article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
understanding how and to what extent inter - individual genetic variation determines gene function in normal and pathological conditions can provide important insights into disease etiology. to this end, the rapid accumulation of large transcriptomic datasets across different tissues has prompted several population - based studies of gene expression variation. in many of these studies, typical transcriptional analyses are carried out within or between whole tissue(s), with the aim of pinpointing gene expression signatures and/or (tissue - specific) genetic regulation of gene expression. even at this level, context - dependent genetic regulation of gene expression has been shown to be important, and the underlying regulatory variants have more complex effects than previously anticipated. for instance, characterizing different cis - regulatory mechanisms between tissues (such as opposite allelic effects) is important to understand the tissue - specific function exerted by disease - associated genetic variants. the genetic variants that are associated with gene expression variation are commonly called expression quantitative trait loci (eqtls). these can be mapped to the genome by modeling quantitative variation in gene expression and genetic variation (for example, single nucleotide polymorphisms (snps)) that have been assessed in the same population, family or segregating population. essentially, mrna levels can be treated as a quantitative phenotype and as such can be mapped to discrete genomic regions (genetic loci) that harbor dna sequence variation affecting gene expression. in many cases, eqtl studies have provided direct insights into the complex regulatory mechanisms of gene expression - for instance, by allowing researchers to differentiate cis (or local) from trans (or distant) control of gene expression in a given tissue, experimental condition or developmental stage. furthermore, eqtl analyses can be integrated with clinical genome - wide association studies (gwas) to identify disease - associated variants. despite this recent, exciting progress in ' genetical genomics ' (that is, eqtl studies), the growing number of single - cell transcriptomic analyses now prompts re - evaluation of our understanding of how heritable variations affect gene function in the cell. establishing a robust link between snps and gene expression variation is a non - trivial exercise when multiple cell types are jointly modeled. to aid this process, nonetheless, emerging concepts such as single - cell transcriptomics have started changing our understanding of the genetic regulation of gene expression in individual cells, which can be hidden in ensemble - averaged experiments. in a recent study published in nature biotechnology, holmes and colleagues carried out single - cell quantification of gene expression for 92 genes in approximately 1,500 individual cells to disentangle the effect of gene variants on cell - to - cell variability, temporal dynamics or cell - cycle dependence in gene expression. the authors looked at selected genes in fresh, naive b lymphocytes from three individuals and clearly showed how gene expression had much greater variability between cells within an individual than between individuals. this observation set the scene for a comprehensive investigation of the distributions of single - cell gene expression and the properties of gene expression noise in a larger population of cells. these analyses were focused on 92 genes affected by wnt signaling (that can be chemically perturbed by a wnt pathway agonist), of which 46 genes were also listed in the catalog of genome - wide association studies, and resulted in four important outcomes. first, perturbing the system with a wnt pathway agonist exposed significant changes not only in whole - tissue gene expression but also in gene expression noise. given the intrinsic stochastic nature of gene expression, it was expected that the number of mrna copy numbers would vary from cell to cell, as previously shown in isogenic bacterial cell populations. the single - cell transcriptomic analyses reported by holmes and colleagues highlight the large effect of fluctuations of mrna copy numbers in hapmap lymphoblastoid cell lines, which has been mostly neglected and might influence eqtl detection in this system to a large extent. second, single - cell transcriptomic analysis allowed holmes and colleagues to quantify both the noise from the regulation of transcription and the noise of rna turnover, which therefore can be modeled independently. in keeping with previous observations, genes differed from each other primarily in terms of burst size (that is, the amount of rna produced when the gene is switched on), resulting in an increased expression variance between cells that was greater than the expression mean. the expression ' fano factor ' (the gene expression variance divided by the mean) quantifies this phenomenon, and it represents another commonly neglected component that might be important in eqtl studies. third, when gene expression distributions were described in terms of heterogeneous cell subpopulations with respect to different stages of the cell cycle, holmes and colleagues showed that the majority of genes analyzed had altered expression between g1 and early s phases. these apparent differences in cell cycle subpopulation proportions between samples represent another determinant of gene expression variation, which is expected to contribute significantly to gene regulation. finally, single - cell transcriptomics enabled the reliable quantification of the gene expression noise in the system. the latter can be considered as another source of variability, which can then be used to infer an expression network for each sample. traditional gene co - expression networks assess gene - gene associations by correlating gene expression profiles across multiple samples. by contrast, in the nature biotechnology article, expression networks were built by correlating gene expression across multiple cells, which were profiled in the same lymphoblastoid cell line. for instance, one expression network built with approximately 200 cells from one of the lymphoblastoid cell lines revealed changes in cell - to - cell gene correlations in response to chemical perturbation of the wnt signaling, which were not detectable at the level of whole - tissue expression. this approach allowed the authors to assess the extent to which the network connectivity of each gene varies in the system in response to other perturbations (for example, chemical, genetic), unmasking an additional factor that is potentially relevant for eqtl analysis. after demonstrating (and quantifying) the important effect on gene function of a number of factors that reflect single - cell differences, holmes and colleagues tested how each of these factors (alone or in combination) contributed to the detection of cis - eqtls (that is, regulatory snps within 50 kb of the gene). this is an important question because integrated eqtl and clinical gwas analyses are commonly employed to identify genes and pathways underlying disease, and eventually generate new hypotheses concerning diagnostic and prognostic biomarkers or potential therapeutic targets. first, the eqtl associations detected at -log10p = 3 for whole - tissue gene expression (at both baseline and after chemical perturbation of the wnt signaling) represented only a small fraction of the total number of eqtls in the system (figure 1). overall, many more eqtl signals were detected for the other single - cell expression phenotypes tested. this highlights the extent to which different masked sources of variation (detailed above) can significantly affect the detection of cis - eqtls in the system. furthermore, it turns out that the complex spatiotemporal expression variability quantified by single - cell analysis (' single - cell expression ') is more heritable than, or at least comparable to, gene expression levels averaged over many cells (' whole - tissue expression '), such that the authors of the study named this new class of associated genetic variants ' single - cell quantitative trait loci ' (scqtls). distribution of single - cell quantitative trait loci detected at basal and perturbed states in hapmap lymphoblastoid cell lines derived from 15 unrelated individuals reported in. the relative number of single - cell quantitative trait loci reported in supplementary table 1 from is represented as a doughnut chart. several different phenotypes derived from single - cell transcriptomic analysis were modeled as described in, and tested for association with single nucleotide polymorphisms within 50 kb of the gene. beyond signals coming from cells with undetected expression (grey), a substantial number of single - cell quantitative trait loci associated with single - cell transcriptional variation due to cell cycle, gene burst, gene - gene correlation, network connectivity and expression noise were detected. the highlighted sector (black) denotes the relatively small contribution of whole - tissue expression quantitative trait loci, which were obtained using gene expression levels averaged over many cells. notably, gwas eqtl genes in particular demonstrated greater cell - cycle (g1 and early s phase) inter - individual variability compared with other genes and greater inter - individual variability of their network connectivities. the implications of these results are two - fold : first, these studies urge caution in the interpretation of eqtl data published to date where only whole - tissue expression was considered ; and second, they prompt a deeper evaluation (and accurate modeling) of these ' masked ' sources of variation resulting from single - cell differences. it will be intriguing to extend these analyses to the study of more distant genetic control of gene expression at the single - cell level (that is, single - cell trans - eqtls) and to investigate the functional relevance of scqtls on whole - body phenotypes in human and animal models. with the growing accessibility of single - cell technologies for transcriptomic studies, the time is right for a deep re - thinking of the key factors determining the observed complexity of gene expression and its regulation. eqtls : expression quantitative trait loci ; gwas : genome - wide association study ; scqtls : single - cell quantitative trait loci ; snp : single nucleotide polymorphism. ep is supported by the medical research council uk and thanks aida moreno - moral for proof - reading. | the recently developed ability to quantify mrna abundance and noise in single cells has allowed the effect of heritable variations on gene function to be re - evaluated. a recent study has shown that major sources of variation are masked when gene expression is averaged over many cells. heritable variations that determine single - cell expression phenotypes may exert a regulatory function in specific cellular processes underlying disease. masked effects on gene expression should therefore be modeled, not ignored. |
copd is a leading cause of death worldwide and contributes to social and economic burden.1 however, there are still many undiagnosed patients with copd worldwide. one of the main reasons for this is that there are few respiratory symptoms in early copd patients.2 sometimes, patients consider their copd symptoms as part of the normal aging process but not as pathological changes. moreover, a pulmonary function test (pft) is not routinely performed in populations at high risk of copd.3 the so - called early copd is expected to eventually develop into symptomatic copd.4 however, few studies have investigated the natural course of patients with early copd,5 primarily because undiagnosed early copd patients usually do not visit the hospital. moreover, long - term follow - up and observation of the natural course of early copd are almost impossible. although these early copd patients have mild symptoms and relatively good lung function, it is important to identify and manage these patients. the decline in forced expiratory volume in 1 second (fev1) was higher in global initiative for chronic obstructive lung disease (gold) stage i and ii patients compared with stage iii and iv patients.6 even patients with early copd have pathological changes,7 physiological changes,8 more systemic inflammation,9 and more comorbidities.10 the korean national health and nutrition examination survey (knhanes) is performed annually in korea. the korean academy of tuberculosis and respiratory diseases and the korea centers for disease control and prevention (kcdc) began conducting national health and nutrition surveys, including an assessment of copd prevalence, in 2007. spirometry was performed as part of the survey, and many patients with mild, early copd were identified by the knhanes. according to the report of knhanes 2008 by yoo,11 most cases of copd diagnosed by the knhanes were mild and asymptomatic. in all, 94% of patients had gold stage i or ii. only 2.4% of patients were reported having been diagnosed with copd by a physician before knhanes, and 2.1% were reported having been treated for copd. thus, copd patients identified by the knhanes are an excellent sample of early copd patients. south korea has a compulsory universal health insurance system that includes medical reimbursement records for the entire korean population. the national health insurance (nhi) reimbursement database provides a unique and advantageous mechanism for evaluating the nationwide magnitude of an illness and consequent health care use.1215 the follow - up of patients with early copd identified by the knhanes was extremely difficult, as they rarely visited the hospital even after their diagnosis of copd by the knhanes. because lung function is relatively good and symptoms are mild, there is little motivation for them to see a physician and follow up regularly. however, by using the nhi database, it is possible to trace every single detail of medical utilization and costs for early copd patients. thus, we merged the knhanes and nhi data of patients with early copd to investigate the natural course of early copd. in this study we also aimed to analyze the medical utilization and costs for early copd during a 6-year period. the inclusion criteria for early copd were : 1) age 40 years ; 2) fev1/forced vital capacity (fvc) 10 years). however, during the 6-year follow - up, the annual percentage of patients who utilized health care for copd was < 10%. it is also very interesting to note that there was an evident change in the medication pattern. in 2007, after 6 years, even though it was still low, the inhaler use increased. this also suggests that some of early copd patients may progress and become symptomatic during the 6-year follow - up. first, we demonstrated for the first time the natural clinical course of a large number of early copd patients. to our best knowledge, this is the first large - scale (n=2,397) report regarding patients with early copd. second, we tracked all of their medical utilization and costs for 6 years without any missing data. all koreans are covered by the national insurance system, which is mandatory by law. thus, we could observe how early copd patients acted and how their disease progressed without any bias. this real - world result is hard to be replicated in other study because it is almost impossible for such early copd patients enrolled in this study to be enrolled in another cohort or interventional study fourth, this study contains many information that would have been missed in other claim data. usually, claim data do not provide important information, such as lung function, smoking status, or quality of life. however, by combining the hira data to knhanes data, we have created a valuable dataset that includes lung function, smoking status, and quality of life. until now, there has been no evidence whether a physician identifies and treats early copd patients. however, we clearly showed that some of early copd patients progressed and utilized health care for copd. specifically, patients with risk factors (old age, lower bmi, lower fev1 (%), and lower eq-5d) should be managed more aggressively. intervention to stop smoking should be provided, and early pulmonary rehabilitation can be also considered. moreover, medication that showed beneficial effect to slow decline of fev1 also needs to be prescribed to these patients. first, this is a retrospective study. however, unlike other studies, we have collected all the information regarding medical utilization and costs for health care. second, the pft results in this study are prebronchodilator ones. however, in many large epidemiologic studies, the pft results were also usually prebronchodilator ones. for example, the prebronchodilator value from copenhagen city heart study and lovelace smokers cohort was used in the study of lange.16 also, in the report by mannino,17 the prebronchodilator value from atherosclerosis risk in communities study and cardiovascular health study was used. this is because performing post - bronchodilator pfts in a large scale is extremely difficult. in knahnes,. it would be ideal if we had followed changes in lung function, quality of life, and progression of emphysema. we reported the natural course of early copd patients by combining knahanes and hira data. although medical utilization and costs for copd were low in this population, they increased over time. age, lower bmi, lower fev1 (%), and lower eq-5d score were significantly associated with medical costs. | background and objectivefew studies have examined the natural course of early copd. the aim of this study was to observe the natural course of early copd patients. we also aimed to analyze medical utilization and costs for early copd during a 6-year period.methodspatients with early copd were selected from korean national health and nutrition examination survey (knhanes) data. we linked the knhanes data of patients with early copd to national health insurance data.resultsa total of 2,397 patients were enrolled between 2007 and 2012. the mean forced expiratory volume in 1 second (fev1) was 78.6%, and the euroqol five dimensions questionnaire (eq-5d) index value was 0.9. in total, 110 patients utilized health care for copd in 2007, and this number increased to 179 in 2012. the total mean number of days used per person increased from 4.9 in 2007 to 7.8 in 2012. the total medical cost per person also increased from 248.8 us dollar (usd) in 2007 to 780.6 usd in 2013. a multiple linear regression revealed that age, lower body mass index, lower fev1 (%), and lower eq-5d score were significantly associated with medical costs.conclusioneven in early copd patients, some of them eventually progressed and utilized health care for copd. |
