco in their lifetime, or smoked > 1 cigarette / day or > 1 cigar / wk for 1 year.9 the clinical records reviewed included data on age, gender, smoking history, tumor size, pathologic stage, operative mode, and mortality outcomes. the tumor sections were examined, with special attention to the following details : classification of the pulmonary adenocarcinoma according to the new iaslc / ats / ers classification system, presence or absence of lepidic growth, extent of invasion, predominant invasive pattern including acinar, papillary, solid, or micropapillary growth, presence or absence of solid or micropapillary growth using a 5%-cutoff, presence or absence of lymph node metastasis, lymphatic invasion, and tumor necrosis. in accordance with the updated iaslc / ats / ers classification system, ais cases were selected according to the following criteria : localized sad (2 cm) with growth of neoplastic cells along pre - existing alveolar structures ; lack of stromal, vascular, or pleural invasion ; absence of papillary or micropapillary patterns ; and absence of intra - alveolar tumor cells. tumors were subclassified as mia in cases with a small solitary adenocarcinoma (2 cm) with a predominantly lepidic pattern and 5 mm invasion in the greatest dimension of any one focus. the invasive component to be measured in mia was defined as follows : histological subtypes other than a lepidic pattern (i.e., acinar, papillary, micropapillary, or solid) or tumor cells infiltrating myofibroblastic stroma. the invasive component was measured morphometrically and a 5-mm cutoff was used to distinguish mia from lepidic predominant adenocarcinoma (lpa). for cases that contained multiple tumor foci, mia was excluded if the tumor invaded the lymphatics, blood vessels, pleura, or contained tumor necrosis. lpa and non - lepidic adenocarcinoma with > 5 mm and 2 cm invasion in diameter were classified as sad and were divided further into acinar, papillary, and micropapillary based on their predominant invasive pattern. forty cases of lung ais and adenocarcinoma measuring 2 cm in its widest dimension were analyzed for nkd1 expression after selecting one representative section of tumor from each case. for immunohistochemistry, 4 m - thick sections were deparaffinized using immunoautostainer (leica bond - max, leica, newcastle upon tyne, uk) hydrated through graded alcohols to water, and washed in distilled water. antigen retrieval was performed by immersing slides in citrate buffer (ph 6.0), heating for 20 minutes, and cooling for 10 minutes. after washing in distilled water, endogenous peroxidase activity slides were then washed in distilled water, placed in tris - buffered saline, incubated for 30 minutes with monoclonal antibody to nkd1 (epitomics, burlingame, ca, usa) at a 1:400 dilution, and then washed in buffer. slides were washed, incubated with polymers (bond polymer refine kit, leica) for 30 minutes, washed in buffer again, and counterstained with hematoxylin. the expression of nkd1 was classified into five groups according to percentage of positively stained cells : 0, negative ; 1, 1 - 25% ; 2, 26 - 50% ; 3, 51 - 75% ; 4, 76%. the staining intensity was evaluated as follows : 0, negative ; 1, weak ; 2, moderate ; and 3, strong. cases with faintly stained cytoplasms were categorized as " weak, " whereas deeply stained were considered to be " strong, " and intermediate ones " moderate. " the expression of nkd1 in normal lung parenchyma was evaluated after randomly selecting ten cases with normal lung tissue with at least 2 cm distance from the tumor. in a normal lung, alveolar pneumocytes were weakly stained in the cytoplasm, whereas bronchial epithelium were weakly to moderately stained in the cytoplasm, especially in the apical portions. scores from normal lung tissue ranged from 3 to 6 (mean, 4.3) as indicated in fig. 1. there were two cases with a score of 3, four cases with a score 4, five cases with a score 5, and one case with a score 6. on the basis of these results, a score of 3 or less was considered to be " reduced expression, " 4 or 5 were " normal expression, " and scores of 6 or more were regarded as " overexpression. " the overall survival rate was evaluated using the kaplan - meier method, and statistical differences in survival times were determined using log - rank testing. a p - value of < 0.05 was considered statistically significant. our patient population was composed of 17 men and 23 women aged 35 - 79 years (mean, 56.9 years). smoking history was available in all 40 patients, with 11 (27.5%) classified as ever - smokers and 29 (72.5%) as never - smokers. the subtypes of lung tumor were as follows : 5 (12.5%) ais, 8 (20.0%) mia, and 27 (67.5%) sad. these various clinicopathologic features were compared according to nkd1 expression (tables 2, 3). among the 40 samples, 2a, b), normal expression in 15 (37.5%) cases (fig. 2c, d), and overexpression in 17 (42.5%) cases (fig. 2e, f). overexpression of nkd1 was closely related to the predominant papillary pattern, showing increased expression in all cases of lung adenocarcinoma with papillary pattern (p=0.026). among five samples of ais staged as tis, four cases showed normal expression (80%) and one case showed overexpression (20%) with no statistically significant differences (p=0.189). nkd1-reduced expression was observed in 2 out of 8 mia cases (25%) and in 6 out of 27 sad cases (22.2%), while no cases of ais had nkd1-reduced expression (p=0.189). the rate of normal or increased nkd1 expression in adenocarcinoma with lepidic predominant growth (11/13, 84.7%) was higher than that without lepidic predominant growth (21/27, 77.8%), but this was not a statistically significant difference (p=0.349). the rate of reduced nkd1 expression in adenocarcinoma with solid predominant growth (1/4, 25%) was higher than that without solid predominant growth (7/36, 19.4%), with no statistical significance (p=0.821). follow - up data were available for 40 patients and the mean follow - up period was 33.7 months ranging from 1 to 156 months. thirty - six patients were alive and free of disease at the mean follow - up period of 35.6 months. one patient died 14 days after surgery and was excluded from the analysis. according to our univariate analysis, factors that statistically influenced survival included presence of lymph node metastasis (p=0.001) and presence of micropapillary pattern (p=0.001) as indicated in table 4. regarding histologic subtypes, all patients with ais and mia were alive and free of disease, while 3 out of 27 sad patients had poor prognosis and died from their disease (ais vs sad, p=0.453 ; mia vs sad, p=0.296) (fig. expected survival time decreased as expression of nkd1 became overexpressed, which was the opposite effect to what had been expected, however there was no statistical significance (reduced vs normal, p=0.763 ; reduced vs overexpressed, p=0.599 ; normal vs overexpressed, p=0.550). our patient population was composed of 17 men and 23 women aged 35 - 79 years (mean, 56.9 years). smoking history was available in all 40 patients, with 11 (27.5%) classified as ever - smokers and 29 (72.5%) as never - smokers. the subtypes of lung tumor were as follows : 5 (12.5%) ais, 8 (20.0%) mia, and 27 (67.5%) sad. these various clinicopathologic features were compared according to nkd1 expression (tables 2, 3). among the 40 samples, 2a, b), normal expression in 15 (37.5%) cases (fig. 2c, d), and overexpression in 17 (42.5%) cases (fig. 2e, f). overexpression of nkd1 was closely related to the predominant papillary pattern, showing increased expression in all cases of lung adenocarcinoma with papillary pattern (p=0.026). among five samples of ais staged as tis, four cases showed normal expression (80%) and one case showed overexpression (20%) with no statistically significant differences (p=0.189). nkd1-reduced expression was observed in 2 out of 8 mia cases (25%) and in 6 out of 27 sad cases (22.2%), while no cases of ais had nkd1-reduced expression (p=0.189). the rate of normal or increased nkd1 expression in adenocarcinoma with lepidic predominant growth (11/13, 84.7%) was higher than that without lepidic predominant growth (21/27, 77.8%), but this was not a statistically significant difference (p=0.349). the rate of reduced nkd1 expression in adenocarcinoma with solid predominant growth (1/4, 25%) was higher than that without solid predominant growth (7/36, 19.4%), with no statistical significance (p=0.821). follow - up data were available for 40 patients and the mean follow - up period was 33.7 months ranging from 1 to 156 months. thirty - six patients were alive and free of disease at the mean follow - up period of 35.6 months. one patient died 14 days after surgery and was excluded from the analysis. according to our univariate analysis, factors that statistically influenced survival included presence of lymph node metastasis (p=0.001) and presence of micropapillary pattern (p=0.001) as indicated in table 4. regarding histologic subtypes, all patients with ais and mia were alive and free of disease, while 3 out of 27 sad patients had poor prognosis and died from their disease (ais vs sad, p=0.453 ; mia vs sad, p=0.296) (fig. expected survival time decreased as expression of nkd1 became overexpressed, which was the opposite effect to what had been expected, however there was no statistical significance (reduced vs normal, p=0.763 ; reduced vs overexpressed, p=0.599 ; normal vs overexpressed, p=0.550). noguchi.10 analyzed the histology of small lung adenocarcinoma and classified it according to the presence or absence of bac components and other histologic characteristics. this seminal study brought to attention the importance of bac and its association with excellent prognosis, including 100% 5-year survival. subsequent studies11 - 16 elucidated various histologic features of prognostic significance in lung adenocarcinomas with bac components, including size of scar, percentage of lepidic growth, percentage of papillary growth, vascular invasion, and size or pattern of invasion. based on these studies, new concepts were introduced, such as including the subgroups of ais and mia, according to the new iaslc / ats / ers classification system. in accordance with earlier studies, our results suggested better tumor behavior in mia (5 mm) compared to sad, which supports distinguishing these classes of tumors from stage t1a cancers. in this study, in contrast, among 27 patients with sad, 2 (7.4%) had lymph node metastasis, and 3 (11.1%) died of disease. the overall survival curve (fig. 3) also identified a relationship among ais, mia, and sad that was not statistically significant. there are several limitations to this study including its small sample size and short follow - up period, which likely contributed to our statistically insignificant results. as seen in fig. 3, patients of ais and mia had shorter follow - up than those with sad. this limited data likely reflects a recent increase in the early detection of small lung adenocarcinoma, owing to advances in imaging technique. we reviewed all surgically resected lung adenocarcinomas less than 2 cm in size since 2000, as well as cases of ais and mia were observed in our institute only after 2007. there is still a need for future studies to validate these findings based on standardized pathologic criteria. although there was not a large enough sample size to conduct a powerful statistical analysis of mia cases, our univariate analysis demonstrated, as expected, that lymph node metastasis and micropapillary patterns were indeed unfavorable prognostic markers (table 4). the aforementioned variables were mostly observed in cases of sad, supporting the idea that among t1a lung adenocarcinomas, mia may be distinguished from sad with obviously different outcomes. increasing reports of nkd1 have demonstrated up - regulation of nkd1 mrna levels in lung cancer, as well as colorectal adenomas and hepatoblastomas.8,17,18 conversely, nkd1 protein expression was down - regulated in some gastric cancers and nsclc. zhang.8 reported nkd1 protein in nsclc. in their study, 100 cases of nsclc, including 33 cases of squamous cell carcinoma, and 76 cases of adenocarcinoma, underwent immunohistochemical staining with nkd1 polyclonal antibody ; their results demonstrated reduced nkd1 protein levels with elevated nkd1 mrna associated with poor differentiation, high ptnm stage, lymph node metastasis, and poor prognosis. the authors hypothesized that a post - translational modification of nkd1 or protein degradation may have been involved in the discordance between reduced nkd1 expression and up - regulated nkd1 mrna. these findings also suggested that nkd1 depletion could up - regulate dvl-1 and -catenin protein, enhancing the invasive ability of lung cancer cells. a statistically significant association was found between reduced nkd1 expression and nodal metastasis (p=0.003), which was observed in previous studies, and further implies an unfavorable prognosis in lung adenocarcinoma with reduced nkd1 expression. this discordant result might have been due to a limited experimental group in this study, which included ptis- and pt1a - staged lung adenocarcinoma. moreover, a monoclonal nkd1 antibody was applied in this study, whereas polyclonal nkd1 antibodies were used in previous studies. nkd1 was expressed differently in the papillary subtype compared to non - papillary subtypes, with several possible implications. hypotheses include that nkd1 protein in the papillary subtype may be less fragile than in the non - papillary subtype, making it less vulnerable to degradation or post - translational modification compared to the non - papillary subtype. overexpression of nkd1 in the papillary subtype suggests that nkd1 may have a specific role in the pathogenesis of distinct histologic subtypes of lung adenocarcinoma, and may specifically drive different pathways, which remain unidentified. pulmonary adenocarcinoma is histologically heterogeneous and currently, there have been several reports of different molecular or immunohistochemical expressions of distinct histologic subtypes in lung adenocarcinoma.19,20 to the best of our knowledge, this is the first study to investigate the relationship between nkd1 expression and clinicopathological features, with special attention to the histologic pattern in small lung adenocarcinoma. though there were several reports on the therapeutic implications of ais, mia, and sad,21 - 23 the appropriateness of limited resection remains unclear and should be subject to further clinical trials. ongoing clinical trials should define selection criteria for limited resection in patients with small lung adenocarcinoma, which will encompass not only histologic parameters but also immunohistochemical and molecular aspects of the cancer. in conclusion however, our study was limited by statistically insignificant results likely due to our small sample size and short - term follow - up. future studies should validate our results, as well as try to verify a favorable prognosis with mia and to identify selection criteria for limited surgical resection. based on previous reports investigating the invasive ability of nkd1 in nsclc, different expressions of nkd1 protein in small lung adenocarcinoma suggest its potential role in invasion assessment. though having failed to support those speculations, this study demonstrated that down - regulated nkd1 expression was closely associated with nodal metastasis and altered expression was associated with the papillary subtype, suggesting that nkd1 is indeed a likely unfavorable marker.	backgroundnaked cuticle drosophila 1 (nkd1) has been related to non - small cell lung cancer in that decreased nkd1 levels have been associated with both poor prognosis and increased invasive quality.methodsforty cases of lung adenocarcinoma staged as tis or t1a were selected. cases were subclassified into adenocarcinoma in situ (ais), minimally invasive adenocarcinoma (mia), and small adenocarcinoma (sad). immunohistochemical studies for nkd1 were performed.resultsforty samples comprised five cases of ais (12.5%), eight of mia (20.0%), and 27 of sad (67.5%). ais and mia showed no lymph node metastasis and 100% disease - free survival, whereas among 27 patients with sad, 2 (7.4%) had lymph node metastasis, and 3 (11.1%) died from the disease. among the 40 cases, nkd1-reduced expression was detected in 8 (20%) samples, whereas normal expression was found in 15 (37.5%) and overexpression in 17 (42.5%). loss of nkd1 expression was significantly associated with lymph node metastasis (p=0.001). all cases with predominant papillary pattern showed overexpression of nkd1 (p=0.026).conclusionsamong mia and sad, mia had better outcomes than sad. down - regulated nkd1 expression was closely associated with nodal metastasis, and overexpression was associated with papillary predominant adenocarcinoma.
uterine papillary serous carcinoma (upsc) is an uncommon but aggressive type of endometrial carcinoma with high recurrence rate and poor survival outcomes. although upsc represents approximately 3% to 10% of the endometrial carcinomas, it accounts for almost 40% of all endometrial cancer - related death. unfortunately, advanced - stage disease or recurrence is common even when upsc is apparently only minimally invasive or even confined to the endometrium.1,2,3 we report a case of a 58-year - old patient with abdominal wall metastasis in upsc stage ia : no lymphovascular invasion and no metastasis in regional lymph nodes were present. a 58-year - old post - menopausal woman presented upsc defined through the international federation of obstetrics and gynecology (figo) at stage ia, diagnosed in october 2008. her past medical history had reported a modified radical mastectomy on right breast due to infiltrating ductal carcinoma in august 2001 and the patient subsequently took toremifene, 40 mg daily, for 5 years. she appeared healthy postoperatively. in october 2008, an abnormal hypermetabolic lesion on her uterus was noted on a follow - up positron emission tomography - computed tomography (pet - ct ; ge healthcare, milwaukee, wi, usa). she underwent a total abdominal hysterectomy and bilateral salpingo - oophorectomy with surgical staging in october 2008. the peritoneal cavity was entered through low midline skin incision and drain was inserted. the pathological finding revealed stage ia upsc that the tumor was limited to the endometrium without lymphovascular space invasion and no lymph node metastasis (fig. after surgical staging, an egg sized palpable mass had developed in her lower right abdomen after 8 months. abdominopelvic ct (showed a 4.4 4.1 cm sized low - attenuated septated cystic mass in the abdominal wall (fig. 2). pet - ct revealed an abnormal hypermetabolic lesion in the abdominal wall with no other metastasis (fig. the frozen and permanent pathological findings showed metastatic upsc with clear resection margin (fig. after diagnosis of upsc metastasis in the abdominal wall, she received chemotherapy utilizing paclitaxel (body surface area [bsa ] 175 mg) and carboplatin (area under the curve [auc ] 5) every 3 weeks. even among diseases that occur after menopause, upsc is a highly malignant variant of endometrial adenocarcinoma that histologically and clinically resembles ovarian papillary serous carcinoma. it is usually found in an advanced stage.4 lymphovascular space invasion is common in the myometrium. the meticulous surgical staging is important for predicting the prognosis of upsc, because most patients tend to be upstaged after a comprehensive surgical staging.1,4,5,6 upsc truly confined to the uterus has an overall excellent prognosis, whereas patients with extrauterine disease, even if it is revealed only in a microscopy, almost always suffers from recurrence and subsequent death caused by the tumor.7,8 upsc tends to spread in a fashion similar to ovarian cancer with a high propensity for upper abdominal relapse and has a poor prognosis even in the absence of deep myometrial invasion or lymph node metastasis. with such a poor survival rate, additional adjuvant therapy with whole abdomen radiation or systemic chemotherapy has been applied in hopes of improving survival. lim.9 reported 78 patients with stage i - iiia upsc : 58 patients were treated with whole abdominal radiation and 20 patients did not receive treatment. the corresponding 5-year disease - specific survival rates were 74.9% and 41.3%, respectively (p = 0.04).9 in gog study 94, the 3-year disease - free and overall survival rates for the 60 patients with stage iii papillary serous or clear cell carcinomas were 40.9% and 45.0%, respectively.10 the data on whole abdominal radiation is somewhat encouraging, but effective systemic therapy is needed, because the rate of relapse is still substantial. trials investigating paclitaxel and carboplatin in upscs reported response rates of 60% to 70%.11,12 gehrig13 reported that paclitaxel and platinum - based chemotherapy for three cycles followed by radiation therapy and then an additional three cycles of chemotherapy was tried for advanced - staged upsc. the progression free survival in 9 patients was 46.4 months.13 a study of 74 patients with stage i upsc between 1987 and 2004, who underwent complete staging at yale university, reported that stage ia patients with residual uterine disease, who were treated with platinum - based chemotherapy, had no recurrence (n = 7), while 6 of 14 (43%) stage ia patients with residual uterine disease, who did not receive chemotherapy, experienced a recurrence. the 15 patients with stage ib upsc who received platinum - based chemotherapy had no recurrences but 10 of the 13 (77%) stage ib patients who did not receive chemotherapy had recurrence. platinum - based chemotherapy was associated with improved progression - free (p < 0.01) and overall survival (p < 0.05). in addition, no patient who received radiation to the vaginal cuff had recurrence at the cuff, but 6 of 31 (19%) patients who were not treated with vaginal radiation had recurrence at the cuff.14 these retrospective, limited data supported the potential benefit of platinum - based chemotherapy with vaginal cuff irradiation in upsc. a randomized, prospective study is needed to define optimal treatment stage i upsc. in conclusion, we suggest that even when upsc is confined to the endometrium without regional lymph node metastasis and with no lymphovascular invasion, chemotherapy should be considered as a postoperative adjuvant therapy.	uterine papillary serous carcinoma (upsc) is an aggressive form of endometrial cancer characterized by a high recurrence rate and poor prognosis. we report a case of a 58-year - old post - menopausal woman with an abdominal wall metastasis in stage ia upsc. after surgical staging, she did not receive additional adjuvant therapy. an egg sized palpable mass developed in the right lower abdomen after 8 months. both abdominopelvic computed tomography (ct) and positron emission tomography (pet)-ct revealed a metastatic lesion in the abdominal wall. hence, surgical excision was performed. the pathological findings showed metastatic upsc with clear resection margin. after the diagnosis of upsc metastasis in the abdominal wall, she received chemotherapy utilizing paclitaxel and carboplatin. after 3 years, no evidence of recurrence was found. therefore, we suggest that even when upsc is confined to the endometrium without lymph node metastasis and without lymphovascular invasion, chemotherapy should be considered as a postoperative adjuvant therapy.
the integration of semiconductor quantum dots (qd) as active elements in new quantum optoelectronic devices [1 - 4 ] requires a precise control in their shape, size and location over the substrate. in this direction, one of them is the use of patterned substrates [5 - 9 ], in which good results on the growth selectivity and photoluminescence (pl) emission of single qd have been obtained [5 - 7 ]. another approach based on droplet epitaxy growth technique has recently emerged as an optimal strategy for obtaining different nanostructures complexes with a great control in shape and size. recently, our group has reported the ability to use this technique to obtain low density inas qd with control in size into previously formed gaas nanoholes. in this previous work, we advanced the possibility of using certain capping growth conditions for marking the underneath nanostructures by the formation of mounding features at the top surface. the possibility of top surface localization of buried qd has been studied in the past by the growth of stacked structures and more recently, by evaluating the surface morphology once a single layer of qd is capped. as it is well known, the surface of a thin layer covering nanometric features is not flat, but it shows characteristic mounding features [3,14 - 17 ]. however, when the thickness of the cap layer increases, these features enlarge and coalesce discarding any further correspondence of the mounds with the buried nanostructures. the possibility to overcome this problem is of high technological interest for the fabrication of devices, as single photon emitters, where the location of the nanostructures after being buried is a critical issue. in this work, by means of preferential nucleation of inas at the top surface, we demonstrate that mounds formed during the growth of the cap layer unequivocally mark the buried nanostructures. additionally, we show that these surface features can be maintained up to 100-nm thick cap layers by the use of low temperature atomic layer molecular beam epitaxy (almbe) growth technique. the different contributions to the surface chemical potential that influence on the selective preferential growth are discussed in the framework of these results. the experimental procedure starts growing a 0.5-m thick undoped gaas(001) buffer layer by molecular beam epitaxy (mbe) at a growth rate rg = 0.5 monolayers per second (ml / s), as4 beam equivalent pressure (bep) of 2 10 torr and substrate temperature ts = 580 c on gaas (001) substrates. it consists of a two - step process where metallic ga droplets are first formed on the surface to be finally exposed to an as atmosphere. in particular, the growth protocol followed for the formation of ga droplets consists in the opening of the ga shutter during 20 s, with the cell providing a flux equivalent to the growth of gaas at 0.5 ml / s. simultaneously, the as cell is pulsed in cycles of 0.2 s open/0.8 s close at a bep(as4) = 5 10 torr. the result of this process is the formation of ga droplets spread all over the surface with a density of 2 10 cm. finally, these ga droplets are annealed under as atmosphere during 6 min at bep(as4) = 5 10 torr. during this annealing step, the in cell is also opened, depositing 1.4 ml of inas, at rg = 0.01 ml / s, for qd formation inside the nanoholes. after this annealing and simultaneous inas deposition step, the formed nanostructures are finally exposed during 1 min to as2 flux at ts = 510 c and bep(as2) = 3.5 10 torr. the formed qd, with dimensions 14 1 nm in height, 50 2 nm in diameter and density 2 10 cm (fig. in particular, the first 15 nm of gaas were grown at ts = 510 c and as2 bep changing from 5 10 to 9 10 torr while the remaining 35 nm under typical mbe conditions : ts = 580 c and bep(as4) = 2 10 torr. as expected, coalesced mounds elongated along the gaas [1 - 10 ] direction are observed. in this sense, in order to study the resulting cap layer surface morphology and its possible correlation with the buried nanostructures, two different gaas cap layers with thicknesses of 25 and 100 nm were grown. in the case of growing a 25-nm thick cap layer, the growth conditions followed were similar to that used in the case of growing the 50-nm thick cap layer ; thus, the initial 15 nm were grown at ts = 510 c and as2 bep changing from 5 10 to 9 10 torr while the remaining 10 nm of gaas, under typical mbe conditions. as shown below (fig. 2a), under this process, the cap layer shows a morphology consisting of a flat surface with isolated mounds. in the case of the 100-nm thick cap layer growth, the first 20 nm are initially grown as before, ts = 510 c and as2 bep changing from 5 10 to 9 10 torr, and the remaining 80 nm are deposited at ts = 450 c and bep(as4) = 2 10 torr using the almbe growth technique, with the aim of preserving as much as possible the mounding morphology achieved after the growth of the thinner cap layer (d = 0 25 nm). after the growth of either 25- or 100-nm thick gaas cap layers, different amounts of inas were finally deposited to reveal the existence and hierarchy of sites for enhanced nucleation of new nanostructures. in particular 1.4, 1.5 and 1.6 ml of inas were deposited at 0.01 ml / s, ts = 510 c and bep(as4) = 5 10 torr. 1 m 1 m afm images corresponding to : a the initial inas qd formed into gaas nanoholes fabricated by droplet epitaxy and b the gaas surface that results after capping by 50 nm of gaas the nanostructures shown in (a) at typical mbe growth conditions. coalesced mounds elongated along the [1 - 10 ] gaas direction are observed left column shows 1 1 m3d afm images of the mounding surface that results after growing a 25-nm thick gaas cap layer (a) and after 1.4 ml (b), 1.5 ml (c) and 1.6 ml (d) of inas is deposited on this surface. the inset in (b) corresponds to the derivative image and is shown to highlight the presence of 3d inas nuclei forming at the top of the mounds. right column shows 1 1 m3d afm images of the mounding surface that results after growing a 100-nm thick gaas cap layer (e) and after 1.4 ml (f), 1.5 ml (g) and 1.6 ml (h) of inas is deposited on this surface. see text for the growth conditions of the different gaas cap layers in order to compare the optical quality of inas qd after the different growth processes followed for the 25- and 100-nm thick cap layers, pl studies were performed after depositing 1.4 ml of inas into the gaas nanoholes. these pl measurements were carried out at 30 k, by using a standard setup with a frequency - doubled nd : yag laser (exc = 532 nm) as excitation source, with a spot diameter of approximately 200 m. figure 2 shows 1 m 1 m 3d afm images of capped inas qd and posterior top surface inas deposition. the corresponding images are distributed in columns for the two different cap layer thicknesses grown (25 and 100 nm) and in files for the different amount of inas deposited (0, 1.4, 1.5 and 1.6 ml). it is first noticeable in this image that the surface morphology obtained just after capping the nanostructures is similar independently of the cap layer thickness (fig. in particular, mounds elongated along the direction [1 - 10 ] are observed ; their dimensions for the 25-nm thick cap layer samples are around 700 nm in length, 150 nm in width and 7 nm in height. it is also noticeable the coincidence between the density of the observed mounds and the nanostructures previously deposited (fig. thus, the most plausible is that below each mound, there is a qd. assuming that the mounds are located just over buried qd, new inas material deposited on the surface would preferentially nucleate at their top if the underlying strain is large enough. in the case of 25-nm thick cap layers, fig. 2b shows the afm image after depositing 1.4 ml of inas on the mounding surface shown in fig. notice that the amount of inas deposited is far from the critical for qd formation on a flat surface under the used experimental conditions (~1.7 ml). this means that we would not expect qd formation unless inas growth is enhanced at preferential sites of the surface. however, we observe incipient inas clusters appearing on top of each mound (fig. these inas nanostructures are clearly observed in the derivative afm image at the inset of this fig. this result corroborates our initial supposition about the presence of a qd underneath each of the surface mounds. figure 2d shows the situation when 1.6 ml of inas is deposited on the surface. with this amount of inas, besides the qd formed at the top of the mounds, we observe qd decorating the sidewalls of the mounds. this result indicates that once the qd at the top surface reaches an equilibrium size, the steps forming the mounds become new preferential nucleation sites for inas material. this result means that, besides strain - related nucleation mechanisms, another energetic term that takes into account also curvature - related considerations in the selective nucleation of inas material has to be considered. 2e g show the top surface morphology that results after capping the nanostructures with a 100-nm thick gaas layer and posterior deposition of different amounts of inas material. comparing with the case of using a 25-nm thick cap layer (fig d), we find significant similarities in the mounding morphology and differences in the nucleation of inas nanostructures at the top surface. first, as above commented, we observe mounds with the same density as that of the buried nanostructures and with similar dimensions, except for a lower height of 4 nm, than in the case of using 25-nm thick cap layers. this result means that the growth process used in this work for thick gaas cap layers (100 nm) allows to maintain the morphology initially obtained for 25-nm thick cap layers. in this sense, the result shown in fig. 2e is of great importance for most applications where thick cap layers and top surface localization are strictly necessary. respect to the deposition of inas on this surface, 1.4, 1.5 and 1.6 ml in fig. 2f h, respectively, it is not observed in this case, any formation of inas nanostructures at the top of the mounds. this result indicates that the non - uniform strain profile induced by the buried nanostructures does not propagate up to a distance of 100 nm, and therefore, only curvature - related effects have to be considered in the preferential nucleation of inas. in a similar way to the previous result obtained for the thinner cap layer (25 nm, fig. 2h), that is, when the critical thickness for the growth of qd on a flat surface is almost reached, well - defined qd at the sidewalls of the mounds are obtained together with the formation of incipient inas islands all over the flat surface. 2indicate a dependence of the formation of qd at the apex of the mounds with the strain profile induced from the buried nanostructures, which decreases with the gaas cap layer thickness. the cap layer thickness seems to also be determinant in the nucleation of qd in the sidewalls of the mounds : fig. 2d, h show that after depositing 1.6 ml of inas, qd nucleate only on one of the side walls in the case of using 25-nm thick gaas cap layers, while qd appear in both side walls of the mounds when a 100-nm thick gaas cap layer is grown. this result could be understood on the basis of a different surface curvature (i.e. step density) and/or in the strain profile in the sidewalls of the mounds when cap layers of different thickness are grown. similar results corroborating a direct correspondence of the mounds formed at the top surface and the underneath nanostructures have been previously reported by our group for ga(as)sb qrings formed on gaas(001) substrates. in that case, mounds with qrings nucleated on top of them were observed once a 50-nm thick gaas cap layer was grown over a first layer of nanostructures. 3 shows the pl emission spectra from inas qd capped by 25 nm (black line) and 100 nm (red line) thick gaas layers. a slight increase of intensity is observed in the case of the 100-nm thick gaas cap layer that could be ascribed to the larger distance from the qd to the air / gaas interface. the similar pl spectra observed in both samples indicates that the low substrate temperature process followed to keep the mounding morphology after growing thick cap layers has no influence on the optical properties of the inas qd. photoluminescence (pl) intensity spectra for 1.4 ml of inas deposited into gaas nanoholes capped by 25 nm (black line) or 100 nm (red line) thick gaas layers on balance, we have demonstrated that after an appropriate capping of inas qd, the resulting gaas top surface show a characteristic mounding morphology that permits a direct localization of buried nanostructures even at cap layer thickness as large as 100 nm. different experiments, based on the nucleation of new nanostructures at the top surface of 25- and 100-nm thick gaas cap layers, have permitted to establish a one - to - one correspondence between the mounds and the buried nanostructures. the results obtained also permit a direct observation of the different preferential sites for nanostructures formation driven by strain and/or curvature related mechanisms. the results presented in this work are of high - technological interest for the fabrication of those devices, as single photon emitters, where the nanostructures location after being buried is a critical issue. the authors gratefully acknowledge the financial support by the spanish micinn (tec2008 - 06756-c03 - 01, consolider - qoit csd2006 - 0019), cam (s-505/esp/000200) and by the european commission through sandie network of excellence (no.	in this work, we study the top surface localization of inas quantum dots once capped by a gaas layer grown by molecular beam epitaxy. at the used growth conditions, the underneath nanostructures are revealed at the top surface as mounding features that match their density with independence of the cap layer thickness explored (from 25 to 100 nm). the correspondence between these mounds and the buried nanostructures is confirmed by posterior selective strain - driven formation of new nanostructures on top of them, when the distance between the buried and the superficial nanostructures is short enough (d = 25 nm).
maggot therapy is categorised as a debridement for chronic infectious wounds using disinfected live maggots for medical use (herein referred to as maggots). since the 1930s, maggot debridement therapy (mdt) has been conducted mainly in north america. in japan, first conducted mdt in 2004 and reported the healing of an ulcerated lesion, leading to the avoidance of major amputation of a limb of a patient with severe cli for whom neither a revascularization procedure nor a transplantation of bone marrow and peripheral mononuclear cells to the lower limb was effective. wound healing is intractable in most cli patients who have reduced blood flow in the skin ; therefore, revascularization is the most important factor for successful management. in addition, the debridement of wounds with no sufficient tissue blood flow may deteriorate ischaemic lesions. treatment decisions are often difficult for cli patients with a reduced cardiac function and surgical intervention or endovascular surgery for revascularization is risky, or not clinically and technically possible. herein, we report a cli patient with severe cardiac dysfunction for whom highly invasive surgery, such as bypass surgery, was impossible due to a history of fulminant myocarditis, but functional limb salvage was achieved after wound bed preparation (wbp) with mdt. a 73-year - old man consulted our institution for a skin ulcer of the left third toe in september 2014. he had a clinical history of fulminant myocarditis, myocardial infarction, acute cardiac failure, chronic renal failure (undergoing dialysis), arteriosclerosis obliterans of the lower limb, hypertension, diabetes and visual disturbance. he was a non - smoker, living by himself, and he could walk with support. his notable illness was an episode of fulminant myocarditis and acute cardiac failure in december 2011, which was treated in the icu for 15 days, and he was discharged from hospital 3 months later. at the time of discharge, he still had significant cardiac functional disorder with an ejection fraction (ef) rate of less than 20%. in april 2014, he developed ulceration of the right toes, diagnosed as arteriosclerosis obliterans of the lower limb at the cardiovascular medicine department and underwent percutaneous transluminal angioplasty (pta). in september 2014, delayed healing of the ulceration of the skin was noted ; thus, he was referred to the plastic surgery department. upon the first consultation at the plastic surgery department, ischaemic ulcer of the left third toe biological data on the left limb were examined between the revascularization procedure and surgical management, and blood test and wound culture were examined at the time of surgical management. ajb : ankle joint nerve block ; crp : c - reactive protein ; mrsa : methicillin - resistant staphylococcus aureus ; pta : percutaneous transluminal angioplasty ; snb : sciatic nerve block ; s. maltophilia : stenotrophomonas maltophilia. endovascular surgery was not conducted after october 2016. in september 2014, after performing pta for the left lower limb, amputation of the left third toe was conducted. in december 2014, re - stenosis of the bilateral below - knee arteries and necrosis of the left first toe were noted, thus re - pta was conducted for the bilateral limbs. subsequently, amputation of the left first toe was performed. in september 2015, arterial re - stenosis of the lower extremity developed along with necrosis of all the left toes, plantar and dorsum, and so pta was performed again ; transmetatarsal amputation (tma) was also performed in the same month. however, delayed wound healing, infection and necrosis progressed in the transected surface of the left limb. therefore, in january 2016, the first and second toes were amputated at lisfranc s joint, and the other three toes were further amputated at the base of the transmetatarsal bone, and the amputated surface was left as an open wound for wbp and post - operative infection management. at the time of the amputation, extensive arterial contraction and severe arteriosclerosis were noted in the left lower limb ; thus, an additional revascularization procedure by pta could not be performed. subsequently, cleansing of the wound, topical ointment of sulfadiazine silver, venous drip infusion of an antibiotic agent (daptomycin), and surgical debridement at the bedside were conducted daily, but the yellowish necrosis lesion did not reduce, and his pain aggravated (figure 1(a)). (b) after one session (48 h) of treatment, the reduction of necrotic tissues is seen. (d) after six sessions of treatment, debridement was conducted to the deep portion from the ulcerated base, and favourable granulation can be seen on the amputated surface. the patient strongly desired to save his limb and refused to undergo major amputation of the limb. surgical management under general anaesthesia (such as bypass surgery) or extensive and highly invasive debridement for a long time was also considered unacceptable, because the patient fulfilled three items of the revised cardiac risk index (history of cardiac failure, insulin - dependent diabetes and renal failure), had ef of 18.4% and had a constantly high level of b - type natriuretic peptide (over 2000 pg / ml). as conventional treatment methods were considered difficult for the patient to tolerate, mdt was started from february 2016. second instar larvae of maggots were placed on the surface of the skin ulcer at six larvae per 1 cm, covered by a mesh sheet and dressing was performed. the maggots were removed when they grew to third instar larvae and were replaced by second instar larvae. by defining a 48-h duration as one session, a total of six sessions were conducted. for pain control, the oral administration of nsaids was performed and he could tolerate the pain, although it remained to a certain extent. subsequently, compared with the conventional treatment, the reduction of necrotic tissues at the ulceration site was noted each time the maggots were replaced, and favourable granulation was observed. mdt was particularly effective in the portion where the margin between the granulation and necrosis was unclear, and the deep portion of the ulceration where manual debridement was difficult (figure 1(b d)). intraoperative and post - operative views are shown in figure 2(a, b). under sciatic nerve block, additional debridement and partial simple reefing suture were done, and skin graft with a split thickness of 20/1000 inches was conducted, harvesting the graft from his left inguinal region. the operation took 1 h and 40 min, and the amount of bleeding was 140 ml. after conducting partial simple reefing, split thickness skin graft of 20/1000 inches was used. post - operatively, about 70% of the grafted skin was taken, although it was unstable for 2 weeks, and his pre - operative pain markedly reduced. although some raw surface remained, the range was relatively small, and additional surgical management was unnecessary. after rehabilitation exercise, as of one post - operative months, he became able to stand with assistance when moving from a wheelchair, walk using a four - point walker, and his barthel index improved to a score of 80 (figure 3(b)). the barthel index improved from a score of 45 to 80, and the patient started to walk using a four - point walker. in patients with cli, debridement may deteriorate necrosis by inducing ischaemia of normal tissues. therefore, blood flow evaluation and the revascularization procedure are important before conducting debridement. however, clinically or technically, up to (maximum) 14% of cli patients are unable to undergo surgical management or endovascular surgery for angioplasty. also, soga. reported a vascular re - stenosis rate of 86.0% and re - occlusion rate of 52.8% in cli patients who underwent endovascular management. in our patient, although the preoperative ankle brachial index and skin perfusion pressure were relatively maintained, arterial restenosis of the lower extremity was seen before healing, and pta was conducted three times. in addition, vascular reconstruction by additional pta was difficult after october 2016. some cli patients are unable to undergo highly invasive surgery because of a reduced cardiac function. reported that 15.6% of their cli patients had an ef rate of less than 50% and 41.1% had coronary artery disease (cad). in addition, a mortality rate of less than 25% has been reported within a year for cli patients. physiologic classification of the american society of anesthesiologists (asa) reports perioperative mortality rate of class - iii patients (angina, old myocardial infarction, and insulin - dependent diabetes) and class - iv patients (unstable angina) of 1.8% and 7.8%, respectively. the revised cardiac risk index, which is commonly used to predict cardiovascular events during a perioperative period, defines six risk factors : ischaemic cardiac disease, history of cardiac failure, cerebrovascular disease, insulin - dependent diabetes, renal failure and high - risk surgical management. if a patient has three or more of these risk factors, when conducting non - cardiac surgery, the average cardiovascular complication rate is reported to be 9.1% and mortality due to cardiovascular disease is 3.6%. our patient had three of these risk factors, suggesting a high risk during the perioperative period. adjuvant therapies for ischaemic ulcer, other than mdt, include hyperbaric oxygen therapy, cell therapy, gene therapy (intravascular growth factor) and ldl apheresis. however, these therapies require special equipment and qualification as a specialist ; thus, they are difficult to perform flexibly depending on the needs of a particular situation. on the other hand, mdt can be conducted less problematically in ordinary hospitals or outpatient clinics, although it is categorised as a private practice in japan and thus not covered by the japanese national health insurance system. four debridement methods are considered for the selective removal of necrotic tissues : (1) surgical debridement, (2) enzymatic debridement, (3) autolytic debridement and (4) biological debridement. surgical debridement removes necrotic tissues with scissors or a scalpel, which entails bleeding and pain of patients, as well as damage to peripheral intact tissues to some extent. enzymatic debridement uses chemical agents for liquefaction of necrotic tissues and is also called chemical debridement. this can be done without anaesthesia and is relatively simple to perform with little risk of bleeding ; however, it is a time - consuming procedure and thus not suitable for situations requiring more immediate results. autolytic debridement involves the application of wound dressing materials such as ointments or hydrocolloid materials, making it suitable for wounds that locate near the body surface or autonomic healing power of the wound is maintained. there are three major benefits of wbp by mdt for cli patients [1921 ]. first, selective and efficient debridement can be performed. even for wounds with unclear margins with the surrounding normal tissues, maggots selectively englobe and liquefy only necrotic tissues. in addition, as maggots naturally favour darker environments (negative phototaxis), maggots reach to the deep portions of a wound where surgical debridement is difficult. pain associated with mdt can be controlled with oral analgesics or by controlling the number of applied maggots, making local or surface anaesthesia unnecessary. further, the technique for mdt is relatively straightforward and easily learned, so a certain efficacy can be obtained irrespective of the proficiency of each surgeon. even for patients of advanced age, with dementia, or unfavourable systemic conditions, for whom surgical debridement is problematic, mdt can be utilised. maggots have a sterilising effect both in vivo and in vitro. in the body, maggots eliminate bacteria through a digesting process in their foregut, midgut and hindgut. in an extracorporeal (in vitro) study, antibacterial peptide contained in maggots secretion was shown to be effective against gram - positive bacterium, including methicillin - resistant staphylococcus aureus (mrsa). thus, mdt is considered suitable for cli patients who likely face the presence of multiple drug - resistant bacteria at high incidence, because of relative immune deficiency and long - term hospitalisation. harmful bacteria including mrsa were not detected in wound cultures of our patient in the months of january and february 2016, while mdt was being conducted, suggesting effective antibacterial action of the maggots secretions. such processes include activation of fibroblast migration, angiogenesis (the formation of new blood vessels from pre - existing vessels) within the wound bed and an enhanced production of growth factors within the wound environment. these are believed to have been part of the success of wbp with our patient although his skin perfusion pressure (spp) in the dorsum of the foot was only 15 mmhg before mdt. a recent case report also indicated the possibility of mdt to improve blood flow, in addition to supporting its effectiveness for debridement, showing the increased skin perfusion pressure by 42 mmhg in the dorsum and 27 mmhg in the plantar. nevertheless, the number of published articles on this aspect is limited, and thus further investigation will be necessary before clear determination can be made. our case presented with five problematic conditions : (1) delayed wbp due to circulation failure, (2) difficulty of angioplasty after re - stenosis, (3) contraindication of highly invasive treatment, (4) infection by mrsa and (5) pain. to cope with these difficulties, mdt provided the benefits of the following : (1) capability of wbp by removing necrotic tissues with unclear margins, (2) possibility of improving blood flow, (3) effective debridement with low invasiveness, (4) antibiotic effect on mrsa and (5) capability of pain control using analgesics, adjusting the number of maggots and duration of treatment. the barthel index at the time of discharge from the hospital was a score of 80 ; thus, we considered that functionally meaningful limb salvage could be pursued. from these facts, mdt is believed to be an effective method to improve the wound surface with delayed healing, under the condition that a certain revascularization procedure is performed. mdt is one of the promising adjuvant treatments for patients with an unfavourable systemic condition and difficulty in undergoing highly invasive surgery. in conclusion, we could achieve functionally meaningful lower limb salvage by wbp with mdt for an ulcerated lower limb lesion in a cli patient who had a severe cardiac disorder, delayed healing of the wound surface and difficulty in undergoing a revascularization procedure after arterial restenosis. mdt is considered one of the adjuvant treatment strategies even for patients with cli, provided it is performed appropriately. the authors certify that there is no actual or potential conflict of interest in relation to this article. none of the authors received any financial support in association with this study and have no relationships that may pose an actual or potential conflict of interest.	abstractischaemic skin ulcer occurred on the foot of a 73-year - old man who had a history of fulminant myocarditis with severe cardiac dysfunction. we attempted wound bed preparation by maggot debridement therapy and salvaged his limb. it can be one of the adjuvant treatment strategies for critical limb ischaemia.
acute pyelonephritis complicates 1 - 2% of all pregnancies, making it one of the most common medical complications of pregnancy. escherichia coli remains the most common pathogen isolated in acute antepartum pyelonephritis, and ampicillin has been a mainstay of treatment for antepartum pyelonephritis because of efficacy, cost, and minimal risk to both the mother and fetus. because of its concomitant use in the prevention of neonatal group b streptococcal sepsis, there is concern for increasing trends of ampicillin - resistant organisms. in 1984, duff reported a 22% incidence of ampicillin - resistant e. coli in acute antepartum pyelonephritis. by 2001, hart reported a 45% incidence of ampicillin - resistant e. coli in acute antepartum pyelonephritis [2, 3 ]. globally, there are increasing rates of antibiotic - resistant strains of e. coli. this trend in antibiotic resistance caused the centers for disease control and prevention (cdc) to identify investigating the clinical implications of antimicrobial resistance as a priority. moreover, it has been postulated that infections with antibiotic - resistant organisms may increase the risk of treatment failures and morbidity [2, 5, 6 ]. accordingly, we sought to measure the incidence of ampicillin resistance in uropathogens causing acute pyelonephritis in our pregnant patient population and to determine if resistant organisms resulted in different clinical outcomes. this is a secondary analysis of a prospective longitudinal cohort study of 440 pregnant women diagnosed with acute pyelonephritis. the original cohort included all pregnant women with antepartum pyelonephritis admitted to parkland memorial hospital, dallas, tx, usa, from january 2000 to december 2001. the diagnosis of acute pyelonephritis was made with clinical findings of fever (temperature 38c), flank pain, and costovertebral angle tenderness along with laboratory findings of pyuria or bacteriuria (20 bacteria per high power field). clean catch mid - stream urine specimens or catheterized urine specimens were collected for culture. the presumptive diagnosis of pyelonephritis, however, was made and treatment initiated prior to receipt of culture results. antimicrobial therapy included intravenous ampicillin two grams every six hours and intravenous gentamicin, consisting of a loading dose of 120 mg once followed by 80 mg every eight hours. antimicrobial sensitivities were performed using a broth microdilution and the study utilized breakpoints established by the clinical and laboratory standards institute (clsi). antimicrobial sensitivities were not performed on uropathogens with colony counts of less than 100 000. ampicillin resistance was defined as a minimum inhibitory concentration (mic) greater than 16 g / ml. research nurses routinely entered pregnancy outcomes and complications for all women delivered at parkland hospital into a previously described, validated, and continuously updated computerized obstetric database. antepartum data on women with acute pyelonephritis were entered into a separate research database that included length of hospital stay, days of intravenous antibiotics received, vital signs, respiratory insufficiency, necessity of admission to an extended care unit, amount of iv fluid received, and laboratory evaluations including urine cultures, complete blood count, and creatinine as previously described. anemia was defined as a hematocrit less than 30%, and renal dysfunction was defined as creatinine 1.2 mg / dl. respiratory insufficiency was defined as dyspnea, tachypnea, and hypoxemia with radiological signs of pulmonary infiltrates (information regarding intubation was not recorded). the database created of antepartum pyelonephritis patient outcomes included urine culture results by organism, but it did not originally include information on antibiotic sensitivities. we subsequently re - examined the medical records of the 440 patients admitted with acute pyelonephritis to review the antibiotic sensitivities of the admission urine cultures and entered these into the database. these data were subsequently linked electronically to pregnancy outcome data from the obstetric research database. statistical analyses were performed using sas 9.1 (sas institute, cary, nc, usa). comparisons were made with the pearson 's chi - square test for categorical data and student 's t - test for continuous data. for statistically nonnormal data, the wilcoxon rank - sum test was substituted for student 's t - test. the mantel - haenszel chi - square was used to analyze trends in categorical data. urine cultures with identification of an organism with sufficient colony forming units for antibiotic sensitivity testing were available for 317 (72%) of the 440 initial study patients (72%). although additional patients had positive urine cultures, our laboratory did not perform antimicrobial sensitivities for cultures less than 100 000 colony - forming units. ninety - two percent (92%) of the cultures that had organisms identified and sensitivities performed grew e. coli. the other organisms identified with sufficient colony - forming units to receive antibiotic sensitivity testing included klebsiella pneumoniae, proteus mirabilis, and enterbacter species. overall, fifty - one percent (51%) of these organisms were resistant to ampicillin. we reviewed the demographic characteristics of the patients with ampicillin - resistant and ampicillin - sensitive organisms. as demonstrated in table 2, there was no significant difference in the ethnicity of patients with ampicillin - resistant organisms. the patients with ampicillin - resistant organisms, however, were more likely to be multiparous (p =.04). the patients with ampicillin - resistant organisms were also older (p =.04) (see table 3). we analyzed the hospital courses of women with acute antepartum pyelonephritis comparing patients infected with ampicillin - resistant and ampicillin - sensitive organisms. as summarized in table 4, we found no significant differences in length of hospital stay, days of iv antibiotics required, admission to the extended care unit, or rate of hospital readmission. we also compared the rates of common complications of acute antepartum pyelonephritis between the ampicillin - resistant and ampicillin - sensitive groups. patients with ampicillin - resistant organisms did not have higher maximum temperatures (see table 5). additionally, infection with ampicillin - resistant organisms was not associated with increased rates of anemia, renal dysfunction, or respiratory insufficiency. there was also no significant difference in the incidence of preterm birth between the two groups. we re - evaluated a large prospective longitudinal study of a cohort of women hospitalized with acute antepartum pyelonephritis to measure the incidence of ampicillin resistance in our patient population and to determine if resistant organisms resulted in different clinical outcomes. our review of the rate of ampicillin - resistance revealed that the majority of organisms cultured were resistant to ampicillin. as expected, e. coli was the most common pathogen cultured in acute antenatal pyelonephritis, and 51% of e. coli cultures were ampicillin - resistant. this finding is similar to hart 's finding in 2001 of a 45% rate of ampicillin - resistance in e. coli causing acute antepartum pyelonephritis. similarly, gupta found that from 1992 to 1996, the rate of ampicillin resistance in e. coli isolates increased from 26% to 34% in women with cystitis. all the klebsiella organisms cultured were ampicillin - resistant, while all proteus organisms cultured were ampicillin - sensitive. ninety - eight percent (98%) of klebsiella isolates were ampicillin - resistant, while only 8% of proteus species were ampicillin - resistant. the initial report from this study found an 11.6% rate of infection with gram - positive organisms, and the majority of these were identified as group b streptococcus. our laboratory does not perform antimicrobial sensitivities on group b streptococcus or any other gram - positive uropathogens with less than 100 000 cfu. our analysis of demographic characteristics of women with ampicillin - resistant organisms revealed no association with ethnicity. it did, however, demonstrate that infection with ampicillin - resistant organisms was more common in older and multiparous patients. the observed trend of increasing incidence of ampicillin - resistance with increasing age and parity may be due to increased exposures to antibiotics and to prior hospitalizations for deliveries. either of these events could increase their risk of acquiring resistant organisms compared with patients who are younger and nulliparous. while the impact of infection with organisms resistant to the initial antibiotic used to treat infection has been studied in septic and icu patients, no similar outcome studies have been conducted in acute antepartum pyelonephritis. in septic patients, infection with -lactam resistant strains of e. coli and klebsiella resulted in significantly higher mortality rates. other studies comparing patient outcomes between antibiotic - sensitive and antibiotic - resistant infections have shown increased length of hospital stay, increased rates of infectious complications, and increased cost of treatment [9, 10 ]. in light of these studies, we undertook this analysis to assess if infection with antibiotic - resistant organisms in acute antepartum pyelonephritis would affect patient outcomes. in acute antepartum pyelonephritis, infection with organisms resistant to ampicillin did not affect patient outcomes in terms of the course of their hospital stay or the frequency of common complications of pyelonephritis. the similarities in outcomes between patients infected with ampicillin - resistant and ampicillin - sensitive organisms are reassuring in light of the common use of ampicillin and gentamicin to treat acute antepartum pyelonephritis and the increasing reports of ampicillin - resistant organisms. the first explanation is that while over fifty percent of the organisms cultured were resistant to ampicillin, all patients were receiving gentamicin in addition to ampicillin. moreover, only a single patient had an organism that was resistant to gentamicin. ampicillin and gentamicin may create a pharmacologic synergy that may also explain the discrepancy between in vitro susceptibilities and in vivo findings. this also raises the question of whether treatment with gentamicin alone would be adequate to treat the majority of cases of acute antepartum pyelonephritis. the second explanation is that while these organisms were microbiologically resistant to ampicillin, they may not have been clinically resistant to ampicillin.. it can be defined genetically (genotypically), meaning that there is a genetic mechanism in the bacteria that encodes for resistance against a class of antibiotics. alternatively, resistance can be defined, as it was here, microbiologically (phenotypically) meaning that there is an abnormally elevated minimum inhibitory concentration (mic) observed in laboratory testing. finally, resistance can be defined clinically as the failure to demonstrate improvement in the patient receiving the medication. wing. alluded to this difference in microbiological resistance versus clinical resistance in their assessment of the utility of blood and urine culture results in acute antepartum pyelonephritis. in their study, some patients were receiving ampicillin and gentamicin while others were receiving monotherapy with a first - generation or third - generation cephalosporin. although they had ampicillin resistance rates of 46% and first - generation cephalosporin resistance rates of 7%, 94% of patients were given appropriate antibiotics when appropriate antibiotics of these, the majority of changes were due to perceived lack of clinical response, including persistent fever beyond 72 hours, rather than due to the sensitivity results of the cultures. this finding led wing. to conclude that blood and urine cultures with sensitivities have limited practical utility in the majority of patients with acute antepartum pyelonephritis. while we believe that culture results continue to have a role in determining the organisms causing infection, the success of therapy in sterilizing the urine, and the antibiotic resistance rates within our hospital, we agree that changes in antimicrobial therapy should be guided by clinical response rather than solely based on culture results. first, we included only patients managed as inpatients, and our findings may not apply to populations managed as outpatients. second, the only patients who had cultures with antibiotic sensitivities were those with gram - negative organisms, so we do not know the rate of ampicillin resistance in other pathogens or whether ampicillin resistance in those organisms would affect outcomes. in summary, we found no association with adverse clinical outcomes in gravidas with acute pyelonephritis treated with ampicillin and gentamicin that had ampicillin - resistant gram - negative uropathogens. these data should reassure clinicians that this well - established treatment regimen is still effective in the management of acute antepartum pyelonephritis in most settings.	objective. to measure the incidence of ampicillin - resistant uropathogens in acute antepartum pyelonephritis and to determine if patients with resistant organisms had different clinical outcomes. study design. this was a secondary analysis of a prospective cohort study of pregnant women admitted with pyelonephritis, diagnosed by standard clinical and laboratory criteria. all patients received ampicillin and gentamicin. results. we identified 440 cases of acute pyelonephritis. seventy - two percent (316 cases) had urine cultures with identification of organism and antibiotic sensitivities. fifty - one percent of uropathogens were ampicillin resistant. the patients with ampicillin - resistant organisms were more likely to be older and multiparous. there were no significant differences in hospital course (length of stay, days of antibiotics, ecu admission, or readmission). patients with ampicillin - resistant organisms did not have higher complication rates (anemia, renal dysfunction, respiratory insufficiency, or preterm birth). conclusion. a majority of uropathogens were ampicillin resistant, but no differences in outcomes were observed in these patients.
cranial irradiation has been widely used as a therapeutic method treating a wide variety of lesions, particularly neoplasms. though radiation therapy of central nervous system is usually well - tolerated, it does occasionally cause clinically significant long - term toxicity such as late delayed radiation necrosis and irradiation - related arteriopathy with stroke14). among other complications induction of neoplasm radiosurgery is not free from this problem although there are only a few reported cases14). we report a case of glioblastoma which was developed after gamma knife radiosurgery (gks) for meningioma. a 47-year - old woman presented with headache, anosmia, and visual dimness. large extra - axial mass originating from olfactory groove and both frontal base was found on mri (fig. she underwent gross total tumor removal, and the pathological diagnosis of meningotheliomatous meningioma was confirmed. approximately 1 year after surgery she underwent gks with 16 gy of marginal dose at 50% isodose line (fig. three years after initial radiosurgery, the subsequent mri scan revealed tumor progression at a location different from the previous recurrence. she underwent radiosurgery with 13 gy of marginal dose and she was subjected to third gks with 15 gy of marginal dose on local recurrent lesion after 2 years from second gks (fig. 2b, c). at 58 months from the initial gks, which is also 72 months from the first operation the patient experienced severe headache with vomiting and a huge new lesion was found in the area of the previous radiosurgery (fig. she was treated with concomitant chemo - radiotherapy (total dose of irradiation 6000 cgy over 30 fractions and oral temozolomide 75 mg / m / day during the radiotherapy period) followed by adjuvant chemotherapy with oral temozolomide. first cycle was consisted of 150 mg / m / day temozolomide for 5 days, and subsequent 5 cycles were maintained with 200 mg / m / day for 5 days with 4 weeks interval between each cycle. the tumor progression was significant at 11 months from the diagnosis of glioblastoma with neurological deterioration. currently, she is alive at the time of this writing (15 months after diagnosis of glioblastoma) with only supportive management. there is now increasing concern regarding the potential for radiation - induced neoplasm, because of the intensive use of radiotherapy under a wide range of doses and treatment conditions resulting in a longer survival of brain tumor patients2,14,24). despite the reported documents about the safety of radiosurgery, additional reports of glioma induction after radiosurgery may temper its use in the treatment of benign lesions, such as meningiomas, particularly in younger patients10,12). the following criteria for radiation - induced neoplasms have been previously described7,11) : 1) a second tumor occurs within the field of irradiation used to treat the primary disease ; 2) the tumor is not present prior to irradiation, and there has been a reasonable interval between radiotherapy and the detection of the second tumor (usually several years) ; 3) a histological difference exists between the primary and subsequent tumor ; and 4) no known genetic or predisposing conditions to secondary malignancy are observed. in other series, the criterion of latent period in radiation induced tumor was set to 5 years5,6,13). however, the " 5 year " period is not accepted as an absolute standard due to insufficient biologic evidence. therefore, the present case could be considered as radiation induced tumor. in this way, the present case fits the all criteria and deserves to be diagnosed as radiation - induced malignancy. however, radiation is now well recognized to be a trigger, not only a treatment, for cancer. when the cells are irradiated, the probability of malignancy increases with dose, most likely with no threshold. this view is based on experimental data showing that even a single photon can cause a base change leading to mutations that eventually can cause malignancy. that is, a cancer induced by a small dose of radiation is not less harmful than a cancer induced by a large dose. but, in the concept of biological equivalent dose, it is not a low - dose treatment, thus it could cause radiation induced tumor. the lower incidence of radiation induced tumor in radiosurgery, could be explained by relatively smaller volume of normal tissue exposed to radiation compared to conventional radiation. brada.4) reported the risk of second brain tumor formation in 334 patients treated for pituitary tumors with surgery and fractionated small - field irradiation (median dose, 45 gy). with a cumulative follow - up period of 3760 years, five patients developed second tumors (two astrocytomas, two meningiomas, and one meningeal sarcoma). the latency period is similar to what has been seen with fractionated therapy in the several years period after radiosurgery, and malignant tumors occur earlier than their benign tumor counterparts. the cumulative risk of developing second brain tumors was 1.3% at 10 years and 1.9% at 20 years. the relative risk of a second brain tumor was 9.38 compared with the normal population4). concerning the risk of developing a secondary neoplasm, several factors such as patient age, tissue vulnerability, radiation type and dose, underlying disease, and additional chemotherapy may all play an important role2,4,17,24,25). the relative risk of a secondary tumor following cranial irradiation in children has been estimated to be from 2.6 to 38.8 compared with the risk in the standard population8,15,22) while in the adult population it was estimated to be from 9.38 to 164,24). in some cases, sadetzki.16) described 253 patients who developed meningiomas after radiation for tinea capitis. the mean time from exposure to meningioma diagnosis was 36 years (range, 12 - 49 year). the authors found a higher incidence of multiple lesions, a younger age at diagnosis, and a higher percentage of calvarial lesions than in control patients who developed meningiomas without previous exposure to ionizing radiation16). in fact, the opposite may be more accurate, because high dose of radiation may sterilize the carcinogenic potential of a tissue by killing cells. only in those cells that are not killed deoxyribonucleic acid repair errors the efficiency of tumor induction varies inversely with repair capacity, which in turn depends on the integrity of cell cycle check - points3,9). the general form of the dose - response curve for radiation associated second tumors is not clear, but several experiments on small animals suggest that the incidence increases with dose up to a maximum usually occurring between 3 and 10 gy, followed by a subsequent monotonic decrease3). there are also studies reporting that the highest incidence of radiation associated second tumors occurs at field peripheries, where the dose is less than at the field center9). most of the reported cases of radiation - associated tumor were related to conventional radiotherapy. there were small number of malignant neoplasms after treatment of vestibular schwannoma, meningioma or arteriorvenous malformation (table 1). considering that carcinogenetic potential is not necessarily dose - dependent and sublethal damage and repair errors are required for development of secondary tumors, single session radiosurgery may be relatively safer than fractionated radiotherapy with repeated chance of sublethal damage. however, it seems that radiation - induced malignancy can occur within very low - dose peripheral regions as well as the full - dose regions. because the number of the patients who underwent radiosurgery and long - term follow up is much smaller than that treated with fractionated radiotherapy, relative safety of radiosurgery needs to be proven by further accumulation of clinical data. as cumulative level of radiation increases by the repeated gks, so does the oncogenic opportunity. in the present study, the cumulative radiation dose of three repeated gks is higher than that of conventional radiotherapy, leading to oncogenic change. in our series, clinical outcome was not different and as poor as primary glioblastoma treated with standard treatment of surgery, radiotherapy and chemotherapy. although malignancy after radiosurgery is very rare, its impact is not acceptable considering the benign nature of the primary disease. no one knows for sure that how much dose of the radiation causes oncogenic transformation. therefore, the possibility of this fatal complication should be balanced always in case of radiosurgery. we experienced a case of radiosurgery - associated glioblastoma that developed after gks for meningioma. although the risk of radiosurgery - associated tumor is very low, application of radiosurgery for benign tumors should be very cautious because its occurrence is fatal to the patients.	we report a patient who underwent gamma knife radiosurgery to treat recurrent meningioma after microsurgery and thereafter developed secondary malignancy adjacent to the original tumor. a 47-year - old woman had underwent resection of the olfactory groove meningioma. then radiosurgery was done three times over 4 year period for the recurrent tumor. after 58 months from the initial radiosurgery, she presented with headache and progressive mental dullness. huge tumor in bifrontal location was revealed in mri. subsequent operation and pathological examination confirmed diagnosis of glioblastoma. this case fits the criteria of radiation - induced tumor and the clinical implication of the issue is discussed.
persistent urogenital sinus (ugs) is a complex, challenging, and controversial pathology for the pediatric surgeon. it consists of a persistent communication of the genital and urinary tract with the urethra and vagina joined in a single common channel (cc), with the ugs reaching the perineum.1 it can be an isolated anomaly or associated with external genitalia virilization (congenital adrenal hyperplasia [cah ]), or included in the cloacal anomaly.2 3 4 surgery should be tailored to the individual patient according to either the length of the cc (that identifies low and high forms) or to the associated anomalies. simple flap vaginoplasties are sufficient to treat low ugs, whereas high forms require a more extensive dissection and a subsequent pull - through.3 4 this can be obtained by prior separation of the vagina and urethra (by the posterior sagittal transanorectal approach [psta ] or the anterior sagittal transrectal approach [astra ]) or by an en bloc procedure (total urogenital mobilization [tum ]). what we are reporting in this article is a modified technique combining the advantages of these two approaches which was performed on a patient with high ugs related to cah. the aim of opting for this combined approach was to reduce surgical trauma and to provide optimum anatomical visualization, thus simplifying surgery and obtaining good functional and cosmetic results. the patient was a girl (46 xx) born at 39 weeks of gestation with ambiguous genitalia. examinations were performed at another institution where a classic form of cah was diagnosed associated with ugs. we performed a cystoscopy and a vaginoscopy, after having identified the presence of a 3 cm long ugs : we performed a clitoridolabioplasty (fig. two - step surgery was recently introduced in our center for young patients to avoid lengthy operations in the case of long ugs (genital reconstruction in the first months of life and delayed urogenital mobilization within the 1st year). we also applied this protocol in the reported case, despite the fact that the girl had only come to our attention when she was already 2 years old (fig. 1). appearance of external genitalia of the patient at birth (a) and after clitoridolabioplasty (b). a full bowel preparation and a preoperative enema were given before surgery and the patient received broad - spectrum intravenous antibiotics. the rectum was irrigated with a 0.25% neomycin solution in the operating room before the procedure and the rectum was closed with a betadinized gauze. we carefully evaluated the length of the cc as well as the length of the urethra and vagina and the exact position of the confluence. we placed a 3f fogarty catheter in the vagina (the fogarty balloon was 8 mm in size) under vision. we then removed the cystoscope and placed an 8f foley catheter in the bladder (white probe in fig. the fogarty probe helped us to identify the vagina during initial dissection and it was later replaced by a 12f foley catheter (yellow probe in fig. the patient was then placed in the prone position with legs abducted and a roll placed under the pubis. we performed a circumferential incision around the meatus extending along the midline of the perineum superiorly to our end point, which was the anterior anal border (fig. the dissection started in the midline to release the ugs from the anterior rectal wall without injuring the anorectal sphincters. to achieve this, a series of 6/0 polyglactin suture was put in place across the meatus of the cc. the dissection maneuver was completed with the modification of the astra technique to increase the operative field by extending the dissection up to the anterior anorectal wall without opening it and keeping the anorectal sphincter complex intact. following this, both the sinus and posterior vaginal walls were exposed (fig. the dissection proceeded circumferentially and inferiorly to release the sinus from the pubis and free the sinus (fig. 2c, the procedure permitted both the urinary tract and the vagina to be mobilized as one block down to the perineum, enough to achieve a good length of the vagina and a wide vaginal opening (fig. the ugs was opened in the midline : its anterior wall (which corresponds to the inferior part of the ugs with the girl in prone position, as was our case) was used to create part of the urethral introitus and to consolidate the urethra to the vulva ; its posterior part was removed. the vaginal wall was then sutured to the perineal skin flaps using separate stitches of 5/0 polyglactin suture (fig. after 2 weeks of the surgery, vaginal dilatations were initiated by the patient 's mother once a day for the 1st week and then twice a week for a total of 3 months, increasing the size of the dilator to avoid postoperative vaginal stenosis (we started with hegar 6 and progressed up to hegar 9) (figs. 2 and 3). endoscopic evaluation (a) ; urogenital sinus dissection (b d) with the fogarty catheter (yellow in b) in the vagina and the foley catheter in the urethra (white in b) ; once the dissection is completed urethra and vagina are sutured to the perineum (e). (a) incision lines ; (b) total urogenital sinus mobilization (sagittal view in [b ] and axial view in [c ]). we did not come up against any complications such as infection, operative wound dehiscence, stenosis, or urethral fistula in the postoperative period. the girl showed neither fecal nor urinary incontinence after being toilet trained when she stopped wearing diapers. this evaluation was based on the results of questionnaires given to the parents concerning the number of accidents in a week : soiling, social problems, urinary incontinence, ability to hold defecation, or micturition and a feeling of urgency. a full bowel preparation and a preoperative enema were given before surgery and the patient received broad - spectrum intravenous antibiotics. the rectum was irrigated with a 0.25% neomycin solution in the operating room before the procedure and the rectum was closed with a betadinized gauze. we carefully evaluated the length of the cc as well as the length of the urethra and vagina and the exact position of the confluence. we placed a 3f fogarty catheter in the vagina (the fogarty balloon was 8 mm in size) under vision. we then removed the cystoscope and placed an 8f foley catheter in the bladder (white probe in fig. the fogarty probe helped us to identify the vagina during initial dissection and it was later replaced by a 12f foley catheter (yellow probe in fig. the patient was then placed in the prone position with legs abducted and a roll placed under the pubis. we performed a circumferential incision around the meatus extending along the midline of the perineum superiorly to our end point, which was the anterior anal border (fig. the dissection started in the midline to release the ugs from the anterior rectal wall without injuring the anorectal sphincters. to achieve this, a series of 6/0 polyglactin suture the dissection maneuver was completed with the modification of the astra technique to increase the operative field by extending the dissection up to the anterior anorectal wall without opening it and keeping the anorectal sphincter complex intact. following this, both the sinus and posterior vaginal walls were exposed (fig. the dissection proceeded circumferentially and inferiorly to release the sinus from the pubis and free the sinus (fig. 2c, the procedure permitted both the urinary tract and the vagina to be mobilized as one block down to the perineum, enough to achieve a good length of the vagina and a wide vaginal opening (fig. the ugs was opened in the midline : its anterior wall (which corresponds to the inferior part of the ugs with the girl in prone position, as was our case) was used to create part of the urethral introitus and to consolidate the urethra to the vulva ; its posterior part was removed. the vaginal wall was then sutured to the perineal skin flaps using separate stitches of 5/0 polyglactin suture (fig. after 2 weeks of the surgery, vaginal dilatations were initiated by the patient 's mother once a day for the 1st week and then twice a week for a total of 3 months, increasing the size of the dilator to avoid postoperative vaginal stenosis (we started with hegar 6 and progressed up to hegar 9) (figs. 2 and 3). endoscopic evaluation (a) ; urogenital sinus dissection (b d) with the fogarty catheter (yellow in b) in the vagina and the foley catheter in the urethra (white in b) ; once the dissection is completed urethra and vagina are sutured to the perineum (e). (a) incision lines ; (b) total urogenital sinus mobilization (sagittal view in [b ] and axial view in [c ]). we did not come up against any complications such as infection, operative wound dehiscence, stenosis, or urethral fistula in the postoperative period. the girl showed neither fecal nor urinary incontinence after being toilet trained when she stopped wearing diapers. this evaluation was based on the results of questionnaires given to the parents concerning the number of accidents in a week : soiling, social problems, urinary incontinence, ability to hold defecation, or micturition and a feeling of urgency. ugs abnormalities are one of the most challenging problems that the pediatric urological surgeon may face.5 the anatomy is complex and varied and adequate surgical exposure can be difficult. most patients are identified at birth with genital ambiguity, most commonly secondary to the cah. however, it may also occur as a pure ugs anomaly with apparently normal external genitalia.6 in all cases, surgery has three main goals : (1) to separate the urinary and genital tract, (2) to correct urinary continence, and (3) to prepare for normal reproductive and sexual life through reconstruction of the vagina and external genitalia.7 in 1982, the posterior sagittal access proposed by pea for patients with cloaca was quickly extended to the treatment of urogenital malformations (prostatic utricles, urethral strictures, atresia of the vagina, ugs), sectioning the anterior and posterior rectal walls in the midline or incising the muscles in the median raphe (psta).8 9 however, the main disadvantage of this technique was the potential damage to perirectal nerves behind the rectum.7 in 1997, dmini sectioned only the anterior rectal wall in an astra to treat ugs in adrenogenital syndrome.10 this approach permitted an excellent anatomical view with a midline incision sparing the levator ani muscle complex and the external sphincter. the authors reported a low risk of fecal incontinence, easier reconstruction, and no need for a protective colostomy with proper bowel preparation. variations of the astra, which avoid entering the rectum, have been proposed, including a prone transperineal approach (by rink) and a pararectal approach.6 11 12 in the same year, pea described a circumferential mobilization of the ugs as a single unit called tum.13 this allowed a midline perineal approach without rectal dissection and with good visualization of the sinus while the patient lies supine. this procedure has gained widespread acceptance and has almost entirely replaced the older techniques.3 14 unfortunately, in this position the identification of the vaginal confluence is difficult, as well as the perivaginal dissection or the complete release of the vagina from the surrounding tissues. the original description of tum limited its use to ug sinuses, less than 3 cm long and required discarding the excess sinus tissue13 15 that inhibits the vagina from reaching the perineum, thereby creating a wide vaginal opening. he had to convert to astra in both cases to gain adequate exposure and admitted that either approach could be attempted initially, especially in infants (where tissue elasticity is excellent and planes are easier to dissect), followed by astra if better visualization is needed.5 at our center, 99 patients with type iii vaginal malformations were treated from 1980 to 2014.4 we applied the benefits of both the astra and tum techniques without splitting the rectal wall.16 we placed the patient in a prone position with bowel preparation and antibiotic therapy. as well as providing excellent exposure, we believe that this approach is safe, and leads to less morbidity than conventional astra, as it avoids the splitting and suturing of the anterior rectal wall. we additionally benefited from tum as it also avoids dissection between the urethra and vagina. as far as the choice of performing two - step surgery is concerned, it was related to the strong psychological pressure from parents, due to cultural reasons. this was the case reported ; the girl came to our attention when she was already 2 years old and the parents were extremely upset because of the external aspect of the genitalia. in these cases, our experience has shown that a two - step approach is useful to immediately reduce stress for the family. incidentally, in patients under 3 years of age, we perform the operation as a single procedure. we acknowledge that the main limitation of our article is that it is a case report and further studies are required to draw definitive conclusions. moreover, long - term outcomes, especially during adolescence, should be assessed. as for the simplicity of the technique, we believe that the correction in older patients is more difficult, but this is a consideration which also applies to the other procedures (e.g., pure tum, pure astra). in conclusion, the approach described above combines the advantages of astra and tum : on the one hand, it is an anterior sagittal approach that does not require rectum splitting, while on the other it has the benefit of avoiding dissection between the urethra and vagina. it is a feasible procedure, which provides excellent exposure and easy identification of the vaginal confluence for cah associated with long ugs. it is an anterior sagittal approach that does not require rectum splitting with the benefit of avoiding dissection between the urethra and vagina. it is a feasible procedure, which provides excellent exposure and easy identification of the vaginal confluence for congenital adrenal hyperplasia associated with long ugs.	persistent urogenital sinus (ugs) is a developmental anomaly. it represents one of the most complex problems that a pediatric surgeon may deal with. we report the case of a patient with ugs treated at 3 years of age by anterior sagittal transrectal approach and en bloc sinus mobilization. the procedure was performed with the patient prone with the initial idea of performing an anterior sagittal transrectal approach. the described approach allows an excellent anatomical view with a midline muscle sparing incision, along with an easy identification of the vaginal confluence with the benefit of avoiding dissection between the urethra and vagina.
with advances in health care and increasing life expectancy, the population of older adults is increasing in most countries. it is estimated that the population aged 60 years and above will rise from 287 million in 2013 to 417 million in 2050 in the developed world, and from 554 million to 1.6 billion in developing countries.1 advancing age is the strongest risk factor for the development of dementia,2 and dementia has been identified as a major current health care challenge.3 the worldwide prevalence of dementia in 2001 was estimated at 24.3 million, and will double every 20 years to an estimated prevalence of 42.3 million in 2020, and 81.1 million in 2040.4 alzheimer s disease (ad) is the most common form of dementia among older adults, accounting for about two - thirds of all cases.5 the burden of dementia on society is substantial : in the united states, the estimated annual direct costs associated with ad in 2013 were $ 203 billion.6 ad is also a leading cause for admission to long - term care facilities7 as well as a risk factor for hospitalization.8 dementia care is particularly time intensive, and, in 2012, caregivers provided 17.5 billion hours of care to ad patients in the us.6 ad is essentially irreversible, and approaches to prevention or treatment have not emerged. ad is a multifactorial disease, and its risk factors can be categorized into non - modifiable and potentially modifiable ones. in addition to advancing age, other non - modifiable risk factors include female sex9,10 and genetic risk factors for both early - onset and late - onset dementia.11 apolipoprotein e (apoe) is associated with amyloid plaques and neurofibrillary tangles in ad, and apoe4 polymorphisms have been associated with sporadic ad.11,12 there are several potentially modifiable risk factors associated with ad. vascular risk factors include diabetes mellitus,13 hypertension, and hypercholesterolemia.14 possible nutritional risk factors include low levels of vitamin b12 and folate, as well as hyperhomocysteinemia.15 head injuries are another potentially preventable risk factor for ad.16 reducing these modifiable risk factors, prior to the onset of cognitive symptoms, could significantly lower ad prevalence.17 for example, lifestyle changes that could delay the onset of dementia by 2 years would translate into a reduction of 36% of dementia cases, and could also yield 30-year reduction in total economic burden of cad219 billion in canada alone.18 as the population ages, surgery is being performed more frequently, and in progressively older adults.19 in the us, approximately 35% of all surgical procedures are performed on adults older than 65 years.20 there has been increasing concern and research investigating whether cognitive sequelae such as postoperative delirium (pod) or postoperative cognitive dysfunction (pocd) are related to specific surgical and/or anesthetic factors. pod has been defined as an acute change in cognitive status characterized by fluctuating attention and consciousness, which typically occurs soon after surgery,21 while pocd is characterized by more persistent cognitive difficulties, including memory and attention problems, as well as executive dysfunction, and occurs commonly after surgery.22 cognitive dysfunction is relatively common during the postoperative course of older adults, and anesthetics have been thought to possibly contribute to this. short - term cognitive dysfunction (days to months) encompasses both pod and pocd, while some patients may also experience longer - term cognitive changes (eg, greater than 6 months) postoperatively. in this review, we will provide an overview of the relationship between surgery and anesthesia and subsequent cognitive changes including ad and related forms of dementia. we will first review the pathology of human ad, then we will discuss possible mechanisms by which surgery and anesthesia may produce cognitive changes or dementia, and then review biomarker evidence for these mechanisms. this review will also outline the epidemiological evidence for ad risk after exposure to surgery and general anesthesia (ga). the diagnostic criteria for dementia published by the alzheimer s association define dementia as the development of cognitive or neuropsychiatric symptoms that are associated with a decline in the individual s previous level of functioning, encompassing multiple cognitive domains, and that are not better explained by delirium or another major psychiatric disorder.23 most recently, guidelines have also incorporated biomarker evidence within these diagnostic criteria. these biomarker changes can include either decreased levels of amyloid - beta (a), together with increased total tau or phosphorylated tau in the cerebrospinal fluid (csf) of the individual.24 the molecular neuropathology of ad reveals two major hallmarks : extracellular plaques consisting largely of a aggregates, and intracellular neurofibrillary tangles composed of hyperphosphorylated tau protein. the amyloid cascade hypothesis states that some forms of the a peptide are neurotoxic and cause abnormal phosphorylation of tau, leading to tau forming paired helical filaments which result in neurofibrillary tangles. this cascade also results in mitochondrial damage, calcium dysregulation, and, ultimately, apoptosis and neurodegeneration.25 it has been postulated that amyloid changes precede the onset of clinical symptoms of dementia by a decade or more.26,27 results from 128 participants enrolled in the dominantly inherited alzheimer network show that changes reflecting ad pathology begin 25 years before expected symptom onset.28 a peptide levels in csf became abnormal first, and were followed by amyloid accumulation and cerebral atrophy and then impaired cerebral glucose metabolism. autopsy studies have consistently found amyloidopathy and tauopathy in the brains of those diagnosed with ad.29,30 further, biomarker studies show that a peptide concentration in csf is inversely related to the degree of ad pathology,31 likely because of sequestration in plaque or diminished synaptic activity. interestingly, both amyloid plaque and reduced csf a have been described in some older adults with no clinical symptoms indicative of a cognitive impairment.32 this suggests that amyloidopathy alone is insufficient for the development of clinical symptoms. the presence of tau in csf, although not specific for ad, indicates neuronal injury. tau is usually elevated in the csf of individuals with ad33 and other tauopathies such as frontotemporal dementia.34 the ratio of total tau to a is currently used as a diagnostic adjunct for ad.35 positron emission tomography (pet) scans have been used to quantify the extent of amyloid deposition in vivo. for example, compounds that preferentially bind to amyloid fibrils (11-c pittsburgh compound b, f - florbetapir, f - flutemetamol, and f - florbetaben) are available, and studies to date indicate they sensitively report cerebral amyloidosis on pet scans.36,37 since amyloidopathy reflects an early stage in the pathology, pet scanning may allow risk stratification well before symptoms begin. further, pet scans demonstrate a decreased uptake of f - fluorodeoxyglucose, a marker of cerebral glucose metabolism, in patients with ad, likely reflecting the decreased neuronal mass secondary to neurodegeneration.27 the early detection of risk is important because it may allow patients to modify ad risk factors. however, it is now clear that false positives occur with these and other biomarkers, which has potential implications when considering the use of these biomarkers. cholinergic dysfunction has been implicated in the clinical symptoms of dementia,3840 and postmortem studies have identified a significant deficiency in the activity of choline acetyltransferase in the brains of individuals with dementia.41 ad is also associated with a loss of cholinergic neurons, and acetylcholine modulates higher functions of the brain such as memory, learning, and attention. the cho - linergic deficit seen in ad is associated with the degree of cognitive dysfunction, providing the rationale for the use of acetylcholinesterase inhibitors in ad. other neurotransmitters, including excitatory amino acids (eg, glutamate), can be neurotoxic, and may play a role in the pathophysiology of ad.42,43 changes in neurotransmitter function may also provide potential links between exposure to ga, surgery, and cognitive changes following surgery. several mechanisms linking anesthetics to worsening of ad pathology from basic science studies have been proposed, providing a potential causal connection between anesthesia exposure and development of ad.44 an in vitro study showed that the volatile anesthetics halothane and isoflurane increase oligomerization and cytotoxicity of amyloid peptides.45 both in vitro and animal studies show that sevoflurane and isoflurane can cause neuronal apoptosis by activating caspase and a protein aggregation.46,47 further, after exposure to isoflurane, mice displayed behavioral impairments and increased mortality.48 propofol, another intravenous anesthetic, also increases tau phosphorylation in the mouse hippocampus.49 overall, information has shown potential linkages between surgery and changes in ad - related pathology, as well as between anesthesia and changes in ad - related pathology. ga could theoretically also contribute to cognitive deficits by altering central cholinergic transmission through nicotinic and muscarinic receptors. a decrease in acetylcholine neurotransmission facilitates some of the desired effects of ga, including analgesia, amnesia, immobility, and hypnosis.50 some anesthetics inhibit n - methyl - d - aspartate (nmda) receptors, leading to decreased glutamate release and a subsequent decrease in excitatory activity.51 however, prolonged exposure to nmda antagonists, such as ketamine, may upregulate nmda receptors following sustained blockade, which, on removal of drug, leads to excitotoxicity and apoptosis via an increase in calcium influx.52 there is a large body of literature from animal studies examining the effects of surgery on cognitive function. cognitive decline in aged mice following surgery has been associated with microgliosis, a production, and tau protein hyperphosphorylation in the hippocampus.53 the role of neuroinflammation as a result of surgery has also been extensively studied. in mice, surgery leads to the production of tumor necrosis factor (tnf-), which subsequently disrupts the blood brain barrier, causing an infiltration of inflammatory macrophages in the brain parenchyma, specifically the hippocampus.53 the levels of the inflammatory cytokines il-1 and il-6 have also been shown to increase in mice that underwent surgery, compared to mice who only received anesthesia.54 in this same study, the levels of cytokines in the group that received anesthesia without surgery were comparable to anesthesia - nave control mice.54 this work demonstrates that the inflammatory response and resultant cognitive deficits may largely be a result of surgery rather than due to any specific effects of ga. however, these findings only reflect data from animal studies and it is unclear to what extent these findings extend to humans. thus, in the future, data from studies investigating the effects of specific anesthetics on neurotransmitter function may provide some guidance for the selection of anesthetics to reduce cognitive dysfunction in the elderly. longitudinal studies with a prolonged follow - up period would be required to causally link surgery and anesthesia with the development of clinically diagnosed ad. in the absence of these studies, it may be possible to examine the effects of ga on more proximal ad csf or neuroimaging biomarkers. studies have shown that ad biomarkers are altered in the csf of individuals undergoing cardiac and noncardiac surgery.55,56 palots conducted a small study on the csf of 14 patients without dementia undergoing coronary artery bypass graft surgery (cabg). csf samples were collected prior to surgery and 1 week and 6 months post - operatively. levels of a, tau, and s100beta (a marker of nonspecific brain injury) were measured. the increase in s100beta subsided, and a peptide decreased to below baseline, while tau continued to rise.55 the 6-month values in csf biomarkers were roughly comparable to those generally observed in patients with ad, although this particular study did not have an ad control group, and the data for ad csf biomarker levels were cited from other studies. further, although the decline in cognitive function was statistically significant, it is unclear to what extent the decline in cognitive function correlated with biomarker changes among individual patients. shiiya reported the findings of 28 patients who underwent prosthetic replacement of the descending thoracic or thoracoabdominal aorta.57 csf levels of tau and s100beta were measured immediately before and up to 72 hours after surgery. the levels of csf tau and s100beta were only increased in individuals with brain infarction or transient neurologic dysfunction ; no increase in these csf biomarkers was found in individuals who did not have neurologic complications. tang studied the csf of eleven patients undergoing idiopathic csf leak correction for biomarkers of ad. all patients received ga, with either intravenous propofol and remifentanil, or the inhalational anesthetic sevoflurane. levels of a peptide, total tau and phosphorylated tau, s100beta, interleukins 6 and 10, and tnf- were measured. mean a peptide concentrations were statistically unchanged, whereas levels of total tau were significantly increased at 6 and 24 hours postoperatively. phosphorylated tau was also increased, although not to the same extent as total tau. s100beta, and the interleukins 6 and 10 and tnf-, were increased in the csf of these individuals as well.56 the aforementioned studies indicate biomarker changes that may reflect an increase in ad risk after anesthesia and surgery. another study reported the findings of changes in the csf of ten patients who underwent cardiac valve replacement surgery with cardiopulmonary bypass. csf samples were collected a day before surgery and 24 hours postoperatively, and assessed for levels of total tau, neurofilament light chain protein, neuron - specific enolase (indicator of neuronal damage), s100beta, glial fibrillary acidic protein (marker of glial cell injury), and the cytokines interleukins 6 and 8.58 levels of s100beta and glial fibrillary acidic protein increased by 35% postoperatively, while levels of total tau, neurofilament light chain protein, and neuron - specific enolase did not change significantly. the levels of both interleukin 6 and 8 in the csf increased significantly after anesthesia and surgery as well. the above studies demonstrate that surgery and anesthesia may be associated with markers of neuronal injury, although their results should be interpreted with caution due to the small size and the unclear correlation between biomarker changes and cognitive deficits. these early postoperative cognitive changes could possibly be linked to development of persistent cognitive deficits consistent with ad. pod occurs commonly after surgery in older adults, and the average incidence of pod has been estimated at 36.8%,21 although rates as high as 73.5% have also been reported.59 additionally, the depth of anesthesia as measured by bispectral index (bis) has also been investigated in relation to pod, and there is evidence suggesting that depth of anesthesia may be related to the risk of delirium.60 radtke showed that incidence of pod in surgical patients whose depth of anesthesia was monitored by bis was 16.7%, compared to 21.4% in the control group (p=0.036).61 another study showed similar results, with the rate of pod being significantly lower in the bis group than in the control group (15.6% versus 24.1%, p=0.01).62 however, results of a recent meta - analysis show that ga does not appear to confer higher risk to the development of pod as compared to regional anesthesia (ra).63 further, it has also been demonstrated that individuals who have baseline cognitive impairment are not at increased risk of developing pod if they receive ga versus regional anesthesia.64 it is evident from these studies that older adults are vulnerable to developing pod and that there are several factors, including premorbid cognitive status, which put them at risk. long - term consequences of pod can be substantial, and it has been reported that pod is associated with prolonged cognitive impairment in patients who have cardiac surgery.65 additionally, pod was associated with an increased risk of developing dementia among older adults without dementia undergoing hip fracture surgery at 5-year follow - up.66 another study showed that patients who developed delirium after hip fracture (pre- and postoperatively) had a higher rate of incident dementia at 6-month follow - up (adjusted odds ratio = 10.5).67 long - term consequences of pocd are significant, as patients with pocd have higher mortality rates at 3 months and 1 year compared to controls.68,69 the reported incidence of pocd has varied considerably across studies, partly due to changes in how it was measured : there is no uniform consensus definition of what degree of cognitive impairment qualifies as pocd. studies on pocd have been criticized due to either the presence of a poorly matched control group or the complete absence of one.70 in a large prospective study, cognitive decline at discharge was reported in 53% of the patients who underwent coronary artery bypass surgery.71 the incidence decreased to 36% at 6 weeks and 24% at 6 months. however, there was no control group in this study. in a systematic review, the pooled prevalence of pocd was estimated to be 22.6% in the 2 months after surgery.72 a large cohort study reported the rates of pocd in patients undergoing major noncardiac surgery : the prevalence of pocd was 25.8% at 1 week and 9.9% at 3 months post - operatively in the surgical patients, whereas the prevalence of cognitive dysfunction in the nonsurgical control group was 3.4% and 2.8% at 1 week and 3 months, respectively (p 60 years old undergoing elective orthopedic or abdominal surgery and 138 matched controls. at 52 weeks, mild and moderate pocd were significantly lower in the intervention group compared to the nonintervention surgical group (84% versus 56%, p=0.015). severe pocd was also lower in the intervention group (3.7% versus 12.5%, p=0.36). one of the tests used to measure cognitive function was the mini - mental state examination (mmse), which may not be sensitive to milder cognitive changes and is also prone to potential learning effects.75 therefore, these results should be interpreted with caution. radtke showed that there was no statistically significant difference in the rate of pocd in patients whose depth of anesthesia was monitored by bis versus the control group utilizing routine anesthetic monitoring.61 however, another group of investigators showed that, although there was no statistically significant difference in the rate of pocd at 7 days between patients who had bis monitoring and those in the control group, rates of pocd in the intervention group were lower at 3 months compared to the control group (10.2% versus 14.7%, adjusted odds ratio = 0.67, p=0.025).62 there are methodological limitations in the existing studies of pocd related to the measures used to define pocd. these limitations include : potential learning effects ; floor and ceiling effects ; test sensitivity ; timing of postoperative testing ; and lack of diagnostic criteria for pocd.76 therefore, it is essential that diagnostic criteria for pocd be standardized, as well as recommendations be made for the use of standardized neuropsychological tests. there are certain similarities between pocd and ad, including advanced age being the strongest risk factor for both. additionally, the clinical presentations described in the literature for pocd can encompass dysfunction in multiple cognitive domains similar to ad, for example, memory impairment, attention and concentration difficulties, and executive dysfunction. however, the association between pocd and development of dementia is unclear at this time. the international study of postoperative cognitive dysfunction (ispocd) group recently published a cohort follow - up study, presenting the results of 686 patients from the original ispocd1 and ispocd2 studies22,7780 who had been followed for a median of 11.1 years. the outcome was the first occurrence of dementia in patients who had been diagnosed with pocd at 1 week and 3 months after surgery. the hazard ratio for the development of dementia was 1.16 for patients who had pocd at 1 week, and 1.50 for patients with pocd at 3 weeks. even though this increase may appear to be clinically significant, due to the limited power of this study, the authors concluded that there was no statistically significant association between incident dementia and pocd at 1 week (p=0.74) and 3 months (p=0.47) as compared to patients who did not have pocd.81 further well - designed and adequately powered studies with a long follow - up period are needed to establish whether there is an association between pocd and dementia. it is challenging to separately examine the independent effects of surgery and anesthesia on postoperative cognition and development of dementia. surgery leads to a larger stress response in older adults and in those who have preexisting ad compared to younger patients and those without ad.82 surgery could influence cognition by altering cerebral perfusion and autoregulation. lower cerebral perfusion pressure can lead to ischemia, and higher pressures can cause cerebral edema.83 observational studies have demonstrated that certain types of surgeries, such as cardiovascular, genitourinary, abdominal, musculoskeletal, dermatological, and eye surgeries, may confer a higher risk of developing dementia,84,85 although it is unclear whether these specific surgery types are associated with greater alterations in cerebral perfusion and/or autoregulation, or whether the indication for surgery itself represents the direct risk factor. researchers have conducted observational studies in order to examine the relationship between prior exposure to ga and subsequent risk of dementia. case - control studies investigating potential risk factors associated with dementia, and specifically ad, have also assessed the risk of having anesthesia and surgery. this study design provides a matched control group in order to provide a more robust method of establishing an association. we published a meta - analysis of case - control studies examining the association between ga and ad.86 this review defined exposure to ga as any history of surgery under ga as compared to no history of surgery under ga (ie, the control group could either be nonsurgical or a surgical control group receiving regional anesthesia). fifteen studies were included in this meta - analysis, including a total of 1,752 cases and 5,261 controls. overall, there was no statistically significant association of ga with the development of ad (pooled odds ratio = 1.05, p=0.43). subgroup analyses compared ga exposure to regional anesthesia and the effect of cumulative anesthesia / surgery exposures over the patient s lifetime. we found no difference in the odds ratio for developing ad after receiving ga compared to ra. there was also no statistically significant association between cumulative exposure to ga and development of ad. since the publication of that meta - analysis, additional studies have been published that have investigated the role of ga in the development of ad. sprung conducted a retrospective population - based nested case - control study using the rochester epidemiology project and the mayo clinic alzheimer s disease patient registry.87 they identified 877 cases of incident dementia recorded between january 1, 1985 and december 31, 1994, and sex- and aged - matched individuals who did not have a diagnosis of dementia in the incident year made up the control group. exposure to anesthesia in the study group was determined by reviewing medical records for each patient after age 45 years and before the index year. among cases, 70% of individuals had been exposed to ga compared to 72.5% of the control group. the authors did not find a significant association between exposure to anesthesia after age 45 years and the diagnosis of dementia (p=0.27), and also found no association between the number of procedures or cumulative exposure to anesthesia and development of dementia (p=0.51). a second case - control study with a large sample size this study identified 5,345 patients from the insurance claims database who were over the age of 50 years and had a new diagnosis of dementia, and 21,380 patients without dementia. these groups were matched for age, sex, and index year.88 the authors divided ga into three categories : endotracheal tube intubation ga (etga), intravenous injection ga (ivga), or intramuscular injection ga (imga), versus sedation only. the dementia group had greater exposure to etga, ivga, and imga when compared to controls, whereas the rates of use of heavy sedation did not differ between the groups. patients exposed to etga (odds ratio = 1.34) or ivga / imga (odds ratio = 1.28) were at significantly higher risk of developing dementia in a dose in addition to case - control studies, observational data are also available from cohort studies. lee performed a retrospective cohort analysis to study the relationship between surgery, ga, and ad. the study population included individuals aged 55 years old or older without a diagnosis of ad prior to surgery. one group received ga and underwent regular cabg, while the other group received only sedation for percutaneous transluminal coronary angioplasty for stent placement. in the 5-year follow - up period, patients who had undergone cabg and ga had a 1.7-fold increased risk of developing ad compared to those who had had sedation and percutaneous transluminal coronary angioplasty.85 vanderweyde conducted a retrospective cohort study on two groups of surgical patients undergoing either prostate or hernia surgery under either ga or regional anesthesia. their results showed that the patients who had received ga developed dementia less frequently than those who had received regional anaesthesia89 (adjusted hazard ratio = 0.65 for ga), although the depth or amount of sedation in the regional anesthesia group was not measured. a retrospective cohort study was also performed in taiwan using the longitudinal health insurance database.84 the study cohort comprised 24,901 patients 50 years and older who, since 1995, were anesthetized for the first time between january 1, 2004 and december 31, 2007. the investigators recorded the first occurrence of a diagnosis of dementia (presenile dementia, senile dementia, or ad). in order to distinguish dementia from pocd, the diagnosis had to be recorded twice, with first occurrence being at least 3 months after administration of anesthesia to minimize the possibility of misdiagnosing pocd as dementia. in a 3- to 7-year follow - up period, the risk of dementia in the anesthesia group was significantly higher than in the control group (hazard ratio = 1.99, p<0.001). within the anesthesia group, patients who received regional anesthesia were at a higher risk of developing dementia as compared to the ga group (p<0.001). the authors concluded that patients undergoing anesthesia and surgery are at higher risk of developing dementia. recently, liu conducted a prospective randomized parallel - group study on the effects of anesthesia on the progression of amnestic mild cognitive impairment (amci) to ad in a chinese population.90 the study group consisted of 180 patients who had a diagnosis of amci, a subtype of mild cognitive impairment in which memory problems are the predominant symptom. these patients were randomly assigned to receive sevoflurane, propofol, or lidocaine epidural anesthesia for lumbar spinal surgery. neuropsychological tests were conducted at baseline before surgery, and csf samples were obtained and levels of a peptide, total tau, and phosphorylated tau were measured. at 2-year follow - up, the number of patients who had progressed to ad did not differ between the two groups. patients assigned to receive lidocaine epidural anesthesia or intravenous propofol anesthesia had the same rate of progression of amci as the control group, whereas the rate of progression to dementia was faster in the sevoflurane group (p=0.005), and the number of progressive amci cases was higher compared to the other groups (p=0.01). the authors concluded that sevoflurane anesthesia for lumbar spine surgery accelerated cognitive decline, but that further studies with a larger sample size and longer follow - up period were required to investigate this relationship further. older adults are requiring the use of surgery and ga more frequently, and it is pertinent to examine whether surgery and ga are associated with the development of ad. in vitro and animal studies suggest that surgery and ga can accelerate ad pathology. cognitive changes, including pod and pocd, after surgery and anesthesia are common in the elderly. however, it is unclear whether surgery and anesthesia increase the risk of longer - term cognitive disorders such as dementia and ad. data from observational studies in humans on the relationship between surgery, ga, and ad have been inconsistent. a previously published meta - analysis failed to show an association between surgery, ga, and ad in case - control studies. some studies published more recently do suggest a possible association between exposure to surgery and anesthesia and the development of ad. given the gaps identified in the current research literature, there are several factors that should be considered in designing future studies in this important area. future study designs should include a sufficient sample size ; presence of a nonsurgical, non - anesthetized control group ; assessment of preoperative cognition, using standardized neuropsychological testing for cases and controls ; and possibly the use of biomarkers and neuroimaging for determining amyloid load and ad pathology. in summary, adequately powered prospective trials meeting the aforementioned criteria, and with a longer follow - up period, are required to determine whether exposure to surgery and/or ga are causally associated with the development of ad.	in this review, we aim to provide clinical insights into the relationship between surgery, general anesthesia (ga), and dementia, particularly alzheimer s disease (ad). the pathogenesis of ad is complex, involving specific disease - linked proteins (amyloid - beta [a ] and tau), inflammation, and neurotransmitter dysregulation. many points in this complex pathogenesis can potentially be influenced by both surgery and anesthetics. it has been demonstrated in some in vitro, animal, and human studies that some anesthetics are associated with increased aggregation and oligomerization of a peptide and enhanced accumulation and hyperphosphorylation of tau protein. two neurocognitive syndromes that have been studied in relation to surgery and anesthesia are postoperative delirium and postoperative cognitive dysfunction, both of which occur more commonly in older adults after surgery and anesthesia. neither the route of anesthesia nor the type of anesthetic appears to be significantly associated with the development of postoperative delirium or postoperative cognitive dysfunction. a meta - analysis of case - control studies found no association between prior exposure to surgery utilizing ga and incident ad (pooled odds ratio = 1.05, p=0.43). the few cohort studies on this topic have shown varying associations between surgery, ga, and ad, with one showing an increased risk, and another demonstrating a decreased risk. a recent randomized trial has shown that patients who received sevoflurane during spinal surgery were more likely to have progression of preexisting mild cognitive impairment compared to controls and to patients who received propofol or epidural anesthesia. given the inconsistent evidence on the association between surgery, anesthetic type, and ad, well - designed and adequately powered studies with longer follow - up periods are required to establish a clear causal association between surgery, ga, and ad.
pathophysiological cycles of denervation and impaired reinnervation, the loss of entire motor units, unloading due to prolonged periods of disuse, and excitation - contraction uncoupling may trigger a substantial loss in skeletal muscle mass and function. although considerable interindividual differences exist in the functional decline of the musculature during aging, most elderly people experience a general loss in skeletal muscle strength. while regular physical activity and a protein - rich diet can partially counteract severe muscle wasting, a sedentary life style and certain medical conditions, such as diabetes, cancer, renal failure, chronic obstructive pulmonary disease, or congestive heart failure [57 ], clearly promote muscle degeneration. skeletal muscle wasting plays a crucial role in physical disability, frailty, and loss of independence in aged people. skeletal muscle wasting in the elderly has been termed sarcopenia of old age, whereby this muscular impairment is probably due to multiple factors, as outlined in figure 1. on the cellular level, a variety of abnormal structural, physiological, and biochemical processes have been identified that are directly or indirectly associated with age - dependent muscle wasting. this includes a severe decline in contractile efficiency, increased apoptosis, denervation - associated atrophy, bioenergetic changes, impaired ion homeostasis, excitation - contraction uncoupling, decreased capacity for fibre regeneration, a partially diminished cellular stress response, and an altered equilibrium of hormones and growth factors crucial for the maintenance of contractile function, as well as oxidative stress and mitochondrial abnormalities [2022 ]. although individual muscles in aged humans and animal models of sarcopenia exhibit alterations in the molecular composition of contractile fibres and changes in their glycolytic and aerobic capacity, findings on distinct shifts in fibre types with aging are highly variable [2326 ]. however, since mitochondrial functions are clearly impaired in senescent muscle tissues, it was of interest to summarize the impact of recent mass spectrometry - based proteomic studies on the molecular fate of mitochondrial enzymes in senescent fibres. this paper briefly outlines the proposed role of mitochondria in cellular senescence and recent achievements of mitochondrial proteomics and then focuses on findings from proteomic profiling studies of aged skeletal muscle preparations and the identification of mitochondrial elements as potential markers of fibre aging. mitochondria are the primary site for energy generation via oxidative phosphorylation and play a key role in protein transport, intermediary metabolism, cell cycle progression, calcium signaling, and the regulation of apoptosis. proteomic cataloguing studies of this crucial organelle suggest the existence of approximately 1,500 mitochondrial proteins [2830 ], whereby altered expression levels within the mitochondrial proteome are critical factors for normal development and numerous diseases [3133 ]. changes in mitochondria have long been associated with playing an integral role during natural aging [3437 ], and the pharmacological application of antioxidants for counteracting mitochondria - specific symptoms of senescence is being extensively studied. interestingly, the mitochondrial theory of aging also encompasses the mechanisms that may lead to cellular senescence in contractile tissues [3941 ]. altered levels of mitochondrial activity in aged muscle tissues have been well established and extensively reviewed [4244 ]. the detrimental accumulation of mitochondrial dna deletions and mutations on the genetic level and deficiencies in the mitochondrial electron transport chain on the biochemical level are clearly associated with muscle aging. the pathological consequences of an age - related decline in mitochondrial function are the impairment of essential atp - dependent cellular processes and amplified oxidative stress in senescent tissues due to the increased release of reactive oxygen species from the mitochondrial respiratory chain [46, 47 ]. in general, senescent muscle tissues are exposed to an enhanced production of mitochondrial reactive oxygen species, increased mitochondrial apoptotic susceptibility, disturbed mitochondrial bioenergetic functions, and a reduced transcriptional drive for mitochondrial biogenesis [22, 48 ]. although these functional impairments clearly occur in skeletal muscle mitochondria during aging, biochemical studies have also demonstrated considerable age - related changes in the abundance and posttranslational modifications of key mitochondrial enzymes. proteomics is concerned with the large - scale and high - throughput identification and characterization of the global protein constellation of a given biological entity, such as cells, tissues, or body fluids. protein complements are separated by standard methods, including gel electrophoresis and liquid chromatography [5052 ], and individual protein species are usually identified by mass spectrometry [5355 ]. the verification of proteomic data is routinely carried out by biochemical, immunological, cell biological, and physiological assays. skeletal muscle proteomics, in particular, involves the comprehensive biochemical analysis of protein populations from defined muscle tissues, individual muscles, specific fibre populations, or distinct subcellular fractions [5658 ]. figure 2 outlines the standard workflow for the identification of novel aging - associated biomarkers using gel electrophoresis - based proteomics. total crude tissue extracts, detergent phase - extracted proteins, or mitochondria - enriched fractions are routinely used as starting material for the determination of new mitochondrial markers. the main analytical steps involved in skeletal muscle proteomics are the extraction of a distinct protein population from crude extracts, subcellular fractions, or affinity - purified protein complexes, the efficient separation of proteins by one - dimensional gel electrophoresis, two - dimensional gel electrophoresis, or liquid chromatography, the densitometric mapping of altered protein concentration levels, the unequivocal identification of protein species by mass spectrometry of protease - generated peptide mixtures, and finally the independent validation of proteomic data by enzyme assays, immunoblot analysis, ligand binding assays, or immunofluorescence microscopy. since the concentration range of proteins is not a static entity, but highly dynamic, and because the density of proteins spans several orders of magnitude in complex cellular systems, proteomic studies of crude extracts result mostly in the cataloguing of abundant and soluble protein species. thus, conventional gel electrophoresis - based proteomics underestimates certain classes of proteins, such as high - molecular - mass proteins, integral membrane proteins, extremely basic or acid proteins, and low - abundance proteins [5052 ]. over the last few years, proteomic approaches have been refined in order to reduce sample complexity by subcellular fractionation protocols and affinity separation techniques [5961 ]. mass spectrometry - based proteomics suggests itself as an ideal analytical method to determine global changes in the mitochondrial protein complement [62, 63 ]. mitochondrial proteomics is concerned with the establishment of the entire organelle - associated protein complement and the dynamic nature of posttranslational modifications in mitochondrial components, as well as differential expression patterns within mitochondrial protein populations due to physiological adaptations or pathological insults [6466 ]. considerable tissue - specific differences exist within the mitochondrial proteome and reflect the diversity of mitochondrial functions in individual organs [6769 ]. as listed in table 1, proteomic maps of mitochondria exist for numerous organs from several different species. the first comprehensive survey of human mitochondria detected approximately 1,500 spots on a silver - stained reference map and identified 46 mitochondria - associated proteins in placental tissue. subsequent studies have discovered several hundred mitochondrial proteins by mass spectrometry, using differential centrifugation or density gradients consisting of percoll, metrizamide or nycodenz for prefractionation purposes [7177 ]. proteomic analyses yielded 615, 680 and 940 distinct mitochondrial proteins in human and mouse heart, respectively [7173 ], 182 and 192 mitochondrial proteins in mouse and rat liver, respectively [74, 75 ], 823 mitochondrial proteins in human skeletal muscle, and 723 and 1,198 mitochondrial proteins in brown and white fat cell lines, respectively. several proteomic studies have investigated mitochondrial protein populations in several organ systems in parallel, including liver, muscle, heart, kidney, and brain [6769 ]. the most comprehensive comparative report on the mitochondrial proteome has created a compendium of 1,098 genes and their protein expression across 14 mouse tissues. detailed listings of proteomic studies that have focused on mitochondria in health and disease can be found in recent extensive reviews of this specialized field of subproteomics [28, 30, 65 ]. these crucial cataloguing exercises form now the basis of detailed comparative investigations into disease - dependent alterations in mitochondria, including studying the effects of aging on the mitochondrial proteome [79, 80 ]. over the last decade, a large number of proteomic studies have identified potential biomarkers of muscle aging. studies of aged human muscle and the most widely employed animal model of sarcopenia - related abnormalities, the senescent rat, have revealed changes in proteins involved in the regulation of excitation - contraction coupling, ion homeostasis, muscle contraction, muscle relaxation, metabolite transportation, energy metabolism, and the cellular stress response [8399 ]. table 2 lists recent proteomic studies that have identified the potential involvement of mitochondrial elements in sarcopenia of old age. the proteomic analysis of total extracts from aged human vastus lateralis muscle has identified numerous aerobic markers with an increased density, including the mitochondrial enzymes atp synthase, ubiquinol - cytochrome c reductase, and oxoglutarate dehydrogenase during muscle aging. in analogy, elevated levels of mitochondrial enzymes, such as succinate dehydrogenase, isocitrate dehydrogenase, atp synthase, malate dehydrogenase, ubiquinol - cytochrome c reductase, and pyruvate dehydrogenase, were also shown to occur during the aging of rat gastrocnemius muscle [93, 94 ]. these investigations were performed with the fluorescence difference in - gel electrophoretic technique, one of the most powerful biochemical methods to compare concentration changes of distinct protein species in soluble proteomes. the recent proteomic profiling of the detergent phase - extracted protein complement from senescent rat gastrocnemius muscle confirmed a changed concentrationof numerous mitochondrial enzymes during aging. the mitochondrial marker enzymes atp synthase and isocitrate dehydrogenase were found to be significantly increased in aged muscle tissue. in contrast to the highly discriminatory difference in - gel electrophoretic technique used for studying muscle aging [86, 93, 94, 97 ], proteomic approaches with conventional protein dyes or dyes that cover a limited dynamic range have identified considerably fewer changes in mitochondrial markers [85, 87 ]. subproteomic studies of mitochondria - enriched fractions from aged skeletal muscles have shown differential effects on the abundance of mitochondrial enzymes [90, 91, 9698 ]. chang. have studied the effect of aging and caloric restriction on the rat mitochondrial proteome. in skeletal muscles, isocitrate dehydrogenase and malate dehydrogenase were shown to be increased in 25-month - old fisher 344 rats, as compared to 6-month - old rats. caloric restriction appears to have only a minor effect on age - related changes in the mitochondrial protein complement. severe metabolic changes in aged skeletal muscle were confirmed by an extensive proteomic survey of mitochondrial preparations from 3-month - old versus 26-month - old rat gastrocnemius muscles. these muscle specimens represent young adult versus senescent contractile tissues, respectively. the fluorescent difference in - gel electrophoretic analysis demonstrated an age - dependent elevation in numerous mitochondrial proteins, including nadh dehydrogenase, atpase synthase, succinate dehydrogenase, the mitochondrial inner membrane protein mitofilin, peroxiredoxin isoform prx - iii, mitochondrial fission protein fis1, succinate - coenzyme a ligase, acyl - coenzyme a dehydrogenase, ubiquinol - cytochrome c reductase core i protein, prohibitin, and porin isoform vdac2 (figure 3). proteomic studies of posttranslational changes in aged skeletal muscle have revealed increased nitration levels in succinate dehydrogenase, decreased phosphorylation levels in cytochrome c oxidase and aconitase, and altered carbonylation levels in atp synthase, nadh dehydrogenase, pyruvate dehydrogenase, and isocitrate dehydrogenase during muscle aging. abnormal posttranslational modifications may alter protein stability, subcellular targeting, intra- and intermolecular interactions, as well as coupling efficiency between substrates and active sites in affected mitochondrial enzymes. thus, natural aging of skeletal muscles appears to be associated with distinct changes in posttranslational modifications of important mitochondrial enzymes. recently, ferreira. compared the proteomes of subsarcolemmal versus intermyofibrillar mitochondria from rat skeletal muscle. a differential expression pattern refined proteomic studies might be able to determine whether intermyofibrillar mitochondria are differently affected by muscle aging as compared to subsarcolemmal mitochondria. since improved nutritional intake and exercise intervention can only partially alleviate the symptoms of sarcopenia, there is an urgent need to develop novel pharmacological strategies to prevent age - related muscle wasting. recent publications by working groups on the etiology, epidemiology, potential interventions, and the clinical assessment of sarcopenia show that a general definition of this common geriatric syndrome is still evolving [104109 ]. in the future, it will be crucial to establish reliable sarcopenia - specific biomarkers to develop superior diagnostic tools for the correct classification of this age - dependent muscle pathology. mass spectrometry - based proteomics suggests itself as an ideal analytical tool for the study of skeletal muscle aging. the biochemical establishment of a robust protein marker signature for sarcopenia of old age will be extremely useful for (i) formulating a coherent cellular theory of muscle aging, (ii) the development of proper diagnostic criteria that can differentiate between different degrees of age - related muscle weakness, (iii) the identification of novel therapeutic targets to counteract cellular stress and fibre degeneration during aging, and (iv) the evaluation of improved treatment regimes to slow down the aging process. recent proteomic studies of mitochondria - enriched fractions and total skeletal muscle extracts have demonstrated altered levels of key mitochondrial enzymes in senescent muscle tissues. thus, although mitochondrial dysfunction and oxidative stress are associated with sarcopenia, muscle aging is also clearly linked to metabolic alterations. this suggests that abundant mitochondrial enzymes may be useful for general muscle profiling and are excellent biomarker candidates for the biochemical classification of cellular changes during the natural aging process.	mitochondria are of central importance for energy generation in skeletal muscles. expression changes or functional alterations in mitochondrial enzymes play a key role during myogenesis, fibre maturation, and various neuromuscular pathologies, as well as natural fibre aging. mass spectrometry - based proteomics suggests itself as a convenient large - scale and high - throughput approach to catalogue the mitochondrial protein complement and determine global changes during health and disease. this paper gives a brief overview of the relatively new field of mitochondrial proteomics and discusses the findings from recent proteomic surveys of mitochondrial elements in aged skeletal muscles. changes in the abundance, biochemical activity, subcellular localization, and/or posttranslational modifications in key mitochondrial enzymes might be useful as novel biomarkers of aging. in the long term, this may advance diagnostic procedures, improve the monitoring of disease progression, help in the testing of side effects due to new drug regimes, and enhance our molecular understanding of age - related muscle degeneration.