tetrachloroethylene or perchloroethylene (pce), a common industrial solvent and environmental contaminant, is primarily used in the dry - cleaning industry, for metal degreasing operations, and in the textile industry (1, 2). it is also present in certain consumer products, including paint strippers, spot removers, silicone lubricants, and food (2). studies have provided clear evidence that both acute and chronic exposure to pce can cause numerous adverse effects. as in the cases of toxicity due to the exposure to other chlorinated solvents, the target organs for pce toxicity in humans are the central nervous system, liver, and kidneys. the documented symptoms of toxicity due to the exposure to pce include headache, dizziness, fatigue, nausea, vomiting, pulmonary edema, and signs of impaired hepatic or renal function, depending on the level of pce exposure (2 - 4). severe exposure to pce can induce behavior alteration, coma, and death (2, 4). in addition, pce causes irritation in the eyes, nose, and upper respiratory tract (4). moreover, the international agency for research on cancer classified pce as a potential human carcinogen (5). although hepatotoxic effects have been reported in humans after heavy exposure to pce, acute liver failure has not been previously reported. we report, for the first time, a case of successful treatment of pce - induced acute liver failure with plasmapheresis. we also describe the pathological features of the condition on the basis of initial and repeat liver biopsies. a 39-yr - old male patient was admitted to our liver intensive care unit (licu) for acute liver failure on august 20, 2009. the patient worked at a leather - manufacturing plant, where he cleaned animal coats by using pce. the patient informed us that he occasionally did not wear protective devices during this procedure and that the process room at the plant was poorly ventilated. after working for about 50 days, the patient suddenly began passing dark urine, but continued his regular work. during the next 4 days, the patient developed progressive jaundice with nausea, vomiting, loss of appetite, and weakness and was admitted to a local hospital. blood chemistry revealed the following findings : total bilirubin (tbil), 202.8 m / l (normal range, 3.0 - 20.0 m / l) ; alanine aminotransferase (alt), 743 u / l (normal range, 5 - 40 u / l) ; alkaline phosphatase (alp), 189 u / l (normal range, 15 - 130 u / l) ; and gamma glutamyl transferase (ggt), 99 u / l (normal range, 12 - 58 serum concentration of pce was 2.8 mg / l and urinary concentration of trichloroacetic acid (tca)-an indirect biomarker for pce poisoning - was 8.4 further, the patient developed coagulopathy associated with progressive deterioration of liver function, which in turn led to the development of grade ii hepatic encephalopathy within 48 hr. the patient had not received blood transfusion ; not traveled recently ; had no family history of liver disease ; and none of his colleagues had similar manifestations. on the day of admission to the licu, all his vital signs were within normal limits. physical examination revealed grade ii hepatic encephalopathy with confusion, slurred speech, asterixis, and disorientation for time and place. laboratory examinations performed at the time of admission showed the following biochemical results : alt, 1,100 u / l ; aspartate aminotransferase (ast), 355 u / l (normal range, 10 - 40 u / l) ; tbil, 421.8 m / l ; direct serum bilirubin (dbil), 197.3 m / l (normal range, 0.0 - 7.0 m / l) ; alp, 201 u / l ; ggt, 139 u / l ; prothrombin time (pt) 51.0 s (normal range, 9.0 - 12.8 s) ; international normalized ratio (inr), 3.32 (normal range, 0.8 - 1.4) ; ammonia, 151 m / l (normal range, 9 - 33 m / l) ; alfa - fetoprotein (afp), 1,045 ng / ml (normal range, 0 - 9 ng / ml) ; and normal electrolyte, hematological, and renal functions. peripheral t - lymphocyte subpopulations, analyzed by flow cytometry, showed cd4/cd8 ratio of 3.74 (normal range, 1.33 - 1.99). serological studies for viral hepatitis (hepatitis a, b, c, d, and e viruses ; human immunodeficiency virus ; epstein - barr virus ; cytomegalovirus) and autoimmunity markers (antinuclear, antimitochondrial, antineutrophil cytoplasmic, anti - smooth - muscle, and anti - liver - kidney microsome antibodies) were negative. screening studies were performed to detect genetic and metabolic liver diseases and hematochromatosis, wilson 's disease, and alpha 1-antitrypsin deficiency were excluded. doppler ultrasonography of the patient 's abdomen revealed homogeneous echogenic liver that had decreased in size ; had patent portal veins, hepatic artery, and hepatic veins ; and no obstruction of the biliary tracts. the patient was managed with general supportive care along with intravenous administration of dexamethasone (15 mg daily) for 5 consecutive days. he was also treated with liver - protective preparations, glutathione, ademetionine, hepatocyte growth - promoting factors, and prophylactic antibiotics. furthermore, plasmapheresis was performed on days 1, 3, and 5, with 3,000 ml of plasma exchanged during each session. gradually, the patient 's mental status became normal, and liver function, coagulation profiles and other biochemical variables improved notably (fig. the patient underwent percutaneous liver biopsy on day 12 ; the biopsy revealed massive hepatocellular necrosis prominently in the centrilobular area with moderate inflammatory infiltration mainly of lymphocytes and neutrophils. we also detected diffuse swelling of the hepatocytes and hemorrhagic infiltration in some necrotic areas. the patient responded well to treatment, and gradually, his general condition improved and all symptoms eventually resolved except for poor appetite and fatigue. the patient was discharged from the hospital on day 26 and advised to completely avoid exposure to pce at his workplace. the patient underwent regular follow - up every month, and liver function and afp level became normal after 2 months. repeat liver biopsy performed 6 months after discharge showed fibrous expansion of the portal tracts caused by moderate inflammatory infiltration and nodular regeneration of the hepatic parenchyma delimited by thin fibrous bands and septa. the biopsy showed evidence of some swollen hepatocytes and scattered foci of hepatocellular necrosis within the liver lobules (fig. currently, the patient is undergoing anti - liver fibrosis therapy using modern chinese medicine (fuzhenghuayu capsule) (6) and continues to receive follow - up. pce is mainly absorbed by mammals following inhalation and, to a lesser extent, by ingestion and dermal exposure (2, 4). most of the absorbed pce (80%-90%) is excreted unchanged in expired air, regardless of the route of exposure, whereas only a small proportion (1%-3%) is metabolized to tca, trichloroethanol, and trichloroacetyl chloride, which were subsequently eliminated in urine (2, 7). the serum half - life of pce is estimated at 65 hr, and that of urinary tca at 144 hr (8, 9). biotransformation of pce occurs predominantly in the liver via cytochrome p-450 (cyp) oxidation pathway, which accounts for the highest percentage of metabolites (2). glutathione conjugation pathway, though a minor route, is activated when cyp oxidation is saturated (2, 10). there is evidence that tca, the principal metabolite of pce, derived from cyp pathway may mainly contribute to hepatotoxicity via several modes of action, including oxidative stress, mitochondrial dysfunction, and dna damage (11). few studies have indicated that pce may exert suppressive effects on the immune system (12). however, our patient showed a remarkably high cd4/cd8 ratio at the initial presentation, indicating the possibility of a pce - triggered cell - mediated immune response that might induce hepatocellular damage. in addition, the hepatic injury in our patient was more severe than those reported in patients in previous studies, and no abnormalities were detected in his colleagues who were exposed to the same conditions at work. we postulated that these differences may be attributable to genetic polymorphism in metabolizing enzymes, which might lead to variations among the level of susceptibility of individual to pce toxicity (11). other factors such as age, sex, pattern of activity, health status, and alcohol consumption also influence pce metabolism and toxicity. meckler. (13) reported hepatocellular injury detected by liver biopsy in a woman with acute hepatitis after exposure to pce. (14) reported a case of an infant presenting with obstructive jaundice and hepatomegaly due to pce exposure via breast milk. brodkin. (15) reported hepatic ultrasonography findings showing diffuse parenchymal changes in dry cleaners in comparison with ultrasonography findings in control subjects. liver damage in the form of hepatomegaly, jaundice, and elevation in levels of several hepatic transaminases and bilirubin has also been reported. in most cases, hepatotoxicity was transient, and its effects were spontaneously resolved when exposure to pce ended. thus far, no study has reported acute liver failure associated with pce exposure. initially, the patient 's condition was similar to viral hepatitis and rapidly deteriorated, resulting in marked liver dysfunction, coagulopathy, and encephalopathy. on the basis of the patient 's occupational history, clinical manifestations, laboratory data, and liver biopsy findings, acute liver failure was attributable to occupational exposure to pce, after other liver diseases had been completely excluded. we also assessed the patient using maria and victorino 's clinical diagnostic scale for drug - induced liver injury, and on the basis of his score 14, he was judged " probable " (16). liver injuries caused by drugs are classified as three types : hepatocellular, cholestatic, and mixed injury (17). our case presented with notably increased alt level of 1,100 u / l and an alt / alp ratio more than 5, suggesting a hepatocellular injury pattern. treatment for pce - induced hepatotoxicity requires supportive care with close monitoring to prevent associated toxicities to other systemic organs. our patient developed acute liver failure, which was a rare medical condition associated with high mortality. on the basis of model for end - stage liver disease (meld) score of 30, the patient was a candidate for living - related orthotropic liver transplantation (18). plasmapheresis has been successfully used in management of acute or chronic liver failure, and it serves a treatment modality to achieve recovery of native liver function or until an appropriate donor is available. although plasmapheresis has no established effects on elimination of serum pce due to its relatively small molecular weight and short half time, it is an effective approach for removing various endogenous toxins and immune complexes from systemic circulation, decreasing serum aminotransferase level, and improving the encephalopathy stage and coagulation profiles (19). all these effects of plasmapheresis may create a better internal environment for native hepatocyte regeneration and change the final outcomes in liver failure. our patient may have benefited from plasmapheresis, as was evident by the notable improvement of clinical status and liver function. due to the adjuvant evidence of increase in the cd4/cd8 ratio indeed, his survival can be mainly attributed to the sufficient residual hepatic capacity for regeneration, as evidenced by the short - term dramatically high levels of serum afp, with maximum value being more than 150 times greater than the normal range. initial biopsy revealed massive hepatic necrosis, primarily, in zone 3, which was consistent with the fact that hepatocytes in zone 3 were probably more susceptible to chemical - induced hepatotoxicity owing to the high concentration of cyp in these cells. furthermore, although his liver function test revealed persistently normal results for approximately 4 months, repeat biopsy revealed foci of hepatocellular necrosis and lymphocytic piecemeal necrosis with inflammatory infiltration. therefore, since liver function test can not completely reflect the severity of liver injury and may give a falsely optimistic suggestion, liver biopsy is a better approach to assess the prognosis of liver disease. our patient 's liver histology examination also showed typical postnecrotic cirrhosis, which was a result of active repair following massive hepatic necrosis. liver cirrhosis, in fact, is a rare sequel to drug - induced acute hepatitis, but it may occur if liver disease progresses to active chronic hepatitis, in which long - term liver lesions maintain. moreover, a single episode of sufficiently severe injury, such as massive / submassive hepatic necrosis, can also cause liver cirrhosis due to collapse of lobular architecture and irregularly scarred repair. a rapid progression from severe hepatitis to cirrhosis, which is similar to that seen in our patient, has been documented in ebrotidine - induced liver injury with serial biopsy confirmation (20). in conclusion, physicians should enhance their awareness of the possibility of acute liver failure induced by pce exposure. increased awareness and early diagnosis of the exposure to toxic substances are essential for performing prompt management, improving clinical outcomes. in addition, early plasmapheresis can serve as a useful treatment approach for patients with pce - induced acute liver failure, particularly for those with sufficient hepatic capacity for hepatocyte regeneration. | tetrachloroethylene is a chlorinated solvent that is primarily used in dry cleaning and degreasing operations. although the hepatotoxicity caused by tetrachloroethylene has been well documented in literature, it is rarely considered as a cause of acute liver failure. we report a case of a 39-yr - old man who was admitted to our hospital for acute liver failure due to tetrachloroethylene exposure. histological examination of the liver revealed massive hepatic necrosis, prominently, in zone 3 of the hepatic lobules. the patient underwent supportive treatment along with 3 sessions of plasmapheresis, and consequently, he presented a favorable outcome. repeat liver biopsy performed 6 months after the patient 's discharge showed architectural distortion with postnecrotic cirrhosis. physicians should be aware of the possibility of acute liver failure induced by tetrachloroethylene. early plasmapheresis can be effective for individuals with sufficient capacity for hepatocyte regeneration. |
mood disorders, including unipolar and bipolar disorders, are the most frequent psychiatric disorders both in the clinical settings and community. according to the previous studies, the lifetime prevalence rate of major depressive disorder was between 4.9% and 20% and the lifetime prevalence rates of bipolar i and ii disorders bipolar disorders are associated with serious complications such as increased risk of other psychiatric axis i and ii comorbidities, especially alcohol and substance use disorders, and increased rates of somatic morbidity and mortality. they also have disruptive effects on quality of life, productivity and daily functioning (1 - 12). besides, bipolar disorders are associated with high risk of both completed and attempted suicide (13 - 15). in the global burden of disease study, bipolar disorder was ranked as the eighth leading cause of medical disability worldwide (16). furthermore, a majority of bipolar patients were reported to suffer from high relapse rates even during mood stabilizer treatments (17). these features lead to burnout in family and have hazardous effects on society (5 - 17). as patients characteristics influence the disorders outcome (18), it is valuable to investigate mood disorders in patients of different large samples, and compare their properties with features. there are articles that reported demographic and clinical features of these patients in the western countries (8 - 12, 18 - 23), but in iran we have limited data in this regard. according to some studies, the course of mood disorders is somehow different in iranian patients. for instance, unlike other studies, in the majority of iranian bipolar patients, the disorder begins with manic phase. this confirms the need for further researches in order to gather more information (24, 25). this study was designed to assess demographic and diagnostic characteristics of 3000 iranian inpatients with bipolar disorders in a psychiatric hospital. in this retrospective cross - sectional study, we collected the files information of inpatients hospitalized from 2006 to 2011, iran hospital of psychiatry, a university affiliated hospital in tehran, iran. it offers inpatient and outpatient services to all clients from all over the country, especially the west of tehran. it has 130 beds, 1 emergency department with 22 beds, 3 wards for men with 90 beds and 1 ward for women with 30 beds. the patients diagnosed as bipolar disorders in first hospitalization by expert psychiatrists (faculties of iran university of medical sciences) were enrolled in the study. diagnosis was made based on the 4th edition of diagnostic and statistical manual of mental disorders (dsm - tv - tr) criteria and through unstructured interviews. a total of 3000 patients with diagnosis of bipolar i disorder were hospitalized in iran hospital during the mentioned time. demographic, clinical, and therapeutic characteristic of the patients including age, gender, date and place of birth, home address, marital status, number of children, occupational status, educational status, insurance status, age of first episode, age of first hospitalization, type of first episode, number of hospitalizations, duration of each hospitalization, psychiatric diagnosis during each hospitalization, type of treatments (medical treatments, electroconvulsive therapy) during each hospitalization were collected by checking their hospital files. data analysis was performed with spss for windows (version 21.0, spss inc., chicago, il, usa) and we used descriptive statistics for quantitatively describing the features. this study was approved by the ethical committee of psychiatric department of iran university of medical sciences and confidential records were kept at a secure area with limited access, and stripping them of identifying information was considered. the majority of the patients was unemployed and had lower than high - school degrees. in this study, the age of disease onset was 27.9 0.19 y and age of their first hospitalization was 32.5 0.2 y. men were admitted more than women in the hospital. low educational level and high health insurance coverage and unemployment rate among them were considerable. in kupfer study, 64.5 out of 3000 bipolar patients were women, and the mean age of onset was 19.8 years. in iran hospital, the number of men beds was triple of women beds and this was the reason why the majority of our patients were men. (28) and kogan. studies data (18) (table 2). our results are in conflict with western studies in a number of features, many of them may reflect cultural and society differences. as it is presented in table 2, the iranian patients are characterized by a higher rate of unemployment, being single, having health insurance and lower rate of divorce and education compared to the other clinical samples. high rates of unemployment, lower education and being single perhaps are due to the stigma and insufficient social resources for patients with mental disorders in iran. also, it could be due to the higher prevalence of these attributes in the iranian general population than western populations. furthermore, iran hospital is located in a low socioeconomic region, outside of tehran and the economic and educational properties of the patients of this study could not be generalized to all the psychiatric inpatients of iran. age of onset and the first admission were also higher than those of other studies. overlooking the symptoms of mania, lack of insight into manic symptoms, and recall bias could be the reasons of higher age of onset. in addition, misdiagnoses and the stigma as a barrier to on time hospitalization may be the causes of higher age of first admission. in the majority of the patients, the disorder had begun with manic phase (24, 25), which is consistent with the data of previous iranian studies on bipolar patients and in contrast to studies in western countries. some reasons such as more acceptability and tolerability of depressive symptoms rather than behaviorally disruptive manic episodes or overlooking of depressive symptoms by mental health system professionals, patients, and their families could perhaps justify these results. hence, it is possible that patients with mild form of disease, especially depressed patients have not been admitted regarding the hospital priority for admitting aggressive manic patients. depression was higher in the women and the number of female beds was one third of male beds. so it can be another reason that mania was the prominent feature of the disorder. furthermore, all the other studies were carried out on outpatients and this could be another explanation for differences of types of episodes. according to jablensky study on severely ill hospitalized patients in germany, (100 years ago) on hospitalized bipolar patients in finland, the corresponding peak of 1-year incidences for a bipolar depressive episode occurred at the same age, was about half of that reported for mania (30). on the other hand, in a study carried out on 8,889 psychiatric inpatients, 52.1 out of 1938 bipolar patients were men and almost 50% of patients were in depressed episode (31). it seems that the findings in the literature are conflicting and difficult to reconcile, so it is highly recommended to design more studies aiming to investigate probable etiologies such as genetics. rate of health insurance shows the better medical insurance coverage in iran than western countries ; however long waiting lists of state - run hospitals, increasing healthcare costs and poor insurance coverage of private outpatients services should not be disregarded. retrospective method and lack of a standard diagnostic instrument were the limitations of this study. in addition, this study was conducted based on the data from medical records of inpatients and lacked appropriate assurance of quality and consistency of collected data. however, considering that the hospital was a university affiliated residency training center and the diagnosis was based on dsm - iv - tr criteria, authors would assume acceptable requirements for using those findings. it is highly recommended to design future outpatient studies in order to review clinical features of bipolar outpatients and compare them with studies in other countries. | background : patients characteristics influence the disorders outcome, so it is valuable to compare mood disorders and inpatients attributes in different large samples.objectives:this study was designed to assess demographic and diagnostic characteristics of 3000 iranian inpatient with bipolar disorders.patients and methods : we collected the information of demographic, clinical, and therapeutic characteristics of the patients who were hospitalized in iran hospital of psychiatry, a university affiliated hospital in tehran, during the 5 years from 2006 to 2011.results:about 66.1% of the subjects were males and 33.9% were females. iranian patients are characterized by a higher rate of unemployment, being more single, having health insurance and lower rate of divorce and education compared to the other clinical samples. in the majority of the patients, the disorder had begun with manic phase.conclusions:clinical and therapeutic features of iranian patients are different from patients in western countries. |