diabetes mellitus is one of the most common diseases, with 346 million affected individuals worldwide in 2012 and represents the seventh leading cause of death in the united states. more than twenty percent of patients with type 2 diabetes develop diabetic nephropathy. moreover, clinical studies reported a high prevalence of hypertension for patients in both early and late stages of this disease, which potentiates further progression of kidney damage. vice versa, the decline in kidney function contributes to elevated blood pressure in patients with type 2 diabetes. premenopausal women typically have lower blood pressure than age - matched men, possibly mediated by estradiol which appears to act as a vasodilator. this is in line with a higher incidence of diabetic nephropathy associated with type 2 diabetes observed in men compared to age - matched women. an unresolved issue is the association of diabetic nephropathy with expression of transport proteins responsible for renal secretion of drugs. members of the solute carrier 22 (slc 22) gene family, organic anion transporters (human oat ; rat and mouse oat), and organic cation transporters (human oct ; rat and mouse oct) are expressed in the kidneys and take up endogenous and exogenous compounds, including frequently prescribed drugs, from the blood into proximal tubular cells [710 ]. among antidiabetic drugs, oct2 is involved in proximal tubular secretion of metformin, and oat3 transports sitagliptin [9, 11 ]. for rat kidneys, androgen - dependent expression of oat1, oat3, and oct2 and higher expression of oat2 in females was reported, suggesting sex - dependent renal drug handling at least in this species [12, 13 ]. atp - dependent efflux transporters, multidrug resistance - associated protein 2 (mrp2), mrp4, and p - glycoprotein (mdr1b) are localized in the apical membrane of renal proximal tubules and are responsible for the secretion of organic anions and cations from the proximal tubular cells into the urine. human gene promoters of oat1, oat2, and mrp2 are activated by the transcription factor hepatocyte nuclear factor 4 (hnf4) [1517 ]. interestingly, single nucleotide polymorphisms (snps) associated with type 2 diabetes were found in the gene encoding hnf4. the aim of this study was to identify, at the level of mrna, potential sex- and diabetes - dependent changes of oats, octs, atp - dependent efflux transporters, and the transcriptional regulators, hnf1, hnf1, and hnf4. additionally, the levels of sodium - dependent glucose cotransporter 1 (sglt1) and sglt2 were investigated. we used obese zucker spontaneously hypertensive fatty rats (zsf1) as an established animal model for type 2 diabetes and diabetic nephropathy. zsf1 rats were previously developed by crossing rat strains with different mutations in the leptin receptor gene, zucker diabetic fatty (zdf) rats, and spontaneously hypertensive heart failure (shhf) rats [19, 20 ]. lean and obese zsf1 rats had similar mean arterial blood pressure at seven weeks of age and elevated blood pressure (bp) at 20 weeks of age (table 1) [21, 22 ]. the concentration of blood glucose and plasma triglycerides were higher in obese than in lean zsf1 rats at eight weeks of age (table 1). however, only obese zsf1 rats developed type 2 diabetes with diabetic nephropathy, characterized by elevated urine albumin / creatinine ratios (table 1) [19, 23 ]. our hypothesis was that, in addition to sex - dependences, the renal expression of oats and octs may be altered in diabetic nephropathy that might influence the renal secretion of metabolites and exogenous substances. kidneys from obese male and female zsf1 (zsf1-leprlepr / crl) rats, and their lean controls, were obtained from charles river (stone ridge, ny). animals were kept in the animal facility of charles river laboratories under conventional housing conditions (22c, 55% humidity, and 12 h day / night cycle) with free access to water and rat chow. kidneys of adult (16-week - old) zsf1 rats were removed postmortem in accordance to federal law, conserved in paraformaldehyde (4%) or rnalater, and shipped to our laboratory. serial sections (3 m) of kidneys were stained with periodic acid - schiff (pas). after removal of the kidney capsule, cortical slices were prepared, from which total rna was isolated using rneasy mini kit (qiagen, hilden, germany) according to the manufacturer 's recommendations. quality and quantity of the extracted rna were determined using the agilent 2100 bioanalyzer (agilent technologies, boeblingen, germany) and nanodrop nd-1000 spectrophotometer (thermo scientific nanodrop technologies, wilmington, nc), following the manufacturer 's protocol. rnas with rna integrity number (rin) > 8 were used for further experiments. superscript ii reverse transcriptase (life technologies, darmstadt, germany) and oligo dt - primers (eurofin mwg operon, ebersberg, germany) were used for reverse transcription of rna. genes of interest were analyzed using taqman master mix and taqman gene expression assays (life technologies) : sodium - dependent glucose cotransporter 1 (sglt1), rn00564718_m1 ; sglt2, rn00574917_m1 ; oat1, rn00568143_m1 ; oat2, rn00585513_m1 ; oat3, rn00580082_m1 ; oct1, rn00562250_m1 ; oct2, rn00580893_m1 ; mrp2, rn00563231_m1 ; mrp4, rn01465702_m1 ; p - glycoprotein (mdr1b), rn00561753_m1 ; hnf1, rn00562020_m1 ; hnf1, rn00447453_m1 ; hnf4, rn00573309_m1. the mrna levels of hypoxanthine phosphoribosyltransferase 1 (hprt1, rn01527840_m1), -actin (rn00667869_m1), and cyclophilin a (rn00690933_m1) were tested as housekeeping control genes for sample normalization. for all tested genes, pcr conditions were as follows : 2 min at 50c followed by 10 min at 95c and 40 amplification cycles (95c for 15 s and 60c for 60 s), using mx3000p real - time pcr cycler (agilent technologies). the amplification efficiencies of used assays were 100% (+ / 10%), in accordance with manufacturer 's information. the real - time pcr data were analyzed as ct = housekeeping gene (hprt1)-gene of interest (figure 2), using the 2 method (see supplementary figures in supplementary material available online at http://dx.doi.org/10.1155/2015/483238). the uptake of cgmp in hek293 cells stably transfected with human oat2 (kindly provided by portacelltec biosciences gmbh, gttingen, germany) was investigated in the absence and presence of metabolites known to be accumulated in diabetic patients and therapeutics for treatment of diabetes and hypertension. first, oat2- and vector - transfected hek293 cells were seeded at a density of 2 10 cells / well in a 24-well cell culture plate and incubated for ~72 h in dulbecco 's modified eagle medium - high glucose (dmem hg, d5796, sigma aldrich) culture medium supplemented with 10% fetal bovine serum (number 10270, life technologies), 100 units / ml penicillin, and 100 g / ml streptomycin (paa laboratories gmbh, austria). the cells in each well were washed with pbs and mammalian ringer solution containing 130 mm nacl, 4 mm kcl, 1 mm cacl2, 1 mm mg2so4, 1 mm nah2po4, 20 mm hepes, and 20 mm d - glucose, ph 7.4. the uptake of cgmp was tested after incubation of the cells for 5 min with 100 nm [h]cgmp (perkinelmer, hamburg, germany) and 9.9 m unlabeled cgmp (biolog, bremen, germany), with and without potential inhibitors at 37c. substances investigated for their inhibitory potential were adipic acid (sigma aldrich), suberic acid (sigma aldrich), glycolic acid (sigma aldrich), citric acid (merck), 3-hydroxyisobutyrate (fluka), cis - aconitic acid (sigma aldrich), homovanillic acid (sigma aldrich), indomethacin (sigma aldrich), sitagliptin (santa cruz biotechnologies), miglitol (santa cruz biotechnologies), captopril (sigma aldrich), enalapril (sigma aldrich), furosemide (sigma aldrich), and bumetanide (sigma aldrich). after incubation with radio - labeled cgmp and potential inhibitors, cells were washed three times with pbs at 4c, and cell lysis was induced by incubation for 2 h with 500 l of 1 m naoh. thereafter, cell lysates were transferred to scintillations vials, 2.5 ml lumasafe scintillation solution was added to each vial, and radioactivity was counted by a liquid scintillation counter (tri - carb 1500 ; perkinelmer). total protein concentrations were determined by the bradford protein assay, and the cgmp uptake was calculated per milligram of total protein. real - time pcr data and data of transport experiments are presented as mean sem. statistical analysis of real - time pcr data was performed with two - way analysis of variance (anova). following two - way anova, bonferroni test was used for multiple comparison of males versus females and of lean versus obese rats (graphpad prism 4, version 4.03 ; graphpad software, la jolla, ca). data of transport experiments were statistically analyzed with two - tailed unpaired t - test (graphpad prism 4). light microscopy of periodic acid - schiff stained sections revealed differences between lean females and lean males in the structure of glomeruli and tubuli of zsf1 rats (figure 1, le - female, le - male). whereas the structure of glomeruli was similar between the two sexes, the tubular basement membrane of lean males appeared to be thicker than that of lean females (arrows). sex - differences became more obvious in obese rats where renal damage was more prominent in obese males than in obese female zsf1 rats. in kidneys of obese male and female zsf1 rats, glomerulosclerosis, extensive mesangial matrix accumulation, and mesangial hypercellularity were detected (figure 1,). in obese males, in addition, a dilatation of bowman 's capsule and tuft - to - capsule adhesion was present (). tubular injury was indicated by the thickening of tubular basement membrane, tubular dilatation with epithelial cell flattening, tubular lesions, and lumen containing protein as well as by atrophic tubuli (#) with hyaline casts (figure 1, # #). excessive depositions of fibronectin confirmed the development of interstitial fibrosis in kidneys of obese zsf1 rats. protein expression of fibronectin was higher in kidneys of lean males than of lean females (data not shown). the housekeeping genes -actin and cyclophilin a were differently expressed between lean and obese animals and between the sexes (data not shown). in contrast, the expression of hprt1 did not differ between experimental groups and was, therefore, used as a reference gene in our study. sex dependences as well as differences in mrna expression between lean and obese rats are presented as ct values in figure 2 and are summarized as 2 values in supplementary figures 1 and 2, respectively. in figure 2, white bars correspond to lean and black bars to obese zsf1 rats, respectively. negative bars indicate that more pcr cycles were needed to reach the threshold for the gene of interest than for the reference gene hprt1, that is, the gene of interest shows a lower expression than hrpt1. conversely, positive bars in figure 2 indicate a lower number of pcr cycles for the gene of interest than for hprt1, that is, a higher gene expression as compared to hprt1. in general, the more positive (or the less negative) the ct values are, the higher the expression of the gene of interest is. in lean zsf1 rats, mrnas coding sglt1 and sglt2 were higher expressed in females, because more pcr cycles were needed to reach the threshold in males (figure 2). in terms of 2 values, sex differences amounted to 8.35 1.02-fold for sglt1, and to 5.51 0.68-fold for sglt2 (supplementary figure 1a). female expression of sglt1 and sglt2 mrna was retained in obese animals but was less pronounced (figure 2). interestingly, sglt1 and sglt2 expression was higher in female lean zsf1 rats than in female obese rats. in males, no significant differences between lean and obese zsf1 rats were observed for sglt1 and sglt2 (figure 2). similarly, levels of oat1, oat2, and oat3 were higher in kidneys of lean females than lean males (figure 2). these sex - differences vanished for oat1 and oat3 in obese rats (figure 2). in contrast, oat2 mrna was higher in obese female than in obese males, with a 6.70 1.58-fold difference (supplementary figure 1b). in female obese zsf1 rats, a decreased expression of oat1, oat2, and oat3 for oat1, oat2, and oat3 mrna levels no significant differences were detected between male lean and obese zsf1 rats (figure 2). in lean female zsf1 rats, the mrna expression level of oct1 was significantly higher than in their male counterparts and this sex dependence vanished in the kidneys of obese animals (figure 2). renal mrna expressions of oct1 and oct2 were significantly reduced in female obese zsf1 rats as compared to lean females. no significant changes in oct1 and oct2 levels were detected between lean and obese male rats. in contrast, significantly higher oct2 expression was detected in obese males as compared to obese females (figure 2). lean female rats showed a higher mrp4 and mdr1b expression than obese females ; however, no change in mrp2 mrna. in male zsf1 rats, expression of mrp2, mrp4, and mdr1b remained unchanged in obese rats compared to leans (figure 2). renal expression of mrp2, mrp4, and mdr1b showed no significant sex dependence in lean zsf1 rats. in obese animals, the expression of the transcription factor hnf1 was low in all tested animal groups with a detection limit beyond 35 amplification cycles. hnf1 and hnf4 mrna expressions were significantly reduced in both female and male obese zsf1 rats as compared to lean controls (figure 2). the expression of hnf1 was slightly higher in lean females as compared to lean males but was similar in kidneys of obese females and obese males. the transcription factor hnf4 was higher expressed in females as in males only in obese zsf1 rats (figure 2). given the large changes in oat2 expression, the inhibitory potential of metabolites (adipate, suberate, glycolate, citrate, 3-hydroxyisobutyrate, cis - aconitate, and homovanillate) associated with diabetic kidney disease [26, 27 ], drugs for treatment of diabetes (sitagliptin, miglitol), and hypertension (captopril, enalapril, furosemide, and bumetanide) on human oat2 expressed in hek293 cells was investigated. the oat2-dependent accumulation of radioactive labeled cgmp, a known substrate for oat2, was not affected by dicarboxylates adipate and suberate (figure 3(a)). in addition, cgmp uptake was not inhibited by the metabolites glycolate, citrate, 3-hydroxyisobutyrate, and cis - aconitate. in contrast, cgmp uptake was significantly decreased in the presence of the dopamine metabolite homovanillate (figure 3(a)). oat2 transport function was abolished by indomethacin, a verified inhibitor of oat2-mediated cgmp uptake (figure 3(b)). no or a small significant inhibition of oat2-dependent cgmp accumulation was observed in presence of the ace - inhibitors captopril and enalapril (figure 3(b)). the uptake of cgmp in oat2-expressing hek293 cells was strongly reduced by the diuretics furosemide and bumetanide (figure 3), showing ic50 values of 10.9 0.6 m (figure 4(a)) and 130.4 21.8 m (figure 4(b)), respectively. lean and obese zsf1 rats are hypertensive, but only obese animals develop type 2 diabetes and diabetic nephropathy, exhibiting symptoms comparable to humans. in this study, we show sex - dependent morphological changes in the renal cortex and in the expression of selected proximal tubular transport proteins and transcription factors in lean and obese zsf1 rats. in addition, we investigated the impact of several metabolites found in the urine of diabetic patients and of drugs used in the treatment of diabetes and diabetes related diseases on the human organic anion transporter 2 (oat2). our histological results are in line with evidence that the symptoms of diabetic renal disease, for example, renal injury, glomerulosclerosis, interstitial fibrosis, and elevated urine albumin / creatinine ratios, were more pronounced in adult male compared to female diabetic zsf1 rats. hypertension, which was reported to be also stronger in male compared to female zsf1 and spontaneously hypertensive heart failure (shhf) rats was associated with higher rates of progression of glomerulosclerosis and increased fibronectin expression. thickening of tubular basement membrane observed in our study was evident not only in kidneys of obese but also in kidneys of lean male zsf1 rats. it has already been shown in the kidneys of wistar rats that sglt1 and sglt2 proteins are higher expressed in females than in males. accordingly, in our study, lean female rats showed considerably higher mrna levels of sglt1 and sglt2 than lean male rats. recent data suggested that expression of both glucose transporters was increased in obese male zucker rats at the age of 21 weeks. we found that diabetic nephropathy in obese animals resulted in a decline in the expression of both glucose transporters. the explanation for this discrepancy is possibly the different stage of diabetic nephropathy in the zucker obese (zo) rat model, described in published study and in the zsf1 rat model, used in our experiments. our histological data confirm the published zsf1 studies, which showed renal damage, as characteristic for diabetic nephropathy, in obese zsf1 rats already before 21 weeks of age [19, 23 ]. in patients with diabetic nephropathy, a significantly downregulated renal oat1 and oat3 gene expression and impaired secretion of organic anions were observed. in agreement with these human data, significant downregulation of oat1 and oat3 in contrast to published data, higher oat1 and oat3 mrna levels were detected in kidneys of female compared with male zsf1 rats. the unexpectedly low expression of oat1 and oat3 in lean males could be due to structural changes as visualized by the thickening of tubular basement membrane in these animals. our results showed for the first time higher expression of oct1 in lean female compared with male zsf1 rats. this finding may have some implications on drug evaluation using rats as opposed to humans, because oct1 is not expressed in renal tubular cells of human kidneys. oct2/oct2, well - known for transport of the antidiabetic drug, metformin, was identified at high levels in human and rat kidneys. in this study, obese males, but not lean male zsf1 rats, showed higher oct2 expression compared with female counterparts. in accordance with published data, oct2 was decreased by diabetic nephropathy in obese females, but not in obese male zsf1 rats. using another model of diabetes, nowicki and colleagues showed increased levels of the efflux transporters, mrp2 and mrp4, in western blots from whole kidneys of male rats with streptozotocin - induced type 2 diabetes. we found in renal cortex no changes for mrp2 and decreased mrp4 mrna levels in obese zsf1 females compared to lean controls. additionally, no sex - differences were found for mrp2, mrp4, and mdr1b expressions in lean animals, which is in line with already published data. however, we observed higher mrp2 expression in obese males compared with female zsf1 rats. the reason for this sex - dependent mrp2 expression in zsf1 rat strain remains to be clarified. the expression of sglt1, sglt2, oct1, oat1, and oat3 was shown to be transcriptionally regulated by hnf1 homodimers and hnf1/ heterodimers [3639 ]. thus, it appears unlikely that hnf1 plays a dominant role in the transcriptional regulation of transporter mrnas. the mrna level of hnf1 was significantly decreased in obese zsf1 rats compared with their lean counterparts. furthermore, the promoters of rat oat1, oat3, and oct1 can be activated by hnf4. the expression of hnf4 was significantly higher in obese females than in obese male zsf1 rats and was decreased in both sexes in comparison to lean controls. hnf4 has been found to be suppressed in kidneys of patients with diabetic nephropathy as well as diabetic zucker diabetic fatty (zdf) rats, a model for diabetic nephropathy different from that used in this study. our data showed a decline in hnf4 expression in male and female obese diabetic zsf1 rats which is in accordance with published results. the observed sex - dependent hnf4 expression in obese zsf1 rats was possibly induced by a higher degree of diabetic nephropathy in male animals as compared to females. interestingly, despite of reduced hnf4 expression in obese male rats, there was no change in expression of renal transporters potentially regulated by hnf4 compared to the lean animals. given the fact that lean males exhibited a lower transporter expression compared to lean females, we assume that obesity or diabetes induced further reduction in hnf4 was not sufficient to decrease transporter expression even more. in accordance with our results, higher renal oat2 expression was found in females than in males [13, 42 ]. diabetic nephropathy significantly decreased oat2 mrna in renal cortex of obese female zsf1 rats. decreased oat2 mrna in female animals is probably the consequence of a higher degree of renal damage in kidneys of obese zsf1 rats. in males, oat2 mrna expression was already very low in lean animals and did not decrease further by diabetes. this result is contradictory to previously published data, which showed increased levels of oat2 protein in whole kidneys of male diabetic sprague - dawley rats. it remains to be clarified why oat2 expression is different in diabetic kidneys of different rat strains. in human kidneys, oat2 is located to the basolateral membrane of proximal tubule cells and is, hence, involved in the uptake of metabolites and drugs from the blood into proximal tubule cells. the renal excretion of adipate and suberate is known to be increased in ketotic episodes of diabetes, but neither adipate nor suberate affected oat2, suggesting no significant role of oat2 in excretion of these anions in diabetes. the concentrations of glycolate, citrate, 3-hydroxyisoburyrate, cis - aconitate, and homovanillate were decreased in the urine of patients with diabetic kidney disease. our experiments excluded an interaction of these metabolites with oat2, because only homovanillate was able to inhibit cgmp uptake, but this inhibition was very weak. the weak inhibition of oat2-mediated cgmp uptake by high concentrations of sitagliptin and enalapril and the absence of any effect of miglitol and captopril on oat2 function indicate that oat2 most likely does not contribute to renal excretion of these antidiabetic and antihypertensive drugs. on the other hand, the loop diuretics furosemide and bumetanide inhibited significantly cgmp uptake by oat2, in our study. for example, patients with mild acute kidney injury (aki) showed a better response to furosemide than patients with severe aki. in addition, the effect of furosemide on the fractional excretion of potassium in the urine was higher in healthy volunteers compared to patients with stage iii chronic kidney disease. nevertheless, loop diuretics like furosemide are appropriate in chronic kidney disease for reduction of blood pressure. our data suggest for the first time the involvement of human oat2 in the secretion of this loop diuretic because of its high affinity (ic50 10.9 m). in mouse s2 cells transfected with human oat2 the reason for the disagreement between our results and published data for the interaction of furosemide with human oat2 is unclear but most likely due to the usage of different expression systems, and different radio - labeled substrates (cgmp versus pgf2). bumetanide inhibited oat2 with moderate affinity (ic50 130 m), in good agreement with previous data (ic50 77.5 m). these two ic50 values are much higher than the free plasma concentration of bumetanide, indicating that oat2 does not appreciably contribute to the renal excretion of bumetanide. kidneys obtained from male and female obese zsf1 rats revealed tissue damage and significant changes in mrna content of transporters involved in glucose absorption and drug excretion, for example, sglt1/2, oat1/2/3, and oct1/2. discrete signs of damage were found in lean males, resulting from other, nondiabetic pathophysiological changes, most probably the hypertension. a number of proximal tubular transporters showed higher mrna expression in females compared with male zsf1 rats. additional experiments showed for the first time the possible involvement of human oat2 in secretion of furosemide, an often prescribed diuretic for patients suffering from diabetes, hypertension, and related kidney diseases. the altered expression of renal transporters may have an impact on sugar and drug excretion in diabetic nephropathy.	the aim of this study was to identify sex - dependent expression of renal transporter mrna in lean and obese zucker spontaneously hypertensive fatty (zsf1) rats and to investigate the interaction of the most altered transporter, organic anion transporter 2 (oat2), with diabetes - relevant metabolites and drugs. higher incidence of glomerulosclerosis, tubulointerstitial fibrosis, and protein casts in bowman 's space and tubular lumen was detected by pas staining in obese male compared to female zsf1 rats. real - time pcr on rna isolated from kidney cortex revealed that sglt1 - 2, oat1 - 3, and oct1 were higher expressed in kidneys of lean females. oct2 and mrp2 were higher expressed in obese males. renal mrna levels of transporters were reduced with diabetic nephropathy in females and the expression of transcription factors hnf1 and hnf4 in both sexes. the highest difference between lean and obese zsf1 rats was found for oat2. therefore, we have tested the interaction of human oat2 with various substances using tritium - labeled cgmp. human oat2 showed no interaction with diabetes - related metabolites, diabetic drugs, and ace - inhibitors. however, oat2-dependent uptake of cgmp was inhibited by furosemide. the strongly decreased expression of oat2 and other transporters in female diabetic zsf1 rats could possibly impair renal drug excretion, for example, of furosemide.
a key and dominant feature of human cancer, including breast cancer, is the heterogeneity evident in the disease. this presents a problem in both understanding the mechanisms of progression and in developing therapeutic options. the development of human breast cancer results in tumors with a wide array of morphological subtypes, starting with the broad classification as invasive ductal cancinoma or invasive lobular carcinomas. with examination of biomarkers such as er and pr status addition of other markers allows further classification, ultimately resulting in a number of heterogeneous histological subtypes. indeed, unlike chronic myeloid leukemia, where the vast majority of tumors are quite similar due to the bcr / abl1 translocation, breast cancer is now recognized to be a diverse collection of disease states. a hallmark of human cancer is genetic complexity, which reflects the mutations that give rise to the tumor phenotype. this is especially true for breast cancer where a number of different mutations are commonly observed, such as her2 (neu, erbb2) amplification and overexpression in 2030% of tumors [24 ]. amplification of other genes is also observed including amplification of myc in 15% of breast cancers. in addition to these spontaneous mutations, 10% of breast cancer is due to inherited mutations in genes such as brca1/brca2 [68 ]. given the wide number of mutations involved in breast cancer, recent large - scale dna sequencing efforts have illustrated the genetic complexity of cancer, revealing many types of alterations that can distinguish tumor subtypes [912 ]. in particular, the study by wood. characterized several mutations that occurred in a large majority of the tumors and a large number of additional mutations that arose in smaller subsets of tumors, illustrating the heterogeneity present within mutations associated with breast cancer. together, the genetic alterations that underlie breast cancer and the resulting histological subtypes illustrate the heterogeneous nature of the disease. the array of genetic abnormalities inherent within breast cancer is also reflected in the complexity of associated gene expression data. indeed, initial studies on human breast cancer using large numbers of samples revealed heterogeneity in the tumor samples with subtypes that correlated with differences in clinical outcome. subsequent studies have refined the expression patterns in the large datasets into predictions for subtypes of breast cancer. indeed, these methods have allowed for the generation of the well - known luminal a, luminal b, basal, erbb2 + and normal breast - like classification using an intrinsic method [1416 ], reflecting the concept that the gene expression data is associated with histological subtypes. in addition to these methods, recent work has used signatures of cell signaling pathways to investigate the pattern of gene expression in a variety of samples [1720 ]. this method uses gene expression data from control samples and pathway - activated samples as the training data to develop a series of pathway signatures. through the development of regression models, a probability score can then be assigned to subsequent datasets that are examined using the signature that separates the biological states. importantly, for our studies of breast cancer, these genetic signatures have largely been created in primary human mammary epithelial cells (hmecs). in order to ensure that we have constructed signatures for the transcriptional response to the pathway of interest, rna for example, the expression of an activated ras gene in hmecs via an adenoviral vector generates a gene expression pattern quite distinct from that in cells infected with a control viral vector or cells expressing a different oncogene. this signature can then be applied to additional samples in separate tumor datasets, generating probability scores for individual samples sharing the ras gene expression profile. as an example, two breast cancer datasets (gse4922 and gse15852), were examined using a collection of pathway signatures. the resulting pathway probabilities were then clustered (unsupervised hierarchical clustering) to reveal patterns of pathway activity that could be presented as a heat map. such an analysis revealed a number of distinct clusters with differences in pathway probability (fig. 1). this approach serves to provide detailed information about the status of pathway activation. by clustering this data, human breast cancer other works have demonstrated a link between the prediction of pathway activity and prediction of sensitivity to drugs targeting the pathway [17, 22 ], these predictions present a unique opportunity for therapeutic options. essentially, we have generated predictions for individual tumors for the status of various pathways, which are in some cases the underlying mechanism of the heterogeneous disease. many of these pathways can be linked directly to therapeutic opportunities, suggesting that these methods could be used to generate individualized therapies. human breast cancer gene expression data from previous studies were downloaded (gse4922 and gse15852), normalized and the two datasets were merged together using the affymetrix housekeeping genes to standardize between batches. the combined dataset was then examined for patterns of signaling pathway activation. upon generating signaling pathway activation probabilities, the data was clustered and the resulting heat map is shown for the pathways indicated at the right. for a given pathway, blue represents a low probability of pathway activation while red represents a high probability of activation. these datasets also included clinical status for the grade of the tumor (1, 2, 3) and in one dataset normal breast samples were included (gse15852). this additional clinical data is shown in the legend above the heat map. using only signaling pathway probabilities, the heterogeneity within human tumors is readily apparent signaling pathway probability in human tumors. human breast cancer gene expression data from previous studies were downloaded (gse4922 and gse15852), normalized and the two datasets were merged together using the affymetrix housekeeping genes to standardize between batches. the combined dataset was then examined for patterns of signaling pathway activation. upon generating signaling pathway activation probabilities, the data was clustered and the resulting heat map is shown for the pathways indicated at the right. for a given pathway, blue represents a low probability of pathway activation while red represents a high probability of activation. these datasets also included clinical status for the grade of the tumor (1, 2, 3) and in one dataset normal breast samples were included (gse15852). this additional clinical data is shown in the legend above the heat map. using only signaling pathway probabilities, the heterogeneity within human tumors is readily apparent the generation of transgenic mouse models of breast cancer began with the creation of mice expressing myc under the control of the mouse mammary tumor virus (mmtv) promoter / enhancer. since that time, many oncogenes have been placed under the control of mmtv with various types of resulting mammary tumors. interestingly, many of these transgenic mice induce tumors that have a distinctive pathology that is dependent upon the initiating oncogene. specifically, this work illustrated that for mice overexpressing ras, neu or myc there was a characteristic phenotype in the resulting tumors consistent with the notion that these tumors have been initiated by a dominant oncogene. conversely, other mouse models of breast cancer are known to result in varied morphological patterns, more analogous to the human condition. for instance, mammary tumors induced through expression of wnt or members of the wnt signaling pathway, are known to have a wide range of histological patterns in the resulting tumors. this is also true for met - induced tumors which produced tumors that were found to have a number of pathologies including papillary, scirrhous, solid nodular, adenosquamous, and spindle cell. other models are also known to result in tumors with varied morphology, including the polyoma virus middle t model, with six well characterized phenotypes. taken together, these various models suggest that a careful examination of the histological subtypes of tumors in a given experiment is a critical component of evaluating the utility of the model. with these studies in mind, we have recently described work with transgenic mice overexpressing various myc alleles under the control of the mmtv promoter. while we noted a distinctive phenotype for each of the myc alleles composing approximately 40% of the tumor type for each strain, by closely examining a large number of tumors (> 350), we noted substantial heterogeneity in the myc models. the histological types we observed ranged from microacinar and papillary as the dominant morphologies, to epithelial, to mesenchymal transition (emt), squamous, adenocarcinomas and tumors with mixed lineages. this suggested that while myc does preferentially induce a distinct phenotype, there is also significant heterogeneity. to examine the heterogeneity of this model system, tumors from each histological subtype were examined through gene expression analysis. unsupervised hierarchical clustering of this microarray data revealed that there were a number of distinct groups of samples. importantly, these subgroups of samples were clustered into groups based on gene expression patterns that corresponded with the histological classifications. while not surprising that the histological characteristics of a tumor are reflected in the transcriptional changes, it is important to note the heterogeneity of the various tumors. interestingly, when these various classes of tumors were compared to a survey of mouse mammary cancers, it was noted that the various classes fit with other tumor models. as an example, the emt tumors clustered with the p53-/- and dmba tumors. in the description of the mmtv met tumors, it was also observed that there were heterogeneous tumor populations at the gene expression level and that the emt tumors clustered together with the p53-/- tumors. together, these findings illustrate the importance of examining both histological variation and gene expression patterns. to further dissect the heterogeneity of the myc - initiated mouse mammary tumors, but do so with information that provides a basis for understanding functional distinctions in subgroups, we applied the various pathway signatures to the collection of tumors. this analysis revealed that the same histological subtypes were also able to be distinguished based on the higher order structure within the data. compared with the unsupervised clustering, this resulted in similar patterns but also revealed additional information. for instance, this analysis illustrated that the ras pathway was highly activated in emt tumors but was not likely to be activated in microacinar tumors, providing information to allow one to decipher the patterns of gene expression data. together with the histological data, this has allowed for a more informative characterization of the various subtypes of myc - induced mammary tumors. importantly, this analysis has also enabled us to compare this tumor model with human breast cancer, which has revealed subtypes of human breast cancer that share pathways with the mouse model, but has also revealed key distinctions. for example, in fig. 1 there is a clear correlation between myc and ras in human breast cancer. however, in the myc - induced mouse model we reported an inverse correlation between myc and ras. in contrast, in the human signatures, we note in fig. 1, that there are subgroups of cancers with an elevated probability of activation of both e2f1 and -catenin (ctnnb1) (bcat pathway in figure legend). interestingly, in the mouse predictions we noted a shared elevation of e2f1 and -catenin in a select subtype of breast cancer, notably in the microacinar tumors. this association was altered in other tumor types, such as emt where e2f1 was low and -catenin was midrange and in papillary where e2f1 probability was high while -catenin was low. as an important component of mouse models, comparisons have been drawn between other mouse model systems and human breast cancer. initially through a survey of 13 models of murine breast cancer, comparisons were made in gene expression patterns using an intrinsic gene expression signature. this study revealed the relationships between the various mouse model systems with an intrinsic gene set, a group of genes that defined the various mouse models. this analysis revealed the similarities and differences between the various mouse models of breast cancer, generating a number of clusters, including normal mammary gland, mesenchymal, basal, luminal, and mixed groups of tumors. in addition to comparing across various mouse models, this report also examined the relation between the models and human breast cancer. through unsupervised clustering, they revealed that the defining features of the human predictions (luminal a, luminal b, and basal) were maintained in specific mouse model systems, for instance, key genes from the basal cluster were shared in several mouse models. however, this analysis also illustrated that the luminal tumor type was not tightly related to the various murine tumor models, although there were genes with similar expression profiles. in addition, this report uses an intrinsic analysis to compare the mouse and human tumors, which placed several of the mouse models together with the luminal tumors, but at the same time, illustrated the estrogen - receptor - mediated differences between the model systems and the human tumors. with this mouse model data as a framework, several recent papers have then generated gene expression data from additional models and then compared it to these 13 mouse model systems [26, 28, 30, 31 ]. this has provided an important context to determine how new tumor models relate to the existing models and to determine what human tumors they are most similar to. indeed, the ability to determine what type of human cancer these mouse models are most closely related to is a critical component in characterizing the mouse model tumors at both the level of gene expression patterns and histological subtypes such as basal and luminal types. in another approach, we created a signature of myc - driven tumors that had an emt component and applied this phenotypic signature to the human breast cancer gene expression data. this analysis revealed that triple negative (er, pr and her2 negative) breast cancer had a significant elevation of emt probability, identifying this mouse model as one that may be appropriate for examination of potential therapeutic strategies. based upon a combination of clinical, histological and genomic data, the goal of current care in breast cancer is to offer a course of treatment best suited to the individual patient. one of the greatest challenges for the effective treatment of this disease is the heterogeneity as we previously discussed, therefore, spurring the current focus on individualized medicine. the importance of dissecting this heterogeneity is best illustrated with the example of the breast cancer drug trastuzumab. only a small fraction of all breast cancer patients benefit from trastuzumab, but with the use of the her2 biomarker, trastuzumab becomes an effective therapy in breast cancer by pre - selecting patients who might respond. perhaps the most significant outcome of the genomic analyses of the mouse mammary tumor models is the realization that the heterogeneity characteristic of the human disease is recapitulated in these models. as such, they have the potential for providing an opportunity to evaluate the effectiveness of using genomic data to guide the selection of a therapeutic regimen tailored to individual mice. firstly, by using a model where we have clearly defined the genetic heterogeneity, we will be able to make probability predictions for the therapies for the various types of tumors that are commonly observed. secondly, the relation of the various mouse models to human breast cancer has been defined genetically. in addition, the mouse serves as an exceptional experimental system since mammary tumors are readily detected, biopsied, and transplanted, and responses to therapy can be measured through a variety of methods. finally, in contrast to human tumors where the standard of care must be maintained, the mouse model offers an opportunity to test only those therapeutic compounds with the highest predicted probability of activity. given these advantages of the murine system, coupled with our previous characterization of the patterns of pathway activation in the myc tumor model our basic experimental design is to mimic a human trial, where samples are biopsied, examined for gene expression characteristics and then randomized into treatment groups (fig. 2). in addition, by implanting portions of the biopsy material into additional recipient mice we are directly able to compare treatment of the predicted, control and no therapeutic intervention on a tumor sample. this proof of principal experiment will demonstrate the utility of the mouse in modeling individualized breast cancer therapy. the design of a proof of the principle experiment where signaling pathway probabilities guide the use of different drug combinations is shown. a line of mmtv - based transgenic mice that develop tumors with demonstrated heterogeneity are used in this scheme. as spontaneous tumors develop, they are biopsied and their gene expression patterns are immediately examined. based on the patterns of signaling pathway activation, the mice will be grouped into the appropriate therapeutic option or into a control group. following treatment with the individualized predicted therapeutic combinations, the response of the tumor will be assessed theraputic strategy based on signaling pathway profiles. the design of a proof of the principle experiment where signaling pathway probabilities guide the use of different drug combinations is shown. a line of mmtv - based transgenic mice that develop tumors with demonstrated heterogeneity are used in this scheme. as spontaneous tumors develop, they are biopsied and their gene expression patterns are immediately examined. based on the patterns of signaling pathway activation, the mice will be grouped into the appropriate therapeutic option or into a control group. following treatment with in the near future, examination of genomic data will be an integral part of directing the therapeutic strategies for individual breast cancer patients. the dissection of the complexity of the disease that originates in the heterogeneity of human breast cancer is being modeled in mice and the results that are observed in these model systems will have direct effects upon the development of individualized therapeutic opportunities.	the heterogeneity of human breast cancer has been well described at the morphological, molecular, and genomic levels. this heterogeneity presents one of the greatest obstacles in the effective treatment of breast cancer since the distinct forms of breast cancer that reflect distinct mechanisms of disease will require distinct therapies. although mouse models of cancer have traditionally been used to simplify the study of human disease, we suggest that there are opportunities to also model the complexity and heterogeneity of human cancer. here, we illustrate the similarities of mouse models to the human condition in the heterogeneity of both pathologies and gene expression. we then provide an illustration of the potential of gene expression analysis methods when used in conjunction with current treatment options to model individualized therapeutic regimes.
given to a long history of substance abuse disorders in the world, it also has remained as a serious problem in recent years. because of some incorrect beliefs and specific geographical conditions, iran has favorable conditions for youth to crave toward substance abuse. based on a study which has conducted in iran, the subjects experienced the drug use before they were 14 years of age in the 1 time. it seems that drug abuse among youth is spending a progressive trend in the country. hence, finding new ways to deal with this problem is one of the main priorities of iranian government. in many countries, young adults aged 18 - 24 years have become a critical population who need to be addressed. anderson (2007) noted that the majority (85%) of relapse occurs among young people when they join together with their peers. research evidences indicate that many psychological factors are involved in drug addiction and subsequent relapse. coping skills is one of these factors has been confirmed their effectiveness in many studies. research has shown that relapse prevention can be some extent predicted by increased the types of cognitive coping responses and coping behaviors. addiction treatment is a complex process that can be handled through addicts desire to quit, family involvement and physical and psychological treatments. coping cognitive behavioral therapy helps individuals to recognize the difficult situation, teaching coping skills, changing reinforcement contingencies, and fostering motivation are the some of the basic tasks in this approach. numerous studies indicate that learning coping skills is associated with a high degree of ability to prevent relapse among addicts. unfortunately, the relapse rates are high among who are not capable to use effectively coping skills in stressful events (family conflict, peer pressure, financial difficulties or temptations). this study aimed to study relapse coping strategies in young adults self - referred to substance abuse treatment centers in the south iran. this study aimed to study relapse coping strategies in young adults self - referred to substance abuse treatment centers in the south iran. a cross - sectional descriptive study was conducted to examine relapse coping strategies in young adult addicts to bushehr public and private substance abuse treatment centers in summer 2013. all of young adult addicts aged 18 to 24 who were treated at these centers were voluntarily recruited. finally, 70 people (total response rate 75%) of them accepted to participate in the study. the questionnaire was developed by myers a 34-item self - report measure to evaluate substance abuser coping skills. the questionnaire introduces a hypothetical situation you arrive at a friend 's house in the evening. there are a few other people ; everyone is sitting around talking, drinking, and using drugs. when you sit down, you are offered drugs and something to drink. the questionnaire consisted of two parts : the first, assess appraisal and how he / she response to this hypothetical situation by 10 points scale in six items and the second, evaluates the relapse coping strategies in seven points with 28 items. this part assesses scales of relapse coping strategies including cognitive and behavioral problem solving (12 items), self - critical thinking (7 items), and abstinence focused coping (9 items). the validity of this survey has been confirmed by expert 's views, and the reliability was calculated using cronbach 's alpha coefficient as 0.84. results were reported as a mean standard deviation for the quantitative variables and percentages for the categorical variables. seventy young adult addicts aged 18 - 24 (mean 21.7) who were treated at public and private substance abuse centers participated. the highest level of education was diploma, and the lowest was bachelor 's degree. the most substance people taking were opium (37.7%) and heroin (29%), respectively. participants mentioned their age at the onset of addiction about 17-year - old. regarding individuals experience in the hypothetical situation mentioned above, 14.7% of them mentioned they have never been in the situation, 42.6% of them 1 - 2 times, 22.1% 3 - 4 times, and 20.6% of them are more than 5 times were facing to this situation. response to the hypothetical situation as shown in table, this situation has been difficult for participants to cope with (7.39 out of 10) and, furthermore, it was important for them not to use drug (mean 8.03). however, they thought it was something that they could be able to keep themselves from using (7.51). table 2 shows findings from the arcq questionnaire and priority items to action by identified response pattern. findings from the arcq questionnaire according to the findings from table 2, the total mean score of coping skills was 5.19. in this regards the highest mean score is related to self - critical thinking subscale (5.45). in self - critical thinking subscale the item wish that you could change what had happened was the highest and finally, think that using is bad, you do not want to be part of it was the highest in the abstinence focused coping subscale. by prioritizing items based on response pattern to identify interventional areas for action and improvement, we found that the top items are in the subscales are : let your feelings out somehow, try to forget the whole thing, and use the support of a higher power, respectively. in this study, 85.3 % of addicts have experienced the hypothetical high - risk situation at least once. it can be said that this situation which individuals is tempted and return to drug use are easily provided in the community. in this regard, it is recommended actions by the families and related institutions to control and prevent the establishment of such circles occur. based on the findings, it is important for addicts to avoid substances use but it was hard for them and they tend to reuse. these people were listed relapse risk rate and assistance from them in average level. by evaluating individuals responses along with appropriate measures encountering these conditions and cognitive - behavioral coping skills training and upgrading can be helped to prevent recurrence. in this study, participants have used coping skills in average level (5.19 out of 10) while they could take advantage of these skills at a higher level. it is recommended that authorities especially psychologists working in substance abuse treatment centers should strive to improve addict 's skills to be able to avoid substance use if they faced to the similar situations. given the importance of the third factor - abstinence focused coping - as the best predictor of current and future substance use in individuals, more attention needs to be paid to the training, and improving the skills., it suggested that decision - makers develop an action plan to strengthen these skills. in addition, establishing continuous training programs and develop coping skills by an expert especially, a psychologist can empower addicts to maintain themselves against any temptation and craving. this study examines relapse coping strategies in young addicts in substance abuse treatment centers in iran. based on the findings, addicts desire to reuse substance in a hypothetical high risk situation and it was hard to handle this situation. they used coping skills to avoid this situation at an average level. improving self - efficacy skills through teaching	background : cognitive - behavioral coping approach is known as an effective strategy to preventing relapse. its goal is to forget incompatible behaviors and replaces them with the compatible answers.objectives:this study examines relapse coping strategies in young adults in selected substance abuse treatment centers in iran.patients and methods : the present is a descriptive cross - sectional study. the sample consisted of 70 self - referred young addicts (18 - 24 years). adolescence relapse coping questionnaire was used to assess relapse coping strategies. descriptive statistics was used to analyze the data.results:the findings revealed that 71.2% have experienced a relapse totally. it was hard to control the hypothetical high risk situation and they greatly wanted to use the substance (mean 7.39 of 10). addicts have used of all three coping skills in definitely would do level.conclusion:enhancing self - efficacy through training coping skills, especially abstinence - focused coping skills to react properly in high risk situation can be useful.
malignant glaucoma is a rare but serious condition of secondary angle closure mostly seen after filtration surgery, but it may also occur spontaneously.1 it has also been described after laser iridotomy,2 laser capsulotomy,3 cataract surgery,4 topical miotic therapy,5 and blunt trauma.6 some basic mechanisms of ciliolenticular block glaucoma are poorly understood. lens disproportion and lens ciliary body apposition in small eyes and anterior hyaloid changes with increased hydraulic resistance are supposed to be major pathophysiological factors.7 besides these factors, poor vitreous flow and a tendency towards expansion of the choroidal volume in small eyes with angle closure refractory to iridotomy are further possible mechanisms of malignant glaucoma as proposed by quigley.8 these features lead to aqueous misdirection into the vitreous cavity restricted by the anterior hyaloid membrane and additional forward movement of the lens iris diaphragm.9,10 it is clinically characterized by an axial shallowing of the anterior chamber in the absence of a pupillary block mechanism, choroidal effusion, or hemorrhage, despite the presence of a patent iridectomy.11 intraocular pressure (iop) is usually dramatically increased, but may also be within the normal range.12 treatment of malignant glaucoma should be done stepwise. medical treatment includes topical antiglaucomatous medication, cycloplegic agents, aqueous suppressants, systemic carbonic anhydrase inhibitors, and hyperosmotic drugs inducing a posterior movement of the lens iris diaphragm, reducing production of aqueous humor, and dehydrating the vitreous volume.13 the performance of laser capsulotomy,14 or laser anterior hyaloidectomy,15 and argon laser of ciliary processes through a peripheral iridectomy16 to relieve the ciliolenticular block are recommended for unsuccessful medical treatment. when medical and laser treatment failed, surgery should be performed to interrupt the ciliolenticular block. pars plana vitrectomy in pseudophakic eyes or combined vitrectomy and cataract surgery in phakic eyes are effective methods to allow aqueous outflow into the anterior chamber.17,18 apart from anterior vitrectomy alone or in combination with phacoemulsification1719 or trabeculectomy20 via a posterior approach (pars plana), a procedure called zonulo - hyaloido - vitrectomy through a peripheral iridectomy or iridotomy via the anterior chamber was described by lois in 2001.21 due to the difficulty in visualization of the anterior hyaloid membrane in phakic eyes and the risk of damaging the lens, chen published a new technique of videoendoscope - guided fluorescein - assisted vitrectomy in phakic eyes.22 in this study, a series of patients diagnosed with malignant glaucoma, who underwent pars plana vitrectomy to interrupt the ciliolenticular block mechanism, were reviewed. major outcome measures were the event preceding malignant glaucoma, the efficacy of vitrectomy including success rate based on iop reduction and need for medical treatment, and complications following vitrectomy in eyes with and without previous trabeculectomy. clinical records of 15 patients were reviewed retrospectively undergoing pars plana vitrectomy for treatment of malignant glaucoma at the university eye hospital of wuerzburg, germany between 1995 and 2010. the following parameters were recorded : age, sex, lens status, primary ophthalmic diagnosis, past medical history, glaucoma medication, and the event preceding malignant glaucoma. preoperatively, all patients received a standard ophthalmic examination including best corrected visual acuity measurement, applanation tonometry, slit lamp biomicroscopy, and indirect ophthalmoscopy. clinical inclusion criteria of malignant glaucoma were as follows : shallow anterior chamber in the presence of a patent iridectomy or iridotomy after a choroidal hemorrhage or effusion have been ruled out. however, three patients were included according to the inclusion criteria despite having an iop 10 days without choroidal detachment was seen in one patient (16.7%) of the nontrab group. there was no statistical difference in length of hypotony between both groups (p = 0.500). in four patients (44.4%) of the trab group, anterior chamber flattened again for 17 days postoperatively and deepened spontaneously thereafter without further interventions. in contrast, in two patients (33.3%) of the nontrab group, the anterior chamber was shallow for 3 days after vitrectomy, deepened spontaneously, and remained deep thereafter. further adverse events were failure of filtering blebs in four patients and progression of cataract in two patients of the trab group. neither choroidal effusion, blebitis, endophthalmitis, nor iris incarceration was seen in either group during follow - up. incidence of further surgical interventions including cyclodestructive procedures and revitrectomy is summarized in table 4. in five patients (55.6%) of the trab group and in three patients (50%) of the nontrab group, one or more additional iop - lowering procedures nine patients (trab group) developed a ciliolenticular block following filtration surgery with a patent iridectomy in the absence of a pupillary block, hypotony, choroidal effusion or hemorrhage (table 1). in six patients (nontrab group), several intraocular surgeries, laser, or cyclodestructive treatments malignant glaucoma occurred in seven patients after trabeculectomy and in two patients after combined trabeculectomy and cataract extraction. the median time between filtration surgery and malignant glaucoma was 41.4 days (range : 5205 days). of the patients in the nontrab group, one patient developed a ciliolenticular block after neodymium : yttrium - aluminium - garnet (nd : yag) laser peripheral iridotomy five patients after cataract surgery. mean time to malignant glaucoma was 14.0 days (range : 141 days) with one patient, who had a cataract extraction 9 years prior, excluded. the mean age of six female and three male patients in the trab group was 65 years (range : 4188 years). four women and two men with a mean age of 78 years (range : 6185 years) were included in the nontrab group and were significantly older than patients with filtering blebs (p = 0.046). patients in both groups had a median axial length of 22.0 1.0 mm and 22.5 1.0 mm (p = 0.383) with a median lens thickness of 4.8 0.9 mm and 4.6 0.7 mm (p = 0.800), respectively. five patients in the trab group and all the patients in the nontrab group were pseudophakic at the time of diagnosing malignant glaucoma. indications for combined surgery were a significant cataract and failed deepening of the anterior chamber during vitrectomy. the mean iop of patients in the trab group was 25.0 9.3 mmhg at the time of malignant glaucoma and was lower than in patients of the nontrab group (38.8 21.0 mmhg), although no statistical difference was found (p = 0.135). figure 1 illustrates iop development during follow - up for both groups. a reduction in iop iop was 20.0 3.9 mmhg in the trab group and 20.3 3.3 mmhg in the nontrab group at the 12-month visit. no statistical difference in iop was found between the two groups (p = 0.571). preoperatively, patients of the trab group received a total number of 2.0 1.3 (range one to four) topical agents. preoperatively, patients of the nontrab group needed 3.0 1.3 (range two to five) topical iop - lowering drugs. additional systemic medication (acetazolamide, mannitol) was necessary in all patients of both groups to lower iop. the number of patients with iop - lowering medication dropped to two patients in the trab group needing 2.0 1.4 medication after 1 month. one patient in the nontrab group was on 4.0 topical medications at the 1-month visit. however, seven patients in the trab group received a total of 2.3 0.8 medications and four patients in the nontrab group received 2.5 1.0 medications at the last available visit of each patient (range : 7 days to 58 months). no statistical difference concerning pre- and postoperative iop - lowering medication was found between the two groups during follow - up (p = 0.781). according to the criteria for qualified success, two (40.0%) patients in the trab group fulfilled both criteria of qualified success after 12 months (follow - up rate 55.6%). none of the patients in the nontrab group had an iop 21 mmhg and 20% reduction of iop from baseline or an iop 10 days without choroidal detachment was seen in one patient (16.7%) of the nontrab group. there was no statistical difference in length of hypotony between both groups (p = 0.500). in four patients (44.4%) of the trab group, anterior chamber flattened again for 17 days postoperatively and deepened spontaneously thereafter without further interventions. in contrast, in two patients (33.3%) of the nontrab group, the anterior chamber was shallow for 3 days after vitrectomy, deepened spontaneously, and remained deep thereafter. further adverse events were failure of filtering blebs in four patients and progression of cataract in two patients of the trab group. neither choroidal effusion, blebitis, endophthalmitis, nor iris incarceration was seen in either group during follow - up. incidence of further surgical interventions including cyclodestructive procedures and revitrectomy is summarized in table 4. in five patients (55.6%) of the trab group and in three patients (50%) of the nontrab group, one or more additional iop - lowering procedures were necessary. in three patients of the trab group, four diode cyclophotocoagulations and cyclocryocoagulations were performed, respectively. two patients in the nontrab group needed diode cyclophotocoagulation and three patients received cyclocryocoagulation. no statistical difference regarding complications or surgical revisions ciliolenticular block glaucoma remains one of the most challenging serious adverse events necessitating immediate treatment to reduce aqueous misdirection into the vitreous and consecutive displacement of the lens iris diaphragm. in a recent review by ng and morgan, different pathophysiological features are described to play an important role for development of ciliolenticular block glaucoma, although not every part is clearly understood.7 lens disproportion and lens ciliary body apposition in at - risk eyes (hyperopic, nanophthalmic) and anterior hyaloid changes with increased hydraulic resistance due to a strong adhesion between vitreous, lens, and ciliary body are major pathogenic factors.7 in angle closure eyes, the lens is disproportionally large and increases in size, thereby pushing the iris and ciliary body forwards. in addition, as the lens ciliary body distance decreases, the fluid resistance increases and aqueous humor passes through the anterior vitreous restricted by the anterior hyaloid. moreover, lens apposition to the ciliary body may lead to reduced aqueous flow into the anterior chamber. both lens disproportion and lens ciliary body apposition result in forward movement of the lens iris diaphragm and a shallow anterior chamber.7 since malignant glaucoma also occurs in aphakic eyes, the lens seems not to be the only cause. flow resistance increases as the aqueous humor passes through the vitreous body and compresses the anterior hyaloid face. the pressure differential between the anterior and posterior chamber leads to an anterior displacement of iris and ciliary body. quigley described poor vitreous flow and a tendency towards expansion of the choroidal volume in small eyes with angle closure refractory to iridotomy as possible mechanisms of malignant glaucoma.8 anterior vitrectomy for malignant glaucoma refractory to medical and laser treatment facilitates aqueous humor outflow into the anterior chamber and reflects one recognizing pathophysiologic role of the vitreous in the mechanism of malignant glaucoma.7,23,24 results of vitrectomy in pseudophakic and aphakic eyes developing malignant glaucoma have been published in several previous studies.1822,25,26 nevertheless, vitrectomy alone in phakic eyes may be disappointing due to the difficulty in visualization and removal of the anterior hyaloid membrane without lens damaging.18,25,26 therefore, combined cataract extraction and vitrectomy even in eyes without lens opacities or mild lens opacities are strongly recommended. in this study of 15 patients diagnosed with malignant glaucoma, the efficacy and safety of pars plana vitrectomy for treatment of the ciliolenticular block was evaluated. the results were based on data of patients with and without previous filtration surgery during a median follow - up of 16.4 months. it was found that vitrectomy for malignant glaucoma was successful in iop reduction after medical treatment failed. vitrectomy seems to be effective in patients with and without previous trabeculectomy with adequate reduction of iop, although iop - lowering medication is necessary in nearly all cases to maintain desired iop. byrnes reported on a case series report of 20 patients with malignant glaucoma and success of vitrectomy in 50% of phakic patients and 90% of pseudophakic eyes.18 they recommended combined vitrectomy and crystalline lens extraction to allow removal of the entire anterior vitreous without damaging the lens. they defined success as immediate backward movement of the iris lens diaphragm during vitrectomy recovering the aqueous outflow, and deepening of the anterior chamber. this is in contrast to the current study in which success was based on criteria of iop reduction and medication use. although the anterior chamber deepened after vitrectomy in all cases of the current study, medication or subsequent iop - lowering procedures became necessary in the majority of patients to reach target iop. a study by harbour, in which surgical outcomes of vitrectomy of ten pseudophakic and 14 phakic eyes were compared, revealed a successful initial vitrectomy in 100% of seven phakic eyes undergoing concurrent lens extraction and in 71% of seven phakic eyes without cataract extraction.26 in pseudophakic patients, therefore, lensectomy during vitrectomy may be considered in cases of dense cataract or inability to deepen the anterior chamber. in the current study, more than two - thirds of patients were pseudophakic at the time of vitrectomy, whereas two patients received cataract extraction during vitrectomy. thus, two patients remained phakic and also had a successful iop reduction after deepening of the anterior chamber, but showed a progression of cataract during follow - up. in the current study, the 23-gauge transconjunctival sutureless vitrectomy was equally effective compared to the standard three - port 20-gauge system regarding reduction of iop and success rate. while the 23-gauge approach is frequently associated with a higher incidence of postoperative hypotony, no differences were found in complication rates between both systems. this is in line with previously published data on complications after vitrectomy for malignant glaucoma mostly encountering transient shallowing of the anterior chamber, hypotony, retinal or choroidal detachment, corneal decompensation, and bleb failure needing surgical revision.18,26 lois reported a novel technique of zonulo - hyaloido - vitrectomy using a vitreous cutter through a peripheral iridectomy or iridotomy via the anterior chamber in five patients.21 resolution of malignant glaucoma was achieved in all cases during a follow - up of 5.5 months. lois stated that zonulo - hyaloido - vitrectomy via an anterior approach appears to be an option in the treatment of pseudophakic malignant glaucoma and can be safely done by an anterior segment surgeon.21 due to the difficulty in visualization of the anterior hyaloid membrane in phakic eyes, chen introduced a novel technique of videoendoscope - guided fluorescein - assisted vitrectomy without cataract extraction in selected cases of prepresbyopic patients to avoid the need for clear lens extraction.22 however, they stated that the limited illumination field of the videoendoscope, when simultaneously used with the vitreous cutter, may contribute to an unintentional touch of the lens during vitrectomy. previous studies have addressed the importance of lensectomy to achieve desired iop reduction after the initial vitrectomy since pseudophakic eyes compared to phakic eyes show a higher success rate in terminating malignant glaucoma.18,19,25,26 the current study has some limitations. first, retrospective data commonly has more sources of error due to confounding and bias. second, the sample size was too small to detect small differences between the two groups. it is difficult to collect a large number of cases since malignant glaucoma is a very rare disease. prospective trials with greater statistical power will be needed to establish surgical methods of malignant glaucoma. in summary, pars plana vitrectomy using the 20- and 23-gauge approach is effective for treatment of malignant glaucoma in patients with and without previous filtration surgery. efficacy regarding reduction of iop, success, and complications rates was similar in eyes with and without previous trabeculectomy.	purposeto assess the outcomes of pars plana vitrectomy for the treatment of malignant glaucoma in patients with and without previous filtration surgery.patients and methodsdata of 15 patients developing malignant glaucoma after trabeculectomy (60%) or following ophthalmic interventions other than filtration surgery (40%) were recorded retrospectively. pars plana vitrectomy was performed in case of failed medical or laser treatment recreating the normal pathway of aqueous humor. the main outcome measures were the postoperative intraocular pressure (iop), the frequency of complications, and success rate based on the following criteria : iop reduction by 20% and to 21 mmhg (definition one) or an iop < 18 mmhg (definition two) with (qualified success) and without (complete success) glaucoma medication.resultsvitrectomy reduced iop from baseline in eyes with and without previous trabeculectomy during a median follow - up of 16.4 months (range 7 days to 58 months) ; although the majority of patients required glaucoma medication to reach desired iop. the complete success rates were 11% (both definitions) for patients with filtering blebs and none of the patients without previous trabeculectomy had complete success at the 12-month visit. complications were few and included transient shallowing of the anterior chamber, choroidal detachment, corneal decompensation, filtering bleb failure, and need for further iop - lowering procedures.conclusionpars plana vitrectomy is equally effective for malignant glaucoma caused by trabeculectomy or interventions other than filtration surgery, although iop - lowering medication is necessary in nearly all cases to maintain target iop.
abdominal tb, a common clinical entity in indian sub - continent can infect the gastrointestinal tract, peritoneum, mesentery, lymph nodes, liver, spleen and pancreas. hepatic tb is usually associated with miliary tb or active pulmonary tb. however, isolated liver tb in the absence of miliary tb is very rare restricted to case reports and case series in english literature. the diagnosis is often delayed due to lack of specific symptoms and laboratory findings. here we report a case of synchronous hepatic tb and adenocarcinoma of the colon which is a very rare finding with only a few reports in the literature and none from the indian subcontinent. this case illustrates the diagnostic difficulties of hepatic tb and the need to consider it in the differential diagnosis of hepatic nodular lesions in carcinoma colon patients. increased awareness of this rare association a 50-year - old female presented to the emergency department with pain in the abdomen since 5 days, vomiting and constipation since 3 days. she had no other co - morbidities, and her family history was not significant. on examination she was conscious, oriented with a regular low volume pulse of 98/min, blood pressure 98/66 mmhg, respiratory rate 22/min, and temperature of 98.8 f. abdominal examination revealed mild distension with visible peristalsis. rectum was empty on per rectal examination, and there was no evidence of any growth. clinical impression of acute intestinal obstruction was made, and the patient was subjected to blood and radiological investigations. her blood investigations were - hemoglobin : 9.1 g / dl, total leucocyte count : 7000 cells / mm, serum bilirubin 0.9 mg%, serum glutamic - oxaloacetic transaminase : 55 iu, serum glutamic pyruvic transaminase : 48 iu, blood urea : 29 mg%, serum creatinine : 1.4 mg%, potassium : 3.2 meq / l, sodium : 139 meq / l, random blood sugar : 98 mg% patient was subjected to x - ray abdomen and chest. x - ray abdomen showed multiple air fluid levels while chest x - ray was normal. based on history, clinical examination and x - ray findings, an impression of acute intestinal obstruction secondary to postoperative adhesions was made. exploration revealed distended small bowel and caecum with a circumferential growth at the hepatic flexure of size around 5 cm 5 cm. the mesenteric lymph nodes were enlarged, and there were three liver lesions, two on the right lobe and one on the left ranging in size from 2 cm to 5 cm. an extended right - sided hemicolectomy with ileocolic, end - to - end anastomosis was done. patient recovered well though she developed superficial surgical wound infection which was treated with irrigation and antibiotics as per the culture and sensitivity. post - operative contrast enhanced computerized tomography of the abdomen showed multiple hypodense lesions in both lobes of the liver suggestive of metastases [figure 1a and b ]. histopathological examination of the resected bowel revealed well - differentiated mucin secreting adenocarcinoma invading the muscular layer [figure 2c and d ]. biopsy from the liver nodules showed multiple confluent epithelioid granulomas with caseation necrosis suggestive of tb [figure 2a and b ]. hypodense lesion in segment 3 of the liver suggestive of metastasis (b) microphotograph showing numerous confluent epithelioid granulomas effacing the normal liver architecture (h and e, 100) (a). high power view of caseating granuloma with adjacent normal hepatocytes (h and e, 400) (b). adenocarcinomatous glands with extracellular mucin infiltrating the muscle layer (h and e, 100) (c). high power view showing glands lined by malignant cells having enlarged hyperchromatic nuclei, coarse chromatin and eosinophilic cytoplasm (h and e, 400) based on the histopathology findings, patient was put on anti - tubercular treatment. chemotherapy was not started as it was a t2 tumor and patient was put on regular follow - up. thus, the patient responded well to anti - tubercular treatment and is still continuing with the treatment. third and much rarer form is focal hepatic tb in the form of local tuberculoma or abscess. our case was also an example of the third form that is, focal hepatic tb with three nodular lesions seen in liver. incidence of isolated hepatic tb is estimated to be 0.3%. it is rare due to low tension of hepatic oxygen which is unfavorable for the mycobacterial growth. hepatomegaly is the most common finding present in 96% of the cases although it was not present in our case. it is not possible to diagnose hepatic tb on imaging as other focal lesions in the liver such as metastasis, and hepatocellular carcinoma can have a similar appearance. noninvasive diagnosis is, therefore, difficult, and up to 90% cases require laparotomy for definitive diagnosis as seen in our case too. the best method of diagnosis remains pathological examination of liver biopsy which will show characteristic caseating granulomas. in a study by landen. major hepatectomy was done in a colon cancer patient diagnosed with focal liver lesions presuming it to be colonic liver metastasis. our patient also showed numerous confluent epithelioid granulomas with caseation necrosis thus clinching the diagnosis of hepatic tb. the possible mechanisms include reactivation of the dormant bacilli due to immunosuppression caused by cancer and derangement of host 's intestinal mucosal barrier by underlying malignancy. however, coexistence of colon carcinoma with isolated hepatic tb is very rare and, therefore, no cause - effect relationship could be defined. isolated hepatic tb although uncommon should be included in the differential diagnosis of liver mass especially in areas endemic for tb. it can be confused with primary or metastatic carcinoma especially if associated with other malignancies. coexistence of carcinoma colon and hepatic tb, although rare should be kept in mind especially in countries where tb is rampant.	tuberculosis (tb) presenting as isolated liver mass without clinical evidence of tb is difficult to diagnose preoperatively and is usually mimicked by primary or metastatic carcinoma of the liver. hepatic tb associated with carcinoma colon is a rare association which has very rarely been reported in the literature. this case illustrates the diagnostic difficulties of hepatic tb and the need to consider it in the differential diagnosis of hepatic nodular lesions in carcinoma colon patients. here, we report a case of 48-year - old female who presented in the casualty with features of acute intestinal obstruction. preoperatively a mass was seen at the hepatic flexure along with three lesions in the liver presumed to be metastatic in origin. however, histopathology of the mass revealed adenocarcinoma colon and the liver lesion proved to be hepatic tb. we wish to highlight that on encountering a hepatic lesion in a carcinoma colon patient the possibility of hepatic tb should also be kept in mind apart from the obvious possibility of metastasis especially in an endemic country like india.
pancreatic ductal adenocarcinoma (pdac) is associated with the worst prognosis of all gastrointestinal malignancies, mainly due to late and unspecific symptoms, an aggressive tumor biology, and resistance to most therapies., these patients were subjected to primary resection ; however, new data suggest that this group of patients may benefit from perioperative / neoadjuvant systemic chemotherapy. another 3040% of patients present with borderline resectable or locally advanced / unresectable tumors. here, the risk of occult distant metastasis is higher than in patients with smaller resectable tumors, and perioperative / neoadjuvant treatment is generally recommended to downsize the primary tumor and estimate tumor biology. depending on the patient 's performance status and preferences, more or less aggressive regimens can be chosen. the further course is determined to be neoadjuvant / curative or palliative depending on the radiological and tumor marker response. however, radiological response prediction is difficult, and tumor markers are informative only in a subgroup of patients. the largest group of patients (50%) with pdac has metastases at the time of diagnosis which is associated with a very limited prognosis of < 1 year. for these patients, this review discusses the current controversy whether patients with pdac should consistently be treated in a perioperative / neoadjuvant setting. further, different treatment approaches for patients with pdac who are resectable or can likely be converted to resectability are briefly addressed. accurate staging and discussion in multidisciplinary tumor boards are necessary to classify the extent of tumor growth / tumor stage and to be able to make treatment decisions. classification of resectability into borderline resectable and locally advanced, unresectable disease should follow the most widely used radiological guidelines of the national comprehensive cancer network, which have also been adopted by the international study group for pancreatic surgery. however, re - classification during or after (neoadjuvant) treatment has turned out to be difficult as radiological findings are often not able to discriminate between vital tumor cells and fibrotic nonmalignant stroma, which may result from effective neoadjuvant treatment. thus, if in doubt, liberal indication for surgical exploration can be beneficial for those patients with radiological unclear response. indeed, some centers advocate exploration in all patients whose tumors do not progress during therapy. depending on the tumor localization and the grade of vessel infiltration, surgical resections are highly complex. first approaches to pdacs that were resectable or borderline resectable (at least not clearly unresectable) consisted of exploration with primary tumor removal if possible. however, over three - quarter of patients with any extent of the primary pdac, who undergo macroscopic complete surgical resection will develop distant metastases as the first evidence of recurrence. thus, clinically occult metastases may be present already at the time of diagnosis, which limits postoperative prognosis. this is one reason why adjuvant chemotherapy is effective and recommended for all patients after resection of pdac. however, due to the extent of surgery and delayed recovery and rehabilitation, in approximately 50% of all cases, adjuvant chemotherapy is not given as planned preoperatively. due to this fact, recent recommendations advocate neoadjuvant treatment not only for patients with locally advanced / borderline resectable pdac. rather, neoadjuvant schemes are also preferred over adjuvant schemes for patients with primary resectable tumors. since there has been a lack of effective single or combination chemotherapies for pdac, traditionally, preoperative therapy consisted of chemoradiation. this resulted in an increased median postoperative survival of nearly 2 years for initial resectable patients who underwent neoadjuvant therapy. within the last two decades, many neoadjuvant treatment protocols have been developed since a higher chance of local control was shown in retrospective analyses of pdac patients who underwent preoperative therapy. however, till date, no completed randomized controlled clinical trial on the effectiveness of neoadjuvant therapy has been published. preoperative treatment, such as neoadjuvant chemotherapy or chemoradiation, may be an effective strategy for all patients with pdac regardless the local tumor extent. more patients are able to complete therapy in a preoperative setting since approximately 50% of patients do not complete adjuvant therapy as planned preoperatively due to delayed recovery and rehabilitation. furthermore, neoadjuvant treatment can induce tumor regression, which may increase the likelihood of complete tumor resection (r0 resection) in both, borderline and primary resectable tumors. however, at the moment, evidence - based guidelines for neoadjuvant therapy in primary resectable pancreatic cancer are still missing due to lack of randomized studies. at least, up to 50% of initially borderline / unresectable patients become eligible for surgical resection after neoadjuvant therapy. further rationale for a neoadjuvant approach for all patients with pdac regardless of the tumor extent is that during an induction therapy of 23 months, unfavorable tumor biology can be anticipated if progression occurs during therapy. in the subset of 2030% of patients who develop local progression or distant metastasis under induction chemotherapy, an operation with its associated morbidity can therefore be avoided. initial concerns that the time point of resectability is missed by neoadjuvant therapy and postoperative complications are elevated have neither been proven nor ruled out. in fact, disease progression during or after neoadjuvant therapy, if it occurs, is usually seen at distant sites such as the liver, peritoneum, and lung, and < 1% of patients develop isolated local disease progression at the time of restaging after neoadjuvant therapy. furthermore, the texture of a preoperative treated pancreas usually becomes more firm and has reduced enzyme production, which would be more likely to reduce the rates of pancreatic fistula and anastomotic leakage, the most frequent serious postoperative complications, rather than to increase it. even if a tumor is radiologically staged resectable from the beginning, there seems to be a higher rate of r0 resections after neoadjuvant - combined chemoradiation. for all that, no differences in the postoperative mortality and morbidity could be shown. however, potential disadvantages of neoadjuvant therapy are complications from pretreatment endoscopic or endosonographic interventions (i.e., fine needle aspiration or true cut biopsy) for histological proof of pdac before therapy, as well as the challenge of collaboration between different disciplines (oncologists, pathologists, radiation oncologists, and surgeons). further, even if the primary tumor shrinks, the relationship of the tumor to the adjacent vessels may stay unchanged, and only in a small percentage, a change in the clinical tumor stage has been reported. finally, tumor progression can not be excluded in the setting of a tumor that does not respond to neoadjuvant treatment. chemotherapeutic regimens have evolved from gemcitabine alone to 5-fu, leucovorin, irinotecan, oxaliplatin (folfirinox), gemcitabine, docetaxel, capecitabine (gtx), gemcitabine / nab - paclitaxel, and other less established combination therapies. because recommendations differ, individualized concepts should be discussed for every patient in multidisciplinary tumor boards. a recently suggested approach is to administer 2 months of neoadjuvant chemotherapy, followed by restaging. in the case of no significant tumor regression by radiological and cancer antigen 19 - 9 findings, rather transition to chemoradiation to reach resectability is recommended than the second - line systemic chemotherapy. figure 1 depicts a flowchart with all currently justifiable treatment options depending on the stage and extent of pdac. in contrast to many other solid tumors, the treatment algorithm for patients with localized pdac, especially borderline resectable and locally advanced tumors, remains controversial and multimodal therapies are increasing. due to shrinkage of the primary tumor as well as putative destruction of distant micrometastases, preliminary clinical data are pointing less toward primary resection, rather suggesting improved outcome for neoadjuvant - intended treatment for every patient with localized pdac. if chemotherapy alone is applied, gemcitabine / nab - paclitaxel and folfirinox over 2 months are the most common regimens, under consideration of both, the patient 's physical status and personal preferences, respectively. chemoradiation can be used as well ; however, compared to chemotherapy alone, it is more controversial and less effective in the palliative setting. in the case of chemoradiation, gemcitabine combined with external - beam radiation therapy is favored. finally, since there is no high - quality evidence available, it is still reasonable not to treat every patient with pdac before surgery, and indeed, most guidelines do not suggest neoadjuvant therapy in resectable tumors yet. finally, as radiological findings do not always represent the true extent of vital tumor, every patient who underwent neoadjuvant therapy and whose tumor did not progress may benefit from surgical exploration.	pancreatic ductal adenocarcinoma is a highly aggressive disease, and medical as well as surgical therapeutic options are limited. this article reviews stage dependent treatment options, with a special focus on the current controversy of perioperative treatment regimens in initially borderline resectable or locally advanced patients. neoadjuvant treatment can potentially increase the rate of complete tumor resection and may be more effective than adjuvant systemic therapy. further, in the case of disease progression during or after neoadjuvant therapy, patients can be spared extensive surgery. today, common therapeutic regimens include gemcitabine / nab - paclitaxel and folfirinox, as well as chemoradiation. however, because of the paucity of evidence from randomized trials, most guidelines do not recommend neoadjuvant therapy in resectable tumors, and for borderline or locally advanced tumors only within clinical trials. importantly, every patient should be discussed in multidisciplinary tumor boards.
mycobacterium marinum, a slow - growing mycobacterium, is considered the most common cause of mycobacterial skin infections. the overall incidence is estimated to be 0.27 cases per 100,000 inhabitants, and this number has increased in recent years.1 although mycobacterial infections are more prevalent in immunocompromised patients, immunocompetent individuals have sometimes been affected. in general, first - line antituberculous drugs and other common antibiotics in monotherapy or multidrug regimens are effective against almost all cutaneous m. marinum infections. however, treatment failure still occurs in less than 20% of cases.15 here, we report a case of a 70-year - old fish tank hobbyist with a refractory cutaneous infection caused by m. marinum who was cured after long - term treatment with clarithromycin, rifampicin, and amikacin. reasons for delayed diagnosis and therapy recommendations are also reviewed. a 70-year - old man presented with a 10-month history of deep erythemas, subcutaneous nodules, and skin ulcers on the right upper limb and a 2-month history of ache and tumidness. these lesions had initially appeared 1 month prior as an isolated indolent nodule on the right wrist after a minor laceration to the second digit of his right hand, which was his dominant hand. as the disease progressed, the primary nodule enlarged and multiple nodules developed in an ascending fashion along the path of lymphatic drainage. a skin biopsy of a nodule performed at a local hospital showed infectious granuloma formation with acid - fast bacilli (afb) identified within the tissue. routine histopathology examination was repeated 1 month later, and this also produced an infectious granuloma reaction. the patient was diagnosed with sporotrichosis and prescribed orally administered potassium iodide and itraconazole. after 3 months of treatment, the patient topically applied a nonprescription chinese herbal preparation, which exacerbated the skin lesions ; these became swollen, red, and intensely painful on the whole right upper limb with ulceration of even the partial lesions. the patient was advised to continue antifungal treatment with terbinafine, itraconazole, and potassium iodide for several months. fresh nodules and erosive papules developed on the dorsum of the right hand during the treatment, followed by diffuse tumidness with deep ulceration. in april 2011 after 8 months of no significant therapeutic effects with antifungal treatment, the patient was transferred to our hospital. another two biopsies were re - examined before admission, and consistent results were obtained that exhibited granulomatous changes. all special stains, including afb stains, and tissue cultures were negative for infectious organisms. since the onset of the disease, the patient did not complain of systemic discomfort. he was in good general condition and did not have a history of hepatitis or tuberculosis. dermatological examination revealed a large area of deep erythema and edema with nodules, ulcerations, and crusts on the right upper limb that was abnormally sensitive to the touch. he had a nummular deep ulcer with severe tenderness on the dorsum of the second digit, which limited movement (figure 1a and b). human immunodeficiency virus antibody test indicated negative results, and no active pulmonary disease was detected by chest radiography. a skin biopsy of a nodule on the patient s right forearm displayed a neutrophilic and histiocytic granuloma, with no caseous necrosis. multinucleated giant cells all special stains, including afb and periodic acid - schiff (pas) stains, were negative for infectious organisms. fungal and other standard bacterial cultures were negative. after identifying a nontuberculous mycobacteria (ntm) infection based upon the positive tissue cultures, certain species of ntm m. marinum, a relatively common cause of mycobacterial skin infection that can spread in a sporotrichoid manner, was the first to be considered.2 the patient was then treated with orally administered rifampicin (450 mg, once daily), clarithromycin (500 mg, twice daily), and moxifloxacin (400 mg, once daily) for 4 weeks. however, the right upper limb became swollen again, with purulent secretions draining from the ulcer, and new lesions appeared during the treatment. because the aggressive infection progressed so rapidly that multiple ulcers resistant to the combined therapy presented one after another, m. ulcerans infection was also suspected. the therapeutic regimen was then altered with the addition of intravenous amikacin (400 mg, once daily) to the antimicrobial regimen and suspension of moxifloxacin. surprisingly, the skin nodules rapidly decreased in size, and ulcer cavities had fresh tissue within several weeks (figure 1c and d). the organism was subsequently identified as m. marinum, sensitive to clarithromycin, rifampin, moxifloxacin, and amikacin, and all the four drugs were consistent with the prescribed regimen. with close surveillance of liver and kidney function and other side effects of amikacin after this period, the lesions had significantly subsided, leaving hyperplastic and atrophic scars, and new nodules did not recur (figure 1e and f). a skin biopsy and culture taken at this stage samples of lesional skin were inoculated on lj medium and incubated separately at 32c and 37c. the ability to grow at different temperatures (25c and 45c) and the possible production of pigmentation neelsen staining was used to confirm whether or not the cultured organisms were afb. in vitro drug susceptibility testing was carried out on the isolated strain by using the microtiter plate method in accordance with clinical and laboratory standards institute guidelines.6 one loop of bacteria on an lj medium slope was harvested and suspended in 2 ml of sterile distilled water. samples were then frozen in liquid nitrogen and transferred to boiling water five times to release mycobacterial dna. after centrifugation to pellet insoluble debris, the supernatant was used as the dna template for polymerase chain reaction (pcr). the infecting strain was identified by pcr - restriction fragment length polymorphism (rflp) analysis of the heat shock protein 65 (hsp65) gene (common to all mycobacteria) as described by telenti.7 the data were analyzed by comparing results to an rflp database (http://app.chuv.ch/prasite.html).8 the pcr products of the hsp65 and 16s rna genes were sequenced, and the basic local alignment search tool (blast) program was used to compare the sequences of the isolated strain with those of other mycobacterial species in genbank.9 the isolated strain was typed by using mycobacterial interspersed repetitive unit (mirus), and locus - specific pcrs for the four more polymorphic loci (1, 5, 9, 33) were used to differentiate the isolated strain.10 samples of lesional skin were inoculated on lj medium and incubated separately at 32c and 37c. the ability to grow at different temperatures (25c and 45c) and the possible production of pigmentation neelsen staining was used to confirm whether or not the cultured organisms were afb. in vitro drug susceptibility testing was carried out on the isolated strain by using the microtiter plate method in accordance with clinical and laboratory standards institute guidelines.6 one loop of bacteria on an lj medium slope was harvested and suspended in 2 ml of sterile distilled water. samples were then frozen in liquid nitrogen and transferred to boiling water five times to release mycobacterial dna. after centrifugation to pellet insoluble debris, the supernatant was used as the dna template for polymerase chain reaction (pcr). the infecting strain was identified by pcr - restriction fragment length polymorphism (rflp) analysis of the heat shock protein 65 (hsp65) gene (common to all mycobacteria) as described by telenti.7 the data were analyzed by comparing results to an rflp database (http://app.chuv.ch/prasite.html).8 the pcr products of the hsp65 and 16s rna genes were sequenced, and the basic local alignment search tool (blast) program was used to compare the sequences of the isolated strain with those of other mycobacterial species in genbank.9 the isolated strain was typed by using mycobacterial interspersed repetitive unit (mirus), and locus - specific pcrs for the four more polymorphic loci (1, 5, 9, 33) were used to differentiate the isolated strain.10 ziehl neelsen staining confirmed the cultured organisms to be afb (figure 3). the test of production of pigmentation showed that the isolated afb was photochromagenic, belonging to runyon s group i.11 in vitro susceptibility testing by use of the absolute concentration method demonstrated that the isolated organism was sensitive to clarithromycin, rifampin, moxifloxacin, and amikacin. a fragment of 439 bp, encoding mycobacterial 65 kda hsp, was amplified in the strain isolated from the patient. digestion of the pcr product yielded two fragments of 245/220 bp with the restriction enzyme bsteii and three fragments of 160/115/80 bp with the restriction enzyme haeiii (figure 4). sequencing of the hsp65 gene (439 bp) and 16s rdna (1428 bp) showed 100% and 99% similarity, respectively, with m. marinum. locus - specific pcrs for the four more polymorphic loci (1, 5, 9, 33) identified the isolated strain as a genotype [1 - 3 - 3 - 3 ] that was distinct from the profiles of other reported m. ulcerans.10 m. marinum, a runyon group i photochromogen, often causes skin infections by direct inoculation through broken skin after exposure to contaminated water in a swimming pool or fish tank ; it has an incubation period ranging from 2 to 6 weeks.1,12,13 fish - related infection cases are gradually increasing due to the popularity of rearing fish at home.14 infection typically occurs on the dominant hand of fish fanciers, and this infection shows with a sporotrichoid distribution, in which nodules and ulcers spread proximally along the path of lymphatic drainage.2,15,16 further examination of our patient s exposure history revealed that he was a right - handed fish fancier and most likely to have been in contact with the organisms in conducting his hobbies associated with fish. as the lesions were suddenly exacerbated right after he topically applied a nonprescription chinese herbal preparation, it can not be excluded that the chinese herbs contained the organisms. typical histologic changes are numerous well - formed infectious granulomas.17 in less than 50% of cases, acid - fast organisms are detectable in the biopsy sections.5,14 in our patient, skin biopsy showed granulomatous inflammation with negative results for afb stains on multiple occasions except the first time. the possibility of a positive result in the biopsy sections may be associated with the course of infection. tissue cultures are of particular value in separating ntm from other organisms if specimens are cultured in the appropriate manner. approximately 90% of cases show positive culture results.5,18 even so, diagnosis is frequently delayed for weeks or even years. as shown in our patient, the determination of the correct diagnosis remained challenging because the patient presented with sporotrichoid lesions and s. schenckii infection was suggested according to the culture results in the early stage. however, m. marinum infection should have been considered earlier in the course of his disease, especially when re - examined skin biopsies and fungal cultures showed negative results. the reasons for the delayed diagnosis included ignorance of fish - related exposure history, atypical manifestations caused by inappropriate therapies, negative results of cultures due to inappropriate cultivation, and low awareness of mycobacterial skin infection among the clinicians because of its rarity in everyday dermatological practice. before the results of species identification and drug susceptibility were available, we empirically treated our patient with rifampicin, clarithromycin, and moxifloxacin as recommended regimen for m. marinum infection.1,35,19 with a view to the relatively aggressive clinical course, m. ulcerans was also suspected for which a combined regime of rifampin and amikacin is effective.19,20 in light of these claims, we replaced moxifloxacin with amikacin, accompanied with close surveillance of liver and kidney function and other side effects of amikacin. although species identification revealed the isolated strain to be m. marinum, in vitro drug susceptibility testing showed the isolated organism was also sensitive to amikacin, and therefore the therapeutic regimen was continued. interestingly, skin eruptions regressed significantly after 6 months of combined therapy, but the dosage of amikacin (8 mg / kg) was relatively lower than recommendation (15 mg / kg) in consideration of the age of the patient.21 in contrast to clarithromycin, a bacteriostatic inhibitor of microbial protein synthesis, amikacin belongs to the aminoglycosides and is a bactericidal inhibitor of protein synthesis.21 although it presents activity against m. marinum and has been identified as one of the most active drugs in some in vitro studies, amikacin is not routinely used for m. marinum infection, probably because it can only be administered by injection and is not available for oral administration.20,22,23 the recommended dose of amikacin is 15 mg / kg per day as a single daily dose. numerous studies have demonstrated that once - daily regimens are as safe or safer than multiple - dose regimens with equal efficacy.21 for older patients or patients who require long - term parenteral therapy, less frequent dosing (eg, every 48 hours) is more appropriate. some experts recommend that a dose of 810 mg / kg two to three times weekly may be necessary, with a maximum dose of 500 mg for patients older than 50 years.19 it is recommended that patients receiving aminoglycosides should be monitored carefully for toxicity, most notably nephrotoxicity and ototoxicity, particularly when using for prolonged periods. in addition, aminoglycosides generally should not be used as single agents because of relatively poor tissue penetration and poorer outcomes associated with aminoglycoside monotherapy.21 our case represented a successful example of treatment with a multiple drug regimen that included rifampin and clarithromycin ; additional amikacin can eliminate m. marinum infection with a duration of up to 6 months. these drugs might act synergistically through suppressing mycobacteria rna synthesis by rifampin and inhibiting protein synthesis by clarithromycin and amikacin. generally, strains of m. marinum are susceptible to first - line antituberculous drugs and other common antibiotics, and monotherapy can even eliminate cutaneous infections successfully. treatment failure is found to be related to deep structure involvement or inappropriate therapies, such as corticosteroid use.1,5 what confused us was the obstinacy of our patient s localized infection with no significant improvement after 1 month of treatment with combined antibiotics, which the isolated strain were proven to be susceptible to by subsequent drug susceptibility tests. the refractory infection may be attributed to the following factors : (1) the long duration and stubborn symptoms of the case caused by the delayed diagnosis might have contributed to a poor clinical response ; (2) the long - term use of inappropriate and irregular therapies, which led to a procrastinated course of infection, might be a risk factor for treatment failure ; (3) the age of our patient. evidence is lacking to show that age is a risk factor for treatment failure because of the scarcity of cases. however, elderly people are more or less immunocompromised, so the response to treatment might be slower. the purpose of this work was to improve the diagnosis and share the experience in treatment of cutaneous m. marinum infection. when evaluating a patient with evolving subcutaneous nodules, plaques, and ulcerations, especially when there is sporotrichoid spread after trauma but no responses to antifungal agents, the occupation and hobbies of the patient should be considered. a history of fish - related exposure is highly suggestive of m. marinum, and a biopsy and tissue culture of mycobacteria should be requested. as a long period is needed to accurately identify mycobacterial species and receive results of in vitro drug susceptibility testing, a strong clinical suggestion of m. marinum infection warrants initial empirical treatment. the total duration of therapy depends on the patient s clinical evolution (usually several months). when managing elderly patients with no responses to recommended agents, amikacin might be a good choice for multidrug therapy in a relatively low dosage, and the duration should be prolonged with close surveillance of the side effects.	background : the incidence of mycobacterium marinum infection has been increasing. first - line antituberculous drugs and other common antibiotics are effective for most cutaneous m. marinum infections ; however, treatment failure still occurs in some rare cases. we report a case of a 70-year - old man with refractory cutaneous infection caused by m. marinum. reasons for delayed diagnosis and related factors of the refractory infection are also discussed.methods:samples of lesional skin were inoculated on lwenstein jensen medium for acid - fast bacilli. species of mycobacterium were identified by polymerase chain reaction restriction fragment length polymorphism (pcr - rflp) analysis. we then carried out genotyping by using mycobacterial interspersed repetitive units and sequencing of heat shock protein 65 (hsp65) and 16s rdna genes.results:tissue cultures for acid - fast bacilli were positive. pcr - rflp analysis and sequencing of hsp65 and 16s rdna genes confirmed the isolated organisms to be m. marinum. systemic therapy with rifampicin, clarithromycin, and amikacin empirically over 6 months led to complete resolution of skin lesions leaving only some residual scars.conclusion:key diagnostic elements for m. marinum infections include a high index of suspicion raised by chronic lesions, poor response to conventional treatments, and a history of fish - related exposure. strong clinical suggestion of m. marinum infection warrants initial empirical treatment. the duration of therapy is usually several months or even longer, especially for elderly patients. amikacin can be considered in multidrug therapy for treatment of some refractory m. marinum infections.
primary hyperparathyroidism is rarely a part of multiple endocrine neoplasia type 1 (men-1) syndrome with familial occurrence. the genetic background of this syndrome offers a unique opportunity to review a pathomechanism of tumourigenesis that may be also operative in some sporadic tumours. the classic clinical manifestation of men-1 is a composition of parathyroid hyperplasia, pancreatic endocrine tumour, and pituitary adenoma. all three tumours, however, do not develop in all affected patients during their life span. therefore, the contemporary definition of men-1 is the coincidence of at least two of the above - mentioned tumours. a diagnosis of familial men-1 requires, besides that, a first - degree relative with at least one of the three tumours. in an autopsy series, prevalence of the men-1 syndrome was estimated at 2.2 per 1000 in the general population, but biochemical surveys suggested lower figures0.010.175 per 1000 [3, 4 ]. in patients with primary hyperparathyroidism (hpt) approximately 15% is associated with the men-1 syndrome [3, 5 ]. combining this data with hpt incidence, the prevalence of men-1 can be estimated to be 1030 per 100,000 in the general population. in about 60% of men-1 patients moreover, it is important to stress that other enteropancreatic tumours usually accompany gastrinoma in men-1. insulinoma is found in 1030% of men-1 cases with the classic clinical presentation with recurrent neuroglycopenia, mainly in fasting, similar to that of sporadic cases. other rare enteropancreatic tumours diagnosed in men-1 may secrete somatostatin, glucagon, vasoactive intestinal peptide (vip), growth hormone - releasing factor (ghrh), acth, or parathyroid hormone - related peptide (pthrp). in approximately 30% of men-1 patients prolactin - secreting microadenomas or tumours secreting growth hormone or acth are less frequent, with the signs and symptoms equivalent to those in sporadic cases. neuroendocrine tumour (carcinoid), found in about 14% of men-1 cases, originates mainly from the foregut (thymus, bronchus, stomach, pancreas, duodenum), in contrast to sporadic cases originating mainly from midgut. in up to 40% of men-1 cases the localization of the tumours in the men-1 syndrome can not be explained by the ubiquitous expression pattern of the mutated gene men-1 and its encoded protein, menin. the interaction of menin with mixed - lineage leukaemia protein - containing histone methyl transferase (mll - hmt) complex mediates tissue - selective tumour - suppressing and tumour - promoting effects and may be responsible for the tissue susceptibility to tumourigenesis in men-1. the men-1 gene is 9.8 kb in 10 exons located on chromosome 11q13 and encodes a 610-amino acid 67-kda protein menin. menin is ubiquitously expressed, located primarily in the nucleus and is able to bind to the dna independently of the sequence. in meiosis menin is able to bind directly or indirectly to the proteins regulating transcription, dna processing, or dna repair as well as cytoskeleton - associated proteins [1921 ]. although its exact role is not fully understood, menin acts as a tumour suppressor. inactivation of the men-1 gene causes cell transition from g0/g1 to s phase and increases their proliferation. loss of this protein prevents apoptosis which normally occurs in cells exposed to uv irradiation or tnf-, and exogenous supplementation of menin restores sensitivity to these stimuli. moreover, in vitro menin overexpression partially suppresses tumour phenotype in neoplastic cell lines supporting its role as a tumour suppressor [25, 26 ]. up to now most of the mutations identified in men-1 subjects cause either absence or low availability of menin [28, 29 ]. a complete loss of menin has been described in tumours from patients with men-1 or from mouse models of men-1 [30, 31 ]. a two - hit hypothesis is applied to describe the development of tumours in men-1. in a germline carrier of the mutated, nonfunctioning allele a tumour develops after local inactivation of the other allele, allowing clonal initiation and promotion. sporadic tumours may develop in a similar mechanism as the two alleles are subsequently inactivated in a cell line. in line with this hypothesis in the sporadic cases of parathyroid adenomas [33, 34 ], pancreatic [35, 36 ] and anterior pituitary tumours [37, 38 ], as well as in carcinoids of lung, thymus and stomach [39, 40 ], lipomas, and skin tumours loss of heterozygosity at the menin locus has been described. mutation of the men-1 gene is the most predominant genetic aberration observed in sporadic endocrine tumours. in approximately 20% of sporadic parathyroid adenoma, gastrinoma, insulinoma, and bronchial carcinoid an men-1 mutation no correlation between men-1 genotype and the tumour phenotype or aggressiveness has been found, therefore men-1 sequencing is not useful for tumour staging. primary hyperparathyroidism (phpt) is the most prevalent clinical expression in men-1 mutation carriers, present in more than 90% of cases (table 1). most frequently multinodular hyperplasia of parathyroid glands is present ; however solitary tumours (usually diagnosed as adenomas) have also been observed. although the defective men-1 gene is a tumour suppressor, the parathyroid carcinoma is diagnosed in the smaller proportion of patients than in sporadic primary hyperparathyroidism. mild hypercalcemia with normal range serum pth concentration can usually be detected during the second decade of life. typically the men-1-associated parathyroid adenomas are diagnosed at the age of about 25 years in a considerably younger population compared to the sporadic cases, occurring mainly about the fifth decade of life. a point to be mentioned is the high frequency of supernumerary (up to 20%) and ectopic parathyroid glands, usually localized within the thyroid gland, in the anterior mediastinum and exceptionally in the pericardium in men-1 patients. until now the main clinical manifestation of men-1-associated phpt is progressing demineralisation and/or recurrent kidney stones [50, 51 ]. it was shown that 44% of patients with uncontrolled men-1-associated phpt had severe osteopenia (t score, < 2.0) by 35 years of age. recurrent kidney stones are less frequently reported in men-1 families [50, 51 ]. unusually men-1 patients develop chronic kidney disease in the course of nephrolithiasis, interstitial nephritis and unrelated to the syndrome diabetes as the most frequent cause of chronic kidney disease all over the world [51, 52 ]. it is recommended that biochemical screening for hyperparathyroidism, as well as for the other tumours, should be performed every 13 years in the carriers of men-1 mutation. for a long period of time clinical manifestation is mild, and the lack of regular screening may result in the delay of diagnosis and numerous complications. total serum calcium concentration corrected for albumin level or ionized calcium fraction has been considered the single sufficient screening test for hyperparathyroidism in men-1, partly because identifying the earliest stages of parathyroid growth has not been considered essential. recently, however, increased cardiovascular risk has been observed in patients with mild hyperparathyroidism even in the absence of hypercalcemia. this may argue for inclusion of serum pth concentration measurement as a screening test as well. diagnosis of hyperparathyroidism requires levels of pth inadequately high for the parallel calcium levels. at present second generation of kits, measuring concentrations of the so - called intact pth (ipth), are in the general usage. these tests assess not only the concentration 1 - 84-pth, but also of a truncated pth fragment which was deprived of the first 16 n - terminal amino acids that do not stimulate pth receptor. until now superiority of the third generation of pth kits, measuring only the concentration of native 1 - 84-pth, has not been proven for diagnosis of primary hyperparathyroidism, at least in patients without chronic kidney disease. routine testing for men-1 mutation in young patients with primary hyperparathyroidism is not recommended, as these mutations are rare in unselected patients even below 40 years of age. the testing should be considered in patients with additional risk factors such as multiple gland disease, past history, or coexistence of other tumours characteristic for men-1, family history of hyperparathyroidism or men-1 tumours. total parathyroidectomy and thymectomy with autotransplantation of parathyroid tissue is the therapy of choice for primary hyperparathyroidism in men-1 in contrast to single gland - resection in sporadic cases [57, 58 ]. the surgery in men-1-related hyperparathyroidism (hpt) bears also more difficulties : postoperative hypoparathyroidism and higher rates of recurrent or persistent hpt. recurrence is usually located in preserved parathyroid tissue either a previously normal gland or a remnant. subtotal parathyroidectomy or total parathyroidectomy with thymectomy and autotransplantation is associated with fewer recurrences than selective gland excision. the recurrence rate is strongly influenced by proceeding the operation diagnosis of men-1, the surgeon 's experience, and the possibility to perform an intraoperative histological examination and quick pth assessment. the main role of intraoperative pth assessment is to confirm the removal of all the functional parathyroid tissue before parathyroid autotransplantation. it is not established if the guidelines for the asymptomatic phpt are applicable for men-1-associated phpt. some experts advocate early parathyroidectomy to control even mild hyperparathyroidism as uncontrolled disease is associated with a progressive decline of bone mineral density and the increased risk for kidney stones [61, 62 ]. in addition burgess emphasises education of the patient in respect to hyperparathyroidism recurrence and possible reoperations in the years to come. because malignancies in men-1 parathyroid tumours are uncommon, pharmacological treatment is hypothetically feasible. the development of calcimimetics brought a new effective, however expensive, and until now unlicensed therapeutic option for both sporadic and men-1-associated phpt [63, 64 ]. thus, such a therapy seems the only option when surgery is not possible or has been ineffective. additionally calcimimetics have been shown to inhibit parathyroid hyperplasia so one may speculate that they could slow the progression of parathyroid tumours in men-1. carriers of men-1 mutations require regular screening at least in 3-year intervals regardless of the current presence of hyperparathyroidism from the second decade of life. surgery remains the main method of primary hyperparathyroidism management despite of high recurrence rate and the necessity of repeated procedures. calcimimetic agents emerge as new therapeutic option if surgery is not possible or has been ineffective.	primary hyperparathyroidism may occur as a part of an inherited syndrome in a combination with pancreatic endocrine tumours and/or pituitary adenoma, which is classified as multiple endocrine neoplasia type 1 (men-1). this syndrome is caused by a germline mutation in men-1 gene encoding a tumour - suppressor protein, menin. primary hyperparathyroidism is the most frequent clinical presentation of men-1, which usually appears in the second decade of life as an asymptomatic hypercalcemia and progresses through the next decades. the most frequent clinical presentation of men-1-associated primary hyperparathyroidism is bone demineralisation and recurrent kidney stones rarely followed by chronic kidney disease. the aim of this paper is to present the pathomechanism, screening procedures, diagnosis, and management of primary hyperparathyroidism in the men-1 syndrome. it also summarises the recent advances in the pharmacological therapy with a new group of drugs calcimimetics.
an estimated 4.4% of adults in the united states are affected by attentiondeficit hyperactivity disorder (adhd) 1, which is characterized by a persistent pattern of inattention, hyperactivity, and/or impulsivity at all ages 2. atomoxetine (atx) is a selective norepinephrine reuptake inhibitor indicated for the treatment of adhd, and is the only nonstimulant approved for the treatment of adhd in adults. for adults, atx is recommended to be initiated at a total daily dose of 40 mg / day and increased after a minimum of 3 days to a target total daily dose of approximately 80 mg / day administered either as a single daily dose in the morning or as evenly divided doses in the morning and late afternoon / early evening. after 24 additional weeks, the dose may be increased to a maximum of 100 mg / day in patients who have not achieved an optimal response 3. results from clinical trials indicate that treatment using an adequate dose of atomoxetine for a sufficient duration of time is important for adhd symptom improvement and, conversely, that suboptimal dosing may lead to lower efficacy 4. however, despite the recommended 80 mg / day target dose, realworld data show that an approximately 60 mg / day average adult atx dose is utilized in clinical settings, at least partially driven by lack of knowledge rather than clinical need 4. additionally, although slower dose titration can benefit some patients, it may add the risk of premature drug discontinuation due to impatience waiting for efficacious results, particularly for patients who are not stimulantnaive and who may be used to experiencing a quicker effect 4. the finding that lower atx doses could lead to lower persistency (time from initial atomoxetine dose to discontinuation) is supported by a post hoc analysis of data from a 12month prospective, observational study in pediatric and adolescent patients with adhd 5. medication persistence was assessed in 134 patients who were treated initially with low starting dose atx (30 continuous days of overlap with another adhd medication, the patient patients were categorized as having been treatment naive or not during the 6 months prior to their index event ; that is, no prescriptions for adhdindicated medications in the 6month preindex period. patients were characterized based on demographic information at the time of the index event including age and gender. clinical characteristics based upon pre and followup period data included adhd subtype and selected comorbid psychiatric disorders based on the presence of 1 medical claim with relevant icd9cm diagnosis codes. prescriber specialty and prior adhd medication use, based on pharmacy claims with relevant ndc codes, were also captured. prescriber specialty was determined based on the clinician specialty for the preindex office visit that fell closest to the date of the index atx prescription. lot was defined as all prescription claim fill days over the 365day followup period, including continuous and sporadic use such that lot was calculated as cumulative days of therapy rather than persistency. all study variables were summarized descriptively and statistical tests of significance for differences between dosing cohorts (atx 80 vs. atx 30 continuous days of overlap with another adhd medication, the patient patients were categorized as having been treatment naive or not during the 6 months prior to their index event ; that is, no prescriptions for adhdindicated medications in the 6month preindex period. patients were characterized based on demographic information at the time of the index event including age and gender. clinical characteristics based upon pre and followup period data included adhd subtype and selected comorbid psychiatric disorders based on the presence of 1 medical claim with relevant icd9cm diagnosis codes. prescriber specialty and prior adhd medication use, based on pharmacy claims with relevant ndc codes, were also captured. prescriber specialty was determined based on the clinician specialty for the preindex office visit that fell closest to the date of the index atx prescription. lot was defined as all prescription claim fill days over the 365day followup period, including continuous and sporadic use such that lot was calculated as cumulative days of therapy rather than persistency. all study variables were summarized descriptively and statistical tests of significance for differences between dosing cohorts (atx 80 vs. atx 100 mg / day through the followup (1.7% of patients), and (4) fluctuators, filled prescriptions that fluctuated across dosing groups throughout the followup (34.9% of patients). lot was defined as days until stopping index treatment (any gap of > 30 days). thus, patients continually dosed at 80 mg / day were compared to those never reaching 80 mg / day in regard to persistency. above recommended and fluctuator patients were not included in analyses (over a third of patients). additionally, patient 's data after a break in their dosing were not included and thus their full dosing patterns over the course of a year could not be fully evaluated. in contrast, the current study looked at patients who reached 80 mg / day at least once versus those who never reached 80 mg / day in regard to cumulative treatment duration, allowing for fluctuation in dosing and gaps in treatment. no patients were excluded, and drug holidays were allowed, thereby addressing the clinically relevant limitations in the kabul study 6, such as not allowing for treatment gaps that are common in this patient population 7, 9, 10. the current, less rigid dosing group and lot definitions may better equate to realworld clinical practice and patient adherence regimens. cumulative days of therapy over time rather than consecutive days of therapy may be more clinically relevant for patients with adhd who tend to start / stop medication over time. the specific reasons for initial medication discontinuation that could affect lot could not be measured in the claims data from either the kabul or the current study. however, speculation behind the similar persistency between dosing cohorts in the kabul study is possible. it could be that patients in the suboptimal group continued therapy longer than expected due to placebo effect and few side effects or due to low and slow titration prescribed by their physician to meet individual patients needs. patients on recommended dosing could have continued therapy for a shorter than expected duration because of symptom control or adverse effects. this could have led to similar initial persistency, while not taking into account longterm compliance over time and thereby masking the dosing group differences in overall adherence seen in the present study. sensitivity analyses provide support for this theory. when lot was reexamined in the kabul study patient population using the current dosing group and lot definitions, the lot results were aligned with the overall study results those reaching 80 mg / day had a significantly longer lot. in this study, monotherapy patients reaching 80 mg / day had a mean dose of 64.8 mg / day at day 14 but had a mean dose of 80.6 mg / day at day 30. this is logical as atx is a titrated drug, although it does show that physicians are titrating patients at a much slower rate than the labelrecommended 40 mg / day for a minimum of 3 days followed by 80 mg / day thereafter. for patients that reach 80 mg / day, the mean dose thereafter fell to a consistent mean dose of about 70 mg / day, perhaps suggesting a drop in dose to aid in tolerability for some patients. the observations that monotherapy patients never reaching 80 mg / day had similar mean lowest (36.0 mg / day) and highest (40.2 mg / day) doses, had a mean dose of 37.0 mg / day on day 14, and had a mean dose of 38.3 mg / day on day 30 suggests that physicians were not titrating their patients upward in dose after initial dosing. healthcare providers appear to be more open to atx monotherapy for adult patients naive to other adhdindicated treatments in the prior 6 months. the lot was statistically significantly less in previously treated patients compared to naive patients in the overall monotherapy cohort, suggesting naive patients have a longer lot. this finding could be because patients used to the feeling of stimulant therapy are more likely to discontinue atx due to a perceived lack of efficacy, regardless of efficacy outcomes 22. aligning with the atx prescribing information, physicians prescribe atx as a monotherapy a majority of the time. factors that increased the likelihood of a patient receiving and filling an 80 mg / day monotherapy prescription during their followup year, included being older, male, hyperactiveimpulsive or combined type, psychiatrist prescriber, and having a bipolar, depression, hypertension, or pervasive development disorder as a comorbidity. however, the increased likelihood was from about 7 to 25% except for pervasive development disorder comorbidity that was about 85%, all of which are less than a 1fold change. also, the multivariate model used to test statistical significance was found to only be of moderatetoweak fit. study limitations to consider are that early dosing of 80 mg / day may be overestimated due to the dose algorithm used, such that some doses within the first 30 days of treatment could be added together but may actually be serial titration doses. this is based upon how ndc codes for prescription claims are entered into the truven database. data describing reasons for discontinuation and clinical outcome data are not available in an administrative claims database, so it was not possible to assess the true association between dosing cohorts and symptom control. results were based upon medication prescribed and filled rather than actual patientlevel adherence, so it is not known whether or not the patients took their medication as intended. the analysis was limited to only those individuals with commercial health insurance and thus may not be generalizable to adhd patients with other insurance types. second, patients do not adhere to taking their medication longterm, also limiting the optimization of their treatment. third, underdosing can exacerbate patient 's lack of treatment compliance over time, synergistically setting the patient up for treatment failure. to maximize potential atx efficacy, it is important for physicians to set appropriate expectations of atx treatment with their patients around labelbased recommended target dosing, length of time to maximized efficacy and how this is different than for stimulants, and the importance of longterm medication compliance. to our knowledge, this is the first study to show a datadriven rather than anecdotal linkage between atomoxetine underdosing, medication adherence, and the importance of assessing cumulative days of therapy over time in the adult adhd population. a majority of adult adhd patients treated with atx were dosed lower than the recommended 80 mg / day. when patients filled at least one 80 mg / day prescription, their cumulative days of therapy over the course of a year were significantly greater than if they did not. ensuring adult adhd patients are treated with atx at a target dose of 80 mg / day is an important clinical consideration for maximizing patient days on therapy, which may be important for optimizing a patient 's chance for treatment response and maximal therapeutic benefit. clemow, nyhuis, and robinson are employees and minor shareholders of eli lilly and company and/or one of its subsidiaries.	summaryaimto compare atomoxetine (atx) length of therapy (lot) among adults with adhd who reached the recommended dose of 80 mg / day (atx 80) versus those who did not (atx < 80) analyzed separately in patients prescribed atx as monotherapy (mono) and in combination with other adhd medications (combo).methodsthis was a retrospective observational cohort study of the truven health marketscan commercial claims database from january 1, 2006september 30, 2013, with a 6month preindex period free of atx (1st atx claim as index event) and a 1year followup. lot during followup was calculated using prescription claim fill dates and included all days with medication on hand regardless of treatment gaps.resultsonly 45.0% of the 36,076 mono and 77.9% of the 1548 combo patients reached an atx dose of 80 mg / day in 1year followup. when patients filled at least one 80 mg prescription, their total days of therapy over the course of a year were significantly greater than if they did not (mono : 159.3 vs. 65.6 days ; combo : 237.4 vs. 172.0 ; p < 0.0001). across all timepoints examined (day 14, 30, 60, 90, 210) for mono and combo, atx 80 versus atx < 80 patients had greater mean doses (p < 0.0001). combo patients had longer atx lot than mono patients regardless if they reached 80 mg or not (p < 0.0001), but mono patients lot was 93.8 days longer for atx 80 versus atx < 80 patients compared to 65.5 days for combo patients. of patients reaching 80 mg / day, 71.7% of mono and 62.8% of combo patients did so by day 30. for mono atx 80 and atx < 80 patients, lot was significantly (p < 0.0001) less in previously treated patients compared to naive patients.conclusionensuring adult adhd patients are treated with atx at a target dose of 80 mg / day is an important clinical consideration for maximizing patient days on therapy, which can be important for treatment optimization.
although the industrial production of polychlorinated biphenyls (pcbs) has been banned worldwide under the stockholm convention, pcbs still represent a significant environmental and human health concern. specifically, pcbs continue to be released into the environment from building materials and other sites of pcb use. electronic waste processing has resulted in considerable environmental and occupational pcb exposure at electronic waste sites around the world. several recent studies revealed the presence of pcbs in certain paint pigments, highlighting the fact that the inadvertent production of pcbs by industrial processes represents a current, environmental source of pcbs. there is increasing evidence that, in particular, pcb congeners with multiple ortho chlorine substituents predominate in outdoor and indoor air, environmental and human samples. these ortho - substituted pcb congeners and their hydroxylated metabolites are endocrine disruptors and have been implicated as developmental neurotoxicants by mechanisms involving altered ca signaling, interference with thyroid hormone signaling, and decreased dopamine content. in vitro metabolism studies have shown that pcbs are oxidized by p450 enzymes to ho - pcbs. the p450 isoforms involved in the metabolism of a particular pcb congener depend on its chlorine substitution pattern. pcb congeners with ortho substituents are typically metabolized by phenobarbital - inducible cyp2b enzymes, whereas pcb congeners without ortho substituents are metabolized by cyp1a enzymes. several environmentally relevant pcb congeners (e.g., pcb 136) are chiral because they exist as rotational isomers, or atropisomers, that are nonsuperimposable mirror images of each other. atropselective metabolism of these chiral pcb congeners by p450 enzymes is thought to result in their atropisomeric enrichment in wildlife, laboratory animals, and humans. ho - pcbs may be further metabolized in the liver to dihydroxylated metabolites or glucuronide and sulfate conjugates. there is experimental evidence from in vitro studies using recombinant p450 enzymes that the oxidation of ho - pcbs to dihydroxylated metabolites is also atropselective. it is likely that glucuronide or sulfate conjugates of ho - pcbs are also formed atropselectively ; however, this has not been shown experimentally. despite a large number of in vitro metabolism studies, the importance of hepatic vs extrahepatic p450 enzymes for the atropselective metabolism and excretion of pcb 136 and its ho - pcb metabolites remains unproven in vivo. to address this knowledge gap, the present study uses a genetic mouse model with defective hepatic metabolism due to the liver - specific deletion of the cytochrome p450 reductase (cpr) gene to investigate the role of hepatic metabolism in the atropselective disposition of pcb 136 and its metabolites in mice. in this mouse model all p450 isoforms involved in the hepatic metabolism of pcbs are inactivated or inhibited because cpr, the required electron donor of all microsomal p450 enzymes, is not expressed in the liver. pcb 136 was selected for this disposition study because it is a chiral pcb congener of environmental relevance and atropspecifically alters neuronal connectivity in rat hippocampal neurons by mechanisms involving ryanodine receptors. analytical standards of 2,3,4,5,6-pentachlorobiphenyl (pcb 117), 2,2,3,4,4,5,6,6-octachlorobiphenyl (pcb 204), and 2,3,3,4,5,5-hexachlorobiphenyl-4-ol (4-159) were purchased from accustandard (new haven, ct, usa). 2,2,3,3,6,6-hexachlorobiphenyl (pcb 136) and the corresponding ho - pcb metabolites (2,2,3,4,6,6-hexachlorobiphenyl-3-ol, 3 - 150 ; 2,2,3,3,6,6-hexachlorobiphenyl-4,5-diol, 4,5 - 136 ; 2,2,3,3,6,6-hexachlorobiphenyl-4-ol, 4 - 136 ; 2,2,3,3,6,6-hexachlorobiphenyl-5-ol, 5 - 136) were synthesized as described earlier. diazomethane for the derivatization of ho - pcbs to methoxylated pcbs was synthesized from n - methyl - n - nitroso - p - toluenesulfonamide (diazald) using an aldrich mini diazald apparatus (milwaukee, wi, usa). simplified metabolism scheme of pcb 136 atropisomers showing major ho - pcb metabolites investigated and the corresponding abbreviations. only one atropisomer of pcb 136 and the corresponding metabolites are shown for clarity reasons. p450, cytochrome p450 enzyme ; ugt, uridine 5-diphospho - glucuronosyltransferase ; sult, sulfotransferase ; glc, glucuronide. alb - cre / cpr mice with liver - specific deletion of the cytochrome p450 oxidoreductase (ec 1.6.2.4) gene (ko) and congenic alb - cre / cpr mice (wild type, wt) were obtained from dr. xinxin ding (school of public health, state university of new york, albany, ny) to establish a breeding colony at the university of iowa. breeding pairs were set up between ko and wt mice, and littermates were genotyped by pcr in the university of iowa transgenic animal facility as described previously. animals were housed in standard plastic cages in a controlled environment maintained at 22 c with a 12 h light dark cycle. the mice were fed a basal diet (harlan 7913 with 18% protein, 6% fat, and 5% fiber) and water ad libitum. housing of breeding pairs and animal experiments were approved by the institutional animal care and use committee at the university of iowa (protocol # 1206120). liver microsomes were prepared from eight week old, nave (i.e., untreated) female ko (n = 6) and wt mice (n = 5) using established procedures to characterize the effects of the liver - specific deletion of cpr on total p450 levels and hepatic cpr, cyp1a, and cyp2b activities (for additional experimental details, see table s1). the effects of the liver - specific deletion on these markers were consistent with published findings. in particular, a drastically reduced cpr activity was observed in the liver of ko compared to wt mice. in contrast, liver - specific deletion of cpr did not significantly alter the expression of synaptic plasticity - associated genes (i.e., activity - regulated cytoskeleton - associated protein, myelin basic protein, neurogranin, and spinophilin) in the cortex, hippocampus, or cerebellum of ko compared to wt mice (table s2). ko and congenic wt mice (8 week old females) were obtained from the breeding colony described above and randomly divided into the following treatment and control groups (table s3) : 1) wt mice (n = 4) received a single oral dose of pcb 136 (30 mg / kg b.w.) on a vanilla wafer cookie (7.5 g / kg b.w.) ; 2) ko mice (n = 7) received a single oral dose of pcb 136 (30 mg / kg b.w.) on a vanilla wafer cookie (7.5 g / kg b.w.) ; 3) wt control mice (n = 5) received the vehicle (cookie ; 7.5 g / kg b.w.) alone ; and 4) ko control mice (n = 5) received the vehicle (cookie ; 7.5 g / kg b.w.) the dosing of all mice using a cookie was performed as described previously. after eating the entire cookie, animals were housed individually in metabolic cages, and urine and feces were collected daily from each animal for 3 days. tissues (brain, liver, and adipose tissue) were excised en bloc, and their wet weight was determined. pcb treatment had no significant effect on body or organ weights (table s3). lipids were extracted from tissues (liver, brain, and adipose tissue) and feces of pcb or vehicle - treated animals by pressurized liquid extraction using a dionex ase200 system (dionex, sunnyvale, ca) as described earlier. briefly, the samples were mixed with 2 g of diatomaceous earth (fisher scientific) and placed in ase extraction cells (11 ml). the cells were extracted using a chloroform / methanol mixture (2:1, v / v) at 120 c and 1500 psi. the extractable lipid content of each tissue or feces are summarized in table s4. pcb 136 and its hydroxylated metabolites were extracted by pressurized liquid extraction from liver (0.300.74 g), brain (0.190.30 g), adipose (0.040.29 g), and feces samples (0.610.75 g) from individual mice using a dionex ase200 system following a published method with modifications. briefly, the tissues were mixed with diatomaceous earth (2 g) and placed in the extraction cell (33 ml) containing florisil (60100 mesh, 12 g ; fisher scientific). pcb 117 (250 ng) and 4-159 (137 ng) were added to each sample as surrogate standards, and the cells were extracted with hexane - dichloromethane - methanol (48:43:9, v / v / v) at 100 c and 1500 psi (10 mpa) with preheat equilibration for 6 min, 60% of cell flush volume, and 1 static cycle of 5 min. sample blanks containing only florisil and diatomaceous earth were extracted in parallel with each sample set. the extracts were concentrated to approximately 1 ml using a turbo vap ii (biotage, llc, nc, usa) and transferred with 1 ml of hexane to glass tubes. the solvent was evaporated to dryness under a gentle stream of nitrogen and redissolved in 1 ml of hexane. after derivatization of the ho - pcbs with diazomethane, the organic extracts were subjected to a sulfur cleanup step as described earlier, followed by treatment with concentrated sulfuric acid and addition of the internal standard (pcb 204). pcb 136 and its hydroxylated metabolites were extracted from blood samples (0.490.87 g) from individual mice by liquid briefly, blood samples were diluted with aqueous kcl (1% ; 3 ml). the surrogate standards (pcb 117 and 4-159, 50 ng each) were added to each sample. samples were acidified with hcl (6 m ; 1 ml), followed by addition of 2-propanol (3 ml). samples were extracted with hexane : mtbe (1:1, v / v ; 5 ml) and hexane (3 ml). the combined organic extracts were washed with aqueous kcl (1% ; 3 ml), evaporated to dryness, derivatized with diazomethane, and further treated as described above for tissue and feces samples. two aliquots of each urine sample (0.2 ml) were diluted with an equal volume of 0.2 m sodium acetate buffer (ph = 5). to determine if glucuronide and/or sulfate conjugates of pcb 136 were present in urine samples both aliquots were incubated in parallel with or without -glucuronidase / sulfatase mixture (20 l ; type h-2 from helix pomatia, 100,000 units / ml ; sigma - aldrich co. st. subsequently, pcb 136 and its hydroxylated metabolites were extracted from urine samples as described above for blood. analysis of pcb 136 and the methylated derivatives of hydroxylated pcb 136 metabolites was performed on a db1-ms (60 m 0.25 mm i d 0.25 m film thickness ; agilent, santa clara, ca) or an equity-1 capillary column (60 m 0.25 mm i d 0.25 m film thickness ; supelco, bellefonte, pa) using an agilent 7890a gas chromatograph equipped with two ni-ecds as described previously. the levels of pcbs were calculated using pcb 204 as internal standard, adjusted for surrogate recoveries, and are presented adjusted for tissue wet weight, lipid content, and as percent of the total pcb 136 dose (tables s7s11). enantiomeric fractions, a measure of the atropisomeric enrichment of pcb 136 and its metabolites, were determined on the same instrument described above. if not stated otherwise (see table s12), enantioselective determinations were performed with extracts from tissues or excreta collected from individual animals. briefly, pcb 136 and 5 - 136 atropisomers were separated using a chiraldex bdm column (bdm column, 30 m 250 m 0.12 m ; supelco, analytical, st. the temperature program was as follows : 10 c / min from 100 to 148 c, hold for 400 min, 10 c / min to 200 c, and hold for 13 min. pcb 136 and 4 - 136 atropisomers were separated with a cyclosil - b column (cb column, 30 m 0.25 mm i d 0.25 m film thickness ; agilent, santa clara, ca, us) using a previously published temperature program. to allow a comparison with previously published data, the ef values were determined as ef = area e2/(area e1 + area e2), were area e1 and area e2 denote the peak area of the first and second eluting atropisomer. on both enantioselective columns, e1-pcb 136 and e2-pcb 136 correspond to ()-pcb 136 and (+) -pcb 136, respectively. the e1- and e2-atropisomers of 5 - 136 (bdm column) and 4 - 136 (cb column) are formed from ()- and (+) -pcb 136, respectively. the ef values of pcb 136, 5 - 136, and 4 - 136 atropisomers from different tissues are summarized in table s12. the ni-ecds used for the pcb and ho - pcb analysis were linear up to concentrations of 1,000 ng / ml for all analytes investigated (r > 0.999). a detailed summary of the limits of detection, limits of quantification, and background levels of pcb 136 and its metabolites is presented in tables s5 and s6, supporting information. the recovery of pcb 117 and 4-159 was 94 7% (range : 84102) and 95 6% (range : 83105), respectively. the average resolution of pcb 136, 5 - 136, and 4 - 136 atropisomers on the enantioselective columns were 0.92 (bdm column or 0.87 (cb column), 0.69, and 0.75, respectively. the ef values for the racemic standards of pcb 136 on the bdm column and the cb column, 5 - 136 on the bdm column, and 4 - 136 on the cb column were 0.502 0.001, 0.505 0.004, 0.513 0.016, and 0.499 0.011, respectively. the ef values of pcb 136 determined on both enantioselective columns were not significantly different from each other (t test, p > 0.05). unless otherwise stated, all data are reported as mean one standard deviation. differences in biological measurements, tissue pcb and ho - pcb levels, and ef values between different treatment groups as well as differences of ef values from the respective racemic standard were tested with two - sample, two - tailed student s t test. ko mice had consistently higher pcb levels in tissues and excreta than wt mice, presumably due to defective hepatic pcb 136 metabolism. pcb 136 levels, expressed as percent of the total dose, decreased in the rank order adipose > liver > brain > blood in both wt and ko mice (figure 2). the same rank order was observed when the pcb levels were adjusted for wet weight or extractable lipid content (tables s7 and s9). the pcb 136 tissue distribution in wt mice was comparable to similar studies in c57bl/6 mice. pcb 136 levels in feces and urine decreased from day 1 to day 3, which is also consistent with earlier pcb 136 disposition studies in rodents. female mice with defective hepatic metabolism due to liver - specific deletion of cytochrome p450 oxidoreductase (ko) have significantly higher levels of pcb 136 in tissues and feces compared to age - matched congenic wild type mice (wt). data represent the mean standard deviation of the pcb 136 levels determined in the tissues and excreta of individual pcb l36-treated ko (n = 7) and wt mice (n = 5) and are expressed on a logarithmic scale as percent of the total pcb 136 dose (see table s11 for additional details). significantly different from wt (t test, p 99%). recent studies of 4-chlorobiphenyl metabolism in rats suggest that these urinary metabolites are likely pcb conjugates. levels of ho - pcbs were, therefore, quantified in mouse urine with or without -glucuronidase / sulfatase deconjugation to investigate if pcb conjugates are also excreted with the urine in mice. urine was a minor route of excretion of ho - pcbs (figure 3) and the corresponding sulfate and/or glucuronide conjugates (figure 4), accounting for 0.5 in all tissues and excreta investigated, with ef values significantly different from the racemic standards (t test, p blood brain > adipose. several other disposition studies have also reported the most pronounced atropisomeric enrichment of pcb 136 in liver and a less pronounced enrichment in adipose tissue. interestingly, the ef values of pcb 136 in different tissues were by and large not significantly different between ko and wt mice (table s12), i.e., reduced hepatic pcb metabolism did not alter the chiral signature of pcb 136 in the mouse, at least at the time point investigated. vice versa, increased hepatic pcb metabolism due to the induction of cyp2b enzymes with phenobarbital also had no significant effect on chiral pcb 136 signatures in mice. because extrahepatic p450 enzyme activities are probably not affected by the liver - specific deletion of the cpr gene (this study) or phenobarbital treatment, a contribution of extrahepatic metabolism to the biotransformation of pcb 136 may explain why changes in the metabolic capacity of the liver have no clear effect on chiral signatures in mice ; however, additional studies are needed to further explore this hypothesis. comparison of the enantiomeric fractions (efs) of pcb 136 (a), 5 - 136 (b), and 4 - 136 (c) in tissues and feces reveals significant differences in the atropisomeric enrichment between female mice with a liver - specific deletion of the cpr gene (ko) and congenic wild type (wt) mice. the ef values are presented as the mean standard deviation and were determined in the tissues of individual pcb l36-treated ko (n = 7) and wt mice (n = 5). the only exceptions are the ef determination for 5 - 136 in blood, which were performed with a single sample pooled by genotype. a cb column was used to separated pcb 136 and 4 - 136, whereas a bdm column was used for separation of 5 - 136 (see table s12 for additional details). significantly different from wt (t test, p < 0.05) ; different from wt (t test, 0.05 p < 0.1) ; nd, not detected ; the dotted line indicates the ef values of the respective racemic standard. several recent studies have reported that hydroxylated metabolites of chiral pcbs are formed atropselectively in mice. in agreement with these earlier studies, 5 - 136 and 4 - 136 displayed atropisomeric enrichment in tissues and excreta from both ko and wt mice. remarkably, the extent and direction of the enrichment was different between ko and wt mice (figures 5b and 5c). e2 - 5 - 136 was enriched in the liver of ko mice, whereas 5 - 136 was near racemic in liver samples from wt mice (figure 5b) ; however, the difference in the ef values between ko and wt mice in the liver did not reach statistical significance (t test, p = 0.058). in contrast, analysis of pooled blood samples revealed an atropisomeric enrichment of e1 - 5 - 136 in the blood from ko mice. a much less pronounced enantiomeric enrichment of e1 - 5 - 136 was present in pooled blood samples from wt animals. e2 - 4 - 136 was enriched in blood and liver samples of ko and wt mice (figure 5c), with wt mice displaying a more pronounced atropisomeric enrichment in blood and liver compared to ko mice. interestingly, the direction of the atropisomeric enrichment of ho - pcbs in the liver was different compared to the enrichment observed in in vitro metabolism studies. while e2 - 5 - 136 and e2 - 4 - 136 were typically enriched in the liver from ko and wt mice, e1 - 5 - 136 and e1 - 4 - 136 were preferentially formed in studies using mouse liver microsomes and tissue slices. in contrast, in vitro models generally predict the direction of the atropisomeric enrichment of the parent pcb in vivo, which is consistent with a major role of p450 enzymes in the atropisomeric enrichment of pcbs in vivo. it is therefore likely that, in addition to their atropselective formation by p450 enzymes, other processes play a role in the atropselective disposition of ho - pcb metabolites. the ef values of 5 - 136 and 4 - 136 in feces samples changed over time (figures 5b and 5c). e1 - 5 - 136 and e1 - 4 - 136 were enriched in day 1 feces samples from both ko and wt mice, with ko mice displaying significantly more pronounced atropisomeric enrichment compared to wt mice. ef values of both 5 - 136 and 4 - 136 changed from day 1 to day 3 feces samples, with ef values in ko mice always being significantly smaller compared to wt mice. in ko mice, e1 - 5 - 136 and e1 - 4 - 136 were enriched in day 2 feces samples, whereas both metabolites were near racemic in day 3 feces samples. in contrast, 5 - 136 was near racemic and e2 - 4 - 136 was enriched in day 2 and day 3 feces samples from wt mice. ef values of ho - pcb could only be determined in day 1 urine samples. consistent with day 1 feces samples, pooled day 1 urine samples also displayed an enrichment of e1 - 5 - 136 and e1 - 4 - 136 (table s12). differences in the subsequent atropselective phase ii metabolism of ho - pcbs as well as the active transport of ho - pcbs and their glucuronide or sulfate conjugates are one possible explanation for these differences. for example, we have shown that ho - pcbs are atropselectively oxidized to dihydroxylated metabolites. moreover, differences in the atropselective biotransformation of ho - pcb 136 metabolites to sulfate and/or glucuronide conjugates may contribute to the differences in the chiral ho - pcb signatures between wt and ko mice. indeed, earlier studies have demonstrated the compensatory induction of various drug metabolizing enzymes (e.g., glucuronosyltransferases) in ko mice. in addition to phase ii metabolism, differences in the atropselective active transport of the ho - pcb and/or their conjugates may explain why the extent and direction of the atropisomeric enrichment of the ho - pcb metabolites in feces samples changed over time and differed between ko and wt mice. further studies to understand the atropselective disposition of pcb metabolites are therefore needed in terrestrial and aquatic organisms, especially considering the fact that ho - pcb and, possibly their conjugates, are also toxic. to date, most pcb metabolism studies have focused on mammalian p450 enzymes ; however, there is growing evidence that p450 enzymes contribute to the biotransformation of pcbs in plants, fish, birds, and marine mammals. as suggested by our results, it is likely that hepatic and possibly extrahepatic metabolism by p450 enzymes plays a major role in the biotransformation of pcbs and structurally related compounds in wildlife, laboratory animals, and humans and contributes to the atropisomeric enrichment of pcbs observed in wildlife. moreover, ho - pcbs can undergo phase ii biotransformation to glucuronides and sulfates in laboratory animal models and in environmentally relevant species, such as polar bear. our findings in mice suggest that, in addition to p450 enzymes, phase ii biotransformation represents a currently unexplored factor in the atropselective disposition of chiral ho - pcb. further understanding these biotransformation processes is important because ho - pcbs are potentially toxic and contribute to the adverse effects of pcbs in the environment and in humans. since animal models with a deletion or knockdown of genes of key enzymes involved in pcb biotransformation (e.g., cpr or p450 enzymes) can be generated for various species, including fish and mice, such models are powerful tools to explore the importance of hepatic vs extrahepatic metabolism in pcb disposition in wildlife and laboratory animals. furthermore, these types of models may be useful for studying how metabolism modulates the developmental neurotoxicity of pcbs and other environmental contaminants. the feasibility of such studies is indicated by our observation that genetic deletion of cpr in the liver does not significantly alter neurodevelopment as determined by an assessment of synaptic plasticity genes in the brains of ko vs wt mice (table s2).	to understand the role of hepatic vs extrahepatic metabolism in the disposition of chiral pcbs, we studied the disposition of 2,2,3,3,6,6-hexachlorobiphenyl (pcb 136) and its hydroxylated metabolites (ho - pcbs) in mice with defective hepatic metabolism due to the liver - specific deletion of cytochrome p450 oxidoreductase (ko mice). female ko and congenic wild type (wt) mice were treated with racemic pcb 136, and levels and chiral signatures of pcb 136 and ho - pcbs were determined in tissues and excreta 3 days after pcb administration. pcb 136 tissue levels were higher in ko compared to wt mice. feces was a major route of pcb metabolite excretion, with 2,2,3,3,6,6-hexachlorobiphenyl-5-ol being the major metabolite recovered from feces. (+) -pcb 136, the second eluting pcb 136 atropisomers, was enriched in all tissues and excreta. the second eluting atropisomers of the ho - pcbs metabolites were enriched in blood and liver ; 2,2,3,3,6,6-hexachlorobiphenyl-5-ol in blood was an exception and displayed an enrichment of the first eluting atropisomers. fecal ho - pcb levels and chiral signatures changed with time and differed between ko and wt mice, with larger ho - pcb enantiomeric fractions in wt compared to ko mice. our results demonstrate that hepatic and, possibly, extrahepatic cytochrome p450 (p450) enzymes play a role in the disposition of pcbs.
lung cancer is the most common cause of metastasis to the central nervous system (1). the brain is also one of the most commonly involved organs in metastases from non - small cell lung cancer (nsclc) (2). unfortunately, once metastatic brain disease become clinically apparent, the cancer usually has already disseminated widely, which signifies extremely poor prognosis. the median survival duration of patients with brain metastases from nsclc is approximately 1 month without treatment (3), 2 - 3 months when treated with steroids alone (4), and 3 - 6 months when treated with whole brain radiotherapy (wbrt) (5). as the survival of patients with brain metastases tends to be so short, quality of life and alleviation of symptoms recently, however, aggressive treatment involving either surgical resection or radiosurgery has been applied, with potential curative intentions. neurosurgical resection of solitary brain metastasis of various origins resulted in a prolongation of median survival to 3.5 - 8 months (6). also, in lung cancer cases, several retrospective reviews have suggested that aggressive therapy, such as resection of the lung and isolated synchronous brain lesions, as well as metachronous brain metastases, may be associated with prolonged survival duration (7 - 9). under the presumption that low - burden metastatic disease can be effectively surgically resolved in certain subsets of patients, we have treated patients exhibiting primary nsclc and isolated synchronous brain metastases aggressively, by the combined control of lung and brain lesions. this study retrospectively examined our experiences with patients who underwent treatment of isolated synchronous brain metastases coupled with primary nsclc in the last ten years. from january 1995 to june 2004, 1,590 patients underwent surgical resection for nsclc at our institution. twelve (0.7%) of these patients exhibited isolated synchronous brain metastases coupled with primary nsclc. preoperative workups included computed tomography (ct) scanning of the chest and upper abdomen in all patients, bronchoscopy or percutaneous needle aspiration, when applicable, for the histologic evaluation of all patients, brain magnetic resonance imaging (mri) in all patients with neurologic symptoms or adenocarcinoma, bone scans, and positron - emission tomography (pet) or pet - ct. pathologic reviews of pulmonary and cerebral or cerebellar neoplastic tissue confirmed identical histological diagnoses for all patients who underwent craniotomies. synchronous brain metastases were defined as those metastases which were diagnosed less than 60 days from the time at which the primary nsclc was diagnosed. the medical records of each patient were examined with regard to age, sex, histologic type and grade, pathologic intrathoracic tn stage, surgical procedure, postoperative complications, adjuvant therapy, and survival duration. cerebral resections were considered complete when all gross evidence of disease was removed. in all patients, pathologic staging was conducted according to the guidelines of the international staging system for nsclc (10). operative mortality included patients who died within the first 30 days after the thoracic procedure, as well those who died later, but during the same period of hospitalization. median patient age was 52 yr, in a range of 32 to 75 yr. median time between the first cerebral treatment or pulmonary resection and the pulmonary resection or cerebral treatment was 15 days, in a range of 10 to 380 days. pulmonary resection included pneumonectomy in 1 patient, bilobectomy in 4, lobectomy in 6, and wedge resection in 1. mediastinoscopic lymph node biopsies were conducted in 3 patients, all of which generated negative findings. complete pulmonary resections (r0) and mediastinal lymph node dissections were performed in all patients, with the exception of one, who underwent wedge resection. the nsclc histologic type was adenocarcinoma in 7 patients (58.3%), squamous cell carcinoma in 3 (25%), and adenosquamous cell carcinoma in 2. lymph node metastases were present in 7 patients, and were staged n1 in 3 patients and n2 in 4. these included headaches in 4, visual disturbances in 1, slurred speech in 1, motor weakness in 1, and gait disturbances in 1. treatment for brain lesions included 5 craniotomies, 7 stereotactic radiosurgery (srs), and 11 wbrt. as modality to increase local control, either craniotomy or srs was applied, and the decision on modality selection was made on an individual bases considering the advantages and the disadvantages of each modality. craniotomy was favored if the lesions were rather superficially located and were causing distressing neurologic symptoms and signs, while srs was favored if the lesions were in deep and eloquent areas. further local treatment for the brain lesions was not performed in two patients following wbrt, who were with very small sized metastatic lesions. treatment for brain lesions was carried out prior to that for pulmonary lesions in 7 patients, one of whom underwent craniotomy and wbrt at another hospital. gross total removal of metastatic tumors was verified in all patients who underwent craniotomy at our institution. srs was conducted with linear accelerator - based radiosurgery system in 1 patient, and gamma - knife unit in 6 patients. survival was estimated by the kaplan - meier method, with the date on which treatment on cerebral or pulmonary lesion was initiated as the starting point, and the date of death or last follow - up as the end point. a p value of less than 0.05 (p<0.05) was considered to be statistically significant. all analyses were performed using the spss software package (spss for windows, release 11.0, standard version). pulmonary resection included pneumonectomy in 1 patient, bilobectomy in 4, lobectomy in 6, and wedge resection in 1. mediastinoscopic lymph node biopsies were conducted in 3 patients, all of which generated negative findings. complete pulmonary resections (r0) and mediastinal lymph node dissections were performed in all patients, with the exception of one, who underwent wedge resection. the nsclc histologic type was adenocarcinoma in 7 patients (58.3%), squamous cell carcinoma in 3 (25%), and adenosquamous cell carcinoma in 2. lymph node metastases were present in 7 patients, and were staged n1 in 3 patients and n2 in 4. six out of 12 patients exhibited neurological symptoms. these included headaches in 4, visual disturbances in 1, slurred speech in 1, motor weakness in 1, and gait disturbances in 1. treatment for brain lesions included 5 craniotomies, 7 stereotactic radiosurgery (srs), and 11 wbrt. as modality to increase local control, either craniotomy or srs was applied, and the decision on modality selection was made on an individual bases considering the advantages and the disadvantages of each modality. craniotomy was favored if the lesions were rather superficially located and were causing distressing neurologic symptoms and signs, while srs was favored if the lesions were in deep and eloquent areas. further local treatment for the brain lesions was not performed in two patients following wbrt, who were with very small sized metastatic lesions. treatment for brain lesions was carried out prior to that for pulmonary lesions in 7 patients, one of whom underwent craniotomy and wbrt at another hospital. gross total removal of metastatic tumors was verified in all patients who underwent craniotomy at our institution. the radiation dose for wbrt was 30 gy in 10 fractions in every patient. srs was conducted with linear accelerator - based radiosurgery system in 1 patient, and gamma - knife unit in 6 patients. survival was estimated by the kaplan - meier method, with the date on which treatment on cerebral or pulmonary lesion was initiated as the starting point, and the date of death or last follow - up as the end point. cox 's proportional hazard model was used for multivariate analyses. a p value of less than 0.05 (p<0.05) all analyses were performed using the spss software package (spss for windows, release 11.0, standard version). follow - up was completed for all 12 patients for a median of 10.6 months and a range of 2 to 55.8 months. recurrence occurred in the brain in 2, distant organ in 2 (pelvic bone / ovary, adrenal gland / rib), and both the brain and distant organ in 3 (brain / extremity, brain / liver / pleura, brain / spine). the pathologic tn stages of patients developing recurrences were t2n0 in 3, t1n2 in 1, t2n2 in 2, and t3n1 in 1. the median interval from initiation of treatment to recurrence was 4.5 months (2.8 - 6.5 months). treatment of recurrence included 2 wbrt and 4 srs for cerebral lesions, radiotherapy for spine, extremities, ribs, and pelvic bones, adrenalectomy, and salphingooophrectomy. currently, 8 patients remain alive, and 4 of them have exhibited no signs of recurrence at 8.5, 12.9, 34.5, and 55.8 months after the initial treatment. the median survival duration for pathologic n2 was 6.2 months (95% ci, 4.8 - 7.5 months) (fig. the difference between survival rates according to pathologic n stage evidenced a trend toward statistical significance (n0 vs. n2, p=0.0586). the 1-yr survival rates for locoregional pathologic stages i and iii were 75% and 53.3%, respectively (p=0.2492). the 1-yr survival rates for solitary and multiple brain metastases were 75% and 44.4%, respectively (p=0.1442). the 1-yr survival rate for the 9 patients with brain metastases involving less than 4 lesions was 70%. the 1-yr survival rate for the 4 patients with 2 or 3 cranial metastases was 66.7%, which was not significantly different from that for patients with solitary brain metastases (p=0.5). currently, 3 patients of them remain alive, at 5.6, 8.5, and 12.8 months after the initial treatment. survival was not found to vary significantly with histologic type (adenocarcinoma vs. non - adenocarcinoma, p=0.9859). approximately 25% of patients with stage iv nsclc exhibit brain metastases, as well as other incidences of metastatic disease (11). the natural course of untreated brain metastases included progressive neurological deterioration, with a median survival time of 1 - 2 months (6). the prognoses of brain metastasis patients tend to be poor, with a median survival of 2 months when treated with steroids alone, and 3 to 6 months when treated with wbrt. aggressive treatment of brain metastases may involve either the surgical resection of the metastases, or the ablation of the metastases by srs. removal of brain metastases has been determined to prolong survival and improve quality of life (12). the effect of treatment of brain metastases without treatment of the primary site, however, may be quite limited. retrospective series suggest that some patients with stage iv lung cancer, coupled with a solitary synchronous site of extrathoracic metastatic disease, can be effectively treated by the resection of both the primary tumor and the metastasis (7 - 9, 13). among patients with lung cancer that has metastasized to the brain, the most favorable prognoses are associated with complete resection of the primary lung tumor (14). solitary metastases are associated with better prognoses than are multiple metastases (9). whether brain metastases are metachronous or synchronous has not generally been found to influence survival. it remains unclear as to whether or not the lymph node status of the primary tumor is of prognostic significance in patients who undergo resection of a solitary brain metastasis (7). suggested that it seemed legitimate to proceed with lung resection after the complete resection of a single brain metastasis, at least in patients with an adenocarcinoma and a small lung tumor and without abnormal mediastinal lymph nodes, as seen on the ct scans or during mediastinoscopic lymph node biopsies (15). the overall 1-yr survival rate of our patients was 61.7%, which is consistent with the findings of other reviews. one was a patient who was discovered to have leptomeningeal seeding 48 days after pulmonary resections. the other was a patient whose multiple brain lesions had regarded as ischemic change, and thus the treatment of this patient 's brain lesion was delayed. excluding these cases from the survival analysis, the overall 1-yr survival rate was 70%. although no evident statistical differences were detected, the difference between survival rates according to pathologic n status tended toward statistical significance (p=0.0586). in addition, the survival of patients with pathologic n1 was not different from that of those with pathologic n0 (p=0.5316). when deciding upon the most appropriate treatment option for an individual patient, the following factors should be taken into consideration : symptoms ; general condition of the patient ; extent and status of cerebral disease ; and extent and status of extracranial disease. craniotomy is the preferred treatment modality for solitary lesions associated with significant edema, large lesions (greater than 3 cm at maximal diameter), superficial lesions, lesions causing symptoms requiring immediate relief, and lesions associated with hemorrhage. srs is recommended in cases in which the lesion is deep, but is less than 3 cm at maximal diameter, when there are medical contraindications to craniotomy, or in some cases, when the tumor recurs (16). the decision to operate on lesions of intermediate size (which typically range from 1 to 3 cm in maximal diameter) is particularly challenging, as in many cases, surgery and srs may be considered to be equally appropriate treatment methods (17). the advantages of craniotomy include the immediate resolution of mass effects, the acquisition of tissue for pathologic diagnosis, and no risk of radiation necrosis (18). the advantages of srs include decreased risks of hemorrhage and infection, less invasiveness, and no risk of tumor seeding. the disadvantages of srs include the potential exacerbation of peritumoral edema, the necessity for long - term steroid administration, and radiation necrosis (19). tumors in eloquent cortex, or deep - seated tumors, are usually considered unresectable. in these cases it remains unclear as to whether srs or craniotomy provides better survival benefits, even for patients manifesting single brain metastases (18). in our reviewed cases, we included patients with multiple cerebral metastatic lesions as well as patients with single lesions (table 2). the survival rate associated with 2 or 3 cranial metastases was not significantly different from that associated with solitary brain metastases. a patient with t2n0 stage and 2 cranial metastases was successfully treated via a combination of srs for the smaller lesion, craniotomy for the larger lesion, wbrt, and bilobectomy., we could speculate that aggressive management of primary nsclc and isolated synchronous brain metastases was beneficial in a selected group of patients, as long as the brain lesions and pulmonary lesions were limited or resectable. admitting the positive role of surgery in the management of isolated synchronous brain metastases coupled with primary nsclc, we are planning to design a prospective phase ii study regarding the surgical treatment of nsclc with isolated synchronous brain metastases.	this study is a retrospective examination of our experiences with patients who underwent treatment of isolated synchronous brain metastases coupled with primary non - small cell lung cancer. from january 1995 to june 2004, 12 patients presented with isolated synchronous brain metastases coupled with primary non - small cell lung cancer. the patient was comprised of 8 men and 4 women. the median age was 52 yr, in a range of 32 to 75 yr. median follow - up duration was 10.6 months, in a range of 2 to 55.8 months. recurrence developed in 7 patients, and the median interval from 1st treatment to recurrence was 4.5 months (2.8 - 6.5 months). the overall 1-yr survival rate was 61.7%. the 1-yr survival rates for pathologic n0 and n1 cases were 75% and 66.7%, respectively. the median survival duration for pathologic n2 was 6.2 months (95% ci, 4.8 - 7.5 months). the 1-yr survival rate for cases of single brain metastasis was 75%. based on our current observations, we could speculate that aggressive management of primary non - small cell lung cancer and isolated synchronous brain metastases was beneficial in a selected group of patients, as long as the brain lesions and pulmonary lesions were limited or resectable.
	cancer is a worldwide public health concern. identifying carcinogens and limiting their exposure is one approach to the problem of reducing risk. currently, epidemiology and rodent bioassays are the means by which putative human carcinogens are identified. both methods have intrinsic limitations : they are slow and expensive processes with many uncertainties. the development of methods to modify specific genes in the mammalian genome has provided promising new tools for identifying carcinogens and characterizing risk. transgenic mice may provide advantages in shortening the time required for bioassays and improving the accuracy of carcinogen identification ; transgenic mice might now be included in the testing armamentarium without abandoning the two - year bioassay, the current standard. we show that mutagenic carcinogens can be identified with increased sensitivity and specificity using hemizygous p53 mice in which one allele of the p53 gene has been inactivated. furthermore, the tg.ac transgenic model, carrying a v - ha - ras construct, has developed papillomas and malignant tumors in response to a number of mutagenic and nonmutagenic carcinogens and tumor promoters, but not to noncarcinogens. we present a decision - tree approach that permits, at modest extra cost, the testing of more chemicals with improved ability to extrapolate from rodents to humans.imagesfigure 1.figure 2.figure 3.
. clinical features of the disease vary from asymptomatic to symptomatic lymphadenopathy accompanied by fever, malaise and/or weight loss. based on the histological findings cd is divided into two variants the hyaline vascular variant (hvv) and the plasma cell variant (pcv). when disease location is considered, cd can be divided further into three types including a unicentric hvv found in 72% of cases, unicentric pcv accounting for 18% of cases and multicentric pcv identified in 10%. the following case has two unique features : (1) presentation as an obstructive jaundice mimicking acute cholangitis and (2) presentation as a widespread systemic lymphadenopathy. the final diagnosis was confirmed as multicentric hvv, which is a very rare variant accounting for only 1% of all cd cases. a previously healthy 50 year - old male patient visited the emergency department for right upper quadrant abdominal pain. he had a smoking history of 20 pack - years and quit smoking seven years ago. he had no history of liver disease or other illness except prurigo simplex and papular urticaria on both lower extremities. three weeks prior to presentation, he visited a local clinic for loss of appetite and weight loss (4 kg/3 months). one week prior to presentation, the patient began to have ruq discomfort, which progressed to pain in three days. physical findings were normal except for a yellowish skin color and a 1 cm - sized lymph node at the right supraclavicular area. initial laboratory testing showed : total bilirubin 6.0 mg / dl, alp 280 iu / l, ast / alt 125/248 iu / l, gamma - gt 195 iu / l, lipase 1648 u / l (23~300), and amylase 140 u / l (60~180). the complete blood cell count (cbc) was normal except for a slightly increased eosinophil count (668/l). pancreas and biliary ct showed masses at the right renal hilum and the peripancreatic area (figure 1). percutaneous needle biopsy (pcnb) from the renal hilum revealed a patchy infiltration of atypical lymphoplasma cells. however, lack of sufficient tissue limited an accurate diagnosis. it revealed multiple positive uptakes in the cervical, right hilar, subcarinal, and subaortic lymph nodes as well as in the peripancreatic area (figure 2). additional neck and chest ct showed multiple enlarged homogeneously enhancing lymph nodes on both side of neck and mediastinum. excisional biopsy of the right supraclavicular node revealed a hyaline vascular variant of cd (figure 3). immunohistochemical findings were cd20 (+), cd3 (+), cd21 (+), cd10 (+ in germinal center), bcl-2 (+ in paracortical area), and hhv-8(-). hhv-8 pcr from peripheral blood mononuclear cells was also negative. after the administration of high dose corticosteroids (1 mg / kg of prednisolone), liver function improved with the level of total bilirubin decreasing from 16.3 to 2.1 mg / dl, alp from 348 to 110 iu / dl and ast / alt from 291/1054 to 29/122 iu / l. after two weeks of treatment, follow - up abdominal ct showed that pancreatic swelling, the pararenal mass and the multiple peripancreatic lymph nodes decreased in size (figure 4). castleman disease is rare, and its scarcity has precluded comprehensive studies leading to an incomplete understanding of its pathophysiology1). recent reports suggest that hhv-8 infection stimulates b lymphocytes to induce ll-6 production in the mantle zone2 - 4). the proportion of hhv-8 infected cases among cd patients is variable and reported to be from 33% to 100%. in hiv - positive patients, immunohistochemical staining of lymph nodes and peripheral blood pcr revealed no correlation between hhv-8 infection and the disease. other exogenous or endogenous factors may induce il-6 secretion from b lymphocytes in hhv-8 negative cd. local production of il-6 may contribute to the characteristic b - cell proliferation and vascularization observed in cd6). moreover, in patients with multicentric cd, systemic symptoms might result from the circulation of il-6 and il-6-producing b lymphocytes7). in these include rheumatoid arthritis, lupus, sjogren syndrome, hiv infection, lymphoma, and drug sensitivity. for our patient there were no specific symptoms, signs or history suggestive of inflammation, infection or drug sensitivity. we used the pcnb of the perirenal mass as a diagnostic tool initially in order to start chemotherapy immediately. since we failed to get enough tissue from the pcnb of the perirenal mass, we next tried an excisional biopsy of the cervical node. the most common type is the unicentric hyaline vascular variant (u - hvv) accounting for 72% of all cds. a single node or a chain of lymph nodes is involved in the u - hvv variant, and its most common location is the mediastinum. the unicentric plasma cell variant (u - pcv) accounts for 18% of all cases of cd ; most u - pcv patients have constitutional symptoms such as anemia, elevated esr and frequently abdominal lymph nodes. the final type is the multicentric plasma cell variant (m - pcv) representing 10% of all cds. the m - pcv patients are usually older than in the other variants commonly in the fifth to sixth decade of life. patients with m - pcv frequently present with fever, organomegaly and/or abnormal laboratory findings such as anemia or thrombocytopenia9). the only symptoms noted on presentation were those commonly associated with an obstructive jaundice, anorexia and/or weight loss. the proportion of patients with muticentric cd and hvv is less than 1% of all cd. two of these patients had systemic symptoms and signs and one patient had hiv infection and kaposi 's sarcoma. we could find only two prior reported cases of cd with obstructive jaundice11, 12). laparotomy confirmed u - hvv involving the bile ducts, liver parenchyma and adjacent lymph nodes. the second case presented with enlarged lymph nodes in the porta hepatis and the common bile duct. the therapeutic approach to multicentric cd depends on whether hhv-8 pcr and cd20 are positive. in hhv-8 pcr - positive cases, use of valgancilovir is considered. for the cd20-positive cases, treatment is with rituximab an anti - cd20 monoclonal antibody5). patients presenting with both markers negative receive treatment with immunosuppressive agents such as prednisolone, interferon - alpha, thalidomide, or chop chemotherapy. the use of prednisolone resulted in an immediate decrease in the size of the mass and improved laboratory profiles. follow up evaluations of symptoms, laboratory tests including liver function and image studies at regular intervals are planned for this patient. in conclusion, we present a case of multicentric cd presenting with jaundice. pet identified widespread systemic lymphadenopathy ; the final diagnosis was confirmed as cd, the hyaline vascular variant.	castleman disease (cd) is a rare lymphoproliferative disorder of unknown etiology with different clinical manifestations. a previous healthy 50 year - old man was hospitalized for right upper quadrant (ruq) abdominal pain. he had jaundice and a 1 cm - sized lymph node in the right supraclavicular area. pancreas and biliary computed tomography (ct) showed masses at the right renal hilum and peripancreatic areas. positron emission tomography (pet) showed widespread systemic lymphadenopathy. excisional biopsy of the right supraclavicular node revealed a hyaline vascular variant of cd. corticosteroid therapy was started and the extent of disease decreased. we here report a case of multicentric cd, the hyaline vascular variant, presenting with jaundice, diagnosed by excisional biopsy and successfully treated with corticosteroids.
trichotillomania is a common impulse control disorder seen in both children and adults characterized by the intense urge to pull out one 's hair which then results in hair loss over the scalp, eyebrows, and/or pubic areas. pulling is often caused or preceded by stress and anxiety which is then relieved after the hair pulling process. there is also a sense of guilt, ridicule, and shame associated with the disorder and patients do not often present on their own for treatment. sometimes, patients may have trichotillomania like symptoms that may extend to them pulling hair from sofa fibers, carpets, soft toys, and even pet animals though its documentation is not as common as the disorder itself. patients with trichotillomania often have insight that they have a disorder and may present to dermatological clinics seeking treatment for alopecia which is patchy and may appear to be alopecia areata. on close scrutiny, however, it may be detected that the alopecia is often due to trichotillomania rather than alopecia areata. here, we present a case of a patient who had trichotillomania and recovered well but then started pulling her child 's hair and in fact brought the child for treatment claiming nonawareness with regards to the cause of the hair loss. a 36-year - old woman presented to the psychiatry outpatient department with symptoms of hair pulling. she was brought by her husband who claimed that his wife used to pull her hair when anxious or worried. on questioning the patient, she revealed having an anxious nature and would worry unnecessarily about routine daily activities. when her worries would increase, she would develop an incessant urge to pull her hair and initially started pulling eyebrow hair, later moving to the scalp. she would have an intense urge that would make her do so, and she would experience a sense of relief after the act. she had similar hair pulling behavior when she was in school, and it would usually happen prior to either a stage performance or school examinations. it resurfaced in the past 6 months when her son who was in second grade had academic difficulties, and she would worry about his academics and education. she had good insight and realized that she has a problem that needed treatment and wanted a cure for her woes. she was started on fluoxetine in the dose of 20 mg / day which was increased weekly by 20 mg and over a period of 3 weeks ; we reached a dose of 60 mg / day. she was also psycho - educated about trichotillomania and was taught thought stopping and habit reversal to encounter her intense urges to pull hair. she responded well to the treatment and claimed nearly 100% improvement in a period of 4 weeks. she did not follow - up thereafter. within a period of 3 months post recovery, she brought her 8-year - old son to our outpatient department as a patient, claiming that he too exhibited trichotillomania and that he used to pull his eyebrow hair. the child was assessed and on repeated questioning vehemently denied hair pulling while his mother insisted on the same. the child 's father was called upon in the absence of the mother and it was during the same session that the child tearfully told us that his own mother used to pull his hair from the eyebrows as a punishment for his bad performance in school. he said she used to do this whenever she felt like and it was only when his eyebrows look damaged and the school authorities complained about the same to her, that she brought him for treatment to us claiming that he was the patient as she needed documentation to the school that he was ill and was undergoing treatment. when we confronted the mother, in the presence of her husband threatening her police and legal action, in view of physically abusing her own child, she then broke down and admitted that she did pull her child 's hair as she had intense hair pulling urges from time to time. supportive counseling was provided to the family, and the school authorities were briefed and asked to report to us if they suspected further hair loss in the child. in child and adolescent psychiatry, we come across a condition called factitious disorder by proxy or munchausen 's disorder by proxy where a child may present to the medical or pediatric unit with medical conditions which may not have a cause and may, in fact, be due to the wrongdoing of a parent. trichotillomania by proxy as a variant of munchausen or factitious disorder by proxy where a parent pulls the child 's hair as a means to satisfy her hair pulling urges and brings the child for treatment claiming that the child has trichotillomania. this is an important consideration for pediatricians, dermatologists, trichologists, and child psychiatrists when assessing childhood onset trichotillomania particularly when parents too have or admit to a history of trichotillomania. this case study brings to the fore an important yet rare presentation of trichotillomania that needs a detailed analysis.	trichotillomania is a disorder of an impulsive hair pulling that occurs in both adults and children alike. trichotillomania is seen in children and often has other psychiatric comorbidity. here, we present an interesting case of a mother who had trichotillomania and recovered with treatment following which she resorted to pulling hair of her child and brought her child for treatment saying that the child too had trichotillomania and that we should help the child recover like her. after interviewing the child, it was revealed that it was, in fact, the mother who used to pull the child 's hair as a release for her hair - pulling urges.
regional anesthesia is the recommended technique for upper and lower limb surgeries with better postoperative profile. considerable research has been conducted over years in order to determine the ideal local anesthetic (la) drug. an ideal drug should have a fast sensory onset, differential offset, with an earlier offset of motor than sensory blockade, enabling early ambulation / movements with prolonged analgesia. several combinations of las and adjuvants such as tramadol, sufentanyl, clonidine, and fentanyl have been employed in the search for near ideal agent, which remains elusive. currently, levobupivacaine (s()-enantiomer of bupivacaine) with favorable clinical profile and lesser cardiotoxicity when compared with racemic bupivacaine is being favored la for regional block. dexmedetomidine, an 2-receptor agonist, with 2/1 selectivity 8 times than that of clonidine has also been reported to improve the quality of intrathecal and epidural anesthesia when used along with la as adjuvant. in our current prospective, randomized, double - blind study we evaluated the effectiveness of the addition of dexmedetomidine to levobupivacaine for supraclavicular brachial plexus block. it was hypothesized that addition of dexmedetomidine 1 g / kg to levobupivacaine will help to reduce the total dose of levobupivacaine required for supraclavicular brachial plexus block. other primary objectives were to asses : onset and duration of sensory blockade ; onset and duration of motor blockade ; duration of postoperative analgesia ; and patient satisfaction score (pss). secondary objectives assessed included : intraoperative narcotic requirement ; hemodynamic changes ; and any side - effects or complications. with ethical committee approval, a double - blind, randomized prospective clinical study was planned among 90 american society of anesthesiologist (asa) grade i and ii patients in the age group of 18 - 55 years, posted for elective upper limb orthopedic surgeries under brachial plexus block using supraclavicular approach. patients with diabetes, peripheral neuropathy, with known allergy to las, coagulopathy, infection at the site of block, pregnancy, and patients on beta blockers were excluded from the study. preoperatively patients were counseled and familiarized with the use of visual analogue scale (vas) pain score for the assessment of perioperative pain. after obtaining written informed consent, patients were randomly divided into two groups using sealed envelopes technique. a sealed envelope was randomly selected and opened by an assistant, with instructions to draw up the relevant drug. the syringe was labeled with the patient 's name and handed to the investigator who performed the block. an independent observer (senior anesthesiologist posted on duty, not included in the study) then observed the onset and offset of sensory and motor blockade and analgesia. group a received 40 ml of solution containing 30 ml 0.5% levobupivacaine and 10 ml 1% lignocaine and group b received 40 ml of solution containing 30 ml 0.25% levobupivacaine with dexmedetomidine 1 g / kg body weight plus 10 ml 1% lignocaine. standard anesthetic monitoring was established using electrocardiogram monitor, pulse oximeter, and a noninvasive blood pressure monitor. an iv access was achieved on the nonoperative arm prior to performing supraclavicular brachial plexus block. patients were kept in the supine position with the arm by side of the trunk and extended along the side towards the ipsilateral knee as far as possible, and the head slightly turned to the opposite side. the supraclavicular brachial plexus block was performed using subclavian perivascular technique described by kulenkampff, modified by winnie and collins. the brachial plexus was located using standard peripheral neurostimulator (stimuplex, b braun) with 2-hz and 1.0-ma. the site that triggered muscular response to a stimulus equal to or lower than 0.4 ma was located, and la mixture was given in the increments of 5 ml after fixing the stimulating needle, aspirating in between to avoid inadvertent intravascular injection. sensory block was assessed by loss of sensation to pin prick over the c5-t1 dermatomes using a three - points scale (0-sharp pain, 1-dull pain [analgesia ], 2-no pain [anesthesia ]). similarly, motor block was assessed using bromage scale (0-normal motor functions with full flexion and extension of the elbow, wrist and fingers, 1-decreased motor strength with the ability to move fingers only, 2-complete motor blockade with inability to move fingers). sensory and motor blocks were assessed every 2 min for first 10 min and then every 3 min until 30 min after injection, and then every 30 min after surgery, until recovery. sensory onset time was defined as the time interval between the end of la administration and establishment of score 2 on three - point scale on all nerve territories. duration of sensory block was defined as the time interval between the end of la administration and the complete resolution of anesthesia (score 0 on three - point scale) on all nerves. complete motor block was defined as the absence of voluntary movement on hand and forearm (score 2 on bromage scale). duration of motor block was defined as the time interval between the end of la administration and the recovery of complete motor function of the hand and forearm (score 0 on bromage scale). general anesthesia was given subsequently to these patients who were then excluded from the analysis. supplemental oxygen was provided to all the patients through nasal canula throughout the surgery. after taking a preoperative baseline value, vital parameters, that is, systolic blood pressure (sbp), diastolic blood pressure (dbp), arterial saturation (spo2), respiratory rate (rr), and heart rate (hr) were monitored at every 5 min interval till 30 min of la injection and then every 10 min till 1 h and thereafter every 15 min till the end of surgery and postoperatively one hourly till first 24 h. adverse events such as hypotension (20% decrease in relation to the baseline value), bradycardia (hr 3). patients were monitored for 24 h postoperatively to assess total duration of sensory and motor blockade and vas pain score. postoperatively rescue analgesia in the form of nonsteroidal anti - inflammatory drugs (injection diclofenac sodium 75 mg) was given when patient complained of vas > 3. injection fentanyl 1 g / kg body weight was administered if patient still complained of pain. pss was recorded after 24 h postoperatively as 5-excellent, 4-very good, 3-good, 2-fair, and 1-poor. statistical methods (n = 43) were chosen after comparing previous studies, taking time for sensory onset in minutes as one of the primary variable to ensure at least 83% power of the study. sample size was calculated by equating standard error of the sample mean to 20% (i.e., /n = 0.20 = > n = /(0.20)) and power analysis was performed by taking 0.66 min as effect size at 1% level of significance (one - tailed). z = 2.33-dn/. power = 1-(z) where (z) is the cumulative probability density. the data from the present study was systematically collected, compiled and statistically analyzed by statistical package for social sciences version 17.0 (spss) software. unpaired t - test was applied for demographic data, hemodynamic parameters, onset and duration of sensory / motor blockade and duration of analgesia, chi - square test was applied for age, sex and asa grades. p value was considered as significant if n = /(0.20)) and power analysis was performed by taking 0.66 min as effect size at 1% level of significance (one - tailed). z = 2.33-dn/. power = 1-(z) where (z) is the cumulative probability density. the data from the present study was systematically collected, compiled and statistically analyzed by statistical package for social sciences version 17.0 (spss) software. unpaired t - test was applied for demographic data, hemodynamic parameters, onset and duration of sensory / motor blockade and duration of analgesia, chi - square test was applied for age, sex and asa grades. p value was considered as significant if 0.05) [table 1 ]. sensory and motor block onset time were significantly shorter in group b as compared to the group a (p 0.05). however, the duration of motor blockade was statistically shorter in group b (p < 0.05) and duration of analgesia was statistically longer in group b (p < 0.05) when compared to group a [table 2 ]. intraoperative fentanyl was required in two patients in group a, while no patient in group b required fentanyl [table 1 ]. vas pain scores were less in group b at each interval [figure 1 ]. the demographic data and surgical characteristics the characteristics of block we observed a statistically significant difference (p < 0.05) in hr between two groups from 10 min after the block, which extended in the postoperative period up to 24 h [figure 2 ]. a statistically significant difference was observed in sbp and dbp from 10 min that extended into the postoperative period [figure 3 ]. bradycardia (hr < 60) was observed in two patients in group b but none of them required treatment. both the groups were comparable for rr and spo2 at each interval, and the results were statistically insignificant. none of the patients in either group had technique or drug - related side effects or complications. patients in both the groups had an equally good satisfaction score [table 4 ]. heart rate in group a and group b systolic and diastolic blood pressure in group a and group b post operative analgesic requirement patient satisfaction score in this study, we demonstrated that the addition of dexmedetomidine to levobupivacaine can significantly : decrease the concentration of levobupivacaine required for surgical anesthesia ; shortens the sensory and motor block onset time ; reduce the offset time for motor block ; prolong the duration of postoperative analgesia ; reduce the total la dose without any perioperative analgesic compromise ; provides significantly lower postoperative vas pain scores, and provided comparable overall satisfaction scores among patients. local anesthetic agent selection, dose, concentration, volume, and physical modifications can affect onset, spread, quality, and duration of anesthesia. levobupivacaine, the s - enantiomer of bupivacaine, which has less cardiac and neural toxicity than bupivacaine, is currently the closest to the ideal agent for neural blockade however large volumes of drug are required for adequate block. it has been observed that 0.25% levobupivacaine and 0.25% bupivacaine have a similar motor and sensory block onset times and qualities, and provide comfortable anesthesia and analgesia for shoulder surgery. a volume of 10 ml of 1% lignocaine was added to both the groups so as to hasten the onset of block. further studies can be conducted to evaluate whether the addition of dexmedetomidine can further reduce the concentration of lignocaine also without compromising motor block. as dexmedetomidine has peripheral analgesic action, so it was hypothesized that it may be helpful in reducing the total concentration of levobupivacaine from 0.5% to 0.25%, which has been validated by the findings of our study. lesser concentration of la correlates well with lesser duration of motor block as seen in patients allowing early painless movement of the limb and hence better postoperative comfort as well as better safety due to reduced amount of la injected. alpha-2-adrenergic receptor (2-ar) agonists have been successfully utilized in various anesthetic techniques due to the hemodynamic - stabilizing properties, sedative, analgesic, and sympatholytic effects. in addition, 2-ar agonist such as dexmedetomidine have demonstrated a dose - dependent increase in the duration of thermal antinociception and analgesia in many animal studies. dexmedetomidine in clinically effective doses lacks respiratory depression, but maintains its analgesic properties that may make it useful and safe adjunct in many diverse clinical applications. no animal study has shown any evidence of neurotoxicity when administering dexmedetomidine (even at high concentrations) directly to sciatic nerves. peripheral analgesic effects of dexmedetomidine have enabled an overall improved blockade quality when added to las in a peripheral nerve block model and are thought to be mediated by 2-ar binding. dexmedetomidine mixed with lidocaine has been reported to decrease tourniquet pain, improve block quality, and prolong postoperative analgesia during intravenous regional anesthesia. in a randomized, double - blind trial performed by esmaoglu., dexmedetomidine added to levobupivacaine for axillary brachial plexus blockade shortened the block onset time, prolonged the duration of motor and sensory effects, and extended postoperative analgesia. however, they used 0.5% levobupivacaine with dexmedetomidine 100 g but in this study we used dexmedetomidine 1 g / kg with 0.25% levobupivacaine and compared it with 0.5% levobupivacaine. mean weight of the patients was 64.16 7.4 in group a and 66.18 7.3 in group b. reduced concentrations of levobupivacaine could be the reason for less duration of motor block seen in group b and reduced amount dexmedetomidine in g / kg body weight could be the reason of less incidence of bradycardia in our study. evaluated the addition of dexmedetomidine 1 g / kg to 0.5% levobupivacaine in axillary brachial plexus block and observed significantly decreased sensory block onset time, an increase in the sensory and motor block duration and time to first - analgesic use, and decreased total analgesic use with no side effects. in our study by using dexmedetomidine 1 g / kg with 0.25% levobupivacaine we could reduce the concentration of levobupivacaine and achieve early motor recovery resulting in better patient comfort and satisfaction without any perioperative analgesic compromise. swami. used dexmedetomidine and clonidine as an adjuvant to bupivacaine 0.25% in supraclavicular plexus block and demonstrated that dexmedetomidine prolongs the duration of sensory and motor block and enhances the quality of block as compared with clonidine. used dexmedetomidine with bupivacaine and compared it with plain bupivacaine and demonstrated enhancement of onset of sensory and motor blockade, prolonged duration of analgesia, increased duration of sensory and motor block, lower vas pain scores, and reduction in supplemental opioid requirements. dexmedetomidine may lead to side effects such as hypotension and bradycardia with increased dosage, along with its effects such as sedation and anxiolysis. in our study, two patients developed bradycardia, which did not require any treatment. major limitations of our study were that we could not biochemically analyze the blood concentration of levobupivacaine and dexmedetomidine due to nonavailability of facilities at our institution, which would have further supported our conclusions. use of ultrasound guided nerve blocks may further help to reduce effective levobupivacaine concentration with advantage of injecting the la mixtures in near proximity of nerve bundles. the results of the present study conclude that the addition of 1 microg / kg dexmedetomidine to 0.25% levobupivacaine for supraclaviclar plexus block helps in decreased onset time for sensory and motor block. it results in better patient comfort and comparable satisfaction due to early motor recovery, with lower vas pain scores.	background and aims : regional anesthesia is a recommended technique for upper and lower limb surgeries with better postoperative profile. in this, randomized, double - blind study, we evaluated the effectiveness of the addition of dexmedetomidine to varying concentration of levobupivacaine for supra clavicular brachial plexus block.material and methods : after obtaining ethical committee approval, a double - blind, randomized prospective clinical study was conducted on 90 american society of anesthesiologist grade i and ii patients in the age group of 18 - 55 years, divided randomly into two groups : group a received 40 ml of solution containing 30 ml 0.5% levobupivacaine and 10 ml 1% lignocaine and group b received 40 ml of solution containing 30 ml 0.25% levobupivacaine and 10 ml 1% lignocaine with dexmedetomidine 1 microg / kg for supraclavicular brachial plexus block. besides effectiveness, other parameters observed were : duration of sensory blockade ; onset and duration of motor blockade ; duration of postoperative analgesia ; and patient satisfaction score.results:onset of sensory and motor blockade was 7.6 1.006 min and 8.3 0.877 min in group a, while it was 6.96 1.077 min an 7.6 1.1 min in group b, respectively. the difference was statistically significant (p 0.05). duration of motor block was 8.45 0.75 h in group a and 5.6 0.98 in group b (p < 0.05). duration of analgesia was 8.5 0.77 h in group a and 9.2 1.05 in group b (p < 0.05).conclusion : addition of 1 microg / kg dexmedetomidine to 0.25% levobupivacaine for supraclaviclar plexus block shortens sensory, motor block onset time and motor block durations, extends sensory block, and analgesia durations. reduction in total levobupivacaine dose also increases the safety margin of the block.
the first case of hiv was reported in nepal in 1988, thereafter, there was a trend for increasing numbers of infections being recorded among specific groups of the population and in the low - risk general population for 20 years. although nepal 's hiv control programme has achieved some progress in reducing the incidence of hiv infections, it needs to be implemented effectively and efficiently to achieve the targets set. hiv in nepal is characterised as a concentrated epidemic in specific groups of the population, for example people who inject drugs (pwid), men who have sex with men (msm) and female sex workers (fsw). male migrants who work particularly in india, where migrant labourers often visit female sex workers, are considered a bridging population that transfers infections to the general population. forty - eight per cent of nepal 's population are between the age of 15 and 49 years, and are vulnerable for acquiring and transmitting hiv infection. the global health sector strategy on hiv 20162021 has proposed the vision of zero new infections, zero new deaths and zero hiv - related discrimination in a world where people living with hiv are able to live long and healthy lives. nepal 's national hiv / aids strategy 20112016 has adopted strengthening of the second generation surveillance (sgs) system. however, before starting sgs, it is important to know the status and progress made in hiv / aids control so as to further strengthen control programmes based on identified intervention gaps. the epidemiology of hiv in nepal has changed due to evolutions in policies over the last 10 years, particularly in diagnosis and treatment, and the various efforts to control hiv in the different population groups. therefore, this review aims to improve knowledge on the effectiveness of the interventions / policies in different sub - populations at risk. this article was prepared by reviewing published and unpublished documents from the nepalese hiv control programme, published journal articles and various survey reports including ibbs surveys. medline and pubmed were searched for key peer - reviewed literature published up to april 2016 for information on key affected populations as well as the general population. furthermore, the strategic information unit of the national centre for aids and std control (ncasc) was consulted for routine programme data on epidemiology and services on the current status of hiv infections in different risk populations and control efforts of the programme in nepal. apart from epidemiological data sources, financial investments in hiv control interventions were also collected and analysed from secondary sources. estimation of the number of hiv infections in 2015 has shown a trend of decreasing hiv incidence since 2008. the estimated prevalence of hiv in 2015 was 0.2%, and had progressively decreased since 2005. the estimated prevalence of hiv has shown a reverted trend as targeted by the programme but reported number of hiv cases did not show such trend. reports from art centres show cumulative deaths due to hiv had reached 2204 in nepal up to 2015 (table 1). trends of hiv infections in nepal (20052015) ncasc routine programme data, 2015 national hiv infection estimation, 2015 the prevalence of hiv infection among pwid (51.7% in 2005 and 6.4% in 2015) was relatively high in all years compared with other risk groups in the population. in addition, prevalence amongst pwid was higher in the kathmandu valley than in the pokhara and terai districts. however, for fsw, hiv prevalence was 2% in 2015 in the kathmandu valley but a cross - sectional survey in pokhara in 2011 and 22 terai districts in 2012 showed prevalences of 1.2% and 1%, respectively, having remained almost constant over the years from 2006. similarly, prevalence of hiv among migrants was relatively higher in the mid- and far - western regions in 2006 (2.8%) but had reduced to 0.6% by 2015. prevalence of hiv among migrants in western districts constituted 1.1% in 2006, 1.4% in 2008, and 0.3% in 2015. the prevalence of hiv infection among msm varied from 1.7 to 14.4 in different years, and was 2.4% in 2015 (table 2). prevalence of hiv infections among key risk groups of populations fsw : female sex worker ; marp : most at - risk population ; msm : men who have sex with men ; msw : male sex workers ; pwid : people who inject drugs ; source : ibbs survey reports, 20052015 [823, 32 ] we assessed hiv prevalence among different population groups. reported hiv prevalence among women attending antenatal clinics was higher in 2006 (0.25%), decreasing over the following years and was lowest in 2015 (0.08%). among blood donors, hiv prevalence has been consistently below 0.5% and was 0.03% in 2014 (table 3). hiv prevalence in the general population of nepal ncasc routine programme data, 2015 gdbs data, 20062014 ; the number of people having an hiv test nationally was highest in 2013 and lowest in 2008. the cumulative number of individuals treated with antiretroviral drugs was 11,089 in 2015 through 61 art antiretroviral treatment sites. however, by 2014, this proportion had gradually increased to 80.8% although this decreased to 42.4% in 2015. the number of sites offering art increased from three sites (in three districts) in 2005 to 61 sites (in 55 districts) by 2015 (table 4). national hiv testing and treatment (20052015) htc : hiv testing and counselling ncasc routine programme data, 2015 health system reports, 2010, 2013 although different interventions have been conducted to cover key populations at risk from hiv, the coverage in some at - risk populations has been very low. similarly, hiv testing and counselling, sti diagnosis and treatment coverage have also been low as compared to vulnerable populations, based on their exposure due to migration, intravenous drug use, msm, fsw and the national estimates of people living with hiv which is around 39,397 (table 5). hiv control intervention activities among key populations (cumulative as of july 2015) bcc : behaviour change communication ; pwid : people who inject drugs ; mlm : male labour migrants ; msm : men who have sex with men ; fsw : female sex workers ncasc routine programme data, 2015 the nepal demographic and health survey 2011 revealed that the proportions of young men and women with knowledge of hiv prevention was slightly reduced compared to 2006. hiv testing status among the general population was very low (among males : 7.5% ; and among females : 2.9%). the percentage of male and female sex workers using condoms was 93.1% and 82.6%, respectively. in 2015, 86% of msm used condoms and 96% of pwids used safe injecting practices. early infant diagnosis of hiv was increased satisfactorily in 2015 to 16% compared to previous years ; however, only one - third of hiv patients were receiving art in 2015 although this was an increase on the years since 2005 (table 6). status of nepal 's aids response indicators between 2005 and 2015, various plans, policies and strategies have been formulated : national hiv strategy 20062011;national hiv and aids action plan 20082011;national hiv and aids strategy 20112016;national blood transfusion and safety policy, 2006;national guideline on antiretroviral (arv) therapy 2005.in addition, various guidelines were developed and came into practice : national guideline on paediatric hiv and aids 2006;national guidelines on management of blood transfusion services in nepal 2008;national aids and sti policy, 2011;national hiv aids strategy, 20062011;national hiv and aids action plan, 20082011;national hiv and aids strategy, 20112016;national blood transfusion and safety policy, 2006;national guideline on antiretroviral (arv) therapy 2005;national guideline on paediatric hiv and aids 2006;national guidelines for hiv testing and counselling, 2011;national guidelines on management of blood transfusion services in nepal 2014;national consolidated guidelines for treating and preventing hiv in nepal, 2014;national guidelines on case management of sexually transmitted infections 2014;prevention of mother - to - child transmission of hiv in nepal, standard operating procedures 2012;the share of the domestic budget for total expenditure on hiv control programmes is very low : 0.8% in 2007 ; 1.3% in 2009 ; 2.0% in 2010 ; and 13.3% in 2014. most of hiv control programmes were financed from foreign support including one - third of funds that came from the global fund. national hiv strategy 20062011 ; national hiv and aids action plan 20082011 ; national hiv and aids strategy 20112016 ; national blood transfusion and safety policy, 2006 ; national guideline on antiretroviral (arv) therapy 2005. national guideline on paediatric hiv and aids 2006 ; national guidelines on management of blood transfusion services in nepal 2008 ; national aids and sti policy, 2011 ; national hiv aids strategy, 20062011 ; national hiv and aids action plan, 20082011 ; national hiv and aids strategy, 20112016 ; national blood transfusion and safety policy, 2006 ; national guideline on antiretroviral (arv) therapy 2005 ; national guideline on paediatric hiv and aids 2006 ; national guidelines for hiv testing and counselling, 2011 ; national guidelines on management of blood transfusion services in nepal 2014 ; national consolidated guidelines for treating and preventing hiv in nepal, 2014 ; national guidelines on case management of sexually transmitted infections 2014 ; prevention of mother - to - child transmission of hiv in nepal, standard operating procedures 2012 ; national guidelines for early infant diagnosis 2012 ; nepal has made progress in hiv control programmes in recent years but reduction of the number of hiv infections is not as expected. the reported number of hiv / aids cases and recent estimations in 2015, showed an almost constant trend over the years. although there was progress in indicators set in the millennium development goals, it seems that the 90 - 90 - 90 target set in 2014 by the joint united nations programme on hiv / aids and partners, in which 90% of people living with hiv know their hiv status, 90% of people who know their status receive treatment, and 90% of people on treatment have suppressed viral load by 2020, may not be achieved. women are at high risk of becoming hiv positive due to biological vulnerabilities, low socio - economic status, dominant sexual practices of males and epidemiological factors and they are also more vulnerable to transmitting hiv. the prevalence of hiv among pwid is still relatively high compared to other risk population groups, but it has been reduced significantly over the years. among pwid, 96% used safe injecting practices and condom use was almost 53% only, both of these practices may have also attributed to a reduction in incidence of hiv among pwid. therefore, drug abuse should be reduced as well as focusing on harm reduction, rehabilitation and re - integration, with further emphasis on preventing non - injecting drug users from becoming pwid., comprehensive hiv prevention activities should be implemented among msm and msw to ensure a reduction. risk behaviour among migrants includes unprotected sex with multiple partners and sex workers and is promoted by substance abuse, loneliness, separation from families, peer pressure, long working hours and poor living conditions. negligence about good sexual health and lack of comprehensive knowledge about hiv among male migrants are major obstacles that have exacerbated the disease prevalence. once home, migrants also have extramarital sex in their villages and do not see any reasons for using condoms with village women. literacy and awareness about hiv is a key measure to decrease the prevalence of the disease among migrants. hiv prevalence among pregnant women attending antenatal care clinics, and who represent the general population, was 7 per 10,000. similarly, prevalence of hiv among blood donors was 0.15% ; however, data on other groups within the general population is not available. therefore, the national hiv aids strategy 20112016 focusing on linkages and integration of the hiv / aids control programme with other services such as hiv testing and counselling, tb, hiv, pmtct, antenatal care, safe motherhood, family planning, etc. should be explored and strengthened to assure comprehensive management of patients and future sustainability. the cumulative number of hiv patients treated with antiretroviral drugs was 11,089 in 2015, which constitutes only 35% of the total population of people living with hiv. the number of people receiving treatment has been increasing year on year. in nepal, hiv treatment initiation occurs at district health facilities and art sites are also fairly limited in numbers. interrupted procurement and supply of antiretroviral drugs and commodities for early diagnosis has also been reported. early initiation of art in discordant couples for the reduction of hiv transmission to the uninfected sexual partner is important. analysis of programme coverage indicators revealed that knowledge on hiv prevention, condom use during high - risk sex, and hiv testing in the general population are very poor. this suggests that hiv control programmes should also focus on the general population in addition to those most at - risk. although coverage of prevention programmes among the most at - risk populations (marps) is satisfactory, hiv test uptake is very low among these populations. a comprehensive programme for the most at - risk populations should be expanded to increase geographical coverage. hiv policies, plans and strategies have been developed to address the hiv response in nepal. those strategies also cover most of the interventions to control hiv among at - risk populations. however, there are the questions of implementation of strategies, inadequate geographical and population coverage, and security of a sufficient budget. the indicates that there is less than a 15% share from the domestic budget, which raises the question of the sustainability of the intervention programmes. there is a lack of adequate surveillance data to provide sufficient evidence on programme success. therefore, a continuous capacity - building process needs to be institutionalised for making monitoring and evaluation an ongoing activity at all levels. the monitoring and evaluation systems need to be integrated with the national health management information system, therefore a phase - wise approach needs to be initiated. a policy guideline also needs to be adopted for rational implementation of the spirit of public private partnership (ppp) at every level, from prevention to care of hiv / aids. the programmatic gaps identified that need to be addressed are as follows : (a)hiv testing and counselling (htc) centres with other relevant health services should be established and expanded. access to services such as sti, tb, hiv, pmtct, antenatal care, safe motherhood and family planning, should be expanded through integration with other reproductive and primary healthcare services to assure comprehensive management of patients and future sustainability.(b)there is a need for expansion of the art services, but prior to that there is need for scaling up the case - detection capacity through various strategies such as awareness raising, htc expansion, incentive provision, and stigma and discrimination reduction. scaling up of art should be done on the basis of needs assessment and geographical marp mapping data.(c)there is a need to significantly expand prevention and develop better strategies to reach larger numbers of nepali migrants working in india.(d)drug abuse should be reduced including harm reduction, rehabilitation and re - integration with emphasis on preventing non - injecting drug - users from becoming pwid.(e)a system should be established to enable marps and plhiv to address the issue of stigma and discrimination and other violations of their rights through continuous scale up of awareness programmes with greater involvement of plhiv, community based organisations, ngos, faith groups and media personnel. greater focus on condom promotion, sti management and partner treatment should be promoted.(f)a continuous capacity - building process needs to be institutionalised for making monitoring and evaluation an ongoing activity at all levels. the monitoring and evaluation system needs to be integrated with the national health management information system.(g)the domestic budget for hiv prevention activities should be increased for sustainability of the programme.(h)there is a strong need of harmonisation and co - ordination of programmes implemented by various partners. a central data bank should be in place at ncasc and data should be shared based on the national monitoring and evaluation guideline. hiv testing and counselling (htc) centres with other relevant health services should be established and expanded. access to services such as sti, tb, hiv, pmtct, antenatal care, safe motherhood and family planning, should be expanded through integration with other reproductive and primary healthcare services to assure comprehensive management of patients and future sustainability. there is a need for expansion of the art services, but prior to that there is need for scaling up the case - detection capacity through various strategies such as awareness raising, htc expansion, incentive provision, and stigma and discrimination reduction. scaling up of art should be done on the basis of needs assessment and geographical marp mapping data. there is a need to significantly expand prevention and develop better strategies to reach larger numbers of nepali migrants working in india. drug abuse should be reduced including harm reduction, rehabilitation and re - integration with emphasis on preventing non - injecting drug - users from becoming pwid. a system should be established to enable marps and plhiv to address the issue of stigma and discrimination and other violations of their rights through continuous scale up of awareness programmes with greater involvement of plhiv, community based organisations, ngos, faith groups and media personnel. a continuous capacity - building process needs to be institutionalised for making monitoring and evaluation an ongoing activity at all levels. the monitoring and evaluation system needs to be integrated with the national health management information system. the domestic budget for hiv prevention activities should be increased for sustainability of the programme. there is a strong need of harmonisation and co - ordination of programmes implemented by various partners. a central data bank should be in place at ncasc and data should be shared based on the national monitoring and evaluation guideline. nepal has maintained a constant incidence of hiv infection with little progress in reducing the number of cases of hiv infection. therefore, there is a need for implementation of more efficient and effective control programmes, with expanded geographical and population coverage. the surveillance system should be strengthened to get up - to - date information for evidence - based planning and developing strategies. the domestic budget for the hiv / aids control programme should be increased for sustainability of the intervention programmes. pg with the cooperation of tp, rp mrb and ns designed the concept for analysis and manuscript designing ; pg and mrb with support from tp, bbr, mc and kb collected the available data and analysed ; pg with support from mrb drafted the initial versions of the manuscript with analysed information as above and circulated to other co - authors for their review and inputs ; all authors reviewed the final manuscript and agreed to the analysis, gaps and final draft for submission to the journal for publication. pg with the cooperation of tp, rp mrb and ns designed the concept for analysis and manuscript designing ; pg and mrb with support from tp, bbr, mc and kb collected the available data and analysed ; pg with support from mrb drafted the initial versions of the manuscript with analysed information as above and circulated to other co - authors for their review and inputs ; all authors reviewed the final manuscript and agreed to the analysis, gaps and final draft for submission to the journal for publication. the authors alone are responsible for the views expressed in this article and they do not necessarily represent the decisions, policy or views of the world health organisation. the authors alone are responsible for the views expressed in this article and they do not necessarily represent the decisions, policy or views of the world health organisation.	abstractbackground and objectivesnepal has made progress with the control of hiv infection in recent years. there have been changes in epidemiology, programme interventions in different population groups, and changes in policies over the last 10 years, particularly in diagnosis and treatment. therefore, this review was conducted to identify the effectiveness of different interventions / policies in different sub - populations at risk, targeted towards epidemiology and treatment outcomes for those with hiv infection in nepal.methodsthis review was prepared based on a review of published and unpublished documents from the nepalese hiv infection control programme, published articles in different journals, different survey reports including integrated bio - behavioural surveillance (ibbs) survey reports.resultsthe prevalence of hiv infection among adults in 2014 was 0.20% with a progressive decreasing trend from 2005. the prevalence of hiv infection among injecting drug users (51.7% in 2005 and 6.4% in 2015 in kathmandu valley) was relatively high in all years as compared to other risk groups. hiv infection prevalence among women attending antenatal clinics was higher in the year 2006 (0.25%) but there was a decreasing trend in the following years to 2015, when prevalence was 0.077%. although different interventions were conducted to cover key populations at risk, the coverage in some risk population was very low. hiv testing status among the general population was very low (7.5% among males and 2.9% among females) in 2011. only one - third of hiv - infected individuals were on art in 2015, although this proportion has increased since 2005. the share of domestic budget among the total expenditure on hiv control program is below 15%.conclusionsthere is the need for implementation of control programmes more efficiently and effectively with expanding geographical and population coverage. surveillance systems should be strengthened to get up - to - date information for evidence - based planning and developing strategies. the domestic budget for hiv control programme should be increased to improve their sustainability.
the term acute coronary syndrome (acs) encompasses a range of thrombotic coronary artery diseases, including unstable angina (ua), and both st segment elevation (stemi) and non - st segment elevation myocardial infarction (nstemi), mostly induced by local coronary thrombosis as an acute complication of atherosclerosis. patients with an acute coronary syndrome have a high risk of suffering subsequent cardiac events.[24 ] coronary plaque disruption, with consequent platelet aggregation and thrombosis, is the most important mechanism by which atherosclerosis leads to the acute ischemic syndromes of unstable angina, acute myocardial infarction, and sudden death. with growing evidence that atherosclerosis is an inflammatory process, several plasma markers of inflammation have been evaluated as potential tools for the prediction of coronary events. these markers of inflammation include serum amyloid a, interleukin 6, homocysteines, fibrinogen levels, fibrinolytic capacity, apolipoprotein a, apolipoprotein b-100, lipoprotein (a) and c - reactive protein (crp). increased concentrations of crp have been reported in unstable angina and in acute myocardial infarction. liuzzo and associates have shown that concentrations of crp and serum amyloid a in unstable angina increase independently of myocardial cell injury. they also reported that higher concentrations of crp at the time of hospital admission (> 3.0 mg / l) were predictive of a poor outcome in unstable angina. crp has been shown to predict risk in a wide variety of clinical settings ; it has incremental value in addition to standard lipid screening for primary prevention.[1113 ] a recent analysis by chew. shows that crp predicts the risk of death or myocardial infarction at 30 days among patients undergoing percutaneous coronary intervention. crp was found to be independently associated with the recurrence of cardiovascular events and with death in the mid to long term. it has been suggested that crp may not only be a marker of generalized inflammation but directly and actively participates in both atherogenesis and atheromatous plaque disruption. the aim of the present study was to evaluate the prognostic value of crp in predicting cardiovascular outcome in patients presenting with acute coronary syndromes. this prospective study was conducted by the department of pathology in collaboration with the department of cardiology, bolan medical college complex, quetta, pakistan, between january and december 2009. a total of 963 consecutive patients presenting with chest pain were enrolled in the study. all patients were assessed by a detailed history and physical examination and relevant laboratory investigations to document presence of acs. patients who presented with history of typical chest pain and st elevation or depression of > 0.1 mv in two concordant ecg leads, or clinical picture of unstable angina were included. the exclusion criteria were acute myocardial infarction within previous month, inflammatory or neoplastic conditions likely to be associated with an elevated crp and patients with valvular heart disease, hepatic failure and renal failure. group-1 included 232 patients with a final diagnosis of unstable angina (men 160 ; women 72 ; mean age 53.6 2.8 years) ; group-2 included 258 patients with a final diagnosis of acute st elevation myocardial infarction (men 182 ; women 76 ; mean age 54.4 4.7 years) ; group-3 included 286 patients with a final diagnosis of acute non - st elevation myocardial infarction (men 201 ; women 85 ; mean age 52.8 5.2 years) and group-4 was a control group which included 187 patients (men 112 ; women 75 ; mean age 53.7 4.9 years). the control group included patients, who initially presented with chest pain but were found to be non - cardiac in origin on the basis of unremarkable serial ecgs and normal cardiac markers. there was no evidence of any infection, inflammation, malignancy, heart failure or valvular heart disease in these patients. the tube was centrifuged for 5 minutes and the serum was separated for crp, ck, ck - mb and troponin t. ck - mb was measured immunochemically (acs : 180 analyzer : bayer) the upper reference limit was 7.5 g / l and the assay was linear from 0 to 500 g / l. the troponin t was measured by elisa on an es300 analyzer (boehring mannheim) the upper reference limit was 0.4 crp was measured with nephelometric assay (boehring diagnostics) the detection limit was 0.2 mg / l, the assay was linear from 0.2 to 230 mg / l, and the cv was 20 minutes, characteristic ecg alterations, and peak ck - mb above 14 g / l (twice the upper limit of normal or previous elevated value) or positive troponin t (> 0.4 ng / ml). acute non - st elevation myocardial infarction was considered present when peak ck - mb exceeded 14 g / l and no new q - waves developed on the electrocardiogram. unstable angina was defined as with typical chest pain at rest (usually more than 20 minutes), new onset of exertional chest pain with marked limitation of ordinary physical activity, or recent (3.0 mg / l in 64 (28%) patients. the crp levels were > 3.0 mg / l in 183 (71%) of patients. crp levels were > 3.0 in 223 (78%) of the patients and mean se was 27.11.67 mg / l. in group 4 (control group), the crp levels at the time of admission were > 3.0 mg / l in 19 (10%) of the patients. a 90-day follow - up was done in all cases. in group-1, 35 (15%) patients suffered acute myocardial infarction, 5 (2%) died of a coronary event, 25 (10.8%) had recurrent angina and 20 (12%) developed heart failure in the follow - up. out of 168 patients with crp 3 mg / l, 21.4% developed a cardiac event, while the proportion of those developing cardiac event among 64 patients with a crp > 3 mg / l was much higher (76.6%). the difference was statistically significant (p 3 mg / l (p 3 mg / l (p < 0.0001). in group-4, the present study shows that the acute phase reactant, crp, is significantly elevated in patients with acute coronary syndromes compared to the control group. the number of patients with crp elevations was much higher in group-2 and 3 (71% and 78%) vs group-1 (28%). the crp levels were much more significant in group-2 and 3 compared to group-1 and 4. the mean crp levels in group-2 and 3 were 29.26 and 31.56 as compared to group-1 and group-4 where the mean crp were 9.22 and 3.78, respectively. it was seen from the study that the crp levels were more elevated in patients with non - stemi in comparison to stemi, signifying a greater degree of inflammation and probably myocardial damage as well. the present study results are comparable to the studies by cavusoglu. and tomado. who demonstrated that the crp concentrations in patients presenting with acute coronary syndromes, within 6 hours of onset of symptoms were significantly higher as compared to the control group the inflammatory process has been shown to be one of the mechanisms causing plaque rupture leading to elevated crp levels in less than 6 hours in patients with acute coronary syndrome in patients presenting with acs, hscrp concentrations are more than 10-fold higher than in patients with stable coronary disease or no known coronary disease. in prior studies, increased concentrations of hscrp have been shown to be associated with mortality in patients with ua and nstemi. there are few data regarding hscrp concentrations and the risk of heart failure in patients with acs. several studies found a relationship between increased concentrations of hscrp and future episodes of heart failure among elderly patients with no known cardiovascular disease, between hscrp and heart failure in patients with stemi, or an association between hscrp and heart failure when these variables were used as a part of a composite endpoint in patients with acs. in the present study, the relationship between even mild increases in baseline crp was strongly and independently associated with the development of heart failure, suggesting that the intensity of the inflammatory response increases the risk of mechanical consequences and complications of ischemic injury and therefore may play a role in the development of heart failure. increased concentrations of crp may then help to identify patients at risk of developing congestive heart failure after acs and prompt closer surveillance and more aggressive therapy and perhaps novel therapy aimed at prevention of adverse remodeling. assessment of crp on admission provides independent prognostic information and thereby improves the ability to identify those patients at highest risk of death and heart failure. a study by mach. showed that among patients with acute ischemic heart disease and no biological markers of myocardial necrosis, the crp concentration at the time of admission was significantly higher in patients in whom an acute myocardial infarction was ultimately diagnosed, while in patients with unstable angina the crp levels were low. in the present study, the 90-day follow up shows that the groups-2 and 3 had greater number of complications compared to group-1. the mortality was only 2 % in group-1 compared to 9% and 12% in groups-2 and 3, respectively. the overall incidence of a major coronary event was 87% in patients with abnormal crp vs 13% in patients with a normal crp. demonstrated that crp elevation in patients with unstable angina, without evidence of myocardial damage as assessed with troponin t, is associated with poor outcome. in another study, liuzzo., showed that severe myocardial ischemia in patients with variant angina without atherosclerotic coronary artery disease does not by itself induce an increase in plasma crp. it has been shown that other pro - inflammatory cytokines such as interleukin-6, interleukin-8 and tnf - a are elevated on admission in patients with acute coronary syndromes[3335 ] and that these elevations may be associated with a worse outcome. it has been shown that crp stimulates production of tissue factor by mononuclear cells, the main initiator of blood coagulation. in addition, it has been suggested that crp together with phospholipase a2 may cause complement activation and promote phagocytosis of damaged cells by activated neutrophils. therefore, it is conceivable that an elevated crp signifies ongoing activation of inflammation that characterizes unstable coronary artery disease and indeed may be one of the causal factors of instability. crp levels were higher in patients with acute coronary syndromes as compared to the control group. however, it could not be ruled out that whether the observed difference would reach a significant level if a significantly larger sample size is used. the study was not designed to study the correlation between crp elevation and the rise in troponin t levels and their combined and independent effects on the coronary events in the follow - up. the measurement of crp at the time of admission in patients with suspected coronary artery disease may be helpful in identifying a group of patients who may be at high risk of cardiac complications and these patients need aggressive cardiac management and close monitoring after discharge.	background and objectives : the acute - phase reactant c - reactive protein (crp) has been shown to reflect systemic and vascular inflammation and to predict future cardiovascular events. the objective of this study was to evaluate the prognostic value of crp in predicting cardiovascular outcome in patients presenting with acute coronary syndromes.patients and methods : this prospective, single - centered study was carried out by the department of pathology in collaboration with the department of cardiology, bolan medical college complex quetta, balochistan, pakistan from january 2009 to december 2009. we studied 963 consecutive patients presenting with chest pain to accident and emergency department. patients were divided into four groups. group-1 comprised patients with unstable angina ; group-2 included patients with acute st elevation myocardial infarction (stemi) ; group-3 comprised patients with non - st elevation myocardial infarction (non - stemi) and group-4 was the control group. all four groups were followed - up for 90 days for occurrence of cardiovascular events.results:the crp was elevated (> 3 mg / l) among 27.6% patients in group-1 ; 70.9% in group- 2 ; 77.9% in group-3 and 5.3% in the control group. among cases with elevated crp, 92.1% had a cardiac event compared to 34.3% among patients with crp 3 mg / l (p < 0.0001). the mortality was significantly higher (p < 0.0001) in group-2 (8.9%) and group-3 (11.9%) as compared to group-1 (2.1%). there was no cardiac event or mortality in group-4.conclusions:elevated crp is a predictor of adverse outcome in patients with acute coronary syndromes and helps in identifying patients who may be at risk of cardiovascular complications.
general physical examination at age 15 years showed : height 113 cm (<3 percentile), weight 10 kg (<3 percentile), and head circumference 48 cm. he was apparently well up to the age of 18 months, later he developed failure to thrive, loss of hair, prominent eyes and joints, and senile appearance. systemic examination revealed craniofacial disproportion, mandibular and maxillary hypoplasia, prominent scalp veins, plucked bird appearance, thin lips, irregular and carious teeth, dental crowding, beaked nose, protruding ears with absent ear lobes, pyriform thorax, thin limbs, prominent and stiff joints, wide - based gait and shuffling, thin and high - pitch voice, incomplete sexual maturation, generalized alopecia, absence of subcutaneous fat, thin and wrinkled x - ray survey of the skeletal system showed radiolucent terminal phalanges ; coxa vulga, enlarged metaphysis of long bones, short dystrophic clavicle and osteoporosis [fig. 4a and b ]. his best corrected visual acuity was 20/20, n6 in both eyes (be) with -1.25 cylinders at 161 in right eye (re) and -0.50 cylinders at 41 in left eye (le). external photograph of a 15-year - old hutchinson - guilford progeria male patient (a) showing disproportionately small face in comparison to the head, micrognathia, prominent eyes, both upper eyelids retraction, beaked nose, thin lips. (b) prominent scalp veins, alopecia with grey and sparse hairs, and protruding ears with absent earlobe (a) upper jaw dental crowding and dental caries (b) lower jaw dental crowding and dental caries prominent joints of hand (red arrow : metacarpophalangeal joints, blue arrow : interphalangeal joints) with loss of subcutaneous fat, nail dystrophy and sclerodematous skin (a) x - ray hand showing radiolucent terminal phalanges (white arrow) and osteoporotic changes (black arrow). (b) x - ray shoulder joint showing dystrophic and short clavicle (white arrow) external ocular examination showed excessive wrinkling of forehead, superior sulcus deformity, inner canthal distance 20 mm, outer canthal distance 58 mm, inter - pupillary distance 40 mm, vertical palpebral fissure 12 mm, horizontal palpebral fissure 20 mm, lagophthalmos 2 mm, upper eyelid retraction 2.5 mm, upper lid lag in down gaze 5 mm, in be, nearly total loss of eyebrows and eyelashes, a few present eyelashes and eyebrows showed poliosis [fig. thus, in view of the characteristic clinical presentation, imaging studies, and urine analysis, the child was diagnosed to have hgp syndrome. (a) both upper lids lag in down gaze, superior sulcus deformity, loss of eyelashes and eyebrows. the hgp syndrome is an extremely rare, fatal, genetic disorder of childhood with striking features resembling premature aging. the hgp syndrome has a slight male predilection ; the male - to - female ratio is 1.5:1. the incidence of the hgp syndrome has been estimated at 1 in 4 - 8 million live births. the clinical diagnosis of the hgp syndrome is based on recognition of characteristic features and exclusion of other progeroid syndromes. children with progeria usually have a normal physical appearance in early infancy. at approximately one to two years of age, affected children develop severe growth retardation, resulting in short stature, low weight and delayed anterior fontanel closure. these children develop a distinctive facial appearance characterized by a disproportionately small face in comparison to the head, micrognathia, delayed dentitions, dental malformation and crowding, beaked nose, prominent eyes, nasolabial circumoral cyanosis and loss of scalp hair, eyebrows, and eyelashes. other characteristic features include generalized atherosclerosis, cardiovascular diseases and stroke, hip dislocations, prominent scalp veins, lipodystrophy, dystrophy of nails, joint stiffness, skeletal defects, and/or other abnormalities. the most common reported ocular features are prominent eyes, loss of eyebrows and eyelashes, and lagophthalmos. other rare ocular manifestations of the hgp syndrome are bands of skin running from the upper lid to the cornea, senile ectropion, ptosis with marcus - jaw - winking phenomenon, dry - eye syndrome, corneal dryness, keratopathy, iridocorneal adhesions, corneal opacities, corneal clouding, cataract, strabismus, irregular nystagmoid movements, myopia, hyperopia, retinal arteriolar narrowing and tortuosity, and retinal angiosclerosis.[468 ] many of these findings are based on individual case reports and are absent in the present case. the ophthalmic anthropometric measurements such as horizontal palpebral fissure length, interpupillary distance, inner canthal distance, outer canthal distance in our patient are less than aged - matched normal indian values. eyelid retractions, lagophthalmos, lid lag in down gaze, are due to inelastic and taut skin. poor pupillary dilatation may be due to ischemic changes in the iris muscles secondary to microvascular insufficiency induced by atherosclerosis, however, visible atrophic changes were absent on slit - lamp examination in our patient. in the hgp syndrome eyes looks prominent (pseudoproptosis) probably due to lid retraction, although there is no true proptosis. interestingly, patients with hgps do not develop other ocular features associated with aging, such as presbiopia, arcus senilis or age - related macular degeneration. the hgp syndrome should be differentiated from other progeroid syndromes such as werner 's syndrome (adult progeria), wiedemann - rautenstrauch syndrome (neonatal progeria), hallermann - streiff syndrome, mandibuloacral dysplasia, cockayne 's syndrome, rothmund - thomson syndrome, metageria and acrogeria. the average life expectancy is 13 years, with an age range of 7 - 27 years. the most common cause of death is myocardial infarction or congestive cardiac failure, secondary to widespread atherosclerosis. at present ophthalmic manifestations / signs / features / findings, eye, premature ageing syndrome and various combinations thereof. all cross - references in citing literature were included in our search and referenced. to the best of our knowledge, lid retraction, lid lag in down gaze, superior sulcus deformity and poor pupillary dilatation	the hutchinson - gilford progeria (hgp) syndrome is an extremely rare genetic condition characterized by an appearance of accelerated aging in children. the word progeria is derived from the greek word progeros meaning prematurely old. it is caused by de novo dominant mutation in the lmna gene (gene map locus 1q21.2) and characterized by growth retardation and accelerated degenerative changes of the skin, musculoskeletal and cardiovascular systems. the most common ocular manifestations are prominent eyes, loss of eyebrows and eyelashes, and lagophthalmos. in the present case some additional ocular features such as horizontal narrowing of palpebral fissure, superior sulcus deformity, upper lid retraction, upper lid lag in down gaze, poor pupillary dilatation, were noted. in this case report, a 15-year - old indian boy with some additional ocular manifestations of the hgp syndrome is described.
osteonecrosis of the knee, first reported by ahlback.1) is characterized by severe pain of sudden onset on the medial side of the knee. the etiology of osteonecrosis has not yet been clearly elucidated, but possible causative factors include sickle cell anemia, gaucher disease, caisson disease, corticosteroid treatment, systemic lupus erythematous, and alcohol abuse. thus, the two major theories of etiology are related to trauma and vascular diseases2). the trauma theory implies that repetitive microtrauma in osteoporotic bones results in stress fracture and osteonecrosis. on the other hand, the vascular disease theory explains that an alteration in microcirculation increases bone marrow pressure and microthrombosis disrupts normal blood flow, which leads to the development of osteonecrosis. osteonecrosis after arthroscopic meniscectomy is very rare and only about a score of cases has been reported since first described by brahme.3) in 1991. santori.4) suggested that abnormal load transfer after meniscectomy that results in chondral damage, inflammation, edema, and increased bone marrow pressure is the major cause of osteonecrosis. in spite of the rarity, osteonecrosis of the knee after arthroscopic meniscectomy requires early diagnosis and proper treatment to prevent it from developing into a serious complication. in this report, we present a case of osteonecrosis after partial medial meniscectomy that exhibited rapid progression with a review of the literature. a 50-year - old male visited our clinic with a major complaint of pain in the right knee that had started five days earlier. he had no history of trauma and complained of a pulling sensation behind the right knee and giving way symptoms when walking down stairs. the patient had been working as a medical technician carrying gurneys for 21 years and had no significant medical history or history of trauma, alcohol abuse, and intra - articular steroid injections. mcmurray 's test was negative, joint instability was not present, and early radiography was normal (fig. 1), magnetic resonance imaging (mri) showed evidence of posterior meniscal tear without any chondral or bone marrow damage (fig. 1). surgical treatment of the posterior tear of the medial meniscus was performed. a complex tear of the posterior horn of the medial meniscus and an international cartilage repair society grade ii cartilage lesion (lesions involving < 50% of the total cartilage thickness) in the medial femoral condyle were observed with arthroscopy (fig. surgery was performed under spinal anesthesia while maintaining 70 mmhg of pressure with an arthroscopy pump, and a tourniquet was not used. partial meniscectomy was performed with a basket forceps and a shaver without using a razor or radiofrequency device and the cartilage damage was treated with debridement. the patient complained of pain at the second postoperative week, which was managed with medication. at the sixth postoperative week, the patient felt severer pain and had the greatest difficulty in walking with straight legs, for which an increased dose of anti - inflammatory analgesics was administered. at the 12th postoperative week, an mri scan was performed because the pain increased except for temporary relief. the mri scan revealed cartilage delamination of the medial femoral condyle that exhibited a low intensity signal on the t1-weighted image and a high intensity signal on the t2-weighted image (fig. since the symptoms deteriorated during three months of medication therapy, another mri examination was performed six months postoperatively, which showed more extensive cartilage delamination and cyst formation. an mri scan taken nine months postoperatively showed an enlarged cyst, increased swelling around the bone, and severe cartilage delamination, all of which were the symptoms of osteonecrosis (fig. currently, at six months after surgery, the patient has been pain - free and returned to work. in the present patient who was a 50-year - old relatively active male without significant medical history, such as arthritis, pain worsened continuously without symptomatic improvement and osteonecrosis progressed rapidly after arthroscopic partial medial meniscectomy that affected approximately 10% of the total meniscus. the incidence of osteonecrosis of the femoral condyles after arthroscopic knee surgery has not yet been fully investigated and reported cases are very rare. moreover, its etiology has not yet been clearly established. santori.4) reported two cases of osteonecrosis after meniscectomy that had occurred in a 21-year - old professional football player and a 47-year - old obese woman. they suggested that overloading after meniscectomy results in minor changes in the articular surface that causes impaired circulation in subchondral bone, which eventually leads to the development of osteonecrosis. in the study, most of the symptoms were improved after 45 days of non - weight bearing restriction. on the other hand, takeda.5) suggested that spontaneous osteonecrosis of the knee is caused by subchondral insufficiency fracture based on the histological findings in 23 patients with the disease : a subchondral fracture and healing reaction were noted in the early stages of the condition and evidence of impaired healing, such as delayed union and nonunion, was observed in the advanced stages. prues - latour.6) encountered 9 cases of osteonecrosis after meniscectomy and suggested that abnormal load transfer after partial meniscectomy causes chondral injury and fracture, which could eventually lead to the development of osteonecrosis. brahme.3) explained the cause of osteonecrosis from a mechanical point of view : more than moderate level of chondral damage was observed in 7 cases of osteonecrosis after meniscectomy and they postulated that the increased intraosseous contact due to chondral damage and meniscectomy could be associated with osteonecrosis. in a study by johnson.7) medial femoral condyle damage was associated with the poor prognosis of surgery for meniscal tears and chondral lesions, especially for those on the medial side, in seven patients who presented with osteonecrosis postoperatively. akgun.8) evaluated five patients with osteonecrosis after arthroscopic meniscal and chondral knee surgery and suggested that development of osteonecrosis should be kept in mind in treating senior osteoarthritic patients with meniscal tears. the difference between the present case and those in the previous reports is that osteonecrosis progressed rapidly after partial medial meniscectomy that affected only 10% of the total meniscus in an active male patient without arthritis. we could not clarify whether the meniscectomy was the cause of the osteonecrosis ; however, considering that mri evidence of osteonecrosis was found three months postoperatively in the patient who had had no other findings other than the posterior horn tear, it seems reasonable to assume a causal relationship between abnormal load transfer after meniscectomy and osteonecrosis. on the other hand, it is difficult to rule out the possibility that the patient had a chronic posterior horn meniscus tear and the severe pain that required him to visit the clinic was caused by pre - existing osteonecrosis. if this was the case, osteonecrosis would have progressed regardless of the meniscectomy. although the preoperative mri scan did not reveal any lesion on the medial femoral condyle, local tenderness over the medial condyle was more pronounced than the mcmurray test result in the physical examination, indicating that osteonecrosis could have developed due to the untreated chronic meniscus tear before meniscectomy. pape.9) reported that the differential diagnosis of postarthroscopic osteonecrosis of the knee is pre - existing or undiagnosed spontaneous osteonecrosis of the knee that can be determined by bone marrow edema pattern on the pre- and postoperative mri scans. in our case, considering the bone marrow edema pattern, the patient 's visit might have coincided with the window period of spontaneous osteonecrosis when mri does not show the lesion in spite of the presence of pain, and the condition deteriorated due to the meniscectomy or irrespective of it. the lesion was located medial to the weight bearing surface on the postoperative mri and bone marrow edema was not observed in the tibia on the t2-weigted mri (fig. thus, we believe it is difficult to attribute the development of osteonecrosis solely to the abnormal load transfer. regarding the treatment of osteonecrosis, the use of non - steroidal anti - inflammatory drugs and analgesics, restriction on weight bearing, and approximately 6 months of conservative treatment should be carried out in the early stages. in the advanced stages, surgical treatment, such as arthroscopic debridement, osteotomy, drilling, or total knee arthoplasty, should be undertaken10). in our patient, symptoms did not improve with the use of non - steroidal anti - inflammatory drugs for a sufficient period of time, follow - up radiographs showed the lesion was progressive, and the lesion affected the whole medial condyle when the progression stopped. thus, a replacement surgery was considered necessary, and unicompartmental knee arthoplasty was carried out considering the young age of the patient who had no past medical history and severe deformity. it is our understanding that the possibility of osteonecrosis or posterior horn root tear should be taken into consideration if pain of sudden onset is abnormally severe compared to the meniscal tear pattern on mri scan and physical examination findings. therefore, if post - meniscectomy symptoms are worse than expectation, thorough examinations including mri should be conducted to provide proper treatment in case of osteonecrosis of the femoral condyle. we believe the post - meniscecotmy osteonecrosis case we presented in this report should be differentiated from the pre - existing spontaneous osteonecrosis. in particular, the osteonecrosis might not have resulted solely from mechanical causes. therefore, further comprehensive research involving additional cases are considered necessary.	osteonecrosis of the femoral condyle is known as an uncommon complication after arthroscopic meniscectomy. the lesion of osteonecrosis can be irreversible, thus early detection of the disease is crucial for treatment. a 50-year - old male patient without known risk factors of osteonecrosis developed increasing knee pain after arthroscopic partial meniscectomy. magnetic resonance imaging showed rapid progression of osteonecrosis of the medial femoral condyle. unicompartmental knee arthroplasty was performed after 9 months of conservative therapy. the patient is now free from pain during daily activities. it might be important to remind that if the patient 's pain after arthroscopic partial meniscectomy is severe than expected, clinical doctors should pay attention to the possibility of ongoing osteonecrosis of the femoral condyle.
consumers interest in the relationship between diet and health has increased the demand for information about the specific health characteristics of food. it is well known that food can contain ingredients that may have physiological benefits and/or reduce the risk of chronic disease, or even represent significant risk factors influencing ill health. in cheese, compounds like amino acids are freed during proteolysis ; they are substrates for secondary catabolic reactions by means of bacteria with aminoacyl decarboxylase activity that may yield bioactive compounds. some of them present useful nutraceutical properties, such as -aminobutyric acid (gaba), while others, such as biogenic amines (ba), may have negative effects on human health. over the last decade attention has been paid to the presence of gaba in cheese and dairy product, as a result of its health - related benefits (mills., 2009 ; wang., 2010 ; nejati., 2013 gaba is a non - protein amino acid acting as one of the main inhibitory neurotransmitters in the sympathetic mammalian nervous system and exerts positive effects in the treatment of sleeplessness, depression, chronic alcohol - related symptoms (oh., 2003) and parkinson s disease (de jong., 1984). in addition, it has shown antitumorigenic activity (thaker., 2005) and, since it is a strong secregatogue of insulin from the pancreas, it can prevent diabetes (hagiwara., 2004). gaba is produced by the decarboxylation of glutamate catalysed by the enzyme l - glutamic acid decarboxylase (gad). this enzyme is present in different species of microorganism that could be used for the development of probiotic cheese (wang., 2010). the most interesting are the lactic acid bacteria (lab), in particular several strains of lactobacillus brevis (mills., 2009), lactobacillus plantarum, lactobacillus delbrueckii subsp. lactis (siragusa., 2007 ; mills., 2009 ; wang., 2010). the enterococcus spp. and streptococcus spp. also include strains that have shown gad activity (hayakawa., 1997). other research has shown that these species of bacteria are also involved in the production of ba (galgano., 2001 ; linares., 2012 ; lorencov., 2012), considered as a serious health problem when present at significant levels (stratton., 1991). tyramine, -phenylethylamine, histamine, tryptamine, cadaverine, putrescine, spermine and spermidine are considered as the most important amines occurring in cheese. in cheese, ba are considered as an indicator of poor hygienic conditions of raw material and/or manufacturing practices since their production and accumulation is often associated with the activity of contaminant bacteria (loizzo., 2013). in general, artisanal sheep cheeses are rich in gaba (siragusa., 2007) but also in ba (loizzo., 2013 ; in fact, microbial decarboxylase activity requires the availability of free amino acid precursors, produced as an outcome of proteolysis, and favourable ph and temperature conditions that can be achieved during ripening (siragusa. some research has reported that gaba is also present in pecorino sardo (siragusa., 2007), as are ba (manca., 2000), even if these studies were limited to a very few samples. for these reasons this study has concerned the simultaneous determination of gaba and ba in pecorino sardo produced in cheese factories, pecorino produced in farmhouses, and casu marzu, made from insect larvae (piophila casei), in order to assess the variability of these nitrogenous compounds important to define cheese quality, in products obtained with different technological traits. the study was carried out on traditional cheeses made in sardinia (italy) from whole ewe s milk. the types of cheese considered were pecorino sardo protected designation of origin (pdo), produced at cheese factories (13 samples with ripening time ranging from 30 - 360 days), farmhouse pecorino (12 samples with ripening time ranging from 60 - 360 days), and farmhouse casu marzu (9 samples with ripening time ranging from 60 - 90 days). pecorino sardo pdo produced in cheese factories is a semi - cooked cheese made from thermised milk inoculated with a starter culture and coagulated with calf rennet. ripening takes place in ripening rooms, the temperature (between 6 - 12c) and relative humidity (between 80 - 95%) of which are measured and controlled automatically. pecorino cheese obtained from farmhouses is a semi - cooked cheese made from raw milk without a starter culture and coagulated with calf rennet. ripening takes place in rooms with no control over humidity or temperature, which may even reach room values. casu marzu (also called casu modde, casu cunddu, or casu frzigu in sardinian language, which translates rotten cheese) is a sardinian cheese produced with the use of larvae of the cheese fly piophila casei. it is prepared in summer, when higher temperatures favour the life - cycle of the fly, and derived from pecorino cheese that producers place in the warmer rooms of the plant, uncovered, so that flies have better access to lay their eggs in it. after 60 - 90 days of ripening the cheese is ready to eat. to extract the nitrogenous compounds considered, an amount of 1 g of ground cheese was weighed directly in a centrifuge tube and 20 ml of hcl 0.1 m added. the mixture was then homogenised in an ultra turrax homogeniser (zipperer, staufen, germany) for 5 min. the two acid extracts were combined and diluted to 50 ml with hcl 0.1 m. one ml of the extracts was diluted to 10 ml with hcl 0.1 m and then an aliquot of 400 l was derivatised with dns - cl. to prepare dansyl derivatives of free amino acids (faa) and ba, the method described by vinci and antonelli (2002), was followed, with some modifications. 40 l of saturated sodium carbonate solution at 20c, 200 l of dansyl chloride solution (1.5% w / v in acetone) and 300 l of acetonitrile were added to 400 l of standard solutions or sample extracts. the vial containing the reaction mixture was capped, vortexed and then incubated at 60c for 30 min under stirring in a sh 2000-dx thermo mixer (finepcr, seoul, korea). in order to eliminate the excess of dansyl chloride the mixture was treated with 50 l of l - asparagine solution (2.2% w / v in water), then 10 l of glacial acetic acid was added to remove the excess of carbonate. the solution was filtered through a 0.22 m pvdf syringe filter (millipore, bedford, ma, usa) then 10 l were injected in high - performance liquid chromatography. simultaneous separation of dansyl derivatives of gaba, protein faa and ba was performed in a varian (walnut creek, ca, usa) chromatography system equipped with a prostar 230 solvent delivery system, a prostar 410 autosampler, and an lc 305 fluorescent detector (linear instruments, reno, nv, usa). the column used was an alltima c18 column, 150 mm x 4.6 mm, 3 m [alltech italia, sedriano (mi), italy ], fitted with an alltima c18 guard column, 7.5 mm x 4.6 mm x 5 m, thermostated at 40c. detection was carried out with the fluorescent detector operating at 340 and 520 nm as excitation and emission wavelengths respectively. free amino acids and ba were determined by the liquid chromatographic method described by minocha and long (2004). the solvents used for separation were eluent a : 100% acetonitrile (acn) and eluent b : 20 mm ammonium acetate buffer (ph 5.9) containing 3% v / v 2-propanol. a gradient programme was implemented as follows : time=0, a : b (10:90), flow=0.5 ml min ; time=1 min, a : b (10:90), flow=0.5 ml min ; time=50 min, a : b (65:35), flow=0.5 ml min ; time=65 min, a : b (100:0), flow=0.5 ml min ; time=66 min, a : b (100:0), flow=2 ml min ; time=70 min, a : b (10:90), flow=0.5 ml min. the identification of the nitrogenous compounds was performed by comparison of the retention times of peaks in the samples to those of standard solutions and by addition of the suspected compound to the samples. a calibration curve was obtained by analysing standard solutions at 9 different concentrations and calibration graphs were constructed by plotting the peak area versus each analyte concentrations. statistical analyses of the data were performed using the software package spss 14 (spss inc., statistical analyses of the data were performed using the software package spss 14 (spss inc., chicago, il, usa). the results were expressed as means of two replications. on the basis of the original method designed for the analysis of faa and polyamines (minocha and long, 2004), we developed a method that allowed extending the analysis to other seven ba. to do this, it was necessary to extend the chromatographic running time from 56 to 70 min. in figure 1 the chromatograms of a cheese sample and of a standard solution of amino acids and amines dansyl amino acids and dansyl ba were eluited in the following order : aspartic acid, glutamic acid, serine, threonine, glycine, alanine, arginine, proline, -amino butyric acid, valine, methionine, isoleucine, leucine, phenylalanine, ornithine, cysteine+cystine, lysine, histidine, tyrosine, agmatine, tryptamine, phenylethylamine, putrescine, cadaverine, hystamine, serotonin, tiramine, spermidine and spermine. the content of the compounds analysed in the three types of ewe s milk cheese considered are shown in table 1. the highest level of gaba was found in casu marzu (ranging from 34.4 to 1001.3 mg 100 g) and in pecorino (ranging from 0.0 to 378.1 mg 100 g), while the samples of pecorino sardo pdo showed a lower content (ranging from 2.3 to 52.0 mg 100 g). the results showed great variability in gaba content not only between the three types of cheese but also within the same type. by comparing these sardinian products with other ewe s milk cheeses it was noted that in most of the samples of both casu marzu and pecorino the gaba content was from 2 to 10 times higher than the maximum level (39.1 mg 100 g) measured in other types of italian cheese (siragusa., 2007). in particular, three samples of casu marzu had a content that was as much as 20 times greater than that reported in the above - mentioned work. the differences in gaba content appear to be dependent on the different degree of proteolysis observed between the three types of cheese. in fact, considering the content of total faa as an index of proteolysis level, calculated as the sum of the individual faa measured, a significant correlation with gaba was found (pearson coefficient 0.555 at p=0.01). as for gaba, the higher levels of total faa were found in the samples of casu marzu. this is most probably due to the high proteolytic activity induced by the piophila casei larvae, and to the high temperature used for cheese storage (mazzette., 2010). the farmhouse samples of pecorino tended to have a total faa content greater than those of pecorino sardo pdo from cheese factories. as reported in the literature, such differences can be attributed to changes in manufacturing processes (pintado., 2008 ; schirone., 2011). by comparison, in cheese samples with the same age, great variability in total faa content was also found within the same type of cheese, highlighting that production processes can vary from one cheesemaker to another. in pecorino sardo, as observed in a previous work (manca., 1999), variability in the faa content was due to a production protocol that allowed the use of different technological features. considering the amino acid profile (percentage of the total faa for each amino acid) shown in table 2, it is possible to highlight that in three samples of pecorino and in three of casu marzu, gaba is the amino acid present in the highest percentage with respect to the total faa (from 12.3 to 18.5 and from 14.2 to 22.9% respectively). in almost all the other samples, including the factory products, glutamic acid, the precursor of gaba, is the amino acid mostly represented, followed by leucine, valine and lysine. this faa profile is similar to that found in other ewe s milk cheese (izco., 2000 ; 1995), while to our knowledge, gaba has never been found as the major faa in sheep s cheese. as for gaba and total faa, great variability in the total content of ba was found between the different types of cheese, but also within the same type. casu marzu showed the highest content of total ba ; in particular, two samples presented values of 1035.7 and 923.0 mg 100 g respectively. the other casu marzu samples had values ranging from 62.9 to 282.1 mg 100 g for this parameter, more similar to that found in other artisanal italian cheeses, such as formaggio di fossa (mascaro., 2010) and pecorino di farindola (schirone., 100 g have been proposed for total ba in food (spanjer and van roode, 1991 ; ten brink., 1990), casu marzu can be considered unsafe, especially for patients treated with monoamine oxidase inhibitor drugs (maois). also four samples of pecorino showed a total ba content (between 79.0 and 287.8 mg 100 g) that exceeded the threshold proposed, while the other samples presented values ranging from 9.4 and 73.4 mg 100 g that did not represent a risk for consumers health. however, the samples of pecorino had, in general, a higher level of total ba than those of pecorino sardo pdo, whose values varied from 3.1 to 33.5 mg 100 g. seeing that ba are considered an index of poor hygienic conditions, the high content of these compounds measured in casu marzu and pecorino could be related to less than optimal environmental conditions during the production process (mazzette., 2010). the use of insects, as in casu marzu, and of raw milk, combined with a high storage temperature, seems to favour the production of ba, as already shown in other artisanal sheep s cheeses (loizzo. 2010). on the contrary, in pecorino sardo pdo, where the milk used is thermised and the temperature and humidity conditions under control, the products showed a low content of total ba. the variability observed in ba content, as observed by novella - rodriguez. (2008) in other types of cheeses, could be attributable to differences in the manufacturing process. a positive correlation was found between total ba and total faa (pearson coefficient=0.513 at p=0.01), confirming the findings of giraffa. (1995) who observed an increase in ba corresponding to an increase in proteolysis. tyramine, cadaverine and putrescine were the main amines in all the types of cheese considered, even if their content varied to a great extent : in this respect the statements made previously are valid for the total content of ba. in casu marzu the highest levels found for tyramine, cadaverine and putrescine were 231.4, 470.7 and 165.8 mg 100 g respectively., 2013 ; schirone., 2013), some samples of casu marzu seem to present the highest contents found in cheeses up to now. in blue cheese one of the richest in ba (loizzo., 2013 ; novella - rodriguez., 2003) the highest levels of tyramine, cadaverine and putrescine were 158.5, 210.4 and 25.7 mg 100 g respectively. regardless of the type of cheese, histamine, triptamine and pphenylethylamine were present in only about 50% of the samples and also for these amines the highest concentrations were found in samples of casu marzu and pecorino. the polyamines spermidine and spermine were present only in pecorino sardo pdo, with a level ranging from 0.0 to 11.1 and from 0.0 to 5.4 mg 100 g respectively, similar to that found in blue cheese (novella - rodriguez., this is in accordance with previous works in which these amines are usually present at low levels or are not detected in cheese (loizzo., 2013 ; the pearson test showed a significant correlation (p=0.01) between gaba and the amines putrescine, cadaverine and triptamine (pearson correlation coefficients 0.779, 0.795 and 0.763 respectively) (table 3). therefore, it may be assumed that factors responsible for ba production, such as temperature, ph, availability of faa and, primarily, microorganisms with amino acid decarboxylase activity (pinho., 2001), may also affect gaba synthesis (siragusa. the literature highlights that in cheese and other dairy products some microbial species responsible for the synthesis of one or more ba are also involved in gaba production. brevis, and lactococcus lactis, active in gaba production (siragusa., 2007), 2012 ; galgano., 2001) ; likewise a streptococcus thermophilus strain can form gaba, tyramine and histamine. cadaverine, putrescine and histamine (maifreni., 2013), but also gaba could be produced by species belonging to the genera enterococcus (dhakal., 2012). paracasei, lactococcus lactis, streptococcus thermophilus and enterococus spp, were found as components of the microflora of traditional pecorino sardo cheese (mannu., 2002 ; 2006). therefore, the types of sheep s cheese considered seem to present the ideal conditions for favouring the production and accumulation of both gaba and ba. the pearson test showed a significant correlation (p=0.01) between gaba and the amines putrescine, cadaverine and triptamine (pearson correlation coefficients 0.779, 0.795 and 0.763 respectively) (table 3). therefore, it may be assumed that factors responsible for ba production, such as temperature, ph, availability of faa and, primarily, microorganisms with amino acid decarboxylase activity (pinho., 2001), may also affect gaba synthesis (siragusa. the literature highlights that in cheese and other dairy products some microbial species responsible for the synthesis of one or more ba are also involved in gaba production. brevis, and lactococcus lactis, active in gaba production (siragusa., 2007), 2012 ; galgano., 2001) ; likewise a streptococcus thermophilus strain can form gaba, tyramine and histamine. cadaverine, putrescine and histamine (maifreni., 2013), but also gaba could be produced by species belonging to the genera enterococcus (dhakal., 2012). paracasei, lactococcus lactis, streptococcus thermophilus and enterococus spp, were found as components of the microflora of traditional pecorino sardo cheese (mannu., 2002 ; madrau., therefore, the types of sheep s cheese considered seem to present the ideal conditions for favouring the production and accumulation of both gaba and ba. great differences were found for gaba, total faa and ba content in the three types of cheese considered. farmhouse casu marzu and pecorino are the types of cheese with a high content of gaba, a compound with beneficial functions, but also of ba, in particular tyramine, cadaverine and putrescine that in high concentrations represent a health hazard for consumers. the pearson correlation test revealed that variability in the content of gaba and ba was correlated with the total faa, indicating that their production depends on the intensity of the proteolytic phenomena and thus on environmental and manufacturing factors that affect this biochemical event. given the significant correlation highlighted by the pearson test (p=0.01) between gaba and the most frequently represented ba, it was supposed that the production of all these compounds is affected by the same factors. furthermore, it was shown that the cheeses considered, in particular those of farmhouse casu marzu and pecorino, presented ideal conditions for developing microorganisms and for their carboxylase activity. considering the interest of the food industry in functional food, casu marzu and pecorino microflora can potentially be useful to enrich cheese or milk - fermented products with gaba, but further studies are needed to assess whether microbial strains are present that are capable of producing a high content of gaba but not of ba and to individuate which technological factors may favour the grows of these bacteria.	the bioactive compounds -aminobutyric acid (gaba) and biogenic amines (ba), together with protein - free amino acids, were measured by high - performance liquid chromatography in ewe s milk cheeses produced in sardinia with different technological traits. the study included three types of cheese : pecorino sardo pdo, pecorino and casu marzu. farmhouse casu marzu and pecorino showed gaba content (maximum levels : 1001.3 and 378.1 mg 100 g1 respectively) that had never been found so high in cheese before, suggesting that these types of cheese present ideal conditions to produce gaba. these two types of cheese also showed high levels of ba (their total maximum levels were 1035.7 and 288.0 mg 100 g1 respectively). pearson correlation analysis detected significant correlation between gaba and the main ba present in the cheeses (tyramine, cadaverine and putrescine), suggesting that the factors affecting the production of gaba are the same as those influencing ba formation.