the goal of palliative care is to prevent and relieve suffering and to provide the best possible quality of life (qol) to patients and their families, regardless of the stage of illness trajectory. the home - based specialist palliative care services have been developed to meet the needs of the patients in advanced stage of cancer at home with physical symptoms and distress. there is evidence to demonstrate that home, hospital and in - patient specialist palliative care services significantly improved patient outcomes in the domains of pain, symptom control and anxiety, and reduced needless hospital admissions. hence, it should be offered to all patients with life - threatening illnesses, early in the course of the disease. home care nursing - based palliative programs are also effective in reducing patient pain and symptom experience ; thus improving patient 's qol and decreasing family burden. providing out of hours (ooh) care is considered as a best practice model in palliative care ; however, there is little data documenting the process and outcomes. the level of ooh service delivery is quite variable, can range from responding to a call, providing a home visit, giving telephone support, and/or routine ooh home visits. one of the important outcomes in care of advanced stage cancer patients is dying at their preferred place. worldwide, majority of the patients preferred to die at home. through specialized palliative home care services, the patients had good symptom control and improved qol, which enabled them to stay at home. at the tata memorial centre, 70% of the patients presented in an advanced stage of the illness, and are in need of palliative care, during and after the curative treatment. services at the department of palliative medicine, tata memorial hospital, include a multidisciplinary home care team providing home visits since 1999. it caters to over 700 patients annually, from mumbai and suburbs with a population of 20.5 million. in addition to control of physical symptoms, the team concentrates on psycho - social, emotional care, along with the provision of bereavement support. to study the impact of specialist home - based palliative care services on (a) symptom control (b) psychosocial support (c) health - related communication (d) home - based death (e) bereavement outcomes and (e) caregiver satisfaction. to study the impact of specialist home - based palliative care services on (a) symptom control (b) psychosocial support (c) health - related communication (d) home - based death (e) bereavement outcomes and (e) caregiver satisfaction. inclusion criteria : all the patients from mumbai within the home care territory (in 35 km radius from tmh), registered in department of palliative medicine in the year 2012, and consenting for home - based palliative care, were recruited into the study. exclusion criteria : age less than 18 years, ecog > 3 were the exclusion criteria. at home, physical symptoms in patients were assessed using the esas (edmonton symptom assessment scale) score. most of these patients were initially assessed using the same scale in palliative medicine opd. socio - economic status and distress were assessed by the social workers along with the rest of the team members. the symptoms were assessed using esas scale, and compared between visit-1 to visit-2 at home [see table 1 ]. the wilcoxon signed ranks test and non - parametric statistical hypothesis test are used to compare the two related samples. comparison of edmonton symptom assessment scale scores between first and second home visit based on symptoms and score on esas scales, patients were prescribed symptom control measures. the family members / caregivers were empowered for patient care e.g. dressing, nasogastric tube feed, tracheostomy care, back care, oral hygiene, etc. where oral route was not possible, a subcutaneous line was secured and family members were empowered to administer the same at home. home care team liaised with the local nurses and local general practitioners (lgps), to provide ooh care so that the continuity of care is maintained. few patients had direct access to the railway hospitals or government hospitals close to home. patients were given a telephonic contact where they or their lgp, could call after hours for telephonic consultation. this is initiated in the hospital and continued at home, both for the patient and family. family often asks the doctors to collude and not to divulge information to patient about diagnosis and prognosis. families are counseled about the need for the patient to have information about the illness as it would help the patient to cope with illness better, understand symptomatology and complete unfinished businesses. social support is an aspect of good palliative care, and is routinely incorporated in our practice. patients and families of lower socio - economic strata were helped by free medicines, ration coupons worth rs 1000 a month, education support, women 's empowerment and self - help schemes. the volunteers and social workers conducting the support group arranged some fun activities and vocational training opportunities in an effort to empower the families. patients or relatives were also encouraged to visit the opd as required and some patients were also referred to the hospice. provision of palliative home care apart involves logistics of travel and each team on an average travels around 50 - 80 km per day and spends at least 6 - 8 hours per day on the run. each team sees 5 - 8 patients / week and spends at least 40 - 60 minutes per patient on initial assessment and 15 - 20 minutes on a follow - up assessment. after the death of the patient, the home care team provided bereavement support to all the families registered under the home care program. the aim of bereavement support was to understand whether the family was coping normally with grief and helping them eventually to return to a normal stream of life. physical symptoms in patients were assessed using the esas (edmonton symptom assessment scale) score. most of these patients were initially assessed using the same scale in palliative medicine opd. socio - economic status and distress were assessed by the social workers along with the rest of the team members. the symptoms were assessed using esas scale, and compared between visit-1 to visit-2 at home [see table 1 ]. the wilcoxon signed ranks test and non - parametric statistical hypothesis test are used to compare the two related samples. comparison of edmonton symptom assessment scale scores between first and second home visit based on symptoms and score on esas scales, patients were prescribed symptom control measures. the family members / caregivers were empowered for patient care e.g. dressing, nasogastric tube feed, tracheostomy care, back care, oral hygiene, etc. where oral route was not possible, a subcutaneous line was secured and family members were empowered to administer the same at home. home care team liaised with the local nurses and local general practitioners (lgps), to provide ooh care so that the continuity of care is maintained. few patients had direct access to the railway hospitals or government hospitals close to home. patients were given a telephonic contact where they or their lgp, could call after hours for telephonic consultation. this is initiated in the hospital and continued at home, both for the patient and family. family often asks the doctors to collude and not to divulge information to patient about diagnosis and prognosis. families are counseled about the need for the patient to have information about the illness as it would help the patient to cope with illness better, understand symptomatology and complete unfinished businesses. social support is an aspect of good palliative care, and is routinely incorporated in our practice. patients and families of lower socio - economic strata were helped by free medicines, ration coupons worth rs 1000 a month, education support, women 's empowerment and self - help schemes. the volunteers and social workers conducting the support group arranged some fun activities and vocational training opportunities in an effort to empower the families. patients or relatives were also encouraged to visit the opd as required and some patients were also referred to the hospice. provision of palliative home care apart involves logistics of travel and each team on an average travels around 50 - 80 km per day and spends at least 6 - 8 hours per day on the run. each team sees 5 - 8 patients / week and spends at least 40 - 60 minutes per patient on initial assessment and 15 - 20 minutes on a follow - up assessment. after the death of the patient, the home care team provided bereavement support to all the families registered under the home care program. the aim of bereavement support was to understand whether the family was coping normally with grief and helping them eventually to return to a normal stream of life. a total of 690 new cases were registered under home - based palliative care service in the year 2012 ; 506 patients were visited with a total of 1830 home visits for the year 2012. the relief of symptoms was assessed based on sequential changes in the esas scale, which was documented during each visit. twenty - nine patients received medical assistive equipment like, water bed, wheel chairs, diapers, bed pans, etc. 50.98% patients were cared for at home, 28.85% patients needed hospice referral and 20.15% patients needed brief period of hospitalization. education support provided to children of palliative care patients 3840 telephonic follow - up calls were done to enquire about patient 's general condition and symptom management. the perceived benefits were : continuity of care was maintained, early reporting of symptoms and early management on phone with / without liasioning with lgp, prioritizing the patient for home visit and development of good rapport with the caregivers. palliative home care team was successful in involving neighbors in patient care and this has decreased caregiver availability issues to a large extent. the visits have helped family members to get over the fear of contagion of cancer, social stigma and changed their overall attitude toward the patients. in addition to providing adequate physical comfort, the counseling has reduced the apprehension of the family members, to care for their loved ones who are at the end of life phase of illness trajectory. out of 506 patients, 87 patients and/or caregivers required recounselling at home. future care, end of life symptoms and process of dying were discussed with the patients and caregivers, and patients and their families were prepared for the inevitable. for 421/506 (83.20%) patients, the perceived benefits were : continuity of care at home, a sense of support felt by the family to care for the patient at home, timely intervention with lgps, and more economically viable care. in all, 266 patients were verified and certified to be dead at home by the lgps. due to the regular home visits by the home care team and liaison of lgps, the unnecessary hospitalization was deferred in most of the patients. only 102 patients required temporary hospital - based supportive care. the following social care support was provided for the patients and their families : education support : 41 children (of palliative care patients) were provided financial support to complete their formal education. support group meeting (sgm) : total 247 people attended the monthly support group meeting. one of the important outcomes was the individuals forming the group among themselves, which helped them to share their experiences, and enabled them to cope better. in all, 102 patients reported that they felt psychologically better and their fear toward death had been drastically reduced after attending sgm. seventy - eight patients / caregivers reported that their attitude toward life had changed and they started enjoying family life. ration help : total 248 ration coupons were distributed to needy families, each worth rs 1000. free medicines : tata memorial centre has a policy of free medications for patients below the poverty line. these patients are identified by the social workers, which would facilitate the provision of free medicines. in all, 382 patients received free medicines. the majority of patients died at home, followed by hospice and hospital [see table 3 ]. total 201 primary caregivers were provided telephonic bereavement support and 15 families were offered bereavement home visits as these families were finding very difficult to cope the loss of their loved ones. anticipatory grief counseling, by the home care team and trained counselors made the bereavement process easier and enabled the families / caregivers to move on to their routine life [table 4 ]. out of 216 bereaved caregivers studied, 9 were in denial, 198 were in acceptance phase, 11 were angry, 6 were in bargaining phase and none were in depression. the strength / coping mechanisms for the bereaved caregivers were : belief in god-183, family and friends support-57, positive attitude-173, destiny / fate-167. a support in the form of monthly ration, education help to their children and women 's empowerment helped them to return to a normal life [see table 4 ]. outcomes of anticipatory grief counseling total 176 of the 690 patients registered to receive home - based palliative care were never visited. twenty - four patients moved out of mumbai to their home town, as their preferred choice of spending their last days and eventual death. seven patients needed in - patient admission (4 hospitals and 3 hospices) for better symptom control during end of life. twelve patients were referred in the last week of the year, thus they were not included for analysis for the year 2012. total 29 patients could not be contacted due to insufficient contact information provided and 94 patients died before the first scheduled home visit. the reasons for refusal were social stigma, undergoing some alternative medicine treatment or undergoing anti - cancer treatment at a private hospital. the relief of symptoms was assessed based on sequential changes in the esas scale, which was documented during each visit. twenty - nine patients received medical assistive equipment like, water bed, wheel chairs, diapers, bed pans, etc. 50.98% patients were cared for at home, 28.85% patients needed hospice referral and 20.15% patients needed brief period of hospitalization. education support provided to children of palliative care patients 3840 telephonic follow - up calls were done to enquire about patient 's general condition and symptom management. the perceived benefits were : continuity of care was maintained, early reporting of symptoms and early management on phone with / without liasioning with lgp, prioritizing the patient for home visit and development of good rapport with the caregivers. palliative home care team was successful in involving neighbors in patient care and this has decreased caregiver availability issues to a large extent. the visits have helped family members to get over the fear of contagion of cancer, social stigma and changed their overall attitude toward the patients. in addition to providing adequate physical comfort, the counseling has reduced the apprehension of the family members, to care for their loved ones who are at the end of life phase of illness trajectory. out of 506 patients, 87 patients and/or caregivers required recounselling at home. future care, end of life symptoms and process of dying were discussed with the patients and caregivers, and patients and their families were prepared for the inevitable. the perceived benefits were : continuity of care at home, a sense of support felt by the family to care for the patient at home, timely intervention with lgps, and more economically viable care. in all, 266 patients were verified and certified to be dead at home by the lgps. due to the regular home visits by the home care team and liaison of lgps, the unnecessary hospitalization was deferred in most of the patients. the following social care support was provided for the patients and their families : education support : 41 children (of palliative care patients) were provided financial support to complete their formal education. support group meeting (sgm) one of the important outcomes was the individuals forming the group among themselves, which helped them to share their experiences, and enabled them to cope better. in all, 102 patients reported that they felt psychologically better and their fear toward death had been drastically reduced after attending sgm. seventy - eight patients / caregivers reported that their attitude toward life had changed and they started enjoying family life. ration help : total 248 ration coupons were distributed to needy families, each worth rs 1000. free medicines : tata memorial centre has a policy of free medications for patients below the poverty line. these patients are identified by the social workers, which would facilitate the provision of free medicines. in all, 382 patients received free medicines. the majority of patients died at home, followed by hospice and hospital [see table 3 ]. total 201 primary caregivers were provided telephonic bereavement support and 15 families were offered bereavement home visits as these families were finding very difficult to cope the loss of their loved ones. anticipatory grief counseling, by the home care team and trained counselors made the bereavement process easier and enabled the families / caregivers to move on to their routine life [table 4 ]. out of 216 bereaved caregivers studied, 9 were in denial, 198 were in acceptance phase, 11 were angry, 6 were in bargaining phase and none were in depression. the strength / coping mechanisms for the bereaved caregivers were : belief in god-183, family and friends support-57, positive attitude-173, destiny / fate-167. a support in the form of monthly ration, education help to their children and women 's empowerment helped them to return to a normal life [see table 4 ]. outcomes of anticipatory grief counseling total 176 of the 690 patients registered to receive home - based palliative care were never visited. twenty - four patients moved out of mumbai to their home town, as their preferred choice of spending their last days and eventual death. seven patients needed in - patient admission (4 hospitals and 3 hospices) for better symptom control during end of life. twelve patients were referred in the last week of the year, thus they were not included for analysis for the year 2012. total 29 patients could not be contacted due to insufficient contact information provided and 94 patients died before the first scheduled home visit. the reasons for refusal were social stigma, undergoing some alternative medicine treatment or undergoing anti - cancer treatment at a private hospital. when faced with a terminal illness, patients and their relatives prefer to stay at home. in australia and uk, home - based palliative care is provided by royal district nursing service (rdns) and mcmillan nurses, respectively. a liaison with the community palliative care nursing team provides effective home - based palliative care. the palliative care patients who received community - based domiciliary services required less frequent and shorter hospitalization as compared to the patients not on home care services. a significant improvement in the overall qol of the patients, with home - based palliative care program has been demonstrated. in india, there is an overwhelming need for home - based palliative care. three different types of home - based palliative care are seen and one such model is the network neighborhood program in kerala ; a community - initiated program, where the need of palliative care is initiated by the community. another model is ngo - initiated ; here the ngo runs the home - based program with external funding and liaises with the hospitals and medical colleges for technical support. the third model is a hospital - initiated home - based program where the home care team is an integral part of the hospital team, supported by an ngo., 506 patients received home - based palliative care, where all domains i.e. physical, psychological, social, end of life and bereavement care were provided through a multidisciplinary team approach. the other important outcome of our home - based palliative care was deferring needless hospitalization through patient and family counseling, empowering the families, liaising with local general physicians, performing simple palliative procedures, and providing essential medications for symptom control and end of life care. though service models are not comparable, in a resource - limited setting like india, the model employed in our practice setting, has resulted in good symptom control, along with improved patient and caregiver satisfaction. psychosocial care for the patients and their families is an integral aspect of supportive care in cancer. a family support program helps patients and caregivers in coping, establish open communication channels and helps in reducing conflicts. the melbourne family support program focuses on psychosocial burden of the family caregivers by providing a study conducted in botswana demonstrated that support groups facilitate information - sharing, education and advocacy, and fosters the spirit and feeling of togetherness. the palliative home care team at our institution has 5 social workers, clinical psychologist and volunteers. based on needs, assessed patients receive counseling and emotional and social support. in the support group meetings, participants were able to share their experiences, difficulties, and problems and motivate each other. home - based palliative care program also facilitates the transition of patients to hospice care as required. one of the important roles of palliative home care team is timely identification of patients needing hospice care. in our study, 146 patients needed hospice admission. the commonly indentified reasons were poor caregiver availability, difficult symptom control at home needing intense palliative care input, poor treatment compliance or limited resources. out of 146 hospice admissions, 111 patients died in the hospice. out of 690 patients registered to receive home - based palliative care in 2012, 94 patients were late palliative care referral, with poor general condition and hence died before the visit could take place. triage coding system for home - based palliative care such that prioritized patients are seen at the earliest. we also felt that strengthening the existing home care services in the form of an additional team with more personnel and funding would help us cater to the needs as per existing population. involving family physicians for caring patients at home, in liaison with the palliative home care team, can be helpful in establishing an ethical care model in terminal cancer patients. ooh is an integral part of our care process ; provided in liaison with the lgp. in our study, 421 (83.20%) patients had access to the lgp. few patients had access to the railway hospitals or government hospitals close by, where ooh was provided. integrating tele - health into routine practice is useful. in our study, ooh care by telephonic consultation was provided via 5 helplines by 3 doctors on rotation, 1 nurse and 1 social worker. the most common reason for telephonic contact is symptom management, which is similar to the findings noted in our study. defining a good death is very difficult, as it can only be judged by the extent to which individual patient and family priorities are fulfilled or met. a large number of studies from the developed world have