in postmortem studies, dementia with lewy bodies (dlb) accounts for 1020% of all cases of dementia and can therefore be regarded as the second most common cause of dementia after alzheimer 's disease (ad). for a definite diagnosis, autopsy is required. however, confirmation of the diagnosis during the patient 's lifetime is both reasonable and important, since patients with dlb respond to acetylcholine esterase inhibitors and furthermore demonstrate a hypersensitivity to antipsychotic treatment. clinical consensus criteria from 1996 possess a fairly high specificity with 8090%, but only a low sensitivity, decreasing to 30% according to some studies. an improvement in clinical accuracy particularly when ad is part of the differential diagnosis seems to be worthwhile. in postmortem studies, a 5790% loss of presynaptic dopamine transporters could be demonstrated in dlb but not in ad. the presence a dopaminergic abnormality in dlb including striatal dopaminergic transporter loss was outlined in vivo with positron (pet) and single - photon emission computed tomography (spect). on the grounds of these observations, a positive, i.e. abnormal, fp - cit - spect was included as a feature suggestive of dlb in the revised clinical consensus criteria from 2005. sensitivity could thereby be increased up to 81.3%. moreover, in a follow - up study over a period of 1 year, it was shown that in case of clinical suspicion, an fp - cit scan may be helpful. of 19 patients initially diagnosed as having possible and after 1 year as having probable dlb, 12 patients (63.2%) had pathological fp - cit - spect, while the remaining 7 cases that were assessed as non - dlb at the 1-year follow - up had normal datscan (100% specificity). another challenge in differential diagnosis resides in the distinction between parkinson 's disease and dementia (pdd). it is still an open question whether the underlying neurobiological changes result from one and the same mechanism in both entities. fp - cit - spect is abnormal in both dlb and pdd, possibly with a lower dopamine transporter uptake in pdd than in dlb. regarding the current clinical criteria, an agreement was reached that the diagnosis of dlb is not possible when extrapyramidal features are present for > 12 months before the diagnosis of dementia. in the following, we describe 3 cases who had no extrapyramidal signs, and thus dlb was the only possible diagnosis (table 1). an 80-year - old male complained of progressively decreasing memory over the previous 2 years. orientation in time and place was reduced, and he developed difficulties in finding the treatment rooms during hospitalization. neurological examination was completely normal, and, in particular, there were no signs of rigidity, hypokinesia or tremor. clinical chemistry did not reveal any significant abnormality apart from slightly elevated homocysteine (16.1 mol / l). mini mental state examination (mmse) was within normal limits (28 of 30 points), but extensive neuropsychological testing revealed significant abnormalities regarding attention, visuospatial capabilities, short - term and working verbal memory, verbal episodic memory and naming. orientation and executive functions were preserved (table 3). cerebrospinal fluid (csf) was normal with respect to basic parameters, but phosphorylated tau at threonine 231 was elevated and -amyloid (a142) was decreased. cerebral magnetic resonance imaging (mri) revealed no significant vascular lesions, but frontotemporal atrophy was noted, with relative preservation of hippocampal formation (fig. 1). according to dsm iv criteria, dementia was diagnosed and according to nincds - adrda criteria probable dementia of the alzheimer type was assumed : symptoms were progressive and were demonstrated in more than one cognitive domain. although only one core feature (fluctuation) was present, fp - cit - spect was performed and revealed a diminished dopamine transporter uptake in the basal ganglia (fig. in conclusion, following the revised consensus criteria for dlb from 2005, probable dlb was diagnosed. an 82-year - old male with ad diagnosed 1 year previously was admitted to the inpatient neurological department due to uncontrolled visual hallucinations. on neurological examination, there were no abnormalities, particularly no extrapyramidal signs. mmse was only slightly decreased (24 of 30 points), but apart from orientation all other cognitive domains were at least 1.5 sd from age - corrected means (attention, executive function, verbal short - term, working and episodic memory, naming and visuoconstruction ; table 3). csf analysis was normal (including tau and a142). due to the neuropsychological findings and at least one core feature of dlb, on the basis of all the findings, a diagnosis of probable dlb was made. a 72-year - old male was admitted to the neurology outpatient clinic with subjective memory complaints. finally, completion of planned actions, e.g. handling of the coffee machine, were reported to be impaired. updrs - iii motor score was 0. only upon further inquiry, he admitted fluctuations and to some degree visual hallucinations although the latter more resembled misperception, were only of short duration and were not very well formed. neuropsychologically, mmse was almost within the normal range with 26 of 30 points, but deficits were found in visuospatial capabilities, executive function and verbal episodic memory, while orientation and naming were spared. thorough assessment of attention was not performed (table 3). mri of the head revealed some global atrophy but the mesiotemporal region, including the hippocampus, was spared (fig. to be able to offer optimal therapeutic treatment, an accurate diagnosis during a patient 's lifetime is important since dlb patients respond to therapy with acetylcholine esterase inhibitors. in addition, in dlb patients the sensitivity to antipsychotics is increased, with a 2- to 3-fold increase in mortality. treatment with these drugs has to be rational and should be restricted to carefully selected substances. although the clinical diagnosis offers a high specificity, sensitivity with respect to dlb is only very low, leading to an important role of supplemental imaging techniques. in particular differentiating between dlb and pdd does not require further investigation since they are distinguished by an anamnestic criterion : whether or not dementia has developed within 1 year of onset of extrapyramidal signs. dementia onset during that period suggests a diagnosis of dlb, whereas a later onset of dementia is suggestive of pdd. differentiation between dlb and ad is less clear. since there is a huge overlap of clinical criteria, distinction is not feasible in most cases. the increase in tau and phosphorylated tau and decrease in a142 sometimes found in ad is less pronounced in dlb. mesiotemporal structures seem to be more affected in ad, whereas in dlb mesencephalic regions are atrophied. another imaging technique, perfusion scintigraphy of the brain with tc - bicisate (neurolite), has been investigated for its possible role as a diagnostic tool. the patterns of hypoperfusion slightly deviate between dlb and ad, with more occipital involvement in dlb, while in ad the characteristic finding is a temporoparietal hypoperfusion, but differences are not sufficient or at least inferior to those found using fp - cit - spect. hence depiction of the dopaminergic system using ligands such as fp - cit offers the greatest potential for accurate diagnosis during a patient 's lifetime. furthermore, spect is readily available, analysis is easily adapted to the diagnosis of dlb, and the procedure is not too time consuming. reduction in fp - cit is clearly and evidently associated with a fundamental neurobiological alteration recognized in dlb, namely dopaminergic loss. the above - mentioned reasons explain the increased implementation of fp - cit - spect in routine diagnostics to support a diagnosis of dlb. the question of the utility of the fp - cit - spect in the distinction between dlb and ad then arises, especially for an early diagnosis. in ad, thus, whether there are extrapyramidal signs or not has a substantial impact on the diagnosis made. although parkinsonism is one of the core features of dlb and occurs frequently in the course of the disease, in up to 7580% of cases it is not required for a probable diagnosis of dlb. in a review of histopathologically confirmed cases from a brain bank and the current literature, parkinsonism was only found as a first sign of dlb in about 50% of the 239 study patients. it remains to be clarified how often an fp - cit - spect will be abnormal in the absence of parkinsonism, and what criteria should be met before a datscan is performed in case extrapyramidal signs are absent. our 3 case reports indicate that a fp - cit scan may indeed be abnormal in the absence of extrapyramidal signs. an overview of the current literature is difficult because in most of the cases there are no detailed clinical descriptions of the patients and their association with datscan findings. from the literature, furthermore, an abnormal datscan was found in the presence of only minor motoric abnormalities in 78 of 11 patients (updrs < 15) in a further study. in the light of these observations, it is interesting that even when extrapyramidal motor signs are present, an abnormal fp - cit - spect is rarely found in ad, possibly pointing to an extrastriatal mechanism in the development of parkinsonism in ad. we conclude that to increase diagnostic accuracy fp - cit - spect should be readily available once the criteria of possible dlb are met. as demonstrated in our cases, attention should be focused on neuropsychological findings, namely preserved orientation, fluctuating levels of attention and visuoconstructive deficits. the latter two have been shown to be sensitive to and predictive of dlb even in the early stages of mild cognitive impairment.	clinically, alzheimer 's disease (ad) is by far the most common cause of dementia. criteria for the diagnosis of dementia with lewy bodies (dlb) are highly specific but not at all sensitive, which is reflected by the higher number of dlb cases detected histopathologically at autopsy. imaging of dopamine transporter with fp - cit spect is one possibility to increase sensitivity. pathological confirmation was also included in the revised consensus criteria for the diagnosis of dlb. however, in the absence of parkinsonism, one of the core features, a clinical diagnosis of ad is more likely. the role of fp - cit spect in dlb diagnosis remains to be clarified. based on our 3 case reports and a review of the literature, the utility of this imaging method in the differential diagnosis of ad and dlb is highlighted.
highly active antiretroviral therapy (haart) has improved the prognosis of patients with human immunodeficiency virus (hiv) infection by significantly reducing related morbidity and mortality.1,2 early treatment protocols, many of which are still recommended, contain two nucleoside reverse transcriptase inhibitors (nrti) and one nonnucleoside reverse transcriptase inhibitor (nnrti) or a protease inhibitor (pi).35 nnrtis currently included in treatment regimens comprise nevirapine (npv), efavirenz, and rilpivirine. although npv is used mostly to substitute pis in patients with high cardiovascular risk in developed countries,5 it is still included in first - line treatment regimens in low - income countries.3 given its short plasma half - life, nvp immediate - release (nvp - ir) must be administered twice a day to achieve a 24-hour effective plasma level.6 in order to simplify art regimens and improve adherence to prescribed medications, the extended - release formulation of nvp (nvp - xr), which allows a single daily intake, has been developed and tested in two phase iii clinical trials. the aim of the current review is twofold : (1) to highlight the clinical utility and efficacy of nvp - xr ; (2) to assess the impact of nvp - xr on patients safety by shedding light on the main side effects of nvp - xr and the expected gain in term of treatment adherence. nevirapine is a member of the nnrti family that was introduced as a component of the triple art in 1996 (viramune ; boehringer ingelheim pharmaceuticals, inc, ridgefield, ct, usa). since then, it has been used in its immediate - release (ir) form alongside nrtis. following an induction phase at 200 mg in a single intake per day for 2 weeks, nvp - ir is administered twice per day at 200 mg per intake during the continuation phase.7 early clinical trials comparing a single daily dose of nvp - ir 400 mg vs 200 mg twice per day, or vs another nnrti with longer half - life, revealed high rates of virologic failure among patients treated with single daily intake.810 for instance, in the daufin randomized, open - label trial,8 a twice - daily combination of zidovudine (300 mg), lamivudine (150 mg), and nvp - ir 200 mg was compared with an once - daily combination of lamivudine (300 mg), tenofovir (245 mg), and nvp - ir (400 mg). this study was prematurely terminated after the inclusion of 35 and 36 patients respectively in each of the study arms, due to a treatment failure rate of 22.2% among those in the nvp - ir single daily intake arm of the study.8 by contrast, in a prospective nonrandomized study published in 2009, assessing the efficacy and tolerance of a once - daily combination of nvp - ir (400 mg), tenofovir (300 mg), and emtricitabine (200 mg), weberschock found a virologic efficacy in 84.6% of patients who were still on treatment after 72 weeks of follow - up, and reported important side effects in 11.4% of patients. in spite of the nonrandomized nature and the lack of a control arm in the study by weberschock,11 there were suggestions for the efficacy and tolerability of regimens based on a once - daily nvp regimen. therefore, in order to simplify treatment protocols, the nvp - xr (viramune 400-xr ; boehringer ingelheim pharmaceuticals, inc), which allows a single daily intake of 400 mg, was approved by the us food and drug administration in march 2011.12 nevirapine belongs to the class of nnrti agents that act by inhibiting the reverse transcriptase (rt) of hiv-1. unlike nrti, nvp does not act through a competitive mechanism, but by directly binding to the catalytic site of rt, leading to the inhibition of the dna polymerase, which is essential for rna and dna activities.13,14 nvp - xr was developed from a hydrophilic polymer called hypromellose 2208, to allow a controlled and extended release of nvp in the intestinal tract.15 nvp - ir is very well absorbed in the digestive tract, with a bioavailability rate as high as 90%. compared with nvp - ir, nvp - xr is slowly absorbed in the digestive tract, with a bioavailability rate of 72%.12 the minimal plasmatic concentration of 2920 ng / ml achieved after a single dose of 400 mg of nvp - xr and the 24-hour time to maximum concentration, are compatible with a single daily intake using this formulation.12 nvp undergoes a biotransformation process involving cytochrome p450 to yield several hydroxylated metabolites. the efficacy and tolerance of nvp - xr have been assessed in two major clinical trials : the verxve16 and tranxition17 trials. verxve was a phase iii multinational, randomized, single - blinded parallel arms trial, comparing the efficacy and tolerance of nvp - xr (400 mg once - daily) with nvp - ir (200 mg twice - daily) ; each arm augmented with emtricitabine (ftc) and tenofovir (tdf) among 1011 adult patients (505 in the nvp - xr arm and 506 in the nvp - ir arm) with hiv infection and nave to art drugs.16 the primary outcome of the study was a sustained virologic response at 48 months of treatment. sustained virologic response was defined by two consecutive hiv viral load 0.05).16 drug side effects were reported in 11.9%17 and 19.8%16 of patients on nvp - xr, and in 2%17 and 24%16 of those on nvp - ir in the two published clinical trials, respectively.16,17 it is also of note that grade 3 and 4 side effects attributable to the trial medications were comparable in the two arms in the two studies. therefore, the reported frequency of side effects during treatment with nvp - xr is comparable to those observed during treatment with nvp - ir. the reduction of the pill burden significantly improves the adherence to art.18 therefore, transition to nvp - xr formulation, which allows a single daily intake would improve the adherence of patients initially on nvp - ir twice daily, or those directly started on the new formulation. in the two clinical trials of nvp - xr, adherence was similar in the two arms, which in some ways is expected in rigorously conducted randomized controlled trials. the xr formulation of nvp is effective and well tolerated in both hiv patients who are nave to art therapy and those initially treated with nvp - ir. the incorporation of nvp - xr in the treatment armamentarium for hiv infection would likely allow a simplification of treatment protocols through single daily intake of the medications and therefore contributing to improving adherence to art.	an extended - release formulation of nevirapine (nvp - xr) has been developed with the aim of simplifying antiretroviral treatment regimens and improving patients adherence with a single daily intake. the verxve and tranxition clinical trials have demonstrated the noninferiority of nvp - xr compared with nevirapine immediate - release (nvp - ir) on viral load after 24 and 48 months of treatment. the tolerance profiles of nvp - xr and nvp - ir are similar. simplifying the treatment dosage for nvp would likely improve adherence to antiretroviral treatments.
the vagina and cervix are the first lines of physical and immunological defense against sexually transmitted pathogens [1, 2 ]. the presence of potentially pathogenic microorganisms, including protozoans, yeast, bacteria, and viruses, initiate the immune response and result in increased vaginal secretion of immune stimulating molecules, irritation, vulvar pruritus, and a fetid odor, although in some situations it may be asymptomatic or oligosymptomatic [1, 3 ]. bacterial vaginosis (bv) of undefined etiology is an inflammatory and recurring syndrome of the lower genital tract and is considered the most prevalent vaginal imbalance affecting women of reproductive age [4, 5 ]. bv is characterized by an alteration in the normal vaginal flora, in which the predominant lactobacilli are replaced by various other microorganisms. mycoplasma hominis, or ureaplasma urealyticum are routinely detected and are accompanied by a subsequent increase in the vaginal ph [5, 6 ]. bacterially produced proteases degrade the mucus secreted from the cervix to facilitate the pathogen 's ability to contact and breach the protective epithelial barrier. the human papillomavirus (hpv) is a sexually transmitted dna virus and is the main causative agent of cervical tumors. distinct profiles of microorganisms colonizing the vagina have been associated with the development of cervical intraepithelial neoplasia (cin) and hpv infection [810 ]. hpv prevalence has been estimated at 27.4% worldwide, and the frequency of women infected by at least one of the oncogenic types has been shown to be significantly higher than that with only low - risk types (18.7% versus 7.5%). the physiological defense mechanisms targeting foreign microorganisms, such as viruses or bacteria, are mediated by the innate and adaptive immune responses. the effector phases of both innate and adaptive immunity are often regulated by peptide molecules known as cytokines. in innate immunity effector cytokines are produced by mononuclear phagocytes and epithelial cells, while in adaptive immunity they are produced by activated t lymphocytes that are capable of inducing inflammatory reactions [13, 14 ]. many of these cytokines, known as interleukins (il), are produced by certain populations of leukocytes residing in the bloodstream, including monocytes, neutrophils, or eosinophils [12, 15 ]. the pattern of immune response can be divided into th1, th2, and treg, these three patterns are best known ; however, others as the th-17 have been described. increase in the levels of il-10 from t lymphocytes in culture supports the hypothesis that the immunosuppression of th2 cytokines may promote the development of cervical lesions. understanding the mechanisms mediating the infectious and inflammatory processes that occur in the vaginal region will contribute to our understanding of the pathogenesis of these infections. we chose to examine the localized cytokines il-2, il-12, tnf-, and ifn- because they are representative of a type 1 t - helper lymphocyte (th1) response that regulates cytotoxic t lymphocytes, which are in part responsible for clearing infections in the genital tract, in association with phagocytic cells and soluble antimicrobial factors. additionally, the cytokines il-6 and il-10 were chosen because il-6 function is an anti - inflammatory molecule and il-10 is a general regulatory cytokine. according to previous studies therefore, our objectives are to verify the relationship between vaginal ph and hpv infection and to measure cytokine levels in endocervical secretions of women with bv or hpv. after approval by the committee of ethics for human and animal research of the gois anticancer association (accg), the work was initiated. from april 2007 to february 2008, a total of 173 women between the ages of 16 and 48 years were prospectively enrolled ; this age range was chosen because it usually corresponds with the more sexually active years for women. initially, study participants were recruited from the gynecology and breast service of the accg, but our enrollment was extended to the basic health units located in distinct regions of the city of goinia, go, brazil. the necessary sample size for this particular age group of women was estimated by considering the known prevalence of bacterial vaginosis (25%) and vaginal hpv infection (15%) [5, 8, 18 ]. based on this calculation and desired test power > 80%, the study required 157 women ; we further took into account a 10% potential loss to followup and determined that a total of 173 participants should be enrolled in the research study. the control group will be selected according to gram staining showing exclusive presence of lactobacilli, along with negative cultures for other microorganisms and clinical features compatible with normality. after each participant gave written informed consent, biological material was collected from the posterior fornix by using a gynecological brush. the sample was immediately inoculated onto columbia - cna (colistin nalidixic acid) agar with 5% human blood and into tubes with bhi - pras broth that had been prereduced, anaerobically sterilized, and supplemented with hemin, vitamin k, and yeast extract. the plates and tubes were immediately placed in an anaerobic jar and transported to the laboratory for processing as described. we also measured the individual 's vaginal ph (posterior cul - de - sac), performed an amine test, and prepared histological slides for a pap smear and a gram stain. diagnosis of bacterial vaginosis was made when three of the four established clinical criteria were met : vaginal discharge, ph > 4.5, positive amine test, and the presence of clue cells. presumptive identification was made when typical bacterial small colony morphology was observed and beta hemolysis was detected upon incubation at 35c for up to 72 hours in an atmosphere of 57% co2. in those cases, diagnosis was confirmed by tests of carbohydrate fermentation, motility, and rapid hippurate hydrolysis. the sample that had been collected from the endocervix was used for laboratory measurement of cytokine levels and the presence of high - risk and low - risk hpv. the tube containing the endocervical secretion was centrifuged and saline (0.85%) was added to obtain a final volume of 500 l, which was then aliquoted and stored at 70c until use for cytokine measurement by elisa. the cultured plate was used for microbiological analysis after 4872 hours of incubation at 37.0 0.5c. for cytokine measurement, an aliquot of the endocervical secretion was thawed and subjected to elisa using pairs of commercially available monoclonal antibodies (bd biosciences, franklin lakes, nj, usa). all cytokines were standardized in a concentration of 10 ng / ml, except for that for tnf- which was standardized at 100 ng / ml. the elisas for the samples and controls were performed in duplicate at the oncology research institute of federal university of tringulo mineiro uftm. samples previously diluted in saline were further serially diluted with assay diluent (pbs and fetal bovine serum), according to the bd recommendations. the spectrophotometric absorbance at 405 and 490 nm was measured and the difference of the values was multiplied by the dilution factor of the initial dilution of the samples in saline. the concentration of cytokines was determined in pg / ml by comparing the absorbances with those of a standard curve for the respective recombinant cytokine. we diluted 100 l of the initial 500 l sample in trizol to extract dna, according to the manufacturer 's instructions (invitrogen, carlsbad, ca, usa). we performed pcr to test for the presence of low - risk hpv 6 and 11 (40 cycles) and high - risk hpv 16, 18, 31, 33, and 35 (35 cycles) using the primers 5 to 3 tacactgctggacaacatgc and 5 to 3 gtgcgcagatgggacacac, for the low - risk strains, and 5 to 3 tttgttactgtggtagatactac and 5 to 3 gaaaaataaactgtaaatcatattc for the high - risk strains, as previously described [18, 20 ]. the amplified products were mixed with 5 l of sample buffer and electrophoresed through a polyacrylamide gel (10%) at 90 volts for 2 hours and stained with 2% silver nitrate. a standard 50 bp molecular weight marker was used on each gel (trackit 50 bp dna ladder, invitrogen). descriptive statistical analyses were carried out, including examination of the frequency distributions of categorical data. the prevalence was calculated to reflect the relative frequency of genital infections using confidence intervals (cis) and odds ratios. the chi - squared and mann - whitney tests were used to determine if differences among the groups reached statistical significance (p 4.5 and hpv infection (table 1). levels of the cytokines il-2, il-6, il-12, ifn-, and tnf- were measured in the presence of bv and hpv - infected women, and they were compared with their corresponding concentrations for the healthy control group. only il-2, il-6, il-10, and il-12 levels were statistically different from controls ; however il-10, tnf-, and ifn- were not (table 2). the association between hpv and bv occurred in 11 patients with il-12 of 143.00 pg / ml, a statistically significant difference when compared to the control group 44,30 pg / ml, p = 0.04. the association between high- and low - risk hpv (n = 6), bv and low - risk hpv (n = 4), bv and high - risk hpv (n = 6), and vb and high - low risks hpv (n = 1) could not be statistically determined due to the relatively low numbers of patients. the other cytokine concentrations and the association between bacterial vaginosis (bv), hpv, high - risk hpv, and low - risk hpv are in table 2. in this study, our cohort exhibited incidences of bv and hpv that were higher than those previously reported. this finding may be due to the fact that our collection strategy included women presenting at the basic health units, which are the first place women come with primary health care concerns and by patients of tertiary care services. papanicolaou smears are a routine method used to identify the presence of clue cells associated with bv [8, 22 ]. we performed this type of diagnostic analysis, but found that the gram stain method was much more sensitive for detecting bv [5, 23 ]. furthermore, we identified gardnerella vaginalis as the main microorganism associated with the appearance of bv in our study cohort. these particular results are consistent with other previous studies [3, 5, 24 ]. the fact that some patients do not have vaginal ph > 4.5 does not exclude them from the group with bv. changes in the vaginal flora, such as the appearance of clue cells, suggest that bv occurs with a significantly higher frequency in women with cervical cytological abnormalities. a higher frequency of hpv has also been observed in these patients and is presumed to be supported by the production of nitrosamines by anaerobic bacteria and subsequent stimulation of cytokine production. however, in our study, we did not find an association between hpv infection and the presence of gardnerella vaginalis (p = 0.890), prevotella sp. (p = 0.150), or any other species of anaerobic bacteria (p = 0.840) in the vaginal mucosa and conclude that the predominance of anaerobic microorganisms in vaginal flora was not significantly associated with the appearance of hpv infections. considering that bv, cervicitis, and cin have been associated in some studies, it would not be surprising if the patients with bv and cin presented with similar profiles in their localized immune response. in contrast, our patient cohort did not exhibit a significant association between the presence of hpv and bacterial vaginosis. one of the most common recognized factors among women with bv is the elevation of the vaginal ph. (2007) measured the vaginal and the endocervical ph using a digital ph meter and concluded that endocervical ph was 5, 4 and it was different from posterior vaginal fornix with ph = 4.9. accordingly, we found a statistically significant association between ph and hpv in this study, where women with a ph > 4.5 in posterior vaginal fornix (mean = 5.4) were predisposed to the appearance of hpv infections (p = 0.031) [18, 26 ]. moreover, we believe that increased vaginal ph may be common in infections due to hpv and independent of the presence of bv. another study concluded that bv was more common among women with high - grade squamous intraepithelial lesions (sil) than in women with no cytological abnormalities, but further studies are required to confirm this hypothesis. knowing the environment that favors the appearance of the viral infection is possible to understand the pathogenesis of this viral infection and seek alternative prophylaxis. sampling the endocervical secretion is a reliable, highly reproducible method to detect cytokine concentrations in the genital tract. by this method, we observed increased concentration of il-10 in the presence of genital hpv infections and particularly in cases of infections with only high - risk hpv. the levels of il-12 were likewise significantly higher in patients with hpv and only hpv infections compared to control and only bv groups. findings by other authors have indicated a correlation between the concentrations of il-10 and il-12 and previous cervical hpv infection or infection with other pathogenic agents, such as hiv, which can compromise the integrity of the epithelial barrier and lead to accumulation of serum proteins in the cervix. however, a study by gravitt and colleagues determined that this association of an increase in il-12 only occurred when there was a coinfection with hiv and hpv. the local production of cytokines in cervix is important for the regulation of immunity in the genital tract. researchers have reported that an increase in il-12 was present in women with increased vaginal ph, a characteristic of women with bv compared to health women [16, 29 ], and we also found statistically significant values. in our study, we found that increased il-12 was associated with bv patients co - infected with hpv strains (p = 0.039), but not those who have coinfection with high - risk hpv strains (p = 0.256). the levels of il-2 are not increased in patients with hpv, hiv, or other stds, probably because this cytokine is produced very early in the immune process and rapidly degraded. however, we observed a significant increase of this cytokine in the presence of bv, total hpv, and high - risk hpv, demonstrating that the collection was carried out effectively and dose obtained before a possible degradation of il-2, and we could also identify an increase of this cytokine in association of bv and hpv infections compared to bv group. cytokines of the th1-type (il-2, 6, 12) enhance cell - mediated immune responses, whereas cytokines of the th2-type (il-4, 5, 10) inhibit it. (2008) find that il-2 deficiency contributes to intraislet treg cell dysfunction and progressive breakdown of peripheral self - tolerance in the nonobese diabetic (nod) mouse and il-2 was originally discovered as a t - cell growth factor and activator of cytotoxic lymphocytes in inflammatory settings such as microbial infection. studies indicate an increase in il-2 as an indicator of effective immune response during activation and proliferation of lymphocytes and their reduction as an immunosuppression factor. these cytokines il-6 and il-8 are probably associated with the development of cervical cell lesions [17, 31 ]. these same authors also reported significant increases in il-6, il-8, and il-10 in women with bv. in our study, we observed a significant increase in the levels of il-6 in women with bv, but not in association with bv and coinfection with hpv. we also observed a tendency to increase il-10 levels in patients with hpv occurred simultaneously with other infections. cytokines of the th1-type (il-2, 6, 12) could enhance cell - mediated immune responses, like those probably seen in bv. the literature also provides evidence that increases in il-10 occur in lymphocytic infiltrates that correspond to hpv infections and are related to the th2-type response. likewise, increasing ph is a characteristic of immune responses and elevation of ph is considered to be a predisposing factor for hpv infection. in this study, the levels of ifn- in women with hpv except in low - risk hpv were rather above those of the control group. according to a previous study, the presence of hpv associated with the regression of cervical lesions may be the result of a th1 response (decreased il-8 and increased ifn-). although one study reported a decrease of ifn- during hpv infections, our study show a significant increase of this cytokine in the presence of hpv infection or bv compared to health women, although when this cytokine was evaluated in only hpv infections or only bv group, its became lower than control group. we could relate that the isolated presence of these complications would decrease the th1 response. this finding may be related to other factors that were not evaluated in our study, such as hemoglobin contamination, volume of secretion, or day of menstrual cycle. the increases in tnf- have not been reported as significantly different between bv - positive and -negative subjects. due to the instability of this cytokine in ambient temperatures, we measured it first, as suggested by sturm - ramirez. previous studies have identified a localized increase in cytokines in the presence of anaerobic bacteria, such as gardnerella sp. and prevotella sp., having a nugent score > 4 when compared to a group with an abundance of lactobacillus sp.. an increase in tnf- and leukocytes in bv - diagnosed women with gv has also been reported. we need to point out, however, that we did not observe a relationship between high levels of tnf- and the presence of bv or in association with bv and hpv infections. further studies are needed to confirm the lack of change in tnf- for cases of hpv infections and bv. other vaginal infections also are influenced by the concentration of cytokines. in candidiasis, increases in il-10 and decreases in ifn- have been reported. trichomoniasis appears to be associated with high levels of il-10 and il-12 ; however, that particular study was focused only on hpv infection in the presence of bv as reported in recent study. unfortunately, it wasnot possible to eliminate the natural variations in cytokine concentrations that occur during different phases of the menstrual cycle because the samples were collected at different times of the cycle, and it was difficult to accurately determine the duration of the infection for the individuals included in our study. stages of infection can also influence the different cytokine levels and the secreted cytokine profile can influence the outcome of an infection. a cohort in order to control these factors could contribute for analyzing those variables. we conclude elevation of vaginal ph (> 4.5) was frequent in genital hpv infections. we also found il-2 and il-12 was increased in individuals with bv and hpv infections, whereas individuals with only bv had higher cytokine levels of il-2, il-12, and il-6, compared to control group, the cytokines il-12 and ifn- were higher in hpv group than only bv. by comparing the levels of cytokines in vaginal secretion among high - risk hpv, low - risk hpv, and bv groups, we found that a th1 immunological response was occurring.	objective. to verify the relationship between vaginal ph and human papillomavirus (hpv) infection and to measure cytokine levels in endocervical secretions of women with bacterial vaginosis (bv) or hpv. methods. 173 women (1648 years old) were enrolled and divided into groups : bv, hpv, and controls. microbiological culture and vaginal ph were measured. hpv detect by pcr, and cytokines by elisa (il-2, il-6, il-10, il-12, tnf-, and ifn- cytokines). results. of 173 women, 60 were control group (34.7%) and 113 were distributed in hpv (n=36, 20.8%), bv (n=36, 20.8%), vaginitis (n=30, 17.3%) and, bv and hpv - associated groups (n=11, 6.4%). vaginal ph > 4.5 was related with hpv infection. il-2 and il-12 were increased in bv and hpv groups, and il-6 (only bv group), compared to control group. il-12 and ifn- were higher in hpv than bv group. conclusion. the increase of vaginal ph was associated with hpv infection ; bv and hpv groups had a th1 cytokines immune response.
exaggerated innate immune / inflammatory responses in the brain are now thought to be a common core in the etiology of numerous psychiatric disorders such as depression, ptsd and bipolar disorder (jones and thomsen, 2013). seemingly unrelated to neuroinflammation, the experience of life stressors is a predisposing factor in the development of psychiatric disorders (kessler, 1997). however, the clinical literature contains numerous instances in which stress predisposes individuals to inflammatory disorders such as cardiovascular disease (albus, 2010), which have a high comorbidity with psychiatric conditions that include depression (sansone and sansone, 2008). indeed, recent evidence from several laboratories, including our own, suggests that stressors sensitize or prime the neuroinflammatory response to subsequent pro - inflammatory challenges, thereby providing a mechanism that can link the impact of stressors and a pivotal role for neuroinflammatory processes in the development of psychiatric disorders. the central notion explored here is that exposure to stressors can induce a vulnerable phenotype characterized, in part, by a sensitized neuroimmune microenvironment. thus, prior stress can lead to a potentiated neuroinflammatory cascade upon exposure to pro - inflammatory challenges that include bacterial or viral infection and sterile injury. this exaggerated neuroinflammatory response can then manifest as changes in cognitive (e.g. memory), affective (e.g. mood), sensory (e.g. pain) and vegetative (e.g. sleep and eating) endophenotypes, typically observed in a spectrum of psychiatric disorders. several neuroimmune mechanisms, by which stress sensitizes / primes the neuroinflammatory response to pro - inflammatory challenges, have been characterized in recent years. first, a brief overview of neuroinflammatory processes will be provided as a basis for exploring mechanisms of neuroinflammatory priming. neuroinflammatory processes are characterized, in large part, by the activation of cns innate immune effector cells including microglia, which secrete an array of inflammatory mediators including pro - inflammatory cytokines, chemokines, prostaglandins and reactive oxygen / nitrogen species (ransohoff and perry, 2009). when elaborated under a variety of neuropathological conditions, including neurodegeneration, brain trauma, ischemia and seizure, these mediators induce the hallmarks of neuroinflammation, which may include recruitment of peripheral leukocytes into the cns (graeber., 2011). of note, peripheral infection or immune challenge also is capable of inducing a neuroinflammatory response in the brain (mccusker and kelley, 2013). for example, peripheral injection of lipopolysaccharide (lps), a non - infectious component of the cell wall of gram - negative bacteria (e.g. e. coli), is commonly used as an immunogenic stimulus to induce a pro - inflammatory response in peripheral biological compartments or organs such as liver, spleen, serum or peritoneum. as a result of pathogen exposure or immune challenge with agents such as lps, peripheral myeloid cells, such as splenic macrophages or liver kupffer cells, secrete pro - inflammatory cytokines, which then signal the brain through several well - characterized neural and humoral pathways connecting the immune system with the cns (maier, 2003). a neural cascade initiated by immune - to - brain signaling then leads to the production of pro - inflammatory cytokines and other inflammatory products by microglia and other cns innate immune cells as if these cells had been directly exposed to the pathogenic agent (mccusker and kelley, 2013). it should be noted that peripheral pathogens are typically excluded from entering the brain and directly activating cns innate immune cells by the blood brain barrier (banks, 2015). thus, cytokine mediated immune - to - brain signaling is a pivotal immunologic process whereby the immune system communicates to the brain that infection or injury has occurred in the periphery. once the cns is alerted of an immunologic threat to the organism, the subsequent neuroinflammatory response engages neural mechanisms that mediate physiological and behavioral modifications, also known as the sickness response, which are key to effective host defense (dantzer., interestingly, aspects of the sickness response resemble aspects of several mood disorders, most notably major depression (dantzer, 2009), a theme we review in section 3. as noted above, microglia are key effectors of neuroinflammatory processes and thus here we will briefly describe the physiological aspects of microglia function that are relevant for understanding the role of this cns innate immune cell in stress - induced neuroinflammatory priming. microglia are mononuclear phagocytes that occupy the brain parenchyma and are ontogenetically distinct from other cns mononuclear phagocytes including meningeal, choroid plexus, and perivascular macrophages, which reside outside the brain parenchyma (katsumoto., 2014). it is important to note that these macrophage subtypes also serve a critical role in the brain 's innate immune response and may contribute to the processes under discussion here (schiltz and sawchenko, 2003). unlike other cns macrophages, microglia are maintained in the adult cns independent of circulating blood monocytes and are thought to self - renew from progenitor cells in the cns (katsumoto., 2014). microglia perform several critical functions in the cns including immunosurveillance for pathogens, cellular debris, apoptotic cells, and alterations in neuronal phenotype (ransohoff and cardona, 2010). recent reviews suggest that microglia may enter a spectrum of activation states (mosser and edwards, 2008, rivest, 2009), which are characterized by varying blends of immunophenotypes and cytokine profiles. of particular relevance here, a primed activation state may be induced in microglia under several neuroinflammatory conditions (perry., 2007) that include exposure to psychological stressors and stress hormones such as glucocorticoids (frank. microglia are considered primed if, upon exposure to a pro - inflammatory stimulus such as lps, the pro - inflammatory cytokine response of microglia is potentiated beyond normal. for example, we have found that prior exposure to a severe acute stressor potentiates the pro - inflammatory response of microglia to a subsequent immune challenge (i.e. lps) ex vivo (frank., 2007). a primed state has been associated with morphological changes such as shrunken processes and increased soma size, as well as immunophenotypic changes such as increased expression of surface antigens including major histocompatibility class ii (mhcii) (norden., 2015). importantly, a primed activation state may not involve increased pro - inflammatory output. however, it is unclear whether a primed activation state involves uniform changes in microglia morphology and immunophenotype. this primed state of activation can be conceptualized as a readiness state because, when in this state, microglia will rapidly respond to inflammatory stimuli with exaggerated production of pro - inflammatory cytokines. microglia express an array of receptors that allow microglia to rapidly mount an immune response to exogenous or endogenous immunological threats (rivest, 2009). at least 50 cell surface antigens distinguish mononuclear phagocytes from other cell types (ransohoff and cardona, 2010). of these, tlrs will be a focus as they are thought to play a pivotal role in stress - induced neuroinflammatory priming (frank., 2015b). microglia express many of the tlrs characterized in peripheral immune cells (carpentier., 2008). cells of the innate immune system recognize microbial products via germ line - encoded receptors that recognize general molecular patterns or motifs that characterize classes of pathogens (pathogen associated molecular patterns ; pamps (janeway and medzhitov, 2002)). for this reason, receptors that recognize pamps tlrs are a family of highly conserved membrane or cytosolic (dependent on tlr subtype) proteins that transduce signals through a family of cytosolic toll adapter proteins that link to downstream signaling cascades (barton and kagan, 2009). the ligation of many of the tlr family members ultimately activates the transcription factor, nuclear factor of kappa light polypeptide gene enhancer in b - cells (nf-b), as well as other transcription factors (salminen., 2008), and nf-b activation is viewed as key to the inflammatory effects of tlr ligation (salminen., 2008). tlr2 and tlr4 have been the most intensively studied prrs within the cns, and are expressed on microglia (aravalli., 2007). they are sometimes reported to be present on astrocytes and sometimes absent, and are typically reported to be absent on neurons (lehnardt., 2003). tlr4 recognizes the lps motif present in the cell membrane of gram - negative bacteria, while tlr2 recognizes lipoteichoic acid that characterizes gram - positive bacteria (kawai and akira, 2007). although tlrs were first studied as receptors for microbial products that then activate immune cells such as macrophages and dendritic cells, thereby initiating host defense against infection, tlrs have also been found to recognize endogenous molecular patterns. over the past several decades it has become clear that peripheral immune responses are initiated by a number of conditions that do not involve pathogen entry into the body such as a sterile bone break (chen and nunez, 2010). these conditions have been summarized as danger (bianchi and manfredi, 2009), and the necessary implication is that these dangers must lead to the release of endogenous molecules that act to initiate innate immune responding. a number of these molecules have been characterized and have been collectively called danger - associated molecular patterns (damps) or alarmins (bianchi, 2007). interestingly, one of these damps, high mobility group box 1 protein (hmgb-1) is recognized by tlr2 and tlr4 (yang., 2013) and is present in brain (fang., hmgb-1 is thought to alert innate immune cells to a variety of internal conditions such as cellular stress, damage or necrosis (kawai and akira, 2010). of note, tlr2 and tlr4 recognize other damps including histones, heat shock proteins and s100 proteins (venereau., 2015), which may play a role in neuroinflammatory priming. however, hmgb1 is of particular interest here because of its direct role in priming of inflammasome signaling (see section 2.4.) our interest has centered on the damp hmgb-1, which stemmed from our initial finding that pharmacologic blockade of tlr2 and tlr4 during stress exposure abrogates stress - induced priming of the neuroinflammatory response to a subsequent immune challenge (weber., 2013) hmgb-1 is a ubiquitous nuclear dna binding protein, which under normal conditions, is not present in the extracellular space (kang., 2014). however, under necrotic conditions, hmgb-1 is passively released into the extracellular milieu to serve as an inflammatory signal (scaffidi., 2002). as noted above, tlr2 and tlr4 mediate the pro - inflammatory effects of hmgb-1, although some recent studies now suggest that the pro - inflammatory effects of hmgb-1 are mediated predominately through tlr4 (yang. the receptor for advanced glycation end products (rage) and the chemokine receptor cxcr4 are thought to mediate the chemotactic function of hmgb-1 (yang., 2013). interestingly, immunocompetent cells also have the unique ability to actively release hmgb-1 in the absence of cell death (bonaldi., 2003). there are three distinct forms of hmgb-1 characterized by post - transcriptional modification of the redox state of three critical cysteine residues (c23, c45, and c106). fully reduced (fr) hmgb-1 is the predominant form that occurs under non - oxidizing conditions. fr - hmgb-1 has chemotactic properties produced by the formation of a hetero - complex with the chemokine cxcl12, which then signals through the chemokine receptor cxcr4 (schiraldi., 2012). the pro - inflammatory form occurs under increased oxidizing conditions, in which a disulfide bridge forms between c23 and c45 (disulfide (ds) hmgb-1). this redox form interacts with tlr4 to induce synthesis and secretion of pro - inflammatory cytokines (antoine., finally, the fully oxidized form of hmgb-1 has no known biological activity (venereau., 2012). the formation and secretion of il-1 is a critical step in the neuroinflammatory cascade and il-1 has been termed the master regulator of neuroinflammation (basu., 2004), given its pleiotropic role in the induction of central inflammatory processes as well as its critical role in the manifestation of the sickness response (goshen and yirmiya, 2009). thus, the production, processing and signaling of il-1 is under tight regulation (dinarello, 2011). il-1 is transcribed as a larger pro - hormone, pro - il-1, and pro - il-1 must be cleaved by caspase-1 to form the biologically active, mature form of il-1. the process of cleaving pro - il-1 typically requires the formation and activation of an inflammasome, most often the nucleotide - binding domain and leucine - rich repeat containing family, pyrin domain containing 3 (nlrp3) inflammasome, an intracellular multiprotein complex that mediates processing and maturation of il-1 via activation of caspase-1 (martinon., 2009). importantly, signaling at tlr4 initiates an intracellular signaling cascade to activate the immune - related transcription factor nf-b (kawai and akira, 2010), which is a critical step in the formation of the nlrp3 inflammasome. the nlrp3 inflammasome is particularly interesting because of 1) its unique functional requirements that include a priming step and an activation step (hornung and latz, 2010) and 2) the role of glucocorticoids in priming of the nlrp3 inflammasome (busillo and cidlowski, 2013) (see section 4.4.). priming occurs in response to a stimulus that signals, in part, through tlr4 to increase the expression of the sensor protein nlrp3 to a critical threshold (latz., interestingly, hmgb-1 has been reported to increase nlrp3 mrna and protein (xiang., 2011) suggesting that hmgb-1 may function as a priming stimulus of the nlrp3 inflammasome. subsequently, a second activating signal such as adenosine triphosphate (atp) is then required to form the nlrp3 inflammasome complex with the adapter protein asc, which then recruits and cleaves pro - caspase-1 into mature caspase-1 (latz., 2013). in turn, caspase-1 cleaves pro - il-1 into mature il-1. it is to be noted that other pro - inflammatory cytokines, such as il-6 and tnf, are not under this type of tight regulation and are not inflammasome dependent (kumar., 2011). while pro - inflammatory cytokines are key mediators sub - serving critical immune functions of microglia and other cns innate immune cells, these mediators of neuroinflammation also orchestrate a constellation of physiological and behavioral modifications known as the sickness response (dantzer., 2008). beyond the scope of the present review, il-1 is a particularly important mediator of the sickness response and has been the subject of several in - depth reviews (for example see review by (goshen and yirmiya, 2009)). however, it should be noted that other pro - inflammatory cytokines including tnf play a role in the sickness response to pro - inflammatory stimuli (dantzer., 2008). this response includes cognitive (memory), affective (mood), vegetative (sleep and eating), sensory (pain) and physiological (fever) changes, which play an adaptive role in an organism 's host defense against infection, trauma, and injury (dantzer, 2009). of note, there is a remarkable similarity between the hallmarks of the sickness response and clinical endophenotypes typically observed in several psychiatric disorders including major depression and anxiety disorders. for example, anhedonia is a symptom typically observed in major depression and is also a hallmark of the sickness response to infection or injury (dantzer., 2008). indeed, a considerable number of findings suggest that inflammatory processes may play a role in the etiology of major depression (raison and miller, 2013). moreover, some of the strongest evidence implicating pro - inflammatory cytokines in the pathogenesis of depression stems from studies demonstrating that treatment with pro - inflammatory agents is sufficient to induce depressive symptoms (miller., prior exposure to acute and chronic stressors potentiates the sickness response to subsequent pro - inflammatory challenges. further, prior exposure to stress induces a primed microglial immunophenotype such that the neuroinflammatory response to a subsequent inflammatory challenge is also potentiated (see section 4.2.). therefore, we propose that stress - induced priming of neuroinflammatory processes may serve to predispose individuals to a heightened neuroinflammatory response as well as the neural / behavioral sequelae of that response if exposed to a subsequent pro - inflammatory insult. in doing so, this neuroinflammatory priming effect of stress may function as an etiological risk factor in the development of major depression or other psychiatric disorders in which inflammatory processes have been implicated in disease pathogenesis (jones and thomsen, 2013). exposure to an acute stressor induces a rapid and brief (26 h) increase of pro - inflammatory cytokines in stress - reactive areas of the brain, including the hypothalamus and hippocampus (johnson., 2005). as a result, acute exposure to a stressor also induces physiological and behavioral sickness response changes that are similar to those produced by a peripheral immune challenge. a stressor as seemingly minor as placing a rat in a novel environment produces fever and impairs contextual fear conditioning (lemay., 1990, pugh., 1999). other typical sickness responses have also been observed after stress exposure, including decreased body weight, food and saccharine consumption, and social exploration (christianson., 2008, johnson., 2003). it is known that these sickness responses result from the cytokine increases because blockade of cytokine receptors in the brain and/or cytokine synthesis blocks or reduces changes in these responses (goshen and yirmiya, 2009). the rapid increase in the pro - inflammatory cytokine and behavioral response to a stressor is due, at least in part, to activation of noradrenergic processes in the brain and the associated release of catecholamines (johnson., 2005). norepinephrine is a fundamental component of the fight / flight response that modulates physiological responses to a stressful event. another major element of norepinephrine is to relay information to the immune system. in the cns, stimulation of beta - adrenergic receptors increases il-1 mrna expression in glial cells (johnson., 2005, maruta., 1997 moreover, peripheral administration of beta - adrenergic receptor antagonists prior to stress prevents subsequent brain cytokine responses and the related behaviors controlled by these cytokines (blandino., 2009, hanke., 2012, johnson., 2005, wohleb., exposure to a stressor not only produces a transient neuroinflammatory response, but also alters how an organism responds to a subsequent inflammatory challenge for a period of time after the stress exposure has ended. several studies have found that prior exposure to a potent acute or chronic stressor potentiates the neuroinflammatory and microglial pro - inflammatory response, as well as the sickness response, to a subsequent immune challenge (de pablos., 2014, de pablos., 2006, espinosa - oliva., 2011, frank., 2007, frank., 2012, johnson., 2002, johnson., 2003, johnson., 2004,, 2006, weber., 2013, weber., 2015, importantly, in these studies, neuroinflammatory and microglial priming was induced using several types of stressors including chronic social defeat, chronic unpredictable mild stress and acute inescapable tail shock. the paradigm we employ involves 100 brief tailshocks that the subject, typically a rat, can not escape (inescapable tailshock ; is). control rats are left undisturbed in their home cage (home cage controls ; hcc). 24 h after is, cytokine levels in the brain are at control levels (johnson., 2003). however, when an immunogenic agent such as lps is administered, the pro - inflammatory cytokine response (il-1, il-6, tnf) in several brain regions (hypothalamus, hippocampus, and cortex) is potently exaggerated compared with hcc subjects that were administered the same immune challenge. as a result, physiological and behavioral processes that are controlled by these brain cytokines are also changed. for example, lps - induced fever, corticosterone, adrenocorticotropic hormone, and decreased locomotor activity are all potentiated by prior exposure to is (johnson., 2003). it should be noted that the potentiated neuroinflammatory response to an immune challenge typically lasts 46 days after is exposure (johnson., 2002). this period of neuroinflammatory sensitization can be conceptualized as a period of vulnerability during which an organism is susceptible to the production of heightened neuroinflammatory processes, if exposed to an immune challenge. it should also be noted that the duration of this period of vulnerability is likely influenced by several factors, including the nature, intensity and duration of the stressor. in humans, understanding how stress predisposes individuals to develop psychiatric disorders is a key question that has only been partially answered. given the link between psychiatric disorders and neuroinflammatory processes, our laboratory has been interested in understanding the central mechanism(s) by which exposure to a stressor impacts the neuroinflammatory environment. to begin to explore this question, we first examined the primary innate immune cell in the brain, microglia. one limitation of measuring cytokines in brain tissue is that the cellular source is unknown, as microglia, astrocytes, endothelial cells, neurons as well as other myeloid cells produce cytokines (basu., 2004). in order to address this issue, our laboratory developed a procedure to isolate and study microglia ex vivo (frank. as noted above, quiescent or surveillant microglia express low levels of the cell surface antigen mhcii, which is rapidly upregulated when microglia are activated (aloisi, 2001) and is indicative of a primed activation state (perry, 2004). exposure to is increased both mrna and protein expression of mhcii on hippocampal microglia for at least 24 h after termination of the stressor. however, exposure to is alone had no effect on hippocampal il-1 mrna levels 24 h later (frank., 2007). that is, although mhcii was upregulated on microglia, the cells were not producing il-1, suggesting that exposure to a stressor induces a primed state in microglia. indeed, when microglia were isolated from rats that were exposed to is and stimulated with lps ex vivo, the pro - inflammatory cytokine response was significantly increased compared with hcc microglia stimulated with lps (frank., 2007). a study by wohleb and colleagues reported similar findings using repeated social defeat as a stressor (wohleb., 2011). mice were given 6 consecutive days of social defeat stress and whole brain microglia were isolated and treated with lps ex vivo. prior exposure to social defeat potentiated the microglial pro - inflammatory response to lps compared to the pro - inflammatory response of microglia isolated from hcc mice. taken together, these findings suggest that acute and chronic stressors prime microglia such that exposure of microglia to a subsequent immune challenge results in an exaggerated pro - inflammatory response. further, these findings imply that stressors may induce the release of a signaling molecule in the brain that modulates the immunophenotype of microglia, thereby inducing a primed activation state. towards addressing this possibility, we focused on the role of stress - induced glucocorticoids (gcs), which on the face of it seems counter - intuitive given the preponderance of evidence showing that gcs are largely anti - inflammatory (boumpas., but, as we detail in section 4.4, gcs have also been found to have paradoxical effects, which are inconsistent with the anti - inflammatory properties typically attributed to gcs. stress (webster marketon and glaser, 2008) and gcs (boumpas., 1993) have been historically regarded to be anti - inflammatory, and this concept has been a bedrock principle until very recently. it has never been clear how inhibition of innate immune inflammatory responses by gcs would be adaptive during a fight / flight emergency as these are periods of increased risk for infection and injury. this conundrum has provoked numerous theoretical attempts at a resolution (frank. moreover, a fair number of clinical trials have reported that gc therapy is not always anti - inflammatory and sometimes produces paradoxical results with the relevant condition being exacerbated rather than alleviated (rutgeerts, 2001). current thinking about the role of stress in the development of psychiatric disorders has also likely been constrained by the notion that stress must be anti - inflammatory, rather than pro - inflammatory. however, recent studies from our laboratory as well as several others now suggest that stress - induced gcs can actually promote or prime neuroinflammatory processes to subsequent immune challenges. beyond the scope of the present review, it is important to note that a considerable number of studies have found that stress - induced noradrenergic processes as well as modulation of immune cell trafficking to the brain play a role in stress - induced neuroinflammatory priming (wohleb., 2014), which may play a role in the processes of neuroimmune priming under discussion here. a number of studies have found that pharmacological blockade of gc signaling during acute or chronic stress exposure ameliorates the potentiated neuroinflammatory response to a subsequent immune challenge (de pablos., 2014, de pablos., 2006, espinosa - oliva., 2011, frank., 2012, moreover, we found that pharmacological (ru486) and surgical (adrenalectomy) blockade of gc signaling during stress exposure abrogated the stress - induced potentiation of the microglia pro - inflammatory response to an immune challenge (lps) ex vivo (frank., 2012). these findings suggest that the stress - induced rise in gcs leads to a shift in the activation state of microglia from surveillant to primed. while these studies demonstrated the necessity of gc signaling in stress - induced neuroinflammatory priming (de pablos., 2014, de pablos., 2006, espinosa - oliva., 2011, frank., 2012,, a number of studies have also found that exogenous gc treatment is sufficient to prime neuroinflammatory processes as well as the microglial pro - inflammatory response ex vivo. we found that acute administration of corticosterone (cort) potentiated the neuroinflammatory response to lps that was administered 24 h after cort injection (frank., 2010). moreover, we found that hippocampal microglia isolated 24 h after cort injection and challenged with lps ex vivo also exhibited a potentiated pro - inflammatory response to lps. interestingly, if cort was administered 1 h after lps, the neuroinflammatory response to lps was suppressed. it should be noted that the dose of cort employed in this study was found to induce a pattern in serum cort concentrations that mimics that produced by inescapable tailshock (fleshner., 1995). subsequent studies have also found that chronic cort administration primes the neuroinflammatory response as well as the ex vivo microglial pro - inflammatory response to a subsequent immune challenge (frank., 2014, munhoz., 2010). although the mechanism(s) by which cort primes microglia is still under investigation, munhoz and colleagues found that prior cort exposure potentiates the lps induction of several signal transduction pathways including the nf-b pathway (munhoz., 2010). similarly, we have found that chronic cort treatment dose dependently increased nlrp3 gene expression as well as nf-b inhibitor, which is induced by nf-b activation (sun., 1993). taken together, these studies suggest the possibility that gcs activate the nf-b pathway, thereby leading to up - regulation of nlrp3 expression and priming of the nlrp3 inflammasome. indeed, busillo and colleagues have found that gcs increase nlrp3 expression in macrophage cell lines as well as potentiate the macrophage pro - inflammatory response to a subsequent immune challenge (busillo., we have recently replicated this effect of gcs on nlrp3 expression in primary microglia (unpublished observations). however, it is unclear from these findings how gcs could directly induce nlrp3 or for that matter activate nf-b. a likely possibility is that gcs prime neuroinflammatory processes via induction / release of danger signals, such as hmgb-1, in the brain. hmgb-1 may then target tlr4 on microglia to activate nf-b and increase nlrp3 expression, thereby priming the nlrp3 inflammasome. to begin exploring this notion, we examined the role of hmgb-1 in neuroinflammatory priming. in order for microglia to be primed by stress, microglia must first receive a priming signal. recent evidence implicates hmgb-1 as one such signal. as noted above, our interest in hmgb-1 stemmed from an initial investigation demonstrating that blockade of tlr2 and tlr4 during stress exposure abrogated stress - induced priming of microglia (weber., given that tlr2 and tlr4 mediate the pro - inflammatory effects of hmgb-1, we explored the possibility that stress - induced hmgb-1 may play a role in neuroinflammatory priming. an initial investigation revealed that is increases hmgb-1 protein in the hippocampus (weber. further investigation indicated that hippocampal microglia, isolated immediately after stress exposure, secreted an increased amount of hmgb-1 compared with microglia from control animals. importantly, cell viability did not differ between stress and control groups suggesting that hmgb-1 was actively secreted by microglia in the absence of cell death. the finding that stress increased hippocampal hmgb-1 expression led us to explore whether hmgb-1 plays a causal role in stress - induced priming of neuroinflammatory responses. to explore whether hmgb-1 is necessary, a competitive hmgb-1 antagonist, boxa, was injected into the brain prior to stress exposure. the blockade of hmgb-1 signaling in the brain prevented the stress - induced priming of hippocampal microglia, that is, box a administered prior to is eliminated the exaggerated cytokine response of microglia exposed to lps ex vivo 24 h after is (weber., 2015). a key question concerns which redox form of hmgb-1 might mediate stress - induced neuroinflammatory priming. interestingly, central administration of dshmgb-1, but not frhmgb-1, primed hippocampal microglia to lps ex vivo (weber., 2015). that is, dshmgb-1 mimicked the effect of stress exposure on microglia and is likely the form that is released during stress exposure to prime microglia. one major difference between the 2 active forms of hmgb-1 is their receptor targets. in this regard, dshmgb-1 is a ligand for tlr4, while frhmgb-1 interacts with cxcr4 via cxcl12 (yang., 2013). signaling at tlr4 initiates an intracellular signaling cascade that activates the immune - related transcription factor nf-b (kawai and akira, 2007) and priming of the nlrp3 inflammasome (hornung and latz, 2010), while cxcr4 activates a variety of signaling pathways including erk1/2, p38, sapk / jnk and mtor, which are associated with calcium influx, cell mobility and survival (ehtesham., 2013). therefore, the ability of dshmgb-1 to prime microglia likely occurs via the tlr4/nf-b pathway. initially, we found that is activates nf-b and increases nlrp3 protein in the hippocampus, yet these changes were not associated with alterations in il-1 protein levels (weber., 2015). this finding would suggest that the nlrp3 inflammasome is primed but not active after exposure to the stressor. a similar effect was observed by pan and colleagues in the prefrontal cortex after exposure to chronic mild stress (pan., 2014). moreover, nlrp3 inhibition during chronic mild stress prevented pro - inflammatory cytokine increases (liu., 2015). as noted in section 2.4, hmgb-1 has been reported to increase nlrp3 mrna and protein (xiang., 2011) and it has been argued that danger signals such as hmgb-1 prime the nlrp3 inflammasome (leemans., 2011). this argument is supported by our finding that pharmacological blockade of hmgb-1 signaling during stress exposure prevents nlrp3 sensitization in microglia (weber., 2015). given that nlrp3 priming can occur via tlr4 and tlr4 is a receptor target for dshmgb-1, we hypothesize that stress - induced dshmgb-1, but not frhmgb-1 primes the nlrp3 inflammasome. thus, stressors, via induction of increased secretion of dshmgb-1, appear to prime the inflammasome so that subsequent inflammatory challenges lead to exaggerated pro - inflammatory mediators in the brain. the effect of stressors on gcs, hmgb-1 and the nlrp3 inflammasome provides a potential mechanism by which stress exposure primes neuroinflammatory processes (fig. 2). danger. we propose that in response to stressors, gcs induce the release of hmgb-1 in the brain, in part, by microglia. it should be noted that neurons are a significant source of hmgb-1 in the cns (fang., 2012) and thus may be involved in the processes under discussion. once released into the extracellular space, hmgb-1, likely in the disulfide redox state, signals microglia in an autocine / paracrine manner via tlr4. thus, binding at tlr4 activates nf-b to synthesize nlrp3, and the cell is now considered primed. in the event of a subsequent immune challenge, formation of the nlrp3 inflammasome is potentiated, resulting in greater caspase-1 activation and cleavage of pro - il-1 into the mature and bioactive il-1. il-1 then initiates a cascade of neuroinflammatory processes including the release of other pro - inflammatory cytokines and inflammatory mediators. therefore, the net result is an exaggerated or amplified neuroinflammatory response and subsequently, the physiological and behavioral sequelae of this cascade (i.e. sickness) are amplified. while prior stress exposure is considered a predisposing factor in the development of psychiatric disorders (kessler, 1997), a key question remains : why does stress lead to the development of psychiatric disorders in some individuals, but not in others ? a number of factors mediating the relationship between stress and psychiatric disorders have been proposed including individual differences in biological, developmental, psychological and sociodemographic factors (hammen, 2005). of these factors, sex differences are of particular relevance here insofar as females are more susceptible to developing affective psychiatric disorders as well as autoimmune disorders, which reflects the tendency of females to display enhanced immune responses (schwarz and bilbo, 2012). moreover, bilbo and colleagues have found that pro - inflammatory mediators are basally elevated in the brain of adult female rats compared to males. moreover, microglia of adult females exhibit an activated phenotype (schwarz., 2012). these findings suggest that females may be particularly vulnerable to stress - related psychiatric disorders due to the tendency for heightened neuroimmune responses. the findings reviewed here provide a framework for understanding how exposure to stressors may function as an additional vulnerability factor in the development of psychiatric disorders, particularly in females and individuals with a predisposition towards a heightened neuroimmune response. if indeed exposure to stressors shifts the neuroimmune microenvironment towards a primed state, then a window of vulnerability to heightened neuroinflammatory processes is opened. if a pro - inflammatory challenge were to occur during this window, the heightened neuroinflammatory response may lead to dysregulation of the neuroimmune microenvironment, thereby increasing the likelihood of developing mood disorders. pro - inflammatory challenges can take many forms such as the obvious, for example bacterial or viral infection, but also the less obvious, such as sterile injury, drugs of abuse and of course, additional stress exposure. therefore, understanding the mechanisms of neuroinflammatory priming may lead to the development of therapeutics, which, if applied during this window of vulnerability, could be used to desensitize the neuroimmune microenvironment and prevent the development of mood disorders.	stress and glucocorticoids (gcs) have universally been considered to be anti - inflammatory, however in recent years, stress and gcs have been found to exert permissive effects (immunological priming) on neuroinflammatory processes. this phenomenon of priming is characterized by prior stress or gc exposure potentiating the neuroinflammatory response to a subsequent immune challenge. a considerable body of evidence is discussed here that supports this permissive effect of stress and gcs.in light of this evidence, a mechanism of neuroinflammatory priming is proposed involving a signal cascade in the brain involving danger - associated molecular patterns (hmgb-1) and inflammasomes (nlrp3), which results in an exaggerated or amplified neuroinflammatory response and subsequently, the amplification of the physiological and behavioral sequelae of this response (i.e. sickness). finally, we explore the notion that stressor - induced sensitization of the neuroimmune microenvironment may predispose individuals to psychiatric disorders, in which exaggerated innate immune / inflammatory responses in the brain are now thought to play a key role.
in this study of human infections by snv in boulder county, colorado, we identified 2 patients who had trapped rodents for ecologic studies. on june 14, 2005, a 24-year - old man was admitted to boulder community hospital with fatigue, headache, fever, and thrombocytopenia (70,000 platelets/l) but without cardiorespiratory compromise. a strip immunoblot assay identified immunoglobulin (ig) m and igg against snv n and gn proteins. on july 6, 2005, a 22-year - old igm- and igg - seropositive woman was admitted to boulder community hospital with fever and dyspnea ; she subsequently experienced bilateral lung infiltrates and thrombocytopenia (116,000 platelets/l). she reported performing fieldwork in the same period as did patient 1 but with no overlap among the sites (the distances between sampling sites where the 2 field workers most probably contracted their infections ranged from 6.4 to 9.8 km). both patients engaged in field activities involving manipulating traps and rodents in areas where deer mice were seropositive for snv (table). snv, sin nombre virus. along with the 2 patients, another 15 field workers were surveyed to assess possible exposures to snv. ninety - five questions were asked involving, among others, contacts with rodents and use of personal protective measures and equipment. most (83.3%, 14/15) reported previous experience with rodents in the field ; all workers were required to wear nitrile gloves and use a powered air - purifying respirator when handling animals. no differences in risk exposure to contract hantavirus were evident between infected and noninfected persons. six persons reported having been bitten > 1 times by rodents, including both case - patients. patient 2 was bitten twice, with 1 bite resulting in bleeding despite the worker s use of nitrile gloves. patient 1 reported being bitten by a vole (microtus sp.) on june 2, and patient 2 was bitten by 2 deer mice on june 14. we hypothesized that the workers might have been exposed to a subset of rodents with unusually high titers of snv. therefore, we resampled sites in boulder and jefferson counties in colorado (where the field workers were infected) during august a total of 44 sites were sampled during both trapping periods by using live traps (h.b. sherman traps, tallahassee, fl, usa) in grids for 4 consecutive nights. prairie dogs (cynomys ludovicianus) were also trapped at a subset of these study sites during june july 2005 with live traps (tomahawk live traps, tomahawk, wi, usa). a total of 1,868 animals from 10 mammalian species were captured during both trapping periods (table). we screened blood samples by strip immunoblot assay for antibodies against snv n protein (4). deer mice showed the highest abundance of seropositive samples, although harvest mice (reithrodontomys megalotis), which carry el moro canyon virus, had higher seroprevalence. two (2.5%) of 81 hispid pocket mice (chaetodipus hispidus) were also positive but are unlikely to play an epidemiologic role. small mammal capture frequencies varied during the 2 sampling periods ; seroprevalence for pocket mice, prairie voles, and harvest mice increased, and that for meadow voles (m. pennsylanicus) decreased. we performed taqman (applied biosystems, foster city, ca, usa) quantitative real - time pcr on a subset of 79 (of 187) samples from deer mice that had detectable antibodies to snv n antigen. the samples selected for pcr analysis were those for which the volume of blood was deemed sufficient (> 25 l) to carry out a satisfactory rna extraction. we chose 25 l as the minimal amount for detecting snv small segment rna by nested reverse transcription pcr on the basis of a spiking experiment in which 5 l of lung homogenate from an infected deer mouse had been added to 20 l of blood from an uninfected deer mouse, resulting in a positive finding. the equivalents of 10-l aliquots of total blood rna (rneasy mini kit ; qiagen, valencia, ca, usa) were subjected to quantitative real - time pcr with primers, probes, and pcr conditions as described (5). we detected only low levels of snv in the blood of 2 of the 79 seropositive deer mice tested (table). this low number of samples with detectable snv rna (2.53%) is congruent with previous findings reporting undetectable levels of snv rna in blood using quantitative real - time pcr (6). the primary mode of hantavirus transmission to humans is through rodent excreta and secretions through the aerosol route (7). although indoor exposure in poorly ventilated buildings has been reported as a major factor for contraction of hcps, our survey supports the possibility that the 2 patients contracted snv outdoors and that, in at least in 1 case, a rodent bite was the proximate vehicle for transmission of snv to the field worker. the fact that patient 1 was bitten by a vole and not by a deer mouse does not necessarily exclude transmission of snv by that route. voles are not known to transmit snv, but there have been repeated instances of vole - associated hantaviruses being carried by sigmodontine rodents (11). although the power of this survey is limited by small sample size, we believe that our finding are potentially useful and suggest that increased attention be devoted toward avoiding rodent bites among the handlers of wild rodents in regions where hantaviruses occur. although both workers sustained rodent bites, 1 by a known snv carrier and 1 by another rodent species, one should remain open - minded about the actual route of infection, which might still be through an airborne route rather than through bites in either case. our results suggest that detecting snv rna of sufficient magnitude (> 80 copies / ml) to score as positive in taqman assays might be uncommon in the natural reservoir. therefore, high loads of snv rna might not be a major factor in virus transmission in the wild. alternatively, snv might cause only a brief rna viremia in wild deer mice (12), and possibly the small number of real - time pcr positive deer mice represents those animals that underwent recent seroconversion. this phenomenon has also been observed with other rodent borne - hantaviruses (13). alternatively, or in addition, the small number of mice found to have quantifiable viral rna in this study might be a consequence of physiologic events (such as viral recrudescence) (14), which result in intermittent detection of viral rna in blood, a phenomenon that might be shared by other agents of hemorrhagic fevers (15).	we report 2 cases of sin nombre virus (snv) infection in field workers, possibly contracted through rodent bites. screening for antibodies to snv in rodents trapped in 2 seasons showed that 9.77% were seropositive. quantitative real - time pcr showed that 2 of 79 deer mice had detectable titers of snv rna.
thrombotic thrombocytopenic purpura (ttp) is a rare acquired or congenital disorder with an annual incidence of six cases per million (1). its pathogenesis involves an imbalance between von willebrand factor (vwf) multimers and adamts13. if there is a gene mutation existing congenitally leading to absent or severely deficient adamts13 activity, it is called upshaw - shulman syndrome. autoantibodies against adamts13 leading to its decreased activity pex is the first - line treatment and is effective in most of the cases. however, in secondary ttp with normal or moderately reduced adamts13 activity and no evidence of adamts13 inhibitor, pex is not effective in many cases (3). atypical hemolytic uremic syndrome (ahus) is a disorder characterized by complement gene mutations or anti - factor h autoantibodies (cfh) autoantibodies causing dysregulation of the alternative complement pathway. some other mutations identified in ahus are as follows : inactivating mutations of cfh (factor h), cfi (factor i), mcp (membrane cofactor protein), or thrombomodulingain - of - function mutations of factor b and c3, and anti - cfh autoantibodies inactivating mutations of cfh (factor h), cfi (factor i), mcp (membrane cofactor protein), or thrombomodulin gain - of - function mutations of factor b and c3, and anti - cfh autoantibodies but only 70% of patients will be found to have these mutations and more mutational analyses need to be done including the recent finding of mutations of diacylglycerol kinase in patients with suspected ahus. the first - line treatment for ahus is still pex because there is no test available that can initially differentiate between ttp and ahus. (4) demonstrated that in patients with anti - cfh antibody - mediated ahus, the instantaneous use of pex and immune - suppressive therapy can improve outcomes. eculizumab (soliris) was approved by food and drug administration (fda) in september 2011 for patients refractory to pex. mortality rate before that was 67% and has gone down a lot where four out of five patients are able to come off dialysis. to note, end - stage renal disease was the major cause of death in people surviving initial hospitalization with ahus (5). it has always been a dilemma to differentiate ahus from ttp. in the past, traditionally, ttp is the diagnosis when there is an involvement of central nervous system (cns), and ahus is the diagnosis when renal impairment is predominant. now it is known that both these entities are in fact different disorders with distinct characteristics. therefore, clinically, patients with ttp may have renal dysfunction and those with ahus may develop cns manifestations. even though, it is now possible to differentiate these two disorders, we still do not have the capability to differentiate them at presentation. hence, initial treatment for both these disorders is same, that is, pex therapy. although a severe deficiency of the adamts13 protease (< 510%) and documented mutations of complement proteins are not required for the diagnosis of acquired ttp and ahus, respectively, both findings in the appropriate clinical context serve to confirm the clinical diagnosis., the two conditions were found to be secondary to completely different mechanisms as explained above. eculizumab was approved by fda in 2011 for ahus and has become the gold standard therapy for this. but it still remains a challenge to differentiate them and the decision has to be made on clinical judgment. adamts13 can differentiate in most of the conditions but takes days to weeks to come back depending on the location. meanwhile, starting therapy as soon as possible is really necessary to improve survival outcomes. c3, c4, and ch50 can not be used because they are very non - specific and can be abnormal in a lot of situations. ttp seems to cause more severe thrombocytopenia, and ahus is associated with more severe renal failure and is a leading cause of death in these patients. diagnosis is likely to be ttp if platelet count is less than 30,000/l and creatinine is less than 2.25 mg / dl. on contrary, ahus is the likely diagnosis if platelet count is greater than 30,000/l and creatinine is more than 2.25 mg / dl. on suspicion of ttp or ahus, emergent treatment with pex should be instituted but should be rethought in 35 days in non - responders and focus should be shifted to eculizumab. pex should be avoided when giving eculizumab because it gets washed out (algorithm 1). approach to thrombotic thrombocytopenic purpura pancreatitis is one of the most common and severe complications after ercp., we need to understand the mechanism behind pep which is thought to be due to sphincter of oddi spasms or papillary edema leading to pancreatic drainage blockage. pd stenting can itself increase post - ecrp complications if there are any manipulation accidents during placement. therefore, safety remains an important concern during prophylactic pd stent placement (6, 7). nsaids have been proposed to reduce the incidence of pep by their anti - inflammatory action, but pd stent was the only major prevention method. recently, a study showed that placebo had four times more pep compared to rectal indomethacin. the incidence of the complication was 4.87% (4/82) in the study group and 20.23% (17/84) in the placebo group ; this difference was significant (p=0.01). rectal indomethacin reduced the incidence of pep among patients at high risk of developing this complication (8). a study done comparing pd stenting with placebo showed that placebo had three times more pep incidence than patients getting pd stenting. pancreatitis is a well - known complication of ttp, but ttp - ahus secondary to acute pancreatitis is a rare occurrence. hosler. (9) found that 30 out of 51 patients diagnosed with ttp had pancreatic involvement. there was a major study done in japan in 2008 that looked at 919 patients with thrombotic microangiopathy (tma) and none of them were triggered by acute pancreatitis (10). the median time from pancreatitis to the development of ttp - ahus is 3 days which is true in our patient. (11) reported 5 patients and reviewed 16 cases from the literature, in which acute pancreatitis preceded clinically and laboratory signs of ttp by a median of 3 days (12). in the great majority of cases, ttp develops in healthy individuals. it has been associated with pregnancy, vascular disease, malignancy, and certain drugs, and the newest associations are hiv and pancreatitis (1). case reports have shown ttp - ahus secondary to autoimmune pancreatitis, alcohol abuse, gallstones, and granulomatous pancreatic inflammation due to sarcoid. the mechanism in ttp - induced pancreatitis is not well understood but is proposed to be pancreatic tissue damage occurring as a result of intracellular activation of enzymes leading to a secondary inflammatory response and release of cytokines (1). in case of ttp occurring after pancreatitis, it is plausible that the widespread immunological response as a result of pancreatitis may be involved. further, as a result of vascular insult, there is a deficiency of adamts13. no data has shown any direct correlation between pancreatitis and ahus because most people can respond to pex and are considered to have ttp. looking at our case, there could be a real possibility of ahus having an association with pancreatitis and should be kept in mind in future. to conclude, the association of pancreatitis is more appropriate to make with tma and not just ttp or ahus. in any case presenting with tma, the first step should be pex. on the failure of therapy for 35 days, eculizumab should be considered without any further delay because mortality in an ahus increases with delay in its treatment. the authors have not received any funding or benefits from the organization or elsewhere to conduct and publish this study.	thrombotic thrombocytopenic purpura (ttp) is a rare multisystem microvascular disorder, which is characterized by pentad of thrombocytopenia, microangiopathic hemolytic anemia, and organ dysfunction due to occlusive thrombi. the proposed pathophysiology involves an imbalance between unusually large von willebrand factor multimers and the cleaving protease adamts13. acute pancreatitis is a well - described consequence of ttp, but ttp secondary to acute pancreatitis is a rare phenomenon. we present a patient who developed ttp due to post - ercp pancreatitis with hematologic, cardiovascular, pulmonary, and renal complications and is the first case of this kind. despite early initiation of therapy, the patient did not recover making it among the 10% of cases of ttp that prove fatal despite appropriate therapy.
records were collected between november 2004 and february 2010, from 197 client - owned dogs with documented pulmonary edema. we evaluated the records of the first onset of pulmonary edema (dyspnea, cough and tachypnea) in dogs with mitral regurgitation, retrospectively. dogs were included, if they had been diagnosed with mmvd via a 2-d echocardiographic examination which showed thickening of the mitral valve leaflets, + / evidence of chordal rupture and left ventricular and left atrial dilatation within the first 3 days of hospitalization. measurements, including fractional shortening and the la / ao ratio, were obtained from the right parasternal short axis using the 2d view. thoracic radiographs (standard lateral and dorsal ventral (dv)/ventral dorsal (vd) views) had to be taken within the initial 3 days of hospitalization for chf to verify the presence of pulmonary edema. the patients were required to have current radiographic evidence of pulmonary edema and cardiomegaly (vertebral heart score (vhs) 10.5). during the initial hospitalization period for stabilization of the left side chf (l - chf), dogs were excluded from the study, if they died without responses to acute therapy during the initial onset of pulmonary edema. after treatment and recovery of chf, the dogs were treated with a combination of diuretics, aceis, digoxin, pimobendan, antiarrhythmics as needed and cough suppressants. the dogs were divided into one of the following treatment groups for the study : conventional therapy group (n=84) : aceis administered according to the manufacturer s recommended dosages, furosemide (2 mg / kg q12hr) or other loop diuretics at the manufacturer s recommended dosages, and other drugs as needed. low dose pimobendan (low - pimo) group (n=49) : aceis administered according to the manufacturer s recommended dosages, furosemide (2 mg / kg q12hr) or other loop diuretics at the manufacturer s recommended dosages, pimobendan at half the manufacturer s recommended dose (0.13 mg / kg [range 0.050.19 mg / kg ]) q12hr, and other drugs as needed. standard dose pimobendan (standard - pimo) group (n=64) : aceis administered according to the manufacturer s recommended dosages, furosemide (2 mg / kg q12hr) or other loop diuretics, pimobendan at the recommended dose (0.24 mg / kg [range 0.200.48 mg / kg ]) q12hr, and other drugs as needed. the dogs were followed individually, and drug dosages were adjusted according to the needs of each patient. however, neither the aceis nor the pimobendan dosages (low or standard dose) were changed. seventy dogs (29 from the low - pimo group and 41 from the standard - pimo group) were treated with pimobendan immediately after the initial onset of pulmonary edema. eleven dogs (eight from the low - pimo group and three from the standard - pimo group) were treated with pimobendan more than 1 month after initial onset of pulmonary edema. thirty - two dogs (12 from the low - pimo group and 20 from the standard - pimo group) were treated with pimobendan after the reoccurrence of pulmonary edema. the primary endpoint was defined as death resulting from an underlying mitral regurgitation, i.e., death at home with signs of fatal pulmonary edema, or sudden cardiac death likely to have been caused by a fatal arrhythmia or rehospitalization with l - chf and severe pulmonary edema considered unmanageable following up to 3 days of intensive therapy, leading to euthanasia. survival was calculated as the number of days from the first occurrence of l - chf until the verified day of all cause death. the secondary endpoint of the study was defined as the reoccurrence (second episode) of clinical and radiographic signs of l - chf. additionally, a log - rank test was used to evaluate whether the reoccurrence of pulmonary edema was associated with a worse prognosis. age, body weight, grade of heart murmur, vhs, la / ao and fs are expressed as the mean standard deviation. statmate iii (statmate iii, atms, co., ltd., tokyo, japan) all continuous baseline variables were compared using bartlett s test and one - way analysis of variance (one - way anova). for categorical data, a or fisher the kaplan - meier method was used to estimate the median time to end point for each treatment group and to plot time to event curves. a log - rank test was used to determine whether there were any significant differences between each group. the primary endpoint was defined as death resulting from an underlying mitral regurgitation, i.e., death at home with signs of fatal pulmonary edema, or sudden cardiac death likely to have been caused by a fatal arrhythmia or rehospitalization with l - chf and severe pulmonary edema considered unmanageable following up to 3 days of intensive therapy, leading to euthanasia. survival was calculated as the number of days from the first occurrence of l - chf until the verified day of all cause death. the secondary endpoint of the study was defined as the reoccurrence (second episode) of clinical and radiographic signs of l - chf. additionally, a log - rank test was used to evaluate whether the reoccurrence of pulmonary edema was associated with a worse prognosis. age, body weight, grade of heart murmur, vhs, la / ao and fs are expressed as the mean standard deviation. statmate iii (statmate iii, atms, co., ltd., tokyo, japan) all continuous baseline variables were compared using bartlett s test and one - way analysis of variance (one - way anova). for categorical data, a or fisher the kaplan - meier method was used to estimate the median time to end point for each treatment group and to plot time to event curves. a log - rank test was used to determine whether there were any significant differences between each group. the most commonly recruited breeds were shih tzu (n=49), maltese (n=36), chihuahua (n=18), cavalier king charles spaniel (n=12), yorkshire terrier (n=11), miniature dachshund (n=8), toy poodle (n=7) and pomeranian (n=7). there were 15 additional breeds and 34 mixed - breed dogs. the median age at initial presentation was 11.8 years (range, 4.918.1 years), and the median body weight was 6.1 3.7 kg (range, 1.521.1 kg). there were no statistically significant differences in the signalment, physical examination, heart size or echocardiographic findings between the 3 groups at initial presentation. (table 1table 1.initial clinical data from dogs in the three treatment groupsconventional grouplow - dose pimobendan groupstandard - dose pimobendan groupp - valueage (years)11.7 2.511.8 2.511.9 2.50.89body weight (kg)5.9 3.86.1 3.66.5 3.70.68sex (m / nm / f / nf) (%) 42/12/12/1828/4/12/534/11/10/90.35(50/14/14/22)(57/8/25/10)(53/17/16/14)grade of heart murmur4.2 0.84.0 0.64.0 0.70.23thoracic radiographyvhs (v)11.9 1.111.9 1.012.1 0.80.40echocardiographyla / ao2.3 0.62.4 0.42.1 0.40.08fs (%) 47.2 10.147.7 9.945.5 7.80.53presence of tr (%) 3826510.09 m, male ; nm, neutered male ; f, female ; nf, neutered female.). m, male ; nm, neutered male ; f, female ; nf, neutered female. there was a significant difference in the number of dogs in the low - pimo group (28/49 : 57%) treated with spironolactone compared to the standard - pimo group (16/64 : 25%) and the conventional group (5/84 : 6%) (p<0.001). there were significantly fewer dogs (p<0.01) treated with bronchodilators in the standard - pimo group (9/64 : 14%) than in the low - pimo (15/49 : 31%) and conventional (31/84 : 37%) groups. 150 dogs (76%) died spontaneously of cardiac related causes, 2 dogs (1%) were euthanized for cardiac related causes, 5 dogs (3%) died of renal failure, and 1 dog (0.5%) died from a neoplasm. thirty - nine dogs (21%) were censored, because 37 dogs (19%) were alive at the termination of the study and 2 dogs (1%) had received mitral valve repair surgery. in both of the groups administered pimobendan, the survival times were significantly prolonged compared to the conventional group (p<0.001) (fig. 1.kaplan-meier survival curve. in both of the groups administered pimobendan, the survival times were significantly longer than those in the conventional group.). the median survival times for the standard - pimo, low - pimo and conventional groups were 334, 277 and 136 days, and the 1-year survival rates were 46%, 37% and 23%, respectively. there was no significant difference between the standard- and low - pimo groups. kaplan - meier survival curve. in both of the groups administered pimobendan, thirty - two dogs (12 from the low - pimo group and 20 from the standard - pimo group) were excluded from the analysis, because pimobendan was initiated after the reoccurrence of pulmonary edema. the reoccurrence rates of pulmonary edema for the standard - pimo, low - pimo and conventional groups were 43% (19/44), 59% (22/37) and 62% (52/84), respectively. the standard - pimo group showed a significant reduction in the reoccurrence of pulmonary edema compared to the low - pimo and conventional groups. the death rates from the reoccurrence of pulmonary edema were as follows : standard (9%), low (11%) and conventional (24%) therapy. thus, the inclusion of pimobendan in addition to conventional therapy for chf was negatively correlated to death as a result of reoccurring pulmonary edema. the group that had reoccurrence of pulmonary edema (n=93) had significantly shorter survival times compared with the group that had non - reoccurrence (n=72) (p<0.05). the most commonly recruited breeds were shih tzu (n=49), maltese (n=36), chihuahua (n=18), cavalier king charles spaniel (n=12), yorkshire terrier (n=11), miniature dachshund (n=8), toy poodle (n=7) and pomeranian (n=7). there were 15 additional breeds and 34 mixed - breed dogs. the median age at initial presentation was 11.8 years (range, 4.918.1 years), and the median body weight was 6.1 3.7 kg (range, 1.521.1 kg). there were no statistically significant differences in the signalment, physical examination, heart size or echocardiographic findings between the 3 groups at initial presentation. (table 1table 1.initial clinical data from dogs in the three treatment groupsconventional grouplow - dose pimobendan groupstandard - dose pimobendan groupp - valueage (years)11.7 2.511.8 2.511.9 2.50.89body weight (kg)5.9 3.86.1 3.66.5 3.70.68sex (m / nm / f / nf) (%) 42/12/12/1828/4/12/534/11/10/90.35(50/14/14/22)(57/8/25/10)(53/17/16/14)grade of heart murmur4.2 0.84.0 0.64.0 0.70.23thoracic radiographyvhs (v)11.9 1.111.9 1.012.1 0.80.40echocardiographyla / ao2.3 0.62.4 0.42.1 0.40.08fs (%) 47.2 10.147.7 9.945.5 7.80.53presence of tr (%) 3826510.09 m, male ; nm, neutered male ; f, female ; nf, neutered female.). m, male ; nm, neutered male ; f, female ; nf, neutered female. there was a significant difference in the number of dogs in the low - pimo group (28/49 : 57%) treated with spironolactone compared to the standard - pimo group (16/64 : 25%) and the conventional group (5/84 : 6%) (p<0.001). there were significantly fewer dogs (p<0.01) treated with bronchodilators in the standard - pimo group (9/64 : 14%) than in the low - pimo (15/49 : 31%) and conventional (31/84 : 37%) groups. 150 dogs (76%) died spontaneously of cardiac related causes, 2 dogs (1%) were euthanized for cardiac related causes, 5 dogs (3%) died of renal failure, and 1 dog (0.5%) died from a neoplasm. thirty - nine dogs (21%) were censored, because 37 dogs (19%) were alive at the termination of the study and 2 dogs (1%) had received mitral valve repair surgery. in both of the groups administered pimobendan, the survival times were significantly prolonged compared to the conventional group (p<0.001) (fig. 1fig. 1.kaplan-meier survival curve. in both of the groups administered pimobendan, the survival times were significantly longer than those in the conventional group.). the median survival times for the standard - pimo, low - pimo and conventional groups were 334, 277 and 136 days, and the 1-year survival rates were 46%, 37% and 23%, respectively. there was no significant difference between the standard- and low - pimo groups. kaplan - meier survival curve. in both of the groups administered pimobendan, thirty - two dogs (12 from the low - pimo group and 20 from the standard - pimo group) were excluded from the analysis, because pimobendan was initiated after the reoccurrence of pulmonary edema. the reoccurrence rates of pulmonary edema for the standard - pimo, low - pimo and conventional groups were 43% (19/44), 59% (22/37) and 62% (52/84), respectively. the standard - pimo group showed a significant reduction in the reoccurrence of pulmonary edema compared to the low - pimo and conventional groups. the death rates from the reoccurrence of pulmonary edema were as follows : standard (9%), low (11%) and conventional (24%) therapy. thus, the inclusion of pimobendan in addition to conventional therapy for chf was negatively correlated to death as a result of reoccurring pulmonary edema. the group that had reoccurrence of pulmonary edema (n=93) had significantly shorter survival times compared with the group that had non - reoccurrence (n=72) (p<0.05). pimobendan is frequently added to the conventional treatment regimen in dogs with clinical signs associated with mmvd. however, there has been no study documenting the efficacy of pimobendan in combination therapy. we retrospectively investigated the survival times after the initial onset of pulmonary edema in dogs with mmvd. the present study compared the impact of two different dose ranges of pimobendan with the efficacy of conventional treatment. the prognosis of dogs diagnosed with severe mitral regurgitation is very poor, and the median survival time is less than 7 months [5, 19 ]. therefore, the efficacy of new treatment regimens was evaluated by observing whether there was an increase in survival times. in the present study, the median survival times for the standard - pimo, low - pimo and conventional groups were 334, 277 and 136 days, respectively. this study showed that pimobendan administered in addition to conventional treatment increased the survival of dogs with chf due to mmvd by 2.5 times. these results are consistent with previously reported studies that have examined the effects of pimobendan monotherapy. at similar doses, although it is difficult to directly compare previous studies due to the differences in study criteria, our data suggest that the combination therapy of pimobendan with conventional treatment (including aceis) is more effective than conventional therapy alone (including aceis). a previous study suggested that pimobendan may increase mr under clinical conditions and may induce ventricular hypertrophy. another study reported that pimobendan may worsen valve regurgitation in dogs with asymptomatic mmvd compared to aceis. the efficacy of pimobendan in asymptomatic dogs with mmvd still needs to be confirmed. in our study, symptomatic dogs with mmvd demonstrated a longer survival time when on either the standard dose or low dose pimobendan. the clinical signs associated with high - dose (2.621.3 mg / kg) pimobendan toxicosis have been reported and include cardiovascular abnormalities, such as severe tachycardia, hypotension and hypertension. however, these adverse effects of pimobendan were not observed in any of the dogs in this study. the other drugs did not show any influence on the survival time in the multivariate analysis. previous reports have indicated the effectiveness of aceis as a medical treatment for mmvd [2, 11 ], and the guidelines for diagnosis and treatment of canine chronic valvular heart disease recommend the use of diuretics and aceis in the treatment of chf. at present, these medications make up the standard drug treatment regimen for dogs with chf. aceis and loop diuretics were used in the treatment of many dogs in this study. thus, the current study is important in clarifying the efficacy of combining pimobendan with other conventional therapies. the positive inotropic effect of digoxin leads to increased oxygen consumption by the myocardium, however, studies on the effect of combined pimobendan and digoxin therapy have not yet been published. spironolactone is an aldosterone antagonist that has a positive effect on survival in dogs with naturally occurring mr caused by mmvd. our study does not address the effect of combination therapy with pimobendan and digoxin or aldosterone antagonists, such as spironolactone or torsemide, and further studies are required to address the impact of combined pimobendan and concomitant drug therapy. our study showed that the reoccurrence rate of pulmonary edema was associated with a shorter survival time. the present study investigated the efficacy of combination therapy including pimobendan to reduce the reoccurrence of pulmonary edema. we found that the standard dose range of pimobendan (0.200.48 mg / kg) was associated with a significantly lower rate of reoccurrence of pulmonary edema compared to conventional treatment. these data are consistent with the fact that pimobendan reduces left atrial diameter and left atrial pressure. the positive inotropic effects of pimobendan have been observed using 0.1 mg / kg administered orally, and pimobendan was administered at this concentration. in addition, a higher dose (0.5 mg / kg) of pimobendan has been shown to decrease left atrial pressure to a higher degree. this retrospective study supports the benefits of adding the standard dose (0.25 mg / kg q12hr) of pimobendan to a conventional therapy regimen to reduce pulmonary edema and improve disease prognosis. this was a retrospective study, and therefore, we did not have any control over the composition and dosage of the conventional treatment or of the dosage and timing of pimobendan introduction into the treatment regimen. these factors brought considerable variability into the analysis of the combination treatment. nonetheless, this study confirmed the benefits of pimobendan and supports the use of standard - dose pimobendan and combination therapy over conventional treatment. another limitation in this study is that sodium intake in each individual patient was not measured. in conclusion, pimobendan in combination with conventional therapy significantly prolongs the survival time after the initial onset of pulmonary edema in dogs with chf caused by mmvd.	the aim of this study was to evaluate the efficacy of pimobendan with conventional therapies on survival and reocurrence of pulmonary edema in dogs with congestive heart failure (chf) caused by myxomatous mitral valve disease (mmvd). records of 197 client - owned dogs from 14 veterinary hospitals were included in this study. dogs were administered conventional treatments with or without pimobendan. sixty - four dogs received a standard dose of pimobendan (0.200.48 mg / kg every 12 hr (q12hr)), 49 dogs received a low dose of pimobendan (0.050.19 mg / kg q12hr), and 84 dogs received conventional therapy alone. dogs in the standard - dose and low - dose pimobendan groups had significantly longer median survival times than dogs in the conventional group (334, 277 and 136 days, respectively ; p<0.001). the reoccurrence rate of pulmonary edema in the standard - dose group was significantly lower than in the low - dose and conventional groups (43%, 59% and 62%, respectively ; p<0.05). combination of pimobendan with a conventional treatment regimen significantly prolonged survival time after an initial episode of pulmonary edema in dogs with chf caused by mmvd. there was no difference in survival between dogs administered standard and low doses of pimobendan, but pimobendan did prevent the reoccurrence of pulmonary edema in a dose - dependent manner.
the -adrenergic receptor (-ar) plays an essential role in normal physiologic functions and consists of catecholamines and their corresponding receptors, including the - and -ar families. the sympathetic nervous system regulates the body 's fight or flee response through the -adrenergic pathway. increasing evidence suggests that -ar signaling is crucial in cancer progression and metastasis and regulates tumor growth, invasiveness, migration, angiogenesis, apoptosis, and anoikis. the nonselective -ar blocker propranolol has exhibited anticancer effects in cancer cell lines and animal models. the association between -ar - blocker usage and cancer outcomes has been widely studied in breast cancer, prostate cancer, ovarian cancer, melanoma, and colon cancer. the use of -ar - blockers has been demonstrated to reduce the recurrence of metastasis and mortality in most studies ; however, several population - based cohort studies have yielded inconsistent findings. whether a -adrenergic pathway is involved in the initiation of cancer several retrospective studies have demonstrated that a -ar blocker can reduce cancer risk, whereas other studies have yielded conflicting results. to clarify the association between the nonselective -ar blocker propranolol and cancer incidence, we conducted a nationwide population - based cohort study, using a substantial dataset available in taiwan. the data were extracted from the national health insurance research database (nhird), which is maintained by the national health research institute of taiwan. taiwan, which initiated the national health insurance (nhi) program in 1995 ; it covers approximately 99% of the 23.72 million taiwanese inhabitants (http://www.nhi.gov.tw/english/index.aspx). the data in this study was obtained from the longitudinal health insurance database 2000 (lhid2000), a subset of the nhird. the lhid2000, which contains all original medical claims and registration files for 1,000,000 enrollees, is derived from the medical claims records of the nhi program. the taiwan national health research institute reported that no statistically significant differences were found in the distributions of age, gender, or healthcare costs between the sample group of the lhid and all enrollees. the lhid2000 includes comprehensive information such as demographic data, dates of clinical visits, and disease diagnoses of insured people. the diagnostic codes are based on the international classification of diseases, ninth revision, clinical modification (icd-9-cm). this study was exempt from full review by the institutional review board of china medical university (cmu - rec-101 - 012) because the lhid2000 comprises deidentified secondary data released to the public for research purposes. between january 1, 2000 and december 31, 2011, we extracted data from the lhid2000 for patients who were 20 years of age and older with complete age and sex information and without a history of cancer (icd-9-cm code 140208). patients were divided into 2 cohorts according to propranolol use : a propranolol cohort, consisting of patients who underwent propranolol therapy for at least 6 months ; and a nonpropranolol cohort, consisting of patients who did not undergo propranolol therapy. we used the date on which propranolol treatment was initialized as the index date. for treatment comparison, patients taking propranolol and patients not taking propranolol were selected according to a 1:1 matching on a propensity score. the propensity score was calculated using a logistic regression to estimate the probability of the treatment assignment according to the baseline variables, including the year of receiving propranolol treatment, age, sex, charlson comorbidity index score (cci score), comorbidities of angina pectoris (icd-9-cm code 413), paroxysmal supraventricular tachycardia (icd-9-cm code 427.0), hypertensive renal disease (icd-9-cm code 403), essential tremor (icd-9-cm code 333.1), anxiety (icd-9-cm code 300.00), thyrotoxicosis without mention of goiter or other cause (icd-9-cm code 242.9), migraine (icd-9-cm code 346.90), hypertension (icd-9-cm codes 401 - 405), and medications of metformin, statin, aspirin, -blockers as well as other -blockers. metformin, statin, and aspirin have been reported to have an impact on cancer development. the confirmation of cancer (icd-9-cm codes 140195 and 200208) events was based on the registry of catastrophic illness patient database, a subset of the nhird. all subjects were followed from the index date until cancer occurred, the date of withdrawal from the insurance system, or the end of 2011. the propranolol and nonpropranolol cohorts were matched according to the propensity score. to estimate the propensity score, a logistic regression model was used, in which the propranolol status was regressed on the baseline characteristics listed in table 1. the standardized difference was used to quantify differences in means or prevalence between the 2 cohorts for continuous and categorical - matching variables. the incidence densities were calculated using sex, age, subdivision cancer, cci score, and comorbidity for each cohort. cox proportional hazard models stratifying the matched pairs were used to estimate the hazard ratio (hr) and 95% confidence intervals (cis) of cancers associated with propranolol treatment in the propranolol cohort ; the results were compared with those of the nonpropranolol cohort. all statistical analyses were performed using the sas statistical package (version 9.2 for windows ; sas institute, inc., the data were extracted from the national health insurance research database (nhird), which is maintained by the national health research institute of taiwan. taiwan, which initiated the national health insurance (nhi) program in 1995 ; it covers approximately 99% of the 23.72 million taiwanese inhabitants (http://www.nhi.gov.tw/english/index.aspx). the data in this study was obtained from the longitudinal health insurance database 2000 (lhid2000), a subset of the nhird. the lhid2000, which contains all original medical claims and registration files for 1,000,000 enrollees, is derived from the medical claims records of the nhi program. the taiwan national health research institute reported that no statistically significant differences were found in the distributions of age, gender, or healthcare costs between the sample group of the lhid and all enrollees. the lhid2000 includes comprehensive information such as demographic data, dates of clinical visits, and disease diagnoses of insured people. the diagnostic codes are based on the international classification of diseases, ninth revision, clinical modification (icd-9-cm). this study was exempt from full review by the institutional review board of china medical university (cmu - rec-101 - 012) because the lhid2000 comprises deidentified secondary data released to the public for research purposes. between january 1, 2000 and december 31, 2011, we extracted data from the lhid2000 for patients who were 20 years of age and older with complete age and sex information and without a history of cancer (icd-9-cm code 140208). patients were divided into 2 cohorts according to propranolol use : a propranolol cohort, consisting of patients who underwent propranolol therapy for at least 6 months ; and a nonpropranolol cohort, consisting of patients who did not undergo propranolol therapy. we used the date on which propranolol treatment was initialized as the index date. for treatment comparison, patients taking propranolol and patients not taking propranolol were selected according to a 1:1 matching on a propensity score. the propensity score was calculated using a logistic regression to estimate the probability of the treatment assignment according to the baseline variables, including the year of receiving propranolol treatment, age, sex, charlson comorbidity index score (cci score), comorbidities of angina pectoris (icd-9-cm code 413), paroxysmal supraventricular tachycardia (icd-9-cm code 427.0), hypertensive renal disease (icd-9-cm code 403), essential tremor (icd-9-cm code 333.1), anxiety (icd-9-cm code 300.00), thyrotoxicosis without mention of goiter or other cause (icd-9-cm code 242.9), migraine (icd-9-cm code 346.90), hypertension (icd-9-cm codes 401 - 405), and medications of metformin, statin, aspirin, -blockers as well as other -blockers. metformin, statin, and aspirin have been reported to have an impact on cancer development. the confirmation of cancer (icd-9-cm codes 140195 and 200208) events was based on the registry of catastrophic illness patient database, a subset of the nhird. all subjects were followed from the index date until cancer occurred, the date of withdrawal from the insurance system, or the end of 2011. the propranolol and nonpropranolol cohorts were matched according to the propensity score. to estimate the propensity score, a logistic regression model was used, in which the propranolol status was regressed on the baseline characteristics listed in table 1. the standardized difference was used to quantify differences in means or prevalence between the 2 cohorts for continuous and categorical - matching variables. the incidence densities were calculated using sex, age, subdivision cancer, cci score, and comorbidity for each cohort. cox proportional hazard models stratifying the matched pairs were used to estimate the hazard ratio (hr) and 95% confidence intervals (cis) of cancers associated with propranolol treatment in the propranolol cohort ; the results were compared with those of the nonpropranolol cohort. all statistical analyses were performed using the sas statistical package (version 9.2 for windows ; sas institute, inc., cary, nc). a 2-tailed p value of < 0.05 was considered statistically significant. among the 24,238 patients who were observed in this study, 12,119 had used propranolol regularly over a period of 6 months, and 12,119 had never used propranolol. the mean ages of the nonpropranolol and propranolol cohorts were 54.6 (17.7) and 52.5 years (15.6), respectively (table 1). the mean follow - up years were 6.96 (sd = 3.20) and 6.50 (sd = 3.33) for the propranolol and the nonpropranolol cohorts, respectively (data not shown). the cumulative incidence of developing cancer was lower in the propranolol cohort than it was in the nonpropranolol cohort (log - rank test : p < 0.01). table 2 shows the overall, sex-, and age - specific incidences and hrs of the 2 cohorts. the overall incidence density of cancer was significantly higher in the nonpropranolol than in the propranolol cohort (7.47 vs 5.31 per 1000 person - years). patients using propranolol exhibited a 25% reduction in the risk of cancer compared with patients not using propranolol (95% ci : 0.670.85). we selected patients who were 20 years of age and older from the lhid2000 as a cohort representing the general population and calculated the cancer incidence. the incidence rates of cancer in the general population, propranolol, and nonpropranolol cohort were 3.85, 5.31, and 7.47 per 1000 person - years, respectively. compared with the general population, the incidence rate ratios of the propranolol and nonpropranolol cohorts were 1.38 (95% ci : 1.321.44) and 1.94 (95% ci : 1.872.01). comparison of incidence and hazard ratio of cancer in the matched cohorts with propranolol treatment and without propranolol treatment stratified by sex and age the incidences were higher in men than in women in both cohorts. the hr of cancer was significantly low in both men and women in the propranolol cohort, respectively (hr : 0.79, 95% ci : 0.670.94 ; hr : 0.70, 95% ci : 0.590.84). in both cohorts, the age - specific propranolol to nonpropranolol - cohort hr of cancer was low in all age groups, and the effect was most significant in the age group 65 years (hr : 0.66 ; 95% ci : 0.550.79). compared with the patients who did not take propranolol, the patients who received propranolol treatment exhibited a significantly lower risk of cancer in the head and neck (hr : 0.58 ; 95% ci : 0.350.95), esophagus (hr : 0.35 ; 95% ci : 0.130.96), stomach (hr : 0.54 ; 95% ci : 0.300.98), colon (0.68 ; 95% ci : 0.490.93), and prostate (hr : 0.52 ; 95% ci : 0.330.83). comparison of incidence and hazard ratio of cancer types in the matched cohorts with propranolol treatment and without propranolol treatment in addition, the duration of propranolol use was associated with the reduced risk of cancer. table 4 shows the incidences of the 5 cancer types stratified according to the duration of propranolol use. the risk of head and neck, stomach, colon, and prostate cancer decreased markedly when the patients used propranolol for longer than 1000 days. incidence and adjusted hazard ratio of subdivision cancer in the matched cohorts stratified by duration of propranolol use the relevance of the -ar signaling system in cancer biology has been demonstrated in cancer cell lines and animal studies. the effects of stress are mediated mainly through activation of the cancer cell 2-ar and its downstream cell cyclic amp - protein kinase a signaling pathway. however, other studies have yielded conflicting results and not supported the proposition that -ar blockers can improve cancer outcomes. several studies have not discriminated 1-ar from 2-ar activity and categorized -ar blockers as a single pharmacologic group. in addition, 1-selective agents have replaced shorter - acting and nonselective propranolol in the treatment of common cardiovascular diseases such as hypertension. although -ar blockers are labeled according to the selectivity, they exhibit an affinity for both 1-ar and 2-ar because of the similarity between 1-ar and 2-ar. this may partly explain the results in the studies and may be consistent with the hypothesis suggested in the preclinical studies. several studies have supported the notion that -ar blockers reduce cancer risk, whereas other studies have revealed that -ar blockers do not exert an influence on cancer development. aspirin, metformin, and statins have been reported to reduce cancer risk and can confound the effects of propranolol. in the present study, we determined that propranolol could lower the risk of cancer development by 25% after adjustment of these medications. our study demonstrated that propranolol could reduce cancer risk in all age groups, particularly in the age group 65 years. therefore, this may explain why, in our study, propranolol usage reduced cancer risk obviously in patients 65 years. we determined that propranolol reduced the risk of head and neck, esophagus, stomach, colon, and prostate cancers. the protective effect of propranolol for head and neck, stomach, colon, and prostate cancers was most substantial when exposure duration exceeded 1000 days. our results are similar to those of assimes who reported a decreased risk of colorectal cancer and a slightly decreased risk of head and neck cancer as well as hematological and other gastrointestinal cancers in -ar blockers ever users. in addition, the results of perron also support our findings in prostate cancer - risk reduction. jansen reported that -ar blocker use was not associated with colorectal cancer risk, but long - term usage was associated with stage iv disease. the sample size in the stage - specific analyses was small, and the results should be interpreted with caution. the main strength of our study was the large size of the sample derived from a generally accurate nationwide database with a wide coverage, which facilitated tracing the histories of medical services and comprehensive follow - ups. the sample provided an adequate statistical power to examine the associations between propranolol and cancer risk in our study. however, our study had several limitations in addition to the limitation related to the retrospective design. first, the cancer incidence rate (per 1000 person - years) in the nonpropranol (7.47) and propranolol cohorts (5.31) were both higher than the general population (3.85). the propranolol group matched with the nonpropranolol group with comorbidity condition in order to decrease diversion. patients with comorbidities might visit physicians more often and may thus be more likely to participate in cancer screening programs, which enable early cancer detection. although matched comorbidities in both propranolol and nonpropranolol cohorts may lead to selection bias, the finding that propranolol can reduce the risk of cancers was true. second, we could not adjust the established risk factors of cancer, such as smoking, body mass index, and family history. third, it has been proposed that hypertension is a risk factor for malignancy ; therefore, it can be a confounding factor. finally, investigating the dose response relations was beyond the scope of the present study. in conclusion, this study supports the proposition that propranolol can reduce the risk of cancers, particularly head and neck, esophagus, stomach, colon, and prostate cancers. in head and neck, stomach, colon, and prostate cancer, the protective effect is most substantial when propranolol is used for a duration exceeding 1000 days.	abstract-blockers have been reported to exhibit potential anticancer effects in cancer cell lines and animal models. however, clinical studies have yielded inconsistent results regarding cancer outcomes and cancer risk when -blockers were used. this study investigated the association between propranolol and cancer risk.between january 1, 2000 and december 31, 2011, a patient cohort was extracted from the longitudinal health insurance database 2000, a subset of the taiwan national health insurance research database. a propranolol cohort (propranolol usage > 6 months) and nonpropranolol cohort were matched using a propensity score. cox proportional hazard models were used to estimate the hazard ratio (hr) and 95% confidence intervals (cis) of cancer associated with propranolol treatment.the study sample comprised 24,238 patients. after a 12-year follow - up period, the cumulative incidence for developing cancer was low in the propranolol cohort (hr : 0.75 ; 95% ci : 0.670.85 ; p < 0.001). patients with propranolol treatment exhibited significantly lower risks of cancers in head and neck (hr : 0.58 ; 95% ci : 0.350.95), esophagus (hr : 0.35 ; 95% ci : 0.130.96), stomach (hr : 0.54 ; 95% ci : 0.300.98), colon (hr : 0.68 ; 95% ci : 0.490.93), and prostate cancers (hr : 0.52 ; 95% ci : 0.330.83). the protective effect of propranolol for head and neck, stomach, colon, and prostate cancers was most substantial when exposure duration exceeded 1000 days.this study supports the proposition that propranolol can reduce the risk of head and neck, esophagus, stomach, colon, and prostate cancers. further prospective study is necessary to confirm these findings.
paroxysmal nocturnal hemoglobinuria (pnh) is an acquired clonal hematopoietic stem cell disorder characterized by a variety of clinical manifestations, including the classic triad of chronic intravascular hemolysis, thrombotic events, and bone - marrow (bm) failure. somatic mutation of x - linked gene pig - a in hematopoietic stem cells, which encodes the first essential enzyme of the glycosylphosphatidylinositol (gpi)-anchor biosynthetic pathway, results in absent or decreased cell membrane expression of all surface proteins normally anchored by it including cd55 and cd59 in all circulating cells [15 ]. the incidence of pnh - like defect has been also demonstrated in many hematological diseases [2,3,612 ] and on peripheral blood cells (pbcs) of normal individuals [1316 ]. complement system (cs) represents a fundamental part, not only of the host s innate immunity against pathogen invasion, but also of adaptive and humoral immunity [1723 ]. nevertheless, when not properly regulated, cs is recognized as having the potential to provoke severe impairment to host tissues through a process mainly mediated by autoantibodies (aab) against specific tissue antigens or non - specific immune complexes (ic) deposited in organs, like renal glomerulus known as damage to the innocent bystander [2426 ]. this has been demonstrated in autoimmune diseases, but the mechanisms have not been thoroughly explained [18,2729 ]. however, autoimmunity is also characterized by the loss of immunological tolerance, the over - activation of t - cell populations against specific antigenic epitopes and, generally, an enhanced and extensive overall immune response. multiple regulatory and inhibitory enzymes, either membrane - bound or soluble in plasma, known as complement regulatory proteins (cregs), regulate the progression of complement cascade (cc) at all levels, protecting the autologous cells. cd55 or daf (decay- accelerating factor), cd59 or mirl (membrane inhibitor of reactive lysis), cd46 or mcp (membrane cofactor protein), and cd35 or cr1 (complement receptor 1) are the 4 major membrane - bound cregs. both cd55 and cd59 are globular gpi - anchored membrane glycoproteins widely expressed in all circulating cells and most human tissues. cd55 accelerates the degradation of c3 and c5 convertases and prevents the formation of new enzymes. cd59 indeed, the pathophysiologic consequence of gpi - anchored cregs defect was initially observed in pnh, leading to an unusual sensitivity of abnormal red blood cells (rbcs) to complement lysis and subsequent intravascular hemolysis and hemoglobinuria. several studies in experimental models of autoimmune injury, such as encephalomyelitis [3537 ], glomerulonephritis, vasculitis, myasthenia gravis, rheumatoid arthritis (ra), and systemic lupus erythematosus (sle), have tried to evaluate the participation of cd55 and cd59 in the evolution of these disorders. as inflammation is not only restricted to a specific tissue, but also occurs in a systemic context, hemocytopenias may occur due to bm failure or excessive destruction of pbcs, both of which may be immune - mediated [4754 ], without disregarding the role of drug - induced toxicity. in sle, hematological involvement is frequent, while anemia (mainly due to chronic disease), and lymphopenia are the most common forms. nevertheless, the potential role of cd55 and cd59 expression on the surface of pbcs in the pathogenesis of hemocytopenias and in disease severity has been poorly elucidated. earlier studies have been mainly performed on pbcs in patients with sle [5865 ] and ra [6668 ]. the aim of this study was to evaluate the presence of cd55 and/or cd59 antigens on erythrocytes of patients with rheumatic disorders, using the sephacryl gel test microtyping system (sgt), a semi - quantitative, inexpensive, and simple method useful in screening pnh - like red - cell defect, as well as to examine possible correlation with patient demographic characteristics, clinical and complete blood count (cbc) parameters, and undergoing treatment. in this study, 113 patients with rheumatic diseases (94 females, 19 males ; median age : 64 years), who presented or were referred to our department s outpatient clinic from february 2009 to february 2013, were evaluated. the study population included 38 patients with rheumatoid arthritis (ra), 25 patients with systemic lupus erythematosus (sle), 17 patients with sjgren s syndrome (ss), 7 patients with systemic sclerosis (sc), 12 patients with vasculitis (vsc), 2 patients with dermatomyositis (drm), 1 patient with ankylosing spondylitis (asp), and 11 patients with mixed connective tissue disease (mctd). at the time of the evaluation, 86 patients underwent immunosuppressive (is) and/or immunomodulary treatment (i m), and 27 received no treatment (n). anemia (hemoglobin<12.0 g / dl) was present in 43 (38.1%) patients, neutropenia (neutrophils < 2.010/lt) in 14 (12.7%), lymphopenia (lymphocytes<1.010/lt) in 21 (18.9%), and thrombocytopenia (platelets<15010/lt) in 13 (11.6%) patients. cytopenias were further categorized in grades according to their severity (grade 0 : absence of cytopenia, grade 1 : mild cytopenia, grade 2 : moderate cytopenia, grade 3 : severe cytopenia, grade 4 : life - threatening cytopenia, grade 5 : death related to cytopenia) (table 2). the national cancer institute (nci), common terminology criteria for adverse events version 3.0 (ctcaev3.0) (publish date : august 9, 2006) was used for this purpose. one hundred and twenty - one (121) healthy blood donors of similar age and gender and 10 patients with pnh were also studied and served as control groups. the cd55- and cd59-deficient red - cell populations were detected using a commercial kit (diamed - id micro typing system - pnh test, diamed ag, switzerland). venous blood in edta - k3 was collected and suspended in low ionic strength buffer (id - diluent 2, modified liss in red cell suspension) at 0.8% (v / v). fifty microliters of the suspension were added in microtubes, on top of the sephacryl gel containing microbeads coated with rabbit anti - mouse immunoglobulin (diamed - id micro typing system pnh test), at room temperature. fifty microliters of monoclonal mouse anti - human cd55 (clone bric 216) or cd59 (clone mem 43) and id - pnh negative control (dilution buffer for anti - cd55 and anti - cd59) were added to the corresponding microtube. the microtubes were incubated at 37c for 15 minutes, centrifuged at 126 g for 10 minutes in an id - centrifuge, and the result was read after centrifugation. rbcs bearing cd55 or cd59 bind to the microbeads of the gel and remain on top of the gel (positive population). in contrast, rbcs lacking cd55 or cd59 do not agglutinate, and pellet at the bottom of the microtube (negative population). when both positive and negative populations are detected, a part of the rbcs lack the corresponding (cd55 or cd59) antigen. the red cells of pnh are characterized by the absence of cd55 and cd59 populations. in preliminary experiments using different mixtures (75%, 50%, 25%, and 10%) of the patient s red cells with compatible normal red cells, defective cd55 or cd59 populations can be detected that account for 10% or more of the red cells. all the blood samples that were used for this purpose had been tested in advance for cd55 or cd59 deficiency. the presence of the individual populations was blindly scored by 2 independent observers and expressed semi - quantitatively as 100%, 75%, 50%, 25%, and 10%. in all samples with cd55- or cd59-negative red - cell populations, ham and sucrose lysis tests were performed. the effect of the age on the existence of cd55- and/or cd59-deficient red - cell populations was evaluated using spearman s coefficient of rank correlation (rs). the impact of gender on the existence of cd55- and/or cd59-negative erythrocytic population was evaluated using the chi - square test (-test). the occurrence of cd55- and/or cd59-deficient rbcs among rheumatic disorders was calculated with chi - square test (-test). the relation between the presence or percentage of cd55 and/or cd59 deficiency and the incidence or severity of anemia, neutropenia, lymphopenia, and thrombocytopenia was examined with the chi - square test (-test) or fisher s test (when there was a small number of expected frequencies, for which chi - square is not appropriate). the variation of hematological parameters (hemoglobin, neutrophils, lymphocytes, and platelets) depending on cd55 and/or cd59 red - cell expression or cd55/cd59 phenotype was studied with one - way anova, 2wo - way anova, t - test, and mann - whitney test (when t - test was not applicable-) for unpaired measurements. the correlation between cbc parameters was examined with pearson s coefficient of rank correlation (rp), and the regression of hematological parameters by cd55% deficiency and cd59% deficiency was studied with rs and multiple linear regression. although the distribution of hemoglobin (hb), lymphocytes (lym), and platelets (plt) were approximately normal, neutrophil (neu) distribution differed significantly from normal ; thus, logarithm transformation was used to apply parametric tests. all p values were two - sided, the level of statistical significance was < 0.05, and confidence intervals (ci) refer to 95% boundaries. in this study, 113 patients with rheumatic diseases (94 females, 19 males ; median age : 64 years), who presented or were referred to our department s outpatient clinic from february 2009 to february 2013, were evaluated. the study population included 38 patients with rheumatoid arthritis (ra), 25 patients with systemic lupus erythematosus (sle), 17 patients with sjgren s syndrome (ss), 7 patients with systemic sclerosis (sc), 12 patients with vasculitis (vsc), 2 patients with dermatomyositis (drm), 1 patient with ankylosing spondylitis (asp), and 11 patients with mixed connective tissue disease (mctd). at the time of the evaluation, 86 patients underwent immunosuppressive (is) and/or immunomodulary treatment (i m), and 27 received no treatment (n). anemia (hemoglobin<12.0 g / dl) was present in 43 (38.1%) patients, neutropenia (neutrophils < 2.010/lt) in 14 (12.7%), lymphopenia (lymphocytes<1.010/lt) in 21 (18.9%), and thrombocytopenia (platelets<15010/lt) in 13 (11.6%) patients. cytopenias were further categorized in grades according to their severity (grade 0 : absence of cytopenia, grade 1 : mild cytopenia, grade 2 : moderate cytopenia, grade 3 : severe cytopenia, grade 4 : life - threatening cytopenia, grade 5 : death related to cytopenia) (table 2). the national cancer institute (nci), common terminology criteria for adverse events version 3.0 (ctcaev3.0) (publish date : august 9, 2006) was used for this purpose. one hundred and twenty - one (121) healthy blood donors of similar age and gender and 10 patients with pnh were also studied and served as control groups. the cd55- and cd59-deficient red - cell populations were detected using a commercial kit (diamed - id micro typing system - pnh test, diamed ag, switzerland). venous blood in edta - k3 was collected and suspended in low ionic strength buffer (id - diluent 2, modified liss in red cell suspension) at 0.8% (v / v). fifty microliters of the suspension were added in microtubes, on top of the sephacryl gel containing microbeads coated with rabbit anti - mouse immunoglobulin (diamed - id micro typing system pnh test), at room temperature. fifty microliters of monoclonal mouse anti - human cd55 (clone bric 216) or cd59 (clone mem 43) and id - pnh negative control (dilution buffer for anti - cd55 and anti - cd59) were added to the corresponding microtube. the microtubes were incubated at 37c for 15 minutes, centrifuged at 126 g for 10 minutes in an id - centrifuge, and the result was read after centrifugation. rbcs bearing cd55 or cd59 bind to the microbeads of the gel and remain on top of the gel (positive population). in contrast, rbcs lacking cd55 or cd59 do not agglutinate, and pellet at the bottom of the microtube (negative population). when both positive and negative populations are detected, a part of the rbcs lack the corresponding (cd55 or cd59) antigen. the red cells of pnh are characterized by the absence of cd55 and cd59 populations. in preliminary experiments using different mixtures (75%, 50%, 25%, and 10%) of the patient s red cells with compatible normal red cells, defective cd55 or cd59 populations can be detected that account for 10% or more of the red cells. all the blood samples that were used for this purpose had been tested in advance for cd55 or cd59 deficiency. the presence of the individual populations was blindly scored by 2 independent observers and expressed semi - quantitatively as 100%, 75%, 50%, 25%, and 10%. in all samples with cd55- or cd59-negative red - cell populations, ham and sucrose lysis tests the effect of the age on the existence of cd55- and/or cd59-deficient red - cell populations was evaluated using spearman s coefficient of rank correlation (rs). the impact of gender on the existence of cd55- and/or cd59-negative erythrocytic population was evaluated using the chi - square test (-test). the occurrence of cd55- and/or cd59-deficient rbcs among rheumatic disorders was calculated with chi - square test (-test). the relation between the presence or percentage of cd55 and/or cd59 deficiency and the incidence or severity of anemia, neutropenia, lymphopenia, and thrombocytopenia was examined with the chi - square test (-test) or fisher s test (when there was a small number of expected frequencies, for which chi - square is not appropriate). the variation of hematological parameters (hemoglobin, neutrophils, lymphocytes, and platelets) depending on cd55 and/or cd59 red - cell expression or cd55/cd59 phenotype was studied with one - way anova, 2wo - way anova, t - test, and mann - whitney test (when t - test was not applicable-) for unpaired measurements. the correlation between cbc parameters was examined with pearson s coefficient of rank correlation (rp), and the regression of hematological parameters by cd55% deficiency and cd59% deficiency was studied with rs and multiple linear regression. although the distribution of hemoglobin (hb), lymphocytes (lym), and platelets (plt) were approximately normal, neutrophil (neu) distribution differed significantly from normal ; thus, logarithm transformation was used to apply parametric tests. all p values were two - sided, the level of statistical significance was < 0.05, and confidence intervals (ci) refer to 95% boundaries. interestingly, only 9 out of 113 (8.0%) patients with rheumatic disorders were not observed with pnh - like rbcs, cd55(+)/cd59(+). as a result, deficient erythrocytic populations for cd55 and/or cd59 were detected in 104 (92.0%) patients (92.0% vs. 8.0%, p<0.0001). cd55 deficiency was present in 97 out of 113 patients (85.8% vs. 14.2%, p<0.0001), and cd59 deficiency was present in 54 (47.8%) out of 113 patients (47.8% vs. 52.2%, p=0.707). moreover, it was noticeable that the frequency of these populations appearance was statistically significantly higher (p<0.05) when compared to that of normal individuals, with the exception of drm and asp, in which the number of observations was very limited. there was a significant difference () (=38.0%, p<0.0001, mcnemar test) between those with cd55-negative red - cell populations and those with cd59-negative ones. indeed, no significant correlation was found between the proportions of these antigens deficiency (rs=0.122, p=0.1989). the population of erythrocytic clones with negativity in cd55 and/or cd59 antigen never surpassed 25% of the total red - cell population. the most common proportion of deficiency for both gpi - anchored proteins was 10% (cd55 : 88/113, 77.9%, cd59 : 48/113, 42.5%). in addition, neither an isolated cd59 negativity of 25%, nor a simultaneous cd55/cd59 negativity of 25% was detected. thus, 3 different pnh - like red - cell populations were present in this cohort of patients ; 1 with isolated cd55 antigen deficiency (50/113, 44.2%), cd55()/cd59(+) ; 1 with isolated cd59 antigen deficiency (7/113, 6.2%), cd55(+)/cd59() ; and 1 with concomitant deficiency of cd55 and cd59 antigens (47/113, 41.6%), cd55()/cd59() (figure 1). there was no significant difference among the patients of the 6 major in this study categories of ctd (ra, sle, ss, sc, vsc, and mctd) concerning the presence and the proportion of cd55 and/or cd59 deficiency on the surface of rbcs. the highest occurrence of pnh - like red - cell populations was noticed in patients with sle (25/25, 100%), sc (7/7, 100.0%), and vsc (12/12. the highest frequency of normal cd55/cd59 erythrocytic phenotype was in patients with mctd (3/11, 27.3%). the most common red - cell phenotypes of cd55/cd59 percentage - deficiency were 10%/0% (44/113, 42.5%) and 10%/10% (34/113, 30.1%). the first phenotype (figure 1a) was most apparent in patients with ss (9/17, 52.9%), ra (18/38, 47.4%), and sle (11/25, 44%), and the second in patients with sc (5/7, 71.4%), sle (12/25, 48.0%), and vsc (5/12, 41.7%) (figure 2b). findings on the red - cell deficiency of cd55 and/or cd59 proteins, the percentage of deficiency, the presence of different pnh - like phenotypes on rbcs of patients with rheumatic diseases, including their occurrence per disease, are shown in detail in tables 3 and 4. no difference was found regarding the presence of cd55 and/or cd59 red - cell deficiency in relation to the type of undergoing treatment, at the time of evaluation. moreover, when patients who did not receive any treatment were compared with those who underwent is and/or i m treatment, no significant heterogeneity was found concerning the presence of cd55- and/or cd59-deficient erythrocytic populations. similarly, there was no significant heterogeneity with regard to age or gender of rheumatic patients. in anemic patients, grade 1 and grade 2 of anemia were the most common forms (18.6% and 14.2%, respectively). patients with sle, ra, and sc were presented more often with anemia than others. there was no significant relation between the presence and proportion of cd55 and/or cd59 deficiency on erythrocytes, and the occurrence or grade of anemia. moreover, among the different pnh - like red - cell phenotypes, no significant difference relating to the presence or grade of anemia was detected. in neutropenic patients the most common grade was 1 (10, 9.1%). among the rheumatic disorders, mctd and sle were associated more frequently with neutropenia (4/11, 36.4% and 4/25, 17.4% respectively). there was an inverse relation (p=0.0005) between the presence of pnh - like red - cell population and the presence of neutropenia (odds ratio, or=0.078, 95%ci : 0.01780.345, p=0.0008). moreover, when the grade of neutropenia was studied in relation to the existence (or not) of pnh - like rbcs, the outcome was significant (p=0.002). this result could be partially ascribed to the relation between the presence of pnh - like erythrocytes and the absence of neutropenia (which was described before). the fact that over 50% (4 out of 7, 57.14%) of patients with normal cd55/cd59 red - cell phenotype presented with grade 1 neutropenia (or=12.67, 95%ci : 2.6825 to 59.812, p=0.0013), could be also responsible for this relation. moreover, there was no significant difference regarding the occurrence / absence or grade of neutropenia between the 3 different pnh - like erythrocytic phenotypes, even when only neutropenic patients were examined. concerning cd55 antigen, there was a significant inverse relation (p=0.0308) between its red - cell deficiency and the presence of neutropenia (or=0.209, 95%ci : 0.0580.749, p=0.0162). the significant heterogeneity of the severity of neutropenia among patients with different cd55 red - cell expression (p=0.0147) was attributed to high occurrence of non - neutropenia in those with cd55 negativity on rbcs (as in neutropenic patients) ; there was not such relation. regarding the presence and severity of neutropenia, percentage of cd55 erythrocytic deficiency demonstrated a similar behavior. although there was no significant difference when comparing 10% with 25% cd55 negativity, as well as 0% with 25%, the presence of 10% cd55-deficient rbcs is significantly associated with non - neutropenia (or=0.205, 95%ci : 0.05608 to 0.7503, p=0.0167). once again, the significant heterogeneity of neutropenia severity depending on cd55% negativity was attributed to high occurrence of non - neutropenia in patients with 10% cd55-deficient rbcs. indeed, in neutropenic patients, such a relation was not found. cd59 expression on red - cell membrane did not generally affect the presence or grade of neutropenia, but cd59 negativity was related with absence of neutropenia in patients with normal expression of cd55 (fisher s test, p=0.044)., when severity of neutropenia was examined (as in neutropenic patients), such relation was not found. vsc and mctd were the disorders with the most high frequency of lymphopenia (8/12, 66.7% and 3/11, 27.3%, respectively). neither the presence of pnh - like erythrocytes nor cd55/cd59 red - cell phenotype was proved to influence the presence of lymphopenia in this cohort of patients. cd55 antigen was not proved to have an effect on presence or severity of lymphopenia. nevertheless, significant heterogeneity was noted when percentage of cd55 negativity was studied in relation with severity of lymphopenia (p=0.0203). it could be attributed partially to the fact that 7 out of 7 patients with lymphopenia grade 3 presented with 10% cd55 negativity on their rbcs. yet, this hypothesis was not verified by fisher s test or odds ratio significance level (or=11.47, p=0.1157). however, both the presence of cd59 deficiency and the percentage of cd59-deficient erythrocytes were not proved as statistically significant factors for the presence or grade of lymphopenia. patients with ra and sle presented more frequently with thrombocytopenia (6/38, 16.2% and 4/25, 16.0%, respectively). there was no heterogeneity of thrombocytopenia in relation with presence of pnh - like red - cell populations. however, when the severity of thrombocytopenia was studied in relation with the existence (or not) of pnh - like rbcs, there was a statistically significant outcome (p=0.0042). pnh - like red - cell phenotype presented with grade 0 or grade 1 thrombocytopenia (or=17.0, 95%ci : 2.029 to 142.470, p=0.0090). in thrombocytopenic patients, there was evidence of heterogeneity when grade 1 thrombocytopenia was compared with the other scales, regarding the presence (or not) of pnh - like red - cell populations (p=0.0695). similarly, while cd55/cd59 erythrocytic phenotype did not had an effect on occurrence of thrombocytopenia, the comparison of severity of thrombocytopenia between the different pnh - like phenotypes was significantly heterogeneous (p=0.0333). once again, this was ascribed to the absence of moderate, severe, or life - threatening thrombocytopenia in patients with cd55- and/or cd59-deficient rbcs (or=0.059 95%ci : 0.00702 to 0.493, p=0.009). red - cell membrane cd55 negativity was not likely to significantly affect the presence or grade of thrombocytopenia. regarding cd59 expression, there was no significant relation with the presence or severity of thrombocytopenia. there was no significant difference of hb between patients with normal expression of cd55/cd59 antigens on their rbcs and those with deficient ones (=1.3035 g / dl, p=0.0928). however, although there was only a trend regarding the influence of pnh - like red - cell phenotype on hb concentration (f=2.874, p=0.093), cd55 antigen expression on rbcs was proved as a significant factor of influence on hb variance (f=6.092, p=0.015), while percentage of cd55% negativity demonstrated a marginal impact (f=3.040, p=0.052). as a result, there was a significant difference when the arithmetic mean of hb was compared between patients with normal expression of cd55 and those with cd55 erythrocytic negativity (=1.4534 g / dl, 95%ci : 2.6202 to 0.2866 g / dl, p=0.0151). the difference of hb between normal expression of cd55 and 10% deficiency was also significant (=1.4392 g / dl, 95%ci : 2.6356 to 0.2428 g / dl, p=0.0189), while between normal expression and 25% deficiency was marginally significant (=1.5924 g / dl, p=0.0508, mann - whitney test). no significant effect on hb was found between 10% and 25% cd55-negative red - cell populations. thus, a significant inverse correlation was found between cd55% deficiency on rbcs and hb levels (rs=0.205, p=0.0296). in contrast cd59% deficiency was not proved as a significant factor of influence on hb concentration (rs=+0.143, p=0.132). figure 3 and 4 demonstrate the scatter diagram with regression line of hb in relation to cd55% and cd59% negativity on red - cell surface, respectively. pearson s correlation coefficient (rp) was examined among different hematological parameters depending on either the presence or absence of pnh - like phenotype, or the deficiency of cd55 and/or cd59 proteins on red - cell surface. hb was not associated, in general, either with neu or lym, apart from cd55()/cd59() red - cell phenotype (rp=0.3416, p=0.0201 and rp=+0.315, p=0.0332, respectively) (table 6). figures 5 and 6 demonstrate the scatter diagram and regression line of these 2 correlations. further findings on the correlation between different cbc parameters regarding the erythrocytic deficiency of cd55 and/or cd59 proteins are depicted in table 6. among the 121 normal individuals, 2 (1.6%) had rbcs with concomitant deficiency for cd55 and cd59, while 3 (2.4%) had erythrocytes with isolated cd55 or cd59 deficiency ; these erythrocytes accounted for no more than 10% of the total red - cell population. all patients with pnh had a simultaneous cd55 and cd59 deficiency (figure 7). interestingly, only 9 out of 113 (8.0%) patients with rheumatic disorders were not observed with pnh - like rbcs, cd55(+)/cd59(+). as a result, deficient erythrocytic populations for cd55 and/or cd59 were detected in 104 (92.0%) patients (92.0% vs. 8.0%, p<0.0001). cd55 deficiency was present in 97 out of 113 patients (85.8% vs. 14.2%, p<0.0001), and cd59 deficiency was present in 54 (47.8%) out of 113 patients (47.8% vs. 52.2%, p=0.707). moreover, it was noticeable that the frequency of these populations appearance was statistically significantly higher (p<0.05) when compared to that of normal individuals, with the exception of drm and asp, in which the number of observations was very limited. there was a significant difference () (=38.0%, p<0.0001, mcnemar test) between those with cd55-negative red - cell populations and those with cd59-negative ones. indeed, no significant correlation was found between the proportions of these antigens deficiency (rs=0.122, p=0.1989). the population of erythrocytic clones with negativity in cd55 and/or cd59 antigen never surpassed 25% of the total red - cell population. the most common proportion of deficiency for both gpi - anchored proteins was 10% (cd55 : 88/113, 77.9%, cd59 : 48/113, 42.5%). in addition, neither an isolated cd59 negativity of 25%, nor a simultaneous cd55/cd59 negativity of 25% was detected. thus, 3 different pnh - like red - cell populations were present in this cohort of patients ; 1 with isolated cd55 antigen deficiency (50/113, 44.2%), cd55()/cd59(+) ; 1 with isolated cd59 antigen deficiency (7/113, 6.2%), cd55(+)/cd59() ; and 1 with concomitant deficiency of cd55 and cd59 antigens (47/113, 41.6%), cd55()/cd59() (figure 1). there was no significant difference among the patients of the 6 major in this study categories of ctd (ra, sle, ss, sc, vsc, and mctd) concerning the presence and the proportion of cd55 and/or cd59 deficiency on the surface of rbcs. the highest occurrence of pnh - like red - cell populations was noticed in patients with sle (25/25, 100%), sc (7/7, 100.0%), and vsc (12/12. the highest frequency of normal cd55/cd59 erythrocytic phenotype was in patients with mctd (3/11, 27.3%). the most common red - cell phenotypes of cd55/cd59 percentage - deficiency were 10%/0% (44/113, 42.5%) and 10%/10% (34/113, 30.1%). the first phenotype (figure 1a) was most apparent in patients with ss (9/17, 52.9%), ra (18/38, 47.4%), and sle (11/25, 44%), and the second in patients with sc (5/7, 71.4%), sle (12/25, 48.0%), and vsc (5/12, 41.7%) (figure 2b). findings on the red - cell deficiency of cd55 and/or cd59 proteins, the percentage of deficiency, the presence of different pnh - like phenotypes on rbcs of patients with rheumatic diseases, including their occurrence per disease, are shown in detail in tables 3 and 4. no difference was found regarding the presence of cd55 and/or cd59 red - cell deficiency in relation to the type of undergoing treatment, at the time of evaluation. moreover, when patients who did not receive any treatment were compared with those who underwent is and/or i m treatment, no significant heterogeneity was found concerning the presence of cd55- and/or cd59-deficient erythrocytic populations. similarly, there was no significant heterogeneity with regard to age or gender of rheumatic patients. anemia was present in 43 out of 113 patients (38%). in anemic patients, grade 1 and grade 2 of anemia were the most common forms (18.6% and 14.2%, respectively). patients with sle, ra, and sc were presented more often with anemia than others. there was no significant relation between the presence and proportion of cd55 and/or cd59 deficiency on erythrocytes, and the occurrence or grade of anemia. moreover, among the different pnh - like red - cell phenotypes, no significant difference relating to the presence or grade of anemia was detected. in neutropenic patients the most common grade was 1 (10, 9.1%). among the rheumatic disorders, mctd and sle were associated more frequently with neutropenia (4/11, 36.4% and 4/25, 17.4% respectively). there was an inverse relation (p=0.0005) between the presence of pnh - like red - cell population and the presence of neutropenia (odds ratio, or=0.078, 95%ci : 0.01780.345, p=0.0008). moreover, when the grade of neutropenia was studied in relation to the existence (or not) of pnh - like rbcs, the outcome was significant (p=0.002). this result could be partially ascribed to the relation between the presence of pnh - like erythrocytes and the absence of neutropenia (which was described before). the fact that over 50% (4 out of 7, 57.14%) of patients with normal cd55/cd59 red - cell phenotype presented with grade 1 neutropenia (or=12.67, 95%ci : 2.6825 to 59.812, p=0.0013), could be also responsible for this relation. moreover, there was no significant difference regarding the occurrence / absence or grade of neutropenia between the 3 different pnh - like erythrocytic phenotypes, even when only neutropenic patients were examined. concerning cd55 antigen, there was a significant inverse relation (p=0.0308) between its red - cell deficiency and the presence of neutropenia (or=0.209, 95%ci : 0.0580.749, p=0.0162). the significant heterogeneity of the severity of neutropenia among patients with different cd55 red - cell expression (p=0.0147) was attributed to high occurrence of non - neutropenia in those with cd55 negativity on rbcs (as in neutropenic patients) ; there was not such relation. regarding the presence and severity of neutropenia, percentage of cd55 erythrocytic deficiency demonstrated a similar behavior. although there was no significant difference when comparing 10% with 25% cd55 negativity, as well as 0% with 25%, the presence of 10% cd55-deficient rbcs is significantly associated with non - neutropenia (or=0.205, 95%ci : 0.05608 to 0.7503, p=0.0167). once again, the significant heterogeneity of neutropenia severity depending on cd55% negativity was attributed to high occurrence of non - neutropenia in patients with 10% cd55-deficient rbcs. cd59 expression on red - cell membrane did not generally affect the presence or grade of neutropenia, but cd59 negativity was related with absence of neutropenia in patients with normal expression of cd55 (fisher s test, p=0.044)., when severity of neutropenia was examined (as in neutropenic patients), such relation was not found. vsc and mctd were the disorders with the most high frequency of lymphopenia (8/12, 66.7% and 3/11, 27.3%, respectively). neither the presence of pnh - like erythrocytes nor cd55/cd59 red - cell phenotype was proved to influence the presence of lymphopenia in this cohort of patients. cd55 antigen was not proved to have an effect on presence or severity of lymphopenia. nevertheless, significant heterogeneity was noted when percentage of cd55 negativity was studied in relation with severity of lymphopenia (p=0.0203). it could be attributed partially to the fact that 7 out of 7 patients with lymphopenia grade 3 presented with 10% cd55 negativity on their rbcs. yet, this hypothesis was not verified by fisher s test or odds ratio significance level (or=11.47, p=0.1157). however, both the presence of cd59 deficiency and the percentage of cd59-deficient erythrocytes were not proved as statistically significant factors for the presence or grade of lymphopenia. patients with ra and sle presented more frequently with thrombocytopenia (6/38, 16.2% and 4/25, 16.0%, respectively). there was no heterogeneity of thrombocytopenia in relation with presence of pnh - like red - cell populations. however, when the severity of thrombocytopenia was studied in relation with the existence (or not) of pnh - like rbcs, there was a statistically significant outcome (p=0.0042). this result was attributed to the fact that 102 out of 104 patients with pnh - like red - cell phenotype presented with grade 0 or grade 1 thrombocytopenia (or=17.0, 95%ci : 2.029 to 142.470, p=0.0090). in thrombocytopenic patients, there was evidence of heterogeneity when grade 1 thrombocytopenia was compared with the other scales, regarding the presence (or not) of pnh - like red - cell populations (p=0.0695). similarly, while cd55/cd59 erythrocytic phenotype did not had an effect on occurrence of thrombocytopenia, the comparison of severity of thrombocytopenia between the different pnh - like phenotypes was significantly heterogeneous (p=0.0333). once again, this was ascribed to the absence of moderate, severe, or life - threatening thrombocytopenia in patients with cd55- and/or cd59-deficient rbcs (or=0.059 95%ci : 0.00702 to 0.493, p=0.009). red - cell membrane cd55 negativity was not likely to significantly affect the presence or grade of thrombocytopenia. regarding cd59 expression, there was no significant relation with the presence or severity of thrombocytopenia. there was no significant difference of hb between patients with normal expression of cd55/cd59 antigens on their rbcs and those with deficient ones (=1.3035 g / dl, p=0.0928). however, although there was only a trend regarding the influence of pnh - like red - cell phenotype on hb concentration (f=2.874, p=0.093), cd55 antigen expression on rbcs was proved as a significant factor of influence on hb variance (f=6.092, p=0.015), while percentage of cd55% negativity demonstrated a marginal impact (f=3.040, p=0.052). as a result, there was a significant difference when the arithmetic mean of hb was compared between patients with normal expression of cd55 and those with cd55 erythrocytic negativity (=1.4534 g / dl, 95%ci : 2.6202 to 0.2866 g / dl, p=0.0151). the difference of hb between normal expression of cd55 and 10% deficiency was also significant (=1.4392 g / dl, 95%ci : 2.6356 to 0.2428 g / dl, p=0.0189), while between normal expression and 25% deficiency was marginally significant (=1.5924 g / dl, p=0.0508, mann - whitney test). no significant effect on hb was found between 10% and 25% cd55-negative red - cell populations. thus, a significant inverse correlation was found between cd55% deficiency on rbcs and hb levels (rs=0.205, p=0.0296). cd59% deficiency was not proved as a significant factor of influence on hb concentration (rs=+0.143, p=0.132). figure 3 and 4 demonstrate the scatter diagram with regression line of hb in relation to cd55% and cd59% negativity on red - cell surface, respectively. pearson s correlation coefficient (rp) was examined among different hematological parameters depending on either the presence or absence of pnh - like phenotype, or the deficiency of cd55 and/or cd59 proteins on red - cell surface. hb was not associated, in general, either with neu or lym, apart from cd55()/cd59() red - cell phenotype (rp=0.3416, p=0.0201 and rp=+0.315, p=0.0332, respectively) (table 6). figures 5 and 6 demonstrate the scatter diagram and regression line of these 2 correlations. further findings on the correlation between different cbc parameters regarding the erythrocytic deficiency of cd55 and/or cd59 proteins are depicted in table 6. among the 121 normal individuals, 2 (1.6%) had rbcs with concomitant deficiency for cd55 and cd59, while 3 (2.4%) had erythrocytes with isolated cd55 or cd59 deficiency ; these erythrocytes accounted for no more than 10% of the total red - cell population. all patients with pnh had a simultaneous cd55 and cd59 deficiency (figure 7). the fundamental role of cs in autoimmunity is clearly reflected in the fact that genetic deficiency of c1q or c4 and other complement components is a major predisposing factor for severe sle, while s allele of cr1 has been genetically linked with this disease. the main potential mechanism includes the release of self - antigens due to failure in the regulation of complement response to apoptosis, as well as the formation of ic between aab and self - antigens against tissues, leading to activation primarily of the classic pathway. b- and t - cell hyperactivity is also present. despite the recognized contribution of cs in autologous tissues impairment and cellular damage in patients with rheumatic diseases, the role of cregs such as daf and mirl in modulating in a systemic context however, since rare gpi - negative stem cells with confirmed pig - a mutations have been described to occur even in bm of normal individuals, but without proliferating in competition with normal ones, case - reports in the literature of autoimmune disorders (such as sle and sc) associated with pnh development [7477 ] enhance the hypothesis of a possible immune - mediated bm failure in these patients, in which gpi - deficient stem cells escape from cytotoxic t - cell mediated attack, proliferate and dominate in bm. although there are few publications evaluating the expression of cd55 and cd59 on pbcs in patients with sle, ra and ss [5868 ], we believe the present study is the first to demonstrate the presence of diminished expression of cd55 and/or cd59 proteins on rbcs pnh - like red - cell populations in patients with sjgren syndrome (15/17, 88.2%), systemic sclerosis (7/7, 100%), vasculitis (12/12, 100%), dermatomyositis (1/2), ankylosing spondylitis (1/1), and mixed connective tissue disease (8/11, 72.7%). furthermore, incidence per disease in these populations was significantly higher when compared to normal individuals, with the exception of drm and asp. interestingly, only 9 rheumatologic patients did not have pnh - like red - cell populations (9/113, 8.0%), using the sgt. the size of defect for each molecule never surpassed 25% of the total erythrocytic population. the 2 most common types of concomitant cd55/cd59 percentage - deficiency were 10%/0% (48/113, 42.5%) and 10%/10% (34/113, 30.1%). yet, remarkably, the appearance of cd55-negative rbcs (97/113, 85.8%) was significantly more frequent than cd59-negative ones (54/113, 47.8%), and there was no correlation between diminished expression of these 2 cregs. initially managed to demonstrate the diminished expression of cregs, particularly that of cr1 (c3b receptor), on red - cell membrane of patients with sle, several flow - cytometric and immunofluorescence studies have evaluated the presence of daf and mirl on erythrocytes in autoimmune diseases like sle [59,60,6365 ] and ra, without determining a specific pattern of the expression of these antigens. primarily performed on a small sample of patients, they revealed a significant deficiency of these molecules either jointly or separately on rbcs, although without association with complement activity, the presence of anemia or antiphospholipid antibodies (apla) and clinical status [61,6365,68 ]. recently, in a large - sample clinical study (100 sle patients) on cregs expression on pbcs surface, alegretti. showed only a diminished expression of cd59 on rbcs, which did not seem to be associated with anemia (hb < 11gr / dl) or autoimmune hemolytic anemia (aiha), in contrast to richaud - patin.. moreover, there was a significant decrease in red - cell membrane bound mirl in patients with sle nephritis, compared to the results of arora.. it is important to mention that the number of patients in this study was far greater than in the previous ones. in addition, among cregs expression on red - cell surface, only that of cr1 was associated with complement activation, while none were related with disease activity. in our study, besides identifying the significant increased occurrence of cd55- and cd59-negative rbcs in patients with sle [with (sea) or without (sl) antiphospholipid syndrome ] compared to normal individuals, no difference was found between sl and sea patients with regard to deficiency of these antigens. moreover, our data show that this loss of expression was unrelated to the presence of anemia. concerning the expression of cd55 and cd59 on leucocytes in sle patients, it has been shown that under circumstances of hemocytopenias, the deficiency of these surface antigens was greater, while an inverse correlation between their expression and complement activation was noted. moreover, in lymphopenic patients there was a higher percentage and titers of aab (such as anti - ssa anti - dsdna), which remarkably were unrelated to cd55 and cd59 deficiency on lymphocytes. lymphopenia not only constitutes the most common hematological manifestation of sle, but it also has been related with clinical exacerbation. although it has been widely accepted the involvement of anti - lymphocyte aab in its appearance (especially igm cryoglobulins), their pathogenic significance, and their correlation with disease activity, remain controversial. in addition to functioning as complement inhibitors, cd55 and cd59 also act as signal transducers or ligands to specific cell receptors of the immune system, thus participating in lymphocyte and macrophage activation and proliferation, in modulation of antigen - presenting cells (apc) and in regulation of cytokines and proinflammatory molecule secretion. our study failed to demonstrate a significant relation between cd55 and cd59 expression on rbcs and the presence of other cell - lineages hemocytopenias. there is scientific evidence of no association between the size of pnh - like deficiency and the presence of marked cytopenias. however, a point of interest for further investigation, revealed in our study, was the description of significant positive correlation between hb and lym, only in patients with concomitant daf and mirl deficiency, as there is no such evidence in the scientific literature. interestingly, to the best of our knowledge, this is the first description of correlation between hb and proportion of cd55 deficiency on rbcs in patients with rheumatic diseases. although daf and mirl deficiency on erythrocytes seems irrelevant to the presence of anemia, our data revealed a significant difference of approximately 1.45 g / dl in hb between patients with cd55-deficient rbcs and those with normal ones. although the pathogenesis of these patients anemia was mainly considered as a result of antibody - induced damage of erythrocytes in the past, evidence to date indicates that anemia of chronic disease (acd) a mild to moderate normocytic - hypochromic anemia is the most common form in patients with autoimmune disorders. inhibiting action of inflammatory cytokines, such as interleukin-1 (il-1), tumor necrosis factor- (tnf-), interferon-, and aab against epo (anti - epo), plays a crucial role in acd pathogenesis. however, acd often coexists with anemia caused by other relatively frequent mechanisms, like iron deficiency anemia (ida), aiha, anemia of chronic renal insufficiency, and cyclophosphamide - induced myelotoxicity. the prevalence of aiha is often overestimated because of a positive direct antiglobulin test (dat) (warm type igg anti - erythrocyte aab) without real hemolysis, while deficiency of gpi - anchored proteins might be responsible for rare episodes of dat - negative hemolytic anemia by increasing the susceptibility to complement - mediated lysis. however, t - cell mediated bm failure is an additional factor that might contribute to anemia in autoimmunity. to explain the changes in the expression of these molecules on the red - cell membrane, first of all, the diminished expression of cd55 and cd59 proteins on rbcs might be due to either the impaired synthesis of the gpi anchor or the abnormal coupling of the protein to the membrane on red - cell precursors. other researchers have excluded this possibility, since different patterns of diminished expression of cregs were observed on each cell type, strongly suggesting the participation of different lineage - specific physiopathology processes. nevertheless, similar variability has been described in the pattern of expression of gpi - anchored proteins (gpi - aps) explored among different hematopoietic cell - lineage subpopulations in patients with pnh and normal individuals. moreover, hernandez - campo. reported that daf and mirl expression is highly variable among different cell - lineage populations, while the latter shows higher amounts on rbcs. thus, this parameter may partially contribute to the significant difference between cd55 and cd59 deficiency on rbcs in our cohort of patients. several studies have described up - regulation of cd55 and cd59 in tissues and nucleated cells that are exposed to complement - sustained activation, pro - inflammatory molecules, and cytokines such as c - reactive protein (c - rp), tnf-, il-1 [59,62,8284 ]. this has been considered as the effect of an adaptive response against chronic but not acute inflammatory state, associated with prolonged systematic complement activation. however, the biological function of these molecules varies, and is associated with the cell - membrane in which they are expressed. unlike leucocytes, endothelial cells, and other nucleated cells, red - cell membrane proteome changes very rarely, being quite constant towards the cell activation state. thus, we hypothesized that this deficiency on rbcs is an adaptive phenomenon that occurs due to consumption of the gpi - anchored cregs on the erythrocytic membrane, when trying to prevent complement - mediated lysis, as down - regulators of cs. previous studies generally did not demonstrate any correlation between complement activation and expression of these antigens on red - cell membrane. moreover, in this study, pnh - like rbcs never exceeded 25% of the total erythrocytic population, while the most common proportion of deficiency for both was 10%. there is scientific evidence that phenotypic alterations (mostly up - regulation) of gpi - aps on both pnh cells and normal residual pbcs of pnh patients compared to those of healthy donors, may sometimes occur independently to complement activation, affected not only by genetic abnormalities (pig - a gene mutations), but also the surrounding microenvironment. since no correlation was found among the presence or titers of several apla or anti - nuclear antibodies (ana) and cd55 or cd59 expression on pbc membrane, nor with clinical status, several authors have suggested the existence of yet undetectable aab or ic against specific cell self - antigens, which might hinder the binding of the proteins to the gpi anchorage or shed the gpi - protein complexes from the cell surface [6063,65 ]. this was doubted by the experimental evidence, since arora. observed no alteration in the expression of daf and mirl after incubating normal erythrocytes with ra patient sera whose rbcs exhibited significantly diminished expression of cd55 and cd59. in addition, the authors proposed as the cause, the spontaneous vesiculation that occurred to erythrocytes incubated with mac, whose vesicles contained daf, mirl, and cr1. or perhaps a proteolytic cleavage is generated in relation to activation of complement on erythrocyte surface by enzymatic activity, as in the phosphatidylinositol - specific phospholipase c and d. as such enzymes are specific for phosphatidylinositol, the latter hypothesis could not be corroborated by our results, due to lack of correlation between cd55 and cd59 deficiency on rbcs, as well as the significant difference between their loss of expression on red - cell membrane. in the majority of these cases, normal individuals have pnh - like clones in a very small proportion, and pig - a mutations characteristic for pnh have been identified. indeed, we found that 5 normal individuals had deficient red - cell populations for cd55 and/or cd59. similarly, the existence of pnh - like clones has been described in a very small proportion of cells prior to selection in their favor by anti - cd52 (campath-1h) administration in patients with chronic lymphocytic leukemia. according to the dual pathogenesis model, findings in bm biopsies in sle patients with hemocytopenias without undergoing any immunosuppressive treatment and the presence of aab against bm progenitor cells in rare cases of sle patients with aplastic anemia (aa), enhance the concept of a possible primary immune - mediated hematopoietic failure syndrome. thus, it suggests the presence of an immunoregulatory selection in favor of gpi - defective red - cell clones to proliferate preferentially on a microenvironment of bm autoimmunity attack, compared to normal ones, and become detectable with our methodology. none of our patients with rheumatic disease showed clinical or laboratory signs of hemolysis, and the ham and sucrose lysis tests were negative. this is possibly due to the small proportion of erythrocytes with concomitantly reduced expression of cd55/cd59. furthermore, isolated cd55 or cd59 deficiency is not able to produce homologous hemolysis. according to the international pnh interest group, subclinical pnh (pnh - sc) is defined by the presence of a small population of gpi - deficient blood cells detected in patients with different types of bm failure, who do not demonstrate clinical or laboratory signs of hemolysis,. pnh - like phenotype on rbcs using sgt ; the presence of pnh - sc patients who may have less than 1% pnh - type cells, which can be detected only by high - sensitivity flow cytometric assay, has been reported in the scientific literature. furthermore, as this assay failed to demonstrate the presence of pnh - like pbc clones in 43 patients with sle, an increase in the proportion of these clones should be considered as a characteristic of bm failure. the acquired cr1 loss of expression on erythrocytes is envisaged by many researchers to contribute significantly to the pathophysiology of many autoimmune disorders such as sle and ra, as well as to reflect the disease activity and inflammatory state. moreover, it plays an important role in the erythrocyte - mediated c3 and c4 clearance of ic from the circulation [59,98100 ]. its expression on rbcs was not assessed, but in previous studies it was significantly associated with complement activation. moreover, disease activity, complement activation, and inflammatory state were not taken into consideration. on the other hand, the use of immunosuppressive and immunoregulatory drugs may have had an impact on our outcomes, being a limiting factor in our study. despite no statistically significant relation between gpi - anchored cregs and treatment, heterogeneous and multiple treatments perplexed the manifestation of clear association between specific drugs and cregs deficiency and/or hematological parameters. undoubtedly, sgt has the disadvantage of not detecting small pnh erythrocytic clones (< 2%), as well as not evaluating the presence of cd55 and/or cd59 deficiency in other hematopoietic cell - lineages, compared to flow cytometry. however, previous studies have proven it is a useful and fairly sensitive test that can be used for screening to identify the presence of pnh red - cell populations. although our study did not sufficiently demonstrate, the clinical significance of the cd55 and/or cd59 deficiency on rbcs in rheumatologic patients, the presence of pnh - like red - cell phenotype in small proportions (mainly less than 25%), that seems to be independent from the development of anemia or other hemocytopenias, as well as the absence of clinical or laboratory signs of hemolysis, supports the hypothesis that these populations may preexist in a bm failure microenvironment owing to autoimmunity. furthermore, the disclosed unprecedented association between cd55 red - cell expression and hb levels in rheumatologic patients of this study may reflect the effect of autoimmunity on erythropoiesis, due to an immune - mediated bm failure. deeper understanding of the pathophysiologic mechanisms seems fundamental for the development of novel therapeutic approaches regarding the hematological involvement in rheumatic disorders. in patients with other types of bm failure such as myelodysplastic syndromes or aa, the detection of pnh - like clones is predictive of the response to immunosuppressive therapy. our study provides evidence supporting the presence of pnh - like erythrocytic populations in patients with rheumatic diseases. any hypothesis about the deficiency of cd55 and/or cd59 on rbcs in patients with rheumatic disorders, jointly or on its own, could be valid, and it is equally valid to believe that the process by which expression of cregs on pbcs membranes is regulated remains rather obscure. however, we provided sufficient scientific evidence that supports the pre - existence of small populations of cd55- and/or cd59-deficient clones in bm, which acquire a survival advantage to proliferate against normal hematopoietic tissue and become detectable. nevertheless, the semi - quantitative method used for the detection of cd55 and/or cd59 absence on erythrocytic membrane has the disadvantage of not demonstrating this abnormality in other cell types and not estimating these populations quantitatively. previous studies have shown that the results obtained by sgt are comparable with those obtained by flow cytometry, proving that it is a useful screening tool for the detection of such populations, as it is fairly sensitive and easy to perform. this study revealed an unprecedented relation between hb levels and daf expression on rbcs, which may reflect the contribution of autoimmunity to impaired erythropoiesis through an immune - mediated bm failure. moreover, an unusual association between hb levels and lymphocytic population, as well as between hb levels and neutrophilic population, was detected only in rheumatologic patients with concomitant deficiency of cd55 and cd59. further research using flow cytometry and other molecular techniques is required to clarify the deeper pathophysiologic processes. this could be fundamental not only for the comprehension of their role in inflammation and autoimmunity, but also for the development of novel therapies for hematological manifestations in autoimmune disorders.	backgroundcomplement has the potential to provoke severe impairment to host tissues, as shown in autoimmune diseases where complement activation has been associated with diminished cd55 and/or cd59 expression on peripheral blood cell membranes. the aim of this study was to evaluate the presence of cd55- and/or cd59-deficient erythrocytic populations in patients with different rheumatic diseases and to investigate possible correlations with clinical or laboratory parameters.material/methodscd55 and cd59 expression was evaluated in erythrocytes of 113 patients with rheumatic diseases, 121 normal individuals, and 10 patients with paroxysmal nocturnal hemoglobinuria (pnh) using the sephacryl gel microtyping system. ham and sucrose tests were also performed.resultsinterestingly, the majority of patients (104/113, 92%) demonstrated cd55- and/or cd59-deficient erythrocytes : 47 (41.6%) with concomitant deficiency of cd55 and cd59, 50 (44.2%) with isolated deficiency of cd55, and 6 (6.2%) with isolated deficiency of cd59. in normal individuals, only 2 (1%) had concomitant cd55/cd59 negativity and 3 (2%) had isolated cd55 or cd59 deficiency. all pnh patients exhibited simultaneous cd55/cd59 deficiency. positive ham and sucrose tests were found only in pnh patients. there was no association between the cd55- and/or cd59-deficient erythrocytes and hemocytopenias or undergoing treatment. however, cd55 expression significantly influenced hemoglobin values (f=6.092, p=0.015).conclusionsthis study provides evidence supporting the presence of erythrocytes with cd55 and/or cd59 deficiency in patients with rheumatic diseases. moreover, cd55 deficiency on red cells influences hemoglobin concentration. further studies using molecular techniques will clarify the exact pathophysiological mechanisms of this deficiency.
copd is associated with significant morbidity and health care costs, and though current pharmacologic treatments have modest benefits, adjunctive pulmonary rehabilitation (pr) has been shown to substantially impact patient outcomes.1,2 the minimum recommended duration of therapy for pr is 8 weeks, and successful completion of pr is associated with improvements in quality of life and dyspnea, exercise tolerance, and a decrease in the rates of exacerbations and hospitalizations.35 despite these benefits, recent studies have highlighted very poor referral rates for pr overall and as low as 10% post - hospitalization.6 of those who do attend pr, a significant percentage of patients do not complete the program with attrition rates as high as 60%.79 the documented benefits of pr necessitate accurate identification of factors associated with non - completion. prior studies have linked non - completion of pr to multiple factors including patients perceptions of their illness and attitudes toward treatment options, time constraints, and transportation problems.10,11 in addition, while pr has been shown to reduce the rate of exacerbation, one study found that individuals frequently withdrew or missed pr appointments due to copd exacerbations or hospitalizations occurring during their enrolment.4,11 while previous smaller studies have documented socioeconomic and psychosocial factors associated with non - completion, many of these are not modifiable. in addition, prior reports have not adequately examined the impact of common copd comorbidities on pr attendance.7,9,1217 we analyzed data from a large, prospective cohort of copd patients at a tertiary care hospital to systematically examine factors associated with pr attendance. specifically, we hypothesized that several modifiable factors including smoking status as well as comorbid depression and anxiety would predict completion of pr. we also hypothesized that completion of pr at our center would result in improvements in exercise capacity and quality of life comparable to prior reports. we analyzed data from a prospectively maintained database of patients who attended an outpatient pr program at the university of alabama at birmingham hospital from january 1996 to april 2013. subjects with a primary diagnosis of copd (international classification of diseases codes 491, 492, and 496) at the time of enrollment in pr were included. those with other chronic respiratory diseases such as asthma, interstitial lung disease, and bronchiectasis, and patients who had lung transplantation were excluded. baseline demographic data including smoking history, oxygen use, and comorbidities were obtained during the orientation visit prior to the initial pr session. subjects were categorized as completers and non - completers, based on attendance and participation in two to three sessions per week for at least 8 consecutive weeks, completing 20 sessions.18 after obtaining written informed consent for enrollment in the pr database, questionnaires were administered to each participant, and these questionnaires were readministered at completion of pr. dyspnea was assessed using the san diego shortness of breath questionnaire (sobq), a 24-question, self - administered questionnaire which rates dyspnea associated with activities of daily living ; a change of five units in the sobq score is considered clinically significant (minimal clinically important difference, mcid).19 health perception was assessed using the short form 36 health survey (sf-36) which has an mcid of 5.20,21 depression was assessed using the beck depression inventory (bdi)-ii, a 21-question self - reported inventory for which higher total scores indicate more severe depression and a change of five is considered the mcid.22 functional capacity was assessed using the 6-minute walk distance (6mwd) per american thoracic society guidelines.23 an mcid of 26 m was used for this study.24 dyspnea after 6-minute walk test was assessed using the rose dyspnea scale (range 04).25 results of pulmonary function test performed within 2 years prior to enrollment were abstracted from medical records. ethical approval for this analysis was obtained from the university of alabama at birmingham institutional review board (assurance number fwa00005960). pr sessions were determined by review of medical history, severity of disease, and walk test distance, and prescribed by an exercise physiologist. subjects were administered two to three sessions per week for a maximum of 36 sessions (12 weeks). exercise regimens were according to standard pr guidelines, and were supervised by certified clinical exercise physiologists.18 exercise sessions included the following : aerobic exercises such as treadmill walking, cycle, and arm ergometry ; resistance training such as machine weights, hand weights, and elastic bands ; and breathing training techniques such as diaphragmatic breathing and pursed lips breathing. regimens were individualized according to patients baseline exercise tolerance as determined by initial 6mwd as well as their subjective sense of dyspnea. a multidisciplinary team of pulmonologists, respiratory therapists, dieticians, nurses, pharmacists, and exercise physiologists provided regular and scheduled education on various topics including understanding copd, tobacco cessation counseling, respiratory medication use, nutrition, stress management, and oxygen therapy. univariate comparisons were made between pr completers and non - completers using chi - squared test for categorical variables, and two - tailed independent t - test for continuous variables. variables significantly different between the two groups with an alpha of 0.10 were included in a multivariate logistic regression model to assess independent predictors of successful completion of pr. paired t - test was used to assess impact of pr on measured outcomes such as sobq, sf-36, bdi, and 6mwd. all analyses were performed using statistical package for the social sciences (version 22.0 ; spss inc., chicago, il, usa). univariate comparisons were made between pr completers and non - completers using chi - squared test for categorical variables, and two - tailed independent t - test for continuous variables. variables significantly different between the two groups with an alpha of 0.10 were included in a multivariate logistic regression model to assess independent predictors of successful completion of pr. paired t - test was used to assess impact of pr on measured outcomes such as sobq, sf-36, bdi, and 6mwd. all analyses were performed using statistical package for the social sciences (version 22.0 ; spss inc., chicago, il, usa). fifty - two (12%) were current smokers, and 362 (82%) were former smokers. comorbidities are listed in table 1, and 104 (23.6%) had at least one comorbidity ; 200 (45.4%) and 284 (64.5%) had at least two and three comorbidities, respectively. two hundred and twenty - nine (52%) participants completed at least 8 weeks of pr. completers underwent a median of 30 sessions (interquartile range 2030), and non - completers had a median participation of seven sessions (interquartile range 311). successful completion of pr was associated with a significant improvement in a number of measured variables (table 2). 6mwd improved by 52 (73) m with 67% achieving mcid of 26 m. dyspnea post-6mwd also decreased (rose dyspnea scale 1.21.2 vs 1.61.2 ; p<0.001). bdi decreased by 3.56.9 units, and average increase in almost all components of sf-36 was greater than the mcid (table 2). tables 1 and 3 show a comparison of demographics and baseline functional indices at enrollment between completers and non - completers. there were no significant differences in age, sex, race, or body mass index, and the groups were evenly matched for indices of disease severity, comorbidities, and baseline functional capacity. compared to completers, as detailed in table 1, the two groups were evenly matched with regard to comorbid conditions. there was also no difference in baseline 6mwd, sobq, sf-36, and bdi between the two groups (table 3). both groups were equally likely to be retired or not gainfully employed (66.1% for completers vs 56.5% for non - completers ; p=0.23). compared to completers, non - completers were no more likely to be dependent and live with their family (86.9% vs 89.6% ; p=0.39). there was also no difference in the number of hospitalizations for acute exacerbation of copd in the 6 months preceding study enrollment (0.631.04 in completers vs 0.811.31 in non - completers ; p=0.11). while there was no difference in overall smoking burden between the two groups, the number of current smokers at enrollment was lower in the pr completers compared to non - completers (7% vs 17.3% ; p=0.002). though only 16 smokers completed pr, we did not detect significant difference in benefits between smokers and nonsmokers who completed pr (data not shown). on bivariate regression, completion was more likely in those with higher sf-36 pain scores at baseline, greater fev1, and lower rates of smoking at enrollment (table 4). on multivariable analyses, cigarette smoking at enrollment was the sole predictor of completion of pr (adjusted odds ratio 0.38, 95% confidence interval 0.160.90 ; p=0.02) (table 4). in this large prospective observational cohort, we found that close to half the subjects enrolled in pr did not complete therapy. the attrition rate for pr is very high despite the known benefits on quality of life, dyspnea, and exacerbation rates which are likely greater than those associated with existing pharmacotherapy.4,79 the drop - out rates are usually higher in real - world practice studies than for rehabilitation trials, and the rate of completion in our study is comparable to other large observational cohorts.9,11,12 completers showed significant improvements in multiple functional indices including exercise capacity, dyspnea scores, and quality of life. cigarette smoking at enrollment was the sole independent risk factor for non - completion of pr. while we hypothesized that underlying disease severity and comorbidities associated with copd would predict completion of pr, we found that these factors were not independently associated with success. lung function has not been shown to be a predictor of pr completion, except in the national emphysema treatment trial which included patients with very severe copd.9,26,27 our findings also indicate that baseline lung function and functional capacity do not predict adherence to and completion of pr. we advance the literature by demonstrating that common copd comorbidities also do not lead to dropout. while some studies have found baseline depression to be a predictor, a large study by harrison found no association between depression and pr non - completion.10,12,14,15,28 while we demonstrated a benefit in depression scores with completion of pr, we did not find associations between completion and either physician - diagnosed depression or baseline bdi scores. the impact of level of baseline functional capacity, either objective or perceived, is controversial. while some studies reported that lower health status and baseline dyspnea predict non - completion, most studies including ours have not found this association.9,16,26 we did not find any association between some social factors such as living alone, dependency, and employment and non - completion, and the associations with social support, travel, living alone, and education status have been inconsistent in previous studies.7,10,11,13,27,28 we found that cigarette smoking at enrollment was the sole independent predictor of non - completion of pr. this appears to be the most consistently reported finding in previous studies.7,11,16,26,2830 while cigarette smoking has been shown to result in skeletal muscle dysfunction, we did not find any interaction between continued cigarette smoking and change in 6mwd, making it unlikely that physical effects of continued smoking played a role in non - completion of pr.31 cigarette smoking more likely represents high risk health behavior linked to negative health outcomes and a lower motivation to complete therapy.32 this link with continued smoking has been noted in other studies assessing adherence to medications and cardiac rehabilitation.33,34 whether active smokers should be offered pr remains controversial as this is often perceived to be a marker of poor patient motivation and compliance, and some rehabilitation programs exclude active smokers despite evidence that rehabilitation benefits active smokers, a finding that was also seen in our study.35,36 although few programs offer smoking cessation counseling as part of rehabilitation services, continued smoking has been shown to be associated with accelerated decline in composite disease indices, and thus, counseling might be an opportunity for targeted intervention, and to improve adherence to pr.29,35,36 whether successful smoking cessation prior to or during rehabilitation improves adherence and benefit remains unknown. our study took place in an urban environment ; we had a large sample size that included patients followed prospectively in a real - world setting without restrictive inclusion and exclusion criteria, thus accounting for multiple copd comorbidities ; we included current smokers ; we included a significant number of women and african - american participants ; and we used multiple validated questionnaires to assess baseline limitations that have been shown in previous studies to be important. except for studies assessing the impact of depression, most studies that examined the question of predictors of completion were conducted outside the usa, and could be influenced by differences in health care delivery. our study has some limitations. despite being a large prospective study measuring multiple possible predictors, we could not measure numerous psychological and social factors that could be associated with non - completion such as travel, social support, income, and education. although we documented non - completion, we did not record the reasons for dropout. we had data for change in the clinical outcome variables for only the completers, and the improvements seen in the various parameters have to be interpreted with caution as this was not the primary objective of the study. successful completion of pr results in improvement in exercise capacity, dyspnea, depression, and patient perception of their health status. cigarette smoking was the sole independent predictor of unsuccessful completion of pr, and might represent a target for intervention prior to enrolment.	backgrounddespite known benefits, a significant proportion of patients with copd do not complete pulmonary rehabilitation (pr). little is known regarding which factors promote successful completion of pr.methodswe analyzed data from a prospectively maintained database of subjects with copd who attended a pr program at the university of alabama at birmingham, from 1996 to 2013. subjects were categorized as either completers or non - completers, based on successful completion of at least 8 weeks of pr. demographics and comorbidities were recorded. short form 36 health survey, beck depression inventory - ii, and san diego shortness of breath questionnaire were administered to all participants at baseline and on completion of pr to assess participants perception of their health status, severity of depression, and dyspnea with performance of activities of daily living. univariate and multivariable analyses were performed to identify predictors of successful completion of pr.resultsfour hundred and forty subjects were included, of whom 229 completed pr. forty - one percent were female, and 17% were african american. compared with non - completers, completers had greater short form 36 health survey pain score, lower forced expiratory volume in the first second, and lower beck depression inventory score, and included a lower percentage of current smokers. on multivariate analysis, cigarette smoking at enrollment was associated with lower likelihood of completion of pr (adjusted odds ratio 0.38, 95% confidence interval 0.160.90 ; p=0.02).conclusioncigarette smoking was the sole independent predictor of pr dropout, and smoking cessation may warrant greater emphasis prior to enrollment.
treatment involves excision of the accessory urethra usually through a suprapubic open approach. we report a novel use of extra peritoneal pelvic laparoscopic approach to disconnect accessory urethra from normal urethra in complete urethral duplication. a 10-year - old boy presented with stress incontinence, splaying of urinary stream, and dorsal curvature of the penis. he had an intact foreskin, which, when retracted, revealed a dorsally grooved glans with two meati : one at the tip and the other smaller one at the corona. the prepuce itself was reverse aligned with the frenulum being dorsal, as in epispadias. first surgery : cystoscopy, correction of chordee, repair of glans, rearrangement of foreskin and partial excision of the dorsal urethra. on cystoscopy, the ventral urethra, bladder neck and posterior urethra were normal. a tube passed through the dorsal urethra was seen entering the ventral urethra at the posterior urethra just opposite the veru. the dorsal accessory urethra was partially excised in the distal shaft and glans repaired to achieve a conical glans with normal coronal collar. the skin was re - arranged to give a circumcised appearance [figure 1 ]. post - operatively he passed urine through both the meati but finger occlusion of the dorsal meatus produced one stream through the normal meatus. chordee has been corrected second surgery performed after 1 year : through a suprapubic 10 mm port the prevesical space was developed with finger dissection and co2 insufflation. two 5 mm ports were inserted as shown in figure 2a (inset). in the space of retzius the accessory urethra was identified as it entered the normal urethra at the prostate. the accessory urethra was severed from the normal urethra using bipolar cautery and scissors [figure 2a ]. the distal stump of the accessory urethra was obliterated by cautery ablation of the mucosa with monopolar electrode passed through the meatus [figure 2b ]. inset shows port placement schematic diagram showing mucosal excision of the distal portion of the accessory urethra first surgery : cystoscopy, correction of chordee, repair of glans, rearrangement of foreskin and partial excision of the dorsal urethra. on cystoscopy, the ventral urethra, bladder neck and posterior urethra were normal. a tube passed through the dorsal urethra was seen entering the ventral urethra at the posterior urethra just opposite the veru. the dorsal accessory urethra was partially excised in the distal shaft and glans repaired to achieve a conical glans with normal coronal collar. the skin was re - arranged to give a circumcised appearance [figure 1 ]. post - operatively he passed urine through both the meati but finger occlusion of the dorsal meatus produced one stream through the normal meatus. chordee has been corrected second surgery performed after 1 year : through a suprapubic 10 mm port the prevesical space was developed with finger dissection and co2 insufflation. two 5 mm ports were inserted as shown in figure 2a (inset). in the space of retzius the accessory urethra was identified as it entered the normal urethra at the prostate. the accessory urethra was severed from the normal urethra using bipolar cautery and scissors [figure 2a ]. the distal stump of the accessory urethra was obliterated by cautery ablation of the mucosa with monopolar electrode passed through the meatus [figure 2b ]. inset shows port placement schematic diagram showing mucosal excision of the distal portion of the accessory urethra urethral duplications usually occur as an isolated deformity in males, the two urethra lying one behind the other in a sagittal plane. usually the normally placed ventral urethra is more functional and contains the sphincter mechanism and verumontanum. our case had an incomplete epispadic sagittal duplication as per william 's classification. however, as per effmann classification it falls into complete patent duplication type ii (a2). surgery to excise the accessory urethra has traditionally involved a combined suprapubic and penile approach to deal with the proximal end and the distal end, respectively. the key step is suprapubic disconnection of the accessory urethra from the good ventral urethra through dissection in the retropubic space. this is technically difficult due to limited space, and risk of venous bleeding from a rich prostatic venous plexus, and carries a risk of damage to the normal urethra, sphincter mechanism and the nerves. however, it would have been a major undertaking considering the length of the tract and its course between the corpora cavernosa. it would have been technically difficult to reach under the pubic bone to completely excise the distal portion. the laparoscopic pre - peritoneal approach has been used in adults for excision of benign prostatic enlargement and in partial cystectomy for bladder pheochromocytoma. the reported advantages are minimal bleeding, a reduced transfusion rate, shorter hospitalization, reduced morbidity and faster recovery.. however, the pre - peritoneal laparoscopic approach for disconnection of accessory urethra has not been described in children to the best of our knowledge. insufflations of gas then result in pressure dissection which creates more space to insert working ports. the visualization of accessory and the main urethra is easy as the view is magnified, free from bleeding and well retracted. since this is probably the first case report of such a procedure in urethral duplication, there is no available data in the literature about dealing with the stump. however, there is now sizable experience with laparoscopic pull thru for anorectal malformations with several authors leaving the stump of rectourethral fistula open with no ill effects. transfixation, suture closure and closure by an endo - loop are other options. identification of the good urethra was a key safety step. in case of difficulty	we report an extraperitoneal pelvic laparoscopic approach to disconnect accessory urethra from normal urethra in complete urethral duplication. first stage consisted of chordee correction, partial excision of the accessory urethra and glansplasty. in the second stage the remaining accessory urethra was disconnected from the normal urethra through a pre - peritoneal minimal access approach to the retropubic space. the remaining distal mucosa was ablated using monopolar cautery.
hepatitis e virus (hev) is a major cause of acute viral hepatitis in developing countries (1, 2). the viral genome is represented by a positive - sense single - stranded rna of about 7.2 kb that contains three partially overlapping open reading frames (orfs). orf1 encodes a non - structural protein with different enzymatic activities (rna - dependent rna polymerase, rna helicase, and protease), orf-2 encodes the capsid protein, and orf-3 (which overlaps orf-2) encodes a viral protein used in virion morphogenesis and release (3, 4). hev has been classified into four main genotypes [1 - 4 ] and a number of subtypes, although other new genotypes have recently been identified in various mammals (5 - 7). genotypes 1 and 2 are restricted to humans and are typically fecal - orally transmitted. genotype 1 is the main cause of sporadic and epidemic hepatitis e in developing regions of asia, africa, and south america, while genotype 2 has thus far been identified in patients in mexico, chad, and nigeria (8 - 10). genotypes 3 and 4 have been recovered from humans, pigs, and other species and are responsible for sporadic cases of hev in humans (11 - 14). hev genotype 3 has a worldwide distribution and is widespread among pigs in developed countries (3). evidence now indicates that hev-3 infection can be transmitted through the ingestion of raw or undercooked meat from infected animals, thereby highlighting the zoonotic nature of this infection (15)., hev has been found in pigs, boars, and humans (11 - 13, 17, 18). the relatively high seroprevalence of hev in domestic pigs indicates an active circulation of hev in italy (19). genotype 3 is the only genotype that has been reported in italian pigs and in wild boars (20, 21). caruso. who performed a serological and virological survey of hev in wild boar populations in northwestern italy, reported a seroprevalence of 4.9% and detected hev rna in 3.7% of liver samples, while no serum samples were positive for hev rna. phylogenetic analysis of the orf2 region revealed that the isolates were clustered within genotype 3, subtypes 3e and 3f, and were closely related to hev strains previously described in domestic pigs from the same geographic area (14). genotyping of the hev virus in association with the evolutionary rate estimate by phylogenetic analysis can aid in determining the circulation of the virus and in understanding viral evolution and the mechanism of infection. the aim of this study was to investigate the genetic diversity of hev in italy in order to obtain a more in - depth insight into the phylogenetic relationships among different strains of genotype 3, the most frequent circulating in italy, among humans and swine. an additional aim was to estimate the date of origin and the demographic history of hev circulation in italy. a total of 327 hev sequences of swine and humans from italy were downloaded from the national centre for biotechnology information (http://www.ncbi.nlm.nih.gov/). three different data sets were built : the first contained 11 sequences of hev from italy from the human orf2 capsid gene, genotype 3, plus 13 genotype - specific reference sequences. the second data set contained 65 sequences of hev from italy from the swine orf2 capsid gene, genotype 3, plus 13 genotype specific reference sequences. the third data set contained the 76 orf2 capsid gene sequences of the hev genotype 3 from humans and swine from italy. the first and the second data sets the first and the second datasets were analyzed separately, without reference sequences, to conduct a selective pressure analysis and to obtain demographic history in both humans and swine. the third data set was used to estimate the mean evolutionary rate, to perform the time - scaled phylogeny, and to obtain the demographic history. all the reference sequences were downloaded from the national centre for biotechnology information (http://www.ncbi.nlm.nih.gov/). the reference sequences were selected based on the following inclusion criteria : 1) sequences already published in peer - reviewed journals ; 2) no uncertainty about genotype / subtype assignment ; 3) sampling dates were known and clearly established in the original publication. the phylogenetic signal in a data set of aligned dna or amino acid sequences can be investigated with the likelihood mapping method by analyzing groups of four randomly chosen sequences, called quartets (22). the likelihood of each topology is estimated with the maximum likelihood method and the three likelihoods are reported as a dot in an equilateral triangle (the likelihood map). three main areas can be distinguished in the map : the three corners representing fully resolved tree topologies (i.e., the presence of a treelike phylogenetic signal in the data), the center (which represents a star - like phylogeny), and the three areas on the sides that indicate a network - like phylogeny, (i.e., the presence of recombination or conflicting phylogenetic signals). a substantial star - like signal (i.e., a star - like outburst of multiple phylogenetic lineages) is indicated by > 33% dots falling within the central area, as confirmed by extensive simulation studies. likelihood mapping analyses have been performed with the tree - puzzle program by analyzing 10,000 random quartets (22). the sequences of all datasets were aligned using clustal x and manually edited by bioedit (23). the genotype of the italian sequences was determined by phylogenetic analysis. the maximum likelihood (ml) phylogenetic tree was generated with the hky + i + g model of nucleotide substitution, using phyml v 3.0 (23, 24). the evolutionary model was chosen as the best - fitting nucleotide substitution model, based on the results of the hierarchical likelihood ratio test (hlrt) implemented in model - test software version 3.7 (25). the statistical robustness and reliability of the branching order within the phylogenetic trees was confirmed by bootstrap analysis, considering a bootstrap value > 70% as significant statistical support. the evolutionary rate and the dated tree for the third data set was co - estimated using a bayesian monte carlo markov chain (mcmc) approach that implemented the hky + i + g model and used both a strict and an uncorrelated log - normal relaxed clock model. three parametric demographic models of population growth (constant size, exponential, and expansion) and a bayesian skyline plot (bsp, a non - parametric piecewise - constant model) were compared as coalescent priors. the best fitting models were selected by means of a bayes factor (bf, using marginal likelihoods) implemented in beast v. 1.7.4 (23). in accordance with villano. (26), the strength of the evidence against h0 (null hypothesis) was evaluated as follows : 2lnbf 10 = very strong evidence. the mcmc chains were run for at least 50 million generations and were sampled every 5,000 steps. convergence was assessed by estimating the effective sampling size (ess) after a 10% burn - in, using tracer software, version 1.5 (http://tree.bio.ed.ac.uk/software/tracer/), and accepting ess values of 250 or more. uncertainty in the estimates was indicated by 95% highest posterior density (95% hpd) intervals. statistical support for specific clades the obtained tree was summarized by tree annotator (included in the beast package) by choosing the tree with the maximum product of posterior probabilities (maximum clade credibility or mcc) after a 10% burn - in. the demographic history was analyzed on the first and second dataset by performing the bayesian skyline plot. the codeml program implemented in the paml 3.14 software package (http://abacus.gene.ucl.ac.uk/software/ paml.html) was used to investigate the adaptive evolution of the hev capsid gene. the sequences alignments of the first and second dataset were used to test whether they were under positive selection. the following six models of codon substitution were used in this analysis (27) : m0 (one - ratio), m1a (nearly neutral), m2a (positive selection), m3 (discrete), m7 (beta), and m8 (beta and omega). these models are nested, so we used codon - substitution models to fit the model to the data, using the likelihood ratio test (lrt) (28). the discrete model (m3), with three dn / ds () classes, allows to vary among sites by defining a set number of discrete site categories, each with its own value. maximum - likelihood optimization allows the estimation of the and p values and the fraction of sites in the aligned data set that falls into a given category. finally, the algorithm calculates the a posteriori probability of each codon belonging to a particular site category. the m3 model was then used to designate sites with a posterior probability exceeding 90% and a value > 1.0 as being positive selection sites (29). the site rate variation was evaluated by comparing m0 with m3, while positive selection was evaluated by comparing m1 with m2. the bayes empirical bayes (beb) approach, implemented in m2a and m8, was used instead to determine the positively selected sites by calculating the posterior probabilities (p) of classes for each site (30). note that paml lrts have been reported to be conservative for short sequences (e.g., positive selection could be underestimated), although the bayesian prediction of sites under positive selection is largely unaffected by sequence length (28, 29). the dn / ds rate () was also estimated by the ml approach implemented in the program hyphy (31). in particular, the global (assuming a single selective pressure for all branches) and the local (allowing the selective pressure to change along every branch) models were compared by the likelihood ratio test (lrt). site - specific positive and negative selection were estimated by two different algorithms : the fixed - effects likelihood (fel), which fits an rate to every site and uses the likelihood ratio to test if dn = ds ; and the random effect likelihood (rel), a variant of the yang - nielsen approach (27), which assumes that a discrete distribution of rates exists across sites and allows both ds and dn to vary independently, site by site. the three methods have been described in more detail elsewhere (31, 32). sites were selected under selective pressure and our test was kept conservative by assuming a p value of 0.1 or a posterior probability of 0.9 as relaxed critical values (31). part of the analysis was conducted by using the web - based interface datamonkey (http://www.datamonkey.org/) (31). the evolutionary analysis was conducted using the reference sequence with accession number ab369687.1 (complete genome cds) to trace the exact position of the amino acids under selection. a total of 327 hev sequences of swine and humans from italy were downloaded from the national centre for biotechnology information (http://www.ncbi.nlm.nih.gov/). three different data sets were built : the first contained 11 sequences of hev from italy from the human orf2 capsid gene, genotype 3, plus 13 genotype - specific reference sequences. the second data set contained 65 sequences of hev from italy from the swine orf2 capsid gene, genotype 3, plus 13 genotype specific reference sequences. the third data set contained the 76 orf2 capsid gene sequences of the hev genotype 3 from humans and swine from italy. the first and the second data sets the first and the second datasets were analyzed separately, without reference sequences, to conduct a selective pressure analysis and to obtain demographic history in both humans and swine. the third data set was used to estimate the mean evolutionary rate, to perform the time - scaled phylogeny, and to obtain the demographic history. all the reference sequences were downloaded from the national centre for biotechnology information (http://www.ncbi.nlm.nih.gov/). the reference sequences were selected based on the following inclusion criteria : 1) sequences already published in peer - reviewed journals ; 2) no uncertainty about genotype / subtype assignment ; 3) sampling dates were known and clearly established in the original publication. the phylogenetic signal in a data set of aligned dna or amino acid sequences can be investigated with the likelihood mapping method by analyzing groups of four randomly chosen sequences, called quartets (22). the likelihood of each topology is estimated with the maximum likelihood method and the three likelihoods are reported as a dot in an equilateral triangle (the likelihood map). three main areas can be distinguished in the map : the three corners representing fully resolved tree topologies (i.e., the presence of a treelike phylogenetic signal in the data), the center (which represents a star - like phylogeny), and the three areas on the sides that indicate a network - like phylogeny, (i.e., the presence of recombination or conflicting phylogenetic signals). a substantial star - like signal (i.e., a star - like outburst of multiple phylogenetic lineages) is indicated by > 33% dots falling within the central area, as confirmed by extensive simulation studies. likelihood mapping analyses have been performed with the tree - puzzle program by analyzing 10,000 random quartets (22). the sequences of all datasets were aligned using clustal x and manually edited by bioedit (23). the genotype of the italian sequences was determined by phylogenetic analysis. the maximum likelihood (ml) phylogenetic tree was generated with the hky + i + g model of nucleotide substitution, using phyml v 3.0 (23, 24). the evolutionary model was chosen as the best - fitting nucleotide substitution model, based on the results of the hierarchical likelihood ratio test (hlrt) implemented in model - test software version 3.7 (25). the statistical robustness and reliability of the branching order within the phylogenetic trees was confirmed by bootstrap analysis, considering a bootstrap value > 70% as significant statistical support. the evolutionary rate and the dated tree for the third data set was co - estimated using a bayesian monte carlo markov chain (mcmc) approach that implemented the hky + i + g model and used both a strict and an uncorrelated log - normal relaxed clock model. three parametric demographic models of population growth (constant size, exponential, and expansion) and a bayesian skyline plot (bsp, a non - parametric piecewise - constant model) were compared as coalescent priors. the best fitting models were selected by means of a bayes factor (bf, using marginal likelihoods) implemented in beast v. 1.7.4 (23). in accordance with villano. (26), the strength of the evidence against h0 (null hypothesis) was evaluated as follows : 2lnbf 10 = very strong evidence. the mcmc chains were run for at least 50 million generations and were sampled every 5,000 steps. convergence was assessed by estimating the effective sampling size (ess) after a 10% burn - in, using tracer software, version 1.5 (http://tree.bio.ed.ac.uk/software/tracer/), and accepting ess values of 250 or more. uncertainty in the estimates was indicated by 95% highest posterior density (95% hpd) intervals. statistical support for specific clades the obtained tree was summarized by tree annotator (included in the beast package) by choosing the tree with the maximum product of posterior probabilities (maximum clade credibility or mcc) after a 10% burn - in. the demographic history was analyzed on the first and second dataset by performing the bayesian skyline plot. the codeml program implemented in the paml 3.14 software package (http://abacus.gene.ucl.ac.uk/software/ paml.html) was used to investigate the adaptive evolution of the hev capsid gene. the sequences alignments of the first and second dataset were used to test whether they were under positive selection. the following six models of codon substitution were used in this analysis (27) : m0 (one - ratio), m1a (nearly neutral), m2a (positive selection), m3 (discrete), m7 (beta), and m8 (beta and omega). these models are nested, so we used codon - substitution models to fit the model to the data, using the likelihood ratio test (lrt) (28). the discrete model (m3), with three dn / ds () classes, allows to vary among sites by defining a set number of discrete site categories, each with its own value. maximum - likelihood optimization allows the estimation of the and p values and the fraction of sites in the aligned data set that falls into a given category. finally, the algorithm calculates the a posteriori probability of each codon belonging to a particular site category. the m3 model was then used to designate sites with a posterior probability exceeding 90% and a value > 1.0 as being positive selection sites (29). the site rate variation was evaluated by comparing m0 with m3, while positive selection was evaluated by comparing m1 with m2. the bayes empirical bayes (beb) approach, implemented in m2a and m8, was used instead to determine the positively selected sites by calculating the posterior probabilities (p) of classes for each site (30). note that paml lrts have been reported to be conservative for short sequences (e.g., positive selection could be underestimated), although the bayesian prediction of sites under positive selection is largely unaffected by sequence length (28, 29). the dn / ds rate () was also estimated by the ml approach implemented in the program hyphy (31). in particular, the global (assuming a single selective pressure for all branches) and the local (allowing the selective pressure to change along every branch) models were compared by the likelihood ratio test (lrt). site - specific positive and negative selection were estimated by two different algorithms : the fixed - effects likelihood (fel), which fits an rate to every site and uses the likelihood ratio to test if dn = ds ; and the random effect likelihood (rel), a variant of the yang - nielsen approach (27), which assumes that a discrete distribution of rates exists across sites and allows both ds and dn to vary independently, site by site. the three methods have been described in more detail elsewhere (31, 32). sites were selected under selective pressure and our test was kept conservative by assuming a p value of 0.1 or a posterior probability of 0.9 as relaxed critical values (31). part of the analysis was conducted by using the web - based interface datamonkey (http://www.datamonkey.org/) (31). the evolutionary analysis was conducted using the reference sequence with accession number ab369687.1 (complete genome cds) to trace the exact position of the amino acids under selection. the phylogenetic noise of each data set was investigated by likelihood mapping (figure 1). the percentages of dots falling in the central area of the triangles were 0.9% (panel a), 3.6% (panel b), and 2.8% (panel c) for the first, second, and third data sets, respectively. none of the datasets showed more than 33% noise, so they contained sufficient phylogenetic signal. maximum likelihood phylogenetic trees of the first and second data set showed that all the sequences analyzed in this study were classified as genotype 3 (data not shown). the phylogenetic relationships among the different sequences of hev were supported by bootstrap analysis, with values > 70%. the bf analysis showed that the data were significantly better fitted with the relaxed clock than with the strict clock (2 lnbf = 56.49 for relaxed clock). the bf analysis under the relaxed clock showed that the exponential growth model was better than the other models (2lnbf > 15.736). the estimated mean value of the hev capsid gene evolutionary rate was 3.9 10 substitutions / site / year (95% hpd : 1.3 10 - 7.0 10). figure 2 shows the bayesian maximum clade credibility tree and the time of the most common recent ancestor (tmrca) estimates performed on the third data set. the root of the tree had a tmrca of 106 years, corresponding to the year 1907 (95% hpd : 1811 - 1975). the asterisks () along the branches represent significant statistical support for the clades subtending those branches (posterior probability > 0.98). human and swine sequences are indicated with different symbols next to the tips of the sequences. clade i includes 40 sequences, 35 from swine and 5 from humans, divided into two sub - clades (ia and ib). sub - clade ia dated back to the year 1973 (95% hpd : 1943 - 2001) and included two other statistically supported clusters : the first dated back to the year 1993 (95% hpd : 1972 - 2005) and the second dated back to the year 1997 (95% hpd : 1978 - 2010) and the sequences from swine and humans appeared closely related. sub - clade ib dated back to the year 1981 (95% hpd : 1951 - 2001) and included only one statistically supported cluster, which dated back to the year 2010 (95% hpd : 2007 - 2013) and consisted of only swine sequences. clade ii included 36 sequences (30 from swine and 6 from humans) divided into sub - clades (iia and iib). sub - clade iia dated back to the year 1966 (95% hpd : 1929 - 1993) and included four statistically supported clusters. the first cluster dated back to the year 1995 (95% hpd : 1985 - 2002), while the second dated back to the year 1993 (95% hpd : 1999 - 2008) and included closely related sequences from swine and humans ; the third and the fourth clusters dated back to 1996 (95% hpd : 1975 - 2009) and 1985 (95% hpd : 1963 - 1999), respectively, and included only sequences of swine origin. sub - clade iib dated back to the year 1972 (95% hpd : 1938 - 1996) and included two statistically supported clusters : the first dated back to the year 1987 (95% hpd : 1970 - 1988) and the second to the year 2006 (95% hpd : 2003 - 2007) ; in these two clusters, only three sequences were from humans. analysis of the skyline plot (figure 3a) showed that the effective number (ne) of hev infections from human and swine, analyzed together, started to grow approximatively in the early 1900s and reached a plateau in 2000. at the plateau, the epidemic stopped growing but remained at a level higher than it had been at the beginning, even though a decreasing phase, showing a typical bottleneck, was evident immediately after 2000. skyline plot analysis was also performed separately for human and swine sequences (figure 3b and c) to determine if the bottleneck evidenced in early 2000 was present in human as well as swine infections. the separated analysis demonstrated the presence of this bottleneck only in the skyline plot from the swine sequences (figure 3c). selection pressure analysis performed on the first data set (sequences isolated from human) did not reveal any positively selected sites that were statistically supported (using both hyphy and paml). the alfa parameter of the gamma distribution was 70%. the bf analysis showed that the data were significantly better fitted with the relaxed clock than with the strict clock (2 lnbf = 56.49 for relaxed clock). the bf analysis under the relaxed clock showed that the exponential growth model was better than the other models (2lnbf > 15.736). the estimated mean value of the hev capsid gene evolutionary rate was 3.9 10 substitutions / site / year (95% hpd : 1.3 10 - 7.0 10). figure 2 shows the bayesian maximum clade credibility tree and the time of the most common recent ancestor (tmrca) estimates performed on the third data set. the root of the tree had a tmrca of 106 years, corresponding to the year 1907 (95% hpd : 1811 - 1975). the asterisks () along the branches represent significant statistical support for the clades subtending those branches (posterior probability > 0.98). human and swine sequences are indicated with different symbols next to the tips of the sequences. clade i includes 40 sequences, 35 from swine and 5 from humans, divided into two sub - clades (ia and ib). sub - clade ia dated back to the year 1973 (95% hpd : 1943 - 2001) and included two other statistically supported clusters : the first dated back to the year 1993 (95% hpd : 1972 - 2005) and the second dated back to the year 1997 (95% hpd : 1978 - 2010) and the sequences from swine and humans appeared closely related. sub - clade ib dated back to the year 1981 (95% hpd : 1951 - 2001) and included only one statistically supported cluster, which dated back to the year 2010 (95% hpd : 2007 - 2013) and consisted of only swine sequences. clade ii included 36 sequences (30 from swine and 6 from humans) divided into sub - clades (iia and iib). sub - clade iia dated back to the year 1966 (95% hpd : 1929 - 1993) and included four statistically supported clusters. the first cluster dated back to the year 1995 (95% hpd : 1985 - 2002), while the second dated back to the year 1993 (95% hpd : 1999 - 2008) and included closely related sequences from swine and humans ; the third and the fourth clusters dated back to 1996 (95% hpd : 1975 - 2009) and 1985 (95% hpd : 1963 - 1999), respectively, and included only sequences of swine origin. sub - clade iib dated back to the year 1972 (95% hpd : 1938 - 1996) and included two statistically supported clusters : the first dated back to the year 1987 (95% hpd : 1970 - 1988) and the second to the year 2006 (95% hpd : 2003 - 2007) ; in these two clusters, only three sequences were from humans. analysis of the skyline plot (figure 3a) showed that the effective number (ne) of hev infections from human and swine, analyzed together, started to grow approximatively in the early 1900s and reached a plateau in 2000. at the plateau, the epidemic stopped growing but remained at a level higher than it had been at the beginning, even though a decreasing phase, showing a typical bottleneck, was evident immediately after 2000. skyline plot analysis was also performed separately for human and swine sequences (figure 3b and c) to determine if the bottleneck evidenced in early 2000 was present in human as well as swine infections. the separated analysis demonstrated the presence of this bottleneck only in the skyline plot from the swine sequences (figure 3c). selection pressure analysis performed on the first data set (sequences isolated from human) did not reveal any positively selected sites that were statistically supported (using both hyphy and paml). the alfa parameter of the gamma distribution was < 1 and showed a characteristic l - shape, which suggested a nucleotide substitution rate heterogeneity across sites but with most sites highly conserved. regarding the selective pressure analysis on the first data set, the average ratio ranged from 0.0083 to 0.0086 among all models, suggesting that a non - synonymous mutation had around 0.83% - 0.86% as much chance as a synonymous mutation of being fixed in the population. negatively selected sites are numbered according to the amino acid position of the capsid protein of hev isolate accession number ab369687.1 similarly, selective pressure analysis performed on the second data set (sequences isolated from swine) showed that the alfa parameter of the gamma distribution was < 1, indicating that this distribution also had a characteristic l - shape, suggesting a nucleotide substitution rate heterogeneity across sites. the average ratio ranged from 0.0339 to 0.0389 among all models, which suggested that a non - synonymous mutation had only around 3.39% - 3.89% as much chance as a synonymous mutation of being fixed in the population. the capsid protein of the second data showed negative selection : specifically, 80 statistically supported, negatively selected sites were identified by hyphy (table 2). negatively selected sites are numbered according to amino acid position of capsid protein of hev isolate accession number ab369687.1 hev infection is a global cause for morbidity and mortality. besides endemic infections, autochthonous infections in developed countries are frequent (33). the transmission route is one of the most discussed issues about hev, and marked differences are observed in different geographical areas. in developed countries, two main transmission routes are described : the fecal - oral route associated with genotypes 1 and 2 transmission and the transmission route through the ingestion of raw meat of infected animals, associated with genotypes 3 and 4 transmission (34). this study analyzed the phylogenetic relationships among different strains of hev genotype 3, circulating in italy between humans and swine, to estimate the date of origin, the spread, and the demographic history of the hev epidemic in italy. our estimate of capsid gene evolutionary rate was 1.8 10 substitutions / site / year, with a broad credibility interval (between 1.2 10 and 5.0 10) that is similar to the value reported by other authors (34). based on this temporal reconstruction, we suggest that the hev genotype 3 strains circulating in italy in the first decade of 1900 diverged into the two main clades i and ii, which include the subclades ia, ib, and iia, iib, respectively, which originated between 1966 and 1981. interestingly, all swine sequences cluster together, except in some cases where they are intermixed with human sequences, as expected. skyline plot analysis was performed globally as well as separately for human and swine sequences. the separate analysis revealed the presence of a bottleneck after the year 2000 but only in the swine sequence data set. this could be due to swine slaughter, which consequently decreased the the number of swine infections registered. these data could suggest that the control of hev infection depends on adequate measures of prevention to avoid infection of farmers through contact with swine meat and the consequent spread of the virus among humans. selective pressure analysis was also used to investigate the presence of sites under negative and positive selection. an average ratio < 1 was found in both the human and swine italian orf2 capsid gene sequence datasets, and only statistically supported negatively selected sites were identified ; this finding confirms the stability of this viral protein. the hev evolution, until now, has been characterized by neutral genetic drift. more studies are needed to examine zoonotic transmission and subsequent spillover into human populations, which would better explain the spread and the bottlenecks observed in swine in different hev epidemics. overall, continued genomic surveillance of the hev human and animal infection is required to assess adaptability and selection, which is increasingly important on the verge of an eventual vaccine deployment. in conclusion, this study contributes to the hypothesis that humans are probably infected with hev after contact with swine sources. this emphasizes the importance of checking the swine country of origin and improving sanitary control measures in order to prevent the spread of hev infection in italy.	backgroundhepatitis e virus (hev), a major cause of acute viral hepatitis in developing countries, has been classified into four main genotypes and a number of subtypes. new genotypes have been recently identified in various mammals, including hev genotype 3, which has a worldwide distribution. it is widespread among pigs in developed countries.objectivesthis study investigated the genetic diversity of hev among humans and swine in italy. the date of origin and the demographic history of the hev were also estimated.materials and methodsa total of 327 hev sequences of swine and humans from italy were downloaded from the national centre for biotechnology information. three different data sets were constructed. the first and the second data set were used to confirm the genotype of the sequences analyzed. the third data set was used to estimate the mean evolutionary rate and to determine the time - scaled phylogeny and demographic history.resultsthe bayesian maximum clade credibility tree and the time of the most common recent ancestor estimates showed that the root of the tree dated back to the year 1907 (95% hpd : 1811 - 1975). two main clades were found, divided into two subclades. skyline plot analysis, performed separately for human and swine sequences, demonstrated the presence of a bottleneck only in the skyline plot from the swine sequences. selective pressure analysis revealed only negatively selected sites.conclusionsthis study provides support for the hypothesis that humans are probably infected after contact with swine sources. the findings emphasize the importance of checking the country of origin of swine and of improving sanitary control measures from the veterinary standpoint to prevent the spread of hev infection in italy.
the progressive loss of height in a motion segment coupled with subluxation of the facet joints leads to changes in biomechanical forces and hypertrophy of the ligamentum flavum and spondylophyte formation around the facet joints. together the combination of a loss of height in the intervertebral space and the apposition of osseous and ligamentary structures result in progressive compression of the nerves passing through affected canals. this compression can be exacerbated by bulging - disc syndrome and spondylophytes in the vertebral endplates. the clinical symptoms are low back and radicular lower - limb pain and intermittent spinal claudication. this cascade of anatomical and pathological anomalies most frequently occur in the lower lumbar region, especially segments l3/4, l4/5, and l5/s1. if conservative therapy fails, operative treatment, that is, segment decompression has to be considered. however, a satisfactory surgical outcome requires the indication for a specific surgical intervention preceded by differentiated diagnostics and accurate identification of the motion segment in question. today, diagnosis of neuroforaminal stenosis or spinal stenosis relies on radiologic upright imaging on 2 levels as well as magnetic resonance tomography (mri). as an alternative to mri, computed tomography (ct) in combination with a myelography can be performed, however, due to its invasiveness and radiation exposure, mri has become the diagnostic gold standard. a drawback of conventional mri imaging is the fact that images are taken in supine position and can therefore not directly display aforementioned dynamic anomalies. the dynamics in spinal - column width in patients suffering spinal canal stenosis while moving from a supine to a standing position were illustrated by zander and lander. this phenomenon correlates well with clinical findings in these patients, as they frequently report decreased pain, when changing from standing to supine position. however, gravity 's effect on neuroforamen in the presence of degenerative spondylolysis in the lower lumbar region has attracted little attention, so far. many radiologic images (both ct and mri) of patients suffering from stenosis of the spinal canal fail to reveal any pathology. this fact underlines the need for additional diagnostic procedures, that enable us to visualize these effects. the possibility of dynamic radiological examinations with the upright mri can close this diagnostic gap. previous investigations of spinal canal imaging under a load are mostly cadaver studies. there is a paucity of in vivo data on structural changes in the lumbar spine, and those that do exist only address specific anatomic structures. the aim of this study was therefore the radiological evaluation of the diameter of the lumbar neuroforamen, the diameter of the spinal canal, the translation of the vertebral bodies, and the angle of the vertebral bodies, that is, of l5/s1 in 3 different positions. all were scheduled for transforaminal lumbar interbody fusion (tlif) l5/s1 after having been diagnosed with degenerative spondylolisthesis l5/s1 via conventional x - ray, segment infiltration, and probatory corset. a dynamic mri in 3 different body positions (at 0 supine, 80 upright, and 80 upright + hyperlordosis posture) was taken using a 0.25 t open - configuration scanner (g - scan, esaote, genoa, italy) equipped with a rotatable examination bed allowing a true standing mri (figure 1a and b). gradient supports 20 mt / m with a slew rate of 25 mt / m / ms. sagittal mr examinations included a 2d fse t2 sequence (tr = 3350 ms, te = 120 ms, fov = 310 310 mm, m = 224 208, th = 4 mm, ta = 528) and a 3d hyce (balanced steady state sequence, tr = 10 ms, te = 5 ms, fov = 290 290 100 mm, m = 232 206 28, ta = 529). (a + b) dynamic mri in supine (0) and weight bearing (80) positions with a volunteer. images taken during these different positions were quantitatively evaluated by measuring the diameter of the neuroforamen and that of the spinal canal at the level of l5/s1. the medical image viewer impax, agfa healthcare was used for standardized reorientation of the images (figure 2). this was done to avoid measurement errors due to partial volume effects caused by differences in the patients positioning. measurement of the neuroforaminal diameter l5/s1 in weight bearing (80) position with standardized reorientation of the images. in the sagittal view, the slice was oriented along the ground plate of l5. in the axial view comparative measurements of the spinal canal volume, spinal canal diameter, the neuroforaminal diameter and its area were taken in all the prescribed patient positions. moreover, intervertebral body translation and the lordosis angle were calculated (figure 3). measurement of the intervertebral body translation l5/s1 in supine (0) position with standardized reorientation of the images. for statistical evaluation for statistical evaluation we employed spss for mac (version 22, spss, inc., chicago, il). the mean diameter of the neuroforamen at l5/s1 in 0 position was 8.4 1.6 mm on the right and 8.8 1.8 mm on the left, in 80 position 7.3 1.4 mm on the right and 7.2 1.8 mm on the left, and in 80 position with hyperlordosis 6.6 1.5 mm (p < 0.05) on the right and 6.1 1.6 mm on the left (p < 0.001) (figure 4a + b). (a + b) mean diameter and standard deviation (error bar) of the neuroforamen at l5/s1 in supine (0), weight bearing (wb) and hyperlordosis (wb+) position (p < 0.005). the mean area of the neuroforamen at l5/s1 in 0 position was 103.5 22.2 mm on the right and 105.0 25.8 mm on the left, in 80 position 92.5 27.9 mm on the right and 94.8 38.1 mm on the left, and in 80 position with hyperlordosis 81.9 28.5 mm on the right and 90.2 31.1 mm on the left. the mean volume of the spinal canal at the l5/s1 level in 0 position was 9770 3900 mm, in 80 position 10600 3900 mm, and in 80 position with hyperlordosis 9414 4700 mm. the mean intervertebral translation at level l5/s1 was 8.3 4.4 mm in 0 position, 9.9 4.9 mm in 80 position and 10.1 5.1 mm in the 80 position with hyperlordosis. the lordosis angle at level l5/s1 was 49.4 11.3 in 0 position, 55.8 13.3 in 80 position, and 64.7 mm 16.3 in the 80 position with hyperlordosis. the main findings of the present study are that significant narrowing of the neuroforaminal diameter develops during the change from a lying to standing position or to a standing position with hyperlordosis. this effect can be displayed in a upright mri and should be included into diagnostics of chronic lower back pain. segmental instability in the spinal column is defined as an anterior posterior translation of the opposing vertebrae by more than 3 mm, whereby a translation exceeding 3 mm is considered pathological and is associated with lower back pain and sciatica. patients suffering from a degenerative spinal disease such as spondylolisthesis complain of worsening pain when standing for a long time or carrying a load ; this is because of a worsening of an existing spondylolisthesis in an upright position. nevertheless, the imaging procedures performed to visualize a known spinal anomaly such as mri or ct are usually carried out with the patient in supine position. as lumbar lordosis is reduced in supine position, the patient 's lumbar pain also tends to lessen. our data confirm the surveillance that lumbar lordosis diminishes when moving from a standing to lying position. radiologic imaging of the spinal column in an upright position enables functional assessment under an axial load. here too, our data confirm the assumption that an increasing axial load on the spinal column leads to a reduction in spinal canal volume and to progressive listhesis of the lumbar vertebrae. we were surprised to observe that changing from a supine position to an 80 upright stance triggered an initial expansion in the spinal canal at the l5/s1 level. a repeated change in position to an 80 upright stance in conjunction with lumbar hypomochlion, however, led to a reduction in spinal canal volume. this reveals that the pain experienced by patients with hyperlordotic spondylolisthesis can be aggravated by an increasing load on the facet joints, as well as by a worsening 360 restriction of the spinal canal. depending on its stage and the amount of pain it causes, treatment for bony decompression is clinical routine nowadays in patients suffering from a spinal canal stenosis caused by spondylolisthesis a randomized, double - blind trial by audat examining clinically symptomatic patients suffering from meyerding stage 1 and 2 spondylolisthesis demonstrated that the outcome of patients who had undergone fixation versus decompression in the affected motion segment were nearly identical, whether the sliding vertebrae had been repositioned or not. due to the more beneficial biomechanical relationships within the spinal motion segment created thereby, other authors recommend repositioning. as a study comparing the sagittal alignment of the spinal column in patients presenting spondylolysis and spondylolisthesis with a normal control group 's sagittal alignment revealed, patients with spondylolysis and spondylolisthesis present exacerbated lumbar lordosis, which in turn alters the biomechanics in the spinal column and facet joints. the sliding vertebrae in conjunction with spinal - cord decompression should create expansion in the spinal cord. considering other spinal column structures and their behavior in association with degenerative diseases, several experimental cadaver studies employing mri and ct come to mind. these specifically examined the effect of a load on spinal - column structures and the related anatomical changes in the neuroforamen. these in vitro cadaver investigations demonstrated in lumbar spinal - column segments that a load on the spinal column caused by axial rotation, extension, or lateral deflection leads to the constriction of neural pathways that does not occur when there is no load. this effect also applies to the diameter of the neuroforamen and its corresponding volume. also apparent is that the effect of increasing constriction in the neuroforamen is much worse at l4/5 than at l5/s1 when changing from a supine to standing position. our investigation has demonstrated that the change from a supine to an 80 upright position results in worsening lumbar lordosis, which in turn exacerbates lumbar hypomochlion. a certain degree of lumbar lordosis is needed, as it enables impacts affecting the discs to be absorbed and deflected. specifically, the effect of lordosis is that it creates increased pressure on the dorsal parts of the disc and thus to ventral displacement of gel - like elements such as the nucleus pulposus, thereby preventing the disc from slipping in a dorsal direction. considering the spinal column 's dorsal structures, it again becomes clear how relevant the change in position from a supine to upright position is. the shear forces occurring in an upright position are absorbed primarily by the facet joints, whereas the facet joints absorb just 16% of the compression forces affecting the spinal column. disc degeneration and the discs accompanying loss of height can raise the facet joints compression load up to 70%, eventually causing the facet joints to degenerate and leading to facet - joint arthrosis, which in turn plays a major role in constricting the adjacent neuroforamen. this study provides an investigation of the dynamic structures of the lumbar spine in 3 different body positions. in our point of view, the gathered information is essential to understand and evaluate the pathogenesis of degenerative diseases of the spine. nevertheless, some limitations need to be recognized ; at first, the number of investigated subjects is limited. moreover, we could demonstrate significant changes in the neuroforaminal diameter that allow to draw conclusions conclude to general public of. however, further investigations on intervertebral translation and the impact on positioning on the spinal canal volume should be carried out in a bigger population. moreover, upright mri was carried out in 80 not in 90. the quasi full up - right position was chosen as the overlordosis position was not possible in the full 90 upright position as we wanted the patients to stand naturally and not to be binded against the patients bed of the scanner. last but not least, investigations were carried out at low field. therefore spatial resolution is lower compared to the high - field environment. however, weight - bearing mri of the spine is so far not possible at high - field. moreover several studies could show that with careful adjustment of slice orientation and sequence design high accuracy during functional mri of the musculoskeletal system can be achieved. pathologies of the spinal column like spinal canal stenosis or (degenerative) spondylolisthesis are subject to dynamic processes that can be displayed in upright mri by positioning the patient dynamically. the range of anomalies is clinically relevant, and dynamic positioning of the patient during upright mri can provide essential diagnostic information to the physician that is not attainable with other methods. we consider upright mri to be superior to supine mri for diagnosing degenerative spinal cord diseases.	abstractspinal canal stenosis is a dynamic phenomenon that becomes apparent during spinal loading. current diagnostic procedures have considerable short comings in diagnosing the disease to full extend, as they are performed in supine situation. upright mri imaging might overcome this diagnostic gap.this study investigated the lumbar neuroforamenal diameter, spinal canal diameter, vertebral body translation, and vertebral body angles in 3 different body positions using upright mri imaging.fifteen subjects were enrolled in this study. a dynamic mri in 3 different body positions (at 0 supine, 80 upright, and 80 upright + hyperlordosis posture) was taken using a 0.25 t open - configuration scanner equipped with a rotatable examination bed allowing a true standing mri.the mean diameter of the neuroforamen at l5/s1 in 0 position was 8.4 mm on the right and 8.8 mm on the left, in 80 position 7.3 mm on the right and 7.2 mm on the left, and in 80 position with hyperlordosis 6.6 mm (p < 0.05) on the right and 6.1 mm on the left (p < 0.001).the mean area of the neuroforamen at l5/s1 in 0 position was 103.5 mm2 on the right and 105.0 mm2 on the left, in 80 position 92.5 mm2 on the right and 94.8 mm2 on the left, and in 80 position with hyperlordosis 81.9 mm2 on the right and 90.2 mm2 on the left.the mean volume of the spinal canal at the l5/s1 level in 0 position was 9770 mm3, in 80 position 10600 mm3, and in 80 position with hyperlordosis 9414 mm3.the mean intervertebral translation at level l5/s1 was 8.3 mm in 0 position, 9.9 mm in 80 position, and 10.1 mm in the 80 position with hyperlordosis.the lordosis angle at level l5/s1 was 49.4 in 0 position, 55.8 in 80 position, and 64.7 mm in the 80 position with hyperlordosis.spinal canal stenosis is subject to a dynamic process, that can be displayed in upright mri imaging. the range of anomalies is clinically relevant and dynamic positioning of the patient during mri can provide essential diagnostic information which are not attainable with other methods.
shivering, a common post - anaesthesia occurrence is defined as an involuntary, repetitive activity of skeletal muscles. the incidence of shivering has been found to be quite high, approximately 40 - 50% in different studies. shivering also increases intraocular and intracranial pressure, and may contribute to increased wound pain, delayed wound healing, and delayed discharge from post - anaesthetic care. apart from being an uncomfortable experience, its deleterious effects deserve primary prevention and rapid control on occurrence. shivering is a physiological response to core hypothermia in an attempt to raise the metabolic heat production. the main causes of intra / post - operative shivering are temperature loss, increased sympathetic tone, pain, and systemic release of pyrogens. spinal anaesthesia significantly impairs the thermoregulation system by inhibiting tonic vasoconstriction, which plays a significant role in temperature regulation. it also causes a redistribution of core heat from the trunk (below the block level) to the peripheral tissues. the non - pharmacological management is by external heating like the use of forced air warming, warming blankets, warmed fluids etc., according to the results of a meta - analysis, the most frequently reported pharmacological interventions include clonidine, pethidine, tramadol, nefopam and ketamine. unfortunately, no gold standard treatment is known for shivering as the administration of all the available drugs is associated with various adverse effects. during the last decade, tramadol has become a favoured and commonly used drug for post - spinal anaesthesia shivering. however, it has many adverse effects like nausea, vomiting, dizziness etc., which cause further discomfort to the patient. various studies, which have been conducted to compare them have concluded that clonidine has better efficacy and less adverse effects as compared to tramadol. it has been used as a sedative agent and is known to reduce the shivering threshold. few studies which have explored its anti - shivering potential have inferred that dexmedetomidine is an effective drug without any major adverse effect and provides good haemodynamic stability. hence, we planned to do a comparative study of the efficacy, haemodynamic, and adverse effects of tramadol and dexmedetomidine when used for the control of post - spinal anaesthesia shivering. this was a prospective, randomised, double - blind study, which was conducted at a tertiary care centre after taking approval from institutional ethics committee. 50 american society of anaesthesiologists (asa) grade i and ii consenting patients of either gender aged 18 - 65 years scheduled for elective as well as emergency lower abdominal, lower limb, orthopaedic and plastic surgeries under spinal anaesthesia were included in the study. patients with known hypersensitivity to dexmedetomidine or tramadol, cardio - pulmonary, renal or hepatic disease, hyperthyroidism, psychiatric disorder, urinary tract infection, severe diabetes or autonomic neuropathies, known history of substance or alcohol abuse, patients receiving any pre - medication were not included in the study. all patients who fulfilled the inclusion criteria and developed post - spinal anaesthesia shivering were enrolled and randomised using computer generated chart with allocation ratio of 1:1 into either of the two groups. group d (n = 25) were administered dexmedetomidine 0.5 g / kg intravenous (iv) and group t (n = 25) received tramadol 0.5 mg / kg iv as per randomisation by index anaesthesiologist (not a part of the study) who prepared either of the drugs, at the onset of shivering (detailed below). the anaesthesiologist conducting the case as well as recording the data were unaware of the drug being administered. upon arrival in the operation theatre, an 18 g venous cannula was inserted and preloading done with ringer 's lactate solution 10 ml / kg before giving spinal anaesthesia and maintained at 6 ml / kg / h after spinal anaesthesia. before starting the procedure, standard monitors were attached and all the baseline parameters such as heart rate (hr), non - invasive blood pressure (nibp), oxygen saturation (spo2), electrocardiography (ecg), and body temperature (axillary) were recorded. subarachnoid anaesthesia was administered with 0.5% heavy bupivacaine (15 mg) at l3 - 4 or l4 - 5 interspace using 26 g quincke 's spinal needle under aseptic conditions. supplemental oxygen was administered to all the patients at the rate of 5 l / min with face mask and patients were covered with drapes but not actively warmed. vital parameters such as hr, nibp, and spo2 were recorded at intervals of every 5 min for first 30 min and every 15 min for the rest of the observation period. : grade 0 : no shivering, grade 1 : one or more of the following : piloerection, peripheral vasoconstriction, peripheral cyanosis, but without visible muscle activity, grade 2 : visible muscle activity confined to one muscle group, grade 3 : visible muscle activity in more than 1 muscle group and grade 4 : gross muscle activity involving the whole body. the drugs were diluted to a volume of 5 ml in a 5 ml syringe and presented as coded syringes as per randomisation list by an anaesthesiologist who was not aware of the group allocation. the attending anaesthesiologist recorded the time in minutes at which shivering started after spinal anaesthesia (onset of shivering), severity of the shivering, time to the disappearance of shivering and response rate (shivering ceasing within 15 min after treatment). duration of surgery was recorded and duration of spinal anaesthesia was noted by assessing spontaneous recovery of sensory block using the pin - prick method and observing spontaneous movements of limbs in the post - operative period. there was recurrence of shivering, patients were treated with an additional dose of dexmedetomidine (0.5 g / kg iv) or tramadol (0.5 mg / kg iv) in the respective groups. adverse effects such as nausea, vomiting, bradycardia (20% of baseline), dizziness ; and sedation score were noted. the degree of sedation was graded on a four point scale as per filos. : grade 1 : awake and alert, grade 2 : drowsy, responsive to verbal stimuli, grade 3 : drowsy, arousable to physical stimuli, grade 4 : unarousable. nausea and vomiting were treated with injection metoclopramide 10 mg iv as and when required. power analysis was based on the detectable difference between the means of time taken for cessation of post - spinal shivering after treatment with dexmedetomidine or tramadol = 180 s. with a standard deviation (sd) of 180 s considering = 0.05 and power of 90% (two - tailed test), sample size calculated to be 21.02 patients per group. to increase the power of study we enrolled 25 patients per group. numerical data were presented as mean sd and categorical data as proportions (%). the comparison of the mean levels of all variables between two groups was made by the unpaired t - test. p value was calculated, and p < 0.05 was considered to be statistically significant. in the present study, a total of 50 patients out of 69 consecutive patients met the inclusion criteria and consented for study. these 50 patients were randomized into two groups of 25 each. out of the total patients, 25 were male, and 25 were female. as it was an intra - operative study, no patient was lost to follow - up [figure 1 ]. patient flow (according to consort chart) both groups were comparable with respect to age, gender, asa grade, duration of surgery and the duration of spinal anaesthesia. duration of spinal anaesthesia ranged from 90 min to 150 min [table 1 ]. there was no statistically significant difference in time for the onset of shivering between the two groups. however, the difference in the time interval between administration of drug after the onset of shivering and cessation of shivering was significantly shorter in the dexmedetomidine group when compared to tramadol group. there was recurrence of shivering in 1 patient in dexmedetomidine group and 2 patients in tramadol group. the patients were given rescue doses of dexmedetomidine or tramadol, respectively [table 2 ]. parameters for post - spinal anaesthesia shivering nausea and vomiting was observed only in tramadol group, and there was no incidence in the dexmedetomidine group. almost similar number of patients were sedated in both groups and the sedation score in all the patients was 2. there was no evidence of respiratory depression, hypotension or bradycardia in any of the patients. hr, mean blood pressure, body temperature, and spo2 remained within normal limits throughout the procedure in both groups [table 3 ]. intra and post - operative shivering is a distressing experience for the patient. the exact mechanism of shivering during spinal anaesthesia has not been fully recognized. the possible mechanisms include impairment of central thermoregulation, internal redistribution of body heat, and heat loss to the environment. potential risk factors for hypothermia in spinal anaesthesia include ageing, level of sensory block, temperature of the operation theatre and iv solutions. in this study, all operation theatres (ots) maintained an ambient temperature of 23 - 25c, and all fluids and drugs were at room temperature during the surgery. demographic factors such as age, gender, duration of anaesthesia and surgery have also been matched to reduce any confounding bias. the neurotransmitter pathways involved in shivering are multiple and involve opioids, 2 adrenergic, serotenergic, and anticholinergic receptors. hence, drugs acting on these systems which include opioids (pethidine, nalbuphine, or tramadol), ketanserin, propofol, doxapram, clonidine, ketamine and nefopam are utilized in the treatment of shivering. however, adverse effects such as hypotension, hypertension, sedation, respiratory depression, nausea and vomiting limit their use. tramadol is an opioid analgesic with opioid effect mainly mediated via mu receptor with minimal effect on kappa and delta receptors. the anti - shivering action of tramadol is probably mediated via its opioid or serotonergic and noradrenergic activity or both. it is a well - established agent in the treatment of post - anaesthetic shivering. dexmedetomidine is an 2 adrenoceptor agonist, with antihypertensive, sedative, analgesic, and anti - shivering properties. the anti - shivering effects of alpha adrenoceptor agonists are mediated by binding to 2 receptors that mediate vasoconstriction and the anti - shivering effect. dexmedetomidine comparably reduces the vasoconstriction and shivering thresholds, thus suggesting that it acts on the central thermoregulatory system rather than preventing shivering peripherally. it has been successfully used as an adjunct to local anaesthetics in spinal anaesthesia and peripheral nerve blockade, for the sedation of mechanically ventilated patients in the intensive care unit, as well as supplementation of post - operative analgesia. the role of dexmedetomidine in the treatment of shivering has been evaluated in a few studies. it may be a good choice because of its dual effects related anti - shivering and sedation. with same dose, that is, 0.5 mg / kg of tramadol, the response rate reported by shukla. was 92.5%, by reddy and chiruvella as 95.56% and by tsai and chu, 87%. maheshwari. reported similar recurrence rate with tramadol as in our study (8%) but the dose used in their study was 1 mg / kg. the recurrence rate in the study by shukla. the incidence of nausea and vomiting with tramadol in our study was 28% and 20%, respectively. the results correspond with that of other studies by reddy and chiruvella, tsai and chu ; bansal and jain however, in the study by shukla., the incidence of nausea was quite high (77.5%), whereas wason. maheshwari. have reported a very high incidence of sedation to the extent of 84%, which as mentioned earlier could be due to the higher dose as opposed to 28% sedation in our study. in a study by easley, all children who had post - anaesthesia shivering were treated with a single iv bolus dose of dexmedetomidine 0.5 g / kg over 3 - 5 min. all children had cessation of shivering behaviour within 5 min following the completion of dexmedetomidine administration. we found a response rate of 100% and apart from sedation, there was no other adverse effect observed. but there was recurrence in 1 patient who had to be given a rescue dose. all other studies have used higher dose of dexmedetomidine (1 g / kg), so comparison of results would not be appropriate. in our study, intra - operative dexmedetomidine infusion caused negligible sedation inspite of using a loading dose of 1 g / kg followed by a maintenance infusion of 0.5 g / kg / h. the other agonist clonidine is associated with a high incidence of hypotension and bradycardia. in this respect the incidence of adverse effects like nausea and vomiting was found to be higher in case of tramadol compared to dexmedetomidine. more studies need to be undertaken with varying dose ranges to extrapolate the results of this study. there was not much difference in the number of patients who were sedated in either group. the sedation seen with dexmedetomidine, in the absence of nausea and vomiting, is beneficial for the surgeon, anaesthetist as well as the patient. it provided more comfort to the patient, maintained more cardio - respiratory stability, improved surgical conditions and also provided amnesia during surgery. another limitation was that the present study included short duration surgeries as the mean duration of surgical period was calculated to be approximately 1 h in both groups. the anti - shivering effect of dexmedetomidine needs to be seen in surgeries of longer duration where chances of developing hypothermia are more. also, we did not assess different doses of dexmedetomidine ; further studies are needed to evaluate the anti - shivering and haemodynamic effects of dexmedetomidine with various doses. the search continues for drugs that sufficiently improve the tolerance of thermoregulation without simultaneously producing respiratory depression, or haemodynamic instability. dexmedetomidine might prove to be a valuable addition in the current armamentarium of the available drugs. both dexmedetomidine (0.5 g / kg) and tramadol (0.5 mg / kg) are effective in treating patients with post - spinal anaesthesia shivering, but time taken for complete cessation of shivering was shorter with dexmedetomidine as compared to tramadol, the difference being statistically significant. more studies of different dose ranges of dexmedetomidine need to be conducted in order to cement its position as an efficient anti - shivering agent.	background and aims : dexmedetomidine (2 adrenergic agonist) has been used for prevention of post anaesthesia shivering. its use for the treatment of post - spinal anaesthesia shivering has not been evaluated. the aim of this study was to evaluate and compare the efficacy, haemodynamic and adverse effects of dexmedetomidine with those of tramadol, when used for control of post - spinal anaesthesia shivering.methods:a prospective, randomised, and double - blind study was conducted in 50 american society of anaesthesiologists grade i and ii patients of either gender, aged between 18 and 65 years, scheduled for various surgical procedures under spinal anaesthesia. the patients were randomised in two groups of 25 patients each to receive either dexmedetomidine 0.5 g / kg or tramadol 0.5 mg / kg as a slow intravenous bolus. grade of shivering, onset of shivering, time for cessation of shivering, recurrence, response rate, and adverse effects were observed at scheduled intervals. unpaired t - test was used for analysing the data.results:time taken for cessation of shivering was significantly less with dexmedetomidine when compared to tramadol. nausea and vomiting was observed only in tramadol group (28% and ; 20% respectively). there was not much difference in the sedation profile of both the drugs.conclusion:we conclude that although both drugs are effective, the time taken for cessation of shivering is less with dexmedetomidine when compared to tramadol. moreover, dexmedetomidine has negligible adverse effects, whereas tramadol is associated with significant nausea and vomiting.