proven that home is the preferred place of death for patients, with a life - limiting illness. total 93.8% of a healthy population in germany and 70.8% people in canada, preferred to die at home. similarly, 75% of hospitalized patients in the us,67% of cancer patients in italy and 71% of cancer patients in denmark preferred to die at home. review of most of the studies has demonstrated that the preferred place of care is home followed by inpatient hospice care. home death is commonly viewed as a more dignified and comfortable experience than death in hospital, with the people they like could be present. patients with cancer who die in a hospital or icu have worse qol compared with those who die at home, and their bereaved caregivers are at increased risk for developing psychological morbidity. a large indian survey conducted by cipla institute of palliative care, in a healthy population, with more than 3000 respondents showed that home was the preferred place of death in 83% of the respondents (personal communication). in our study, 57.08% died at home and the ratio of home death to hospice to hospital was 6:2:2 for the year 2012. the patients in our study group preferred to stay with their loved ones during the last days at home, in familiar surroundings. acceptance of death and the continuance of valued living is the major strength for the caregiver dealing with terminal illness and bereavement. most families who have experienced a normal grieving process have accepted the loss well and have returned to a normal routine life. total 198 of the bereaved families who were evaluated and found to be in stage of acceptance in their grief process returned to their normal routine life early. anticipatory grief counseling, recognizing a high risk bereavement and managing this with the help of counselors / volunteers improved bereavement outcomes. outcomes of the study also showed that our bereavement care program is consistent with the recommended bereavement care practices and standards around the world. specialist home - based palliative care improved symptom control, health - related communication and psychosocial supportit promoted increased number of home - based death, appropriate and early hospice referral, and averted needless hospitalizationit improved bereavement outcomes and caregiver satisfaction. specialist home - based palliative care improved symptom control, health - related communication and psychosocial support it promoted increased number of home - based death, appropriate and early hospice referral, and averted needless hospitalization it improved bereavement outcomes and caregiver satisfaction. | background : home - based specialist palliative care services are developed to meet the needs of the patients in advanced stage of cancer at home with physical symptoms and distress. specialist home care services are intended to improve symptom control and quality of life, enable patients to stay at home, and avoid unnecessary hospital admission.materials and methods : total 690 new cases registered under home - based palliative care service in the year 2012 were prospectively studied to assess the impact of specialist home - based services using edmonton symptom assessment scale (esas) and other parameters.results:out of the 690 registered cases, 506 patients received home - based palliative care. 50.98% patients were cared for at home, 28.85% patients needed hospice referral and 20.15% patients needed brief period of hospitalization. all patients receiving specialist home care had good relief of physical symptoms (p < 0.005). 83.2% patients received out of hours care (ooh) through liaising with local general practitioners ; 42.68% received home based bereavement care and 91.66% had good bereavement outcomes.conclusion:specialist home - based palliative care improved symptom control, health - related communication and psychosocial support. it promoted increased number of home - based death, appropriate and early hospice referral, and averted needless hospitalization. it improved bereavement outcomes, and caregiver satisfaction. |
given the association of bats with emerging infectious diseases, field surveys were performed during july the selection of sites was based on preliminary data regarding bat roost locations and observations of bats in the field during the survey. attempts were made to collect specimens from 1020 animals of each species present in each location. bats were captured manually and by using mist nets and hand nets ; adults and subadults of both sexes were captured. each bat was measured, sexed, and identified to the genus or species level when possible. blood samples and oral and fecal swabs were collected ; the animals were then euthanized in compliance with field protocol. blood, fecal swabs, and selected tissue samples were transported on dry ice from the field and stored at 80c. fecal swabs (n = 221 ; table) were screened for the presence of cov rna using 2 semi - nested reverse transcription pcr (rt - pcr) assays. for the pan - coronavirus rt - pcr, conserved primers were designed from highly conserved regions of the rna - dependent rna polymerase (rdrp) gene 1b based on available cov sequences (1st and 2nd round forward 5-atgggitgggay tatccwaartgtg-3 ; 1st round reverse 5-aattat arcaiacaacisyrtcrtca-3 ; 2nd round reverse 5-ctagticcacciggyttwanrta-3). for the pan bat coronavirus rt - pcr, conserved primers were designed from the same highly conserved regions based on available bat cov sequences and presumed to be more specific to bat coronaviruses (1st and 2nd round forward 5-atgggitgggaytatccwaartgtg-3 ; 1st round reverse 5-tattatarcaiaciacrccatcrtc-3 ; 2nd round reverse 5-ctggticcacci ggyttnacrta-3). total nucleic acids were extracted from 200 l of a phosphate buffered saline suspension of each swab by using the qiaamp mini viral elute kit (qiagen, santa clarita, ca, usa), according to the manufacturer s instructions. the seminested rt - pcr was performed by using the superscript iii one - step rt - pcr kit and platinum tag kit (invitrogen, san diego, ca, usa). the positive pcr products were purified by gel extraction by using the qiaquick gel extraction kit (qiagen) according to the manufacturer s instructions ; they were then sequenced on an abi prism 3130 automated sequencer (applied biosystems, foster city, ca, usa), according to the manufacturer s instructions. of 221 bat fecal swabs examined, 41 (19%) were positive by at least 1 of the 2 seminested rt - pcr assays (table). one specimen had 2 distinct cov sequences, each amplified by 1 of the 2 pcr assays, giving a total of 42 distinct cov sequences. to characterize the overall diversity of cov sequences, in this study a phylogenetic tree (figure 2) of the 121-bp fragment of rdrp was generated from 39 coronaviruses from bats in kenya and 47 selected human and animal coronaviruses from the national center for biotechnology information database based on the bayesian monte carlo markov chain method (14). three of the 42 sequences were not of sufficiently high quality to include in this tree. phylogenetic tree generated using bayesian markov chain monte carlo analysis implemented in bayesian evolutionary analysis sampling trees (beast ; http://beast.bio.ed.ac.uk) by using a 121-nt fragment of the rdrp gene 1b from 39 coronaviruses (covs) in bats from kenya. covs from this study are shown in boldface ; an additional 47 selected human and animal coronaviruses from the national center for biotechnology information database are included. cov groups (1 to 3) based on international committee on taxonomy of viruses recommendation are indicated. bat coronaviruses from the people s republic of china (), northern germany (), and north america () are labeled. scale bar indicates number of nucleotide substitutions per site. among the 39 sequences in the tree, 23 belonged to previously defined group 1 and the 121-bp sequences in these 5 clusters had an average nucleic acid (na) sequence identity of 88%, 85%, 81%, 77%, and 80% when compared with the next closest previously characterized covs (i.e., btcov1a, bthku8, bthku7, hcov229e, and btcova970, respectively). bats (location 17) were closely related to a sars - like cov cluster, including 1 sequence shown in figure 2 (btky15) and another (btky16) that was 1 of the 3 low - quality sequences excluded from the tree. these 2 na sequences show 89% identity with the nearest previously characterized bat : sars - like cov, btcovrf1, shows 80% na sequence identity to sars cov (urbani strain) and 63% na sequence identity to the human group 2 cov hcovoc43. one cluster contains the recently described bthku9 with > 95% na sequence identity, and the other cluster (btky18-like cluster) contains no other previously known covs, with < 75% na sequence identity to bthku9. the pattern of cov detections by bat species and location demonstrates several features concerning coronaviruses in bats. a given bat species in the same location can harbor several distinct covs as noted for chaerophon spp. (location 17), miniopterus inflatus (location 5), and rousettus aegyptiacus (location 2 and 16) ; similar covs can also been seen in the same type of bat in different locations, as noted for btcov1a - like cluster covs being detected in miniopterus spp. one m. inflatus bat from location 5 harbored 2 different, but closely related, covs, 1 (btcov 36) from the btcov1a - like cluster and 1 (btcov 35) from the bthku8-like cluster (figure 2). bats, but not detected in other bat genera, including those that shared roosts with miniopterus spp. bats. this finding is consistent with studies from china in which btcov1a - like and bthku8-like covs were frequently identified but only in miniopterus spp. this may suggest that viruses of the btcov1a - like cluster and the bthku8-like cluster are specifically adapted to miniopterus spp. bats and not easily transmitted to other bat species. in contrast, other genetically similar covs were detected in several different bat species. for example, covs from th bthku7-like cluster were detected in both chaerophon spp. and otomops martinsseni bats ; covs from the btcova970-like cluster were detected in cardioderma cor and rousettus aegyptiacus bats ; covs from the btky18-like cluster were detected in chaerophon spp., eidolon helvum, and r. aegyptiacus bats ; and covs from the bthku9-like cluster were detected in hipposidereos commersoni and r. aegyptiacus bats. these data demonstrate that the cov diversity in bats previously detected in asia, europe, and north america is also present, possibly to a greater extent, in africa. the extent of this diversity among covs may be shown more clearly through additional studies in bats, and increased demonstration of cov diversity in bats may require a reconsideration of how they should be grouped. the frequency and diversity of cov detections in bats, now in multiple continents, understanding the extent and diversity of cov infection in bats provides a foundation for detecting new disease introductions that may, like sars, present a public health threat. | diverse coronaviruses have been identified in bats from several continents but not from africa. we identified group 1 and 2 coronaviruses in bats in kenya, including sars - related coronaviruses. the sequence diversity suggests that bats are well - established reservoirs for and likely sources of coronaviruses for many species, including humans. |
serum samples as well as the demographic and clinical information about the human participants in this study were described in detail in our earlier report (27). that report also describes how recombinant msg fragments were cloned, expressed, and purified and how western blot was performed. serum specimens were tested against the following antigens : recombinant msg fragments ; escherichia coli extract expressing the pet vector without insert as a vector control ; tetanus toxoid (tt) as a positive control ; phosphate - buffered saline (pbs) without antigen (negative control). a standard serum sample, obtained from a healthy donor with known reactivity to msga, msgb, and msgc in western blot, is run on each plate as a control. duplicate wells of a 96-well plate were coated with antigen (1 g / ml, 100 l / well in pbs ph 7.4 overnight. the plates were washed in wash buffer (pbs with 0.05% tween-20) and blocked with blocking buffer (wash buffer with 5% nonfat milk) (200 l / well) for 2 h at room temperature. the plates were washed again, and human serum diluted 1/100 in blocking buffer was added to each well (100 l / well). the plates were rocked overnight at 4c, washed in wash buffer, and horseradish peroxidase (hrp)-labeled goat anti - human immunoglobulin (ig) g (heavy and light chains) was added to each well (100 l / well at 1/5,000 dilution in blocking buffer). hrp - labeled s - protein was used on each plate as a positive control and to correct for antigen loading. the plates were incubated at room temperature for 1 h, washed, and developed by adding 3,3,5,5-tetramethylbenzidine substrate (100 l / well). color was allowed to develop for 4 min, the reaction was stopped by adding 100 l of 0.18 mol / l h2so4 to each well, and the plates were read at a wavelength of 450 nm., the reactivity of each serum specimen to msg was expressed as the ratio of reactivity to the pet vector (mean optical density [od ] msgtest serum mean od pbstest serum) / (mean od pettest serum mean od pbstest serum). in elisa 2, the reactivity to msg was expressed as the percent reactivity to tt for each serum : (mean od msgtest serum mean od pbstest serum) / (mean od tttest serum mean od pbstest serum) x 100. in elisa 3, the reactivity to msg was expressed as percent reactivity of the standard serum : (mean od msgtest serum the mean od pbstest serum) / mean od msgstandard serum the mean od pbsstandard serum) x 100. variations in assay results using the control serum were measured for msga and msgc on a per - plate basis (n = 6), a daily basis using two plates (n = 12), and an overall basis (across 4 days with two plates per day) (n = 48). the coefficients of variation for msga were 3%5%, 3.3%5.8%, and 8.7%, respectively, and for msgc, 3.6%7%, 4.8%7.4%, and 13.3%, respectively. geometric means and 95% confidence intervals (95% ci) of observed elisa measurements were obtained by patient category and antigen status. before analysis weighted least squares regression analysis of variance (anova) was carried out for each elisa measurement separately to test the equality of elisa means between pcp - positive, pcp - negative, hiv, and donor categories, adjusted for categorically modeled antigen level (a, b, c). the means of pcp - positive, pcp - negative, and hiv groups were compared to the mean of blood donors by calculating a post hoc linear contrast of individual estimates. the model included interactions between antigens and patient categories to allow for possible differences in the effect of patient status on mean values of elisa among antigen levels. the association between western blot positivity and elisa was investigated by logistic regression in which western blot (dichotomous) was related to continuously measured elisa, adjusted for categorically modeled antigen level (a, b, c) and patient group (pcp - positive, pcp - negative, hiv, donor). associations were obtained by calculating the odds of western blot positive versus negative results for increasing elisa reactivity, ranging from low (25th percentile) to high (75th percentile). from the same analysis, odds ratios (ors) measuring associations between western blot positivity and patient status (donor versus pcp - positive, pcp - negative, hiv) were calculated at midpoints of elisa 1, 2, and 3, equal to 2.7, 16, and 35, respectively. ors for the combined pcp groups, i.e., blood donor versus hiv, were obtained by comparing the mean of pcp groups to mean of the donor group, calculated from a linear contrast of the individual group effects. a ci that does not include 1 indicates a significant association (two - sided p = 0.05) between the odds of western blot reactivity when elisa results are high versus low, or between blood donors and patient groups at the midpoint of elisa measurements. spearman correlation coefficients were obtained by measuring associations between elisa and cd4 and viral counts in hiv patients. all statistical analyses were performed by using the sas statistical analysis system (sas for windows, version 8.2, sas institute, cary, nc.) serum specimens were tested against the following antigens : recombinant msg fragments ; escherichia coli extract expressing the pet vector without insert as a vector control ; tetanus toxoid (tt) as a positive control ; phosphate - buffered saline (pbs) without antigen (negative control). a standard serum sample, obtained from a healthy donor with known reactivity to msga, msgb, and msgc in western blot, is run on each plate as a control. duplicate wells of a 96-well plate were coated with antigen (1 g / ml, 100 l / well in pbs ph 7.4 overnight. the plates were washed in wash buffer (pbs with 0.05% tween-20) and blocked with blocking buffer (wash buffer with 5% nonfat milk) (200 l / well) for 2 h at room temperature. the plates were washed again, and human serum diluted 1/100 in blocking buffer was added to each well (100 l / well). the plates were rocked overnight at 4c, washed in wash buffer, and horseradish peroxidase (hrp)-labeled goat anti - human immunoglobulin (ig) g (heavy and light chains) was added to each well (100 l / well at 1/5,000 dilution in blocking buffer). hrp - labeled s - protein was used on each plate as a positive control and to correct for antigen loading. the plates were incubated at room temperature for 1 h, washed, and developed by adding 3,3,5,5-tetramethylbenzidine substrate (100 l / well). color was allowed to develop for 4 min, the reaction was stopped by adding 100 l of 0.18 mol / l h2so4 to each well, and the plates were read at a wavelength of 450 nm. the reactivity of each serum specimen to msg was expressed as the ratio of reactivity to the pet vector (mean optical density [od ] msgtest serum mean od pbstest serum) / (mean od pettest serum mean od pbstest serum). in elisa 2, the reactivity to msg was expressed as the percent reactivity to tt for each serum : (mean od msgtest serum mean od pbstest serum) / (mean od tttest serum mean od pbstest serum) x 100. in elisa 3, the reactivity to msg was expressed as percent reactivity of the standard serum : (mean od msgtest serum the mean od pbstest serum) / mean od msgstandard serum the mean od pbsstandard serum) x 100. variations in assay results using the control serum were measured for msga and msgc on a per - plate basis (n = 6), a daily basis using two plates (n = 12), and an overall basis (across 4 days with two plates per day) (n = 48). the coefficients of variation for msga were 3%5%, 3.3%5.8%, and 8.7%, respectively, and for msgc, 3.6%7%, 4.8%7.4%, and 13.3%, respectively. geometric means and 95% confidence intervals (95% ci) of observed elisa measurements were obtained by patient category and antigen status. before analysis, weighted least squares regression analysis of variance (anova) was carried out for each elisa measurement separately to test the equality of elisa means between pcp - positive, pcp - negative, hiv, and donor categories, adjusted for categorically modeled antigen level (a, b, c). the means of pcp - positive, pcp - negative, and hiv groups were compared to the mean of blood donors by calculating a post hoc linear contrast of individual estimates. the model included interactions between antigens and patient categories to allow for possible differences in the effect of patient status on mean values of elisa among antigen levels. the association between western blot positivity and elisa was investigated by logistic regression in which western blot (dichotomous) was related to continuously measured elisa, adjusted for categorically modeled antigen level (a, b, c) and patient group (pcp - positive, pcp - negative, hiv, donor). associations were obtained by calculating the odds of western blot positive versus negative results for increasing elisa reactivity, ranging from low (25th percentile) to high (75th percentile). from the same analysis, odds ratios (ors) measuring associations between western blot positivity and patient status (donor versus pcp - positive, pcp - negative, hiv) were calculated at midpoints of elisa 1, 2, and 3, equal to 2.7, 16, and 35, respectively. ors for the combined pcp groups, i.e., blood donor versus hiv, were obtained by comparing the mean of pcp groups to mean of the donor group, calculated from a linear contrast of the individual group effects. a ci that does not include 1 indicates a significant association (two - sided p = 0.05) between the odds of western blot reactivity when elisa results are high versus low, or between blood donors and patient groups at the midpoint of elisa measurements. spearman correlation coefficients were obtained by measuring associations between elisa and cd4 and viral counts in hiv patients. all statistical analyses were performed by using the sas statistical analysis system (sas for windows, version 8.2, sas institute, cary, nc.) the reactivity of serum antibodies from hiv patients and healthy blood donors to msga, msgb, and msgc was compared by three different elisa analyses (table 1). irrespective of the method of analysis, hiv - positive patients had significantly higher levels of antibody than healthy blood donors to each of the msg fragments (p msga > msgb) for all methods of analysis. similar results were seen for hiv patients in elisa 1 and 2, but in elisa 3 reactivity to msgb was higher than to msga or msgc (not significant). ci, confidence interval ; elisa, enzyme - linked immunosorbent assay ; pcp, pneumocystis pneumonia. antibody reactivity of healthy blood donors (donors) ; hiv - positive ; pcp - positive, hiv - positive ; and pcp - negative, hiv - positive patients to human pneumocystis major surface glycoprotein c (msgc) by enzyme - linked immunosorbent assay 1 (ratio to pet), showing the range, 25% and 75% confidence intervals, and