understanding major adverse events and patient - reported outcomes (pros) after acute myocardial infarction (ami) is fundamental to improving the quality and effectiveness of health care. with the emergence of validated instruments to measure health status, physical function, and other pros, several observational studies in western countries have explored these outcomes after ami, providing an opportunity for driving both cost - effectiveness and clinical quality improvement. however, due to substantial differences in health care systems, treatment patterns, lifestyle, and environment, data from western countries may not necessarily be extrapolated elsewhere. china, home to one - fifth of the world 's population, has experienced an epidemiological transition, marked by a shift from a predominance of infectious to noncommunicable diseases in a much shorter time span than many other countries. the number of patients hospitalized with st - segment elevation myocardial infarction in china has quadrupled over the last decade. these epidemiological shifts have created an imperative to understand a broad range of outcomes in longitudinal follow - up for high - impact noncommunicable conditions as ami. despite the increasing prevalence of ami in china, little is known about the experience of patients after the acute event, including mortality, major adverse vascular events, and pros. previous studies in china have found that patients with acute coronary syndromes have worse in - hospital outcomes compared with patients in western countries, and the use and maintenance of appropriate combinations of evidence - based treatment are suboptimal over both the short- and long - term. existing studies, however, have been either limited to in - hospital mortality and in - hospital clinical events or lacking the comprehensive evaluation of a broad range of outcomes, including pros. no information is currently available on longitudinal outcomes, risk factors, risk prediction tools, and in - hospital and long - term management of a national sample of patients following ami in china. such information would provide a perspective on the current results that are achieved and identify areas for improvement. to understand the experience of patients after ami and guide quality improvement initiatives for post - ami care in china, we designed and implemented the china patient - centered evaluative assessment of cardiac events prospective study of ami (china peace - prospective ami study), which is the first longitudinal study on clinical outcomes and pros among ami patients who are discharged alive in china. it aims to (1) examine major vascular events and a broad range of pros (i.e., health status, depression, social support, cognitive function, and sexual health) in patients with ami in the short- (i.e., within 1 month) and long - term (i.e., within 12 months) ; (2) determine risk factors associated with these patient outcomes, including patient characteristics (e.g., demographic, clinical, psychosocial, and behavioral factors), in - hospital care, and hospital attributes ; (3) generate tools for risk prediction among chinese patients with ami ; and (4) evaluate the control of risk factors for subsequent events after ami hospitalization. the china peace - prospective ami study is based on the china peace platform, a collaborative effort among china national center for cardiovascular diseases (nccd), the yale - new haven hospital, center for outcomes research and evaluation, the chinese government, and 208 chinese hospitals to improve cardiovascular disease outcomes in china [figure 1 ]. the china peace - prospective ami study recruited 4000 patients treated for ami in 53 hospitals (35 tertiary and 18 secondary hospitals) located in 21 of the 31 provinces in china (supplementary material 1) and followed them prospectively for 12 months. the first patient was enrolled in december 2012 ; follow - up finished in june 2015. data were collected at baseline (i.e., index hospitalization for ami), as well as at 1, 6, and 12 months following hospital discharge. key partners include the chinese government, collaborating hospitals, the china national center for cardiovascular disease, and the yale - new haven hospital, center for outcomes research and evaluation. ami : acute myocardial infarction ; pci : percutaneous coronary intervention ; 3vd : revascularization in patients with triple - vessel disease. the national coordinating center (ncc) of this study is based at the nccd / fuwai hospital in beijing, and works in close collaboration with 10 regional coordinating centers in various regions of china. the nccd / fuwai hospital ethics committee approved this study and, where required, individual hospitals received approval from their local ethics committee. the chinese government, which provides financial support for the study, has no role in the design or conduct of the study ; in the collection, management, analysis, and interpretation of the data ; or in the preparation or approval of the article or any of the articles that will be derived from the study. nct01624909). we selected geographically matched hospitals, consisting of one secondary and at least one tertiary hospital in each geographic region (typically a province). this design was implemented to examine the treatment outcomes and associated risk factors of patients following ami, under different treatment circumstances and patterns with the ability to compare tertiary hospitals (with the capacity of performing primary percutaneous coronary intervention [pci ]) with secondary hospitals (without the capacity of performing primary pci). although selecting pairs of secondary and tertiary hospitals from the same city was a priority, when this was not feasible, we selected secondary and tertiary hospitals from geographically proximal cities. eligible patients included those age 18 years or older admitted to a participating hospital for ami within 24 h of symptom onset. the diagnosis of ami was defined as an increase in cardiac biomarker levels (troponin or creatine kinase [ck]-mb) with at least one value above the 99 percentile of the upper reference limit, and clinical evidence of acute myocardial ischemia (i.e., symptoms of ischemia, or electrocardiogram changes indicative of new ischemia). patients were excluded if they have any of the following : ami caused by physical trauma, elevated cardiac biomarkers as a complication of elective coronary revascularization. the diagnosis confirmed by local physicians all eligible patients were registered and invited to participate in the study by trained / certified investigators at each site. hospitals with enrollment rates that were lower than expected were provided assistance from the ncc, which shares the best practices and strategies used by more successfully enrolling hospitals. we established the study cohort for follow - up, which included all enrolled ami patients who were alive at discharge. in order to evaluate potential selection bias by comparing enrolled versus nonenrolled patients, we collected information on baseline characteristics, in - hospital care, and in - hospital outcomes for all eligible patients through medical chart abstraction. the china patient - centered evaluative assessment of cardiac events prospective study of acute myocardial infarction study flow chart. ami : acute myocardial infarction ; acs : acute coronary syndrome ; ua : unstable angina. data are collected via central medical chart abstraction, interviews, and physical examinations by site investigators, local lab tests, and central lab analysis [table 1 ]. all data are treated as protected health information and are securely stored in an encrypted and password - protected database at the ncc with frequent local and offsite backup on secure servers. data collected during the ami index hospitalization and follow - up only performed in 6 hospitals (3 tertiary and 3 secondary hospitals, from 3 provinces) ; only collected in secondary hospitals. ami : acute myocardial infarction ; cvd : cardiovascular disease ; saq : seattle angina questionnaire ; eq-5d : euroqol group 5-dimension self - report questionnaire ; phq-8 : patient health questionnaire 8-item depression scale ; pss : perceived stress scale ; essi : enhancing recovery in coronary heart disease (enrichd) social support inventory ; mbq : modified berlin questionnaire ; mmse : mini mental state examination ; tcm : traditional chinese medicine ; bun : blood urea nitrogen ; hba1c : hemoglobin a1c ; hs - crp : high - sensitivity c - reactive protein ; dna : deoxyribonucleic acid ; rna : ribonucleic acid ; bmi : body mass index. medical chart abstraction for all registered patients, we abstracted detailed information from medical chart of the index hospitalization (case report form shown in supplementary material 2 and data dictionary shown in supplementary material 3). site investigators photograph complete hospital medical charts of all eligible patients, with identity information concealed (name, national i d, and contact information). electronic copies of the charts are sent to the ncc via encrypted flash drives for central abstraction. following receipt of each chart, research staff at the ncc checks the hospitalization i d and date of hospital admission to verify the correct patient identity. the data are evaluated to ensure completeness, quality, and concealment of personal identifiers. incomplete or poorly scanned records are rescanned and retransmitted. per the china peace - retrospective ami study methodology, two contracted vendors abstract details of each patients hospitalization using their medical charts. one vendor abstracts the part that can be abstracted verbatim without need for interpretation (face sheet, laboratory test results, and physician orders) of all medical charts via double entry by separate abstractors to ensure the accuracy. the other vendor abstracts the other part (the admission record, discharge record, daily record, and procedure reports) of all medical charts. to ensure the accuracy of interpretation, research staff at the ncc randomly audits 5% of all charts on an ongoing basis. if the charts are not abstracted with at least 98% accuracy, all medical charts in the audited batch will be considered unqualified and will be re - reviewed. participant interviews participants were interviewed at baseline (i.e., during the index hospitalization for ami), and at 1, 6, and 12 months following hospital discharge (questionnaires shown in supplementary material 4). during follow - up period, baseline and follow - up questionnaires click here for additional data file. at baseline, we collect detailed information on demographics, socioeconomic status, cardiovascular risk factors, medical history, sleep apnea, generic and disease - specific health status, depression, and stress [table 1 ]. we collected patient outcomes within 12 months after the index ami, including clinical events and pros. we collected all hospitalizations during follow - up with the medical record as supporting documents. clinicians at ncc adjudicate all major vascular events (defined as cardiac death, nonfatal ami, coronary revascularization, or ischemic stroke) using standard criteria employed in clinical trials. to provide a complete picture of patients health status, we collect both generic and disease - specific measures, as well as estimates of patients psychosocial status, and sexual functioning. the study used the euroqol group 5-dimension instrument as a measure of generic health - related quality of life, which also enables the estimation of utilities, and the seattle angina questionnaire to assess condition - specific functioning and quality of life. psychosocial status was assessed for depressive symptoms (8-item patient health questionnaire), stress (4-item perceived stress scale), cognitive function (mini - mental state examination), and sexual activity / function. during follow - up, we also asked questions regarding adherence to secondary prevention and assessed the management of cardiovascular risk factors. to assess sexual health and cognitive functioning after ami, we conducted a sub - study among 6 of the participating hospitals (3 tertiary and 3 secondary hospitals, from 3 provinces). sexual activity / function and cognitive function were assessed at baseline, 1, and 12 months after the index ami [table 1 ] by trained physicians. sexual activity / function was assessed using instruments from previous large - scale studies of adult sexuality following ami. this includes information on partner status, sexual activity (active or not, frequency), attitudes (importance, motivation), function, and physician counseling about sexual activity. site investigators complete the questionnaires electronically on a tablet computer, which allows real - time logic checks to ensure the accuracy and completeness of data. site investigators photographed signed consent forms with the tablet camera and upload them to the central server. the data were transferred to the server for synchronization into the central database at ncc via a customized virtual private network. the ncc coordinators checked consents of all participants, reviewed missing data and made data queries, and requested reasons for missed follow - up appointments. in addition, an audio record was automatically made during the patient interview and uploaded to the server along with questionnaire data.. physical examinations and local laboratory tests blood pressure, height, weight, and waist circumference are measured at baseline as well as each follow - up visit. at the 1- and 12-month follow - up visits, lipid profiles, glucose, renal function, liver function, blood counts, and urinalysis were analyzed locally, which are consistent with the routine clinical practice. central laboratory tests and long - term storage of blood and urine samples for the purpose of central lab analysis, separate blood and urine samples are obtained during the index hospitalization (primarily prior to acute treatments, particularly reperfusion therapies), as well as at 1-month (only in the 18 secondary hospitals) and 12-month follow - up visits. this will facilitate the assessment of ami biomarkers and long - term management of risk factors (supplementary material 5). samples were processed within 24 h following collection, stored at 40c or 80c, transported with dry ice from local sites within 6 months, and then stored in liquid nitrogen at china nccd for central analysis and long - term storage. the following will be analyzed at a central laboratory : blood lipid profiles (total cholesterol, high - density lipid - cholesterol, and low - density lipid - cholesterol) and metabolic markers (i.e., alanine aminotransferase, creatinine, ck, high - sensitivity c - reactive protein, glucose, and hemoglobin a1c). blood and urine collection click here for additional data file. to help investigate the effects of health care system and institutional factors on the treatment and outcomes of patients with ami, participating hospitals are surveyed about their treatment capacity and processes, as well as their organizational learning behaviors and cultures (supplementary material 6). questions about organizational learning were drawn from previously developed instruments. we invite two respondents from each hospital to complete the survey : one is the local principal investigator of the china peace - prospective ami study at each hospital (usually the director of the cardiology department or internal medicine department) and the other is the coordinator of this study at each hospital (usually a physician involved in routine clinical practice). our strategy of data collection permits a broad range of analysis and analytic approaches, based upon the primary research question (supplementary material 7). we will calculate summary statistics for major vascular events, as well as pros within 1, 6, and 12 months after ami. we will report summary statistics for patient demographic, clinical, psychosocial, and behavioral characteristics, use of diagnostic tests, treatments received, and control of cardiovascular risk factors. to help identify factors associated with the major vascular events, we will use standard parametric and nonparametric tests for bivariate analyses, including t - test, chi - square test, fisher 's exact test, and wilcoxon rank sum tests. in addition, appropriate multivariable regression analyses, such as linear, logistic, cox proportional hazard, and poisson models, will be conducted to determine a factor 's association with the outcome measures while adjusting for potential confounders. as patients are clustered within hospitals and there are repeated observations clustered within patients, our analyses will account for clustering in data (e.g., generalized estimating equations or random effects models). while all efforts are made to obtain high response rates in follow - up pros, some missing data are inevitable. we will carefully evaluate any potential selection biases introduced by missing data and conduct inverse probability weighting when appropriate, based upon a propensity model for participation in the follow - up assessments, to preferentially weight the experiences of patients who were most like those who did not participate in follow - up. a sample size of 4000 is determined based on both feasibility and consideration of adequate statistical precision for describing 12-month major vascular events and pros in the overall sample, and secondary or tertiary hospitals separately (supplementary material 8). the china peace - prospective ami study is based on the china peace platform, a collaborative effort among china national center for cardiovascular diseases (nccd), the yale - new haven hospital, center for outcomes research and evaluation, the chinese government, and 208 chinese hospitals to improve cardiovascular disease outcomes in china [figure 1 ]. the china peace - prospective ami study recruited 4000 patients treated for ami in 53 hospitals (35 tertiary and 18 secondary hospitals) located in 21 of the 31 provinces in china (supplementary material 1) and followed them prospectively for 12 months. the first patient was enrolled in december 2012 ; follow - up finished in june 2015. data were collected at baseline (i.e., index hospitalization for ami), as well as at 1, 6, and 12 months following hospital discharge. key partners include the chinese government, collaborating hospitals, the china national center for cardiovascular disease, and the yale - new haven hospital, center for outcomes research and evaluation. ami : acute myocardial infarction ; pci : percutaneous coronary intervention ; 3vd : revascularization in patients with triple - vessel disease. the national coordinating center (ncc) of this study is based at the nccd / fuwai hospital in beijing, and works in close collaboration with 10 regional coordinating centers in various regions of china. the nccd / fuwai hospital ethics committee approved this study and, where required, individual hospitals received approval from their local ethics committee. the chinese government, which provides financial support for the study, has no role in the design or conduct of the study ; in the collection, management, analysis, and interpretation of the data ; or in the preparation or approval of the article or any of the articles that will be derived from the study. we selected geographically matched hospitals, consisting of one secondary and at least one tertiary hospital in each geographic region (typically a province). this design was implemented to examine the treatment outcomes and associated risk factors of patients following ami, under different treatment circumstances and patterns with the ability to compare tertiary hospitals (with the capacity of performing primary percutaneous coronary intervention [pci ]) with secondary hospitals (without the capacity of performing primary pci). although selecting pairs of secondary and tertiary hospitals from the same city was a priority, when this was not feasible, we selected secondary and tertiary hospitals from geographically proximal cities. eligible patients included those age 18 years or older admitted to a participating hospital for ami within 24 h of symptom onset. the diagnosis of ami was defined as an increase in cardiac biomarker levels (troponin or creatine kinase [ck]-mb) with at least one value above the 99 percentile of the upper reference limit, and clinical evidence of acute myocardial ischemia (i.e., symptoms of ischemia, or electrocardiogram changes indicative of new ischemia). patients were excluded if they have any of the following : ami caused by physical trauma, elevated cardiac biomarkers as a complication of elective coronary revascularization. the diagnosis confirmed by local physicians all eligible patients were registered and invited to participate in the study by trained / certified investigators at each site. hospitals with enrollment rates that were lower than expected were provided assistance from the ncc, which shares the best practices and strategies used by more successfully enrolling hospitals. we established the study cohort for follow - up, which included all enrolled ami patients who were alive at discharge. in order to evaluate potential selection bias by comparing enrolled versus nonenrolled patients, we collected information on baseline characteristics, in - hospital care, and in - hospital outcomes for all eligible patients through medical chart abstraction. the china patient - centered evaluative assessment of cardiac events prospective study of acute myocardial infarction study flow chart. ami : acute myocardial infarction ; acs : acute coronary syndrome ; ua : unstable angina. data are collected via central medical chart abstraction, interviews, and physical examinations by site investigators, local lab tests, and central lab analysis [table 1 ]. all data are treated as protected health information and are securely stored in an encrypted and password - protected database at the ncc with frequent local and offsite backup on secure servers. data collected during the ami index hospitalization and follow - up only performed in 6 hospitals (3 tertiary and 3 secondary hospitals, from 3 provinces) ; only collected in secondary hospitals. ami : acute myocardial infarction ; cvd : cardiovascular disease ; saq : seattle angina questionnaire ; eq-5d : euroqol group 5-dimension self - report questionnaire ; phq-8 : patient health questionnaire 8-item depression scale ; pss : perceived stress scale ; essi : enhancing recovery in coronary heart disease (enrichd) social support inventory ; mbq : modified berlin questionnaire ; mmse : mini mental state examination ; tcm : traditional chinese medicine ; bun : blood urea nitrogen ; hba1c : hemoglobin a1c ; hs - crp : high - sensitivity c - reactive protein ; dna : deoxyribonucleic acid ; rna : ribonucleic acid ; bmi : body mass index. medical chart abstraction for all registered patients, we abstracted detailed information from medical chart of the index hospitalization (case report form shown in supplementary material 2 and data dictionary shown in supplementary material 3). site investigators photograph complete hospital medical charts of all eligible patients, with identity information concealed (name, national i d, and contact information). electronic copies of the charts are sent to the ncc via encrypted flash drives for central abstraction. following receipt of each chart, research staff at the ncc checks the hospitalization i d and date of hospital admission to verify the correct patient identity. the data are evaluated to ensure completeness, quality, and concealment of personal identifiers. incomplete or poorly scanned records are rescanned and retransmitted. per the china peace - retrospective ami study methodology, one vendor abstracts the part that can be abstracted verbatim without need for interpretation (face sheet, laboratory test results, and physician orders) of all medical charts via double entry by separate abstractors to ensure the accuracy. the other vendor abstracts the other part (the admission record, discharge record, daily record, and procedure reports) of all medical charts. to ensure the accuracy of interpretation, research staff at the ncc randomly audits 5% of all charts on an ongoing basis. if the charts are not abstracted with at least 98% accuracy, all medical charts in the audited batch will be considered unqualified and will be re - reviewed. participant interviews participants were interviewed at baseline (i.e., during the index hospitalization for ami), and at 1, 6, and 12 months following hospital discharge (questionnaires shown in supplementary material 4). during follow - up period baseline and follow - up questionnaires click here for additional data file. at baseline, we collect detailed information on demographics, socioeconomic status, cardiovascular risk factors, medical history, sleep apnea, generic and disease - specific health status, depression, and stress [table 1 ]. we collected patient outcomes within 12 months after the index ami, including clinical events and pros. we collected all hospitalizations during follow - up with the medical record as supporting documents. clinicians at ncc adjudicate all major vascular events (defined as cardiac death, nonfatal ami, coronary revascularization, or ischemic stroke) using standard criteria employed in clinical trials. to provide a complete picture of patients health status, we collect both generic and disease - specific measures, as well as estimates of patients psychosocial status, and sexual functioning. the study used the euroqol group 5-dimension instrument as a measure of generic health - related quality of life, which also enables the estimation of utilities, and the seattle angina questionnaire to assess condition - specific functioning and quality of life. psychosocial status was assessed for depressive symptoms (8-item patient health questionnaire), stress (4-item perceived stress scale), cognitive function (mini - mental state examination), and sexual activity / function. during follow - up, we also asked questions regarding adherence to secondary prevention and assessed the management of cardiovascular risk factors. to assess sexual health and cognitive functioning after ami, we conducted a sub - study among 6 of the participating hospitals (3 tertiary and 3 secondary hospitals, from 3 provinces). sexual activity / function and cognitive function were assessed at baseline, 1, and 12 months after the index ami [table 1 ] by trained physicians. sexual activity / function was assessed using instruments from previous large - scale studies of adult sexuality following ami. this includes information on partner status, sexual activity (active or not, frequency), attitudes (importance, motivation), function, and physician counseling about sexual activity. site investigators complete the questionnaires electronically on a tablet computer, which allows real - time logic checks to ensure the accuracy and completeness of data. site investigators photographed signed consent forms with the tablet camera and upload them to the central server. the data were transferred to the server for synchronization into the central database at ncc via a customized virtual private network. the ncc coordinators checked consents of all participants, reviewed missing data and made data queries, and requested reasons for missed follow - up appointments. in addition, an audio record was automatically made during the patient interview and uploaded to the server along with questionnaire data. physical examinations and local laboratory tests blood pressure, height, weight, and waist circumference are measured at baseline as well as each follow - up visit. at the 1- and 12-month follow - up visits, lipid profiles, glucose, renal function, liver function, blood counts, and urinalysis central laboratory tests and long - term storage of blood and urine samples for the purpose of central lab analysis, separate blood and urine samples are obtained during the index hospitalization (primarily prior to acute treatments, particularly reperfusion therapies), as well as at 1-month (only in the 18 secondary hospitals) and 12-month follow - up visits. this will facilitate the assessment of ami biomarkers and long - term management of risk factors (supplementary material 5). samples were processed within 24 h following collection, stored at 40c or 80c, transported with dry ice from local sites within 6 months, and then stored in liquid nitrogen at china nccd for central analysis and long - term storage. the following will be analyzed at a central laboratory : blood lipid profiles (total cholesterol, high - density lipid - cholesterol, and low - density lipid - cholesterol) and metabolic markers (i.e., alanine aminotransferase, creatinine, ck, high - sensitivity c - reactive protein, glucose, and hemoglobin a1c). blood and urine collection click here for additional data file. to help investigate the effects of health care system and institutional factors on the treatment and outcomes of patients with ami, participating hospitals are surveyed about their treatment capacity and processes, as well as their organizational learning behaviors and cultures (supplementary material 6). we invite two respondents from each hospital to complete the survey : one is the local principal investigator of the china peace - prospective ami study at each hospital (usually the director of the cardiology department or internal medicine department) and the other is the coordinator of this study at each hospital (usually a physician involved in routine clinical practice). our strategy of data collection permits a broad range of analysis and analytic approaches, based upon the primary research question (supplementary material 7). we will calculate summary statistics for major vascular events, as well as pros within 1, 6, and 12 months after ami. we will report summary statistics for patient demographic, clinical, psychosocial, and behavioral characteristics, use of diagnostic tests, treatments received, and control of cardiovascular risk factors. to help identify factors associated with the major vascular events, we will use standard parametric and nonparametric tests for bivariate analyses, including t - test, chi - square test, fisher 's exact test, and wilcoxon rank sum tests. in addition, appropriate multivariable regression analyses, such as linear, logistic, cox proportional hazard, and poisson models, will be conducted to determine a factor 's association with the outcome measures while adjusting for potential confounders. as patients are clustered within hospitals and there are repeated observations clustered within patients, our analyses will account for clustering in data (e.g., generalized estimating equations or random effects models). while all efforts are made to obtain high response rates in follow - up pros, some missing data are inevitable. we will carefully evaluate any potential selection biases introduced by missing data and conduct inverse probability weighting when appropriate, based upon a propensity model for participation in the follow - up assessments, to preferentially weight the experiences of patients who were most like those who did not participate in follow - up. a sample size of 4000 is determined based on both feasibility and consideration of adequate statistical precision for describing 12-month major vascular events and pros in the overall sample, and secondary or tertiary hospitals separately (supplementary material 8). the china peace - prospective ami study is the first national longitudinal study on both clinical events and pros among patients with ami in china. the goal of the study is to assess a broad range of outcomes of patients recovering from ami to directly address an important knowledge gap and serve as a foundation with which to develop novel interventions to improve the health outcomes of ami patients in china. several unique features of this study, including the consecutive enrollment of patients, the validation processes to ensure accurate capture of source data, the collection of patient - centered data elements through serial interviews, and the detailed longitudinal follow - up, augment the value of this study. pro measures will provide critically important and currently unknown information to support quality improvement initiatives for ami patients in china. traditional clinical methods of measuring health and the effects of treatment are increasingly accompanied by pros, which enable the patients perspectives to be taken into account in key aspects of healthcare. during the past decade, the treatment of ami has advanced considerably, resulting in significantly decreased mortality and underscoring the importance of capturing the health outcomes of survivors. physicians need to take into account the impact of treatments on patients health status including psychosocial outcomes that may influence the patient recovery process. however, previous large - scale international or national studies lack information about pros. in recent years, several observational studies have broadened the range of outcomes among patients with ami to include these outcomes. however, these studies were conducted in western countries and in - hospitals with the capacity for angiography. findings from the china peace - prospective ami study will provide information about the long - term outcomes of patients with ami, in settings both with and without advanced technical capability, such as pci, and thus inform generalizable strategies to improve care and reduce disparities with a focus on a broad range of outcomes including those that reflect the patient 's experience. the collection of detailed data describing patient characteristics (e.g., demographic, clinical, psychosocial, behavioral factors, and hospital care received) and hospital attributes will enable investigators to define the prognostic importance of both patient- and hospital - level variables on both short- and long - term outcomes. risk prediction tools developed in the chinese population can facilitate understanding of patient prognosis, stratification, and personalized treatment according to individual risk. currently used risk scores (e.g., grace, timi, gusto) were developed based on non - chinese patients, and the performance of these models in chinese populations may differ from that in western patients. accordingly, a risk model tailored to identify high - risk patients with ami in china may be more effective in predicting poor prognosis including major adverse vascular events and/or poor quality of life. data from this study will be used to assess patient- and hospital - level factors influencing continuation of medications and the control of risk factors to optimize secondary prevention following ami, as well as the association between secondary prevention and patient outcomes. such studies will address a substantial gap in knowledge regarding long - term adherence to preventive medications, particularly in low- and middle - income countries (lmics). as most prior studies focused only on in - hospital care and discharge medications, there is a continued need to understand the barriers in adherence to secondary prevention, as well as associated patient characteristics and institutional factors. for example, identifying patient- or system - level factors associated with nonadherence can support novel strategies for improving treatment after discharge and serve as a foundation for strategies to improve medication adherence and risk factor control in ami patients. besides the clinical and psychosocial patterns examined for optimizing the treatment and prognosis of patients with ami, the blood and urine samples collected in our study will serve the need of basic science, translational, or clinical research to advance the diagnosis, prevention, or treatment of ami. the large sample of well - characterized patients will be stored long - term as a bio - repository, enabling identification of novel biomarkers, detecting the association between genetic and phenotype factors, and exploring potential mechanisms of ami onset and recovery. the strengths of conducting a longitudinal study on clinical outcomes and pros among patients with ami have been well - recognized both in china and other lmics, which are all in need of a better understanding of where the greatest opportunities lie in optimizing patient outcomes in the face of an increasing burden of cardiovascular disease. in addition, the established organizational infrastructure of our research team, based on partnership with the chinese government, collaboration with international experts in observational studies, and the involvement of local hospitals, ensures a rigorous study design and rapid dissemination of findings. furthermore, the implementation of the high - quality and cost - effective study is supported by a broad research network as well as a robust management system. during the past decade, china nccd has collaborated with world 's leading academic institutions to conduct several of the largest clinical trials in china. continuous efforts have been made in establishing the research network through in - depth training and rigorous quality control procedures. we have also established a management system for large multi - center studies, which has internationally - accepted quality standards and accounts for the diverse health care settings in china. the collaborative research and performance improvement network created by the china peace platform will ultimately improve patient outcomes for a broad range of conditions and may present a model for research and quality improvement in other international settings. it should be noted that only patients who consented can be enrolled and followed - up. these patients may differ from those who were eligible but did not consent to participate. in addition, missing data, particularly follow - up pro data, can introduce biased estimates of outcomes and will require extreme diligence in collecting all follow - up pro data and advanced statistical methods for the planned analyses to account for missing data. in conclusion, the china peace - prospective ami study is uniquely positioned to help improve the quality of care and patient outcomes for china and similar lmics by generating novel, high - quality, and comprehensive data about patients experience following hospitalizations for ami. the partnership among the chinese government, an expert clinical trial group, a large network of hospitals with geographic and capability diversity, and international experts in outcomes research, will be leveraged to create a platform for research on cardiovascular diseases which will facilitate policy - making and inform the development of novel quality improvement tools. supplementary information is linked to the online version of the paper on the chinese medical journal website. this study was supported by the research special fund for public welfare industry of health (no. hmk is supported by grant u01 hl105270 - 05 (center for cardiovascular outcomes research at yale university) from the national heart, lung, and blood institute. the sponsors had no role in the conduct of the study ; in the collection, management, analysis, and interpretation of the data ; or in the preparation or approval of the manuscript. krumholz works under contract with the centers for medicare & medicaid services to develop and maintain performance measures, is chair of a cardiac scientific advisory board for unitedhealth, and is the recipient of research grants from medtronic, johnson and johnson (janssen) through yale university, to develop methods of clinical trial data sharing. this study was supported by the research special fund for public welfare industry of health (no. hmk is supported by grant u01 hl105270 - 05 (center for cardiovascular outcomes research at yale university) from the national heart, lung, and blood institute. the sponsors had no role in the conduct of the study ; in the collection, management, analysis, and interpretation of the data ; or in the preparation or approval of the manuscript. krumholz works under contract with the centers for medicare & medicaid services to develop and maintain performance measures, is chair of a cardiac scientific advisory board for unitedhealth, and is the recipient of research grants from medtronic, johnson and johnson (janssen) through yale university, to develop methods of clinical trial data sharing.	background : despite the rapid growth in the incidence of acute myocardial infarction (ami) in china, there is limited information about patients experiences after ami hospitalization, especially on long - term adverse events and patient - reported outcomes (pros).methods : the china patient - centered evaluative assessment of cardiac events (peace)-prospective ami study will enroll 4000 consecutive ami patients from 53 diverse hospitals across china and follow them longitudinally for 12 months to document their treatment, recovery, and outcomes. details of patients medical history, treatment, and in - hospital outcomes are abstracted from medical charts. comprehensive baseline interviews are being conducted to characterize patient demographics, risk factors, presentation, and healthcare utilization. as part of these interviews, validated instruments are administered to measure pros, including quality of life, symptoms, mood, cognition, and sexual activity. follow - up interviews, measuring pros, medication adherence, risk factor control, and collecting hospitalization events are conducted at 1, 6, and 12 months after discharge. supporting documents for potential outcomes are collected for adjudication by clinicians at the national coordinating center. blood and urine samples are also obtained at baseline, 1- and 12-month follow - up. in addition, we are conducting a survey of participating hospitals to characterize their organizational characteristics.conclusion:the china peace - prospective ami study will be uniquely positioned to generate new information regarding patient 's experiences and outcomes after ami in china and serve as a foundation for quality improvement activities.
type 2 diabetes (t2d) mellitus is a chronic metabolic disease with epidemic proportions. its global prevalence was estimated to be 6.4% worldwide (285 million adults in 2010) and is predicted to rise to approximately 7.7% (439 million) by 2030. t2d is a multifactorial disorder resulting from an interaction between genetic and environmental conditions (sedentary lifestyle and western diet) and characterized by a peripheral insulin resistance, hyperglycaemia, and pancreatic cell dysfunctions. two defects have been reported during diabetes development, a gradual deterioration of cell functions and a reduction in pancreatic cells mass. cell failure is not limited to t2d but is rather a common feature of all forms of diabetes, including the autoimmune type 1 diabetes (t1d), autosomal dominant onset diabetes of young (mody), wolfram syndrome, and wolcott - rallison syndrome (wrs). in the early stage of diabetes development, the response of pancreatic islets challenged by nutrients and/or insulin resistance is a hypersecretion of insulin to maintain normoglycaemia. to this end, the process of cell compensation is a combination of cell mass expansion and an increase of acute glucose - stimulated insulin secretion. postmortem analyses of pancreas of nondiabetic obese patients show an increase of cell volume, implying postnatal plasticity of cell mass. moreover the cell compensation process is associated with an improved capacity of the secretory machinery to support increased insulin production. subsequently, the production of large amounts of insulin by compensating islet cells places a continuous demand on the er for proper protein synthesis, folding, trafficking, and secretion. when the folding capacity of the er is exceeded, misfolded or unfolded proteins accumulate in the er lumen, resulting in er stress. paradoxically, upr signalling activation leads to opposite cell fates, that is, adaptation / survival versus death. increasing evidence links the endoplasmic reticulum (er) stress to cell deterioration and apoptosis [2, 3 ]. recent experiments performed in db / db mice and ob / ob mice models at different times of disease progression revealed that the maintenance (or suppression) of adaptive upr is associated with cell compensation (or failure) in obese mice. moreover, engin. recently showed a progressive loss of upr mediator expression before the onset of diabetes in nod mice. the administration of the chemical chaperone tauroursodeoxycholic acid to rescue the deleterious er stress response improved pathophysiological signs of diabetes with a recovery of cell survival and adaptation to stress. in addition, the authors showed a decline of the upr mediator in both experimental models and t2d human islets, suggesting that decreased expression of cell upr actors can play a central role in cell compensation and subsequently t2d occurrence. three canonical er resident molecules mediate upr response, namely, protein kinase r - like er kinase (perk), inositol - requiring enzyme 1 (ire1), and activating transcription factor 6 (atf6), which are maintained inactive by their association with the immunoglobulin heavy chain - binding protein (bip, grp78) in normal conditions (figure 1(a)). the accumulation of unfolded proteins in the er leads to the release of perk, ire, and atf6 and their subsequent activation [7, 8 ]. the downstream signalling effectors from these pathways converge to the nucleus and activate upr target genes, finally reducing the er input (figure 1(a)). their action is bipartite, with an acute programme that attenuates the er workload and a latent transcriptional one that builds er capacity. perk is a type 1 er transmembrane kinase with a stress sensing luminal n - terminal domain. during er stress perk phosphorylates the -subunit of eif2- on serine 51 leading to a delivery inhibition of the initiator methionyl - trnai to the ribosome and ultimately resulting in global protein translation attenuation (figure 1(a)). this phosphorylation event directly contributes to the reduction of er stress and protects cells from er stress - mediated apoptosis. intriguingly, the mrna transcription of upr target genes is selectively activated by eif2 phosphorylation, as these polycistronic mrnas have inhibitory upstream open reading frames (uprfs) and are thus preferentially translated by the ribosome. these include the bzip transcription factor 4 (atf4) that acts as a regulator of upr target genes such as c / ebp - homologous protein (chop) and growth arrest and dna damage inducible gene 34 (gadd34), as well as genes involved in the redox balance and amino acid synthesis. gadd34 interacts with the catalytic subunit of protein phosphatase (pp1c) and controls the level of eif2- phosphorylation by a negative feedback loop, allowing the restoration of an upr basal state once er stress is resolved. ire1 is a central regulator of upr. like perk, ire1 is also a type 1 transmembrane kinase with an n - terminal luminal domain that senses er stress signalling. two homologues of ire1 have been described, ire1 and ire1. ire1 is expressed ubiquitously, showing high expression levels in the pancreas and placenta, whereas ire1 is only expressed in the intestinal epithelium and lung. once the er stress is triggered, ire1 activates its rnase domain through its dimerization and transautophosphorylation and causes an unconventional splicing by the removal of 26-nucleotide intron from the x - box binding protein 1 (xbp1) mrna (figure 1(a)). the subsequent spliced xbp1 (xbp1s) mrna encodes a leucine zipper transcription factor with a high transcriptional activity that upregulates genes encoding er protein chaperones, er associated protein degradation (erad), and lipid biosynthetic enzymes [15, 16 ]. ire1 has also a nonspecific rnase activity that degrades mrnas localized near the er membrane, thereby reducing protein import into the er lumen. high levels of er stress also activate the kinase activity of ire1 and initiate a signalling cascade of apoptosis signal - regulating kinase 1 (ask1)/cjun amino terminal kinase (jnk), which can participate in the apoptotic cell fate. atf6 is an er located type 2 transmembrane protein with a basic leucine zipper dna binding domain (figure 1(a)). two ubiquitously expressed isoforms of atf6 have been described, atf6 and atf6. under er stress conditions, atf6 translocates from the er to the golgi apparatus, where it is cleaved by site-1 protease and site-2 protease (s1p / s2p). the newly generated cytosolic fragment migrates to the nucleus and activates upr gene transcription [20, 21 ]. the exclusive or the combined action of cleaved atf6 and xbp1s is able to activate all three er stress response elements : erse, upre, and erse2. atf6 was first described as a repressor of atf6. however, mouse embryonic fibroblasts generated from atf6 null mice did not show altered upr gene induction, suggesting a minor role for atf6 in er stress response. in contrast, atf6 null mice have a significant alteration in their upr gene expression profile, suggesting a central role for atf6 in er protein quality control and protection against er stress. as the double atf6/ knockdown is lethal, the authors suggested that atf6 and atf6 provide a complementary function during early development. moreover atf6 activity is regulated by the wolfram syndrome 1 (wfs1) protein, which targets atf6 to the e3 ubiquitin ligase hrd1, consequently resulting in its ubiquitination and proteasomal degradation. a number of other er stress transducers that share a high sequence homology with atf6 have been identified, such as luman, oasis, bbf2h7, crebh, and creb4 (reviewed in). however, despite their structural similarities, each atf6 homolog seems to have specific functions in upr regulated processes in specific organs and tissues. cell is a highly specialized secretory cell which responds to elevated postprandial glycaemia by increasing mrna proinsulin translation and insulin secretion. the periodic waves of proinsulin mrna translation generate biosynthetic loads that induce upr. to manage this burden imposed by proinsulin synthesis, cells increase their er size, as exemplified during diabetes development. in the prediabetic state, cell must adapt its er machinery to the new hyperglycaemic environment, promoting cell compensation. the use of genetically modified mouse models and genetic studies from human diabetic patients demonstrated that upr actors support this adaptation as well as cell compensatory mechanism [4, 28 ]. misfolding of proinsulin is associated with er stress and severe dysfunctions leading to a massive destruction of cells. in vivo evidences were observed in both akita and munich mice carrying cysteine residues mutations that interfere with disulphide bond formation [29, 30 ]. interestingly, inactivation of the upr induced proapoptotic chop gene delayed the onset of diabetes in heterozygous akita mice, suggesting a key role for chop in er stress - mediated cell apoptosis. diabetes of youth (midy) is a syndrome caused by a heterozygous mutation of the coding sequence of proinsulin leading to an autosomal - dominant and insulin - deficient diabetes. this mutation has been shown to be the second most common cause of permanent neonatal diabetes related to er stress [32, 33 ]. in line with these observations, inducible expression of the human analogue proinsulin c96y mutation of akita mice in rat insulinoma-1 (ins-1) caused er stress and cell apoptosis. however, upregulation of upr and erad seems to have a protective effect. in vivo expression of the same proinsulin mutant driven by the weak ins1 promoter altogether these data demonstrate a clear link between misfolding of proinsulin and er stress induction. loss of function mutation in the eif2ak3 gene - encoding perk was associated with wrs, which has been confirmed by the functional characterisation of perk knockout mice. embryonic development of these mice is normal but they exhibit a postnatal growth retardation, skeletal dysplasia, and progressive loss of cells, associated with defects in er secretory machinery and proinsulin folding [37, 38 ]. however, generation of cell specific perk knockout mice revealed that cell death was not increased, but rather cell proliferation and differentiation were repressed during the embryonic and postnatal state. other studies on these mice models demonstrated an impaired er to golgi anterograde trafficking, retrotranslocation out of the er, and proteasomal degradation, showing requirement of perk for er and golgi integrity and processing of atf6. in contrast to the first rapport, specific cell inducible perk deletion in mice showed a rapid progression of insulin dependent diabetes regardless of mice age. the authors showed, on the one hand, that this phenotype was due to an increased cell proliferation after the induction of perk deletion due to the increased activation cyclin d - dependent kinase activity. on the other hand, they showed a significant increase in cell death, associated with an activation of other upr actors and a disturbance in calcium homeostasis. moreover, a recent work demonstrated that perk, in concert with calcineurin, regulates er calcium reuptake through calnexin interaction and a negative regulation of the sarcoplasmic endoplasmic reticulum calcium atpase pump (serca) (figure 1(a)). perk thus appears to sense glucose by direct sensing of er calcium levels, raising the possibility that the primary function of perk in cell is to modulate proinsulin quality control and trafficking. within the cell, phosphorylation of elf2 mice harbouring a homozygote knock - in mutation at the perk - mediated phosphorylation site (ser51ala) of elf2 display a severe cell deficiency detectable in late stage embryos and die within 18 h after birth as a consequence of hyperglycaemia associated with defective neoglucogenesis. heterozygote mice development is normal ; however, when challenged with a high fat diet, they develop severe obesity, glucose intolerance, and impaired insulin release. in this genetic context reduced insulin content, fewer granules, er distension, and a prolonged association of proinsulin with bip thus, elf2 phosphorylation is required for upr to prevent cell failure when insulin demand is increased. these findings demonstrate a central role of elf2 phosphorylation in cell adaptation during compensation. these mice exhibit a high rate of cell apoptosis, likely caused by hypoinsulinemia, severe glucose intolerance, and hyperglycaemia. furthermore, the authors showed er distension and mitochondrial damage associated with a lower basal expression of the majority of upr genes and cell antioxidant responsive genes. altogether these data indicate that the correct upr and antioxidant response controlled by perk - elf2 signalling are required for cell adaptation and survival. phosphorylation of elf2 leads to attenuate global translation of most mrna although translation of atf4 is selectively stimulated in this context (figure 1(b)). pioneer studies showed that atf4 knockout mice on a 129sv genetic background are lean, hypoglycaemic, and resistant to diet - induced obesity, probably as a result of increased energy expenditure. however, no effect was observed on plasma insulin level when mice were fed with normal diet, whereas insulin levels were shown to be lower in atf4 null mice compared to wild - type mice when fed with a high fat diet [46, 47 ]. paradoxically, other studies using atf4 ko mice on c57bl6/j genetic background demonstrated that these mice are hypoglycaemic and hyperinsulinemic with an increased cell mass and function. the phenotype of these mice could be secondary to an overexpression of osteocalcin in osteoblasts, a bone derived secreted molecule promoting insulin secretion and insulin sensitivity. the role of atf4 in insulin synthesis and cell adaptation to er stress remains unclear, and further studies using a cell specific atf4 ko mouse model may be useful to answer this question. atf4 activation by elf2 also leads to the transcription of elf4-e binding protein (4e - bp-1), a well - documented gene involved in cells adaptation to stress. in fact, translation attenuation by elf2 phosphorylation is transient, subsequently leading to the feedback dephosphorylation by gadd34, whereas 4e - bp1 suppresses prolonged translation by the inhibition of cap - dependent translation [49, 50 ]. cell specific 4e - bp1 ko mice are normal without any metabolic disorder when fed normal diet but are insulin resistant and show cell defects under high fat diet due to induced er stress [49, 51, 52 ]. moreover, the inactivation of 4e - bp1 gene in min6 cell line results in sensitization to er stress and increased cell loss and hyperglycaemia in diabetic mouse models. these findings suggest a central role of 4e - bp1 in cell adaptation to er stress. in contrast, other groups indicated that suppression of 4e - bp1 expression is involved in beneficial effects of high - density lipoproteins on cells survival, suggesting that the role of atf4 in cell compensation might depend on several cellular interactions. ire1 is the major isoform expressed in the pancreas and plays a central role in cell adaptation to er stress (figure 1(b)). ire1 is required for embryonic development as demonstrated by the embryonic lethality of global ire1 ko mice. the generation of ire1 conditional ko mice revealed that ire1 deletion caused mild hyperinsulinemia and hyperglycaemia and a lower body mass under normal diet. physiological activation of upr by glucose results in ire1 phosphorylation, without increasing xbp1 mrna splicing. moreover, knockdown of ire1 in ins-1 insulinoma cell line resulted in decreased proinsulin biosynthesis or insulin content without impacting global protein synthesis or insulin secretion, suggesting a beneficial effect of ire1 activation by transit exposure to glucose in cells. however, chronic exposure to high glucose leads to hyperphosphorylation of ire1, which in turn results in selective degradation of proinsulin mrna. this may be part of the cell protective mechanism from apoptosis under chronic this adaptative mechanism combined to upr activation may explain the reduced insulin secretion in type 2 diabetic patients in the absence of cell death. ire1 dephosphorylation is mediated by proteins phosphatase a2 (pp2a) through ternary complex containing the scaffold protein rack1 (receptor for activated c kinase 1). under glucose stimulation or er stress, rack1 mediates ire1, rack1, and pp2a complex formation and promotes ire1 dephosphorylation by pp2a, thereby inhibiting ire1 activation and attenuating ire1-dependent increase in insulin production. moreover, ire1 activation is increased and rack1 abundance is decreased in db / db mice. the endoplasmic activity of ire1 is also involved in the activation of a key metabolic enzyme, amp - activated kinase (ampk), in response to nitric oxide (no) and er stress in cells. ampk is a holoenzyme activated by changes in amp / atp ratio, shifting from glucose to the use of lipids as an energy source in order to respond to cellular demand. activated ampk by gtpase dynamin related protein 1 (drp1) phosphorylation prevents er and mitochondrial alteration in stressed cells. in addition ire1 modulates nuclear factor light chain enhancer (nf-b) target gene expression and il-1 activation under mild er stress, which could contribute to chemokine - induced cell death. upon upr several reports indicated that xpb1s target genes and its downstream effect are cell specific and might be dependent on the activating pathways. like ire1, xbp1 deficient mice died between 10.5 and 14.5 day after birth because of cardiac myocyte defects. heterozygous xbp1 mice exhibited significant increase in body mass associated with a progressive hyperinsulinemia and glucose intolerance when fed with a high fat diet. these mice showed increased er stress and decreased insulin receptor expression in the liver. the cell - specific deletion of xbp1 in mice resulted in a modest hyperglycaemia and glucose intolerance caused by decreased insulin secretion. the loss of xbp1 markedly decreased the number of insulin granules and impaired proinsulin processing. further analysis revealed that xbp1 deficiency not only participated in the er stress in cells but also caused constitutive hyperactivation of its upstream activator, ire1, which could degrade a subset of mrnas encoding proinsulin - processing enzymes. in summary, cell defects in xbp1 mutant mice result from a combined effect of xbp1 suppression on canonical upr and its negative feedback activation of ire1. altogether these findings suggest a dual and opposite role for ire1 in cells. a precise regulated feedback circuit involving ire1 and its product xbp1s is required to achieve optimal insulin secretion and glucose control. in contrast, sustain production of xbp1s leads to inhibition of pdx1 and mafa expressions, promoting cells dysfunction and apoptosis. both atf6 isoforms are required for positive regulation of upr. however, the transcriptional activity of atf6 is lower than that of atf6. the double knockdown of the two isoforms caused an embryonic lethality demonstrating overlapping functions of atf6 and atf6, which are essential for embryonic development. atf6 ko mice demonstrated a severe hypoglycaemia suggesting that suppression of atf6 increased insulin sensitivity. treatment of these mice with a pharmacological er stress inducer leads to liver dysfunction and steatosis. furthermore, when fed with a high fat diet, atf6 null mice developed insulin resistance associated with impaired insulin secretion and lower insulin content, reinforcing the idea of a key role of atf6 in cells adaptation and insulin resistance. recently, a basal expression of active atf6 was demonstrated to be essential for cell survival even under unstressed conditions. interestingly, specific functions of atf6 have been revealed depending on its interaction with xbp1. when atf6 is acting alone, it induces the expression of a cluster of genes involved in protein folding such as bip and grp94. when it heterodimerizes with xbp-1 they are modulating the expression of specific class of target genes, such as genes involved in protein degradation (edem, herpude1, hrd1, and p58ipk). in contrast, a deleterious effect of active atf6 overexpression on cell function and expression of insulin, pdx1, and mafa in ins-1 cells was shown. interestingly, some reports demonstrated that some atf6 variants are associated with type 2 diabetes and new onset diabetes after transplantation (nodat), suggesting potential links between atf6 and human diabetes pathophysiology [68, 69 ]. it is important to note that, from the myriad of atf6 homolog described until now, only old astrocyte specifically induced substance (oasis) was identified in cell. however, microarray analysis of ins-1 cell line overexpressing the active form of oasis showed its implication in extracellular matrix production and protein transport but not in the classical er stress response. a great interest has been focused on the atf6 negative regulator wfs1 because of its association with the wolfram syndrome, a rare genetic disorder [71, 72 ]. loss of function mutation in the wfs1 gene encoding wolframin protein caused neurodegenerative disorders characterised by juvenile onset diabetes mellitus, optic atrophy, and hearing impairment [73, 74 ]. wfs1 ko mice exhibit an activated er stress especially in cells, leading to cell loss through impaired cell cycle progression and increased apoptosis. conditional wfs1 knockdown in cell induced diabetes as a result of enhanced er stress and apoptosis. moreover wfs1 is essential for glucose and glucagon - like peptide 1 (glp1) stimulated amp production and regulation of insulin biosynthesis and secretion. under glucose stimulation, wfs1 translocates from the er to plasma membrane, where it stimulates cyclic adenosine monophosphate synthesis through an interaction with adenylyl cyclase 8 (ac8), which subsequently promoted insulin secretion (figure 1(a)). a recent report using induced pluripotent stem (ips) cells to create cells from individuals with wolfram syndrome confirmed these observations. in this study, wfs1 deficient cells showed increased levels of upr genes and decreased insulin content, leading to cell dysfunctions as previously described in mouse models. the inability of upr outputs to restore homeostasis may generate continuous signalling from these sensors, tipping the balance in favour of apoptosis. the er might actually serve as a site where apoptotic signals are generated and integrated to elicit the death response. several stimuli have been linked to er stress - induced apoptosis including hyperglycaemia, exposure to long - chain free fatty acids (e.g., palmitate) [7981 ], hyperinsulinemia occurring in the prediabetic stage, glucose deprivation, islet amyloid polypeptide (iapp) expression, and exposure to inflammatory cytokine. players involved in the cell death response include perk / elf2-dependent transcriptional induction of proapoptotic transcription factor chop which represses bcl-2, ire1-mediated activation of ask1/jnk, and cleavage and activation of procaspase 12 (caspase 4 in humans) [87, 88 ]. the induction of chop is regulated by atf4 [11, 90 ] and atf6 [9193 ] and its role in er stress - induced apoptosis was demonstrated both in vitro and in vivo. mice lacking chop are protected from renal toxicity of the er stressor tunicamycin, an inhibitor of glycosylation. chop deletion promotes cells survival in both genetic and diet - induced insulin resistant mice models [30, 92 ]. pancreatic cells are also sensitive to oxidative stress, but cells from chop knockout mice are protected and maintain insulin secretion under oxidative stress [92, 95 ]. moreover, islets from these mice showed resistance to no, a chemical agent implicated in cells disruption in type 1 diabetes. in contrast, chop deficiency in a genetic background of nonobese diabetic mice (nod - chop/) did not affect the development of insulitis, diabetes, and cells apoptosis. interestingly, chop knockout mice on a c57bl/6 background showed a different phenotype, with abdominal obesity and hepatic steatosis, while preserving normal glucose tolerance and insulin sensitivity. under er stress chop positively regulates the expression of genes involved in apoptosis including gadd34 [50, 99 ], the er oxidoreductin 1 (ero1), death receptor 5 (dr5), and the pseudokinase tribbles related 3 (trb3). as shown for chop deletion, genetic inactivation of these genes protected against cell er stress - induced apoptosis [100, 103105 ]. additionally, chop represses the expression of the antiapoptotic gene bcl2 and enhances oxidant injury. finally, deletion of chop was reported to prevent the cytokine - mediated cleavage of caspase 9 and caspase 3 and subsequent cells apoptosis by reducing cytokine - induced nf-b activity and the expression of key nf-b target genes involved in apoptosis and inflammation. er stress - mediated apoptosis can also be signalled through ire1 dependent activation of jnk pathway. ire1 interacts with tbf receptor associated factor 2 (traf2) and ask1 mediating jnk phosphorylation [18, 108 ]. the analysis of ask1 deficient mice showed that ask1 loss of function attenuated insulin resistance, cardiac inflammation and fibrosis, vascular endothelial dysfunction, and remodelling induced by diet - induced obesity. moreover, deletion of ask1 in homozygous akita mice protected cells from er induced apoptosis and delayed the onset of diabetes. the ire1/traf2 complexes also contributes to er stress - induced apoptosis by promoting the clustering of procaspase-12 and its activation by cleavage in response to er stress. in addition, the ire1/traf2 complex interacts with ikk, an inhibitor of nf-b, mediating its activation and promoting cell apoptosis in response to er stress [112, 113 ]. finally, members of bcl2 family including bax, bak, bim, and puma have been reported to directly interact with ire1 demonstrating a physical link between members of the core apoptotic pathway and the upr [114, 115 ]. in contrast, ire1 forms a stable protein complex with bax inhibitor-1 (bi-1) protein, suppressing cell death. the ire1/bi-1 association decreased the ribonuclease activity of ire1 and seemed to be required for early adaptive responses against er stress - induced apoptosis. the control of ire1 activity appears to be central in the mechanism protecting cells from er stress - induced apoptosis. further studies are needed to understand the various aspect of ire1 regulation and the contribution of the others actors of upr in the er stress - induced apoptosis. clear evidence of the existence of er stress in human cells has been reported in the last decade [2, 3, 6, 117 ]. first analysis of islets from human t2d patients showed an er extension but modest signs of er stress marker in human pancreatic samples and isolated islets. however, glucose stimulation induced increased upr in t2d islets cells. some markers of er stress are increased in t1d human islets with partial er stress [117, 118 ]. a recent report shows an alteration in the expression of specific branches of upr mediators in t2d cells. these findings support the hypothesis of a decline in cell adaptation / compensation during the progression of diabetes in human. the cell has a marked capacity to adapt to environment changes by increasing its mass and function. diabetic signs occur when this adaptative mechanism fails to compensate for the increasing insulin demand. activation of upr actors is triggered in the early stage of the compensatory mechanism and may play a central role in cell adaptation and subsequent functions. further studies are required to understand the physiological significance and the direct implication of er stress and upr in the early stage of diabetes physiopathology. moreover, the relationships among upr actors, their activation, and cell fate (adaptation / survival versus cell dysfunction / apoptosis) remain to be fully clarified. theoretically, the size of cell mass is controlled by a balance between proliferation and apoptosis. either increase of cell apoptosis or decrease in cell adaptation and compensation could, therefore, reduce the cell mass in t2d patients. studies carried out during diabetes development are required to better understand the mechanism of compensatory capacity and subsequent cell loss in humans. this is of particular interest, since it could have beneficial impact for the treatment of metabolic diseases such as diabetes. it is important to note that most upr molecules have an adaptive function in cells. their role in the switch from survival to apoptosis is clearly demonstrated in vitro and in animal models but it remains unclear whether the same mechanisms occur in human cell. isolating and culturing primary cells may be very stressful and do not perfectly reflect the in vivo context. therefore the use of alternative method such as immunohistochemistry is powerful to determine the role of each branch of upr in diabetes.	pancreatic cell failure leads to diabetes development. during disease progression, cells adapt their secretory capacity to compensate the elevated glycaemia and the peripheral insulin resistance. this compensatory mechanism involves a fine - tuned regulation to modulate the endoplasmic reticulum (er) capacity and quality control to prevent unfolded proinsulin accumulation, a major protein synthetized within the cell. these signalling pathways are collectively termed unfolded protein response (upr). the upr machinery is required to preserve er homeostasis and cell integrity. moreover, upr actors play a key role by regulating er folding capacity, increasing the degradation of misfolded proteins, and limiting the mrna translation rate. recent genetic and biochemical studies on mouse models and human upr sensor mutations demonstrate a clear requirement of the upr machinery to prevent cell failure and increase cell mass and adaptation throughout the progression of diabetes. in this review we will highlight the specific role of upr actors in cell compensation and failure during diabetes.
a total of 897 clinical specimens were collected from february 2007 to january 2008 and transported to the national influenza center. two hundred and two samples belonged to children under the age of six from 897 specimens, described above, were selected. then they were tested for influenza virus types and subtypes by real time pcr assay subsequently, the specimens were tested for rsv and hmpv by hemi - nested multiplex pcr and parainfluenza viruses type 14 by hemi - nested multiplex pcr and adenovirus by hemi - nested pcr. the throat swab was taken from the kawasaki case with the history of chicken s contact. the specimen was tested for all influenza subtypes especially h5n1 and the results were negative. meanwhile pcr was done for screening of other respiratory viruses that results came out positive for rsv and hmpv. in the present study, we demonstrated the possibility to detect dual infection caused by rsv and hmpv, but because of the extravagant pattern of this case, more investigation is suggested specially on kawasaki patients. due to worldwide occurrence, substantial morbidity and mortality rates, respiratory viral infection which swiftly and easily spread, pose a serious public health problem (1). human metapneumovirus (hmpv) is one of the etiological agents of acute respiratory tract infections (artis) which can infect people in all age groups (2). it induces clinical symptoms ranging from upper to lower respiratory tract illnesses such as bronchiolitis, bronchitis and pneumonia (35). in 2001, hmpv was identified in samples from children with respiratory tract disease for the first time (6). in addition, it is a new member of the family paramyxoviridae, subfamily pneumovirus, genus metapneumovirus (7). rsv is one of the most important respiratory pathogens of childhood, with detection rates reaching 7085% in hospitalized infants during seasonal winter epidemics worldwide (1, 8). rsv causes severe lower respiratory infections like bronchiolitis or pneumonia in infants and young children (9). coinfection of hmpv with rsv in infants has been suggested to be a factor that influences the severity of bronchiolitis (9). phylogenetically, rsv is the closest human virus related to hmpv, and the clinical manifestations of hmpv may share an overlapping spectrum with rsv, so that these two viruses can not be distinguished by clinical manifestations (4, 7, 9, 10). rsv and hmpv might have similar seasonal patterns, so co - infection is possible (6, 9). this report describes a case who did not have the respiratory sign and symptoms, while was actually infected with rsv and hmpv simultaneously. a 24 mo old girl, who was originally from tehran, capital of iran, was admitted to a pediatric hospital in tehran on 29 jan 2007 with a 2 wk history of fever and erythema of cheeks, lips, throat, and mouth since 4 d ago. in spite of treating with antipyretics, fever still was persistent. on physical examination, the vital signs were as follow : respiration, 22 breath / min ; pulse, 104 beats / min and temperature, 38 c. cardiac, abdominal, neurological and respiratory findings were normal. laboratory findings were as follows : wbc count, 9.910/l ; rbc, 3.7710/l ; hb, 10.6 g / dl ; hct, 34.5% ; plt, 44310/l ; esr, 90 ; crp, + 1 ; wright / widal and salmonella para a / b, typhi d were negative., there was no problem and chest x ray was also normal. according to the findings, possible diagnosis was kawasaki syndrome and treatment with ivig, aspirin and acetaminophen was started. after one day, fever was resolved but dry cough started at the day four of the admission. because of the history of contact with chickens and possibility of h5n1, throat swab specimen of the patient was collected and sent to the national influenza center in tehran university of medical sciences for influenza surveillance. the specimen was tested for influenza virus types and subtypes by real time pcr assay using cdc procedure, cdc real - time rt - pcr (r.rt-pcr) protocol for detection and characterization of influenza virus (version.2007), but the result was negative. subsequently, as a part of a project, the specimen was tested for rsv and hmpv by hemi - nested multiplex pcr and parainfluenza viruses type 14 by hemi - nested multiplex pcr (11), and adenovirus by hemi - nested pcr (12). in our surprise positive results for rsv and hmpv were observed without any special respiratory sign and symptoms. the test was repeated and the results were confirmed again. the nucleotide sequence of the pcr product of the detected hmpv (the m gene fragment) was submitted to genbank (accession no. in the present study, we demonstrated the possibility to detect dual infection which caused by rsv and hmpv. due to the lack of sensitivity of conventional methods detection of co - infections with severe rsv bronchiolitis in small patient series had been recognized because of co - infection with other viral pathogens (14). some previous studies have lighted up increased clinical severity in case of dual infection caused by rsv and hmpv (8, 9). greensill. observed a 70% co - infection rate with hmpv and rsv and a 90% co - infection rate among intubated infants with hmpv and rsv admitted to their picu (8). although greensill. did not include an appropriate control group in their study, these findings suggest that co - infection with both hmpv and rsv is common and that together the two viruses may contribute to increase the severity of disease (9, 14). whereas in other reports hmpv did not contribute to the severity of rsv infection (15, 16). since severe rsv disease may develop in apparently healthy children, known host risk factors can not completely account for instances of severe illness. preexisting or maternally acquired immunity, innate immunity, viral factors and genotypes and environment all likely contribute to disease pathogenesis. we detected co - infection of hmpv and rsv in kawasaki patient without special respiratory sign and symptoms, we could not find the patient to follow up her and study more about the immunity status and other possibilities of this scenario. all ethical issues including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc have been completely observed by the authors.	background : respiratory virus infections in children are a leading cause of morbidity and mortality worldwide.methods:a total of 897 clinical specimens were collected from february 2007 to january 2008 and transported to the national influenza center. two hundred and two samples belonged to children under the age of six from 897 specimens, described above, were selected. then they were tested for influenza virus types and subtypes by real time pcr assay subsequently, the specimens were tested for rsv and hmpv by hemi - nested multiplex pcr and parainfluenza viruses type 14 by hemi - nested multiplex pcr and adenovirus by hemi - nested pcr.results:the throat swab was taken from the kawasaki case with the history of chicken s contact. the specimen was tested for all influenza subtypes especially h5n1 and the results were negative. meanwhile pcr was done for screening of other respiratory viruses that results came out positive for rsv and hmpv.conclusion:in the present study, we demonstrated the possibility to detect dual infection caused by rsv and hmpv, but because of the extravagant pattern of this case, more investigation is suggested specially on kawasaki patients.
	in the present study, the antioxidant activity of successive leaf extracts of dracaena reflexa was investigated using the scavenging activity on 1,1-diphenyl-2-picrylhydrazyl and reducing power by ferric reducing antioxidant power assay. methanol extract was found potent in both the assays. ic50 values of 1,1-diphenyl-2-picrylhydrazyl assay for methanol extract was 0.97 mg / ml and ferric reducing antioxidant power value for the same is 1.19. phytochemical screening, proximate analysis and total phenolic content were also determined. qualitative screening for phytochemical showed the presence of alkaloids, flavonoids, terpenoids, glycosides and saponins. highest phenolic content was shown by methanol extract (49.69 mg gallic acid equivalent / g dry weight). proximate analysis showed moisture content (3.31%), ash content (8.02%), crude fibre (1.31%), crude fat (0.97%), total protein (3.70%), total carbohydrate (86.01) and nutritive value (367.56 kcal/100 g), which would make it a potential nutraceutical. this study suggested that dracaena reflexa, a potential natural free radical scavenger, which could find use as an antioxidative.
sino - nasal undifferentiated carcinoma (snuc) is a rare malignancy first described by frierson., as an aggressive neoplasm that was clinico - pathologically distinct from other poorly differentiated malignancies of the nasal cavity and sinuses. snuc is believed to originate from schneiderian epithelium or from the nasal ectoderm of the paranasal sinuses. snuc typically presents as a rapidly enlarging tumor mass involving multiple (sinonasal tract) sites, often with an evidence of extension beyond the anatomic confines of the sinonasal tract. given the undifferentiated nature of this malignancy, however, immunohistochemical analysis is extremely helpful. with the use of a panel of markers, positive staining for neuron - specific enolase and chromogranin, cytokeratins 7, 8 and 19, nonreactive to s-100 and non - expression of vimentin. these findings suggest that the tumor is of epithelial origin and lacks any evidence of neuroendocrine, muscle, melanocyte or leukocyte differentiation. this allows proper classification of the tumor as an snuc - a malignant tumor of the sinus (sinonasal) that is of epithelial origin (carcinoma), but lacks evidence of keratin production (undifferentiated). since the initial recognition of snuc as a distinct clinicopathological entity, treatment regimens have evolved to include the current recommendation of combined radial resection, radiotherapy and chemotherapy. despite this aggressive therapy, outcome has remained dismal, with the mean survival time being less than a year after diagnosis. a 63-year - old man came to the outpatient department of saveetha dental college and hospital, chennai with the chief complaint of pain and swelling in the left side of face since two months along with pain on mouth opening. he had the habit of tobacco, betel nut chewing for the past eight years. extra oral examination revealed a diffuse swelling on the left side of the face, in the maxillary region. intraorally an ulcerated proliferative growth was seen on the left alveolar maxillary region in 24 - 27 region along with obliteration of buccal vestibule. the surface of the growth was covered with necrotic tissue with pus discharge and bleeding [figure 1 ]. limitation of mouth opening along with bilateral ulceration, bleeding and crust formation at angle of mouth was also observed. clinical picture showing the ulcerated growth with bleeding the opg revealed a radiolucent area with bone destruction and obliteration of antrum on the left side. the ct scan revealed a huge enhancing lesion involving the entire left maxillary sinus causing erosion of its superior, medial, and postero - lateral walls, extending up to the nasal cavity, left ethmoid sinus and retro maxillary space [figure 2 ]. ct scan showing the expansile mass involving the maxillary sinus microscopic examination of the biopsy specimen revealed pleomorphic undifferentiated epithelial cells in the form of nests and trabeculae separated by thin fibrous connective tissue septa [figure 3 ]. the cells were of variable size and shape, large cells with amphophilic cytoplasm with round to oval diffusely hyperchromatic nuclei with or without small nucleoli are seen interspersed with cells which have vesicular nuclei and prominent nucleoli [figure 4 ]. very few areas of squamous cells were appreciated along with areas of necrosis and increased mitotic activity. pleomorphic undifferentiated epithelial cells in the form of nests and trabeculae separated by thin fibrous connective tissue septa (h&e, 10) photomicrograph showing large cells with pleomorphic nuclei (h & e, 40) immunohistochemical assay revealed immunoreactivity of the neoplastic cells to cytokeratin (ck7, 8, 19) [figure 5 ] and epithelial membrane antigen. photomicrograph showing positive reactivity to cytokeratin (40) the patient subsequently underwent maxillectomy of the left maxilla including the zygomatic process, floor of orbit, ramus of mandible with supra - omohyoid neck dissection. the patient subsequently underwent radiation therapy and is now on a regular follow - up for the past one year. snuc is an uncommon, highly aggressive, and clinicopathologically distinctive carcinoma of uncertain histogenesis.. there may be an association with cigarette smoking or a previous history of radiation therapy. in contrast to nasopharyngeal carcinoma, an association with epstein - barr virus infection has not been demonstrated. the most common symptoms are nasal obstruction, proptosis, cranial nerve palsies, periorbital swelling, diplopia, epistaxis, and periorbital pain. the duration of symptoms for these cases varied from a few weeks to five months. these tumors are large, involved multiple paranasal sinuses, and produced marked destruction of sinus walls. invasion of the orbital bones occurred in along with penetration of the cranial cavity, and spread to the nasopharynx. most of these features are consistent with the findings in our case. the computed tomography (ct) and mri features of snuc are bone destruction and invasion of adjacent structures, including the anterior cranial fossa, adjacent paranasal sinuses, and orbits. when formulating a differential diagnosis for a swelling in proximity to the jaws, it is often helpful to determine first, by radiographic examination, whether the enlargement originates primarily in bone or in the extraosseous soft tissue. common intraosseous expansile radiolucent lesions would include central giant - cell granulomas, developmental odontogenic cysts (dentigerous cyst, odontogenic keratocyst), as well as odontogenic tumours (ameloblastoma). when faced with an expansile radiopaque or mixed radiopaque radiolucent intraosseous lesion, the possibility of a benign fibro - osseous lesion should be considered. an infection of odontogenic origin is the most common cause of a soft tissue swelling of the maxillary buccal vestibule. less common reactive or neoplastic lesions of connective tissue origin, such as inflammatory myofibroblastic tumour, nodular fasciitis, myofibroma and desmoplastic fibroma should also be included in the differential diagnosis. finally, the possibility of a malignant neoplasm of the maxillary antrum, although uncommon, should be considered.[35 ] the differential diagnosis of such neoplasms includes esthesioneuroblastoma, neuroendocrine carcinoma, rhabdomyosarcoma, lymphoepithelioma, lymphoma, melanoma, and poorly differentiated adenoid cystic carcinoma. they can be distinguished by their clinical, light microscopic, electron microscopic, and immunohistochemical features. immunohistochemistry is an important tool that can be valuable in reaching a diagnosis in such a situation. the light microscopic features of snuc include the presence of a hypercellular proliferation with varied growth patterns, including trabecular, sheet - like, ribbon, lobular, and organoid patterns. the tumor cells are medium to large sized and round to oval and have pleomorphic and hyperchromatic nuclei, inconspicuous to prominent nucleoli, varying amount of eosinophilic cytoplasm, high nuclear - to - cytoplasmic ratio, marked increase in mitotic activity frequently with atypical mitoses, tumor necrosis, and apoptosis. the presence of squamous cell differentiation would correlate to origin in the schneiderian epithelium, thereby conferring an ectodermal derivation to these tumors. adjunct analyses (e.g., immunohistochemistry, electron microscopy, and molecular biologic studies) are often required in the diagnosis of snuc and in differentiating it from other undifferentiated malignant neoplasms. in accordance with the literature, the immunostaining for cytokeratin 7,8 and 19 and ema were documented in our present case. due to the small number of reported cases, the ideal treatment regimen has not been systematically evaluated. patients with snuc have a high rate of both local regional recurrence and distant metastasis. moreover, because of the complex anatomy of the head and neck area, complete removal of the tumor with wide margins is not always possible. the treatment of snuc includes aggressive multimodality therapy, including surgical resection and adjuvant therapy (i.e., radiotherapy, chemotherapy). the prognosis associated with snuc is poor, and death due to disease often occurs within short periods following the diagnosis. it is important to recognize and differentiate this distinct tumor from other nasal tumors because of its aggressive behavior, since early intervention may result in a successful outcome. our patient had undergone a combination treatment protocol comprising surgery and radiotherapy and is remaining disease free for the past one year and is on a regular follow - up. in conclusion, we describe a rare case of snuc of the maxillary sinus confirmed by ihc markers, who had undergone combination treatment protocol and remaining disease - free for the past one year.	malignant neoplasms of the paranasal sinuses and nasal cavity are rare, comprising only 3% of all head and neck malignancies. this includes both primary sinonasal neoplasms and metastatic disease. we present the case of a patient with a maxillary soft tissue swelling, which proved to be a rare malignant tumor of maxillary sinus origin, a sinonasal undifferentiated carcinoma
lichen striatus (ls) is an uncommon, asymptomatic, self - limiting dermatosis which lasts an average of nine months and usually occurs in children, although it is also rarely seen in adults. it often arises without a clear trigger, but some cases would appear to be related to several possible precipitating events such as infections and, more rarely, cutaneous injury, trauma, hypersensitivity, or other unspecified factors. ls typically presents as a continuous or interrupted linear band of pink, tan, red, or skin - colored papules that follow blaschko 's lines, which represent the pathways of cutaneous cell migration during embryonic development. the lesions are generally solitary and unilateral, but unusual cases with multiple and bilateral lesions have been rarely reported. however, this therapy is not always effective and its prolonged use may be associated with certain adverse effects including cutaneous atrophy. other anecdotal therapies include oral corticosteroid, photodynamic therapy, topical calcineurin inhibitors, and oral acitretin. we report a case of ls unresponsive to topical steroid therapy associated with psoriasis vulgaris, successfully treated with oral acitretin. a 61-year - old woman was admitted for an asymptomatic linear skin eruption of the right lower limb that had started about four weeks earlier. during this period of time, the lesions had been treated with a topical corticosteroid (mometasone furoate cream 0.1% once a day) without any significant improvement. skin examination revealed linearly arranged erythematous papules on and along the right lower limb following the line of blaschko [figure 1a ]. histopathologic examination of a papule revealed parakeratosis, acanthosis, piecemeal disappearance of the stratum granulosum, lymphocytic exocytosis, mild spongiosis, and a superficial and deep perivascular, lichenoid, perifollicular, and perieccrine infiltrate of lymphocytes and histiocytes [figure 1b ]. on the basis of the clinical and histological data, a diagnosis of ls was made. in addition to ls, she had chronic plaque psoriasis of 15 years duration mainly localized to the elbows and scalp that had progressively extended to her arms and trunk [figure 2a ] over the past three months. for this psoriatic exacerbation, the patient had been applying an ointment containing calcipotriol 50 g / g and betamethasone dipropionate 0.5 mg / g (once a day) with only slight improvement. since the woman had already used methotrexate and cyclosporine in the past with poor tolerance, we decided to start oral acitretin (0.5 mg / kg / day). interestingly, we found that ls regressed completely and rapidly after only four weeks [figure 2b ]. the patient continued therapy with acitretin at the same dosage for other two weeks ; thereafter, the drug was tapered over the subsequent four weeks due to resolution of psoriatic lesions. no recurrence of ls and psoriasis was observed during the subsequent four - month follow - up period. linearly arranged erythematous papules on and along the right lower limb following the line of blaschko (a) parakeratosis, acanthosis, piecewise disappearance of the stratum granulosum and spongiosis. inflammatory chronic infiltrates is also observed in the epidermis and around the vessels and skin appendages in the superficial dermis (h and e, 20) (b) several psoriatic plaques of the back (a) complete regression of lichen striatus after 4 weeks of oral acitretin therapy (b) the association between ls and psoriasis is a rare event, since, to the best of our knowledge, there are only two well - documented published reports in the literature. the first case was a 2-year - old boy with a ls localized to his left half of the body who developed an unusual form of unilateral eruptive psoriasis limited to the right half of the body 2 weeks later. the authors stressed that a common, but unknown, triggering factor may have been involved. the second report described a 58-year - old man suffering from plaque psoriasis who developed ls at the third session of narrow - band ultraviolet b phototherapy instituted for a psoriatic exacerbation that had manifested 5 months earlier. in this case, the authors hypothesized that the association between two dermatoses was a mere coincidence. we believe that also in our case the association between the two dermatoses is casual, since a wide time gap between the appearance of each. although ls is an asymptomatic and self - limited dermatosis, it may cause a significant psychological distress in some patients, thus requiring an appropriate therapy. several treatments have been reported with various degrees of success including oral and topical corticosteroid, photodynamic therapy, topical calcineurin inhibitors, and oral acitretin. regarding this last therapy, there is only one report describing an extensive case of ls markedly improved over the course of a few weeks with an attack dose of 0.6 mg / kg / die. in our case of ls, the patient was found to be resistant to topical steroid treatment while she had a complete and rapid response to oral acitretin. ls has been considered to be the consequence of an acquired stimulus that induces a loss of immune tolerance to embryologically abnormal clones, resulting in a t - cell - mediated inflammatory reaction, which causing the typical blaschko linear lesions histopathologically characterized by lichenoid, lymphocytic infiltrate with overlying epidermal acanthosis, dyskeratosis, hyperkeratosis, occasional parakeratosis, and lymphocytic exocytosis. therefore, it can be assumed that therapeutic efficacy of acitretin is attributable to its effect on cutaneous immunomodulation as well as epithelial cell proliferation and differentiation. in conclusion, the clinical improvements observed in this report tend to further support the efficacy of oral acitretin in the treatment of ls and suggest its use not only in extensive and unaesthetic forms but also in cases unresponsive to steroid therapy.	lichen striatus (ls) is an uncommon dermatosis of unknown etiology that presents as a continuous or interrupted linear band of pink, tan, red or skin - colored papules in a blaschkoid distribution. the lesions are generally solitary and unilateral, but unusual extensive cases with multiple and bilateral lesions have been also described. albeit ls is typically an asymptomatic and self - limited dermatosis, it may cause a significant psychological distress in some patients, thus requiring an appropriate therapy. topical steroid is the most commonly used treatment but it is not always effective. we report a case of ls unresponsive to topical steroid therapy associated with psoriasis vulgaris successfully treated with oral acitretin.
gastrinomas are neuroendocrine tumors (net), primarily located in the duodenum or pancreas. gastrin overproduction causes the zollinger - ellison syndrome, which includes ulceration of the gastrointestinal tract, mainly the jejunum, resulting in abdominal pain and diarrhea. the incidence of gastrinomas is 0.52 per million per year and therefore very rare [2, 3 ]. gastrinomas are classified according to a grading system, similar to other pancreatic neuroendocrine tumors (pnets). this grading is based on histopathology and subdivided into immunostaining for tumor markers and proliferation markers (table 1). using the current who criteria, grades 1 and 2 are well - differentiated pnets with increased expression of the tumor markers, chromogranin a, and synaptophysin. grade 3 tumors are poorly differentiated with areas of necrosis and decreased expression of chromogranin a [3, 5 ]. up to 25% of the gastrinomas liver metastases are the most important prognostic factor for survival [2, 6 ]. ten - year survival of patients with diffuse liver metastases is 16% compared to 90% 10-year survival in patients who underwent a curative gastrinoma resection. for patients with unresectable liver metastases, patients with liver metastases may experience symptoms such as weight loss, pain, and anorexia, particularly caused by tumor load. liver metastases derive the majority of their blood supply from the hepatic artery, compared with normal liver parenchyma, which derive the majority of the blood supply from the portal venous circulation. postembolization syndrome is the most important complication after embolization, characterized by symptoms of fever, unremitting nausea, general malaise, loss of appetite, and abdominal pain. the exact cause is not yet entirely clarified ; however, it may be a result of tumor ischemia and inflammation of the liver tissue [8, 9 ]. only a small series describes the effect of hepatic embolization of liver metastases from gastrinomas. the aim of this study is to present our single - centre experience of the effect of selective arterial embolization for gastrinomas in symptoms reduction, complications, and response rate. these results are compared to the literature results, and a protocol for patients care during embolization is presented. all patients with liver metastatic gastrinomas, treated by selective hepatic artery embolization, were selected from a prospective database starting in january 1992 up till december 2012. diagnostic strategy for gastrinoma patients includes serum chromogranin a and gastrin levels, preferably after a 10-day cessation of the proton pump inhibitors (ppis). our treatment protocol for gastrinoma patients consists of a resection in patients with a solitary resectable primary lesion or a resectable primary lesion with resectable liver metastases. patients with a gastrinoma and irresectable liver metastases do not undergo resection of the primary gastrinoma. patients with irresectable liver metastases are treated with ppi 's sometimes combined with somatostatin analogues. the indication for embolization is an insufficient response to medical treatment for relief of symptoms or progressive disease confined to the liver. if embolization is not possible or patients have progressive disease after embolization therapy, further chemotherapeutical options or peptide receptor radionuclide therapy options embolization response is evaluated according the response evaluation criteria in solid tumors (recist). patients were considered in complete response (cr) if gastrin or chromogranin levels were normal and target lesions disappeared. a partial response (pr) was considered if at least 30% reduction was achieved of the tumor markers or target lesions. the progression of disease (pd) is described as 20% increase of tumor makers or if new lesions were noticed. the literature search was performed in pubmed and embase using the following headings : gastrinoma, liver metastases, neuroendocrine tumors, carcinoid, zollinger - ellison syndrome, and embolization. in the included studies, all abstracts in english which evaluate hepatic artery embolization for liver metastases in patients with net were included. studies were excluded if patients were treated with hepatic arterial chemoembolization (tace) alone instead of hepatic artery embolization and if treated patients had no gastrinoma or pnet, such as midgut carcinoid or lung net. three patients were identified (table 2) from a total of 109 pnet patients in the database including 13 gastrinomas. of the 13 gastrinoma patients, 1 patient had lymph nodes metastases and will not be further discussed ; 11 patients were previously described. after an episode of undesirable weight loss of 15 kg, an ultrasound showed single liver metastases. patient 2 is a 43-year - old male without other morbidities. at presentation, there was a disease - free survival of 76 months after resection of a pancreatic gastrinoma. then symptoms of the zollinger - ellison syndrome recurred caused by resectable liver metastases. after a 6/7 liver segment resection, symptoms returned 16 months later because of new liver metastases. patient 3 is a 58-year - old man with a previous history of diverticulitis which was treated with a sigmoid resection. he presented with a duodenal perforation and underwent a damage control laparotomy and primary closure of the defect with a prolonged hospital stay including multiple drainage procedures and intensive care episodes. imaging during this episode also showed multiple right - sided liver metastases and a gastrinoma of the pancreas. symptoms were treated with a ppi (40 mg twice a day), and patients had increased symptoms when these ppis were discontinued, for example, for blood tests for chromogranin a and gastrin measurements. all patients had elevated levels of chromogranin a and/or gastrin (table 3) before embolization. indications for embolization were patients ' choice of treatment for embolization instead of liver resection in patient 1 and multiple liver metastases in left and right liver in patient 2. the third patient had major complications after duodenal perforation combined with zollinger - ellison syndrome, and embolization was performed to reduce symptoms while recovering before the curative gastrinoma and right liver resection could be performed. selective embolization was performed with polyvinyl alcohol (pva) particles of the selective left or right hepatic artery (figure 2). in these three patients, embolization was performed as a one - stage procedure, regardless if the lesions were diffusely spread in the left and right liver. in patient 1, extreme selective embolization of the right hepatic artery occurred, in patient 2, both arteries, and in patient 3, only the right hepatic artery. patient 1 started selective embolization treatment in 2010, patient 2 in 2007, and patient 3 in 2010. patient 2 developed symptoms of fever, general malaise, and abdominal pain 4 days after embolization. patient 3 experienced symptoms of general malaise, chest pain, nausea, and sweating without a cardiac or pulmonary cause. the patient was observed for one day extra without any further complications or reinterventions. all patients experienced a clinical response ; in patients 2 and 3, the ppis dose was reduced by 50% without worsening of symptoms. in all patients, symptoms of diarrhea or chromogranin a and gastrin levels declined after embolization in two patients (table 3). patient 2 had diffuse disease progression of other new liver lesions, including rise of gastrin level. all patients had a complete radiological response (table 3) after 6 months of the treated liver lesions. patient 2, with diffuse liver metastasis, had tumor progression of new liver metastases. after embolization, he also underwent radiofrequency ablation (rfa) therapy, surgical metastasectomy, and finally peptide receptor radionuclide therapy (prrnt). he died 162 months after the initial pancreatic resection and 41 months after embolization therapy due to progressive disease including pancytopenia and aplastic anemia after recent pprnt. patient 3, with diffuse liver metastasis in the right liver lobe, was eligible for surgical resection of pancreatic gastrinoma and liver metastases after embolization which successfully took place, one year after embolization. progression - free survival (pfs) of patient 1 is 20 months after embolization. because of recurrent increase in gastrin and chromogranin a 2-no progression - free survival can be related to embolization because of the diffuse progression of new liver metastases. patient 3 has a pfs of 26 months after embolization and is currently still tumor free but also underwent a right hemihepatectomy 12 months after embolization. less is known about the effect of liver embolization for liver metastases in patients with pnet, given the amount of publications. therefore, all studies regarding pnet and liver metastases treated with liver embolization are listed in table 4. of all the studies, 8 studies only described the results of pnet without specifying the presence of gastrinomas [1320 ]. some of the studies mentioned the number of gastrinoma patients but not the specific individual response. it is not described if the presented results apply for the included gastrinoma patients. two studies have included patients treated with tae or tace [15, 21 ] without differentiation by types of treatment. five studies have included gastrinomas [2125 ] all presented an objective response after embolization for the total group of included patients. a clinical response is seen, from symptom relief up to a complete response in 59% of the patients, [2224 ] and a biochemical response is described with a reduction of hormone levels in 50% [2325 ]. the radiological response is not uniformly described, from the presence of tumor regression to a partial response of 67% [21, 24, 25 ]. all patients with liver metastatic gastrinoma in the present study treated with selective hepatic artery embolization showed a clinical, biochemical, and radiological response., patients suffer from the typical zollinger - ellison syndrome, which impaired their daily life due to symptoms of the zollinger - ellison syndrome. after selective embolization, besides heartburn, treated with only half doses of ppi, there were no symptoms left. a complete radiological response was seen in all patients in the treated lesions after 6 months. therefore, selective embolization of gastrinoma liver metastasis seems to be an effective treatment for the reduction of symptoms. this is also shown in other studies including different pnet and carcinoid patients. in general, liver embolization is only effective on treated lesions, other metastases remain untreated. in patients with tumors that demonstrate aggressive growth, an additional treatment is recommended. in metastatic gastrinomas, surgical resection remains the best option for extended survival. in patients with diffuse liver metastases, different kinds of treatment options, including rfa, radioembolization, and prrt, are available. the toxic effects after rfa treatment may lead to liver abscesses, cholangitis, hepatic infarction, subcutaneous abscesses, and pleural effusion. radioembolization may lead to pancytopenia caused by bone marrow suppression, pulmonary insufficiency secondary to radiation pneumonitis, gastric and duodenal ulceration, and ascites. compared to these treatments, toxicity of tae is relatively mild as was also shown in our patients. patients were treated according to our own institute embolization protocol to prevent the postembolization syndrome which is described in 82% of patients. nevertheless, two out of three patients suffered from mild symptoms of postembolization syndrome resulting in extended hospital stay of one day and readmission of 2 days. since liver abscess is very infrequent in patients without previous bile duct involving operations and described to be only 0,4%, no standard antibiotic prophylaxes or treatment are added to the protocol. however, the patient with previous pancreatic and liver resections was treated with antibiotics during the hepatic artery embolization to prevent infectious complications. this net embolization protocol does include treatment with corticosteroids, as described in patients with hcc. the rationale for corticosteroids is not only edema prevention for decreased liver capsular pressure and subsequent pain reduction but also to reduce the immune response [31, 32 ]. only five studies describe detailed results of hepatic artery embolization in gastrinoma patients (table 4). most studies show results of embolization in pnet and carcinoid patients without differentiation for tumor type or tumor grade / stage. overall results of hepatic artery embolization of patients with pnet liver metastases show a 17100% effect on either clinical, biochemical, or radiological measurements. complications and postembolization syndrome were not well described in these studies and could not be compared to our results. this is the first study describing the exact response rate of tae in liver metastatic gastrinomas. gastrinoma with liver metastases is a rare condition with a broad spectrum of treatment strategies [2, 3 ]. selective hepatic artery embolization leads to symptom control of the zollinger - ellison syndrome in liver metastatic gastrinomas. post embolization syndrome is the most important complication after hepatic artery embolization ; therefore, careful treatment protocols must be available for prevention of tumor necrosis syndrome after posthepatic artery embolization. our advice is to discuss every patient in a multidisciplinary meeting with endocrinologists, oncologists, pathologists, hpb surgeons, and (intervention) radiologists. treatment should be based on their tumor classification, tumor burden, complaints, and quality of life considerations.	background. gastrinomas are rare functional neuroendocrine tumors causing the zollinger - ellison syndrome (zes). at presentation, up to 25% of gastrinomas are metastasized, predominantly to the liver. embolization of liver metastases might reduce symptoms of zes although a postembolization syndrome can occur. in this study, the results of embolization are presented, and the literature results are described. methods. from a prospective database of pancreatic neuroendocrine tumors, all patients with liver metastatic gastrinomas were selected if treated with arterial embolization. primary outcome parameters were symptom reduction, complications, and response rate. the literature search was performed with these items. results. three patients were identified ; two presented with synchronous liver metastases. all the three patients had symptoms of zes before embolization. postembolization syndrome occurred in two patients. six months after embolization, all the 3 patients had a clinical and complete radiological response ; a biochemical response was seen in 2/3 patients. from the literature, only a small number of gastrinoma patients treated with liver embolization for liver metastases were found, and similar results were described. conclusion. selective liver embolization is an effective and safe therapy for the treatment of liver metastatic gastrinomas in the reduction of zes. individual treatment strategies must be made for the optimal success rate.
mucinous cystic tumors of the ovary rarely contain one or more solid mural nodules in which the histological features differ markedly from the background of benign, borderline or malignant mucinous neoplasms. four varieties of mural nodules have been described, including true sarcomas, sarcoma - like mural nodules (slmn), foci of anaplastic carcinoma and mixed type. slmn stend to occur in younger women and are characterized by smaller size, sharp demarcation, a heterogeneous cell population, and no serious impact on the prognosis. it should be differentiated from true sarcomatous mural nodules and foci of anaplastic carcinoma with areas of sarcomatoid differentiation since both of these lesions carry a graver prognosis. we report a very rare case of slmn in a borderline mucinous tumor of the ovary. a 30-year - old unmarried female patient presented with progressive abdominal enlargement for last 7 months. she also complained of mild lower abdominal pain and discomfort for last 2 and half months. a cystic swelling of about 18 - 20 weeks size reaching just below the level of umbilicus was felt on physical examination. ultrasonography revealed a left ovarian cystic space - occupying lesion(sol) of 12 cm 9.6-cm size with internal echogenicity and septations. grossly the cystic ovarian mass [figure 1a ] measured 13.8 cm 12 cm 8 cm. an elevated firm, well - definednodular area measuring 4.8 cm 3.6 cm 2.5 cm was noticed on the inner surface of the largest locule. microscopic examination displayed the histopathological features of a borderline mucinous tumor showing complex cribriform architecture with mild to moderate cellular atypia along with an adjacent circumscribed nodular area [figure 1b and d ]. however, no recognizable glandular structures infiltrating into the deeper part of the nodule were identified. the nodular area was predominantly composed of pleomorphic spindle cells with hyperchromatic nuclei and occasional prominent nucleoli arranged in a vaguely fascicular pattern. the pleomorphic cells focally demonstrated smooth muscle and rhabdomyoblastic differentiation [figure 2a and b ]. frequent mitotic figures including atypical forms admixed with histiocytes and inflammatory cells especially eosinophils were noticed. immunohistochemistry for cytokeratin was focally positive and vimentin was diffusely positive in the pleomorphic spindle cells of the nodule. overall, the histopathogical features of the nodule closely mimicked that of a sarcoma except the presence of circumscription and absence of vascular invasion. true sarcoma, atypical inflammatory myofibroblastic tumor, carcinosarcoma were considered as differential diagnoses. however, considering the circumscription of the nodule in macroscopy as well as in microscopy along with corroborative histopathological and immunohistochemical findings, the diagnosis of a borderline mucinous tumor with slmn was made. (a) mucinous cystic neoplasm of ovary with mural nodule (b) a well - circumscribed slmn alongwith borderline mucinous tumor (h and e, 100) (c) a cellular well - demarcated nodular area of slmn (h and e, 100) (d) complex atypical cribriform glands of borderline mucinous neoplasm (h and e, 400) (a) photomicrograph showing prominent mitotic figures and smooth muscle differentiation in slmn (h and e, 400) (b) rhabdomyoblastic differentiation in slmn (h and e, 400) (c) photomicrograph showing coagulative necrosis in slmn (h and e, 400) (d) atypical mucinous glands showing strong cytokeratin positivity and spindle cells of the nodule in the background displaying focal and weak cytokeratin positivity (h and e, 100) in 1979, prat and scully reported 14 cases of slmns, seven of them from the previous literature, and pointed outtheir favorable clinical behavior. they described three types of morphology in slmns namely pleomorphic and epulis type, pleomorphic and spindle cell type and giant cell - histiocytic type. sarcomatous nodules can exhibit a variety of patterns, including fibrosarcoma, rhabdomyosarcoma, and undifferentiated sarcoma. mixed nodules may feature carcinosarcoma or a mixed anaplastic carcinoma and sarcoma - like nodule. the present case displayed the morphology similar to the pleomorphic and spindle cell type with areas of smooth muscle and rhabdomyoblastic differentiation. in contrast to slmns, the sarcomatous nodules and foci of anaplastic carcinoma which can also present as mural nodule, tend to occur in older patients and are characterized by larger size, poor circumscription, a monotonous spindle cell population in the former, evidence of carcinomatous differentiation in the latter, and aggressive behavior. anaplastic carcinomatous nodules generally have spindled and rhabdoid cells with unequivocal cytologic features of a high - grade malignancy, and are associated with intraepithelial or invasive mucinous carcinoma in 72% of cases. atypical inflammatory myofibroblastic tumors may resemble slmns possibly due toa florid reaction to intramural hemorrhage or spilling of mucinous material in cystic ovarian tumors. in contrast to slmns that occur in association with an epithelial tumor, inflammatory myofibroblastic tumors have a predilection for relatively younger patients, appear de novo, and are larger and less well circumscribed. although various hypotheses have been proposed to explain the histogenesis of the slmns, it probably represents a reactive and self - limited phenomenon within a neoplasia. slmns usually strongly express vimentinand focally or weakly express cytokeratin, similar to true sarcomas yet distinct from anaplastic carcinomas that usually have strong / diffuse cytokeratin expression. finally the age of the patient, well circumscription of the nodule and lack of vascular invasion were the only parameters that led us to the correct diagnosis. the outcome of mucinous tumors with slmns is the same as the corresponding category of mucinous tumors without the nodule. but slmns should be regarded with caution as their histologic appearance is worrisome and clinical follow - up data are very limited. hence, careful and meticulous examination of this rare lesion within a mucinous cystic tumor is essential for reassuring the patient of a favorable clinical outcome and for excluding the similar looking aggressive lesions having poorer outcome.	sarcoma - like mural nodule (slmn) is a very uncommon and misleading benign entity which may be associated with benign, borderline or malignant mucinous neoplasm of the ovary. it should be distinguished from other malignant mural nodules with sarcoma, carcinosarcoma or anaplastic carcinoma for proper management. we report a rare case of slmn in a borderline mucinous tumor of the ovary in a 30-year - old lady. in spite of having confusing histopathological features the final diagnosis was made depending on the younger age of the patient, well circumscription of the nodule, absence of vascular invasion and immunohistochemical profile.
in 1987, researchers hunting for cytotoxic cell surface molecules isolated a cdna from activated cd8 t cells and called it cytotoxic t cell antigen (ctla)-4 (2). genetic studies provided a clue that connected ctla-4 to t cell costimulation : ctla-4 and cd28 both mapped to the same chromosomal neighborhood and shared a high degree of sequence similarity (3). this information caught the attention of jeffrey ledbetter and peter linsley at the bristol - myers squibb research institute (seattle, wa). at the time, their group was studying b7-cd28 interactions using a soluble version of cd28 that lacked transmembrane and intracellular domains. the soluble cd28 protein worked just as well as the cell - attached version in binding b7 (4). the team hedged their bets on the similarities between ctla-4 and cd28 and tested whether ctla-4 also bound b7. soluble ctla-4 turned out to bind b7 with 20-fold higher avidity than the soluble cd28 protein, establishing ctla-4 as a second receptor for b7. the group published these results in the journal of experimental medicine in 1991 (5). it now seemed that ctla-4 was a third switch in what was previously thought to be a two - switch circuit for t cell activation. but whether it promoted or jammed the circuit was a contentious issue for several more years. the debate arose because in vitro assays of costimulation - dependent t cell proliferation offered multiple interpretations. but when soluble ctla-4 was added to the mix, this proliferation was strongly inhibited (5). one interpretation of this finding was that the soluble ctla-4 blocked the binding of b7 to the ctla-4 on the t cells. in this model, this conclusion was supported when the group showed that antibodies to ctla-4 enhanced cd28-stimulated proliferation (6). a second interpretation, however, was that soluble ctla-4 might block proliferation by gumming up b7 's interaction with cd28. and the ctla-4 antibody might enhance proliferation not because it stimulates clta-4 's proliferative power, but because it blocks ctla-4 's negative signal. this alternative role for ctla-4 was supported by the work of james allison and his team at the university of california (berkeley, ca), which was also published in the jem (7). this group studied cross - talk among tcr, cd28, and ctla-4 by cross - linking these receptors. t cells proliferated when the tcr was linked to cd28, but not with ctla-4. t cell proliferation was greatly reduced when all three receptors were cross - linked simultaneously, suggesting that ctla-4 inhibits cd28 costimulation. the generation of ctla-4 knock - out mice finally put the conflict to rest. these animals develop a fatal t cell proliferative disorder, as their t cells lack the brakes to hold them in check (8). one benefit of enhancing t cell responses via ctla-4 blockade is the strengthening of antitumor immunity. allison 's team found that tumor - transplanted mice injected with antibodies that block ctla-4 activity rejected several different types of tumors and had long - lasting antitumor immunity (9). human anti - ctla-4 mabs are now in phase iii clinical trials against melanoma and renal carcinomas. the t cell inhibiting soluble ctla-4 originally defined by linsley and ledbetter is now used to treat autoimmune diseases such as rheumatoid arthritis.	ctla-4 was first identified in 1991 as a second receptor for the t cell costimulation ligand b7. uncertainties about its biological function plagued the early years after its discovery until 1995, when it was confirmed to be an inhibitor of t cell responses. ctla-4 has since scored in the clinic as a target for antitumor therapy and as a soluble inhibitor of autoimmunity.
adolescent idiopathic scoliosis (ais) is the most common pediatric musculoskeletal disorder that affects the spine and is characterized by a three - dimensional deformity of the spine, and altering coronal and sagittal profiles. brace treatment is the most common non - operative intervention for the prevention of curve progression, but the rate of treatment success is only 72%. numerous studies have proposed a broad variety of theories to elucidate the etiologies and pathogenesis behind ais, including genetic predisposition, neuromuscular dysfunction, and hormonal and environmental factors. trunk muscle imbalance is one of the most important factors in the onset and progression of ais. authors have postulated a muscle balancing / tuning theory to explain the mechanism of muscle imbalance causing progression of ais. moreover, there are some interesting study findings that have shown that some ais risk loci, identified by genetic study, occurred in regions near or within genes associated with muscle biogenesis. since many authors focused on the differences in electromyographic activity and histological changes of paravertebral muscle in patients with ais, there is limited research on muscle volumetric and fatty infiltration imbalance of patients with ais. whether the changes of muscular morphology occur in all of the levels of vertebrae involved in the major curve remains unresolved. the objective of this study was to measure the muscular volume and fatty infiltration rate of paravertebral muscles in different vertebra levels of ais patients and to analyze the relationship between the degree of imbalance and several radiographic parameters, such as the apical vertebral translation and coronal cobb angle, which would provide a better understanding of mechanisms underlying the development and progression of ais. this was a prospective cross - sectional study on 34 consecutive ais patients with primary thoracic scoliosis (lenke i iv) identified at the forth spine department of shanghai changzheng hospital during the period from january 2014 to september 2016, following institutional review board approval. inclusion criteria were as follows : coronal thoracic cobb angle was over 40 or there was an increase of more than 5 per year. patients were excluded from the study if had identified lenke v, vi or other types of scoliosis (congenital, neurological, etc.) ; received previous treatment for ais ; had a history of spine surgery ; or had other pathological conditions involving the spine or paravertebral muscle. standardized anteroposterior (ap) and lateral standing films were obtained. on each ap radiograph the following parameters were measured besides main thoracic coronal cobb angle : the thoracic apical vertebral translation (avt), which is the distance between the apical thoracic vertebra of the curve and the c7 vertebra plumb line ; the coronal balance (cb), which is the distance between the c7 vertebra plumb line and the central sacral vertical line ; the thoracic kyphosis (tk) was measured on lateral radiographs for each patient and was defined as the angle between the superior endplate of t4 and the inferior endplate of t12. the mri system used in this study was a 3.0 tesla imaging system (achieva nova dual ; philips medical systems, hamburg, germany). a sagittal sequence was performed with the following sequences : t1-weighted turbo spin echo se (tr 550 ms, te 12 ms) and t2-weighted turbo se (tr 4,000 ms, te 120 ms). with the same sequences, transverse images were acquired at the level from t4l1, where the major thoracic scoliosis curvature in ais patients is usually located, with each slice of 4 mm section thickness, a 180180 mm field of view, and a 512512 matrix per level. to explore the imbalance of the paravertebral muscles, the muscle volume of deep paravertebral muscles at the level of the apical vertebra, upper end vertebra, and lower end vertebra was calculated. because the paravertebral muscle is too small in the thoracic region to measure, and it is difficult to isolate one specific muscle from the other, we grouped the deepest muscle layer of the thoracic spine, including the thoracic multifidus, semispinalis, and rotator muscles, and referred to them collectively as the deep thoracic paravertebral muscle. transverse images were parallel to the vertebra at the apex, but not at the level of upper end or lower end vertebra because of the cobb angle, which could influence the calculation of the muscle volume at these levels. after normalization, the bilateral cross - sectional area (csa) of the deep paravertebral muscles were measured by outlining the fascial boundary of the muscle manually using the image j ver.1.3 software. the csas of eight consecutives slices in t1 sequence, approximately the thickness of a vertebra, were used to get a volume associated with each vertebral level. the fatty infiltration rate was measured using a pseudo - coloring technique as mentioned by lee.. to facilitate the correlation test of the degree of muscle imbalance with radiographic parameters, the difference indexes of muscle volume and fatty infiltration rate were calculated as follows : continuous data were summarized as means with standard deviation (sd). for pair - wise comparisons between the convex and concave side, either a one - sample t - test or one - sample wilcoxon test was used. one - way anova test or snk test were used for comparison of difference index of muscle volume and fatty infiltration rate within different levels. pearson correlation test was used to analysis the correlation between the difference index and the cobb angle, age, tk, avt, and cb. continuous data were summarized as means with standard deviation (sd). for pair - wise comparisons between the convex and concave side, either a one - sample t - test or one - sample wilcoxon test was used. one - way anova test or snk test were used for comparison of difference index of muscle volume and fatty infiltration rate within different levels. pearson correlation test was used to analysis the correlation between the difference index and the cobb angle, age, tk, avt, and cb. a total of 34 patients (28 females, 6 males) with an average age of 14.3 years (range 1117 years) were included in this study. based on lenke s classification, there were 18 type i, 7 type ii, 6 type iii, and 3 type iv (figure 1). all patients demonstrated thoracic convexity to the right and the mean cobb angle of the major thoracic curve in coronal plane was 48.2 (range from 28.3 to 65.8). the upper end vertebrae involved in the major thoracic curve ranged from t4t7, while the lower end vertebrae ranged from t9l1 (table 1). for both sides, the muscle volume increased from upper end vertebra to lower end vertebra. and the muscle volume was significantly larger on the convex side rather than that on the concave side at the three levels studied (table 2, figure 2). different from the result of the muscle volume, significantly higher fatty infiltration rate was found on the concave side of the scoliosis curve (table 3). to find the differences in degree of the muscle imbalance in the three levels, we compared the difference index of the muscle volume and fatty infiltration rate (table 4). the difference index of muscle volume was significantly larger at the apex of the curvature level than at the upper end vertebra level or lower end vertebra level (p=0.002 and p=0.000, respectively). the difference index of muscle volume was not significant statistically between the upper end and lower end vertebra level. however, the difference index of fatty infiltration rate was similar within the three levels. in the correlation test, the difference index of muscle volume at the apex level was negatively correlated with the apex vertebra translation (r=0.749, p=0.032), but not with age, cobb angle, thoracic kyphosis, or coronal balance (table 5). the difference index of fatty infiltration rate was positively correlated with the apex vertebra translation (r=0.727, p=0.041) and cobb angle (r=0.866, p=0.005). the main finding of this study was that a magnetic resonance imaging of the paravertebral muscles revealed significant asymmetry in muscle volume and fatty infiltration with larger volume on the convexity of the scoliotic curves and higher fatty infiltration rate on the concave side. the muscle imbalance occurred not only at the apex of the ais major curve, but also at the level of upper end and lower end vertebra, implying that the changes observed were universal at all levels of vertebrae involved in the major curve. fidler and jowett measured the length of multifidus muscle at the apex in is patients during operation and found the multifidus muscle was shorter on the convex side. they explained this as a theory of primary muscular imbalance causing the spinal deformity, in which the muscle on the convex side with higher proportion of slow twitch fibers contracts and shortens as the deformity is produced. using mri, chan. found hyperintense signal change on the concave side of the apex of the curve and thought that the concave side muscles were the morphologically abnormal ones. some researchers have demonstrated the difference in the cross - sectional area (csa) of paravertebral muscles in patients with degenerative lumbar scoliosis (dls). the limitation of csa is that the csa itself is not adequate to represent the functional status of muscle due to the three - dimensional nature of scoliosis. recently, zapata. measured the paravertebral muscle thickness by means of ultrasound imaging and showed significant differences in the muscle thickness on the concave side in mild curves of ais. but none of the parameters mentioned above could capture the entire muscle asymmetry. findings related to muscle volume have been reported by saka who have observed increased muscle volume on the convex side in one idiopathic scoliosis patient. in another study, zoalbi. analyzed the mr images of 17 ais patients with 25 scoliotic curves and indicated a larger muscle volume on the convex side at the apex level, but on some curves only. because scoliosis developed in various regions (thoracic / thoracolumbar / lumbar) could have different impacts on the paravertebral muscle, we included patients with primary thoracic curves to minimize the deviations. in this study, the volume of paravertebral muscles on the convex side was larger relative to those on the concave side at the three levels.. found that tissue calmodulin concentrations of paravertebral muscles were significantly higher on the convex side in ais patients. calmodulin regulates the contractile properties of muscle cells, and its change in concentration implied a potential effect of paravertebral muscles on the progression of scoliosis. found increased proportion of type i muscle fiber on the convexity, which correlated significantly with higher progression of ais curves. in addition, a larger emg activity on the convex side at the apex level has been reported. these changes were mostly interpreted as secondary adaption to higher load demand by the muscles on the convex side in ais. our findings showed an imbalanced muscle volume with predominance on the convexity at the apex level. normal myogenesis, as in childhood growth, is established by extensive hypertrophy of the muscle fibers, which requires the continuous activation, proliferation, and differentiation of satellite cells into new myonuclei. we assumed for our study that when skeletal muscle on the convex side was stretched, satellite cells were activated to enter the cell cycle and contributed to the muscle hypertrophy. on the other hand, martinez. found that different muscle groups including upper and lower limb muscles in ais patients had function impairment, and they defined ais as a primary and systemic muscle disorder which might lead to both spinal deformity and muscle dysfunction. in our study, paravertebral muscle imbalance was generalized among different levels in ais patients, which supports the hypothesis that systemic factors may play an important role in the muscle changes associated with ais, such as hormone and inflammatory factors. this study also revealed that the fatty infiltration rate was significantly higher on the concave side, supporting the load asymmetry theory aforementioned, as muscle atrophy was associated with increased fatty involution. based on wajchenberg s histochemical analysis of paravertebral rotator muscles from patients with ais, fatty involution was considered to be significantly higher on the concavity of the curve, which was similar to our results. recently, stetkarova. demonstrated that muscles of both sides of the curve in ais were affected the convex side by the increased proportion of type i fibers and the concave side by the lower proportion of type i fibers. the declined number of type i fibers and increased fatty involution on the concave side could be a result of muscle atrophy and degeneration. moreover, our correlation test suggested that the difference index of muscle volume correlated significantly with apex vertebra translation, while the difference index of fatty involution correlated significantly with apex vertebra translation and the cobb angle. the rationale for many approaches to conservative management of scoliosis during skeletal growth assumes an important role of the paravertebral muscles in deformity progression. the compensatory role of the paravertebral muscle is substantiated by the partial straightening of the spinal column of ais during nighttime using electric muscle stimulation. tamoxifen, a calmodulin antagonist, has been reported to be effective in decreasing the magnitude of the scoliosis in animal models. recently, physiotherapy treatment through straightening the paravertebral muscles has appeared advisable in children with the scoliosis angle of 1025. our study demonstrated the important role of paravertebral muscles on the progression of scoliosis, and implied that better muscle re - straightening our findings demonstrated a significant asymmetry in muscle volume and fatty infiltration with larger volume on the convex side of the scoliotic curves and higher fatty infiltration rate on the concave side. these changes might be morphological changes corresponding with known altered muscle function of ais, and be important in understanding the pathogenesis as well as mechanisms of progression.	backgroundseveral studies have described the differences in electromyographic activity and histological changes of paravertebral muscles in patients with adolescent idiopathic scoliosis (ais). however, there is little knowledge about the muscle volumetric and fatty infiltration imbalance of patients with ais.material/methodsthirty-four patients with ais were evaluated with standardized anteroposterior (ap) and lateral standing films for the location and direction of the apex of scoliosis, coronal cobb angle, apex vertebra translation, and thoracic kyphosis ; and with magnetic resonance imaging (mri) scan of the spine at the level of t4l1. the muscle volume and fatty infiltration rate of bilateral deep paravertebral muscles at the level of upper end, apex, and lower end vertebra were measured.resultsall patients had major thoracic curve with apex of curves on the right side. the muscle volume on the convex side was larger relative to the concave side at the three levels, while the fatty infiltration rate was significantly higher on the concave side. the difference index of the muscle volume was significantly larger at the apex vertebra level than at the upper end vertebra level (p=0.002) or lower end vertebra level (p<0.001). the difference index of muscle volume correlated with apex vertebra translation (r=0.749, p=0.032), and the difference index of fatty involution correlated with apex vertebra translation (r=0.727, p=0.041) and cobb angle (r=0.866, p=0.005).conclusionsour findings demonstrated significant imbalance of muscle volume and fatty infiltration in deep paravertebral muscles of ais patients. moreover, these changes affected different vertebra levels, with the most imbalance of muscle volume at the apex vertebra. we interpreted this as morphological changes corresponding with known altered muscle function of ais.
participants were employees of the tokyo gas company that supplies natural gas to the tokyo area. all employees received annual health checkups and completed a health questionnaire in accordance with the industrial safety and health law. the participants for this study were 5,984 male employees who had participated in an annual health checkup and annual submaximal exercise tests in 1985. among these men, 335 were excluded because they were found at the health checkup to have at least one of the following : diabetes (n = 102), cardiovascular disease including hypertension (n = 228), tuberculosis (n = 3), or gastrointestinal disease (n = 9). for the present study, we also required participants to have at least four submaximal exercise tests in the previous 7 years (19791985). this excluded 1,462 men, leaving 4,187 men, who were followed until june 1999 for the development of type 2 diabetes. the initial exercise loads were 600, 525, and 450 kilopond meter / min for participants aged 2029, 3039, and 4049 years, respectively. heart rate was calculated from the r - r interval on an electrocardiogram, and 85% of the age - predicted maximal heart rate (220 age [years ]) was set as the target heart rate. the exercise load was increased by 225 kilopond meter / min for each stage among all age - groups, until heart rates during the course of the exercise reached the target heart rate or until the completion of the third stage. maximal oxygen uptake (vo2max) was estimated using the strand - ryhming nomogram (11) and the strand age correction factors (12). first, we used a simple linear regression of vo2max against time to assess the individual regression coefficient (slope) of fitness over 7 years. next, all participants were divided into quartiles based on the slope from their individual model. the annual health checkup included measurement of height, body weight, and blood pressure and a urinary glucose test., participants were followed for the development of type 2 diabetes, which was based on any one of the following three diagnostic parameters : 1) plasma glucose levels exceeded 11.1 mmol / l (200 mg / dl) 2 h after an oral glucose tolerance test, conducted in men with urinary glucose detected at a follow - up annual health checkup, 2) participants themselves reported current therapy with hypoglycemic medication (insulin or oral hypoglycemic agent) when they were interviewed at their health checkup, or 3) fasting plasma glucose levels were > 7.0 we first compared baseline characteristics of participants according to quartiles of the fitness trend using one - way anova for continuous variables and a test for categorical variables as appropriate. we used cox proportional hazards models to estimate the hazard ratios (hrs) of the incidence of type 2 diabetes. we adjusted for age, initial fitness level (continuous vo2max), bmi (continuous variable), systolic blood pressure (continuous variable), cigarette smoking (nonsmokers, 120 cigarettes / day, and 21 cigarettes / day), alcohol intake (none, 145 g / day, and 46 g / day), and a family history of diabetes (present or not) in a multivariate model. a family history of diabetes was defined as the known presence of family members with diabetes in any of three generations, as determined by self - report on the health questionnaire. the proportionality assumption of the model was tested using a log - minus - log plot ; no evidence of violation was found. all analyses were performed using spss 15.0j for windows (spss, chicago, il). the initial exercise loads were 600, 525, and 450 kilopond meter / min for participants aged 2029, 3039, and 4049 years, respectively. heart rate was calculated from the r - r interval on an electrocardiogram, and 85% of the age - predicted maximal heart rate (220 age [years ]) was set as the target heart rate. the exercise load was increased by 225 kilopond meter / min for each stage among all age - groups, until heart rates during the course of the exercise reached the target heart rate or until the completion of the third stage. maximal oxygen uptake (vo2max) was estimated using the strand - ryhming nomogram (11) and the strand age correction factors (12). first, we used a simple linear regression of vo2max against time to assess the individual regression coefficient (slope) of fitness over 7 years. next, all participants were divided into quartiles based on the slope from their individual model. the annual health checkup included measurement of height, body weight, and blood pressure and a urinary glucose test., participants were followed for the development of type 2 diabetes, which was based on any one of the following three diagnostic parameters : 1) plasma glucose levels exceeded 11.1 mmol / l (200 mg / dl) 2 h after an oral glucose tolerance test, conducted in men with urinary glucose detected at a follow - up annual health checkup, 2) participants themselves reported current therapy with hypoglycemic medication (insulin or oral hypoglycemic agent) when they were interviewed at their health checkup, or 3) fasting plasma glucose levels were > 7.0 we first compared baseline characteristics of participants according to quartiles of the fitness trend using one - way anova for continuous variables and a test for categorical variables as appropriate. we used cox proportional hazards models to estimate the hazard ratios (hrs) of the incidence of type 2 diabetes. we adjusted for age, initial fitness level (continuous vo2max), bmi (continuous variable), systolic blood pressure (continuous variable), cigarette smoking (nonsmokers, 120 cigarettes / day, and 21 cigarettes / day), alcohol intake (none, 145 g / day, and 46 g / day), and a family history of diabetes (present or not) in a multivariate model. a family history of diabetes was defined as the known presence of family members with diabetes in any of three generations, as determined by self - report on the health questionnaire. the proportionality assumption of the model was tested using a log - minus - log plot ; no evidence of violation was found. all analyses were performed using spss 15.0j for windows (spss, chicago, il). the mean age of the participants was 32.0 years (range 2240 years) at baseline. the mean sd number of fitness tests during 7 years was 6.0 0.96. the time between the first and last fitness test in each single individual was 6.5 0.73 years. the median follow - up time was 14 years, with a total of 56,749 man - years of observation. during follow - up there were 42 deaths, and 143 participants were lost to follow - up due to retirement. men in the lowest fitness trend quartile (quartile 1) decreased their average vo2max from 45.3 to 36.6 ml / kg / min (median slope 1.25 ml / kg / min) between 1979 and 1985, whereas men in the highest fitness trend quartile (quartile 4) increased their average vo2max from 36.3 to 45.6 ml / kg / min (median slope 1.33 ml / kg / min) over the same time. the men in the lowest fitness trend quartile had the highest level of fitness in 1979, whereas those in the highest fitness trend quartile had the lowest level of fitness. the men in the highest quartile were more likely to have lower systolic and diastolic blood pressure and a lower rate of smoking compared with those in the lowest quartile. baseline characteristics by cardiorespiratory fitness trend data represent median (range), mean sd, or %. men with higher initial fitness had lower hrs for type 2 diabetes than men in the lower initial fitness group. in addition, older age, high bmi, high systolic blood pressure, alcohol intake, and a family history of diabetes all significantly increased the risk of type 2 diabetes. adjusted hr for incidence of type 2 diabetes by potential risk factors at baseline (1985) data are n (%) unless otherwise noted. table 3 shows the hrs for type 2 diabetes by fitness trend quartiles, with the lowest quartile used as the referent. there were progressively lower age - adjusted hrs of type 2 diabetes across fitness trend quartiles. after further adjustment for initial fitness level, bmi, systolic blood pressure, cigarette smoking, alcohol intake, and a family history of diabetes, there remained a strong inverse association between type 2 diabetes risk and fitness trend quartiles (ptrend < 0.001). men in the highest quartile of fitness trend had an 70% lower risk of developing type 2 diabetes compared with men in the lowest quartile. hrs of incidence of type 2 diabetes, according to quartiles of cardiorespiratory fitness trend data are means (range) unless otherwise indicated. adjusted for age, initial cardiorespiratory fitness level, bmi, systolic blood pressure, cigarette smoking, alcohol intake, and a family history of diabetes. we next investigated the hrs of type 2 diabetes associated with quartiles of fitness trend, among men classified according to their initial fitness levels in 1979. the inverse gradient for diabetes across long - term trends in fitness categories was generally observed for all levels of fitness in 1979, except for men in the highest category of initial fitness (45.0 ml / kg / min). we also investigated the hrs of type 2 diabetes among men with different levels of bmi at baseline (1985). again, there generally was an inverse gradient for diabetes risk across long - term trends in fitness categories for all bmi categories except the lowest. hrs for incidence of type 2 diabetes associated with quartiles of cardiorespiratory fitness trend, among men categorized by initial (1979) cardiorespiratory fitness level (top) or baseline (1985) bmi (bottom). hrs were adjusted for age, systolic blood pressure, cigarette smoking, alcohol intake, a family history of diabetes, and bmi (top) or initial cardiorespiratory fitness level (bottom). in this study, we prospectively investigated the relationship between long - term trends in fitness and the incidence of type 2 diabetes in nondiabetic japanese men. there was a strong inverse relationship between long - term trends in fitness and the incidence of type 2 diabetes, with men increasing their fitness over a 7-year period having lower risks than men with decreasing fitness over the same span. the observed association is biologically plausible, because physical activity or fitness is a strong independent predictor of lower type 2 diabetes incidence rates (2,3). physical activity or fitness may prevent and delay type 2 diabetes by improving glucose levels, reducing adiposity, increasing muscle mass and the glut4 in muscle tissues, and reducing insulin resistance (13,14). the major strength of this study is the objective measurement of fitness, repeated over time. fitness, an objective marker of daily physical activity, is a stronger predictor of morbidity or mortality than self - reported physical activity (15). terslinna. investigated the relationship, among 31 subjects, between measured vo2max and estimated vo2max using the strand - ryhming nomogram and correction factors used in the present study, obtaining a correlation coefficient of 0.92 (16). furthermore, we used values obtained in oral glucose tolerance tests or fasting blood glucose levels as objective measures of the study outcome, type 2 diabetes. individuals at high risk of type 2 diabetes, such as those with impaired glucose tolerance or obesity, have been studied in randomized controlled trials of lifestyle, including physical activity and type 2 diabetes (810). however, there are no data in low - risk populations. in addition, most of the data have been in caucasian subjects. type 2 diabetes is a global problem ; thus, data are needed not only in high - risk populations but also in low - risk populations and in other racial / ethnic groups. one limitation of the present study is that subjects may not be representative of the entire japanese population and women were not included. another limitation is that possible changes in fitness levels were taken into account between 1979 and 1985 but not during the follow - up period, 19851999. however, not accounting for changes during the latter period would probably dilute the true association between fitness and the risk of developing diabetes. in conclusion, this cohort study showed a strong inverse relationship between long - term trends in fitness and the development of type 2 diabetes in japanese men. this relationship was independent of age, initial fitness level, bmi, systolic blood pressure, cigarette smoking, alcohol intake, and a family history of diabetes. thus, regular physical activity, which is associated with an increase or preservation of fitness, should be promoted by health professionals, because it decreases the risk of type 2 diabetes, in addition to decreasing the risks of many chronic diseases (17).	objectivewhereas single assessments of cardiorespiratory fitness have been shown to predict lower incidence of type 2 diabetes, there are no data on long - term trends in fitness and risk. we investigated the relationship between long - term trends in fitness and the incidence of type 2 diabetes.research design and methodsa cohort of 4,187 japanese men free of diabetes completed annual health checkups and fitness tests for estimated maximal oxygen uptake at least four times over 7 years (19791985). we modeled the trend in fitness over 7 years for each man using simple linear regression. men were then divided into quartiles based on the regression coefficient (slope) from the model. during the follow - up period (19851999), 274 men developed diabetes. hazard ratios (hrs) and 95% cis for the incidence of diabetes were obtained using the cox proportional hazards model.resultsmen in the lowest quartile of the distribution decreased in fitness over the 7 years (median slope 1.25 ml / kg / min), whereas men in the highest quartile increased in fitness (median slope 1.33 ml / kg / min). with adjustment for age, initial fitness level, bmi, systolic blood pressure, cigarette smoking, alcohol intake, and a family history of diabetes and use of the lowest quartile, the hrs (95% ci) for the second through fourth quartiles were 0.64 (0.460.89), 0.40 (0.270.58), and 0.33 (0.210.50), respectively (ptrend < 0.001).conclusionsthese results indicate that the long - term trend in fitness is a strong predictor of the incidence of type 2 diabetes in japanese men.