median of the data. data were log - transformed to approximate normality. to determine if the increased reactivity of the hiv serum samples could be accounted for by increased antibodies in the pcp - positive patients as a consequence of infection with pneumocystis, we compared the reactivity of hiv - positive, pcp - negative and hiv - positive, pcp - positive patients with that of blood donors (table 1, figure). irrespective of the elisa method chosen, the reactivity of pcp - negative serum samples was higher than that of blood donor serum samples for each of the msg fragments (p 0.05). however, level of reactivity to msgc was significantly higher than to msga in the pcp - positive cohort (p 0.05), some trends were interesting. patients in whom pcp developed subsequent to collecting their specimens had lower antibody levels to msgc than the other patient groups. the reactivity of serum antibodies from hiv patients and healthy blood donors to msga, msgb, and msgc was compared by three different elisa analyses (table 1). irrespective of the method of analysis, hiv - positive patients had significantly higher levels of antibody than healthy blood donors to each of the msg fragments (p msga > msgb) for all methods of analysis. similar results were seen for hiv patients in elisa 1 and 2, but in elisa 3 reactivity to msgb was higher than to msga or msgc (not significant). ci, confidence interval ; elisa, enzyme - linked immunosorbent assay ; pcp, pneumocystis pneumonia. antibody reactivity of healthy blood donors (donors) ; hiv - positive ; pcp - positive, hiv - positive ; and pcp - negative, hiv - positive patients to human pneumocystis major surface glycoprotein c (msgc) by enzyme - linked immunosorbent assay 1 (ratio to pet), showing the range, 25% and 75% confidence intervals, and median of the data. data were log - transformed to approximate normality. to determine if the increased reactivity of the hiv serum samples could be accounted for by increased antibodies in the pcp - positive patients as a consequence of infection with pneumocystis, we compared the reactivity of hiv - positive, pcp - negative and hiv - positive, pcp - positive patients with that of blood donors (table 1, figure). irrespective of the elisa method chosen, the reactivity of pcp - negative serum samples was higher than that of blood donor serum samples for each of the msg fragments (p 0.05). however, level of reactivity to msgc was significantly higher than to msga in the pcp - positive cohort (p 0.05), some trends were interesting. patients in whom pcp developed subsequent to collecting their specimens had lower antibody levels to msgc than the other patient groups. using elisa, we have compared blood donor and hiv+ patient serum samples for antibody reactivity to recombinant fragments of p. jiroveci msg. we analyzed the data by three independent methods and found that hiv - positive patients had significantly higher mean serum antibody levels to msga, msgb, and msgc than healthy blood donors by all methods of analysis. furthermore, when the hiv - positive patients were separated on the basis of a prior documented episode of pcp, the pcp - positive patients had higher antibody levels to msgc than the pcp - negative patients by all elisa methods tested. these results differ from published work (25,26) showing no difference in antibody levels between hiv - positive, pcp - positive patients ; hiv - positive, pcp - negative patients ; and healthy controls to recombinant fragments of msg. the discrepancy in results could be due to differences in study populations, msg preparations, and methods (28). at the onset of the study, we decided on three independent methods of analysis of the data in an attempt to standardize the assay. each method of analysis provides different information about the results of the elisa, and each method has strengths and weaknesses. the first analysis involved comparing the response to recombinant msg fragments with the response to protein expressed from the pet vector without insert. the protein expressed from the sequences of the pet vector is an integral part of each msg recombinant tested, and therefore this method of analysis allows measurement of msg - specific immune reactivity corrected internally for any reactivity to the vector - derived sequences. the second method of analysis was a comparison of the reactivity to msg with that of a standard antigen, tetanus toxoid, chosen because it is likely that most adults have been vaccinated against tetanus toxoid and are likely to react with this protein in assay. while this method is consistent when analyzing individual serum samples, one potential problem with this analysis is that the antibody response to tetanus toxoid varies from person to person. this variation means that, when a population is studied, the range of values obtained by this method can be quite large. the third method of analysis was comparing the test serum reactivity to that of a standard serum. our standard serum was chosen because of clear reactivity to all msg fragments tested in western blot analysis. however, this serum responded weakly to msgb in elisa. our choice of standard serum is still valid and is useful for comparing the reactivity to any one of the fragments in different populations. however, the use of this method to compare responses to different msg fragments must be treated with caution. an alternative approach would be to use a pool of serum samples from several donors chosen for reactivity to the individual msg fragments. we have previously shown that msgb was the most common fragment recognized by blood donors and hiv patients (27), and a significant difference was found in the frequency of recognition of msgb between donors and hiv+ patients. in contrast to these results, this study has shown that msgc is the antigen with the highest level of reactivity in both the healthy and hiv - positive populations tested. this apparent discrepancy between assays is probably due to the nature of the epitopes recognized in the different assays, since the recombinant antigens were reduced and denatured during testing by western blot analysis but not in elisa. the lack of strict concordance in recognition of msg fragments in elisa and western blot has also been seen by other groups (15,26) however, we did find a significant association between elisa antibodies and western blot seropositivity in hiv - positive patients but not in blood donors. using regression analysis, we calculated ors measuring the association of western blot positivity and study participant (blood donor vs. hiv) status at the midpoint of each elisa. first, 84% of our blood donors, but only 66% of the hiv patients (p = 0.003), responded to at least one of the three msg fragments. third, blood donors exhibit larger standard deviations than hiv patients in their elisa values, suggesting they have a more heterogeneous antibody response in terms of affinity for msg epitopes. the association between western blot positivity and elisa values is probably not due to the pcp - positive patients response, as pcp - negative patients also showed an association in two of the three elisa methods. despite their lower western blot seropositivity rate, hiv patients had significantly higher mean serum antibody levels to msga, msgb, and msgc than healthy blood donors by both methods of elisa analysis. that hiv - positive patients should have higher levels of antigen - specific reactivity than healthy blood donors is surprising. one possible explanation is that hiv - positive patients may come into contact with pneumocystis more frequently or for longer periods of time before the organism is cleared from the lungs (1). while this exposure to pneumocystis may not result in overt pcp, the immune system likely takes longer to clear the organisms from the lung, allowing responses to new or subdominant epitopes to develop. in contrast, these responses would be absent or diminished in healthy populations, who would clear pneumocystis from the lungs more quickly. therefore, the higher response in hiv - positive patients could be due to the accumulated responses to multiple epitopes, whereas the responses in healthy blood donors may be limited to immunodominant epitopes. an alternative explanation may be that the elevated levels of reactivity seen in hiv - positive serum are specific for the igg isotypes and that the elevated levels of the isotype profile of msg - specific antibodies may be skewed in healthy persons and hiv - positive patients. this study shows that pcp - positive patients have higher antibodies to msgc than pcp - negative patients by all elisa methods. furthermore, nine hiv patients in whom pcp developed after their serum specimens had been obtained and who did not have antibodies to msgc by western blot (27) had lower levels of antibodies to msgc in this study. overall, a hierarchy appeared to exist in the level of serum antibodies to msgc by elisa : highest in pcp - positive patients, next highest in pcp - negative patients, and lowest in blood donors. humoral immunity has long been thought to have little role in host defenses against pneumocystis because pcp develops in many patients despite preexisting antibodies to the organism (8). yet considerable evidence, mainly from animal models, now suggests that b cells contribute to these host defenses (2). also of interest is that some serologic studies have shown decreased antibody levels or production before a person acquires pcp or increased antibody levels after a patient recovers from pcp (6,8,23,2934). our data suggest that analysis of the immune reactivity to msg fragments, msgc in particular, may be important in understanding differences between patient populations and may lead to identifying epitopes linked to protection from or susceptibility to pcp in populations at risk. | seroepidemiologic studies of pneumocystis pneumonia (pcp) in humans have been limited by inadequate reagents. we have developed an enzyme - linked immunosorbent assay (elisa) using three overlapping recombinant fragments of the human pneumocystis major surface glycoprotein (msga, msgb, and msgc) for analysis of antibody responses in hiv - positive patients and healthy blood donors. hiv - positive patients had significantly higher antibody levels to all msg fragments. furthermore, hiv - positive patients who experienced a previous episode of pcp (pcp - positive) had higher level of antibodies to msgc than patients who never had pcp. a significant association was found between elisa antibody level and reactivity by western blot in hiv - positive patients, especially those who were pcp - positive. thus, this elisa will be useful in studying serum antibody responses to pneumocystis in different human populations. |
within the last few decades the concept of good health has moved from the absence of disease or illness to a more positive concept which embraces the subjective experience of well being and quality of life (1), a quality of life perspective can identify sensitive adults issues that may be affected by illness or disability of treatment (2, 3). definition of quality of life : the term qol (quality of life), health and functional status are not interchangeable, nor are the instruments used to assess them (4, 5). who definition of health : a state of complete physical, mental, social well being, not merely absence of disease or infirmity (6). quality of life has emerged as an important concept and outcome in health and health care (7). in public health and in medicine, the concept of health- related quality of life refers to a person or groups perceived physical and mental health over time. physicians have often used health - related quality of life to measure the effect of chronic illness in their patients in order to better understand how an illness interferes with a person 's day - to - day life. similarly, public health professionals use health - related quality of life to measure the effects of numerous disorders, short and long - term disabilities, and disease in different populations. tracking health - related quality of life in different populations can identify subgroups with poor physical or mental health and can help guide policies or interventions to improve their health (8). who definition of qol (1993) : individual perception of their position in life in the context of culture and value systems in which they live and in relation to their goals, expectations, standards and concerns (9, 10). assessment of qol can help the physicians in better understanding the results of their treatment not only in dimension of physical well being but also in spirit of treatment or qol. during the past two decades, psychological status and quality of life of one very important clinical research and is emphasized as one of the aspects of effective patient care and has used its review of the existing differences between patients diagnosed, forecast consequences of disease treatment interventions and evaluation (11), has been on for a goal to improve the daily functioning and quality of life in patients with chronic diseases (12). a peptic ulcer is a breach in the gastric or duodenal mucosa down to the sub mucosa. worldwide, the two most common causes of peptic ulceration are helicobacter pylori infection and non - steroidal anti - inflammatory drugs (nsaids), including aspirin ibuprofen, naproxen, smoking cigarettes or using tobacco (13, 14). the lifetime risk for developing a peptic ulcer is approximately 10% (15). before the twentieth century, gastric ulceration constituted the bulk of peptic ulcer disease and duodenal ulcers were quite rare (16), the incidence of duodenal ulcers increased progressively, reaching a peak in the 1950s. the cause of this rise is unclear, because h. pylori are thought to have been ubiquitous in the human population for thousands of years (16). the present investigation was conducted to survey quality of life in peptic ulcer patients referring to al - zahra hospital affiliated to isfahan university of medical sciences. this was a cross - sectional survey performed during 2010 in isfahan city, iran. the population under study consisted of 93 patients referred to al - zahra hospital affiliated to isfahan university of medical sciences who recruited randomly. data gathering was done with standard questionnaire (demographic data and information about quality of life) ; they were ranked according to lickhert classification. data gathering was done via standard questionnaire including five domains : physical, psychological, social, behavioral and economical. reliability was confirmed by krunbach alpha test with 95% confidence interval (= 0.86). lickhert classification of 0 to 4 was used for each question and total score was between 0 and 100 : scores less than 33 for poor quality of life, scores 33 - 63 for relatively good quality of life status and scores more than 66 for favorable quality of life. data analysis was done with spss15 software using anova, t - test and pearson correlation test. 93 patients with mean age of 38.54 years, including 43 (46.2%) women and 54 (53.8%) men, were studied. among the participant, 60.2% were 30 - 60 years, 67.7% married, 53% had disease duration of 1 - 5 years, 69.9% non smoker, and 19.4% had history of smoking between 1 and 5 years. the majority of participants in this study (69.9%) evaluated their current quality of life as relatively good (table 1). frequency distribution of quality of life status in various domains of studied patients there was a negative significant between quality of life and age (p = 0.001, r = 0.28), and between disease duration and psychological (p < 0.05, r = 0.23), economical (p < 0.05, r = 0.24) domains and between and also between the mean of qol scores in physical (p < 0.001,r =.39) and social (p < 0.001, r =.39) domains with the number of cigarette per day (table 2), also there was significant relation between social domain and gender (p < 0.05), and physical(p < 0.05), psychological (p < 0.05)and behavioral (p < 0.001) domains with marital status (table 3). also, physical (p = 0.001), social (p < 0.05) domains with smoking. also there was a negative significant between physical (p < 0.001, r = 0.39), social (p = 0.001, r = 0.33) and behavioral (p < 0.05, r = 0.23) domains with years of smoking (table 3). pearson test 's correlation coefficients (r) between quality of life domains and age, disease duration, years of smoking and number of cigarette per day in studied patients mean and standard deviation of quality of life domains scores in studied patients this study was conducted to determine the relationship between individual characteristics of patients and quality of life. this finding is consistent with the results of studies verma, shojaei and colleagues (17, 18) but inconsistent with the results of studies zboralski, entezari and colleagues and tabari and colleagues (1921). the results of present study showed that, there was a negative significant between quality of life and age (p = 0.001, r = 0.28), on the other hand reduced quality of life of patients with increasing age. in studies done by entezari and colleagues and shojaei and colleagues, there is a significant relationship between quality of life with age (18, 20). in the present study, there was significant relation between social domain and gender (p < 0.05), quality of life is higher in women than men, which conform to the results of study shojaei and colleagues (18). also there was significant relation between social domain and gender (p < 0.05), and physical (p < 0.05), psychological (p < 0.05) and behavioral (p < 0.001) domains with marital status. in the physical domain, singles has a better quality of life, and in the psychological domain, married participants have better quality of life, perhaps receive more support from their family. this finding is consistent with the results of study shojaei and colleagues (18) but inconsistent with the results of study entezari and colleagues (20). there was a negative significant between disease duration and psychological (p < 0.05, r = 0.23), economical (p < 0.05, r = 0.24) domains. perhaps, affect stress and anxiety and costs resulting from long - term illness on quality of life in patients that consistent with the results of study shojaei and colleagues (18).also there was significant relation between physical (p = 0.001), social(p < 0.05) domains with smoking. in other words, quality of life is worse in smokers in physical and social domain. there was a negative significant between quality of life and between the mean of qol scores in physical (p < 0.001, r =.39) and social (p < 0.001, r =.39) domains with the number of cigarette per day, and between physical (p < 0.001, r = 0.39), social (p = 0.001, r = 0.33) and behavioral (p < 0.05, r = 0.23) domains with years of smoking. our findings showed the necessity of determining the usefulness of different methods and implementation of appropriate training program for patients suffering from peptic ulcer, in order to improve their quality of life, promote level of health, alleviate anxiety, reduce complications, cut expenses and decrease mortality. also, we know that health and quality of life are vital social reflections. the way a society distributes resources amongst its population tells us a great deal about the society itself. this unique volume unites readings that explore the integral link between quality of life and public policy choices. we suggest education on disease related factors, techniques for patients education in hospital wards, improvement of effect and applicability of educational programs content, by using, health education and medical students, residents, nurses and by improving their skills and capabilities regarding their communication with the patients. based on the results it is suggested to increase financial help and social support for vulnerable patients in a serious way socially and economically screening of the society is recommended. | aimthe purpose of this study was to determine quality of life in peptic ulcer patients referring to al - zahra hospital of isfahan.backgroundpeptic ulcer disease (pud) is one of the most prevalent diseases. its prevalence is 6 - 15% and about 10% of people experience its symptom in their life. pud can have a considerable impact on patients quality of life (qol).patients and methodsthis descriptive- analytic survey was done on 93 randomly patients referred to al - zahra hospital of isfahan city in iran. data gathering was done via questionnaire including five domains : physical, psychological, social, behavioral and economical. for data analysis, t - test, pearson correlation and anova test were used.results93 patients with mean age of 38.54 years, including 43 (46.2%) women and 54 (53.8%) men, were studied. there was a negative significant between quality of life and age and between disease duration and psychological, economical domains and between the mean of qol scores in physical and social domains with the number of cigarette per day, also there was significant relation between social domain and gender, and physical, psychological and behavioral domains with marital status ; physical, social domains with smoking. also there was a negative significant between physical, social and behavioral domains with years of smoking.conclusionstudy results showed that quality of life is in a relatively good level among patients, thus some diseases such as peptic ulcer can effect on quality of life. so, treatment and prevention of these diseases may improve their quality of life. |
dna damage response pathways have been evolved to maintain the genomic integrity of organisms as well as to counter serious assaults on genomic stability. errors made by the dna replication machinery can cause genomic instability and contribute significantly to the onset of cancer. several pathological diseases are linked with aberrant dna replication through several dna mutations and chromosome rearrangements. moreover, faithful transfer of genetic information during replication can be impaired by several environmental and cellular factors like replication stress, reactive oxygen species (ros), reactive nitrogen species (rns), and exposure to uv or ionizing radiation. highly transcribed dna sequences, several secondary dna structures, and modified / damaged dna stall replication forks. to prevent the deleterious effects of dna damage, several checkpoint responses are activated following the damage. the checkpoint response can repair the damaged dna prior to the next round of cell division or it can signal the cell to undergo apoptosis. dna can be damaged by the introduction of single - strand breaks (ssbs) and/or double - strand breaks (dsbs) and/or formation of dna adducts (crosslinking of individual purine or pyrimidine bases). dna damage sensors and repair proteins act promptly to remove these lesions in a timely manner so that the genome is protected from permanent mutations. eukaryotic cells have developed several repair pathways in order to maintain genomic stability and integrity. the major repair pathways are mismatch repair (mmr), nucleotide excision repair (ner), base excision repair (ber), homologous recombination (hr), nonhomologous end joining (nhej), and translesion synthesis (tls). the scope and role of protein phosphorylation is well established in the dna repair pathways, but the role of protein ubiquitination has recently been reported as a key regulatory mechanism that influences almost all aspects of the dna repair pathways. ubiquitin, a highly conserved, 76-aminoacid protein is commonly used by cells for proteasome - mediated protein degradation. however, its proteasome - independent functions help in the regulation of dna repair mechanisms. ubiquitination regulates the activities of the atp - dependent, ubiquitin - activating enzyme (e1), ubiquitin - conjugating enzyme (e2), and ubiquitin ligase (e3) [4, 5 ]. however, this can be reversed by a family of enzymes known as the deubiquitinating enzymes (dubs) [6, 7 ]. monoubiquitination is an addition of a single ubiquitin molecule to the substrate and is involved in a wide variety of cellular functions. it ranges from control of endocytosis, and intravesicular transport to transcriptional regulation (ubiquitination of histone h2a on lysine 119 is required for polycomb group gene silencing and x - chromosome inactivation) [9, and references therein ], dna replication, and repair. the activity of the mammalian origin recognition complex (orc) is regulated by cell - cycle - dependent changes in its orc1 subunit. modification of orc1 in the form of monoubiquitination and phosphorylation during s and g2-m phases is essential for mammalian development. in the absence of these modifications, p53-independent polyubiquitination or the ability of ubiquitin molecules to form a polymeric chain adds another layer of complexity to ubiquitin - mediated signaling. all the seven lysine residues of ubiquitin can act as initiators of ubiquitin polymeric chains. in addition, the amino terminus of ubiquitin also acts as an acceptor for the formation of polymeric ubiquitin chains. as the lysine residues are distributed over the surface of the ubiquitin molecule, chains of different linkage produce different geometries and thus result in generation of structurally distinct signals with unique consequences for the modified substrate. in this paper, we will highlight the role of ubiquitination in major repair pathways : the repair mechanism after dsbs is mediated by polyubiquitination, the repair of dna adducts by nucleotide excision repair pathway, and the fanconi anemia (fa) pathway. repair of interstrand crosslinks (icls) during dna replication is mediated by monoubiquitination, and dna damage tolerance for replicative lesion bypasses by both monoubiquitination and polyubiquitination. we will also discuss the role of ubiquitin ligases in the regulation of checkpoint functions, functions of deubiquitinating enzymes, and finally the possibilities of the ubiquitin signaling mechanism as a therapeutic target for cancer. this results in replication fork stalling, and activation of the checkpoint kinase ataxia telangiectasia and rad3-related (atr). once a replication fork stalls, repair pathways are activated to allow re - initiation of replication. collapse of replication forks also triggers a checkpoint response that results in cell cycle arrest, dna repair, or cell death through apoptosis. the collapse of forks can be avoided by bypassing the lesions in a process known as translesion synthesis or tls [18, 19 ]. a growing class of dna polymerases designated alphabetically to have recently been reported to be involved in repairing damage - induced replication stress [20, 21 ]. these special polymerases, also known as translesion polymerases, have flexible base - pairing properties and hence permit translesion synthesis by temporarily taking over from the blocked replicative dna polymerase-/ and pol. since the translesion polymerases have low fidelity, they are responsible for introducing several point mutations in the genome, leading to permanent damage and onset of carcinogenesis. in yeast (s. cerevisiae), a second pathway exists that ensures error - free bypass of dna damage or lesions. this mechanism involves reinitiation of replication downstream of the lesion with the resultant gap filled in by recombination replication using the newly synthesized complementary strand. yeast protein complexes, like ubc13/mms2, are involved in this process, and are conserved all the way to mammals. interstrand dna crosslinks (icls) are extremely toxic dna lesions and are particularly deleterious for the cell as they prevent the separation of dna strands required for both replication and transcription. the repair of icl is mediated by a group of factors that belong to the fa pathway. during dna replication, monoubiquitination of two components of the fa pathway, fancd2 and fanci, triggers or activates icl repair. double - strand breaks (dsbs) in the double helix during dna replication are particularly hazardous to cells because they can obstruct replication fork progression and result in genome rearrangements. the damage response to a dsb involves complex ubiquitin - mediated signaling events that lead to the recruitment of modified proteins at the site of damage as detailed later in this paper. the ubiquitin system mediates the dna damage response to all the above forms of replicative damage in the cell in order to prevent genomic instability and onset of cancer. another common form of dna damage that interferes with the replication fork progression is the chemical modification (adducts) of dna bases that occur due to interaction with chemically reactive drugs or exposure to uv or ionizing radiation. small adducts can be identified and removed by base excision repair (ber) pathway, whereas the bulky ones are removed by nucleotide excision repair (ner) pathway. it is a high fidelity dna repair mechanism that occurs during repair of oxidative dna lesion in the genome. recently it was reported that ber is regulated by breast cancer susceptibility gene 1 (brca1), which is a tumor suppressor for the hormone - responsive cancers like breast, prostate, and ovarian cancer. brca1 upregulates the key enzymes of the ber pathway such as ogg1, nth1, and ref1 via the oct1 transcription factor to stimulate the process during oxidative stress [23, 24 ]. the cellular machinery responsible for dna damage surveillance and subsequent repair has the unique property of sensing modification of the dna and then arresting the cells at specific cell cycle checkpoints. this allows repair of damaged dna in order to avoid their transformation into permanent damage or mutations. dna damage checkpoints occur at the g1/s and g2/m boundaries as well as to an intra - s checkpoint during the cell cycle. structural modification of the chromatin and the dna double - strand breaks are the substrates of atm [26, 27 ], while atr is primarily recruited in the stalled replication forks. a class of checkpoint mediator proteins including brca1, mdc1, and 53bp1 has been identified and will be discussed in this paper. the utmost posttranslational modifications implicated in the regulation of checkpoint activation are phosphorylation and ubiquitination [29, 30 ]. the dna damage checkpoint activation ensures arresting or slowing down of the cell cycle, so that the cell has adequate time to either repair the lesions before entering the next cell division cycle or undergo apoptosis. in mammalian cells, the atm - chk2 and atr - chk1 kinase - pathways play key roles in signaling checkpoint arrest. the cyclin - dependent kinases (cdks) are the prime targets of the checkpoint pathways, but they are not targeted by the checkpoint kinases atm or chk1. the checkpoint apparatus targets the cdk regulators like cyclins, cdk inhibitors, or cdc25 family of dual - specificity phosphatases, depending upon the stage of the cell cycle in which the dna damage has occurred. two types of ubiquitin ligases the scf (skp1/cul1/f - box) and the apc / c play central roles in cell cycle regulation. the phosphatase cdc25a is degraded by the ubiquitin - proteasome machinery [32, 33 ] in response to dna damage, resulting in cdk inhibition and cell cycle arrest. chk1/chk2-mediated phosphorylation of cdc25a results in recognition of phosphorylated cdc25a by scf, leading to the degradation of cdc25a [34, 35 ]. scf also regulates checkpoint recovery : the ubiquitin - dependent degradation of claspin (a dna - binding protein required for the atr mediated activation of chk1 in response to dna replication stress) in g2 allows efficient termination of dna replication checkpoint which is necessary for progression of the cell into mitosis [3639 ]. the e3 ubiquitin ligase apc / c which is active during m and g1 phases of the cell cycle, helps in the formation of polyubiquitin chains on substrates for subsequent degradation [40, 41 ]. apc / c either associates with subunit cdc20 to form apc / c that mediates its proteasomal degradation during g1 or associates with subunit cdh1 to form apc / c, which functions during the g2/m phase of the cell cycle. during g1 phase of the cell cycle, apc takes part in a p53-independent checkpoint response that targets the degradation of cyclin d1. during g2/m checkpoint, dna damage triggers the activation of apc, which is mediated by an atm - independent repair mechanism. upon checkpoint activation, phosphatase cdc14b is translocated from the nucleus to the nucleoplasm, resulting in dephosphorylation of cdh1. interstrand crosslinks (icls) are known to prevent strand separation during both transcription and replication, and its repair is collectively mediated by several dna repair proteins known as the fanconi anaemia (fa) pathway. in addition to removal of the lesion, the fa pathway is also responsible for sensing the icls and thereafter triggering an appropriate atr - dependent checkpoint response. monoubiquitination of two fa components by other members of the pathway leads to the activation of icl repair during dna replication. dna interstrand cross links are recognized by a protein complex comprising fancm, fa - associated protein 24 (faap-24), and dna - binding histone fold proteins mhf1 and mhf2 as shown in figure 1. this recognition complex then recruits the fa core complex (comprising fanca, b, c, e, f, g, l, and faap-100) onto the site of the dna lesion. fancl is the catalytic subunit of the core complex and interacts with the e2 conjugating enzyme (ube2 t) to ubiquitinate fancd2 and fanci, which are then recruited to the damaged chromatin. monoubiquitination of the fancd2 protein takes place at lysine 561 and is conserved among eukaryotes, suggesting the evolutionary significance of this particular gene. a mutation in lysine 561 affecting the monoubiquitination of this protein fails to complement the dna crosslinking activity of fancd2-deficient cells [43, 44 ]. monoubiquitinated fancd2 appears to colocalize with other components that are recruited to the site of dna repair including brca1, brca2, rad51, pcna, and rev1 suggesting a functional connection between the fa pathway and the homologous recombination and tls pathways [4547 ]. as a result, the presence of fancd2 at the dna damage foci depends upon its ubiquitination at k561, demonstrating the importance of monoubiquitinated form of fancd2 as a targeting signal to the sites of dna damage. fanci (mutated in fa - i patients) also undergoes monoubiquitination and this modification is critical for repair of dna crosslink damage. the current understanding is that, in the absence of dna damage, fancd2 and fanci are present as free entities. dna damage triggers the fa pathway thus modifying fancd2 and fanci by monoubiquitination and phosphorylation. special receptors at the sites of dna damage recognize these modified substrates and target them to the dna repair foci. the breast and ovarian cancer susceptibility protein brca1 also plays a significant role in the fa pathway. a conserved ring domain in brca1 forms a heterodimer with the ring domain of another protein bard1. the brca1-bard1 complex monoubiquitinates fancd2 in vitro. the formation of the fancd2 repair foci is severely impaired by depletion of brca1, but the specific role of brca1 in fancd2 monoubiquitination is still unclear. monoubiquitinated fancd2 interacts with the downstream repair proteins brca2/fancd1 and possibly fancj and fancn to repair the dna crosslinks and other lesions by homologous recombination. in addition to the monoubiquitination of fancd2, deubiquitination of fancd2 by deubiquitination enzyme usp1 is known to be required for icl repair. an usp1 knockout mouse showed an increased chromatin localization of monoubiquitinated fancd2 without proper assembly of fancd2 repair foci and subsequent defects in homologous recombination. deficiency of usp1 or fancd2 promotes haematopoietic stem cells defects, and sirna knockdown experiments have shown that usp1 also deubiquitinates fanci, but whether this step is indispensable for icl repair needs to be ascertained. the sliding clamp of dna replication, also known as the proliferative cell nuclear antigen (pcna), plays a leading role in the regulation of replicative lesion bypass (reviewed in). monoubiquitination of pcna is mediated by the e2 ubiquitin - conjugating enzyme rad6 and the rad18 ring finger - containing e3-ubiquitin ligase [52, 53 ]. monoubiquitination of pcna at a stalled replication fork leads to the recruitment of several damage - tolerant dna polymerases at the site of damage [5355 ]. these enzymes use the damaged dna as a template for translesion synthesis and their actions on different lesions lead to mutagenesis as the translesion polymerases have exceptionally low fidelity. polyubiquitination of pcna, mediated by the combined action of rad6, rad18, and rad5 ubiquitin ligases, promotes an alternative error - free pathway of bypassing the damage. recent studies have shown that monoubiquitinated - pcna is deubiquitinated by the deubiquitinating enzyme usp1. sirna knockdown of usp1 results in increased levels of monoubiquitinated - pcna both in the presence and absence of dna damage. therefore, usp1 seems to regulate the error - prone translesion synthesis activity in the cell in the absence of uv - induced dna damage. the dna damage response following a dsb triggers a series of ubiquitination enzymes that lead to checkpoint activation. signaling at the dsb depends mainly on the multifunctional e3 enzyme (brca1). recruitment of brca1 to the site of damage is mediated by a series of ubiquitination events that are initiated by ring finger protein 8 (rnf8) in complex with the e2 ubiquitin - conjugating enzyme 13 (ubc13) [5760 ]. protein kinases atm and atr activate signaling cascades that recruit repair proteins to the sites of dna damage. the atm protein kinase is activated and recruited at the site of dsbs through the mre11-rad50-nbs1 or the mrn sensor complex (reviewed in), and then it phosphorylates several proteins such as h2ax. phosphorylated h2ax recruits the atm substrate, mdc1, and finally leads to the recruitment of the repair machinery at the site of damage. the ring finger protein rnf8, in conjugation with its e2 enzyme ubc13, ubiquitinylates h2ax and h2a thus leading to recruitment of proper effector complexes like abraxas - brca1-brcc36 complex at the sites where the repair foci are formed, as shown in figure 2. brca1 is recruited to the dna damage sites through the ubiquitin - interaction - motif-(uim-) containing protein rap 80 and is associated with the brca1-binding protein abraxas [6467 ]. although there are reports of formation of functional complex between brca1 and h2ax, it is still unclear if polyubiquitination of h2ax and h2a is essential for recruitment of brca1 or rap 80, or if the polyubiquitination of the h2ax and h2a is a consequence of rnf8 recruitment. depletion of rnf8 leads to a failure in assembling the different components at the sites of damage. thus, rnf8 may serve as the leading player responsible for orchestrating the events associated with damage at the double - strand break. also, cells lacking the rnf8-e2 ubiquitin conjugating enzyme, ubc13, fail to establish a proper dna damage response. in addition, loss of ubc13 decreases h2ax monoubiquitination and reduces damage - triggered h2ax polyubiquitination. finally, once the repair process is completed through the function of the ubiquitin - mediated signaling complex initiated by rnf8, deubiquitinating enzymes (dubs) remove or edit most of the polyubiquitin chains to disassemble the repair complexes after the double - strand break repair is completed. the bulky dna adducts that are introduced by exposure to several chemical compounds or uv radiation are recognized and removed by the ner pathway. these helix - distorting damages include the uv - induced cyclobutane pyrimidine dimers and pyrimidine - pyrimidone (6 - 4) photoproducts (6 - 4pp). defective ner activity gives rise to some rare autosomal - recessive disorders in humans such as xeroderma pigmentosum (xp) and the cockayne syndrome (cs). in the ner pathway, thirty different proteins function together for detection of the dna lesion, opening of the helix, incision on the damaged dna strand, removal of the lesion - containing dna strand, dna synthesis for gap - filling, and finally dna ligation. ner operates in two pathways : the first pathway repairs damages across the entire genome known as global genome repair (ggr), and the second pathway is known as transcription - coupled repair (tcr), which is linked to dynamic transcription and is aimed at the transcribed strand of active genes. xeroderma pigmentosum (xp) is an inheritable genetic disorder where patients become extremely susceptible to ultraviolet exposure and have a predisposition to skin cancer. based on complementation studies involving uv sensitivity of fused cells, xp was classified in 7 subgroups xp - a to xp - g. a uv - damaged dna - binding component ddb (composed of subunits ddb1 and ddb2) is responsible for the inability of these cells to bind damaged dna. ddb recognizes the dna damage for ggr and recruits repair factors like xpc - hr23 [71, 72 ] to the sites of damage. in cs, patients are also hypersensitive to sunlight and show signs of premature ageing. cs is caused by mutations in the csa or csb genes, and this leads to defects in tcr. the ddb2 and csa proteins occur in large complexes (ddb - ligase complex) inside the cell that represents ubiquitin - ligase subunits cul4a (cullin-4a), roc1, and cop9 signalosome (csn), which is the negative regulator of cullin - based ubiquitin ligases. upon damage by uv, the ddb ligase complex translocates to the site of the dna lesion resulting in its dissociation from the csn following neddylation. polyubiquitinated xpc binds dna for repair activity whereas polyubiquitinated ddb is targeted for proteasomal degradation. ubiquitination, like many other posttranslational modifications, is a dynamic and reversible process that depends on dubs. the human genome encodes about 100 dubs that are involved in processing of ubiquitin precursors and removal of ubiquitin or polyubiquitin from the target proteins. dubs are divided into five families based on their mechanism of action and phylogeny (reviewed in). the first four families are papain - like cysteine proteases that include the ubiquitin - specific proteases (usps), ubiquitin c - terminal hydrolases (uchs), the ovarian tumor proteases (otus), and the josephins. the dubs are highly diverse in their structure and enzymatic activities and have a high degree of specificity for their substrates. the catalytic core domain of dubs is responsible for the recognition and positioning of the enzyme on the ubiquitin substrates [75, 76 ]. in addition to the catalytic core domain, dubs have ubiquitin - binding domains and protein - protein interaction domains that help in dub function. according to available literature, there are seven dubs that are involved in opposing the function of e3 ubiquitin ligases. as illustrated in previous sections, pcna and fancd2/fanci ubiquitination usp1 seems to have functional importance in the pcna - dependent postreplicative repair pathways as usp1 helps in relocalization of the translesion polymerase pol in uv - induced foci, and depletion of usp1 causes an increase in spontaneous and damage - induced mutagenesis. however, in fa pathway, disruption of usp1 gene causes accumulation of the monoubiquitinated forms of fancd2/fanci but increases icl hypersensitivity and genomic instability [49, 77 ]. therefore, these activities of the dubs ensure that the process of ubiquitination is a dynamic, reversible process that is optimally regulated in the cell. ubiquitination has emerged as a key regulatory mechanism in dna repair pathways and a powerful means for pharmacological intervention. studies have shown how crucial dna repair pathways are regulated by ubiquitin - dependent modifications. thus, the different players including the e2 and e3 enzymes, the deubiquitinating enzymes (dubs), and the proteins harboring the ubiquitin interacting motif (uim) are all critical in recruitment and assembly