by the end of 20 century, hepatitis c virus (hcv) started to emerge as a global threat with around 170 million people infected worldwide1. the virus is a blood borne pathogen and the high risk group includes patients undergoing blood transfusions, intravenous drug users, renal patients undergoing frequent dialysis, people involved with tattooing and unsafe sexual activity. the infection with virus can follow either an acute and/or subsequently in majority of the cases a chronic clinical profile. while the acute infection is resolved spontaneously in a few weeks time without any therapeutic intervention, the most disturbing aspect of this infection is that the spontaneous viral clearance is atypical, with nearly 54 - 86 per cent of the infected individuals progressing to chronic hepatitis234. chronic hcv infection is defined as the persistence of hcv rna in the blood for at least 6 months and in its more aggressive form in about 5 - 10 per cent cases progressing to cirrhosis and hepatocellular carcinoma (hcc)3 this virus has a single - stranded rna of positive polarity of 9.6 kb nucleotides. the rna contains one long open reading frame, encoding a polyprotein of approximately 3000 amino acids flanked by un - translated regions (utrs) on both 3 and 5 ends. owing to high mutability due to error prone reverse - transcription, the hcv genome, has high degree of genetic variability. to date, at least six genotypes and more than 120 subtypes of the virus have been identified, and more are in the process of being characterized. genotypes 1a (hcv-1a), 1b, 2a, 2b, and 3a are distributed globally and account for the majority of hcv infections worldwide5. hcv-1b, the most common genotype worldwide, is also the dominant genotype in asia - pacific, particularly in japan, south korea, china and taiwan. hcv-2a and 2b are also commonly distributed, particularly in japan, south korea and southern taiwan6. while genotype-3 of hcv is more prevalent in many countries of asia oceania78, the genotype-4 is predominantly found in north africa and middle east. genotypes 7 - 11 appear to be the variants of hcv-3 (genotype 10a) and hcv-6a (genotypes 7, 8, 9, 11), and have been re - classified as subtypes of genotypes 3 and 66. in india, genotype 3 predominates in the north, east and west india while genotype 1 is more common in southern parts of india8101112. antiviral agents like interferon (ifn)- and nucleoside analogue like ribavirin, have been widely used for the treatment of chronic hcv infection to prevent the development of cirrhosis of liver and hepatocellular carcinoma. in addition to causing direct inhibition of viral replication, these agents modulate antiviral immune responses, which greatly contribute to the successful therapeutic response. the response to the therapy is largely dependent on the genotype of the virus involved. hcv genotype 1b is less sensitive to interferon as compared to genotypes 2 and 313. however, the high cost of therapy makes it far less affordable for many affected individuals, especially in the resource limited countries like india. there have been a few reports available in literature stating the superior response to ifn - based therapies in asian patients as compared to caucasians, hispanics and afro - americans in the corresponding hcv genotype1415. the outcome or the response to the treatment can be measured using three parameters : (i) biochemical outcome measured in terms of normalization of serum alanine transaminase (alt) levels, (ii) virological outcome defined by absence of hcv rna from serum by a sensitive pcr based assay, and (iii) histological outcome measured as 10.6 mg / kg), age < 40 yr, non - african - american race, female gender, lower body weight (< 75 kg), the absence of insulin resistance, elevated alt levels (three - fold higher than the upper limit of normal), and the absence of bridging fibrosis or cirrhosis on liver biopsy202122. recently, interleukin (il) 28 polymorphism has also been highlighted as one of the reliable predictors of response to therapy. the chances of attaining an svr with peg - ifn and ribavirin and of spontaneous resolution of hcv infection differ depending on the nucleotide sequence near the gene for il28b on chromosome 192324. the detection of the c or t allele at positions 12979860 is found to be highly predictive. interestingly, the cc genotype is found more than twice as frequently in persons who have spontaneously cleared hcv infection than in those who had progressed to chronic hepatitis - c infection (chc)23. once the treatment starts, a four week rapid virological response (rvr) has been the single best predictor of an svr for anti - hcv treatment with peg - interferon and ribavirin combination therapy, irrespective of hcv genotype2526. further, depending upon the rvr, the duration of treatment can be shortened or extended162526. hcv is not directly cytopathic for the hepatocytes, and brings out progressive liver lesions resulting in end - stage liver disease unless eradicated effectively. it is noteworthy that the cellular immune response to virus is thought to be responsible for both viral clearance and progression to liver disease. however, the patients who successfully resolve the acute phase, mount a multi - epitopic polyclonal cytotoxic t lymphocyte (ctl) response to several viral antigens. in a study on injection drug users, those who resolved previous hcv infection were 12 times less likely to be reinfected to develop persistent infection than people infected for the first time. the median peak of hcv rna levels in those who became re - infected, were two logs lower than individuals who got infected for the first time to develop chronic infection. these findings suggest that at least in some individuals, a protective immunity develops against the virus, which is capable of complete or partial control of hcv infection17. in contrast, this response is absent, short - lived or much weaker in patients who are unable to clear the virus and progress on to become chronically infected. thus, it is rational to conclude that the outcome of hcv infection (viral clearance versus viral persistence) is determined primarily by the vigour and quality of the cellular immune response27. once the virus survives the initial assault by the host immune response, it uses several strategies to nullify the selective immunological pressure during the later phases of infection. the virus alters its antigenic epitopes recognized by t cells and neutralizing antibodies to escape immune surveillance34 it may also subvert immune functions in an antigen specific manner, from innate to adaptive immunity. after the virus infects the liver, viral replication continues and viral particles are continuously released into the circulation. it is considered that innate immunity not only provides an immediate response to viral infection, helping to clear the virus during initial period, but also shapes the nature of the adaptive immune response to viral infection28. the different components of both innate and adaptive immune response are so interconnected that the defects of one or more may lead to the establishment of chronicity of hcv infection. the first line of defense is provided by the natural killer (nk) and nkt cells, as their numbers are shown to be relatively increased in the liver compared to the periphery. these cells are activated in the liver, where expression of ifn and ifn - inducible genes are extremely high during the early phase of hepatitis virus infection29. activated nk and nkt cells eliminate virus - infected hepatocytes directly by cytolytic mechanisms as well as by secreting ifn, which inhibits replication of hcv through a non - cytolytic mechanism30. an important role for nk cells in early hcv infection has recently been suggested by khakoo who showed that the activation threshold of nk cells might be lower in hcv patients, which might support hcv clearance. interaction of nk cells with hcv e2 protein by its receptor, cd81, inhibits nk cell activity32, whereas it causes stimulation of t and b lymphocytes. nk cells from hcv - infected patients are impaired in their capacity to activate dendritic cells due to the production of il-10 and tumour growth factor (tgf)-33. not surprisingly, hcv has evolved multiple strategies to counter the host 's nk cell response. the reduction in nk cell frequency may be a consequence of hcv infection, or a predisposing factor to chronic hcv disease, and both hypotheses have some scientific support. in individuals with chronic hcv infection, a reduction in peripheral blood nk cell frequency in individuals with chronic hcv as compared to spontaneous resolvers il-15, a pivotal cytokine for nk cell development, proliferation and function, may be relevant to this observation. meier showed a significant reduction in il-15 levels in hcv patients as compared to healthy controls and demonstrated that exogenous il-15 rescued their nk cells from apoptosis, increasing ex vivo proliferation and function. several studies have reported an increase in circulating cd56 nk cells, but not cd56 component in this population in chronic hcv infection as compared to acute cases3738. while most studies on the human adaptive immune responses against hcv are concentrated on the t cell responses, the role of neutralizing antibodies in the protective immunity against hcv has only recently gained attention3940. even though there are less number of cases with self - limited hcv infection that have been studied so far, a pattern of vigorous and strong hcv specific t cell response has been observed404142. such responses were observed only during the early phase of acute disease4143 and sustained for long after the clearance of hcv40. these responses were generally targeted at multiple major histocompatibility complex (mhc) restricted epitopes rather than a dominant epitope42. in contrast, patients with chronic hcv infection usually have weak or defective t cell responses against hcv, as indicated by low frequencies of the specific t cells44, short - lived responses4445, narrowly targeted epitopes44, as well as defects in the effector functions of the specific t cells45. hcv specific cd8 t cells in chronic hepatitis c patients possess lesser capacity to proliferate and produce lesser amounts of ifn in response to hcv antigens46 (fig. 1). the immune response in viral hepatitis c involves both the innate and adaptive immune system. innate immunity involves activation of resident liver macrophages (m), dendritic cells (dcs), natural killer (nk) cells, and nkt cells, whereas cd4 + t cells, cd8 + t cells, and b lymphocytes are effectors of adaptive immunity. ctl, cytotoxic t lymphocyte ; hcv, hepatitis c virus ; ifn, interferon ; il, interleukin ; mhc, major histocompatibility complex ; tnf, tumour necrosis factor., new jersey, usa [clin liver dis 2006 ; 10 : 753 - 71]17. taken together, these studies strongly suggest that the host t cell responses are a key factor in determining the outcome of hcv infection. interestingly, during the acute phase of self - limiting hcv infection, there is a brief span of dysfunction of hcv specific cd8 t cells4344, suggesting that a transient down - modulation of the effector functions of specific cd8 t cells may be a host strategy to keep a check at the tissue damage, caused by the cytotoxic cd8 t cells at the early stage of infection when viral replication is at its peak. on the contrary, there is a report which failed to find a relationship between ctl response and hcv eradication47. although, little is known regarding the exact cause for the failure of the host 's adaptive immunity against hcv, many of these defects can be attributed to deficiencies in innate immune responses leading to progression to chronic hcv infection. to understand the mechanism behind apparently weak or abnormal t cell immunity to hcv in chronic hepatitis, it is important to explore the initial events leading to the antiviral adaptive immunity, which mainly pertains to the processing and presentation of viral antigens and onward signaling. in this scenario the immune system works as a well - coordinated squad of different types of cells whose final mission is to eliminate invading pathogens. dendritic cells (dcs) orchestrate the entire course of events as these are essential for activation of both t helper cells and cytotoxic t - lymphocytes. dendritic cells not only form an important component of the innate immune surveillance but also play a significant role in shaping the nature of adaptive immune response against various pathogens and tumour cells. among different subsets of dcs, myeloid - derived dcs (mdcs) are the most important antigen presenting cells with the capability to capture and process antigens, express lymphocyte co - stimulatory molecules, migrate to lymphoid organs and secrete cytokines to initiate b and t cell responses48. while the plasmacytoid dendritic cells (pdcs) play a unique role in secreting large amounts of type i interferons, their efficiency as antigen - presenting cells (apcs) has not been completely understood. however, it has been reported that during viral infection pdcs not only secrete immunomodulatory cytokines, but also recognize infected cells and function as antigen cross - presenting cells to trigger the antiviral immune response with specific reference to activation of virus specific cd8 + cells4950. besides activating lymphocytes, dcs also have the important function as mediators of peripheral immune tolerance and maintenance of immune homeostasis48. the two conflicting roles of dcs have been related to their different patterns of maturation and cytokine production5152. the functions of dcs are precisely controlled to either activate or tolarize the t cells depending on the nature of antigens which may be foreign or self. any perturbation to this control may lead to serious consequences including impaired immunity to infecting pathogens, causing persistent infections. many viruses have devised strategies to counteract antiviral immunity by down - modulating the functions of dcs. the response of dendritic cells to any infection in general and initial hcv infection in particular, at early stage is critical in determining the course and outcome of the disease. however, studying the immune responses in patients at early stage of hcv infection is difficult because the acute infection is usually asymptomatic, and by the time the disease is identified, it has already passed the initial acute phase and progressed into chronic infection. it has been shown that hcv specific t cells appear early after infection inducing strong t cell response during acute hcv infection40. to activate hcv specific t cells and induce strong antiviral immune responses, dcs have to respond to hcv viral proteins. moreover, hcv seems to successfully disrupt the coordinated activity of the innate immune cells to result in deficient adaptive immune response and prevent pathogen elimination. while a couple of studies have observed no functional defects in mdcs in hcv - infected individuals535455, the findings from other studies indicate that blood - derived mdcs from hcv infected patients are functionally and numerically impaired555657585960. an increase in the frequency of mdcs during acute hcv infection has been shown to be associated with viral clearance in a small study, whereas the deficiency of mdc might be an important factor in the development of chronic state of the infection61. the mdcs of patients with chronic hcv infection have impaired abilities to stimulate allogeneic cd4 t cells and to produce il-12p70 compared with those from healthy volunteers62. although dcs can bind to hcv and may even get infected with this virus and possibly act as hcv reservoirs63, but there has not been much evidence of viral replication within these cells. the phenotype and cytokine production profile of bone marrow originated mdcs can be generated from peripheral blood monocytes [monocyte - derived dcs (mo - dcs) ] in the presence of il-4, granulocytes - macrophage colony - stimulating factor (gm - csf) and serve as an ex vivo model for mdcs. data on the function / phenotype of mo - dcs during acute hcv infection are scarce, and the opinions on the function of mo - dcs in chronic hcv are divided. although longman reported normal phenotypic characteristics and allogeneic functions in mo - dcs in humans and larsson identified similar findings in a non human primate model of chronic hcv infection, the majority of researchers find functional abnormalities in mo - dcs of humans with chronic hcv infection656667. we and others have demonstrated that decreased expression of the co - stimulatory molecules cd83 and cd86, increased production of il-10 and decreased levels of il-12, may lead to impaired capacity to stimulate allogeneic t cells in vitro, and may cause defective maturation of mdcs in patients with chronic hcv infection regardless of viral genotype or patient age / sex across a wide geographic localization of patients65666768. in vitro experiments have effectively shown that upon exposure of human mo - dcs to cell culture - grown hcv (hcvcc) genotype 1a or 2a, there was a significant inhibition of dc maturation and was associated with low hla - dr expression and high production of il-10. furthermore, dcs exposed to hcvcc were impaired in their functional ability to stimulate antigen - specific cd4 and cd8 t cell responses69. dcs, upon exposure to hcv core protein, showed downregulation of major histocompatibility molecules (hla - dr) and co - stimulatory molecules (cd80, cd86) and induction of il-10 producing t cells70. the hcv may induce modulation of the cytokine response, especially of increase in il-10 and decrease in il-12 production that may result in altered hcv specific t cell responses in chronic hcv infection. in another report, lipopolysaccharide (lps)-stimulated mo - dc from hcv patients showed a mature phenotype but with a significantly decreased expression of il-12, could be responsible for the th1 defect since the intensity of the th1 defect was directly related to the intensity of il-12 decrease71. we have also recently shown that the monocytes from healthy donors when differentiated in the presence of hcv core and ns5 proteins developed maturation defects as these could not upregulate the hla - dr alongwith cd83, cd80 and cd86 on toll like receptor (tlr)-4 mediated stimulation68. peripheral blood dc of chronically infected patients have been shown to express less il-12 than control cells from healthy individuals60 and a small population of circulating myeloid dc displayed an impaired response to specific tlr stimulation72. viral components can either bind to tlr and activate their signaling pathway or block tlr function by interfering with intracellular intermediates. there have been a few studies in which role of dcs have been studied in context of antiviral therapy576673. in general, it has been demonstrated that the early response to antiviral treatment leads to the improvement of dc functions which was not observed in patients who remained viraemic on therapy. evaluating the defects in maturation and chemotaxis in peripheral mdcs and pdcs from therapeutic responders and non - responders, revealed that successful antiviral therapy normalized many phenotypic and functional abnormalities of pdcs from patients with hcv infection74. maturation defects were detected in the mo - dcs from genotype-3 infected chronic hepatitis c (chc) patients when checked before the initiation of therapy, however, it was very interesting to find that all those chc patients whose mo - dcs could upregulate the surface expression of activation (cd83), and co - stimulatory (cd80 and cd86) molecules on their surface after tlr-4 mediated stimulation ex - vivo even before the initiation of therapy, were able to subsequently achieve svr after completion of antiviral treatment, while the patients whose cells showed an inability to upregulate these molecules initially, did not achieve svr later on as well68. this suggested that the response to antiviral therapy in chc is somehow related to the functional status of dcs. this finding is in agreement with a previous report wherein it was demonstrated that the pdcs were functionally activated in terms of increased chemotaxis even before therapy in patients who subsequently achieved svr, suggesting that increased baseline inflammation is associated with failure to respond to the antiviral therapy74 (fig. differential elevations of chemokine receptors and maturation markers in dendritic cell (dc) subtypes before and after therapy. a two - tailed non parametric wilcoxon signed rank test was used for paired data or the two - tailed mann - whitney test was used to calculate p values. (b) cd83 mfi on plasmacytoid and myeloid dcs (pdcs, mdcs) ; cd40 mfi for pdcs, mdcs ; hla - dr for pdcs and mdcs. (reproduced with permission from british medical association, london, uk [gut 2009 ; 58 : 964 - 73]74. furthermore, dcs from patients who achieved svr in our study68 demonstrated an improvement in the maturation capacity after completion of treatment. on the other hand, non responders to therapy continued to show maturation defects in their mo - dc. the functional improvement of mo - dcs was directly related to the successful clearance of virus in responders upon completion of therapy68 (fig. it clearly suggests that defect seen in chronically infected patients is limited to the period of active viral replication but can be resolved after viral clearance. this observation is corroborated by similar reports demonstrating clearance of hcv rna from circulating dcs in chc patients who achieved rapid virological response (rvr)57 indicating that therapy with ifn may induce improved dc function by reducing the load of hcv in vivo. however, the role of antiviral agents, especially that of type-1 ifns on maturation and activation of dcs, is controversial. it has been proven that in vitro addition of ifn to dc cultures of chc patients improves their function in terms of increased expression of activation and co - stimulatory molecules7576. on the other hand, mcrae have shown that ifn and inhibit the in vitro differentiation of mo - dcs from normal subjects. it has been suggested that ribavirin is not strictly antiviral in its action, but rather alters the t - cell balance in the immune system and attenuates the dc function in vitro and in vivo78. effect of treatment on expression of (a) hla - dr, (b) cd83, (c) cd80 and (d) cd86 on monocyte - derived dendritic cells (mo - dcs) from chronic hepatitis - c patient (chc)-ii pre and post - treatment (in terms of fold increase in mean fluorescence intensity, mfi). expression of all molecules increases significantly in svr+ although no change is seen in svr- patients. besides the expression of co - stimulatory and mhc class ii molecules on their surface, dcs also secret many cytokines, as a direct evidence of their maturation and activation. a few reports have demonstrated that purified dcs or mo - dcs from chc patients showed lower il-12 and higher il-10 production in response to poly - ic or tnf stimulation ex vivo7980. however, no difference in cytokine profile from chc and hc was found in another report55. il-10 has been shown to be an important player in the pathogenesis of hcv infection, being induced by various hcv antigens81. we also reported recently that the mo - dcs from non - responders to antiviral therapy were not able to secrete proinflammatory cytokines such as il-1 and il-12 in response to lps stimulation but showed an increased il-10 and tnf production68 (fig. 4). this aberrant cytokine profile also conforms to immature phenotype of mo - dcs in these patients. consequently, the patients who did not achieve svr also had high il-10 secreting mo - dcs, even prior to the start of antiviral treatment and continued to have that trend even after completion of therapy. this finding implies the possibility of the tolerogenic signals by immature dcs under the influence of il-10 in these individuals which might be responsible for their inability to ultimately clear the virus. the persistence of high vireamia in chc patients who failed to achieve svr might be a possible reason behind the abnormal cytokine secretion. stress causing the dcs to secrete pro - inflammatory cytokines. however, the immunomodulatory role of ifn/ribavirin therapy can not be ignored. a previous in vitro study had revealed that ifn and ribavirin act synergistically to normalize the functions of defective dendritic cells, while the ifn enhances the production of il-12 and tnf, the ribavirin at the same time suppresses the production of il-10, thereby tilting the balance towards th1 response55. cytokine profile of monocyte - derived dendritic (mo - dcs) cells pre- and post - lipopolysaccharide (lps) stimulation. secretion of il1, il12 and tnf- increased significantly in lps stimulated mo - dcs after therapy in svr+ patients, although those from svr - patients secreted high il10 before and after therapy. hc, healthy controls ; svro+, treatment nave sustained virological responders ; svr6 +, responders post 6 months treatment ; svr6-, non - responders post 6 months treatment. divergent conclusions have been drawn on in vitro established mo - dcs with regard to allostimulatory capacity of these cells in mixed lymphocyte reaction (mlr) assay5355. in our study, lps stimulated mo - dcs from chc patients exhibited low allostimulatory capacity indicating impaired antigen presentation on ex vivo stimulation. this was expected as dcs from chc patients exhibited low abundance of co - stimulatory molecules (cd80 and cd86) and mhc - ii on their surface making them weak antigen presenters68. we also observed a significant improvement in allostimulatory capacity of mo - dc in patients who achieved svr in sharp contrast to those who did not. it has also been shown in other studies that allostimulatory capacity of dc from therapy nave chc patients was compromised8082. yet another report had revealed that dcs from patients who became hcv rna negative after four weeks of combination therapy improved allogenic t cell stimulating capacity57. some groups have reported that the priming capacity of dcs from chc towards allogeneic t lymphocytes was comparable to that of hc5355. however, mcdonald using mlr assay have suggested that the defect in dcs is subtle and can be overcome by increasing dc numbers. this would only be possible if patients are given autologous mo - dc therapy in which large numbers of dcs are administered to the patients. dendritic cells play a key role in shaping up the adaptive immune response as they can drive the th1 or th2 cell responses. the mo - dcs from chc patients secreted lower quantities of th1 cytokines like ifn, il-2, il-12 but higher quantities of th2 cytokines like il4 and il10, in mlr supernatants which got reversed on successful treatment in therapy responders, suggesting that the combination therapy of ifn and ribavirin alters the cytokine profile of maturing dcs to induce th1 reactivity5568. in fact, the il-10 released from dc may hamper the th1 responses, by inducing tolerogenic t - cell responses. the activated t cells, on one hand are fundamental to the eradication of hcv infection, are also responsible for injury to the liver tissue due to activated cytotoxic t cell response against hcv - infected hepatocytes84. therefore, the production of il-10 in chc patients may be detrimental to the control of viral infection on one hand but may also be favourable to the prevention of overwhelming liver inflammation and injury on the other. based on these observations it can be proposed that the inflammatory state in chronic viral hepatitis impairs the dc functioning by making them incapable to mature. the viral clearance in chc patients after cessation of treatment improves the status of dcs which further helps in rejuvenating the adaptive immune response in these individuals. the observation that dcs from patients achieving svr in response to antiviral treatment projected an active and mature phenotype upon lps stimulation even before start of treatment emphasizes the use of immunological markers in predicting response to therapy. further studies are warranted to identify the factors that may be responsible for the sustained functional defects in dcs in non - responders, to find an appropriate agent that may help in reversing these defects and achieve viral clearance.	chronic hepatitis c infection poses a major global health predicament and appears to be potent threat to mankind. the treatment in wide use is interferon / ribavirin combination therapy which is generally effective in about 60 - 70 per cent of patients carrying genotype 3 and causes significant morbidity. the response to therapy is largely guided by limited number of factors such as genotype of virus, rapid virological response, ethnicity, pre - therapy viral load, etc. while involvement of host genetic factors has been a major focus of research in playing an important role in the outcome of disease, the role of immune system can not be marginalized. poor cellular trafficking and suboptimal t cell responses in liver, the hall marks of chronic hepatitis c virus infection, might be attributed to defective antigen presentation. various immunological factors, both innate and adaptive, play role in the pathogenesis of the disease and become dysfunctional in active disease. recent reports suggest the major impact of functional and numerical status of dendritic cells in deciding the fate of antiviral therapy. in this review we take a look at the involvement of dendritic cells in playing an important role in the response to therapy.
in mammalian cells the position of the golgi correlates with that of the microtubule (mt)-organizing center or centrosome (kupfer., 1982). disruption of normal mt cytoskeleton dynamics with antibodies or agents such as colchicine and nocodazole that cause mt depolymerization, or paclitaxel, which stabilizes mts, results in dispersal of the golgi into smaller units or mini - stacks spread throughout the cell (robbins and gonatas, 1964 ; wehland. exactly how these structures arise is the subject of some controversy ; in brief, two models have been proposed. either golgi proteins and membranes directly fragment into smaller units or they are recycled via the er and reform at the so - called er exit sites. remarkably, these smaller units still retain the classical stacked cisternal organization of the golgi (rogalski., 1984). therefore, mts are important for the formation of the so - called ribbon of golgi stacks and positioning this adjacent to the centrosome and nucleus. however, despite many years of study, there is still no satisfactory answer to the question of what role mt - dependent golgi positioning and mts play in protein secretion. early studies suggested that mt - dependent spatial organization of the er and golgi might facilitate er to golgi traffic in polarized cells of isolated lacrimal glands (busson - mabillot., 1982). first, mt minus end directed movement of copii vesicles from er exit sites toward the golgi involves dynein (presley., 1997). second, dynactin, a multisubunit complex that increases the processivity of the dynein motor (king and schroer, 2000), can bind to components of the copii vesicle coat. the p150 subunit of the dynactin complex directly interacts with the copii coat subunits sec23a and sec24d, and expression of the copii - binding domain of p150 causes a delay in the formation of er golgi vesicular tubular transport intermediates from copii vesicles (watson., 2004). however, this is not the whole story because studies using fibroblast cell cultures indicate that the transport kinetics of a model glycoprotein, the vesicular stomatitis virus g protein, between the er and golgi or through the golgi are not significantly altered in cells treated with paclitaxel or nocodazole (rogalski., 1984). rather, the only aspect of vesicular stomatitis virus g protein transport found to be altered concerned the delivery to the plasma membrane. this occurred adjacent to the ribbonlike golgi in the control cells, but uniformly over the entire plasma membrane in cells where the golgi was dispersed by nocodazole treatment (rogalski. a role for golgi position in directing secretion has also been suggested by observations that the golgi polarizes together with the centrosome in migrating fibroblasts, and that this appears to be of significance for the establishment and maintenance of cell polarity (kupfer., 1982 ; bergmann., 1983 ; preisinger., 2004). the kinetics of both constitutive and regulated vesicle transport from the tgn to the plasma membrane are reduced in the absence of mts (tooze., 1991), suggesting that transport from the tgn to the cell surface may therefore be more sensitive to mts than er to golgi and intra - golgi trafficking. consistent with this idea, post - tgn transport intermediates have been observed to move along mts (toomre., 1999). a more complex situation is found in polarized epithelial cells where mts are important for cell polarization in addition to membrane trafficking events. it is difficult to make a general case for the role of mt - dependent transport in polarized epithelial cells because they do not all show the same type of mt organization. to give two examples, kidney - derived epithelial cells have vertical mt arrays (bacallao., 1989), whereas polarized hepatocytes have horizontal mt arrays (meads and schroer, 1995), which probably reflects the different types of epithelial organization seen in tissues such as the kidney and liver (cohen., 2004). one heavily studied cell type is the kidney - derived mdck cell, which forms columnar epithelial monolayers, with an apical or lumenal surface separated by tight junctions from the basal and lateral (basolateral) surfaces. these cells have vertical mt arrays, with the mt minus end facing the apical surface, whereas the golgi and centrosome are positioned above the nucleus below the apical membrane (bacallao., 1989). mt depolymerizing drugs cause a reduction in the rate of transport to the apical but not the basolateral surface and cause some of the apical cargo to be mis - sorted to the basolateral surface (rindler., 1987 ; consistent with the mt polarity in these cells, vesicle delivery to the apical surface involves the mt minus end directed motor dynein, and potentially additional motor proteins of the kinesin family (lafont., 1994). thus, mts are likely to be important for organizing the secretory pathway and directing vesicles to specific destinations within the cell or subdomains of the plasma membrane in both polarized and fibroblast - like cells. the first clues to the mechanism underlying mt - dependent golgi positioning in the perinuclear region came from experiments using an in vitro cell assay, where the ability of permeabilized cells to capture exogenous golgi membranes was followed (corthesy - theulaz., this assay was dependent on cytosolic factors and could be blocked by the depletion of dynein or the addition of antibodies inhibitory to dynein function (corthesy - theulaz., 1992). some years later it was shown that expression of the p50 subunit of dynactin results in dispersal of the golgi from the perinuclear region (burkhardt., 1997). finally, cells lacking dynein are unable to concentrate organelles such as the golgi and lysosomes in the perinuclear region, although, interestingly, the golgi fragments are still associated with mts (harada., 1998). these and other observations have led to a model in which dynactin together with additional accessory factors regulates dynein - dependent vesicle and organelle movement at the level of cargo binding (allan., 2002) cellular mts are in a constant state of flux termed dynamic instability, where they switch from growth to collapse, and thus over time the volume of the cytoplasm is probed by mts. dynactin is concentrated at mt plus ends and can transiently capture golgi membranes that are then transported toward the minus ends by dynein (vaughan., golgi membranes are thus concentrated in the perinuclear region by a mt search, dynein dynactin capture process. several groups have attempted to purify factors linking the golgi with mts using sophisticated biochemical assays (bashour and bloom, 1998 ; hennig., 1998) ; however, this approach has not proven to be as successful as originally hoped for. using such assays, two groups identified the same golgi - associated factor, the enzyme formiminotransferase cyclodeaminase (ftcd). however, this is a liver - specific enzyme and unlikely to act as a general mt linker at the golgi (bashour and bloom, 1998 ; hennig., 1998). tubulin is typically purified from brain for such assays, and with hindsight this turns out to be problematic. bovine brain tubulin is heavily modified by the addition of polyglutamates, and it is suspected that ftcd interacts with mts via these because it does not bind to mts assembled from liver tubulin that essentially lacks this modification (bashour and bloom, 1998). although in some cases posttranslational modification of tubulin may play an important role in modulating the interaction of motor proteins and maps with the mt surface (rosenbaum, 2000), it is unlikely that binding of ftcd to polyglutamylated mts is of significance for golgi positioning. moreover, the specificity of the mt interaction has to be questioned because ftcd has also been found associated with the vimentin intermediate filament network (gao and sztul, 2001). therefore, the search for proteins linking the golgi to mts has continued and has recently become focused on the role of the golgin family of proteins as potential golgi maps. gmap-210 was originally identified as a cis - golgi localized autoantigen of 210 kd using the serum from a patient with an autoimmune condition known as sjgrens syndrome (rios., 1994). it was subsequently characterized at the molecular level and found to have extensive regions of predicted coiled - coil (infante., 1999), justifying its classification as a member of the golgin family of proteins (barr and short, 2003 ; gillingham and munro, 2003). golgins have diverse functions at the golgi, but it is believed that together they form a golgi matrix giving identity, shape, and stacked organization to golgi cisternae (barr and short, 2003 ; gillingham and munro, 2003). therefore, the finding that gmap-210 interacts with mts was significant (infante., 1999) because it provided a link between golgi structure and positioning. when the mts were sheared, increasing the number of free ends without changing the concentration of mts themselves, an increase in bound gmap-210 was seen hinting that it is a mt end binding protein. this interaction was mapped to amino acids 1597 to 1979 at the cooh terminus of gmap-210, whereas the golgi - targeting signal was found in the first 375 amino acids. both of these domains, when expressed at high level, caused perturbations in golgi structure. thus, gmap-210 was proposed to bind a subpopulation of mt ends through its cooh terminus and to the golgi via its nh2 terminus (infante., 1999). an interesting aspect of this work was the finding that the gmap-210 cooh - terminal domain accumulated at the centrosome when expressed as a gfp fusion rather than decorating mts and could displace a marker for the pericentriolar material defined using the ctr453 monoclonal antibody (infante., 1999). one of the key centrosomal components required for initiating mt assembly in vivo is the -tubulin ring complex (-turc ; for review see schiebel, 2000). recently, the same authors have shown that gmap-210 could be immunoprecipitated with components of the -turc under conditions where -tubulin was not (rios., 2004). this finding might explain the increased binding of gmap-210 to sheared mts, as -turc interacts with mt minus ends. therefore, displacement of centrosomal proteins caused by the gmap-210 cooh terminus may be due to sequestration of the -turc. because the -turc plays a key role in mt nucleation and attachment at the centrosome, rios. (2004) reasoned that gmap-210 could nucleate and/or attach mts at the golgi (chabin - brion., 2001). consistent with the hypothesis, they found that cells expressing high levels of gmap-210 show some recruitment of -tubulin to golgi structures, indicating that gmap-210 may act as a targeting factor for -turc. they also found that a polyclonal antibody to -tubulin stained both the centrosomes and the golgi, although this is a little surprising because other antibodies to -tubulin and gfp - tagged -tubulin have not indicated a golgi pool of this protein (murphy. gmap-210 is not the only protein reported to interact with both mt ends and the golgi. clasps (clip - associating proteins) are a family of proteins important for mt organization at the leading edge of motile fibroblasts that bind to mt plus ends and localize to both the cell cortex and the golgi apparatus (akhmanova., 2001 ; together with the mt end binding factor, eb1, their main activity is to promote mt stability and interaction of mt plus ends with the cell cortex (mimori - kiyosue., 2005). what role clasps play at the golgi is less clear, but because cells depleted of clasps using rna interference have a less dense disorganized mt network and a pool of clasp1 and clasp2 is present at the golgi (mimori - kiyosue., 2005) it is possible that this also alters mt organization around the golgi and, as a consequence, golgi positioning. these findings have been brought together in a model where gmap-210 captures short mt seeds formed at the centrosome by their minus ends and, together with the golgi - localized pool of the clasps that attach to and stabilize the mt plus ends, generates a meshwork of short mts associated with adjacent golgi stacks and links them to form a ribbon (rios., 2004). by interacting with mts emanating from the centrosome, this meshwork would then keep the golgi in the pericentriolar region. however, there are some problems with this model concerning the function of gmap-210 and how it targets to the golgi (summarized in fig.. a schematic depiction of human gmap-210 showing the predicted segments of coiled - coil (green), the grab domain (blue) and grab - associated region (ga1 ; red), and the proline - rich hydrophobic sequence (yellow). nomenclature is that which has been used previously (gillingham., 2004). the data of gillingham and munro (2003) and chen. they identified a minimal golgi - targeting region between amino acids 1757 and 1838, the grab domain. deletion of 17541866 aa, removing the grab domain, or mutation of the conserved aspartate 1780 and leucine 1783 to alanine abolishes golgi targeting of gmap-210 (chen. 2004). neither group found a role for the nh2 terminus in golgi targeting. the data of rios. they described 1375 aa as a golgi - targeting region and 17971979 aa as a mt- and -tubulin complex binding domain. rud3p is a putative yeast golgin associated with early golgi compartments, originally identified as a suppressor of mutants in er to golgi vesicle traffic (kim., 1999 ; rud3p is not an essential gene in budding yeast but its deletion results in glycosylation defects, suggesting it is important for golgi function, perhaps in recycling glycosyltransferases (kim, 2003). initially, rud3p was proposed to be the yeast homologue of golgin-160 ; however, a recent paper shows that it is in fact related to gmap-210 (gillingham., 2004). when analyzing the mechanism by which rud3p targets to the budding yeast golgi, gillingham and munro (2003) identified a cooh - terminal region of 126 amino acids responsible for golgi localization. this region shows some similarities with the grip domain found in a family of other golgins (barr and short, 2003 ; gillingham and munro, 2003). because the grip domain functions by binding a golgi - localized gtpase of the arf - like (arl) family, they reasoned that the golgi - targeting region of rud3p might also bind a gtpase. in vitro binding assays revealed that the golgi - targeting region of rud3p bound to two arf family gtpases, arf1p and arf3p, and that mutations in a key leucine residue abolished golgi targeting and arf1p binding. therefore, this region was termed the grip - related arf - binding (grab) domain. sequence analysis showed that the grab domain is also found in gmap-210 and a variety of related coiled - coiled proteins from a wide range of eukaryotes. one aspect of these proteins that is not conserved is the nh2-terminal region proposed to be responsible for golgi targeting of gmap-210 gillingham and munro (2003) then analyzed the targeting of gmap-210 and found that like rud3p the grab domain containing cooh terminus localized to the golgi, whereas the nh2-terminal 372 amino acids did not. furthermore, neither full - length gmap-210 nor the grab domain were found at centrosomes, and expression of the gmap-210 cooh - terminal domain also failed to recruit -tubulin to the golgi (gillingham., 2004). a previous paper on gmap-210, where the authors believed that it was a potential transcriptional coactivator they called trip230, also found that the region containing grab domain targets to the golgi (chen., 1999). first, the grab domain falls within the region previously shown by rios. (2004) to bind to the -turc and hence mts, and also to localize to the centrosome (infante., 1999). second, the gmap-210 nh2 terminus and not the cooh terminus was claimed to localize to the golgi (infante., 1999). one potential explanation for these differences is that the different constructs and epitope tags used give confusing results. however, our unpublished observations using constructs designed to match those of rios. (2004) with a variety of epitope tags fused at either the nh2 or cooh terminus fail to confirm their findings, but are in agreement with chen. we have also raised specific antibodies to detect endogenous human gmap-210, and these stain the golgi but not centrosomes. thus, the cooh - terminal grab domain of gmap-210 contains golgi rather than centrosomal targeting information. whether or not it also binds mts is still open to debate, but this dual function seems unlikely because mutations that abolish arf binding are diffuse in the cytoplasm and do not obviously target to centrosomes or mt structures (gillingham., 2004). it is of course possible that the grab domain can also bind to the -turc, but one would then have to assume that the mutations inactivating arf binding also abolish an interaction with -turc. such a model would then only be true for gmap-210 in mammalian cells because budding yeast golgi is not reported to show any interactions with mts. one outstanding issue is that a direct interaction between human arf1 and gmap-210 has not been demonstrated to date ; thus, further investigation of gmap-210 will be needed to clarify both its golgi targeting and putative mt binding properties. what exactly is the primary function of the grab domain containing proteins if not in mt binding ? synthetic lethality is a powerful tool of the yeast genetic toolbox that allows insight into the function of cellular pathways that are redundant or not required for growth under laboratory conditions but are likely to be important under physiological growth conditions. in simple terms, one asks which genes, when deleted or mutated in combination with the gene of interest, cause a lethal growth defect. further investigation of the rud3 gene revealed that it is synthetically lethal with ric1, the gene encoding the exchange factor for budding yeast ypt6p (rab6 in mammals ; gillingham., 2004). a previous paper had defined a list of genes synthetically lethal with the ric1 deletion, and strains deleted for these genes were then tested for the ability to target a gfp - rud3p fusion protein to the golgi. a single gene encoding a small membrane protein erv14p was identified by this approach (gillingham., 2004). erv14p recycles between the er and golgi and is required for the selection of a subset of cargo molecules into copii vesicles (powers and barlowe, 1998). exactly how erv14p contributes to rud3p targeting requires further investigation because it does not appear to directly interact with rud3p, but it is a highly conserved molecule and thus likely to be important for golgi targeting of grab domain proteins in other organisms. it is difficult to assemble all these findings into a compelling model, but they suggest that rud3p, and by extension other grab domain proteins including gmap-210, cooperates with both the ypt6/rab6-dependent transport pathway and erv14p - dependent er to golgi transport to maintain normal golgi function. consistent with this idea, overexpression of gmap-210 blocks recycling between the er and golgi (pernet - gallay., 2002). if gmap-210 is not a golgi map, then what other factors are important for mt - dependent golgi positioning ? two candidates can be found in the literature, both putative binding partners for the rab family gtpase rab6. the first of these is rabkinesin-6, identified in a yeast two - hybrid screen for interaction partners of mammalian rab6a and initially proposed to function in a mt - dependent transport step from the golgi to the er (echard., 1998 ; white., 1999). subsequently, it was found that rabkinesin-6 is a cell cycle regulated protein absent from interphase cells and enriched during mitosis where it plays an essential role in cytokinesis (hill., 2000 ;, it seems that its key function is to transport two mitotic kinases, plk1 and aurora b (neef., 2003 ; gruneberg., 2004). the second candidate is bicaudal - d, a golgi - localized binding partner for the dynein dynactin complex (hoogenraad., 2001). bicaudal - d targets to membranes through an interaction with rab6, and thus recruits the dynein dynactin complex to golgi membranes (matanis., 2002 ; short., 2002). the main function of this interaction appears to be in a mt - dependent recycling pathway from the tgn to the er (young., 2005). therefore, it is unlikely that either of these factors plays a significant role in maintenance of golgi positioning in interphase cells. although mts are important for golgi positioning in mammalian cells, this is not true in all organisms. in, drosophila melanogaster for example, the golgi does not form a ribbon and is found as discrete exocytic units evenly dispersed throughout the cytoplasm (stanley., 1997). nevertheless, there is order to golgi positioning in d. melanogaster, and golgi stacks are associated with er exit sites (kondylis and rabouille, 2003). like mammalian cells, positioning, d. melanogaster can restrict specific mrnas to subregions of the er such that specific exocytic units (golgi stacks) deliver this cargo to a local region of the cell surface (herpers and rabouille, 2004). similar considerations apply to plants, which also lack a ribbonlike golgi and organize many small golgi stacks at er exit sites (dasilva.,, 2002), suggesting that the mt cytoskeleton is not required for golgi positioning or secretion in plants. specializations of the secretory pathway have clearly arisen throughout evolution, for example, the regulated secretory pathway important for release of neurotransmitters, stored peptide hormones, and digestive enzymes, and it is important to understand these. the role of mts in vesicle transport and this problem, like many other aspects of golgi form and function, seems to have generated more arguments than answers (farquhar and palade, 1998). maybe this reflects the problems associated with understanding the complex problem of how organelles work and our willingness to oversimplify complex problems. as we have discussed here, there are still many open questions about how the mammalian golgi interacts with mts.	one of the characteristics of the mammalian golgi is its position adjacent to the nucleus. this characteristic is maintained through the action of the microtubule (mt) minus end directed motor dynein and mt - associated proteins (maps). recent findings suggest that gmap-210, a member of the golgin family of proteins, may help to link golgi membranes and vesicles with the mt cytoskeleton. however, there are good grounds to doubt that either gmap-210 or its yeast homologue rud3p is a map. instead, they appear to function in vesicle trafficking events at the golgi together with the gtpase arf1 and a small membrane protein, erv14. as such, the interesting question of how the golgi interacts with mts may well remain open to further investigation.
laparoendoscopic single - site surgery (less) in urology was first described by rane.. the less approach has been utilized for various indications in adults, including donor nephrectomy, simple nephrectomy, and reconstructions such ureteral reimplantation and pyeloplasty. the safety and efficacy of the standard laparoscopic approach has also been described in pediatric populations, in which studies have compared outcomes between the laparoscopic and open approaches. however, there is a paucity of literature regarding application of the less approach in children. concerns regarding the application of less in children are the smaller working space and the need for specialized instrumentation. in this article, we review our experience with less in children. we detail the intraoperative outcomes and the measures taken to reduce the level of difficulty. this was a retrospective analysis of all patients younger than 5 years who underwent less between july 2010 and june 2012. the parameters analyzed included operating room time, blood loss, hospital stay, and complications. all procedures were performed with the patient in a position similar to that used for standard laparoscopy. the patient was placed at the edge of the table with the arms padded and secured. it was made certain that no tubes (suction, irrigation) were placed on the torso. the patients were secured with the help of tape ; however, the use of a bean bag would also be suitable. the surgeon stood while the assistant (camera driver) sat to make space in the operating area. all procedures were done by use of the r - port multi - instrument access port (advanced surgical concepts, bray, ireland), except for one in which a gelpoint port (applied medical, rancho santa margarita, ca, usa) was used. the ports are single - use and have one 10-mm port channel and two 5-mm channels for instrument access. the port features a plastic sleeve that connects two rings, one abdominal and one peritoneal. the ports were inserted by using the open technique. an umbilical skin crease incision was made and the fascia incised.. the opening should not be too large, because the port tends to slip out ; neither should it be too small, because this may cause difficulty in introduction of both the port and the instruments. once the port was inserted, the plastic sleeve was pulled down so that the plastic rings (abdominal and peritoneal) approximated and the port fit snugly on the abdominal wall. in three of our cases, an accessory port was used. the common reasons for introduction of accessory ports included difficulty in upper pole dissection, inadequate exposure of the renal hilum, and difficulty in suturing in reconstructive procedures. the gelpoint mini port accommodates various abdominal wall and incision sizes, provides continuous access, and ensures improved articulation of both 5-mm and 10-mm instruments. the choice of instruments is a matter of surgeon preference ; the surgeon should choose instruments he is familiar with. the nephrectomy followed the typical steps of dissection of the ureterogonadal packets followed by dissection of the hilum (fig. the hilum was secured by using hem - o - lok clips (teleflex medical, research triangle park, nc, usa) with two clips placed on the patient side. in one case, an endo gia stapler (covidien surgical, norwalk, ct, usa) was placed through a 10-mm port inserted through the gelpoint port. the less approach affords the advantage of retrieval of the specimen from the port itself without the need to extend the incision (figs. 1, 2). before a pyeloplasty in pediatric patients, we preferred to place an ultrasound - guided antegrade ureteral catheter. before placing the patient in the laparoscopy position, an ultrasound - guided percutaneous access was gained, and two guide wires were placed in the pelvicaliceal system. over one guide wire a nephrostomy was inserted, whereas over another the ureteral catheter was coiled in the renal pelvis. the advantages of this arrangement are that the ureteral catheter apart from being used as a splint can also be used as a conduit for passage of the stent. in addition, as a protocol, we removed the ureteral catheter first, followed by the nephrostomy. the antegrade ureteral catheter and nephrostomy help to avoid the urethral route for stent removal. the salle stent works on a similar principle except that it is inserted intraoperatively and has a flower at its end that is self - retaining. intraoperatively during dissection, the nephrostomy was clamped, which distends the pelvis and facilitated dissection. all pyeloplasties were done with a modified anderson technique, and the pelvis in all cases was extrarenal and required reduction. the pelvis was hitched up by using a suture placed strategically through the abdominal wall. this helped in dissection of the pelviureteral junction and avoided the need to place an extra port. a triport access port was used during the procedure. an ultrasound - guided antegrade ureteral splint along with a percutaneous nephrostomy the stitch was placed by using a taper - cut needle on a 3/8th circle needle (fig. the antegrade ureteral catheter that acted as a splint was removed on the third postoperative day, and the nephrostomy was clamped for 24 hours and removed. all procedures were performed with the patient in a position similar to that used for standard laparoscopy. the patient was placed at the edge of the table with the arms padded and secured. it was made certain that no tubes (suction, irrigation) were placed on the torso. the patients were secured with the help of tape ; however, the use of a bean bag would also be suitable. the surgeon stood while the assistant (camera driver) sat to make space in the operating area. all procedures were done by use of the r - port multi - instrument access port (advanced surgical concepts, bray, ireland), except for one in which a gelpoint port (applied medical, rancho santa margarita, ca, usa) was used. the ports are single - use and have one 10-mm port channel and two 5-mm channels for instrument access. the port features a plastic sleeve that connects two rings, one abdominal and one peritoneal. the ports were inserted by using the open technique. an umbilical skin crease incision was made and the fascia incised.. the opening should not be too large, because the port tends to slip out ; neither should it be too small, because this may cause difficulty in introduction of both the port and the instruments. once the port was inserted, the plastic sleeve was pulled down so that the plastic rings (abdominal and peritoneal) approximated and the port fit snugly on the abdominal wall. in three of our cases, an accessory port was used. the common reasons for introduction of accessory ports included difficulty in upper pole dissection, inadequate exposure of the renal hilum, and difficulty in suturing in reconstructive procedures. the gelpoint mini port accommodates various abdominal wall and incision sizes, provides continuous access, and ensures improved articulation of both 5-mm and 10-mm instruments. the choice of instruments is a matter of surgeon preference ; the surgeon should choose instruments he is familiar with. the nephrectomy followed the typical steps of dissection of the ureterogonadal packets followed by dissection of the hilum (fig. the hilum was secured by using hem - o - lok clips (teleflex medical, research triangle park, nc, usa) with two clips placed on the patient side. in one case, an endo gia stapler (covidien surgical, norwalk, ct, usa) was placed through a 10-mm port inserted through the gelpoint port. the less approach affords the advantage of retrieval of the specimen from the port itself without the need to extend the incision (figs. 1, 2). before a pyeloplasty in pediatric patients, we preferred to place an ultrasound - guided antegrade ureteral catheter. before placing the patient in the laparoscopy position, an ultrasound - guided percutaneous access was gained, and two guide wires were placed in the pelvicaliceal system. over one guide wire a nephrostomy was inserted, whereas over another the ureteral catheter was coiled in the renal pelvis. the advantages of this arrangement are that the ureteral catheter apart from being used as a splint can also be used as a conduit for passage of the stent. in addition, as a protocol, we removed the ureteral catheter first, followed by the nephrostomy. the antegrade ureteral catheter and nephrostomy help to avoid the urethral route for stent removal. the salle stent works on a similar principle except that it is inserted intraoperatively and has a flower at its end that is self - retaining. intraoperatively during dissection, the nephrostomy was clamped, which distends the pelvis and facilitated dissection. all pyeloplasties were done with a modified anderson technique, and the pelvis in all cases was extrarenal and required reduction. the pelvis was hitched up by using a suture placed strategically through the abdominal wall. this helped in dissection of the pelviureteral junction and avoided the need to place an extra port. a triport access port was used during the procedure. an ultrasound - guided antegrade ureteral splint along with a percutaneous nephrostomy the stitch was placed by using a taper - cut needle on a 3/8th circle needle (fig. the antegrade ureteral catheter that acted as a splint was removed on the third postoperative day, and the nephrostomy was clamped for 24 hours and removed. a total of 11 less procedures were performed on 10 patients (1 was bilateral). an accessory port (3 mm) was inserted in 3 patients. in children undergoing nephrectomy (n=7), the mean age was 3.141.7 years, and the mean operating room time was 97.512.54 minutes. no perioperative complications were encountered. in the pyeloplasty group, the mean operating room time was 19247.16 minutes and the mean patient age was 2.432.3 years. a follow - up renogram at 6 months was available for two patients and showed good drainage. in all our patients who underwent ablative procedures, mean length of stay was 3.6 days (range, 3 to 6 days). since the first description of less surgery in 2007, various surgical procedures have been performed with this approach in urology and allied surgical fields. the literature is scant regarding the application of this approach in small patients, however. as with any surgical procedure, the advantages of less in the pediatric age group are well - defined tissue planes, absence of fat, and thin abdominal walls. the challenges in development of less revolve around technique and anesthesia - related issues. from a technical standpoint, although a few workers have used articulating and bent instruments, we used standard instruments in our series. the technical challenges one encounters are in - line camera and instrument angles and a need for coordination with an experienced camera driver. the various maneuvers that we have used to reduce instrument clashing are as follows : 1) camera driver position : the camera driver sits behind the surgeon, which allows the operating surgeon increased space for movement and decreases crowding in the surgical field. 2) use of long and short instruments in either hand : the instrument can be an articulating or a nonarticulating instrument. 3) hand and instrument crossover : this is useful during dissection of the upper pole, because this is one of the most challenging steps in the procedure. 4) use of a hitch stitch in reconstructive procedures : among the various maneuvers one can use to avoid an extra port is the use of a transabdominal hitch stitch. this stitch is passed through the abdominal wall and is useful in reconstructive procedures such as pyeloplasty. a similar 5) use of a long suction and a harmonic scalpel : we do not use articulating or prebent instruments ; however, an extra - long suction is useful during dissection of the upper pole. 6) use of a camera with coaxial light cable : a camera with a coaxial light cable helps in decreasing instrument clashing ; alternatively, a flexible tip camera helps in providing the surgeon a vantage of the operating field without causing clashing. 7) use of an accessory port : it is debatable whether adding an extra port defeats the purpose of performing the procedure through a single incision. the steps particularly relevant to facilitating suturing are, first, the use of one straight instrument and one bent instrument (to improve triangulation) ; second, the use of a hitch stich for retraction of the redundant pelvis and orienting the anatomy during the anastomosis ; and third, the use of an extra 3-mm port to facilitate suturing. there are reports describing pediatric less in children using the silstm (covidien, norwalk, ct, usa) port. from an anesthesia perspective it is the responsibility of the anesthetist and the surgeon to ensure that the child is positioned properly on the table. it should be ensured that the access port fits snugly, thus preventing subcutaneous emphysema. in addition, the pneumoperitoneum pressures should be kept at 8 - 10, and all efforts made to prevent hypothermia. it has been argued that less with a scar hidden in the umbilicus is cosmetically superior than a scar in the adjacent abdominal wall. in the pediatric age group evidence suggests that visible scarring in children reduces their self - esteem, resulting in impaired socialization skills. thus, lesser scarring through the umbilical incision offered with less will have a lower psychosocial impact on the growing child. it is known that infants have a greater risk of port site hernias ; however, we did not notice any defects in the scars on follow - up in any of our cases. in the series by koh. two patients developed unilateral hydroceles in the first postoperative week. in the pediatric population, the relatively less fat and thin musculature make dissection easy and facilitate easy port insertion. the characteristics of the abdominal wall also make retrieval of specimens easy without the need to extend the incision. advances in instrumentation that may be beneficial for pediatric patients include the spider surgical system (transenterix, durham, nc, usa). this is a single - access device that has two flexible channels that are inserted in the abdomen. the use of magnets for retraction has been described in adults ; however, their utility in children has yet to be proven. the shortcomings and difficulties in development of less in the pediatric age group include the lack of adequately powered randomized studies comparing less with conventional laparoscopy in various procedures. patient safety is the prime consideration, because in children there is no room for error. there is a need to develop simulators in the future for less training in the pediatric age group u. s. food and drug administration data show that the development of pediatric medical devices lags by 2 years compared with adult equipment. although a head - on comparison between standard laparoscopy and less in a pediatric population was beyond the scope of this study, we have eluded to our anecdotal experience with standard laparoscopic pyeloplasty in children. the real advantages of less in children in terms of cosmesis and the perceived " smaller " length of incision need to be proven in larger randomized controlled trials. the results from our series show that less is technically feasible in small patients as young as 4 months of age. the development of smaller instruments will allow further growth of this technique in this patient subgroup.	purposewe report our experience with laparoendoscopic single - site (less) urological procedures in children less than 5 years of age.materials and methodsten patients (11 procedures) underwent less through the umbilicus. seven patients underwent nephrectomy and three patients underwent pyeloplasty (one simultaneous bilateral). r - port port (advanced surgical concepts, ireland) was used in nine cases, in one case, the gelpoint access port (applied medical, rancho santa margarita, ca, usa) was used. the olympus endoeye camera with coaxial light cable was used. the hilum was secured in all cases with hem - o - lok clips (teleflex medical, research triangle park, nc, usa) except in one case in which an endo gia stapler (covidien surgical, norwalk, ct, usa) was used.resultsall procedures were technically successful. accessory port (3 mm) was used in 3 patients. mean age in nephrectomized patients was 3.141.7 years, the mean operative room time (ort) was 97.512.54 minutes. in the pyeloplasty group, mean ort was 19247.16 minutes and mean age was 2.432.3 years. bilateral pyeloplasty was done in a 4-month - old infant. the ort in this case was 180 minutes. a follow - up renogram done in the pyeloplasty patients (n=2) showed good drainage. mean length of stay was 3.6 days (range, 3 to 6 days).the analgesic requirement was 23.86 mg (range, 12.5 to 50 mg) of diclofenac sodium.conclusionsless is technically feasible in patients as young as 4 months of age. it has the potential to offer better cosmesis. this needs to be proved in further comparative studies. development of miniature instruments will further the growth of less in this age group.
the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.	in neurons a well - defined source of signaling ca2 + is the extracellular medium. however, as in all metazoan cells, ca2 + is also stored in endoplasmic reticular compartments inside neurons. the relevance of these stores in neuronal function has been debatable. the orai gene encodes a channel that helps refill these stores from the extracellular medium in non - excitable cells through a process called store - operated ca2 + entry or soce. recent findings have shown that raising the level of orai or its activator stim, and consequently soce in neurons, can restore flight to varying extents to drosophila mutants for an intracellular ca2 + -release channel the inositol 1,4,5-trisphosphate receptor (insp3r). both intracellular ca2 + -release and soce appear to function in neuro - modulatory domains of the flight circuit during development and acute flight. these findings raise exciting new possibilities for the role of soce in vertebrate motor circuit function and the treatment of neurodegenerative disorders where intracellular ca2 + signaling has been implicated as causative.
ovarian cancer has the highest fatality - to - case ratio of all gynecologic malignancies [1, 2 ]. this is attributed to the lack of early warning signs and efficacious early detection techniques [1, 3 ]. another problem hindering the successful management of the disease is the paucity in prognosticators that could assist the selection of treatment modality. one of the most promising routes towards improvement in the detection and surveillance of ovarian cancer is the identification of serum markers. utilization of the ca125 as an ovarian cancer serum marker has improved cancer detection rates during the last few years [1, 2, 3 ]. nevertheless, ca125 does not diagnose early - stage cancers with high accuracy and is prone to false positives. therefore, the need to identify additional serum markers for ovarian cancer is paramount to the successful management of this disease. a major obstacle in finding a diagnostic biomarker is the tremendous molecular heterogeneity that exists for nearly all human cancer, suggesting that simultaneous screening of a patient specimen for multiple biomarkers will be required to improve the early detection / diagnosis of cancer. dna chip technologies address this problem at the genomic level, and provide accessibility to gene expression profiles. however, since proteins are, for the most part, the mediators of a cell 's function, the study of the changes in proteins that result from a pathological lesion, such as cancer, would appear to be a rich source of potential cancer biomarkers. most of the previous studies in search of diagnostic biomarkers have employed two - dimensional electrophoresis (2de) which can resolve hundreds to thousands of proteins present in complex protein mixtures, such as cell lysates and body fluids. although some successes have been reported in detecting potential ovarian cancer - associated biomarkers [4, 5, 6, 7 ], this classical proteomic technique is very time consuming, not highly reproducible, and not easily adaptable to a clinical assay format. a recently developed mass spectrometry proteomic approach, the seldi (surface - enhanced laser desorption / ionization) proteinchip system (ciphergen biosystems, inc, fremont, calif), appears to hold promise for biomarker discovery and as a potential clinical assay format [8, 9 ]. (the seldi system and its applications are described in the report by reddy and dalmasso ; and a recent review by wright). using this system, distinct protein patterns of normal, premalignant, and malignant cells were found for ovarian, esophageal, prostate, breast, and hepatic cancers [12, 13, 14 ]. potential biomarkers for breast and bladder cancers were also detected in nipple aspirate fluid and urine, see respectively [15, 16 ], by the seldi system. recent reports also support that analysis of the seldi data by artificial intelligence algorithms can lead to the identification of protein fingerprints specific for prostate, ovarian, and breast cancers, significantly increasing the accuracy in differentiating cancer from the noncancer groups [17, 18, 19, 20 ]. these studies employed different algorithms to analyze the seldi data, including a genetic algorithm, a decision tree [17, 18 ], and a support vector machine algorithm. the high dimensionality of the data generated by seldi requires a mathematical algorithm to analyze the data without overfitting. since the seldi protein profiling approach is new, it is difficult to determine up - front which algorithm to select for the data analysis and development of a diagnostic classifier. it is also fair to assume that different bioinformatic tools may be required for different cancer or disease systems. the objective of this study was to evaluate the commercially available classification algorithm (biomarker pattern software [bps ]) developed by ciphergen biosystems inc for analysis of the seldi serum protein profiling data from patients with ovarian cancer, benign pelvic diseases, and normal women. the potential, advantages, and drawbacks of this approach as well as suggestions for improvement are discussed. serum samples were obtained from patients with epithelial ovarian cancer prior to treatment administration (n = 44), benign pelvic diseases (n = 61), and from women with no evidence of pelvic disease (n = 34) enrolled through the division of gynecologic oncology, university of texas, southwestern medical center. the demographics of the patients and the stage distribution of the ovarian cancers are presented in table 1. benign conditions included benign pelvic masses (endometriosis, cystadenomas, hydrosalpinx, lipoma, brenner tumor, fibroids, endometrial polyp). the sera were aliquoted and stored at 80c. serum samples were applied on the strong anion exchange (sax) and immobilized - copper (imac) chip surfaces. in brief, 21 l of serum were mixed with 30 l 8 m urea in 1% chaps - pbs ph 7.4 buffer for 30 minutes at 4c, followed by the addition of 100 l of 1 m urea in 0.125% chaps - pbs buffer and 600 l of binding buffer compatible with the type of surface in use (pbs for imac and 20 mm hepes containing 0.1% triton for sax). fifty l of the diluted samples were then applied onto the chips using a bioprocessor. following a 30-minute incubation, nonspecifically bound molecules were removed by 3 brief washes in binding buffer followed by 3 washes with hplc - gradient h2o. acn-0.1%tfa) was applied to the chip array surface and mass spectrometry was performed using a pbs2 seldi mass spectrometer (ciphergen biosystems inc). mass calibration was performed using the all - in - one peptide standard (ciphergen biosystems inc) which contains vasopressin (1084.2 daltons), somatostatin (1637.9 daltons), bovine insulin -chain (3495.9 daltons), human insulin recombinant (5807.6 daltons), and hirudin (7033.6 daltons). protein spectra of one serum sample processed on the imac metal binding chip array and on the positively charged sax chip array. note that several different proteins are captured by the two different chip chemistries. protein peaks were labeled and their intensities were normalized for total ion current (mass range 2200 kd) to account for variation in ionization efficiencies, using the seldi software (version 3.1). peak clustering was performed using the biomarker wizard software (ciphergen biosystems) and the following specific settings : spectral data from imac surface ; signal / noise (first pass) : 4, minimum peak threshold : 10%, mass error : 0.3%, and signal / noise (second pass) : 2 for the 220 kd mass range and signal / noise (first pass) : 5, minimum peak threshold : 10%, mass error : 0.3%, and signal / noise (second pass) : 2.5 for the 20100 kd mass range. spectral data from the sax surface were analyzed with the same set of settings with the difference that the minimum peak threshold was set to 5%. with these labeling parameters, a total of 122 protein clusters (45 from the imac and 77 from the sax surface) were generated. peak mass and intensity were exported to an excel file, and the peak intensities from each duplicate spectra were averaged. pattern recognition and sample classification the decision tree described in the result section was generated using the gini method nonlinear combinations. a 10-fold cross - validation analysis was performed as an initial evaluation of the test error of the algorithm. briefly, this process involves splitting up the dataset into 10 random segments and using 9 of them for training and the 10th as a test set for the algorithm. multiple trees were initially generated from the 122 classifiers by varying the splitting factor by increments of 0.1. the peaks that formed the main splitters of the tree with the highest prediction rates were then selected, the tree was rebuilt based on these peaks alone and evaluated by the test set. the values of p were calculated based on t - test (biomarker wizard software). decision tree classification of the ovarian cancer (c) and noncancer (normal and benign or b) groups. the blue boxes show the decision nodes with the peak mass (m in kd), the peak intensity (i) cutoff levels, and the number of samples. the 5.54, 6.65, and 11.7 kd masses were detected on the imac chip, and the 4.4 and 21.5 kd on the sax chip. these five masses form the splitting rules. the red boxes are the terminal nodes with the classification being either cancer or benign (normal + benign). serum samples were obtained from patients with epithelial ovarian cancer prior to treatment administration (n = 44), benign pelvic diseases (n = 61), and from women with no evidence of pelvic disease (n = 34) enrolled through the division of gynecologic oncology, university of texas, southwestern medical center. the demographics of the patients and the stage distribution of the ovarian cancers are presented in table 1. benign conditions included benign pelvic masses (endometriosis, cystadenomas, hydrosalpinx, lipoma, brenner tumor, fibroids, endometrial polyp). the sera were aliquoted and stored at 80c. serum samples were applied on the strong anion exchange (sax) and immobilized - copper (imac) chip surfaces. in brief, 21 l of serum were mixed with 30 l 8 m urea in 1% chaps - pbs ph 7.4 buffer for 30 minutes at 4c, followed by the addition of 100 l of 1 m urea in 0.125% chaps - pbs buffer and 600 l of binding buffer compatible with the type of surface in use (pbs for imac and 20 mm hepes containing 0.1% triton for sax). fifty l of the diluted samples were then applied onto the chips using a bioprocessor. following a 30-minute incubation, nonspecifically bound molecules were removed by 3 brief washes in binding buffer followed by 3 washes with hplc - gradient h2o. acn-0.1%tfa) was applied to the chip array surface and mass spectrometry was performed using a pbs2 seldi mass spectrometer (ciphergen biosystems inc). mass calibration was performed using the all - in - one peptide standard (ciphergen biosystems inc) which contains vasopressin (1084.2 daltons), somatostatin (1637.9 daltons), bovine insulin -chain (3495.9 daltons), human insulin recombinant (5807.6 daltons), and hirudin (7033.6 daltons). protein spectra of one serum sample processed on the imac metal binding chip array and on the positively charged sax chip array. note that several different proteins are captured by the two different chip chemistries. protein peaks were labeled and their intensities were normalized for total ion current (mass range 2200 kd) to account for variation in ionization efficiencies, using the seldi software (version 3.1). peak clustering was performed using the biomarker wizard software (ciphergen biosystems) and the following specific settings : spectral data from imac surface ; signal / noise (first pass) : 4, minimum peak threshold : 10%, mass error : 0.3%, and signal / noise (second pass) : 2 for the 220 kd mass range and signal / noise (first pass) : 5, minimum peak threshold : 10%, mass error : 0.3%, and signal / noise (second pass) : 2.5 for the 20100 kd mass range. spectral data from the sax surface were analyzed with the same set of settings with the difference that the minimum peak threshold was set to 5%. with these labeling parameters, a total of 122 protein clusters (45 from the imac and 77 from the sax surface) were generated. peak mass and intensity were exported to an excel file, and the peak intensities from each duplicate spectra were averaged. pattern recognition and sample classification the decision tree described in the result section was generated using the gini method nonlinear combinations. a 10-fold cross - validation analysis was performed as an initial evaluation of the test error of the algorithm. briefly, this process involves splitting up the dataset into 10 random segments and using 9 of them for training and the 10th as a test set for the algorithm. multiple trees were initially generated from the 122 classifiers by varying the splitting factor by increments of 0.1. the peaks that formed the main splitters of the tree with the highest prediction rates were then selected, the tree was rebuilt based on these peaks alone and evaluated by the test set. the values of p were calculated based on t - test (biomarker wizard software). decision tree classification of the ovarian cancer (c) and noncancer (normal and benign or b) groups. the blue boxes show the decision nodes with the peak mass (m in kd), the peak intensity (i) cutoff levels, and the number of samples. the 5.54, 6.65, and 11.7 kd masses were detected on the imac chip, and the 4.4 and 21.5 kd on the sax chip. the red boxes are the terminal nodes with the classification being either cancer or benign (normal + benign). one hundred thirty - nine serum samples were assayed by seldi mass spectrometry. both sax and imac surfaces could effectively resolve low - mass (20 kd) protein peaks. figure 1 shows representative protein spectra from one serum sample processed on sax and imac chips. of a total of 139 serum samples, 124 (85 controls and 39 cancers) were randomly selected to form the learning set and 15 (10 controls and 5 cancers) to form the blinded test set for the algorithm. five peaks were selected by the bps algorithm to discriminate cancer from the noncancer groups. figure 2 is the decision tree that was generated from the learning set to classify the two groups. three peaks (5.54, 6.65, and 11.7 kd) detected on the imac chip and 2 (4.4 and 21.5 kd) detected on the sax surface form the main splitters. their mass spectra and gray - scale / gel views are shown in figures 3, 4, 5, 6, and 7. these peaks have significantly different intensity levels between the cancer and benign or normal controls with the exception of the 6.65 and 21.5 kd peaks, which did not differ significantly between cancers and benigns (table 2). a 10-fold cross - validation analysis was performed as an initial evaluation of the accuracy of the algorithm in predicting ovarian cancer. a specificity of 80% and sensitivity of 84.6% were obtained (table 3). in the test set, sensitivity and specificity of 80% the misclassified samples in the test set included one benign (uterine fibroid), one normal, and a stage iii c cancer. statistical comparison of the intensity levels of the peaks used in the decision tree between the cancer and control groups. c - n : cancer versus normal ; c - b : cancer versus benign ; and c - b / n : cancer versus normal and benign. performance of the decision tree in predicting ovarian cancer. numbers in parentheses denote the number of correctly classified sample out of total number of samples in the group. the high degree of genetic heterogeneity associated with human cancers makes it likely that panels of multiple biomarkers will be needed to improve early detection / diagnosis. this entails the development of high - throughput proteomic and genetic approaches as well as of reliable bioinformatic tools for data analysis. the seldi proteinchip system offers the advantage of rapid and simultaneous detection of multiple proteins from complex biologic mixtures. we employed this system in combination with the bps classification algorithm for protein profiling of ovarian cancer in serum. using this approach, a classifier that was 80% accurate in discriminating patients with ovarian cancer from patients with benign disease and healthy controls from a blinded test set evaluation of the classifier by cross - validation and the analysis of the independent test set offers statistical confidence of the potential of this approach as an ovarian cancer detection tool. however, the sample size included in this study decreases the validity of generalized conclusions. complete evaluation of this classifier will require testing its prediction rates for larger blinded and independent serum sets. however, bps, like other mathematical algorithms, is prone to data overfitting, and also is not reliable when a large number of variables relative to samples sizes are included in the analysis. a preselection process of the most significant variables using statistical analysis (eg, roc curve, anova) may help in alleviating this problem. spectra (top) and grey - scale or gel views (bottom) of the peaks (arrows) forming the splitting rules. the protein peak was detected on imac chip. the peak appears to be upregulated in the cancer (c1 c4) compared to the benign (b1-b2) and normal (n1-n2) groups. spectra (top) and grey - scale or gel views (bottom) of the peaks (arrows) forming the splitting rules. spectra (top) and grey - scale or gel views (bottom) of the peaks (arrows) forming the splitting rules. the peak appears to be upregulated in cancer (c1c4) compared to the benign (b1-b2) and normal (n1-n2) groups. spectra (top) and grey - scale or gel views (bottom) of the peaks (arrows) forming the splitting rules. the peak appears to be upregulated in the cancer (c1c4) compared to the begin (b1-b2) and normal (n1-n2) groups. spectra (top) and grey - scale or gel views (bottom) of the peaks (arrows) forming the splitting rules. petricoin recently reported the successful application of a genetic algorithm for the analysis of seldi proteomic data from ovarian cancer patients. in this study, five discriminatory peptides were detected, moleculalr mass range 5002500 daltons, and the accuracy in predicting ovarian cancer in a blinded set of samples was 97.4%. we focused on the analysis of potential biomarkers in higher mass ranges (> 2000 daltons). furthermore, in contrast to the case where bps algorithm is processed, that is, labeled peak information is analyzed, the genetic algorithm employed by petricoin analyzes time - of - flight raw seldi data. in this case, prerequisite for the further identification of the potential discriminatory markers is the coupling of the genetic algorithm with a peak identification system where the raw data are translated into protein peak information. bps employs the peak identification system of the seldi software facilitating biomarker detection. it should be noted, however, that careful and precise selection of the peak labeling settings and normalization of peak intensities are considered critical for biomarker identification and for the efficient and reliable performance of any learning algorithm used in conjunction with the seldi system. besides providing a preliminary evaluation of the suitability of bps for the comparison of seldi data, our study also demonstrates the potential of combining spectral data from different types of surfaces as a means to increase protein resolution. although, compared to seldi, the resolving power of 2d gel electrophoresis remains unchallenged, we have found that this combinatorial approach can significantly enhance biomarker discovery and increase test accuracy for ovarian and breast cancers from 7075% up to 90%. in conclusion, the bps software appears to be potentially suitable for analysis of the high - dimensional seldi spectral data. avenues for improvement of the algorithm performance include optimization of the peak labeling process as well as preselection of the most significant peaks by statistical approaches. more extended studies will be required to validate the potential and reliability of bps as a bioinformatic tool for proteomic studies. it should also be emphasized that comparative analysis of different types of algorithms will be of paramount importance for the better evaluation of their performance and the selection of the bioinformatic features needed for effective biomarker discovery and discrimination of cancer. this study was supported by grants from the gustavus and louise pfeiffer research foundation, the early detection research network, nci (ca85067), and the virginia prostate center.	recent reports from our laboratory and others support the seldi proteinchip technology as a potential clinical diagnostic tool when combined with n - dimensional analyses algorithms. the objective of this study was to determine if the commercially available classification algorithm biomarker patterns software (bps), which is based on a classification and regression tree (cart), would be effective in discriminating ovarian cancer from benign diseases and healthy controls. serum protein mass spectrum profiles from 139 patients with either ovarian cancer, benign pelvic diseases, or healthy women were analyzed using the bps software. a decision tree, using five protein peaks, resulted in an accuracy of 81.5% in the cross - validation analysis and 80% in a blinded set of samples in differentiating the ovarian cancer from the control groups. the potential, advantages, and drawbacks of the bps system as a bioinformatic tool for the analysis of the seldi high - dimensional proteomic data are discussed.
the anastomotic complications after primary repair of esophageal atresia (ea) are well recognized and can significantly increase the morbidity. the management options for an anastomotic leak (al) vary from conservative management to reoperation. a major al may require esophageal diversion that leads to discarding of the native esophagus. to retain the native esophagus, a redo anastomosis with or without vascularized flaps or a conservative approach with adequate nutritional supplementation have all been described in the literature, however, the reported success of conservative treatment is quite variable. there is no controversy regarding the conservative management of minor leaks, but the management strategies for major anastomotic disruptions are still not standardized. gastroesophageal reflux is associated with a significant number in patients of ea and is one of the factors preventing the closure of al leading to failure of conservative treatment. we performed transgastric feeding jejunostomy (fj) with decompressing gastrostomy in patients of ea with anastomotic dehiscence and studied its effect on healing. from january 2006 to october 2012, 20 consecutive neonates with major al, fulfilling the inclusion criteria, were prospectively studied. all the leaks were identified in the chest tubes and these patients were managed with a decompressing gastrostomy and transgastric fj. transgastric fj was used for enteral nutrition, and none of the patients received total parenteral nutrition (tpn). in our study, a major leak was defined as the presence of either more than 20% of the total nasogastric feeds draining out through the intercostal drain or < 20% of total nasogastric feeds with chest complications (pneumothorax, persistent collection, and lung collapse), increase in ventilatory parameters and worsening general condition of the neonate. patients with a major leak who developed pneumothorax or persistent collections were considered for insertion of a second intercostal chest drain (icd). the patients with high icd output draining more than 20% of the feeds and those with continuing chest complications underwent gastrostomy and fj and formed the subjects of this report [figure 1 ]. the patients with a minor leak and those who improved with a second icd were excluded from the study. algorithm for management of major anastomotic leak a transgastric fj was done by selecting an area in the body of the stomach as is done for gastrostomy. a hole was created within a purse string suture through which a malecot 's catheter of suitable size and a 6 fr infant feeding tube were introduced. the malecot 's catheter was kept inside the stomach while the feeding tube was guided across the duodenum into the jejunum. the purse string was tightened, and the stomach was fixed to the abdominal wall in a watertight manner at the exit of the tubes. a gastrostomy tube was used for decompression while the jejunostomy was used for feeding purpose. the objectives of the study were to analyze the effect of fj and gastrostomy in terms of decrease in the chest tube output, improvement of lung complications, change in parameters of ventilation, and subsequent anastomotic healing. over a period of 6 years, 20 patients with major anastomotic dehiscence were analyzed. the birth weight of patients ranged from 1.6 to 3.3 kg (mean-2.2 kg). all patients underwent primary end to end anastomosis of the esophagus (vicryl 5 - 0) with ligation of fistula and 15 patients required mobilization of the lower pouch also. as per the management protocol, after primary repair, the patients were nursed in head up position, and the feeds were started by transanastomotic feeding tube on 2 postoperative day in all the patients, except two who had associated jejunal and rectal atresia. al was clinically noted in all these patients from 3 to 5 postoperative day with chest tube showing evidence of saliva. all the patients of al were managed conservatively, and the feeding was continued through the nasogastric tube. the contents of the leak were saliva mixed with feeds, and the amount was more than 20% of nasogastric feeds in all the patients. the first chest drain was effective in 75% of the patients, whereas a second icd was required in the remaining 25% (5/20) for persistent pneumothorax or collection. on an average, the patients underwent gastrostomy and fj on the 12 postoperative day (range 8 - 15 days) after an adequate trial of conservative management. after fj and gastrostomy, the condition of lungs improved gradually in 53% of patients (8/15) with single chest tube over next 8 - 10 days who could then be extubated. the rest of the patients required prolonged ventilation due to persistent high chest tube output, and associated heart and gastrointestinal diseases. there was a gradual reduction in chest tube output and improvement in the condition of chest in these patients also. on an average, the postoperative ventilation was required for 25 days (14 - 51 days). enteral nutrition could be started through the jejunostomy in two - thirds (14/20) of the patients on the 2 postoperative day. esophagogram demonstrated healing of the anastomosis and leak free patency after an average of 1.5 months (range 1 - 3 months) when oral feeds could be instituted. of these six, two developed jejuno - cutaneous fistulas as a complication of jejunal intubation, two necrotizing enterocolitis and one each had associated jejunal and rectal atresia. remaining two patients had severe associated congenital heart anomalies. in the follow - up, gastroesophageal reflux was noted in seven patients, and six of them had a resolution of the reflux over next 2 years. four patients developed stricture, out of which two were amenable to multiple dilatations, but the other two required resection of the strictured segment and end to end anastomosis. one had a rare complication of pseudo - diverticulum that required excision [figure 2 ]. the overall incidence of al age after surgical repair of ea is around 15 - 17% but major leakage is approximately 3.5%. the main factors held responsible for anastomotic dehiscence are the use of certain suture materials such as silk, devascularization secondary to extensive dissection, excess tension on the sutures, small and friable lower segment, technically poor suturing techniques, and inaccurate mucosal apposition. current management of als depends on the clinical condition of the patient and the extent of leak. labeled involvement of more than one - fourth circumference of the esophagus as a major leak. chavin. reported 11 cases of als, seven of which were considered in contrast to the above - mentioned studies, we defined the of degree of al as major or minor based not only on chest tube output but also the presence or absence of pneumothorax, chest collection, and lung collapse. major leaks usually occur in early postoperative period (< 48 h) and may require additional procedures such as rethoracotomy or esophageal diversion to tide over the situation. however, minor leaks detected on the routine contrast study on 5 - 7 day postoperatively usually heal spontaneously, with or without strictures. when anastomotic dehiscence occurs, the choice between surgical and conservative management can be difficult. initially, a conservative approach was advised as long as the lungs were maintained in an expanded state although this required careful and prolonged monitoring. inability to prevent lung complications and deliver adequate enteral nutrition via nasogastric route necessitated surgical intervention. in addition, tpn is required for these patients, which has its own short and long - term complications and availability may be an issue in developing countries. however, many a times, the decision to abandon the wait - and - see approach and reoperate is both complex and crucial. some authors advice early thoracotomy and reanastamosis, with good results. in most cases, the recently operated friable tissue is further jeopardized by being constantly in contact with salivary and possibly gastric juices from the leak. another approach to manage major als involves a cervical esophagostomy and gastrostomy followed by gastric, colonic, or jejunal interposition at an appropriate time, like a staged procedure. apart from abandoning the native esophagus, consequences of interposition grafts such as poor motility, severe gastric reflux and the tenuous nature of the blood supply especially in jejunal grafts make these less than ideal. primary gastric pull up in patients with als has also been described but is not feasible, most of the times, due to sepsis, and poor general condition. use of anticholinergic medications, to reduce the drain output, during the conservative approach has also been described recently. none of the above - mentioned approaches have turned out to be ideal and free of complications. with this background, we describe an innovative addition in the form of an fj with gastrostomy, which is feasible in an acute setting without rendering the native esophagus unusable in future. our results even though not very encouraging show significant improvement in a subset of patients who did not require esophageal replacement after major al. first, it is less time consuming and requires less anesthesia time in the friable, septic cohort of patients with major al. furthermore, gastrostomy drainage in the early period helps in decreasing the reflux which is an aggravating factor for al. third ; an ability to institute early enteral feedings is a major advantage which could be done in the majority of our patients. this improved the overall well - being, avoided complications of parenteral nutrition and provided breast milk during this crucial period. nonavailability of silastic tubes which are more suitable for jejunostomy forced us to use simple nasogastric tubes although these are likely to become hard with the passage of time. many complications such as accidental dislodgment of the tube, bowel perforation with peritonitis, and a jejunocolic fistula formation have been described in the literature and were noted in our patients as well. in the initial part of the study, the decision for doing fj was delayed as it was based on lung condition and chest tube output. there was a tendency to continue conservative management in the presence of good lung condition even with persistent chest tube drainage. in the later part of study, the patients underwent the procedure at an earlier stage as a result of the experience gained and showed better outcomes. we do not claim that this procedure is an ideal way of managing major anastomotic dehiscence but can be considered in a septic cohort of patients who would otherwise end up with an esophageal replacement. it can also be considered at centers, which can not provide long - term tpn. although many of our patients required secondary procedures to normalize the esophageal tube, yet they had the benefit of native esophagus. the mainstay of treatment of most esophageal al after tracheoesophageal fistula repair includes adequate chest drainage, treatment of infection, observation, and maintenance of proper nutrition. protocolized treatment can lead to better results, avoiding the therapeutic dilemmas, and delay in interventional decisions. gastrostomy and fj are feasible in this crucial period and may help in salvaging the native esophagus.	aims : to investigate the role of feeding jejunostomy (fj) in patients of esophageal atresia with anastomotic leak (al) to decrease the degree of gastroesophageal reflux (ger) and its effect on anastomotic healing.materials and methods : twenty neonates, with major al and severe ger after primary repair were managed with decompressing gastrostomy and transgastric fj and analyzed prospectively.results:male to female ratio was 1.7:1. mean birth weight was 2.2 kg. anastomotic gap ranged from 0 to 4 cm. the amount of leak was more than 20% of nasogastric feeds. gastrostomy and fj was done on an average of the 12th postoperative day, after observing the general condition, chest tube output, lung expansion, and ventilatory requirement. there was a drastic reduction in chest tube output and lung expanded in all patients. average hospital stay was 36 days (8 - 80 days). sixty percentage patients were discharged successfully on fj. esophagogram demonstrated healing and leak free patency after an average of 1.5 months. ger was noted in seven patients, four developed stricture, and one had pseudodiverticulum in follow-up.conclusion:decompressing gastrostomy and fj can be an alternative to managing major als. it helps in healing of anastomotic dehiscence and in preserving the native esophagus.
the author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.	amphibians are important vertebrates in toxicology often representing both aquatic and terrestrial forms within the life history of the same species. of the thousands of species, only two have substantial genomics resources : the recently published genome of the pipid, xenopus (silurana) tropicalis, and transcript information (and ongoing genome sequencing project) of xenopus laevis. however, many more species representative of regional ecological niches and life strategies are used in toxicology worldwide. since xenopus species diverged from the most populous frog family, the ranidae, ~200 million years ago, there are notable differences between them and the even more distant caudates (salamanders) and caecilians. these differences include genome size, gene composition, and extent of polyploidization. application of toxicogenomics to amphibians requires the mobilization of resources and expertise to develop de novo sequence assemblies and analysis strategies for a broader range of amphibian species. the present mini - review will present the advances in toxicogenomics as pertains to amphibians with particular emphasis upon the development and use of genomic techniques (inclusive of transcriptomics, proteomics, and metabolomics) and the challenges inherent therein.
collision cancers are malignancies in the same organ or anatomical site that comprises at least two different tumor components, with no mixed or transitional area between the two components., it is known that the prognosis of collision cancer is very poor even after radical resection. herein, we present a case of coexisting neuroendocrine carcinoma and conventional adenocarcinoma (collision tumor) in the ampulla of vater, which has seldom been reported in literature. a 51-year - old man was presented with a month history of jaundice, pruritis and choluria. he had no history on medical problems, but was paraplegic due to his car accident. physical examination showed acutely ill appearances without fever, with generalized skin and mucosal jaundice also being observed, but otherwise, his overall symptoms were unremarkable. in laboratory findings, we found elevated serum levels of bilirubin (3.38 mg / dl), alkaline phosphatase (229 u / l), gamma - glutamyl transpeptidase (843 u / l), alanine aminotransferase (389 u / l), and aspartate aminotransferase (602 u / l). all tumor markers, including serum carcino - embryonic antigen (cea) and carbohydrate antigen 19 - 9 (ca 19 - 9) were within normal limits. abdominal computed tomography (ct) and magnetic resonance cholangiopancreatography (mrcp) disclosed about 1.91.8 cm sized heterogeneously enhancing mass in ampulla of vater, causing obstruction of distal common bile duct, and dilatation of biliary tree and wirsung duct. 1). with the clinical diagnosis on tumor of the ampulla of vater, endoscopic retrograde cholangiopancreatography (ercp) was performed, which revealed huge prominent papilla and dilated common bile duct with asymmetrically irregular structures (fig. he underwent pylorus - preserving pancreaticoduodenectomy under the diagnosis of ampulla of vater cancer. in operation finding, there was about 21.5 cm sized hard mass on ampulla of vater. several enlarged lymph nodes were found around periampullary region, and all of them were cleared. the patient suffered from delayed gastric emptying during his recovery, probably because he was paraplegic and bed - ridden. he recovered from delayed gastric emptying in 50 days after surgery, and was discharged on postoperative day 59. after discharge, he was re - admitted due to ongoing nausea, and was later expired due to tumor lysis syndrome on postoperative day 90. pathologically, routine haematoxylin and eosin stains through the sections on the ampulla of vater showed multiple nests of tumor cells displaying a prominent organoid pattern of growth and forming rosettes. the tumor cells were large and had a moderate amount of eosinophilic cytoplasm, a low nuclear to cytoplasmic ratio, and round or oval nuclei of various sizes. the tumor cells were immunoreactive for cd56, neuron specific enolase (nse) and synaptophysin. in addition, conventional ductal adenocarcinoma composed of infiltrating glands was seen. in this area, the immunochemical stain with cd56, nse and synaptophysin was negative, and this area extended and collided with poorly differentiated neuroendocrine carcinoma (fig. thus, we finally diagnosed the condition as ' collision tumor ' of adenocarcinoma and neuroendocrine carcinoma in ampulla of vater. the majority of neuroendocrine tumor (net) occurs in the gi tract (67.5%) and in the bronchopulmonary system (25.3%). within the gi tract, most nets occur in the small intestine (41.8%), rectum (27.4%), and stomach (8.7%).1 less than 1% of nets occur in the ampulla of vater.2 the who classification published in 2010 fundamentally divides net into 2 clinically distinct pathologic classes : well- and poorly differentiated.3 well - differentiated nets can be classified as either low or intermediate grade. well - differentiated grade 1 and grade 2 nets traditionally have been referred to as carcinoids, regardless of grade or site of origin. poorly differentiated nets are high - grade, large cell and small cell carcinomas are characterized by rapid dissemination, resistance to treatment, and have a highly fatal course. disease extent varies according to location of the primary tumor.4 patients with distant metastases (well- and moderately differentiated) have a median survival of 33 months.4 the median survival of patients with distant metastases who have anaplastic nets is only 5 months.4 across all types of nets, prognosis seems to be dependent on both the histology and extent of the disease. well - differentiated grade 1 nets are generally associated with less - aggressive behaviors, grade 2 nets have a more variable clinical course, and poorly differentiated grade 3 nets are characterized by extremely aggressive tumor biology and poor prognosis.5 simultaneous coexistence of different tumor is assorted into two characteristics : collision tumor and composite tumor.6 a collision tumor is defined as the simultaneous coexistence of at least two independent tumors located in close proximity with no mixed or transitional areas in between. nevertheless, composite tumor is formed by two or more neoplastic tissues with different histological characteristics developed from the same histological origin, as shown by transition area.7,8 collision tumors have occasionally been reported in the past, but recently, there has been an increasing number of emerging reports. the overall prognosis of collision tumor around the periampullary region varies from its differentiation, but malignant collision tumor has dismal prognosis even after the radical resection. this means that the malignant collision tumor is more malignant than the adenocarcinoma of periampullary region. stomach and esophagus are the main sites of origin for collision tumor in the gastrointestinal tract. adenocarcinomas and other malignancies such as squamous cell carcinomas, carcinoid and neuroendocrine tumors are usually situated in these areas.9 - 11 however, occurrences of collision tumors in pancreas and periampullary regions are very rare. only few reports on occurrences of collision tumors in periampullary regions have been published in english literature.2,8,12 - 18 preoperative diagnosis of collision tumors is difficult due to its lack of specific symptoms and radiologic features. in addition, serum levels of tumor markers such as cea and ca 19 - 9 are not significantly different from the adenocarcinoma patients. although it is difficult to diagnose collision tumors preoperatively, radical resection of tumor is still the reasonable treatment choice for resectable tumors. nevertheless, some studies insisted that it is debatable whether surgical resection is a proper treatment, because of its dismal prognosis.19 chemotherapy using gemcitabine has been widely used for periampullary malignancies clinically, but there is no proven efficacy for collision tumors in periampullary region.19 this is probably due to the highly malignant nature of collision tumors and some unknown oncological features of collision tumor. generally, neuroendocrine tumor has higher invasiveness and poorer prognosis than adenocarcinoma in collision tumor for ampulla of vater.20 therefore, it is reasonable to treat more aggressive tumors in collision tumors, such as the neuroendocrine tumor in this case. according to the who complementary notes on tnm staging of malignant tumors, if more than one tumor co - exists in one organ, the staging of the tumors, we presented a case of coexisting neuroendocrine carcinoma and conventional adenocarcinoma in the ampulla of vater. thus, principle therapeutic modalities are not available, such as the extent of resection, off - the - shelf chemo - regimen, and adjuvant therapeutic tools. further investigations are required to determine the tumorigenesis of collision tumor, and to generate principle therapeutic modalities of collision tumor in ampulla of vater.	herein, we present a case of coexisting neuroendocrine carcinoma and conventional adenocarcinoma (collision tumor) in the ampulla of vater, which has seldom been reported in the literature. a 51-year - old man presented with a month history of jaundice. mrcp disclosed about 1.91.8 cm sized heterogeneously enhancing mass in ampulla of vater, causing obstructions of distal common bile duct. he underwent pylorus - preserving pancreaticoduodenectomy under the diagnosis on ampulla of vater cancer. pathologically, sections on the ampulla of vater showed conventional ductal adenocarcinoma extended and collided with poorly differentiated neuroendocrine carcinoma. in conclusion, we hereby presented a case of coexisting neuroendocrine carcinoma and conventional adenocarcinoma in the ampulla of vater.
urate (uric acid) is the major inert end product of purine degradation in humans and higher primates in contrast to most other mammals because of the genetic silencing of hepatic enzyme uricase, which is oxidized to water soluble allantoin1), and serum urate concentration is determined by the balance between production and elimination2). the kidney plays a dominant role in urate elimination because it excretes approximately 70% of the daily urate production. particularly, the renal proximal tubule has an important role in transport of organic anions including urate3). renal handling of uric acid in the proximal tubule seems bidirectional, apical absorption via the urate / anion exchanger and basolateral uptake via organic anion transporters4). the organic anion transporter type 1 (oat1) is expressed at the basolateral membrane of proximal tubular cells and functions as an organic anion / dicarboxylate exchanger that takes up organic anions from the plasma into proximal tubular cells. the organic anion transporter type 3 (oat3) is also localized at the basolateral membrane of the proximal tubular cells, and may be involved in the transport of endogenous and exogenous organic anions5). also, oat3 has been identified as an organic anion / dicarboxylate exchanger similarly to oat16). in addition, urat1 is a urate - anion exchanger regulating blood urate levels and has been reported to be expressed in the apical membrane of proximal tubular cells.. however, the physiologic roles of these urate transporters in regulation of uric acid transport in the kidney are not clearly defined8). hyperuricemia and gout in humans have important clinical implications because of their pathogenic roles in atherosclerosis and other cardiovascular diseases9). this study was undertaken to investigate in rat kidneys whether the protein abundance of urat1, oat1 and oat3 is affected by the increase in uric acid intake. we used specific pathogen - free male sprague - dawley rats (orient bio co., korea) weighing 180 - 220 g. the rats were randomly divided into control (n=6) and uric acid - supplemented (n=6) groups. the control rats were fed regular rat chow 15 g per 180 g bw per day and the uric acid - supplemented rats were additionally given 0.75 g of uric acid (sigma, st louis, mo) per 180 g body weight per day for 8 days. all the rats ate the entire amount of the offered rat chow and showed a steady increase in body weight throughout the study period. after the animal experiment, kidneys were harvested and semi - quantitative immunoblotting was carried out from cortical homogenates using polyclonal peptide - derived antibodies to urat1, oat1, and oat3. when the rats were killed, kidneys were rapidly removed for dissection of the cortices. the cortices were placed in 10 ml of ice - cold isolation solution containing 250 mm sucrose, 10 mm triethanolamine (sigma), 1 ug / ml leupeptin (sigma), and 0.1 mg / ml phenylmethylsulfonyl fluoride (sigma) titrated to ph 7.6. the mixture was then homogenized at 15,000 r.p.m. with three strokes for 15 sec using a tissue homogenizer. after homogenization, total protein concentration was measured using the bicinchoninic acid protein assay regent kit (sigma) and was adjusted to 2 g / ul with isolation solution. the samples were then stabilized by adding 1 volume of 5 laemmli sample buffer per 4 volumes of sample and by heating to 60 for 15 min. initially, ' loading gels ' were performed for each sample set to allow fine adjustment of loading amount so as to guarantee equal loading on subsequent immunoblots. a 10 g aliquot of protein form each sample was loaded into individual lanes, electrophoresed on 12% sds - polyacryl - amide minigels using a mini protean iii electrophoresis apparatus (bio - rad, herculs, ca) and then stained with coomassie blue dye (g-250, bio - rad ; 0.025% solution made in 4.5% methanol and 1% acetic acid). after destaining, selected bands from these gels were scanned (gs-700 imaging densitometry, bio - rad) to determine the density and relative amounts of protein loaded in each lane. finally, protein concentrations were ' corrected ' to reflect these measurements. for immunoblotting, the proteins were transferred eletrophoretically from unstained gels to nitrocellulose membranes (bio - rad). after blocking with 5% skim milk in pbs - t (80 mm na2hpo4, 20 mm nah2po4, 100 mm nacl, 0.1 percent tween-20, ph 7.5) for 30 min, membranes were probed overnight at 4 with the respective primary antibodies. for probing blots, all antibodies were diluted into a solution containing 150 mm nacl, 50 mm sodium phosphate, 10 mg / dl sodium azide, 50 mg / dl tween 20, and 0.1 g / dl bovine serum albumin (ph 7.5). the secondary antibody was goat anti - rabbit igg conjugated to horseradish peroxidase (31458 ; pierce, rockford, il) diluted to 1:5,000. antibody - antigen reaction sites were viewed using an enhanced chemiluminescence substrate (ecl rpn 2106 ; amersham pharmacia biotech, buckinghamshire, uk). relative quantification of resulting immunoblot band densities was carried out by densitometry using a laser scanner and imagequant software (molecular analyst version 1.5, bio - rad, hercules, ca). for semiquantitative immunoblotting, we used rabbit polyclonal peptide - derived antibodies against rat oat1 (roat1), rat oat3 (roat3), and mouse urat1 (murat1). quantitative comparisons between the groups were made by the mann - whitney u test (statview software ; abacus concepts inc., berkeley, ca). to facilitate comparisons in the semiquantitative immunoblotting, we normalized the band density values by dividing by the mean value for the normal control group. we used specific pathogen - free male sprague - dawley rats (orient bio co., korea) weighing 180 - 220 g. the rats were randomly divided into control (n=6) and uric acid - supplemented (n=6) groups. the control rats were fed regular rat chow 15 g per 180 g bw per day and the uric acid - supplemented rats were additionally given 0.75 g of uric acid (sigma, st louis, mo) per 180 g body weight per day for 8 days. all the rats ate the entire amount of the offered rat chow and showed a steady increase in body weight throughout the study period. after the animal experiment, kidneys were harvested and semi - quantitative immunoblotting was carried out from cortical homogenates using polyclonal peptide - derived antibodies to urat1, oat1, and oat3. when the rats were killed, kidneys were rapidly removed for dissection of the cortices. the cortices were placed in 10 ml of ice - cold isolation solution containing 250 mm sucrose, 10 mm triethanolamine (sigma), 1 ug / ml leupeptin (sigma), and 0.1 mg / ml phenylmethylsulfonyl fluoride (sigma) titrated to ph 7.6. the mixture was then homogenized at 15,000 r.p.m. with three strokes for 15 sec using a tissue homogenizer. after homogenization, total protein concentration was measured using the bicinchoninic acid protein assay regent kit (sigma) and was adjusted to 2 g / ul with isolation solution. the samples were then stabilized by adding 1 volume of 5 laemmli sample buffer per 4 volumes of sample and by heating to 60 for 15 min. initially, ' loading gels ' were performed for each sample set to allow fine adjustment of loading amount so as to guarantee equal loading on subsequent immunoblots. a 10 g aliquot of protein form each sample was loaded into individual lanes, electrophoresed on 12% sds - polyacryl - amide minigels using a mini protean iii electrophoresis apparatus (bio - rad, herculs, ca) and then stained with coomassie blue dye (g-250, bio - rad ; 0.025% solution made in 4.5% methanol and 1% acetic acid). after destaining, selected bands from these gels were scanned (gs-700 imaging densitometry, bio - rad) to determine the density and relative amounts of protein loaded in each lane. finally, protein concentrations were ' corrected ' to reflect these measurements. for immunoblotting, the proteins were transferred eletrophoretically from unstained gels to nitrocellulose membranes (bio - rad). after blocking with 5% skim milk in pbs - t (80 mm na2hpo4, 20 mm nah2po4, 100 mm nacl, 0.1 percent tween-20, ph 7.5) for 30 min, membranes were probed overnight at 4 with the respective primary antibodies. for probing blots, all antibodies were diluted into a solution containing 150 mm nacl, 50 mm sodium phosphate, 10 mg / dl sodium azide, 50 mg / dl tween 20, and 0.1 g / dl bovine serum albumin (ph 7.5). the secondary antibody was goat anti - rabbit igg conjugated to horseradish peroxidase (31458 ; pierce, rockford, il) diluted to 1:5,000. antibody - antigen reaction sites were viewed using an enhanced chemiluminescence substrate (ecl rpn 2106 ; amersham pharmacia biotech, buckinghamshire, uk). relative quantification of resulting immunoblot band densities was carried out by densitometry using a laser scanner and imagequant software (molecular analyst version 1.5, bio - rad, hercules, ca). for semiquantitative immunoblotting, we used rabbit polyclonal peptide - derived antibodies against rat oat1 (roat1), rat oat3 (roat3), and mouse urat1 (murat1). quantitative comparisons between the groups were made by the mann - whitney u test (statview software ; abacus concepts inc., berkeley, ca). to facilitate comparisons in the semiquantitative immunoblotting, we normalized the band density values by dividing by the mean value for the normal control group. physiologic parameters measured after the animal experiments are summarized in table 1. in response to uric acid supplementation for 8 days, serum uric acid level showed an increasing tendency as compared with the control rats (p=0.055). serum uric acid concentrations were 2.600.27 mg / dl in uric acid - supplemented rats and 1.970.29 mg / dl in the control rats, respectively. however, the urinary uric acid excretion was not significantly different between the uric acid - supplemented rats (3.270.40 mg / d) and the control rats (2.610.34 mg / d). the antibody to urat1 detected a band that corresponded to the utat1 protein, with a molecular mass of approximately -75 kd, in the renal cortex. uric acid supplementation for 8 days resulted in an insignificant change in urat1 protein abundance in the renal cortex. relative densitometry revealed that the urat1 protein abundance in the uric acid - supplemented rats was 13214% (p=0.078, fig. the antibody to oat1 detected a specific band that corresponded to the oat1 protein, with a molecular mass of approximately -70 kd, in the renal cortex. uric acid supplementation for 8 day resulted in a significant increase in oat1 protein abundance in the cortex. oat1 protein abundance was significantly (p=0.037) increased in the uric acid - supplemented rats (14813%) compared with the control rats (1008%). oat3 protein abundance was not significantly different between the uric acid - supplemented rats (13112%) and control rats (10017%). throughout the study period, both the control and uric acid - supplemented rats showed a steady increase in body weight : from 1982 g to 2534 g in the control rats and from 1992 g to 2404 g in the uric acid - supplemented rats. thus, the amount of weight gain was significantly lower in the uric acid - supplemented rats than in the controls (p<0.05). although the daily urine output was not significantly different between the two groups (table 1), it was significantly larger in the uric acid - supplemented rats than in the controls (55.06.9 vs. 38.73.9 l / g / d, p<0.05) when it was expressed per g body weight. this relative difference in urinary concentration led us to carry out immunoblotting against water channels aquaporin 1 and aquaporin 2. 4 revealed that both aquaporin 1 and aquaporin 2 protein abundances had no significant differences between the control and uric acid - supplemented rats. we examined the effects of uric acid supplementation on the abundance of oat1, oat3, and urat1 proteins in the kidney using semi - quantitative immuoblotting. the results showed that oat1 protein abundance in the renal cortex was significantly increased by uric acid supplementation whereas urat1 and oat3 protein abundances were not significantly affected. although urate may have beneficial effects in conjunction with genetic or environmental factors, such as scavenging potential harmful radicals in our body12, 13), it can cause significant health problems, including complications associated with urate crystals such as kidney stones and gout. humans are the only mammals in whom gout is known to develop spontaneously, probably because hyperuricemia only commonly develops in humans14). the absence of uricase, combined with extensive reabsorption of filtered urate, results in urate levels in human plasma that are approximately 10 times those of most other mammals15). however, hyperuricemia can be detrimental in human, as demonstrated by its proven pathogenetic roles in gout and nephrolithiasis and by its putative roles in hypertension and other cardiovascular disorders16). thus, we tried our animal model of urate excess to investigate renal adaptation on the level of urate transporters. there is general agreement that virtually all urate transport occurs in the renal epithelial cells of the proximal convoluted tubule. since transport is bidirectional, urate anions must be capable of moving both from lumen to blood and from blood to lumen at this site17). although reabsorption and secretion may occur simultaneously within a single cell under specific conditions, there is direct evidence that net reabsorption occurs in the early part of the proximal convoluted tubule (s1 region), net secretion in the s2 region and post - secretory reabsorption, if it exists, in the later part (s3 region) of this section of the nephron18, 19). the roat1, which is mainly located in s2, constitutes a specific mechanism for the secretion of urate from the blood to the lumen at the proximal tubules17). our result of increased abundance of roat1 in response to uric acid supplementation suggests the contributory role of roat1 to enhance urate secretion to relieve the state of urate excess. on the other hand, since it is distributed over s1, s2, and s3 segments, the contributions of roat1 and roat3 in the basolateral uptake of organic anions may differ. as a new member of the oat family, urat1, may act for urate reabsorption7) in the kidney, where the protein is located at the apical (luminal) membrane of the epithelium of proximal tubules. the urat1 has been demonstrated to be located on the brush borders of apical membranes of the proximal tubule and may constitute a specific mechanism for the reabsorption of urate from the lumen (extracellular) to the cytosol (intracellular) at the proximal tubule. initially we hypothesized that urat1 might be down - regulated in response to uric acid supplementation. however, our results showed that the urat1 was not altered by uric acid supplementation at least on the level of transporter protein abundance. in conclusion, among the uric acid transporters in the rat kidney, oat1 may have a regulatory role in response to the increase in uric acid intake in the rat kidney. the up - regulation of oat1 would exert to stimulate urinary uric acid excretion and might contribute to protection from hyperuricemia. therapeutics that are designed to modify oat1 activity for enhancing secretion of uric acid might be useful in treating pathologies that are associated with hyperuricemia and gout.	renal handling of uric acid mainly occurs in the proximal tubule, and bidirectional transport of urate may involve apical absorption via the urate - anion exchanger (urat1) and basolateral uptake via organic anion transporters (oat1 and oat3). in rat kidneys, we investigated whether the protein abundance of urat1, oat1, and oat3 is affected by the increase in uric acid intake. male sprague - dawley rats were randomly divided into control and uric acid - supplemented groups, and uric acid - supplemented rats were given 0.75 g of uric acid per 180 g body weight per day for 8 days. after the animal experiment, kidneys were harvested and semi - quantitative immunoblotting was carried out from cortical homogenates using polyclonal peptide - derived antibodies to urat1, oat1, and oat3. serum uric acid level showed an increasing tendency in the uric acid - supplemented rats compared with control rats, whereas urinary uric acid excretion was not significantly different between the uric acid - supplemented rats and control rats. urat1 protein abundance in cortical homogenates was not significantly different between the uric acid - supplemented rats and control rats. however, oat1 protein abundance was significantly increased in the uric acid - supplemented rats compared with the control rats. oat3 protein abundance was not significantly different between the uric acid - supplemented rats and control rats. in conclusion, oat1 may have a regulatory role in response to the increase in uric acid intake in the rat kidney. the up - regulation of oat1 would exert stimulation of urinary uric acid excretion and might contribute to protection from hyperuricemia.