of the repair complexes at the site of dna damage. therefore, in all likelihood, these posttranslational processes might provide attractive cancer therapeutic targets that inhibit the dna repair pathways causing malignancies in the cell. the recent discovery that rnf8 plays a key role in ubiquitin - regulated double - strand break repair makes rnf8 an attractive target for new drugs. thus, inhibitors to any ubiquitinated proteins that help in genome maintenance and repair are predicted to be potent antiproliferative agents. discovery of such agents will open up new avenues for the treatment of cancer. during times of cellular stress, the ubiquitin molecule, which is not produced in excess, could be limiting. in yeast and mammalian cells, the proteasome machinery is known to recycle the ubiquitin that is associated or conjugated to protein substrates that are condemned to be degraded. the deubiquitinating enzymes are capable of recycling the ubiquitin back to its monomeric form [7880 ]. the proteasome inhibitor, bortezomib, can prevent both ubiquitin - mediated degradation and recycling of ubiquitin to monomeric forms thus causing a decrease in the monomeric ubiquitin pool. therefore, by depleting the pool of free ubiquitin, bortezomib can indirectly inhibit the dna damage response and repair pathways, which could eventually lead to tumorigenesis. studies have shown that cop1, an e3-ubiquitin ligase, is overexpressed in human hepatocellular carcinoma (hcc). a recent report has shown how sirna - mediated knockdown of cop1 could slow down growth and induce apoptosis in hcc cells. systemic suppression of cop1 in a xenotropic mouse model resulted in inhibition of hcc cell growth, thus making cop1 a therapeutic target in hcc. much attention is being given lately to the cullin - regulated ligases (crls) which include ligases such as scf complexes as these could be potential targets for chemotherapy. a specific inhibitor, mln4924, of nedd8 activating enzyme e1, had been developed, which inhibits the entire crl subfamily [85, 86 ]. mln4924 demonstrates significant antitumor activity in vivo in mice having human tumor xenografts at concentrations which are well tolerated. so, nedd - activating enzyme inhibitors seem to have an enormous potential for treatment of cancer. the dub family of enzymes could also hold promise for chemotherapy, as they have well - defined catalytic pockets, which make screening with small molecule inhibitors easy. inhibitors of the ubiquitin carboxy - terminal hydrolase (uch) family of dubs have been reported with a decent amount of affinity and selectivity [87, 88 ]. inhibitors of the sars coronavirus dub plpro have been developed by screening a structurally diverse library of more than 50,000 compounds. the discovery of this potent antivirus against sars - cov suggests that such drugs can be developed against the pathogenic dubs such as sars cov dub plpro, without affecting the host dubs. the ubiquitin system not only senses the dna damages but also repairs the damages in a highly regulated manner. the specificity of the e2-ubiquitin conjugating enzymes, the e3 ligases, and the dubs with specific domains ensure that these activities are highly integrated and regulated. similarly, several details of the fa pathway and the dna damage bypass pathways are still being worked out. targeting the usps, sumoylation, and neddylation pathways, as well as exploring the effects of deubiquination enzyme inhibitors, offers significant promise in the treatment of hematologic and solid malignancies. | faithful transmission of genetic information through generations ensures genomic stability and integrity. however, genetic alterations occur every now and then during the course of genome duplication. in order to repair these genetic defects and lesions, nature has devised several repair pathways which function promptly to prevent the cell from accumulating permanent mutations. these repair mechanisms seem to be significantly impacted by posttranslational modifications of proteins like phosphorylation and ubiquitination. protein ubiquitination is emerging as a critical regulatory mechanism of dna damage response. non - proteolytic, proteasome - independent functions of ubiquitin involving monoubiquitination and polyubiquitination of dna repair proteins contribute significantly to the signaling of dna repair pathways. in this paper, we will particularly highlight the work on ubiquitin - mediated signaling in the repair processes involving the fanconi anemia pathway, translesional synthesis, nucleotide excision repair, and repair of double - strand breaks. we will also discuss the role of ubiquitin ligases in regulating checkpoint mechanisms, the role of deubiquitinating enzymes, and the growing possibilities of therapeutic intervention in this ubiquitin - conjugation system. |
cyclic vomiting syndrome (cvs) is a relatively rare disorder characterized by recurrent episodes of severe nausea and vomiting interspersed with symptom free periods. cvs remains as a clinical diagnosis which is based on three main criteria : stereotypical episodes of vomiting regarding acute onset and duration (1 week) has been found in some adult patients with cyclic vomiting syndrome.12 differential diagnosis of cvs is very broad and it is important to exclude other gastrointestinal disorders and extra - intestinal disorders, including metabolic and central nervous system diseases, renal disorders, and psychogenic vomiting. the extent of diagnostic evaluation and the role for the use of empiric therapy for migraine in patients with cvs remains undefined. diagnostic approach to exclude other disorders with recurrent vomiting includes biochemical testing for electrolyte abnormalities, serum calcium, thyroid function tests and liver function tests. an upper gi series with small bowel follow - through x - ray, ct / mri of the head, and endoscopy can be performed in between episodes.7,8,13 because the vomiting attacks only occurred at the onset of menstruation, we suspected dysmenorrhea as a cause of symptoms. but, neither the typical manifestations of dysmenorrhea were identified nor the treatment for it controlled the symptoms. gastric emptying scintiscans have been investigated in adult patients with cvs, primarily during asymptomatic periods in between emetic episodes. rapid gastric emptying at baseline, which may be related to autonomic dysfunction, or delayed gastric emptying during episodes have been demonstrated in adults with cvs.14,15 in our case, gastroparesis was initially considered as a cause of frequent vomiting episodes. but, trials with prokinetics including erythromycin, mosapride and antiemetics did not affect the duration and severity of symptom episode. moreover, on - off symptom pattern with intervals of complete normality in between menstruation suggests uncertain association between vomiting episodes and gastroparesis. however, several empiric treatments have been effective in case series.16 life style changes, abortive treatment, prophylactic therapy, and supportive care to ameliorate acute episodes are efficient treatments. diabetes should be managed with strict glucose control and episodes of hypoglycemia should be avoided. treatments during the emetic phase consist of hydration, antiemetic, antianxiety and/or analgesic medications. a constant intravenous infusion of 5-ht3 antagonist, ondansetron, has shown an efficacy of about 60% if given early in the vomiting attack.17 if nausea persists, addition of lorazepam provides sedation that may lessen intractable nausea in some cases.11 in our case, repeated injections of lorazepam during the emetic phase reduced both nausea and vomiting. some studies have investigated the drug therapy in preventing episodes of cvs and only a small number of maintenance therapies have so far been reported to be effective. low - dose tricyclic antidepressants, sumatriptan, and beta blockers (e.g., propranolol) have been found to be effective in prevention of episodes.1,18 if psychiatric disorder is present, it should also be treated. if menstrual cycles trigger an attack, gnrha injections or continuous birth control to block menses should be considered. although low - dose estrogen oral contraceptives could help to prevent the vomiting attack in patients with menstruation - related cvs,11 oral contraceptives can also exacerbate symptoms on the other hand.16,19 administration of gnrha down - regulates the pituitary - ovarian gonadal axis and reduces levels of the gonadotropin, luteinizing hormone and follicle - stimulating hormone.20 gnrha suppresses ovulation and is found to have benefits in the treatment of premenstrual syndrome. however, maximum treatment period is 6 months, and hormone replacement therapy has to be given to prevent side effects.21 we chose gnrha and estrogen replacement therapy as the prophylactic therapeutic modality due to its efficacy in preventing vomiting attack and a relatively short period of courses of therapy (e.g., 3 months). in conclusion, careful understanding of the history, symptom pattern and triggering factors should be obtained in patients with recurrent vomiting attacks. for women with menstruation - related cvs, we suggest that gnrha is an effective therapeutic modality for preventing symptom episode. | cyclic vomiting syndrome (cvs) is a disorder characterized by recurrent episodes of incapacitating nausea and vomiting interspersed with symptom free periods. common triggers of cyclic vomiting include noxious stress, excitement, fatigue and menstrual period. here, we report a case of cyclic vomiting syndrome in adult patient characterized by stereotypical vomiting attack, occurring in every menstruation period. recurrent vomiting episodes began 6 years ago and we treated this patient with subcutaneous injection of goserelin, a gonadotropin - releasing hormone analogue (gnrha) and oral estrogen. after 4 months of therapy, she was symptom free for the following 5 years, even with the resumed normal menstruation. recurrence of vomiting attack with same pattern occurred 1 month before readmission. treatment with intravenous lorazepam aborted vomiting, but could not prevent recurrences of vomiting and epigastric pain. we treated the patient with gnrha and oral estradiol again which effectively prevented recurrence of the symptoms. |
in the 1960s jacobson asked, whether the number fields \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\mathbb q (\sqrt{2})$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\mathbb q (\sqrt{5})$$\end{document } are the only quadratic number fields such that each algebraic integer is the sum of distinct units. liwa solved this problem for quadratic number fields and showed that even no pure cubic number field has this property. these results were extended to cubic and quartic fields by belcher [2, 3 ]. in particular, belcher solved the case of imaginary cubic number fields completely by applying the following criterion, which now bears his name, cf.. let \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$f$$\end{document } be a number field and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\mathfrak o $ $ \end{document } the maximal order of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$f$$\end{document}. assume that the unit equation\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } u+v=2, \qquad u, v\in \mathfrak o ^ \end{aligned}$$\end{document}has a solution \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$(u, v)\ne (1,1)$$\end{document}. then each algebraic integer in \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\mathfrak o $ $ \end{document } is the sum of distinct units. the problem of characterizing all number fields in which every algebraic integer is a sum of distinct units is still unsolved. let us note that this problem is contained in narkiewicz list of open problems in his famous book [9, see page 539, problem 18 ]. recently the interest in the representation of algebraic integers as sums of units arose due to the contribution of jarden and narkiewicz. they showed that in a given number field there does not exist an integer \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$k$$\end{document }, such that every algebraic integer can be written as the sum of at most \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$k$$\end{document } (not necessarily distinct) units. for an overview on this topic we recommend the survey paper due to barroero, frei, and tichy. let an order \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\mathfrak o $ $ \end{document } of a number field and a positive integer \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$k$$\end{document } be given. does each element \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\alpha \in \mathfrak o $ $ \end{document } admit a representation as a linear combination \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\alpha = c_1 \varepsilon _ 1 + \cdots + c_\ell \varepsilon _ \ell $ $ \end{document } of units \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\varepsilon _ 1,\ldots, \varepsilon _ \ell \in \mathfrak o ^$$\end{document } with coefficients \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$c_i\in \{1,\ldots, k\}$$\end{document } ? this problem was attacked by using dynamical methods from the theory of digit expansions. in the present paper in particular, we wish to generalize belcher s criterion in a way to make it applicable to this problem. in order to get the most general form let \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$f$$\end{document } be some field of characteristic 0, \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\vargamma $ $ \end{document } be a finitely generated subgroup of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$f^$$\end{document }, and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$r\subset f$$\end{document } be some subring of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$f$$\end{document}. assume that \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\alpha \in r$$\end{document } can be written as a linear combination1.1\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \alpha = a_1\nu _ 1 + \cdots + a_\ell \nu _ \ell, \end{aligned}$$\end{document}where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\nu _ 1,\ldots, \nu _ \ell \in \vargamma \cap r$$\end{document } are pairwise distinct and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a_1\ge \cdots \ge a_\ell > 0$$\end{document } are integers. if [in case there exists more than one representation of the form (1.1) ] \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a_1$$\end{document } in (1.1) is chosen as small as possible, we call \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\omega _ { r,\vargamma } (\alpha) = a_1$$\end{document } the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$r$$\end{document}-\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\vargamma $ $ \end{document}-unit sum height of\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\alpha $ $ \end{document}. in addition we define \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\omega _ { r,\vargamma } (0):= 0$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\omega _ { r,\vargamma } (\alpha) : = \infty $ $ \end{document } if \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\alpha $ $ \end{document } admits no representation as a finite linear - combination of elements contained in \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\vargamma \cap r$$\end{document}. moreover, we define\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \omega _ \vargamma (r)=\max \{{\omega _ { r,\vargamma } (\alpha) : } \quad { \alpha \in r}\ } \end{aligned}$$\end{document}if the maximum exists. if the maximum does not exist we write\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \omega _ \vargamma (r)= \left\ { \begin{array}{ll } \omega&\quad \text { if}\ ; \omega _ { r,\vargamma } (\alpha) w + 2(w-1)f(w-1) \end{aligned}$$\end{document } holds. each coefficient satisfies \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$b_{k,\ell, \mathbf{x } } \in [\ ! [{ 0},{n-1}]\!]$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \overline{b}_m - \underline{b}_m \le w + 2(w-1)f(w-1) \end{aligned}$$\end{document } holds for all \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$m \in [\ ! [{ 1},{m}]\!]$$\end{document}. there exists an index \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$m$$\end{document } such that \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \overline{b}_m - \underline{b}_m > w + 2(w-1)f(w-1) \end{aligned}$$\end{document } holds. each replacement step \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$$$\end{document } yields an essentially different representation, see d, and there are at most \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$t(w)$$\end{document } possibilities to distribute our new coefficients in an interval \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$[\ ! [{ 0},{k-1}]\!]\times [\ ! [{ 1},{l}]\!]\times b$$\end{document } with\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \overline{b}_m - \underline{b}_m \le w + 2(w-1)f(w-1) \end{aligned}$$\end{document}for each \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$m$$\end{document } with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$1\le m\le m$$\end{document}. therefore after at most \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$t(w)$$\end{document } replacement steps we are either in case 1 or in case 2 of e. \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\square $ $ \end{document } with the setup and notations of e, a possible translation of the indices stays small. more precisely, we have\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \max \left\ { \left|{\underline{a}_m-\underline{b}_m}\right|:\quad { m\in [\ ! [{ 1},{m}]\!]}\right\ } \le t(w) r, \end{aligned}$$\end{document}and\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \max \left\ { \left|{\overline{a}_m-\overline{b}_m}\right|:\quad { m\in [\ ! [{ 1},{m}]\!]}\right\ } \le t(w) r, \end{aligned}$$\end{document}where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$r$$\end{document } is as defined as in (2.1). the quantity \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$r$$\end{document } is the maximum of all exponents in the representation of the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$u_i$$\end{document } as powers of the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${\varepsilon } _ m$$\end{document}. thus, an application of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$$$\end{document } can change the exponents, and therefore the upper and lower bounds, respectively, by at most \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$r$$\end{document}. we have at most \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$t(w)$$\end{document } applications of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$$$\end{document }, so the statement follows. \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\square $ $ \end{document } now we look at the two different cases of e. the first one leads to a result directly, whereas in the second one we have to use the induction hypothesis to get a representation as desired. if we are in case (1) of e, then we are finished. since\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \left|\overline{a}_m - \overline{b}_m\right|\le t(w) r c + 2f(w-1) } } b_{k,\ell, \mathbf{x } } \zeta ^k\eta _ \ell \varvec{\varepsilon } ^\mathbf{x}. \end{aligned}$$\end{document } in case 2 of e we have an index \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$m \in [\ ! [{ 1},{m}]\!]$$\end{document } with\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \overline{b}_m - \underline{b}_m \ge w + 2(w-1)f(w-1) \end{aligned}$$\end{document}the total weight of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\alpha $ $ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$w$$\end{document }, so the representation\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \alpha = \sum _ { k,\ell } \sum _ { \mathbf{x}\in b } b_{k,\ell, \mathbf{x } } \zeta ^k \eta _ \ell \varvec{\varepsilon } ^\mathbf{x }, \end{aligned}$$\end{document}has at most \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$w$$\end{document } non - zero coefficients. therefore, by the pigeon hole principle we can find an interval \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$j$$\end{document } of length at least \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$2f(w-1)$$\end{document } and with the property that all coefficients \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a_{\mathbf{x }, i}$$\end{document } fulfilling \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$x_m \in j$$\end{document } are zero. therefore we can split up \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\alpha $ $ \end{document } as mentioned. \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\square $ $ \end{document } if we have the splitting described in h, then claim 2.3 follows for weight \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$w$$\end{document}. after renaming the intervals and coefficients, we have \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\alpha = \gamma + \delta $ $ \end{document } with\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \gamma = \sum _ { k,\ell } \sum _ { \mathbf{x}\in c } c_{k,\ell, \mathbf{x } } \zeta ^k\eta _ \ell \varvec{\varepsilon } ^\mathbf{x}\end{aligned}$$\end{document}and\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \delta = \sum _ { k,\ell } \sum _ { \mathbf{x}\in d } d_{k,\ell, \mathbf{x } } \zeta ^k\eta _ \ell \varvec{\varepsilon } ^\mathbf{x}. \end{aligned}$$\end{document}both total weights \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$w_\gamma $ $ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$w_\delta $ $ \end{document }, respectively, are smaller than \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$w = w_\alpha $ $ \end{document }, so we can use induction hypothesis : we get representations2.3\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \gamma = \sum _ { k,\ell } \sum _ { \mathbf{x}\in e } e_{k,\ell, \mathbf{x } } \zeta ^k\eta _ \ell \varvec{\varepsilon } ^\mathbf{x}\end{aligned}$$\end{document}with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$e_{k,\ell, \mathbf{x } } \in [\ ! [{ 0},{n-1}]\!]