one woman is sexually assaulted in canada every minute (1). sexual assault is any form of sexual contact without voluntary consent andthat violates a person 's sense of autonomy, control and mastery over their body (2). at the university of alberta, recovery from sexual- assault- related posttraumatic stress disorder (ptsd) is not solely measured by eliminating symptoms or achieving specific outcomes. healing from this trauma does not mean that the survivor will forget the experience or never again experience any symptoms. rather, successful recovery is subjective and measured by whether the survivor increases his or her involvement in the present, acquires skills and attitudes to regain control of his of her life, forgive him or herself for guilt, shame and other negative cognitions, and gain stress reduction skills for overall better functioning (4). there are many factors involved in successful recovery, including the degree of support received, previous self - concept, personal strength, and professional treatment provided by the medical and justice systems (5). ptsd is one of the problems that may result from failure of the recovery process. ptsd is caused by exposure to a traumatic event and intense psychological distress occurs as a result of re - experiencing the event (6). ptsd is diagnosed when symptoms last longer than one month (7). to prevent the distressing reactions, survivors will avoid stimuli that provoke these feelings and this avoidance behaviour can be severe enough to significantly impair daily life (8). the consequences of a sexual assault may be manifested biologically, psychologically, and sociologically. by gaining a better appreciation of the repercussions of sexual assault, a holistic and individualized therapy can be developed to ameliorate the physical and emotional pain following the trauma. the issues facing individuals who have experienced sexual assault will be discussed and improvements in current treatments will be suggested, with hopes to develop more effective and holistic therapies in the future. the us national comorbidity survey report estimates the lifetime prevalence of ptsd among north americans to be 7.8% (9). the lifetime prevalence of ptsd for women who have been sexually assaulted is 50% (10). moreover, sexual assault is the most frequent cause of ptsd in women, with one study reporting that 94% of women experienced ptsd symptoms during the first two weeks after an assault (9). the alarmingly high rate of ptsd in survivors of sexual assault is a strong indication that the current therapies for rape victims are inadequate and in need of improvement. there is no ' cookie cutter ' treatment for every victim suffering with ptsd, as the disorder can manifest itself in many ways (8). it is important to consider the biological, psychological, and sociological impacts when developing effective treatment and intervention methods for sexual - assault - related ptsd. before treatment for sexual - assault - related ptsd can be developed, an understanding of the pathophysiology of ptsd is critical. the dysregulation seen in individuals with ptsd can be observed and measured on all major systems of the body including the neural, endocrine and immune systems (6). the hypothalamic - pituitary - adrenal (hpa) axis plays a key regulatory function in the body, controlling all three systems through negative feedback inhibition. cortisol is a major hormone of the hpa axis and is the primary stress hormone in the body. it is released when stimulated by corticotropin releasing hormone (crh) and inhibited via negative feedback acting at the hypothalamic and pituitary levels. intense psychological trauma such as sexual abuse can cause changes in the body 's response to stress by increasing levels of crh and dysregulating the hpa axis (11, 12). this results in a decreased number of crh receptors in the anterior pituitary, decreased pituitary responsiveness to crh, and disturbed negative feedback inhibition (13). reduced responsiveness to crh causes overactivation of the hpa axis and can disturb negative feedback by cortisol (figure 1). cortisol has widespread action and its dysregulation affects other neural systems including the mesocorticolimbic dopaminergic system, leading to inappropriate fear reactions and persistent mild depression (14). knowledge of the biological changes with ptsd has led to the development of new treatments that offer more comprehensive management of ptsd and enable patients to enjoy an improved quality of life (11). there are five main goals for treating ptsd with medications, including a reduction of the core symptoms such as anxiety and flashbacks, an improvement in stress resilience, an improvement in the quality of life, and a reduction in disability and comorbidity (15). as brunello. concurrent with hpa axis dysfunction, disruption of glutamatergic, serotonergic, and adrenergic systems is a fundamental cause of the structural and functional abnormalities which contribute to the symptoms of ptsd. such symptoms include hyperarousal and re - experiencing feelings associated with the trauma through flashbacks or nightmares (11). the persistent re - experiencing of traumatic events may cause an increase in crh levels, which damages the hippocampus, an important region of the brain associated with learning and memory (16, 17). with psychological trauma, a decrease in hippocampal volume has been observed (6). this volume decrease, when coupled with hypersensitivity of the hpa axis, is associated with a reduction of cognitive functioning drastically affecting the performance of affected individuals (18). selective serotonin reuptake inhibitors (ssris) have been successfully used to treat these hyperarousal symptoms purported to be caused by a decrease in hippocampal volume. ssris are commonly used to treat depression and there is some evidence that they may promote neurogenesis, which might be the therapeutic mechanism by which these medications effect changes in behaviour (18). for example, bremner and vermetten demonstrated a 4.6% increase in the volume of the hippocampus and an improvement in memory of ptsd patients through treatment with the ssri paroxetine (18). many hormones and receptors in the glutamatergic, serotonergic, and adrenergic systems have been identified as key factors in memory and perception, one of which is the gamma - aminobutyric acid receptor (gaba - r) (11). following sexual abuse and the development of ptsd, the dysregulation of the hpa axis can stimulate the adrenergic system, activating gaba - r (15). the multifaceted interactions between these systems may explain the connections of emotions with factual memory. it has been proposed that while a traumatic memory is re - lived during a flashback, there is an increase in the stimulation of gaba - r caused by an increase in the release of endogenous benzodiazepines (15). to control the overstimulation of gaba - r and thereby control anxiety and flashbacks, benzodiazepine inhibitors such as flumazenil have been used successfully (11). this has also been achieved with clonidine to stop nightmares by decreasing the release of catecholamines, a key component of the anxiety - provoking ' fight or flight ' response of the autonomic nervous system (19). the immune system is reciprocally regulated by the neural and endocrine systems and can also be affected by ptsd (20). ptsd often co - occurs with various inflammatory diseases, likely due to hpa axis dysregulation affecting the immune system (21). immunomodulation is therefore important to avoid this subsequent dysregulation of the immune system and this can be achieved with ssris such as fluvoxamine. fluvoxamine has been shown to be effective in decreasing the hyperresponsiveness of the hpa axis, thereby increasing levels of interleukins and other essential immune factors (22). interestingly, there is a sexual dimorphism in immune functioning, as men with ptsd were found to have an inhibited cell - mediated immunity, while women showed enhanced cell - mediated immunity (21). a better understanding of this is necessary and it is important to consider sexual dimorphism for immunomodulation. other drug treatment options are available for ptsd including tricyclic antidepressants (tca), monoamine oxidase inhibitors (maoi), ssris, serotonin antagonists, and anticonvulsants and are described in table 1 (23). although there are some promising studies for medications, reviews of pharmacotherapies for ptsd have revealed that most treatments are inadequate, aside from some supportive evidence of ssri effectiveness (24). although the pathology associated with ptsd has a biological basis, the treatment need not be restricted to drugs. for example, a serious consequence of hpa axis dysregulation is the effect on the steroid hormones, namely estrogen and testosterone, which are also modulated through this axis (25). as a result interestingly, research indicates that fertility may be restored with cognitive behavioural therapy (cbt), just one example of many where psychological intervention was used to treat a biologically based malady (26). after an assault, survivors experience the rape trauma syndrome (rts), which affects not only victims of rape, but also victims of all types of sexual violence and would perhaps be better labelled as sexual assault trauma syndrome. the acute phase occurs immediately following the assault when the survivor is in crisis and experiences a wide range of emotional reactions. these reactions may be categorized as expressive, such as shaking, crying or yelling ; or controlled such as flattened affect, appearing outwardly calm and subdued. the second phase is outward adjustment, when the survivor focuses less on the assault, often with a high level of denial, and involves themselves in normal daily activities. the final phase is long term reorganization, in which the survivor integrates the assault into their view of themselves and resolves their feelings about the assailant. there are many psychological effects to consider following a sexual assault such as feelings of shame, guilt, anxiety or depression (9). these feelings may be even stronger and more harmful if the survivor does not receive support from their family, friends or authorities (9). cognitive factors play a large role in the onset, severity, and outcome of ptsd after sexual assault (28). these factors include mental defeat and confusion, negative appraisal of emotions and symptoms, avoidance and perceived negative responses from others (5). if the survivor of sexual assault believes that others have failed to react in a positive and supportive manner, there is a greater risk of ptsd (9). it has been suggested that trauma recovery is characterized by a reprogramming, integration, and habituation to the traumatic images, leading to a restoration of a sense of safety (29). over time, ptsd symptoms will decrease, the survivor will be less preoccupied with blame towards self and others, and a will achieve a regained sense of control (29). events perceived as uncontrollable are much more distressing than controllable events, therefore with uncontrollable events such as sexual assault, survivors will attempt to attribute blame to behavioural, dispositional or vicarious causes (30). behavioural self - blame has the potential to be adaptive as it promotes the belief that negative outcomes can be avoided in the future ; whereas dispositional self - blame attributes the traumatic event to one 's personality and this thinking does not give a sense of future control (30). vicarious control refers to the perception that some other person or entity had control over the occurrence of that event (30). attributing blame in any of these ways focuses on the past and is associated with poorer outcomes in ptsd. to improve ptsd, treatment outcomes emphasis should be on controlling the present situation and what can be done about the impact of the event, rather than how it could have been avoided or can be avoided in the future (30). in view of the fact that control over the recovery process results in lowered distress levels, fostering this form of control could be an important component of interventions for sexual assault survivors (30). early intervention is critical for sexual assault victims because the level of distress immediately following the assault is strongly correlated to future pathologies and ptsd (31). in a study collecting self - reports from survivors of assault that assessed their degree of support and psychological distress during and immediately following the rape, it was found that high distress levels significantly predicted increased levels of fear and anxiety in the months following the assault (31). as the level of distress is strongly correlated to ptsd symptoms, an attempt to decrease levels of distress immediately following sexual assault may result in a more positive treatment outcome. when survivors seek medical assistance, the forensic rape exam can be very traumatizing (32). resnick., demonstrated that meeting with a rape crisis counsellor or viewing a video before a forensic rape exam depicting in detail what to expect during the exam, resulted in decreased levels of stress after the exam in test groups compared to the non - video control group (32). of all the eligible women, 81% agreed to participate in this video study, indicating that this is a feasible way to decrease distress and reduce future ptsd development following the physical examination. since november 1999, the edmonton capital health authority has run the sexual assault response team of edmonton (sarte) (33). this form of intervention has been very effective in lowering levels of distress in the hospital setting. sarte consists of a team of nurses who are sensitized to the particular needs of survivors, and specialized in dealing with victims of sexual assault. when working with survivors, the nurses explain in detail the procedures they will perform, assist patients in reporting to the police, and maintaining an open environment where the survivor is able to make as many decisions on their own as possible (28). in addition to promising social programs, there are many therapies focussing on the psychological aspect of ptsd. cbt focuses on changing thought patterns and cognitions to decrease negative emotions, develop skills to cope with anxiety and negative thoughts, restore effective social skills, and develop ways to manage anger and future trauma symptoms (9). eye movement desensitization and reprocessing (emdr) is an information processing therapy that combines elements of cbt, psychodynamic, interpersonal, experiential and body - centred therapies to treat ptsd (34). during emdr, the client thinks of past or present traumatic experiences while concurrently focusing on a stimulus such as auditory tones, tactile stimulation, or visual cues (34). this leads to dual attention, changing the processing of the traumatic memories and decreasing anxiety when thinking about the traumatic experience. it has been suggested that ptsd is due to an inability to adequately process the trauma and emdr may be useful in this reprocessing (35). in an emdr study by rothbaum, only 10% of participants who were treated with emdr therapy exhibited ptsd symptoms after treatment, compared to 88% of non - treatment control patients (36). although the role of the eye movements has been contested, emdr is proving to be an effective treatment option for ptsd (36). group therapy can be very effective to help survivors focus on the present and share experiences with others in a safe and empathetic environment. according to one survey, over half of the women who experienced sexual assault within the previous five years never told anyone about their trauma (37). this silence can have an important impact on the development of ptsd, as the degree of support received can influence symptom severity (5). psychodynamic therapy focuses on the emotional conflicts caused by the trauma, especially as they pertain to early life experiences. this helps to develop self - esteem, effective ways of thinking and coping, and may be used to treat ptsd (9). as discussed earlier, focusing on the past is associated with poorer adjustment and present control should be encouraged (30). as such new psychological therapies and treatments are continually developed as older ones are re - evaluated. for example, trauma debriefing is common practice to reduce distress and aid in recovery immediately following a traumatic experience. recently, it has been found that debriefing did not prevent the onset of ptsd and may even increase the risk of ptsd symptoms, demonstrating that treatments should be continuously evaluated and modified (38). both pharmacotherapy and cbt are viable treatment options for ptsd, however it is clear that empowering victims by giving back control is crucial in successful recovery. in one study, survivors were asked to choose between cbt with prolonged exposure to traumatic stimuli or the ssri medication sertraline (39). participants of the study rated cbt as more credible and had more positive feelings towards this treatment option, citing effectiveness and potential side effects as the two primary factors in their decision. when presenting treatment options, it is important to explain both options and put side effects in perspective. many women do not want pharmacotherapy and the therapy provider should give victims of assault a choice when deciding treatment options, to help them regain a sense of control (39). recovery from psychological issues due to sexual assault related ptsd is not solely an individual challenge, but also a challenge for those close to the affected individual (27). the recovery process is also a sociological issue and societal aspects should not be ignored. research indicates that initial levels of distress and perceived control are key factors in the onset and severity of ptsd (31). perceived positive regard and support has also been shown to be important to recovery (28). less than half of individuals who have been sexually assaulted disclose the assault to others and it is clear that many are not getting the support they require. as a large part of the recovery process is related to a solid support network, part of the discussion of treatment and prevention of ptsd should be sociologically directed by targeting attitudes towards and origins of sexual assault with considerations of how these attitudes may create a rape - prone society and allow for such a high frequency of sexual assault. there are many rape myths in our society, for example, beliefs that individuals lie about being assaulted, perpetrators are easily identifiable, or that men can not be sexually assaulted. the number of sexual assault victims willing to tell someone about their experience is increasing, potentially because there is less of a stigma attached to it today and there are more voluntary and professional support agencies (37). although this shows some improvement, many individuals still have attitudes that sex role stereotyping, adversarial sexual beliefs, and acceptance of interpersonal violence, all of which lead to greater acceptance of rape myths (40). although sexual assault programs are becoming more pervasive across college campuses, these programs are not always effective in implementing meaningful changes in cognition and behaviour (32). by understanding the failures of education programs, directions for improvement increasing program length may allow for more meaningful changes in cognition and behaviours to occur (41). targeting the attitudes that lead to greater acceptance of rape myths may lead to a more supportive community for victims of sexual assault. education is vital in rape prevention and to foster a supportive environment for survivors of this crime, but it is clear that more research is needed to improve the efficacy of these programs. secondary trauma occurs when survivors seek assistance from medical, legal or healthcare professionals, but these professionals often exhibit and use victim - blaming behaviours (42). contact with many services especially those which do not specialize in sexual assault traumatization, can increase survivors ' psychological and physical distress (43). society contributes to the acceptance of rape myths through individuals the survivor solicits for help as well as by contributing to the negative cognitions of the survivors themselves. negative cognitions foster self - blame and increase the risk of post - assault psychopathologies, likely contributing to the low disclosure rates. as knowledge of the pathophysiology of ptsd improves, more effective medications are developed to treat and manage the biological aspects of this disorder. the number of rape prevention centres and education programs are on the rise with aims to debunk rape myths, change victim - blaming attitudes and de - stigmatize the subject. one of the most important aspects in assisting the recovery process is empowering the survivor and putting control back into their hands. the three - treatment modalities for the biological, psychological, and sociological impacts should not remain mutually exclusive. physicians, therapists, law enforcement agencies, and family and friends must work together to find the meaning of recovery from the perspective of the survivors and to understand what conditions will facilitate growth and recovery. when the therapies available to treat sexual - assault - related ptsd are brought together during the right stages in the recovery process to form a comprehensive treatment of the highly individual survivor, greater success in decreasing the rate of ptsd associated with sexual assault may be achieved.	sexual assault occurs with alarming frequency in canada. the prevalence of posttraumatic stress disorder (ptsd) in assault survivors is drastically higher than the national prevalence of the disorder, which is a strong indication that the current therapies for sexual - assault - related ptsd are in need of improvement. increasing knowledge and understanding of the pathologies associated with rape trauma in biological, psychological and sociological domains will help to develop more effective treatments for survivors. a dysregulation of the hypothalamic - pituitary - adrenal (hpa) axis is observed in survivors of sexual assault and this may be a fundamental cause of the structural and functional abnormalities contributing to ptsd symptoms. pharmacotherapies are available to treat ptsd ; however, they are often inadequate or unwanted by the survivor. psychological health is compromised following interpersonal trauma and many psychological therapies are available, but with varying efficacy. a person 's cognitions have a dramatic effect on the onset, severity, and progress of ptsd following sexual assault. sociological impacts of assault influence the development of ptsd through victim - blaming attitudes and the perpetuation of rape myths. perceived positive regard and early social support is shown to be important to successful recovery. education is vital in rape prevention and to foster a supportive environment for survivors. the biological, psychological and sociological impacts and treatments should not remain mutually exclusive. a better appreciation of the biopsychosocial repercussions of sexual assault will aid in developing a more holistic and individualized therapy to help alleviate the physical and emotional pain following the trauma of rape.
born of the prophet muhammad s favorite daughter, fatimah, al - hasan was declared as the legitimate successor of his father, ali ibn - abi - talib (the last of the caliphs known to arab historians as orthodox), in 661. faced by his rival, muawiyah ibn - abi - sufyan, who had been proclaimed caliph in 660 in jerusalem, al - hasan abdicated in the same year and reasoned as follows : i have deemed it right to make peace with him and have pledged allegiance to him, since i considered whatever spares blood as better than whatever causes it to be shed. after living in retirement in al - madinah (in present - day saudi arabia) for eight years, al - hasan died in 669, when he was just 45 years of age. the belief that al - hasan died peacefully has not been ruled out by all the experts on muslim history. however, in general, muslim theologians commonly believe that his death was caused by a fatal act of poisoning. with autopsy information unavailable, historical documents are the only available evidence in order to investigate cases such as al - hasan s death scientifically. a few traditions, such as the one containing the following quote, mention that when al - hasan was about to die, he was asked by his younger brother al - husayn to identify his poisoner but refused to do so (as he wanted no innocent person to be falsely accused and killed):if he / she [the poisoner ] is not [i.e., not the one whom i suspect ], i would like no innocent person to be killed because of me.still, the following tradition addresses two concurrent acts of poisoning, which resulted in two victims : al - hasan and a survivor. jadah daughter of al - ashath ibn - qays al - kindi poisoned al - hasan ibn-ali, peace be upon both of them, and poisoned a freedwoman of his ; however, the freedwoman of his vomited the poison while al - hasan kept it in his stomach. this tradition says that a freedwoman of al - hasan who had also been poisoned vomited the poison and survived, which means that she could have served as forensic evidence for the murder of al - hasan. but are there any historical reports in which the poison is qualitatively described and can lead to a forensic hypothesis for the murder of al - hasan ? if he / she [the poisoner ] is not [i.e., not the one whom i suspect ], i would like no innocent person to be killed because of me. jadah daughter of al - ashath ibn - qays al - kindi poisoned al - hasan ibn-ali, peace be upon both of them, and poisoned a freedwoman of his ; however, the freedwoman of his vomited the poison while al - hasan kept it in his stomach. that al - hasan was offered a poisoned drink by his wife jadah is reported in both shiite and sunni sources. since intoxicating drinks, such as wine, are not allowed in islamic law, the drink itself must have been a nonalcoholic drink. according to one tradition one tradition describes the poison that was given to al - hasan as follows : it has been said that he was given gold filings to drink. elemental gold is relatively inert, and an important use for it is in dentistry. it dissolves in concentrated hydrochloric acid if a strong oxidizing agent is present (e.g., in a 3:1 mixture of concentrated hydrochloric acid and concentrated nitric acid). the hydrochloric acid in the human stomach is neither concentrated nor in the presence of a strong oxidizing agent. what could the true identity of the toxic substance that al - hasan had ingested in the drink have been if the powdered solid phase of the substance only looked like gold filings ? in order to answer this question accurately, it is useful to know the geographic source of the poison. the tradition referred to in the introduction, which says that a freedwoman of al - hasan had also been poisoned, suggests that the plot to poison al - hasan was because of some harem jealousy. however, madelung says that al - hasan s pursuit of women was not more covetous than that of most of his class. it is logically appropriate to ask if the murder of al - hasan could have had a political motive force behind it. although al - hasan abdicated, in the process of surrendering the reign, he stipulated that his rival should not be entitled to appoint his successor but that there should be an electoral council. still, when the caliph died in 680, he had already nominated his own son yazid as his successor and caused homage to be paid to him. there are reports, accepted by both shiite sources and several major sunni historians, stating that the poisoning of al - hasan by jadah was at the instigation of the caliph. a very specific report says that in order to eliminate al - hasan, the caliph, whose empire s capital was damascus, wrote to the byzantine emperor and asked him for a poisoned drink, which the emperor, despite refusing at the beginning, sent conditionally. the mention of the conditionality of the emperor s agreement in this report is consistent with the hostility of arab byzantine relations in 669 (the year al - hasan died), when byzantium had an energetic emperor, constantine iv. the mainland of the byzantine empire in 668 (about one year before al - hasan s death) was approximately present - day turkey (figure 1). in present - day western turkey, there are more than 50 mines that contain minerals with deposits of mercury. mercury is isolated from its main ore, cinnabar (mercury(ii) sulfide, hgs), and was used in the mediterranean world for extracting metals by amalgamation as early as 500 bc. the element does not have any known biological functions and has a long history of toxic effects. mercury(ii) chloride (hgcl2), for instance, which was probably first made by arabic alchemists in the 10th century, was widely used as a violent poison in the middle ages. do the mercury mines in western turkey contain any mercury species that look like gold ? (chris ambrose, explore byzantium, http://byzantium.seashell.net.nz/, is credited for the image.) (chris ambrose, explore byzantium, http://byzantium.seashell.net.nz/, is credited for the image.) although abandoned since the 1990s, trkn and haliky are two important mercury mine locations in turkey. the haliky mine exists in an area made up of metamorphic rocks, including gneiss and schist. mine locations also contain deposits of pyrite, marcasite, chalcopyrite, arsenopyrite, quartz, and calcite. the mineral calomel (mercury(i) chloride, hg2cl2) is found as a secondary mineral in oxidized zones along with cinnabar, calcite, and limonite. calomel can present as a yellow gold crust (figure 2) and forms as tetragonal crystals presenting in a variety of formations, including tabular, prismatic, and pyramidal. figure 2.calomel from mariposa mine, texas, usa. (rob lavinsky, the arkenstone, www.irocks.com, is credited for the image.) calomel from mariposa mine, texas, usa. (rob lavinsky, the arkenstone, www.irocks.com, is credited for the image.) the environmental assessments performed at the mine locations in turkey have utilized computer programs to aid in analysis of the soil and water samples. the software programs aquachem and phreeqci determined that water samples taken near the haliky mine presented with oversaturation with calomel, as well as quartz and cinnabar. without an autopsy or any diagnostic testing, it is impossible to diagnose with certainty what poisoned al - hasan. however, we can hypothesize the type of poison used by the symptoms described in the traditions. some clinical symptoms described by traditions of al - hasan s death are a green coloring of the skin and vomiting of blood. these are also symptoms that can be caused by the ingestion of calomel and the resulting mercury intoxication. calomel acts on the kidneys and causes renal tube necrosis and can lead to acute kidney failure. the green coloring is due to a type of anemia called hypochromic anemia, also called chlorosis or green sickness. this type of anemia is caused by a lack of hemoglobin, the oxygen binding protein responsible for nourishing our body tissues with oxygen. hemoglobin is found within the erythrocytes or red blood cells, and a low erythrocyte count is the most common cause of hypochromic anemia. if acute renal failure occurred, erythropoietin, the hormone that signals hemiopoetic stem cells in the bone marrow to have a cell fate of becoming erythrocytes, would not be present due to damage of the proximal renal tubule. the promixal renal tubule is the area in which the red blood cell mass or hematocrit is determined by the kidneys. it stands to reason that if the hematocrit level could not be correctly sensed due to renal tube necrosis, then the signal that is normally sent to the cortical labyrinth to make erythropoietin would be unlikely to occur. the lack of this hormone would prevent new erythrocytes from being made, which in turn would result in a lower hemoglobin level, and a person affected by this would present with an ashen appearance, sometimes said to appear green. the corrosive effects of calomel on the alimentary or gastrointestinal tract are known to cause damage and irritation of the esophagus. kabid, an arabic word that means liver and also means interior. if ulceration were to occur in the esophagus, a certain extent of bleeding should be expected. when human blood reaches the stomach, it is broken down and can coagulate, very often resulting in vomiting a substance that has the appearance of coffee grounds. this occurrence of vomiting blood is referred to as hematemesis and generally occurs due to esophagitis, bleeding ulcers, and certain cancers. considering that the understanding of the human body in the 7th century was less extensive, the commoner s arabic expression to refer to vomited blood clots would have been kabid. in fact, in some rural areas in the arab world, it is still said, my liver is torn and thrust away (kabidi mutaqatti ' mat'un). in several traditions, al - hasan says that he is vomiting pieces of his kabid, which could have been coagulated blood in the emesis, resembling pieces of his liver and/or internal organs due to the coffee - ground color and texture. liver damage is another noted effect of mercury intoxication by calomel, which is due to the accumulation of deposits of mercury via the hepatic portal vein system. this capillary type has the largest pores and is the only type that allows exchange of red blood cells through their pores. red blood cells have susceptibility of the attachment of corrosive sublimate (mercury(ii) chloride, hgcl2) by way of a sulfhydryl attachment. the liver is one of the areas where red blood cells are destroyed when they are damaged, which would allow for more mercury accumulation than the filtering of blood alone. aqueous calomel ingested by the human body is converted into corrosive sublimate, which is known to have much more harmful effects than calomel alone. (hgcl2), by oxidation in the hydrochloric acid (hcl) within the stomach. this reaction, which is shown by equation (1), goes to completion, as the calculated equilibrium constant for it, at the normal human body temperature (37), is keq = 2.4 10. (1)2hg2cl2(aq)+4hcl(aq)+o2(g) 4hgcl2(aq)+2h2o(l) calomel absorption into the body tissues is not seen in large quantities. however, it is enough to cause the anemia mentioned previously. effects of corrosive sublimate, such as intestinal ulceration, are thought to increase the amount absorbed due to the breakdown of protective barriers such as mucous membranes, which prevent absorption before damage. noting that in the traditions al - hasan refers to being poisoned at least three times, if the initial poisoning had started this damage, the subsequent poisonings would have allowed a much greater amount of absorption of calomel or corrosive sublimate. in later centuries, for example, when there was an outbreak of syphilis in europe at the end of the 15th century, calomel was routinely ingested as a medicine. why could the calomel in al - hasan s drink have been lethal ? after the final poisoning, according to a couple of traditions, he says that he has been poisoned three times, and according to a few other traditions, he conveys the information that he has been poisoned at least four times. if the latter is the case, the number of times he was given calomel could have been too many to survive.according to one tradition, the final poisoning was when al - hasan was breaking his fast (islamic fast, which includes refraining from eating and drinking from dawn to dusk) on a hot day. if that is the case, it will naturally lead to the conclusion that he ingested a large quantity of the drink containing aqueous calomel, which is completely converted to corrosive sublimate in the human stomach according to equation (1).the same net ionic equation as that of equation (1) (equation (2)) may be written for the reaction between any acids in the to - be - ingested nonalcoholic drink and the aqueous calomel in the drink, leading to the formation of mercury(ii), which is the mercury in corrosive sublimate. a couple of examples of common arabic nonalcoholic drinks in the 7th century are honey water and yogurt drink, which both contain acids. (2)2hg22+(aq)+4h+(aq)+o2(g) 4hg2+(aq)+2h2o(l) with the reaction shown by equation (2) in the to - be - ingested nonalcoholic drink, al - hasan has ingested some aqueous mercury(ii) cation, in addition to the ingested aqueous calomel, which is converted to corrosive sublimate later (in the human stomach, according to equation (1)).it is possible that the mineral calomel that was mixed with the drink was naturally accompanied by some other toxic substance(s). after the final poisoning, according to a couple of traditions, he says that he has been poisoned three times, and according to a few other traditions, he conveys the information that he has been poisoned at least four times. if the latter is the case, the number of times he was given calomel could have been too many to survive. according to one tradition, the final poisoning was when al - hasan was breaking his fast (islamic fast, which includes refraining from eating and drinking from dawn to dusk) on a hot day. if that is the case, it will naturally lead to the conclusion that he ingested a large quantity of the drink containing aqueous calomel, which is completely converted to corrosive sublimate in the human stomach according to equation (1). the same net ionic equation as that of equation (1) (equation (2)) may be written for the reaction between any acids in the to - be - ingested nonalcoholic drink and the aqueous calomel in the drink, leading to the formation of mercury(ii), which is the mercury in corrosive sublimate. a couple of examples of common arabic nonalcoholic drinks in the 7th century are honey water and yogurt drink, which both contain acids. (2)2hg22+(aq)+4h+(aq)+o2(g) 4hg2+(aq)+2h2o(l) with the reaction shown by equation (2) in the to - be - ingested nonalcoholic drink, al - hasan has ingested some aqueous mercury(ii) cation, in addition to the ingested aqueous calomel, which is converted to corrosive sublimate later (in the human stomach, according to equation (1)). it is possible that the mineral calomel that was mixed with the drink was naturally accompanied by some other toxic substance(s). records of a green hue to al - hasan s skin, which could occur due to acute renal failure, concurrent with his vomiting of blood and, apparently, coagulated blood in the emesis are decisively consistent with those of calomel intoxication. mineral calomel can present as a yellow gold crust (figure 2), which can, in the powdered solid phase, be mistaken for gold filings (the identity of the poison according to a certain tradition). the effect of al - hasan s poisoned freedwoman s recorded experience seems to indicate that contemporaneously to al - hasan s death, both people suffered the same affliction while residing under a common household. this, in light of several historical sources, points at al - hasan s wife jadah as the prime suspect. a considerable number of calomel - containing mercury mines exist in present - day western turkey, which was in the heart of the byzantine empire around the time of al - hasan s death. the caliph sought to nominate his own son as his successor (when the caliph died, he had done so and had caused homage to be paid to the son, who actually succeeded him). al - hasan was obtrusively an obstruction to that goal, because that was despite the caliph s official guarantee of al - hasan s stipulation that he (the caliph) should not be entitled to appoint his successor. the report of the caliph s solicitation of the byzantine emperor by writing a letter asking the emperor for a poisoned drink is a clear example of his intent to act in furtherance of the plot, and, according to the report, the emperor s final response was a positive and deliberate agreement to that end. the fact that neither an autopsy nor a judicial investigation was performed by the authorities at the time should not deter the use in evidence of eyewitness accounts. mineralogical, medical, and chemical facts support the hypothesis that al - hasan s death was caused by calomel (mercury(i) chloride) intoxication. this forensic hypothesis is consistent with the historical position, reflected in ancient (medieval) documents, that al - hasan was poisoned by jadah, at the instigation of the caliph, and with the byzantine emperor s involvement. the author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article. this research received no specific grant from any funding agency in the public, commercial, or not - for - profit sectors.	the puzzle of a mysterious death in the middle ages has been hypothesized in terms of contemporary forensic legal and scientific methods. that al - hasan ibn-ali died in 669 aged just 45 has been forensically analyzed based on written sources that dictate eyewitness accounts of historical events. the report of the contemporaneous poisoning of another individual who resided under the same household as al - hasan s and experienced similar, yet non - lethal, symptoms has served as the beginning of the analysis. in light of ancient (medieval) documents and through using mineralogical, medical, and chemical facts, it has been hypothesized that mineral calomel (mercury(i) chloride, hg2cl2) from a certain region in the byzantine empire (present - day western turkey) was the substance primarily responsible for the murder of al - hasan.
	when using the mass balance equation to model indoor air quality, the primary assumption is that of uniform mixing. different points in a single compartment are assumed to have the same instantaneous pollutant concentrations as all other points. although such an assumption may be unrealistic, under certain conditions predictions (or measurements) of exposures at single points in a room are still within acceptable limits of error (e.g., 10%). in this article, three studies of the mixing of environmental tobacco smoke (ets) pollutants are reviewed, and data from several other ets field studies are presented. under typical conditions for both short sources (e.g., 10 min) and the continuous sources of ets in smoking lounges, i find that average exposure concentrations for a single point in a room represent the average exposure across all points in the room within 10% for averaging times ranging from 12 to 80 min. i present a method for determining theoretical estimates of acceptable averaging times for a continuous point source.imagesfigure 1figure 2figure 3figure 6
ecstatic experiences have been reported in every major religion, and psychologists have long advocated research in these areas [1, 2 ]. neuroscience can contribute to these issues by documenting the brain activity of expert meditators, some of whom have trained to enter these states with volitional control. the type of meditation studied here is a buddhist concentration technique called jhana that induces an altered state of consciousness (asc) in the framework of vaitl. and whose short - term goal is joy or happiness. because happiness is a fundamental goal of many people and is the object of the new discipline of positive psychology [4, 5 ], imaging the brain of an individual who claims to generate joy without any external rewards or cues could point the way toward improved training in joy and greater resilience in the face of external difficulties. jhana meditations consist of a set of 8 sequential practices that were first codified by buddhists over 2000 years ago. all are reported to be ecstatic, in that they generate great joy while in an asc that is dissociated from external cues or stimuli. the first three practices are, to our knowledge, the only meditations to specifically target short - term joy or happiness (see [7, 8 ] for other meditations that generate ascs). figure 1 shows a schematic of the reported jhana experiences on 2 dimensions of interest. joy or happiness is shown on the x - axis, and vigilance for external stimuli is plotted on the y - axis. meditators progress in sequence from normal resting consciousness (rest) to ac, a preparatory meditation concentrating on the breath. when internal concentration is strong enough, j1 is entered, accompanied by strong physical pleasurebetter than sexual orgasm (p.151)and greatly reduced vigilance with smaller startle responses. in j2 joy permeates every part of the body, but with less physical pleasure. in j3, the character of joy changes to deep contentment and serenity. the higher - numbered jhanas j5j8 are characterized by more subtle and profound perceptions. j5 is called infinite space, j6 is infinite consciousness, j7 is nothingness, and j8 is named neither perception nor non - perception. each jhana is reported to be deeper and more remote from external stimuli than the last, yielding the ranking shown on the y - axis in figure 1. j1j3 are the highest on joy or happiness, with j4j8 intermediate, yielding the ranking on the x - axis. previous studies have shown that long - term meditators have higher volume of grey matter compared to matched controls [12, 13 ], and randomized experiments show that subjects benefit from as little as 4 weeks of training in the areas of attention regulation [14, 15 ] and emotion regulation [11, 1618 ]. heretofore, all of the emotion studies have tested subjects ' ability to learn to downregulate negative emotions, particularly their response to stress. in contrast, the present study examines the ability to up - regulate positive emotion, which involves different neural pathways [19, 20 ]). perhaps the most thoroughly studied system related to positive emotion is the dopamine system, which gives rise to pleasure and mediates positive reinforcement [21, 22 ]. both animal and human studies show that when a delivered reward is greater than expected, dopaminergic neurons in the ventral tegmental area (vta) in the brain stem are activated. the vta in turn innervates the nucleus accumbens (nac) in the ventral striatum, which leads to higher centers in the orbital frontal cortex (ofc). human studies have shown that activity in the medial ofc at the time of a reward correlates with subjective reports of pleasure for olfactory, gustatory, and musical stimuli. studies have shown that this system is activated for a diverse array of stimuli, including food, sex, music, humor, monetary rewards, and maternal love. but it has never been shown that this dopamine system can be activated without external cues or rewards by volitional mental activity. the mechanism by which such a mental activity can self - stimulate positive emotions would be of great interest. one hypothesis is that the full dopamine pathway is stimulated beginning with the vta and progressing upward. an alternate hypothesis is that the subjective report of pleasure is caused only by expectancy effects (such as a belief that a high - priced wine must taste better ; see or) and that the lower parts of the dopamine system do not participate. yet a third alternative mechanism is that the subjective pleasure is due to subtle rhythmic body movements which are known to induce pleasurable altered states. the dopamine reward system has also been shown to be stimulated by most drugs of abuse and plays an important role in addiction. an important question is whether jhana meditators are subject to addiction and tolerance effects that can result from stimulation of the dopamine reward system. besides the dopamine system, unfortunately, it shares a pathway very close to that of the dopamine system in the nac. discrimination between the two systems would require microinjection studies and is beyond the spatial discrimination of typical fmri studies. hence, the current paper limits itself to detecting activation in the region shared by these two reward pathways. experientially, all jhanas in figure 1 are reported to share the following 5 characteristics that may have specific brain correlates : (1) external awareness dims and startle responses diminish, (2) internal verbalizations fade completely or become wispy, (3) one 's sense of body boundaries and orientation in space are altered, (4) attention is highly focused on the object of meditation, and (5) happiness increases to very high levels and can be maintained for long periods of time. jhana is distinguished from some other ascs because it does not include visual or auditory hallucinations (as in some organic disorders and drug experiences) nor does it include cross - sense synesthesia (such as seeing the bell ring or feeling a bird sing). the correspondences expected from known functions of brain regions can be articulated in the form of the following a priori hypotheses. h1 : jhanas should show decreased activation compared to the rest state in the visual (ba 1719) and auditory (ba 41 - 42) processing areas. since all jhanas share the experiential characteristic that external awareness dims, then the brain regions associated with vision and hearing should become less active. h2 : jhanas should show decreased activation compared to the rest state in broca 's area (ba 44,45) and in wernicke 's area (ba 39,40). because internal verbalization fades in jhana, the brain regions associated with speech should become idle or less active. h3 : jhanas should show decreased activation compared to the rest state in the orientation area (ba5). since the normal sense of personal boundaries is altered, the orientation area of the brain should show changes from normal rest. h4 : jhanas should show increased activation compared to the rest state in the anterior cingulate cortex (acc) (ba 32,33). because attention is highly focused on the object of meditation in the jhanas, we would expect high activity in the acc, which regulates and monitors attention. h5 : jhanas should show increased activation compared to the rest state in the dopamine reward system of the brain (nac in the ventral striatum and medial ofc). a broad range of external rewards stimulate this system (food, sex, beautiful music, and monetary awards), so extreme joy in jhana may be triggered by the same system (the vta is also part of this system, but is too small to image with standard fmri methods, but see for successful imaging methods). h6 : jhanas should show no increased activation compared to the rest state in the areas responsible for rhythmic movement, including motor cortex (ba4), primary somatosensory cortex (ba 1,2,3), and cerebellum. increased activity in these areas would support an alternative hypothesis that the reward system is being stimulated not by internal means but by subtle rhythmic movements that are known to induce ecstatic states. the activation of brain regions during these six subjective jhana experiences can now be examined via fmri and eeg. the subject is a long - term buddhist practitioner (53-year - old male, left - handed). at the time of recording, he had 17 years of training consisting of about 6,000 hours of practice and was trained in the sri lankan tradition of jhanas by khema (the length of training was estimated based on his daily practice and the time spent on meditative retreats, counting one day of retreat as 8 hours of sitting meditation). at the time of testing, this subject was to our knowledge the only person in the us who had the requisite training in jhana who was willing to submit to the experimental protocol. the subject signed informed consent, and a neurological exam was performed, confirming the absence of neurological disease. the subject meditated in his standard sequence, starting with access concentration (ac), progressing through j1, j2, j8, then returning through j7, j6, and so forth, back down to j1. for each jhana state, the subject signaled with a double finger tap using an mr - compatible force transducer when he was beginning the transition to the next higher - number jhana state, then clicked the mouse once when he had reached the state. he clicked three times to indicate he was transitioning downward to the next lower - number jhana state. the protocol did not use a random assignment of states because each jhana builds on the previous one, and the time required to transition from one state to another was variable. this sequence had been very well practiced, making state identification easy for our subject. the duration of each jhana state averaged about 120 sec, with about 30 sec transition between states. we acquired gradient echo t2 -weighted echo - planar images (epis) with blood - oxygen - level - dependent (bold) contrasts on a ge 1.5-tesla scanner (repetition time tr of 2.5 s and te of 50 ms). a total of 421 volumes were collected, with 20 axial slices per volume and slice thickness of 7 mm, going from vertex to inferior cerebellum with no skip between slices. two t1-weighted structural images were also acquired, the first a high - resolution volumetric series and the second a lower resolution scan in - plane with the functional data. three periods of rest were interspersed with 2 periods of tapping the force transducer for control purposes, then subject entered ac followed by j2, j3, j4, and j5. the fmri recording the first four volumes were discarded due to tissue nonsaturation, and each remaining volume was motion corrected to the 5th volume. all images were normalized to a standard mni template and smoothed using an isometric gaussian kernel with a full width at half maximum of 8 mm. high - pass filtering was increased to 4096 seconds because the experimental design consisted of a very low frequency of 625 s (from rest to j5). the time signature of the epochs was modeled as a series of boxcar functions convolved with a canonical hemodynamic response function (hrf). the general linear model estimated the percent signal change of each event (jhana versus rest versus ac) as a function of the convolved time signature. the two contrasts of interest in testing the planned hypotheses were jhana - rest and jhana - ac. in addition, j2 was contrasted with each of the other states in order to investigate specific differences between jhana levels of meditation. for each a priori roi specified in the hypotheses, an anatomical mask was prepared from the wfu pickatlas software and the mean percent signal change was calculated for each contrast using marsbar. the masks used in this study were brodmann 's area (ba) 17 or 19, ba 41 or 42, ba 44 or 45, ba 39 or 40, ba 5 or 7, ba 32 or 33, ba 1 or 2 or 3, and ba 4 (where or refers to the logical addition of two masks), cerebellum, and med ofc. finally, the nac was approximated with spherical masks of radius 5 mm centered at (10, 9, 4) using the location identified by kirk. and knutson.. the eeg system used a 256-channel geodesic sensor net (system v.2.0 from electrical geodesics, or), sampled at 500 hz and referenced to the vertex (cz). sections of the recording that showed eye movements or muscular artifacts were manually excluded from the study. the data was bandpassed with a digital high - pass filter at.4 hz and a hardware low - pass filter at 200 hz. a 60 hz notch filter was employed to remove 60 hz line artifacts. six epochs of 4 seconds each were extracted from each of the 21 states (2 resting states and 19 jhana states). for each electrode and for each 4 s epoch, the power spectral distribution was computed by using welch 's method, which averages power values across sliding and overlapping 500 ms time windows. spectral bands were defined to be consistent with previous research : theta band was from 4 to 6 hz, alpha1 band from 6 to 8 hz, alpha2 band from 8 to 10 hz, alpha3 from 10 to 12.5 hz, beta from 12.5 to 25 hz, and gamma from 25 to 42 hz. the last is consistent with lutz. who analyzed only the gamma range. the first 3 bands are congruent with aftanas. who analyzed only those bands. however, we did not perform the analysis of alpha dominant frequency to establish frequency band boundaries individually for our subject, as aftanas et. all power estimates are reported as a ratio of the power in a selected band to total power from 4 to 42 hz. electrode positions were matched with underlying anatomical rois using the probabilistic maps developed by okamoto. who correlated the anatomical mri 's of 17 healthy adults with the overlying electrodes placed in the standard 1020 position. table 1 reports a formal assessment of the 6 a priori hypotheses. the first row of table 1 tests h1, where the first column shows the subjective experience during jhana (that external awareness dims), the second column shows the roi associated with that experience (the primary and associative visual cortex ba 17,19), and the third column shows predicted change in activity during jhana compared to rest (activity will be less during jhana). column 4 shows that the actual contrast is.81, a difference that is significant (t = 4.3, p <.001) and in the predicted direction. the last column of table 1 uses an alternative comparison standard, calculating the bold signal contrast for jhana relative to access concentration (jhana - ac). that column confirms that the contrast is also negative, supporting the reports in figure 1. the next row shows that the contrast in primary auditory and association cortex (ba 41, 42) was also negative and significant, again supporting h1. similarly, h2 (that internal verbalization fades) is strongly supported by significant negative contrasts in broca 's area (ba 44, 45) and in wernicke 's area (ba 39, 40). h3 (an altered sense of personal boundaries) is strongly supported with large and significant negative signal contrasts in the orientation area (ba 5, 7). h4 (that attention is highly focused) is more weakly confirmed, with both bold signal contrasts in the acc positive compared to rest, though column 5 shows that the contrast jhana - ac failed to reach significance. h5 is strongly confirmed, with both the nac and med ofc recording significantly higher bold signal during jhana than during both rest and ac meditation. the last rows of table 1 show the test of an alternative hypothesis (h6) that the ecstatic joy in jhanas may be caused by subtle rhythmic movements, resulting in higher bold signal during jhana in the primary somatosensory cortex, the primary motor cortex, and the cerebellum. in addition to testing the six a priori hypotheses, standard spm5 statistical tests using post hoc analysis were computed for all brain tissue. figure 2 displays all cortical surfaces with post hoc t values greater than + 3 (in red and yellow) or 3 (in blue and green) in the contrast (jhana - rest). it shows very extensive but patchy areas of activation, with 63 clusters significantly positive, and 27 clusters were significantly negative, suggesting an overall pattern of diffuse activation during jhana. perhaps the most evident results in figure 2 are that transition to jhana is associated with selective decreases in bold signal in the parietal and posterior frontal lobes (confirmed by a priori tests above) and with selective increases in the right temporal region. given that the data support the six hypotheses, we then disaggregated the results to explore whether the different jhana meditation states produced different brain activation patterns. figure 3(a) plots the bold signal of each state contrasted with j2, with a separate line for each of the rois from h1 to h3. for example, the line labeled orientation plots the bold signal (relative to j2) on the y - axis as a function of meditation state on the x - axis, progressing from rest to ac to j2 and on through j5. it shows a steep decline from rest and ac to j2, and another steep decline to j3, then reaches a global maximum at j4, followed by a return to the low levels of j3. interestingly, the remaining four lines in figure 3(a) are highly correlated with the orientation line, showing similar patterns of decline, steep increases at j4, and return to low values at j5. the correlation suggests an association between the rois, the most likely being that reduced activation of vision and audition will deafferent the orientation area from its normal inputs, causing an altered sense of orientation. figure 3(a) also gives a more nuanced view of individual jhanas than the pooled results in table 1. while the average jhana shows lower activation than rest and ac (as predicted by h1h3), the individual jhanas show great variability, with lower activation in j2, j3, and j5, (as predicted by traditional reports in figure 1), but j4 shows activation equal to or higher than rest. we caution that this figure plots single meditation states of an individual, so that a single distractor event could greatly alter the activation pattern during a meditation. in this case, a distractor event may have occurred during j4, causing increased activity in visual, auditory, and orientation area (however, the subject did not report any distractions during debriefing). a final deviation from predictions is that no decline in activation occurs after j2, whereas figure 1 would predict that activity will decline with each successive jhana in areas associated with sensing external stimuli. figure 3(b) plots the bold contrast (relative to j2) of the remaining rois as a function of meditation state on the x - axis, progressing from rest through j5. nac, shows a very steep increase in activation from rest and ac to j2, consistent with figure 1. but activity in the nac declines during j3 to near that of rest and ac and declines even further in j5, consistent with a dopamine depletion hypothesis in later jhanas. the line for med ofc shows moderate decline during j3 and reaches its maximum at j4. this pattern contrasts with the predictions of figure 1 where j4 is reported as less joyful than j2 and j3. finally, the line labeled acc shows increased monitoring from rest to j2, declining to lower monitoring at j3 and j5, but spiking at j4. since figure 3(b) shows that j2 was the only jhana to activate the complete dopamine pathway, tests of the alternative hypothesis were conducted on j2 alone. consistent with the pooled results in table 1, the alternative hypothesis (h6) that subtle rhythmic movements triggered joy in j2 was rejected, with significantly lower activity in areas associated with movement during j2 compared to rest in ba 1,2,3 (t = 4.7, p <.001), ba 4 (t = 4.5, p <.001), and in the cerebellum (t = 1.75 n.s.). all signs were in the opposite direction from that predicted by the alternative hypothesis. figure 4 shows more detailed dynamics of the state transitions, with the time course of the bold signal averaged over all voxels in three a priori specified rois during the 417 fmri scans. figure 4(a) shows average bold signal for the orientation area ba 5 and 7, with the blue line representing the right side and the red line representing the left. the black spikes extending from the x - axis represent events where the meditator signaled a transition to a higher state with a mouse click. note the steep drop during the transitions from ac to j2 and j2 to j3. these drops are not caused by the clicking action because they do not appear during transition from rest to ac. the drops occurred promptly after the subject signaled that he was starting to transition, beginning within 2 scans (5 sec) and reaching minimum within 8 scans (20 sec) during the ac to j2 transition, with similarly prompt transitions from j2 to j3. figure 4(b) shows the bold signal in the right and left acc regions, with similar steep and prompt drops during the transitions from ac to j2, j2 to j3, and j4 to j5. finally, figure 4(c) shows the bold signal in the right and left medial ofc, with even steeper drops during the transitions from ac to j2, j2 to j3, j3 to j4, and j4 to j5. though no missing data was found, all of the data for j1 are outliers, with putative gamma power at least 10 times the gamma power of other jhanas and rest. it is likely that much of the gamma was due to muscle tension because of head movements. hence j1 is excluded from analysis because it was more than 4 standard deviations away from any other state. statistical tests for the planned comparisons that test h1h6 are presented in table 2. similar to table 1, column 1 shows the subjective experience, column 2 shows the rois and the scalp electrode locations (from) associated with that experience, and column 3 shows the predicted direction of contrasts between jhana and rest. column 4 shows the actual gamma power (2542 hz) measured at that scalp location. in the case of the first row, the gamma power at o1 (overlying the primary and associative visual cortex ba17, 19) showed no significant difference between jhana and rest. examining all rows of column 4 shows that gamma power increased significantly only in the electrode locations overlying the acc and the med ofc, consistent with h4 and h5. however, in locations overlying regions expected to decrease activation (h1, h2, h3, and h6), all showed nonsignificant contrasts in the gamma range (with the exception of c4, which was in the predicted direction). we also examined contrasts in the alpha1 range (not shown), which laufs. twelve of the 14 contrasts testing h1, h2, h3, and h6 showed significant increases in the alpha1 range, consistent with the hypotheses. we integrated the power information from many bands in column 5, which calculates the difference in power between the high frequencies (gamma + beta) minus the power in the lower frequencies (alpha1 + theta) for jhana compared to rest. consistent with column 4, the largest increases in activation during jhana are observed near the med ofc (h5), accompanied by smaller but very significant increases in acc (h4). significant declines in activity during jhana are observed near ba 17,19, ba 41,42, ba 44,45, ba 5,7, and ba 1,2,3, consistent with those hypotheses (h1, h2, h3, and h6). the fmri and eeg recordings provide mutually consistent evidence on the neural correlates of ecstatic meditations called jhanas. in the cortical regions associated with external awareness, verbalization, and orientation (h1, h2, and h3), in addition, table 2 shows that the eeg signal shifted to the lower - power bands of theta and alpha1, although it is acknowledged that spatial localization of cortical function with scalp eeg has some limitations. in the region associated with executive control (h4) and the region associated with subjective happiness (h5), the fmri in table 1 showed higher bold signal during jhana contrasted with rest, while the eeg in table 2 showed a shift to higher power in the beta and gamma bands. in addition, the subcortical imaging from the fmri was able to distinguish whether the subjective happiness (h5) was associated with activation of the dopamine / opioid reward system or due to purely cortical expectation effects. table 1 (in the row h5) shows very strong activation of the nac in the ventral striatum indicating that the full pathway was activated in at least one of the jhanas. examining individual jhanas revealed several deviations from the predictions derived from subjective reports in figure 1. first, activity in orientation and visual areas does decline below rest and ac but does not decline further after j3, contrary to reports that each succeeding jhana goes deeper. second, activity in the nac peaks during j2 and then drops quickly, contrary to reports that j3 is equally joyful. we conclude that full activation of the dopamine reward system occurred only in j2, while j3 activated only the med ofc portion of the reward system. previous imaging of the dopamine / opioid reward system has always used external stimuli to activate it (e.g., actual food or drink was consumed or photos of loved ones cued a short period of attachment). in contrast, jhana meditators claim that they can voluntarily generate increased happiness purely by volitional mental processes and for extended periods. first, we examined rois associated with somatosensory and motor coordination, which would be active if the subject was making subtle rhythmic movements known to trigger ecstatic ascs. these areas were not found to show increases but instead showed significant decreases in activity during j2, consistent with the claim that the reward system is triggered without physical cues or imagined movements. another alternative hypothesis is that the subject was using indirect mental processes to stimulate the reward system such as evoking a visual or auditory memory of a happy time, which in turn would trigger the reward system. however, our evidence in tables 1 and 2 (row h1) showed that the cortical rois associated with vision and hearing declined significantly in activity during jhana (and figure 3(a) confirms this specifically for j2), contrary to this alternate hypothesis. finally, evidence on lateralized brain activation such as those related to h2 and wernicke 's area must be interpreted with some caution, as the subject examined in the current study was left handed. left handedness can be associated with structural and functional changes in brain symmetry, as compared to the majority of human subjects, who are strongly right handed [46, 47 ], and this fact might have influenced some results in figures 3 and 4. our data would reject four possible cortical mechanisms (expectations, rhythmic movement, visual memories, and auditory memories) by which the subject might have self - stimulated his own reward system during j2. first, it is known that reciprocal connections exist between the nac and the medial ofc, so that it might be possible to activate a feedback loop between the two. under normal conditions, the feedback loop would be quickly interrupted by shifting attention to everchanging input from visual, auditory, or somatic senses, but these cortical areas have been downregulated, and attention may be tightly focused on reinforcing the feedback loop. the loop might be realized by creating a series of very short tasks that can each be completed successfully, allowing a new goal to be achieved and reward attained with each new moment. the classic meditation instructions for breathing would constitute such a task, wherein the student is instructed : when that in - breath finishes, you know that moment. you then see the next moment as a pause between breaths, and then many more moments of pause until the out - breath begins we are aware only of the beautiful breath, without effort and for a very long time. (p.16). other possible mechanisms of action could comprise subcortical activations that might have reward characteristics. for example, shifting control of breathing from the voluntary motor cortex to the involuntary medullary rhythmicity area in the brain stem might be perceived as relaxing, as well as giving rise to a common altered experience of feeling like i am being breathed, not in control. also, rhythmic movements might be maintained below the level of cortical control, since spinal reflexes are now known to mediate rhythmic movements as complex as coordinating leg movements related to walking. our results also shed light on the magnitude of the activation of the dopamine reward system. subjective reports from the subject indicated extremely high magnitude of reward, comparing j1 (which was not recorded due to head movement) to continuous multiple orgasms, j2 to opening a birthday gift and getting exactly what you most wished for, and j3 to postcoital bliss. yet the apparent mismatch between extreme subjective reports and moderate objective activation can be explained by the signal - to - noise ratio of the circuits. when most other cortical activity is reduced, as in this subject, a much smaller reward signal can be detected and will be perceived as more intense than when cortical noise from other sources is high, as in normal awareness. indeed, during normal awareness it takes drug - induced hyperstimulation of the dopamine pathways to generate such extreme subjective reports. if this signal - to - noise view is correct, then jhana 's reduced sense awareness is not incidental to achieving extreme pleasure but is a contributing condition. despite the moderate level of activation, caution is advisable with any voluntary stimulation of the reward systems. drugs of abuse can generate short - term bliss but can quickly increase tolerance, requiring ever greater doses of the drug to create the same level of pleasure. in contrast to the drugs, jhana meditators report negative tolerance because they can achieve the same state more quickly with less effort over time, and no withdrawal symptoms have been reported when meditation is stopped. nevertheless, figure 3 shows that nac activity dropped below normal resting consciousness in j5, which may be a sign of short - term tolerance and neurotransmitter depletion. our experiment is to our knowledge the first that compares brain states in five different meditations (ac and j2j5), finding strong differences between ac meditation and jhana, and smaller but still significant differences between jhana states. these in turn differ from the tibetan buddhist compassion meditation reported by lutz. where eeg gamma frequencies were dominant and from the alpha dominance of transcendental meditation. taken together, the multiplicity of brain states suggests that there may be a vast array of ascs available through meditation, depending on which brain regions are given awareness and which are inhibited from awareness. if there are a large number of possible ascs, it is likely that only some would have survival value. for example, the state of mystical union with all beings might be helpful in encouraging cooperation with all people in the tribe, so that evolution may have selected certain of these ascs to be more easily learned and retained. however, the same reasoning would suggest that the ability to self - stimulate the brain 's reward system would be dysfunctional in the struggle for survival and procreation because it could short - circuit the system that motivates survival actions. organisms that are adept at self - stimulation would quickly die out if they fail to respond to environmental demands or to pass on their genes. this reasoning suggests caution in making autonomous self - stimulation more available, but we point out that the modern environment already allows unprecedented stimulation of the dopamine reward system with plentiful food and drugs of abuse. a meditation that stimulates the reward system without the harmful effects of obesity and environmental damage could be beneficial in the modern environment. on the other hand, a meditation that short - circuits the desire to get an education and work for long - term goals could become dysfunctional. rather than simply stimulating the reward system in response to traditional goals of food and sex, it would be beneficial to regulate the system and focus it on long - term goals that are more adaptive. first, it demonstrates that jhana is not so fragile that it can be destroyed by the presence of curious experimenters or by intrusive sounds of mri scanners. second, the transition time to move from one jhana to another in a practiced subject is much shorter (between 5 and 20 seconds) than we expected, in line with other meditations that do not produce such extreme ascs. with short transition times, it might be feasible to use better randomized designs that alternate control states with meditations (however, the short transition times here may be due to the subject 's internal knowledge of readiness to transition, and he may not be able to transit on demand). third, the experiment could be shortened if interest is focused only on the reward system because only j2 shows strong self - activation of the nac. condition used here could be replaced with better controls that have been demonstrated to increase happiness, such as remembering a happy event in your life or visualizing a loved one. more potential subjects will become available as more english - speaking students are being trained in jhana meditation [9, 50 ]. how these meditators achieve periods of extreme joy without common negative side effects could contribute to the scientific pursuit of happiness and could pave the way for novel paradigms for rehabilitation and recovery from nervous system injury.	we report the first neural recording during ecstatic meditations called jhanas and test whether a brain reward system plays a role in the joy reported. jhanas are altered states of consciousness (asc) that imply major brain changes based on subjective reports : (1) external awareness dims, (2) internal verbalizations fade, (3) the sense of personal boundaries is altered, (4) attention is highly focused on the object of meditation, and (5) joy increases to high levels. the fmri and eeg results from an experienced meditator show changes in brain activity in 11 regions shown to be associated with the subjective reports, and these changes occur promptly after jhana is entered. in particular, the extreme joy is associated not only with activation of cortical processes but also with activation of the nucleus accumbens (nac) in the dopamine / opioid reward system. we test three mechanisms by which the subject might stimulate his own reward system by external means and reject all three. taken together, these results demonstrate an apparently novel method of self - stimulating a brain reward system using only internal mental processes in a highly trained subject.
bronchodilator drugs significantly decrease airway resistance in patients with obstructive lung disease, as well as in patients with acute lung injury [2,3,4 ]. in patients with obstructive lung disease (chronic obstructive pulmonary disease [copd ] or asthma), these drugs are part of the standard therapy and play an important role in patient management [5,6 ]. by reducing the resistance to airflow, dynamic hyperinflation, this leads to improved synchrony between the patient and ventilator, less risk of barotrauma and cardiovascular compromise, and enhancement of respiratory muscle performance [5,6 ]. in mechanically ventilated patients bronchodilators may be administered either by the systemic route (ie intravenously) or directly to the target site in the endobronchial tree by inhalation [2,3,6 ]. similar to the situation with ambulatory patients, the inhaled route is preferable during mechanical ventilation because the drug efficacy is comparable or even greater than that of the intravenous drug, but the side effects are minimized because of the smaller dose and minimal systemic absorption [2,3,6 ]. inhaled bronchodilators in mechanically ventilated patients may be delivered either by a nebulizer or by a mdi [2 ]. however, the delivery of bronchodilators with mdi in mechanically ventilated patients has received considerable interest in recent years[2,3 ]. this is because the use of mdi has several advantages over the nebulizer, such as reduced cost, ease of administration, less personnel time, reliability of dosing and a lower risk of contamination. particularly, in the present era of limited financial resources, the cost of therapy is an important issue. indeed, it has been estimated that substitution of nebulizers with mdis in a 700-bed hospital could potentially reduce the cost of aerosol therapy by us$300 000 a year. moreover, the use of nebulizers under certain circumstances may lead to patient / ventilator dyssynchrony. ineffective efforts have been identified in patients ventilated on assisted modes of support whenever the flow rate of continuous inline nebulizer exceeded the patient 's inspiratory flow rate. this may lead to serious episodes of hypoventilation, which may not be detected by the alarm function because the bias flow introduced into the system by the continuous flow is falsely interpreted by the ventilator as representing minute ventilation. finally, nebulizers may damage the expiratory transducer of some ventilators, rendering the expiratory volume measurement unreliable. although bronchodilator delivery with mdi in mechanically ventilated patients has several advantages over nebulizers, the use of mdis in this group of patients has not gained widespread acceptance among intensive care unit physicians. indeed, bronchodilator delivery with mdi is considered to be relatively ineffective due to drug deposition in the ventilator circuit and endotracheal tube [13 ]. this consideration, however, is not supported by recent scientific data. provided that a proper technique of administration is used, bronchodilator therapy with mdi is clearly effective [2,3 ]. in this brief review we present data regarding the efficacy of mdi in mechanically ventilated patients, and provide guidelines for proper use of this mode of bronchodilator therapy. several factors may affect respiratory tract deposition of bronchodilator drugs delivered by a mdi during mechanical ventilation. in vitro studies [14,15,16,17,18,19,20,21,22 ] have shown that aerosol deposition is influenced by the ventilator mode and settings, heat and humidification of inspiratory gas, density of inhaled gas, size of endotracheal tube, and method of connecting the mdi in the ventilator circuit. bypassing the humidifier, using a large - bore endotracheal tube and inhalation of less dense gas are associated with increased aerosol deposition. in particular, heat and humidification have a great impact on aerosol deposition ; studies have shown that bypassing the humidifier may increase aerosol deposition to target sites by approximately 50% (fig. endotracheal tubes with less than 6-mm internal diameter decreases significantly the efficacy of aerosol delivery, which an important issue when bronchodilator drugs are administered in children. synchronization of aerosol delivery with the beginning of inspiration, large tidal volume, low inspiratory flow and long duty cycle (ti / ttot) are also associated with greater aerosol deposition [14,19 ]. furthermore, active as opposed to passive mechanical ventilation increases considerably the delivery of bronchodilator drugs [14,23 ]. finally, connecting the mdi in the ventilator circuit using a spacer device significantly increases the drug deposition to target sites. indeed studies demonstrated that the combination of mdi and spacer device resulted in a fourfold to sixfold greater delivery of bronchodilators compared with mdi actuation into a connector placed directly at the endotracheal tube or into an in - line device without a chamber. the aerosol delivery to target sites may approach 30 - 35% of the nominal dose when a spacer device is used (fig. this is much higher than the corresponding values obtained with nebulizers (for review[2 ]). nevertheless, the results of in vitro studies should be interpreted with caution because bronchodilatation depends not only on drug dose, but also on several other factors that are mainly related to the patient. in vivo drug deposition to the lower respiratory tract may be estimated by radionuclide methods and by measuring serum or urine levels of the active drug or its metabolites. it is of interest to note that duarte [25 ] observed that administration of albuterol with mdi combined with a spacer device produces peak serum levels in mechanically ventilated patients that are comparable to those in healthy control individuals, whereas the area under the concentration time curve was lower in ventilated patients than in control individuals (fig. it follows that bronchodilator delivery with mdi and a spacer in mechanically ventilated patients results in satisfactory drug deposition in the lower respiratory tract, although its duration of action might be somewhat decreased. drug deposition, expressed as a percentage of nominal dose of albuterol from a chlorofluorocarbon formulation (cfc) propelled mdi, in the spacer chamber, the ventilator circuit, the endotracheal tube and on filters at the bronchi under dry (upper panel) and humidified (lower panel) conditions during controlled mechanical ventilation. under dry conditions 30.4% of the aerosol was deposited at the target sites (bronchi), versus 16.2% in a humidified circuit. rh, relative humidity ; s, spacer chamber ; vc, ventilator circuit ; et, endotracheal tube ; b, filters at the bronchi. from fink. venous serum albuterol, corrected for the number of puffs of albuterol administered, in mechanically ventilated patients (filled square) and nonintubated control individuals (filled circle). serum levels were similar in both groups except at baseline and 15 min after drug administration. note that the groups had similar patterns of systemic absorption, with the peak level occurring at 10 min and a rapid decline in serum levels thereafter. the main outcome variable of bronchodilator therapy is the resistance to airflow [2,3 ]. measuring the airflow resistance in mechanically ventilated patients is not always an easy task [5,6 ]. in patients with active respiratory efforts in particular, bedside estimation of resistance as well as of respiratory mechanics is rather complicated and imposes unique problems. we briefly review the methods used to assess bronchodilator response in patients ventilated on controlled (ie passive mechanical ventilation) and assisted modes of ventilatory support. in these patients the bronchodilator response is usually estimated by measuring inspiratory resistance using the method of rapid airway occlusion at constant flow inflation [26,27 ]. briefly, the airways are occluded at end - inspiration, and there is an immediate drop in airway pressure from a peak to a lower value (p1), followed by a gradual decay to a plateau pressure (pp). airway resistance (rint or rmin) is obtained by dividing the difference between peak airway pressure and p1 by the preceding constant inspiratory flow. by dividing the difference between peak airway pressure and pp by inspiratory flow, total resistance of the respiratory system (rmax) is obtained. the difference between rmax and rmin represents two phenomena : time - constant inequalities (pendelluft) and viscoelastic behaviour (stress relaxation) [26,27 ]. because reduction in the resistance to airflow decreases the dynamic hyperinflation, the bronchodilator response may also be assessed by measuring indices of dynamic hyperinflation, such as pp, end - expiratory alveolar pressure (intrinsic positive end - expiratory pressure [peepi ]) and the trapped gas volume above passive functional residual capacity (frc ; vtrap) at the end of expiration[5,6 ]. peepi is measured by occluding the airways at the end of a tidal expiration and observing the airway pressure [26,27 ]. vtrap is determined by measuring the total exhaled volume during a period of apnoea for a sufficiently long period to visually detect expiratory volume change to cease, thus allowing the patient to reach the passive frc. expiratory resistance may better characterize the bronchodilator response because it greatly influences dynamic hyperinflation [5,6 ]. however, expiratory resistance is difficult to measure in patients with obstructive lung disease, in whom expiratory flow limitation during tidal expiration commonly exists. in this case the driving pressure for flow is not the difference between alveolar and mouth pressure, but between alveolar pressure and total pressure head at the choke point, which is very difficult to measure in humans. nevertheless, the decrease in expiratory resistance after bronchodilator therapy can be indirectly estimated by measuring expiratory flow at a given elastic recoil pressure (ie pp) before and after bronchodilator delivery. this technique, however, is cumbersome, time consuming, and necessitates stepwise lung deflation at lung volumes between end - inspiration and passive frc. furthermore, the pause time may affect pp independently of volume, making the interpretation of pp - expiratory flow relationship rather complex. for these reasons, measurement of expiratory resistance is rarely used in order to assess the bronchodilator response. in patients ventilated on assisted modes of support, the bronchodilator response can not easily be assessed. with assist volume, static and dynamic airway pressure may reflect, to a variable extent, respiratory muscle activity, and thus calculation of resistance using the occlusion technique is misleading [5,6,33 ]. similarly vtrap can not be measured in patients with active respiratory efforts. in these patients reduction in the number of ineffective efforts and faster response of the ventilator to patient inspiratory efforts may indicate, among other causes, a decrease in dynamic hyperinflation due to a decrease in resistance [5,6 ]. in patients being ventilated on pressure support, the decrease in dynamic hyperinflation and inspiratory resistance may result in higher tidal volume [5,6 ]. measuring the work of breathing is another index that may by used to assess the bronchodilator response in patients on assisted modes of ventilation. this, however, implies insertion of an oesophageal catheter to measure oesophageal pressure [33 ]. this technique is also useful for measuring respiratory mechanics in patients with active respiratory efforts. by recording transpulmonary pressure (ptp ; airway pressure minus oesophageal pressure), flow and volume over a breath, the weighted average of inspiratory and expiratory pulmonary resistance can be estimated as the ratio of change in ptp over that of flow between two points in the breathing cycle in which lung volume is the same [33 ]. alternatively, inspiratory pulmonary resistance can be measured as the difference between ptp at mid - inspiration and the corresponding pressure on the ptp - volume axis (ie relaxation pressure) divided by the inspiratory flow at that point. the ptp - volume axis is obtained by connecting the points of zero flow on the ptp - volume curve [33,35 ]. in mechanically ventilated patients with active respiratory efforts, peepi can be measured as the amount of change in oesophageal pressure preceding the initiation of inspiratory flow [33 ]. otherwise, an additional catheter to record gastric pressure simultaneously is needed in order to correct for expiratory muscle activity [33 ]. however, detailed description of the methods used to measure respiratory mechanics in patients ventilated on assisted modes is beyond the scope of the present review. the techniques described above are not practical and are rarely used in every day practice. in the busy and crowded environment of intensive care unit, clinical examination and assessment of the patient - ventilator interaction remains the most widely used method to assess the bronchodilator response in mechanically ventilated patients with active respiratory efforts. in these patients the bronchodilator response is usually estimated by measuring inspiratory resistance using the method of rapid airway occlusion at constant flow inflation [26,27 ]. briefly, the airways are occluded at end - inspiration, and there is an immediate drop in airway pressure from a peak to a lower value (p1), followed by a gradual decay to a plateau pressure (pp). airway resistance (rint or rmin) is obtained by dividing the difference between peak airway pressure and p1 by the preceding constant inspiratory flow. by dividing the difference between peak airway pressure and pp by inspiratory flow, total resistance of the respiratory system (rmax) is obtained. the difference between rmax and rmin represents two phenomena : time - constant inequalities (pendelluft) and viscoelastic behaviour (stress relaxation) [26,27 ]. because reduction in the resistance to airflow decreases the dynamic hyperinflation, the bronchodilator response may also be assessed by measuring indices of dynamic hyperinflation, such as pp, end - expiratory alveolar pressure (intrinsic positive end - expiratory pressure [peepi ]) and the trapped gas volume above passive functional residual capacity (frc ; vtrap) at the end of expiration[5,6 ]. peepi is measured by occluding the airways at the end of a tidal expiration and observing the airway pressure [26,27 ]. vtrap is determined by measuring the total exhaled volume during a period of apnoea for a sufficiently long period to visually detect expiratory volume change to cease, thus allowing the patient to reach the passive frc. expiratory resistance may better characterize the bronchodilator response because it greatly influences dynamic hyperinflation [5,6 ]. however, expiratory resistance is difficult to measure in patients with obstructive lung disease, in whom expiratory flow limitation during tidal expiration commonly exists. in this case the driving pressure for flow is not the difference between alveolar and mouth pressure, but between alveolar pressure and total pressure head at the choke point, which is very difficult to measure in humans. nevertheless, the decrease in expiratory resistance after bronchodilator therapy can be indirectly estimated by measuring expiratory flow at a given elastic recoil pressure (ie pp) before and after bronchodilator delivery. this technique, however, is cumbersome, time consuming, and necessitates stepwise lung deflation at lung volumes between end - inspiration and passive frc. furthermore, the pause time may affect pp independently of volume, making the interpretation of pp - expiratory flow relationship rather complex. for these reasons, measurement of expiratory resistance is rarely used in order to assess the bronchodilator response. in patients ventilated on assisted modes of support, the bronchodilator response can not easily be assessed. with assist volume, static and dynamic airway pressure may reflect, to a variable extent, respiratory muscle activity, and thus calculation of resistance using the occlusion technique is misleading [5,6,33 ]. similarly vtrap can not be measured in patients with active respiratory efforts. in these patients reduction in the number of ineffective efforts and faster response of the ventilator to patient inspiratory efforts may indicate, among other causes, a decrease in dynamic hyperinflation due to a decrease in resistance [5,6 ]. in patients being ventilated on pressure support, the decrease in dynamic hyperinflation and inspiratory resistance may result in higher tidal volume [5,6 ]. measuring the work of breathing is another index that may by used to assess the bronchodilator response in patients on assisted modes of ventilation. this, however, implies insertion of an oesophageal catheter to measure oesophageal pressure [33 ]. this technique is also useful for measuring respiratory mechanics in patients with active respiratory efforts. by recording transpulmonary pressure (ptp ; airway pressure minus oesophageal pressure), flow and volume over a breath, the weighted average of inspiratory and expiratory pulmonary resistance can be estimated as the ratio of change in ptp over that of flow between two points in the breathing cycle in which lung volume is the same [33 ]. alternatively, inspiratory pulmonary resistance can be measured as the difference between ptp at mid - inspiration and the corresponding pressure on the ptp - volume axis (ie relaxation pressure) divided by the inspiratory flow at that point. the ptp - volume axis is obtained by connecting the points of zero flow on the ptp - volume curve [33,35 ]. in mechanically ventilated patients with active respiratory efforts, peepi can be measured as the amount of change in oesophageal pressure preceding the initiation of inspiratory flow [33 ]. otherwise, an additional catheter to record gastric pressure simultaneously is needed in order to correct for expiratory muscle activity [33 ]. however, detailed description of the methods used to measure respiratory mechanics in patients ventilated on assisted modes is beyond the scope of the present review. the techniques described above are not practical and are rarely used in every day practice. in the busy and crowded environment of intensive care unit, clinical examination and assessment of the patient - ventilator interaction remains the most widely used method to assess the bronchodilator response in mechanically ventilated patients with active respiratory efforts. traditionally, nebulizers have been used for bronchodilator therapy during mechanical ventilation, because bronchodilator delivery with a mdi is considered relatively ineffective. manthous [13 ] reported no benefit from administration of up to 100 puffs of albuterol (9 mg) with an mdi and elbow adapter in ventilator - supported patients. other studies, however, using a spacer device instead of elbow adapter [36,37,38,39,40,41 ], did not confirm these findings ; bronchodilator delivery using an mdi and a spacer device results in significantly decreased airflow resistance. thus, a spacer device is thought to be fundamental in improving the efficacy of bronchodilator therapy given by mdi. as a rule, in our unit 3) remains in the ventilator circuit, so that disconnection of the ventilator circuit at each bronchodilator treatment is avoided. in patients with copd, delivery of bronchodilators with an mdi and a spacer results in approximately 18 - 25% and 8 - 15% decreases in rmin and rmax, respectively [36,37,38,39,40,41 ]. these decreases are comparable to those observed when bronchodilators are delivered with a nebulizer, at a fraction of the drug dose. although expiratory resistance, the main determinant of dynamic hyperinflation, is usually not measured, indirect evidence suggests an appreciable decrease in expiratory resistance also. indeed, an approximately 20% reduction in peepi has been observed after bronchodilator therapy [39,40,41 ], indicating a decrease in dynamic hyperinflation as a result of a decline in expiratory resistance. the decrease in total resistance of respiratory system after bronchodilator delivery with an mdi and a spacer is mainly due to a decrease in rmin decrease (ie airway resistance), whereas the additional resistance due to time - constant inequalities and/or viscoelastic behaviour remains unchanged [37,38,39,40,41,42 ]. this indicates that the delivery of bronchodilators with mdi affects the smooth muscle tone of large airways. on the other hand, bronchodilators administered using nebulizers seem to elicit a parenchymal response. guerin, in a recent study in mechanically ventilated copd patients, administered a combination of fenoterol - ipratropium bromide either with a nebulizer or with a mdi, and found that total resistance of respiratory system, vtrap and peepi decreased similarly with the two modes of drug administration. with the nebulizer, the reduction in rmax was due to a decrease in the difference between rmax and rmin, whereas with the mdi the decrease was due to rmin. the authors attributed these results to the higher alveolar deposition of the total drug mass achieved with the nebulizer, although, as a percentage of the nominal dose, the deposition was greater with the mdi. the optimal dose of bronchodilators delivered with a mdi in mechanically ventilated patients is not clearly established. manthaus [13 ] found, in patients who had peak pressure - pp gradient of more than 15 cmh2o, that five puffs of albuterol (90 g / puff) decreased resistive pressure significantly. the addition of 10 more puffs reduced the resistive pressure further, but only slightly. dhand [38 ] showed, in mechanically ventilated patients with copd, that the decrease in airway resistance with four puffs of albuterol was comparable to that observed with cumulative doses of 28 puffs (fig. 4). in a recent study [41 ] we demonstrated in copd patients that two puffs of salbutamol resulted in significant bronchodilatation that was comparable to that observed with six puffs. it seems that, in stable mechanically ventilated patients, two to six puffs of short acting 2-agonist may achieve maximum or near maximum bronchodilatation with no side effects. however, patients with acute bronchospasm (ie status asthmaticus) may require higher doses. individual titration of the dose so as to achieve the best bronchodilatation with acceptable side effects may be an alternative strategy, rather than using a standard dose [6 ]. in our unit four to six puffs of short acting 2-agonist is delivered initially, and the dose is increased according to the response. the optimal doses of other bronchodilators, such as anticholinergic agents or long - acting 2-agonists, are not known. the duration of the bronchodilator response is an important issue, which surprisingly has not been adequately studied. in a recent study we observed, in patients with copd, that six puffs of salbutamol resulted in significant bronchodilatation lasting approximately 3 h (fig. 5). other studies, presented so far in abstract form, concluded that the duration of bronchodilatation in mechanically ventilated patients is decreased compared with that in ambulatory patients. these findings are in accordance with those of duarte [25 ], who showed that the relative systemic bioavailability of albuterol as measured by serum level was reduced in mechanically ventilated patients. it follows that the dose interval in mechanically ventilated patients might be shorter than that in ambulatory patients. as a rule, in our unit we administer inhaled short - acting bronchodilators every 3 - 4 h. the technique of administration of bronchodilators in mechanically ventilated patients using an mdi and a spacer is an important factor thaty determines the efficacy of this therapy. proper timing of drug delivery, relatively high tidal volumes, low inspiratory flows and application of end - inspiratory pause (breath - hold) are some of the factors that have been suggested to enhance drug delivery to target sites and, thus, bronchodilatation [2,3 ]. however, these suggestions are based, at least as far as the ventilator settings are concerned, on in vitro studies. recently, in a series of studies [39,40,41 ], we examined the effects of various ventilator settings on the bronchodilatation induced in mechanically ventilated copd patients by salbutamol administered using an mdi and a spacer. these studies demonstrated that neither application of 5 s end - inspiratory pause [39 ] nor increasing the tidal volume by 4 ml / kg [40 ] (strategies that probably enhanced drug delivery [14,19 ]) augmented the bronchodilator effect of six puffs of salbutamol. furthermore, we showed [41 ], at constant tidal volume and inspiratory time, that changing the inspiratory flow - time profile from constant (volume controlled) to decelerative flow (pressure controlled) did not have any effect on salbutamol - induced bronchodilation, given by mdi and a spacer [41 ]. this was true with both 600 and 200 g salbutamol (fig. it follows that, in patients with acute exacerbation of copd, significant bronchodilatation can be achieved both with pressure or volume control, and with doses of salbutamol as low as 200 g. the similar bronchodilatation observed with both high and low dose of the drug [41 ] suggests that the high drug dose used in the other studies [39,40 ] was not responsible for the failure of manipulation of ventilator settings to modify the salbutamol - induced bronchodilatation. the findings of the above studies do not support alterations in ventilator settings when bronchodilator drugs are administered in mechanically, passively ventilated patients. for minimizing the importance of manipulation in ventilator settings, the use of an mdi in mechanically ventilated patients is more appealing because it is easier to use. in our unit, the strategy for bronchodilator delivery with an mdi in mechanically ventilated patients is shown in table 1. schematic representation of the mdi adapted to the spacer device in the inspiratory limb of the ventilator circuit. notice that the mdi flume is directed away from the patient. from mouloudi [40 ]. airway resistance (rrsmin) in mechanically ventilated patients with copd after four, eight and 16 puffs of albuterol (total dose 28 puffs). the addition of eight and 16 puffs did not cause further bronchodilatation than that observed with four puffs. airway resistance (rint) as a function of time after administration of 600 g salbutamol with mdi and a spacer device in 10 mechanically ventilated patients with copd. relationship between the individual mean bronchodilatory response of airway resistance (rint, percentage decrease from baseline) when (a) 200 g (n = 8) and (b) 600 g (n = 10) salbutamol were given with volume control (rintvc) and pressure control (rintpc). the mean bronchodilatory response in each patient was obtained by averaging the rint response at 15, 30 and 60min after salbutamol. for clarity of presentation, the mean bronchodilatory response was used instead of data at various time intervals after drug administration. note also that the magnitude of bronchodilatation was not affected by the mode of ventilatory support. the continuous line is the regression line, and the dashed line represents the line of identity. from mouloudi strategy used in our unit for mdi bronchodilator therapy the spacer device remains in the circuit so that disconnection and manipulation of the ventilator circuit is minimized. the effect of the heat - moisture exchanger on the efficiency of bronchodilator therapy has not been studied ; if a humidifier is used it should not be bypassed, but the drug dose may need to be increased. if the tidal volume is less that 400 ml, an increased dose may be required ; this has not been studied. a shorter interval may be needed in some patients, particularly those with status asthmaticus. there is evidence in the literature that the delivery of bronchodilators with a mdi and a spacer device in mechanically ventilated patients is effective and results in bronchodilatation that is comparable to that achieved with a nebulizer. mdis have several advantages over nebulizers, making mdi bronchodilator therapy attractive for use in mechanically ventilated patients.	the delivery of bronchodilators with metered - dose inhaler (mdi) in mechanically ventilated patients has attracted considerable interest in recent years. this is because the use of the mdi has several advantages over the nebulizer, such as reduced cost, ease of administration, less personnel time, reliability of dosing and a lower risk of contamination. a spacer device is fundamental in order to demonstrate the efficacy of the bronchodilatory therapy delivered by mdi. provided that the technique of administration is appropriate, mdis are as effective as nebulizers, despite a significantly lower dose of bronchodilator given by the mdi.
coronary heart disease (chd) and stroke are leading causes of death in the usa and globally. elevated serum low - density lipoprotein (ldl) has been identified as a major risk factor for chd.1 epidemiological studies have shown a relationship between dietary cholesterol and chd risk, and early metabolic studies have shown a positive relationship between dietary cholesterol and plasma total and ldl cholesterol (ldl - c).25 these findings, in part, have led to guidelines from the american heart association recommending that healthy adults limit cholesterol intake to less than 300 mg per day. since a large egg contains about 185 mg cholesterol, the american heart association recommends restricting egg consumption unless cholesterol intakes from other sources are limited.6,7 however, there is a growing body of scientific literature showing a lack of relationship between egg intake and cardiovascular disease (cvd) risk,817 including two recent meta - analyses that showed no association or dose - response relationship between egg consumption and chd or stroke.18,19 further, recent dietary guidelines indicate healthy people can consume one egg a day as part of a healthy diet.20 the positive relationship between egg intake and cvd risk among persons with type ii diabetes mellitus (t2 dm) has been shown in several prospective studies.14,21,22 further, the direct relationship between egg intake and risk of diabetes has also been shown ; however, in several of these prospective studies, dietary factors, in particular saturated fat intake, were not accounted for.14,22 t2 dm is a metabolic disorder characterized by high blood glucose and develops in the presence of deficient insulin action, which can be attributed to either insufficient production or excretion of insulin, resistance to the actions of insulin, or both.23 clinical definitions for prediabetic and diabetic conditions have been established by the world health organization (who)24 and the american diabetes association,23 based on fasting plasma glucose (fpg) levels 2 hours following intake of oral glucose load (oral glucose tolerance). insulin resistance, hypertension, impaired glucose tolerance, elevated fpg, dyslipidemia, abdominal adiposity, obesity, inactivity, and genetic characteristics are among the complex web of risk factors that can indicate risk for future development of t2dm.23,2529 many of the risk factors for t2 dm are also cvd risk factors. metabolic syndrome (mets) can be used as a clinical tool to characterize individuals with some combination of cvd risk factors, including diabetes, obesity, dyslipidemia and hypertension. persons with mets are at a twofold risk for developing cvd and fivefold risk for t2dm.3032 diabetes is also frequently called an independent risk factor for cvd, ie, independently of ldl - c levels, diabetes increases the risk of cvd.33 hemoglobin a1c (hba1c), a well - established indicator of overall serum glucose control in diabetic patients, is the most potent predictor of chd risk.34 inflammation induced by diabetes and insulin resistance can accelerate atherosclerosis in patients with diabetes.35 normal insulin signaling is essential for normal cardiovascular function, and lack of it will result in cardiovascular dysfunction and cvd.36 kidney disease, a well - known complication of diabetes progression, is significantly associated with cardiovascular events, even after correction for classical risk factors, such as diabetes itself, hypertension, and dyslipidemia.37 the complex shared risk factors between cvd and t2 dm, in combination with diabetes being an independent risk factor for chd and stroke, pose real challenges in epidemiologic studies that attempt to examine the role of egg intake in cvd risk among diabetics. the published epidemiological evidence on 1) the relationship between egg consumption and cvd risks among individuals with t2 dm and 2) the direct relationship between egg consumption and risk of developing t2 dm were systematically reviewed in this study. published clinical trials and feeding studies that examined the relationship between egg intake and biomarkers of the shared risk factors for t2 dm and chd were also evaluated as a subanalysis in this review. two initial pubmed searches were conducted to identify epidemiological studies on egg consumption and cvd risk among diabetics (completed june 15, 2011). the first search was conducted using the search terms : egg or eggs and diabetes or diabetic or insulin or resistant or tolerance and cardiovascular or stroke or myocardial or coronary or heart or atherosclerosis or chd or cvd or cad [coronary artery disease ] without any limitations. six epidemiology studies on egg consumption and cvd risk among diabetics were found.14,16,21,22,38,39 a second search, with broader search terms, including egg or eggs and diabetes or diabetic, and with limitations to human studies and english publications, was conducted and was followed by a hand search. six studies on egg consumption as a risk factor for diabetes were found.4045 in the hand search, one study on dietary cholesterol and cvd risk among diabetics was found.46 three supplemental pubmed searches were conducted to identify studies that examined the relationship between egg consumption or dietary cholesterol and biomarkers of chd and t2 dm risk, followed with a hand search (completed june 15, 2011). these searches were limited to : humans, clinical trial, meta - analysis, randomized controlled trial, comparative study, english, medline, and all adult 19 years. egg or eggs or dietary cholesterol and intake or consumption or diet and diabetes or diabetic and triglycerides or hdl (high - density lipoprotein) or ldl or serum cholesterol or serum lipids were terms included in the first search, which resulted in four relevant studies.4750 egg or eggs or dietary cholesterol and intake or consumption or diet and diabetes or diabetic and cardiovascular or stroke or myocardial or coronary or atherosclerosis were terms used in the second search ; only one new study was found (lindeberg).51 the search terms used in the third search were egg or eggs and metabolic or syndrome or insulin or glucose or impaired or resistant and triglycerides or hdl or ldl or cholesterol or lipids or hdl - cholesterol (hdl - c) or ldl - c and resulted in six studies.5257 in a hand search, one study on the effect of egg consumption and chd risk among t2 dm subjects58 and four studies on the effect of egg and egg - containing diet and chd / t2 dm risk factors in healthy individuals were found.5962 two later searches were also performed on march 30, 2012 and november 14, 2013. these searches found a new case - control study on egg intake and t2 dm risk;63 a cross - sectional survey that examined modifiable risk factors, including egg consumption, for diabetes;64 two prospective cohort studies that followed protein intake from eggs and risk of t2dm,65 and egg consumption and risk of t2dm;66 and four studies reporting results from the same diet intervention study, in individuals with mets.6770 three meta - analyses were published in 2013 that evaluated the association between egg consumption and cvd, with subgroup analyses among diabetics.18,19,71 two of these meta - analyses also evaluated the association between egg consumption and the risk of diabetes.19,71 six prospective cohort studies examined the relationship between egg consumption and cvd risk among diabetics, of which four studies found statistically significant increases in cvd risk and egg consumption,14,21,38,40 one study found suggestive evidence but no statistically significant increase,22 while another study did not find a statistically significant increase but referred to the small number of diabetics in the study.16 these studies are summarized in table 1 and described below. hu conducted an analysis using data from a prospective study of 37,851 male health professionals and 80,082 female nurses, aged 4075 years (males) and 3055 years (females) at enrollment, with average follow - up periods of 8 years (males) and 14 years (females).21 egg consumption was measured using a food frequency questionnaire (ffq) at baseline and every 24 months, and consumption status was classified in five groups : 6 eggs per week relative to 1 egg / week) after adjusting for confounders (odds ratio [or ] = 0.7 [95% ci : 0.31.7 ]), among 15,956 subjects in a mediterranean cohort.66 however, the text of the full article is in spanish, and therefore, this study was excluded from further evaluation. two studies found significant associations between dietary scores representing dietary patterns that included egg consumption and t2dm,43,45 while ericson observed a significant association between overall protein intake and risk of t2dm.65 summaries of these studies are in table 2 and are briefly described here. djouss used data collected on 20,703 male physicians and 36,295 female health professionals from two completed randomized trials, the physicians health study and the women s health study, respectively, to assess the association between egg consumption and t2 dm risk.40 the mean ages at enrollment were 53.5 and 54.5 years, with average follow up of 20 and 11.7 years for men and women, respectively. egg consumption was measured using a ffq at baseline for both men and women and every 24 months for men, and subjects were classified into six intake groups : no egg, 6.0%. cox proportional hazard regression models were used to estimate the hrs of t2 dm with quintiles of daily egg intake (grams). higher quintiles of egg intake were associated with an increased risk of t2 dm (hr = 1.21 ; 95% ci : 1.041.41 ; p - trend=0.02) among the total population, in multivariate modeling. when the analysis was stratified by sex and controlled for all factors including body mass index (bmi), the association in women was not significant. the association in men was only significant among the highest quintile of egg consumers (hr = 1.32 ; 95% ci : 1.071.63), but the increasing trend was borderline significant (p - trend=0.05). the researchers also found a significant association between protein intake and t2 dm among the total population (hr = 1.27 ; 95% ci : 1.081.49), but the association only remained significant among women in the sex - stratified analysis (hr = 1.30 ; 95% ci : 1.031.64 ; p - trend=0.07). radzeviien conducted a case - control study to examine the role of eggs and t2 dm risk among lithuanian subjects.63 the study was carried out at an outpatient clinic and included 234 cases, aged 3586 years, with a newly confirmed diagnosis of t2 dm according to who criteria. a total of 468 controls (sex- and 5 years age - matched) were also recruited from the same clinic. conditional logistic regression was used to evaluate the or for t2 dm in relation to egg consumption. the multivariate analysis showed that the risk of t2 dm increased among subjects who consumed 5 eggs / week compared with subjects eating 6 eggs per week relative to 6 eggs per week relative to 1 egg / week) after adjusting for confounders (odds ratio [or ] = 0.7 [95% ci : 0.31.7 ]), among 15,956 subjects in a mediterranean cohort.66 however, the text of the full article is in spanish, and therefore, this study was excluded from further evaluation. two studies found significant associations between dietary scores representing dietary patterns that included egg consumption and t2dm,43,45 while ericson observed a significant association between overall protein intake and risk of t2dm.65 summaries of these studies are in table 2 and are briefly described here. djouss used data collected on 20,703 male physicians and 36,295 female health professionals from two completed randomized trials, the physicians health study and the women s health study, respectively, to assess the association between egg consumption and t2 dm risk.40 the mean ages at enrollment were 53.5 and 54.5 years, with average follow up of 20 and 11.7 years for men and women, respectively. egg consumption was measured using a ffq at baseline for both men and women and every 24 months for men, and subjects were classified into six intake groups : no egg, 6.0%. cox proportional hazard regression models were used to estimate the hrs of t2 dm with quintiles of daily egg intake (grams). higher quintiles of egg intake were associated with an increased risk of t2 dm (hr = 1.21 ; 95% ci : 1.041.41 ; p - trend=0.02) among the total population, in multivariate modeling. when the analysis was stratified by sex and controlled for all factors including body mass index (bmi), the association in women was not significant. the association in men was only significant among the highest quintile of egg consumers (hr = 1.32 ; 95% ci : 1.071.63), but the increasing trend was borderline significant (p - trend=0.05). the researchers also found a significant association between protein intake and t2 dm among the total population (hr = 1.27 ; 95% ci : 1.081.49), but the association only remained significant among women in the sex - stratified analysis (hr = 1.30 ; 95% ci : 1.031.64 ; p - trend=0.07). radzeviien conducted a case - control study to examine the role of eggs and t2 dm risk among lithuanian subjects.63 the study was carried out at an outpatient clinic and included 234 cases, aged 3586 years, with a newly confirmed diagnosis of t2 dm according to who criteria. a total of 468 controls (sex- and 5 years age - matched) were also recruited from the same clinic. conditional logistic regression was used to evaluate the or for t2 dm in relation to egg consumption. the multivariate analysis showed that the risk of t2 dm increased among subjects who consumed 5 eggs / week compared with subjects eating < 1 egg / week (or = 3.02 ; 95% ci : 1.147.98). qiu reported on two studies assessing the association between risk of gestational diabetes mellitus (gdm) and maternal egg consumption.44 the first study, the omega study, was a prospective study of 3,158 women obtaining prenatal care. the mean age at enrollment was 32.7 years, and egg consumption in the 3 months preconception and during the first pregnancy trimester was measured via ffq. subjects were classified in six groups : 0, 1, 23, 46, 79, and 10 eggs per week. the analysis was repeated using two egg consumption categories : < 7 and 7 eggs per week. the study outcome was gdm, defined based on fpg levels and oral glucose tolerance test. generalized linear models using a log - link function were used to estimate the rr for the association of gdm with maternal egg consumption. the models were adjusted for total energy, age, race / ethnicity, prepregnancy bmi, physical activity, intake of meat, fiber, vitamin c, and saturated fat. other factors (smoking, family history of diabetes, daily fruit, vegetable, and cholesterol intake) were investigated and found not to affect the association between maternal egg intake and gdm and were not included in the final model. the rr for the association of gdm with a maternal egg consumption of 10 eggs per week (reference group : nonconsumers) was 2.52 (95% ci : 1.115.72 ; p - trend=0.008). in the analysis using a dichotomized classification of egg consumption, the rr for the association of gdm with 7 eggs per week was 1.77 (95% ci : 1.192.63). the second study reported by qiu, the alpha study, was a case - control study designed primarily to examine the epidemiology of preeclampsia, but the study also recruited women with gdm.44 a total of 185 gdm cases were included. the mean age for the cases was 32.9 years, and for the controls, the mean age was 31.5 years. egg consumption was measured via ffq (including portion sizes), assessing dietary intake in the three months preconception and during pregnancy. subjects were classified in six groups : 0, 1, 23, 46, 79, and 10 eggs per week. multivariate logistic regression models were used to estimate the or for gdm and egg consumption. the models were adjusted for the following confounders : total energy, age, race / ethnicity, prepregnancy bmi, physical activity, smoking, family history of diabetes, intake of meat, fiber, vitamin c, and saturated fat. the analysis was repeated using two egg - consumption categories : < 7 and 7 eggs per week. the or for gdm associated with 10 eggs per week (reference group : nonconsumers) was 2.76 (95% ci : 1.037.43 ; p - trend=0.005). in the analysis using a dichotomized classification of egg consumption, the or for gdm shi conducted a cross - sectional study of 1,308 men and 1,541 women, aged 20 years, from a nationally representative sample in jiangsu, people s republic of china.42 egg consumption was measured via a ffq, with estimated portion sizes, and subjects were classified in three intake groups : 2 eggs / week, 26 eggs / week, and 1 eggs / day. logistic regression models were used to compute the or for the association of t2 dm with egg consumption, with adjustment for the following confounders : age, energy intake, education, smoking, sedentary activity, family history of diabetes, and bmi. a statistically significant increased risk of t2 dm with consumption of egg, for women and for the total population, was found ; the increase in men was not statistically significant. the or associated with intake of 1 eggs / day was 2.01 (95% ci : 0.735.55 ; p - trend=0.335) for men and was 2.90 (95% ci : 1.087.84 ; p - trend=0.033) for women. in a cross - sectional study of 99,574 women and 56,742 men aged 2049 years, from india s third national family health survey (nfhs-3) (20052006), agrawal and ebrahim examined the distribution of self - reported diabetes and its association with modifiable risk factors.64 egg consumption was categorized as daily, weekly, occasionally, or never, based on the response to the question how often do you yourself consume eggs?.64 for purposes of analysis, the occasional / never egg consumers were grouped together and used as the reference group. in a crude analysis, there was an increased odds of diabetes among the weekly and daily egg consumers, but this association was no longer significant after the adjustment for age ; socioeconomic status ; bmi ; activity level ; smoking ; and dietary factors, including milk, fruit / vegetables, pulses / beans, fish, meat / chicken, and alcohol consumption (or for daily vs occasionally / never egg consumption was 1.06 [95% ci : 0.901.26 ] and 1.11 [95% ci : 0.931.31 ] for women and men, respectively). liese investigated the association between plasminogen activator inhibitor-1 (pai-1), fibrinogen, and t2 dm (based on 2-hour glucose levels) and dietary patterns, in a prospective study of 880 subjects, aged 4069 years, with normal or impaired glucose tolerance.43 the average follow up was 5.2 years. dietary patterns were derived using reduced - rank regression, and logistic regression was used to model t2 dm versus diet scores. the models included the following confounders : age, sex, race, clinic, parental history of diabetes, glucose tolerance status at baseline, energy expenditure, smoking, energy intake, insulin sensitivity, acute insulin response, and bmi. the analysis identified a food pattern predictive of t2 dm that was characterized by a high intake of red meat, low - fiber bread and cereal, dried beans, fried potatoes, tomato, vegetables, eggs, cheese, and cottage cheese, and a low intake of wine. the or for the association of t2 dm with the fourth quartile of the food pattern score (reference group : first quartile) was 4.51 (95% ci : 1.6012.69 ; p - trend=0.0173). imamura investigated the association between t2 dm (based on antidiabetes drug use or a fpg 126 mg / dl) and dietary patterns in a prospective study of 2,879 subjects (mean age 54.2 years) from the framingham offspring study.45 the study follow - up period was 7 years. dietary patterns were derived using reduced - rank regression, and multivariate cox proportional hazard regression models were used to estimate the hr for t2 dm associated with quartiles of the dietary pattern scores. the models included the following confounders : age, sex, parental history of diabetes, treatment for elevated blood pressure (bp), caloric intake, and weight change. scores associated with dietary patterns from three studies (the nurses health study, the european prospective investigation into cancer, and the whitehall ii study) were used in this study. high intakes of soft drinks, meat and processed meat, and refined grains were common components of all scores. eggs, french - fried potatoes, and alcohol were predictive in some but not others. the strongest association found was based on the food pattern score identified by the nurses health study, for which the hr for t2 dm for continuous increase of the dietary pattern score was 1.44 (95% ci : 1.251.66), and the hr for the association of t2 dm with the fourth quartile of the food pattern score (reference group : first quartile) was 4.14 (95% ci : 2.456.99). the djouss study strengths included its large cohort and long follow up ; however, the study had several limitations, including a study population that may not be representative of the general us population and the lack of control for potential dietary confounders (ie, intake of fat, saturated fat, cholesterol, whole grains, carbohydrates, fruit and vegetables, and, in the men s data analyses, family history of diabetes).40 the study population was relatively older and had low reported egg consumption.41 the shi and agrawal and ebrahim studies included a relatively large sample ; however, both studies were cross sectional and did not adjust for several variables found to be associated with egg consumption, including : protein, fat, and carbohydrate intake or other dietary factors known to be associated with diabetes, eg, saturated fat intake.42,64 shi also did not adjust for active commuting, residence, or income.42 further, the agrawal and ebrahim study was based on self - report of diabetes, with no physician s confirmation of diagnosis.64 the radzeviien study was a small case - control study with several limitations, including the lack of accounting for other dietary factors and reliance on self - reported intake obtained from a questionnaire of unknown quality.63 the qiu studies evaluated the risk of gdm, rather than t2 dm. these studies had relatively large sample sizes but did not adjust for dietary cholesterol (from sources other than eggs) or several other dietary variables that were significantly associated with egg consumption (eg, whole grain, pufa, mufa, and n-3 fatty acid intake in the omega study ; or parity, history of hypertension, family history of hypertension, and intakes of cholesterol from sources other than eggs, pufa, mufa, trans fat, n-3 fatty acids, and fruit intake, in the alpha study).44 the study by ericson analyzed data from a large study with long follow up and benefited from highly validated dietary methods and the ability to exclude individuals with reported dietary changes in the past. the multivariate models used in the study were adjusted for potential dietary confounders, including fiber - rich bread and cereals, fruit and vegetables, and fat intake but did not include an adjustment for dietary cholesterol intake from sources other than meat and eggs. however, the authors noted that the marginal significance observed between egg consumption and t2 dm may have been due to limitations in the statistical power, especially in the sex - stratified analyses.65 the leise and imamura studies used a multifactorial approach for defining risk factors ; however, the hrs were derived for diet pattern scores, not necessarily for specific foods, and thus could not be used to express the excess risk of t2 dm associated with increased egg consumption.43,45 in addition, the imamura study used dietary patterns extracted from other studies and found inconsistencies in the composition of these patterns across studies, in particular with respect to the contribution of eggs to the pattern scores.45 overall, the following inconsistencies between these studies present significant challenges for conducting a meta - analysis and limit the interpretation of results : differences in study design : some were case - control studies, while others were prospective cohort studies outcome differences : the outcome in the two qui studies was gdm, while the other studies focused on t2 dm differences in how t2 dm was measured : some studies relied on self - reports, others relied on self - reports and follow - up questionnaires, while still others required actual confirmation based on fpg difference in the exposure variable : eight of the studies modeled the association between t2 dm and eggs directly and two of the studies (imamura and liese) investigated the association of dietary scores representing dietary patterns (which included eggs) and t2 dm difference in the age of the study populations difference with respect to the other diabetes risk factors they controlled for difference in follow - up time. despite these limitations, li and shin quantified the risk of t2 dm associated with egg consumption as part of the meta - analyses of prospective cohort studies described previously. both sets of analyses showed a significant increased risk of t2 dm when comparing the highest (1 egg / day) to the lowest (< 1 egg / week or never) category of egg consumption. pooled incident risk estimates ranged from 1.42 (95% ci : 1.091.86) based on five cohorts19 to 1.68 (95% ci : 1.412.00) based on seven cohorts.71 again, the underlying data and methodology in the individual cohorts included in these meta - analyses need to be considered as well as the limited number of available studies upon which these conclusions are based. the published literature on the role of dietary cholesterol from both egg and non - egg sources and biomarkers of chd risk, such as lipoproteins, among healthy individuals is extensive and has previously been reviewed. the overall evidence from human studies has documented the lack of effect of dietary cholesterol on lipoprotein levels among healthy individuals.72,73 on the other hand while there is a possibility that diabetics transport cholesterol differently than healthy individuals, providing a possible explanation for the apparent observed association between egg consumption and chd risk among diabetics,21 the biological mechanism underlying this relationship remains elusive. in the current review, we conducted a focused literature search to identify experimental studies that examined whether egg consumption is associated with alterations in the biomarkers of cvd risk among diabetics or subjects with chd / t2 dm risk factors, such as mets and/or insulin resistance. a limited number of studies were found including six studies that were conducted on diabetics (table 3). of these six studies, eggs were the primary sources of dietary cholesterol in three of the studies.4749 in the trial conducted by arora, no statistical significant change in serum total cholesterol, hdl, ldl, or triglycerides (tag) was found within and across the study groups of healthy controls and type i and ii diabetic subjects, after a single dose of 800 mg egg cholesterol.47 the romano trial found a significant increase in ldl and ratio of ldl / hdl in type i diabetics when fed with 800 mg egg cholesterol over a period of 3 weeks.48 on the contrary, the pearce trial found statistically significant decreases in weight, total cholesterol, tag, non - hdl - c, apolipoprotein b, hba1c, fpg, insulin, and bp among t2 dm patients after 12 weeks of hypoenergetic high - protein diets with either low or high cholesterol (from egg supplementation).49 eggs were also part of a diet (the paleolithic diet) in two studies conducted on t2 dm subjects.50,51 in the lindeberg trial, t2 dm subjects on a paleolithic diet had better improvement in fpg than did those on a mediterranean diet.51 similarly, t2 dm subjects in the jnsson trial who were on a paleolithic had lower hba1c, tag, diastolic bp, weight, bmi, waist circumference (wc), and higher hdl - c than did those on the diabetes diet.50 in the trial by taggart, extremely high doses of cholesterol (1 g / day and not from egg sources) were given to t2 dm subjects.58 following the challenge, there was a tenfold increase in very low - density lipoprotein (vldl) and apolipoprotein b48 in diabetic subjects compared with a threefold increase in healthy controls. there were six experimental trials that were conducted on nondiabetic individuals who had risk factors for chd / t2 dm (table 4). of these six studies, the study by knopp was conducted on hypercholesterolemic or combined hyperlipidemic subjects who were fed either 2 eggs a day or egg substitutes for 12 weeks.52 this study found that in the egg - fed group, ldl - c significantly increased among hyperlipidemic subjects ; however, hdl - c was also significantly increased among both the hypercholesterolemic and combined hyperlipidemic subjects. in another study by knopp conducted on insulin sensitive, insulin resistant (ir), obese ir and lean ir subjects, it was found that feeding 4 eggs a day for 1 month led to statistically significant increases in ldl - c in insulin sensitive and ir subjects and statistically significant increases in hdl - c in insulin sensitive, ir, and obese ir subjects.53 the trial by tannock found increases relative to baseline in c - reactive protein (crp), serum amyloid a (saa), and non - hdl - c among lean ir subjects after 1 month of feeding of 4 eggs a day.54 one study (mutungi) was conducted on male subjects, some with mets at baseline, and found no differences in serum lipids among the subjects who were fed either 3 whole eggs a day or egg substitute for 12 weeks.55 another study by amini, albeit cross - sectional in nature, was conducted on 425 individuals with impaired glucose tolerance in which egg intake was evaluated as part of a western dietary pattern.57 this study found the western dietary pattern to be associated with greater odds of having an increase in tag and bp. four articles reported on a randomized, single - blind, placebo - controlled, parallel - designed 12-week dietary intervention study, in 37 adults aged 3070 years with mets on a carbohydrate - restricted diet (, 30% energy) fed either 3 whole eggs / day (the egg group, n=20) compared with a yolk - free egg substitute (the sub group, n=17).6770 andersen found a reduction in the hdl - tag content and an increase in the macrophage cholesterol efflux in the egg group compared with the sub group, among subjects with normal baseline hdl - c.67 results of this intervention trial further reported increases in hdl - c and large hdl particles and a reduction in vldl and medium vldl particles in the egg compared with the sub group (p<0.05),68 along with reductions in markers of inflammation (saa and plasma tumor necrosis factor [tnf]-).69 blesso also reported overall reductions in anthropometric measurements, including wc, weight, and percent body fat in both groups (p<0.01).69 in an analysis of the effect of egg consumption on plasma carotenoids, there was a significant increase in plasma and lipoprotein (hdl and ldl), lutein, and zeaxanthin in the egg group.70 while not the focus of this review, five studies were uncovered in the literature search that evaluated the relationship between egg consumption alone or as part of a dietary pattern and chd / t2 dm risk factors (ie, mets, lipoproteins, or other markers) in healthy subjects.56,5962 it is anticipated that if this search is expanded to include dietary cholesterol from all sources (not just eggs) or the benefits of low - glycemic index foods (of which eggs are one) on markers of cardiovascular health, this list of studies would be much more extensive. all of the experimental studies conducted to examine the relationship between egg consumption and biomarkers of t2dm / chd risk factors had small sample sizes, had vastly different study design and quality, and produced somewhat conflicting results, making it difficult to reach a coherent synthesis of the effect of egg consumption on various markers of t2dm / chd risk factors among type ii diabetics and individuals with risk factors for t2 dm. nevertheless, several of these studies showed that improvements in markers of risk for t2 dm or mets, including decreased serum glucose, hba1c, fasting serum insulin, body weight, wc, and trunk fat,49,55,56 can result from egg consumption when combined with targeted changes in the overall diets of t2 dm patients, individuals who are overweight, and others with elevated cvd risk. in a randomized trial of men with t2 dm, pearce compared the effects of a 12-week calorie - restricted diet that included 2 eggs per day with the same diet including 100 g of lean animal protein substituted for the eggs.49 both diets resulted in improvements in several markers of cvd risk, including weight loss, decreased tag and total cholesterol levels, and improved apolipoprotein b levels, insulin sensitivity, and glycemic control. however, only the egg - fed group displayed significantly increased levels of hdl - c, a biomarker associated with decreased cardiovascular disease risk. in a similar study, mutungi assessed the impact of feeding 3 eggs per day for 12 weeks in male subjects, some with mets at baseline.55 egg or egg substitute was fed as part of a carbohydrate - restricted diet with no limitations on total energy intake. both the egg - fed group and the cholesterol - free egg substitute group had similar statistically significant decreases in body weight, trunk fat, wc, and systolic bp ; however, the egg - fed group had an approximately twofold greater decrease in diastolic bp than did the egg substitute group. in both groups, no statistically significant changes occurred in total cholesterol, cholesterol ratios, or in ldl - c levels, and plasma tag was significantly decreased (p<0.001). in agreement with the observations of pearce,49 the subjects in the mutungi trial who were fed egg displayed increased hdl - c, while those fed egg substitute did not.55 at baseline, 18 subjects in the mutungi trial were classified as having mets, and by the end of the 12-week study, only three subjects were classified as mets, and all three of these subjects were in the egg substitute fed group.55 in a similar study design, ratliff observed decreased serum glucose and insulin and decreased ir in healthy subjects participating in both the egg and egg substitute groups of a carbohydrate - restricted dietary intervention.56 participants reported greater satiety and had decreased caloric intake and body weight following the trial, despite the ad libitum nature of the diet, indicating the utility of these types of diets for at least short - term (12 week) weight loss for at - risk patients. the three articles that reported on a comparison of egg and egg substitute groups consuming a moderate carbohydrate - restricted diet for 12 weeks, in adults with mets, showed that daily egg consumption resulted in favorable shifts in hdl lipid profiles beyond the observed increase in plasma hdl - c67, along with improved insulin resistance,68 increased plasma carotenoids,70 decreased markers of inflammation, and improved anthropometric measurements.69 together these studies suggest that egg consumption in combination with broader dietary changes could provide additional health benefits to at - risk individuals, beyond the benefits provided by the broad dietary change alone. from the body of epidemiological studies, the finding of elevated cvd risk and egg consumption among diabetics was observed across studies, with the exception of the studies by djouss and gaziano22 and scrafford.16 the available prospective cohort studies that evaluated the relationship between egg consumption and cvd among diabetics had significant differences in study design and limitations and are not ideally suitable for a meta - analysis. in general, there is no consistency in the findings across epidemiological studies with respect to incident t2 dm and egg consumption, and dietary confounders were not accounted for in all of the prospective studies. ffqs were used to assess exposure in all of the prospective studies with the exception of ericson,65 who used a 7-day diary combined with an ffq. however, there were discrepancies in the ffq questions, for eg, some studies asked subjects how many times they ate eggs per week, rather than how many eggs they ate, and it is unclear whether eggs included as part of mixed dishes were included in the assessment. while there have been three meta - analyses based on these prospective studies, with reported findings of statistically significant increased cvd risks with egg consumption among diabetics and increased risk of t2 dm associated with egg consumption among the general population, these findings are limited by the noted differences, and interpretation of these findings should be treated with caution. a small number of experimental studies investigated the relationship between egg consumption and biomarkers for chd risk among diabetics ; however, study limitations and varying study designs limit our ability to interpret these results more broadly. similarly, the somewhat conflicting results from the small number of experimental studies examining egg consumption and biomarkers of chd risk among individuals with t2 dm risk factors (measured by biomarkers) and the small number of subjects involved in these studies prevent broad interpretation and conclusions. results from several small studies suggest that eggs that are part of a broader dietary intervention may reduce the risk of t2 dm and mets, thereby reducing the risk of cvd. however, given the noted study limitations, broad interpretation of these results should be avoided, and the findings of these studies should be investigated further.	backgroundthis study reviewed epidemiological and experimental evidence on the relationship between egg consumption and cardiovascular disease (cvd) risks among type ii diabetes mellitus (t2 dm) individuals, and t2 dm risk in nondiabetic subjects.resultsfour of the six studies that examined cvd and mortality and egg consumption among diabetics found a statistically significant association. of the eight studies evaluating incident t2 dm and egg consumption, four prospective studies found a statistically significant association. lack of adjustment for dietary confounders was a common study limitation. a small number of experimental studies examined the relationship between egg intake and cvd risk biomarkers among diabetics or individuals with t2 dm risk factors. studies among healthy subjects found suggestive evidence that dietary interventions that include eggs may reduce the risk of t2 dm and metabolic syndrome.conclusiondifferences in study design, t2 dm status, exposure measurement, subject age, control for confounders and follow - up time present significant challenges for conducting a meta - analysis. conflicting results, coupled with small sample sizes, prevent broad interpretation. given the study limitations, these findings need to be further investigated.
extramammary paget 's disease (empd) is a rare cutaneous, intraepithelial adenocarcinoma involving primarily the epidermis but occasionally extending into the underlying dermis which accounts for < 1% of carcinomas in vulva and majority of the patients are postmenopausal females. it presents with a long - standing history of pruritic, erythematous, scaly, or velvety patches. the most frequent site is the vulva, but perineal, scrotal, perianal, and penile skin are also common areas. the cancer cells in the neoplasm usually stay in situ and only rarely invade into the dermis to be metastatic through the lymphatic system. a 55-year - old postmenopausal female presented with history of itchy and gradually progressive reddish lesion on genitals for 3 years. cutaneous examination revealed a well - defined, moist erythematous plaque of size 15 cm 10 cm with multiple erosions involving bilateral labia majora and clitoris [figure 1 ]. on full body examination, no other lesion or lymphadenopathy was observed. on investigations, a well - defined erythematous plaque the clinical diagnosis of empd was confirmed by a 3 mm punch biopsy which showed cells within the basal layer of epidermis having nuclear enlargement with atypia, prominent nucleoli, and well - defined ample cytoplasm. in addition, a focus of squamous cell compression and moderate inflammatory cell infiltrate was seen in the upper dermis [figure 2 ]. our patient was advised to undergo excisional surgery, but she refused and was lost to follow - up. in 1874, sir james paget first described mammary paget 's disease and in 1901, dubreiuhl reported the first case of vulvar empd. vulvar paget 's is a rare disease and typically presents as a red, velvety, pruritic skin rash of the vulva region which closely mimics a multitude of other, more common conditions. as a result paget 's disease can be found in both men and women ; however, it is most commonly seen in postmenopausal caucasian females. typically, involved sites are the vulvar, perianal, scrotal and penile regions ; rare sites include the thighs, buttocks, axilla, eyelids and external ear canal. the lesions can be white to red, scaling or macerated, can appear infiltrated, eroded or look like an ulcerated plaque. due to disease 's relatively low incidence and since many cases are unreported, its true incidence remains unknown. the clinical differential diagnosis for empd includes psoriasis, contact dermatitis, fungal infections, lichen sclerosus, intraepithelial neoplasia and melanoma. the nonspecific clinical findings often lead to misdiagnosis and an average of 1 year can pass before a biopsy is taken and definitive diagnosis is made. it is characterized microscopically by the presence of specific tumor cells called paget 's cells. paget cells are large cells with pale clear cytoplasm, large round hyperchromatic nuclei which tend to form clusters or solid nests. paget 's cells have intracellular mucopolysaccharides, with empd having a greater amount of mucin as compared to mpd. as a result, cells frequently show positive staining for periodic acid - schiff and diastase resistance, mucicarmine, alcian blue at ph 2.5, and colloidal iron. surgery remains the treatment of choice for empd with recurrence rate of up to 44% with wide local excision. other modalities include mohs micrographic surgical excision, radiotherapy, topical agents including 5-fluorouracil, bleomycin, imiquimod and photodynamic therapy. this case is being reported for its rarity and to stress on the fact that an early biopsy should be advised to avoid misdiagnosing empd.	extramammary paget 's disease is a rare cutaneous, intraepithelial adenocarcinoma involving primarily the epidermis but occasionally extending into the underlying dermis. the condition typically presents as a red, velvety, pruritic skin rash of the vulva region which closely mimics a multitude of other, more common conditions. as a result, vulvar paget 's disease is frequently misdiagnosed, leading to an often lengthy lag time (an average of about 23 years) between the onset of symptoms and diagnosis.

Subsets and Splits