$$\end{document } and2.4\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \delta = \sum _ { k,\ell } \sum _ { \mathbf{x}\in f } f_{k,\ell, \mathbf{x } } \zeta ^k\eta _ \ell \varvec{\varepsilon } ^\mathbf{x}\end{aligned}$$\end{document}with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$f_{k,\ell, \mathbf{x } } \in [\ ! [{ 0},{n-1}]\!]$$\end{document}. the upper and lower bounds of the intervals in \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$c$$\end{document } to \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$e$$\end{document } differ by at most \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$f(w_\gamma) \le f(w-1)$$\end{document } in each coordinate. the same is valid for the intervals of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$d$$\end{document } to \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$f$$\end{document}. since the intervals in \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$c$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$d$$\end{document } were separated by intervals of length at least \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$2f(w-1)$$\end{document }, therefore the intervals in \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$e$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$f$$\end{document } are disjoint. in other words, so we can add these two representations and obtain\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \alpha = \sum _ { k,\ell } \sum _ { \mathbf{x}\in g } g_{k,\ell, \mathbf{x } } \zeta ^k\eta _ \ell \varvec{\varepsilon } ^\mathbf{x}\end{aligned}$$\end{document}with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$g_{k,\ell, \mathbf{x } } \in [\ ! [{ 0},{n-1}]\!]$$\end{document}. we have\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \max \left\ { \left|{\overline{g}_m-\overline{a}_m } \right|:\quad { m\in [\ ! [{ 1},{m}]\!]}\right\ } \quad \le t(w) r+f(w-1) = f(w) \end{aligned}$$\end{document}and\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \max \left\ { \left|{\underline{g}_m-\underline{a}_m}\right|:\quad { m\in [\ ! [{ 1},{m}]\!]}\right\ } \le t(w) r+f(w-1) = f(w), \end{aligned}$$\end{document}which finishes the proof. \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\square $ $ \end{document } let \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a$$\end{document } be an integer and let \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\alpha $ $ \end{document } be a root of the polynomial\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } x^3-(a-1)x^2-(a+2)x-1. \end{aligned}$$\end{document}then the family of real cubic fields \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\mathbb q (\alpha) $ $ \end{document } is called the family of shanks simplest cubic fields. these fields and the orders \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\mathbb z [\alpha ] $ $ \end{document } have been investigated by several authors. in particular, in a recent paper of the second and third author it was shown that the unit sum height of the orders \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\mathbb z [\alpha ] $ $ \end{document } is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$1$$\end{document } in case of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a=0,1,2,3,4,6,13,55$$\end{document } and the unit sum height \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\le 2$$\end{document } in case of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a=5$$\end{document}. moreover, it was conjectured that \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\omega (\mathbb z [\alpha ]) = 1$$\end{document } for all \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a\in \mathbb z $ $ \end{document}. using our main theorem we are able to prove the following result. we have \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\omega (\mathbb z [\alpha ]) \le 2$$\end{document } for all \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a\in \mathbb z $ $ \end{document}. first let us note some important facts on \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\mathbb q (\alpha) $ $ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\mathbb z [\alpha ] $ $ \end{document }, see for example shanks original paper. we know that \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\mathbb q (\alpha) $ $ \end{document } is galois over \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\mathbb q $ $ \end{document } with galois group \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$g=\{\text { i}d, \sigma, \sigma ^2\}$$\end{document } and with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\alpha _ 2:=\sigma (\alpha) = -1-\frac{1}{\alpha } $ $ \end{document}. if we set \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\alpha _ 1:= \alpha $ $ \end{document }, then \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\alpha _ 1$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\alpha _ 2$$\end{document } are a fundamental system of units. now we know enough about the structure of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\mathbb z [\alpha ] $ $ \end{document } to apply theorem 1.2. if we can find three units \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$u_1,u_2,u_3\in \mathbb z [\alpha ] ^$$\end{document } such that \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$u_1+u_2+u_3=3$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$u_i \ne 1$$\end{document }, then the theorem is a direct consequence of theorem 1.2. indeed we have\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } 3&= \overbrace{(\alpha _ 1 ^ 2+(-a+2)\alpha _ 1-a)}^{=u_1 } \\&+ \overbrace{(-2\alpha _ 1 ^ 2+(2a-1)\alpha _ 1 + a+4)}^{=u_2 } \\&+ \overbrace{(\alpha _ 1 ^ 2+(-a-1)\alpha _ 1 - 1)}^{=u_3 } \\&= \alpha _ 1\alpha _ 2 ^ 2+\alpha _ 1^{-2}\alpha _ 2^{-1}+\alpha _ 1\alpha _ 2^{-1}. \end{aligned}$$\end{document}\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\square $ $ \end{document } we start with the definition of a signed double - base expansion of an integer. (signed double - base expansion) let \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document } be different integers. let \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$n$$\end{document } be an integer with\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } n = \sum _ { i\in \mathbb n _ 0, j\in \mathbb n _ 0 } d_{ij } p^i q^j, \end{aligned}$$\end{document}where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$d_{ij } \in { \left\ { { -1,0,1}\right\ } } $ $ \end{document } and only finitely many \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$d_{ij}$$\end{document } are non - zero. then such a sum is called a signed\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document}-\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document}-double - base expansion of\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$n$$\end{document}. the pair \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$(p, q)$$\end{document } is called base pair. a natural first question is, whether each integer has a signed double - base expansion for a fixed base pair. if one of the bases \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document } is either \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$2$$\end{document } or \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$3$$\end{document }, then existence follows since every integer has a binary representation (base \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$2$$\end{document } with digit set \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${\left\ { { 0,1}\right\ } } $ $ \end{document }) and a balanced ternary representation (base \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$3$$\end{document } with digit set \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${\left\ { { -1,0,1}\right\ } } $ $ \end{document }), respectively. to get the existence results for general base pairs, we use the following theorem, cf. (birch) let \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document } be coprime integers. then there is a positive integer \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$n(p, q)$$\end{document } such that every integer larger than \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$n(p, q)$$\end{document } may be expressed as a sum of distinct numbers of the form \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p^iq^j$$\end{document } all with non - negative integers \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$i$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$j$$\end{document}. let \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document } be coprime integers. then each integer has a signed \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document}-\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document}-double - base expansion. next we want to give an efficient algorithm that allows to calculate a signed double base expansion of a given integer. birch s theorem, or more precisely the proof in, does not provide an efficient way to do that. however, using our main result, there is a way to compute such expansions efficiently at least for certain base pairs. let \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document } be coprime integers with absolute value at least \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$3$$\end{document}. if there are non - negative integers \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$x$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$y$$\end{document } such that4.1\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } 2 = \left|{p^x - q^y}\right|\ !, \end{aligned}$$\end{document}then each integer has a signed \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document}-\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document}-double - base expansion which can be computed efficiently (there exists a polynomial time algorithm). in particular given a \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document}-adic expansion of an integer \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\alpha $ $ \end{document }, one has to apply (4.1) at most \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$o(\log (\alpha) ^2)$$\end{document } times. we start to prove the first part of the corollary and therefore apply theorem 1.2 with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\mathbb f = \mathbb q $ $ \end{document }, \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$r=\mathbb z $ $ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\vargamma $ $ \end{document } is the multiplicative group generated by \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$-1,p$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document}. since by assumption \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$2=\pm (p^x - q^y)$$\end{document } we have a solution to (1.2) and theorem 1.2 yields that \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document}-\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document}-double - base expansions exist. \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\alpha $ $ \end{document } the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document}-adic expansion\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \alpha = a_{0}+a_{1}p+\cdots + a_{k } p^{k } \end{aligned}$$\end{document}is given, with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a_{0},\ldots, a_{k}\in [\ ! [{ 0},{p-1}]\!]$$\end{document}. let us note that the weight \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$w$$\end{document } of this representation is at most \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$o(\log \alpha) $ $ \end{document}. now the following claim yields the corollary. \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\square $ $ \end{document } assume\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \alpha = \sum _ { i\in [\ ! [{ 0},{i}]\ ! ] } a_i p^i \end{aligned}$$\end{document}with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a_i\in \mathbb z $ $ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$i\in \mathbb n _ 0$$\end{document }, and set \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$w = \sum _ { i\in [\ ! [{ 0},{i}]\ ! ] } \left|{a_i}\right|$$\end{document}. then, after at most \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\frac{w^2-w}{2}$$\end{document } replacement steps \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$$$\end{document } we arrive at a representation of the form\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \alpha = \sum _ { j\in [\ ! [{ 0},{j}]\ ! ] } q^{jy } \sum _ { k\in [\ ! [{ 0},{k}]\ ! ] } b_{k, j}p^k, \end{aligned}$$\end{document}where the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$b_{k, j}$$\end{document } are integers with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \left|{b_{k, j}}\right| \le 1$$\end{document }, and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$j, k\in \mathbb n _ 0$$\end{document}. we prove the claim by induction on \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$w$$\end{document}. if \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$w\le 1$$\end{document } the statement of the claim is obvious. further, if all the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a_i$$\end{document } are in \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$${\left\ { { -1,0,1}\right\ } } $ $ \end{document } we are done. therefore we assume that there is at least one index \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$i$$\end{document } with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \left|{a_i}\right|>1$$\end{document}. we now apply the replacement step \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$$$\end{document } in the following way : if \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a_i>1$$\end{document }, then \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a_i$$\end{document } is replaced by \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a_i-2$$\end{document }, if \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a_i0$$\end{document } yields the desired representation. moreover, this can be done with at most\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \frac{w_\beta ^2-w_\beta } { 2 } + w-1 \le \frac{(w-1)(w-2)}{2 } + w-1 = \frac{w(w-1)}{2 } \end{aligned}$$\end{document}applications of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$$$\end{document }, which finishes the proof of the claim. \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\square $ $ \end{document } now we want to give some examples for base pairs, where the corollary can be used. let \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$(p, q)$$\end{document } be a twin prime pair, i.e., we have \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q = p+2$$\end{document } and both \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document } are primes. then clearly\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } 2 = q - p, \end{aligned}$$\end{document}so, by corollary 4.4, every integer has a signed \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document}-\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document}-double - base expansion, which can be calculated efficiently. let \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p=5$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q=23$$\end{document}. we have\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } 2 = 5 ^ 2 - 23, \end{aligned}$$\end{document}therefore every integer has a signed \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$5$$\end{document}-\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$23$$\end{document}-double - base expansion, which can be calculated efficiently., we calculated the following:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } 995&= - 5^{5 } + 5^{4 } + 5^{3 } \cdot 23 - 5^{2 } + 5 \cdot 23 + 23^{2 } + 1 \\ 996&= - 5^{3 } + 5^{2 } \cdot 23 + 23^{2 } - 5 + 23 - 1 \\ 997&= - 5^{3 } + 5^{2 } \cdot 23 + 23^{2 } - 5 + 23 \\ 998&= 5^{4 } - 5^{3 } - 5^{2 } + 23^{2 } - 5 - 1 \\ 999&= 5^{4 } - 5^{3 } - 5^{2 } + 23^{2 } - 5 \\ 1000&= 5^{4 } - 5^{3 } - 5^{2 } + 23^{2 } - 5 + 1 \\ 1001&= - 5^{3 } + 5^{2 } \cdot 23 + 23^{2 } + 23 - 1 \\ 1002&= - 5^{3 } + 5^{2 } \cdot 23 + 23^{2 } + 23 \\ 1003&= 5^{4 } - 5^{3 } - 5^{2 } + 23^{2 } - 1 \end{aligned}$$\end{document}in each case we started with an initial expansion, which is obtained by a greedy algorithm : for a \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$v\in \mathbb z $ $ \end{document } find the closest \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$5^i \cdot 23^j$$\end{document }, change the coefficient for that base, and continue with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$v - 5^i \cdot 23^j$$\end{document}. then we calculated the expansion by applying the equation \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$2 = 5 ^ 2 - 23$$\end{document } as in the proof of theorem 1.2. one can find pairs \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$(p, q)$$\end{document } where corollary 4.4 does not work. consider the equation4.2\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } 2 = \left|{p^x - q^y}\right| \end{aligned}$$\end{document}with non - negative integers \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$x$$\end{document }, \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$y$$\end{document}. a first example, where the corollary fails, is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p=5$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q=11$$\end{document}. indeed, looking at eq. another example is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p=7$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q=13$$\end{document }, where looking at (4.2) modulo \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$7$$\end{document }, yields a contradiction. a third example is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p=7$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q=11$$\end{document}. so in the cases given in the remark above, as well as in a lot of other cases, we can not use the corollary to compute a signed double - base expansion efficiently. is there an efficient (polynomial time) algorithm for each base pair \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$(p, q)$$\end{document } to compute a signed \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document}-\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document}-double - base expansion for all integers ? for some combinations of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document } we can get a weaker result. first, we define an extension of the signed double - base expansion : we allow negative exponents in the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p^i q^j$$\end{document }, too. (extended signed double - base expansion) let \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document } be different integers (usually coprime). let \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$z\in \mathbb q $ $ \end{document}. if we have\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } z = \sum _ { i\in \mathbb z, j\in \mathbb z } d_{ij } p^i q^j, \end{aligned}$$\end{document}where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$d_{ij } \in { \left\ { { -1,0,1}\right\ } } $ $ \end{document } and only finitely many \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$d_{ij}$$\end{document } are non - zero, then we call the sum an extended signed\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document}-\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document}-double - base expansion of\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$z$$\end{document}. with that definition, we can prove the following corollary to theorem 1.2. let \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document } be coprime integers. if there are integers \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a$$\end{document }, \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$b$$\end{document }, \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$c$$\end{document }, and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$d$$\end{document } with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$(a, b, c, d)\ne (0,0,0,0)$$\end{document } and such that4.3\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } 2 = p^a q^b \pm p^c q^d, \end{aligned}$$\end{document}then every element of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\mathbb z [1/p,1/q]$$\end{document } has an extended signed \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document}-\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document}-double - base expansion which can be computed efficiently (polynomial time algorithm). if we have a solution to the equation in corollary 4.4, then corollary 4.11 works, too. but more can be said about the existence and efficient computability of extended double - base expansions for the elements of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\mathbb z [1/p,1/q]$$\end{document}. if each integer has an efficient computable signed \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document}-\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document}-double - base expansion, then each element of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\mathbb z [1/p,1/q]$$\end{document } has an extended signed \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document}-\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document}-double - base expansion which can be computed efficiently. the proof of this corollary runs along the same lines as the proof of corollary 4.4. we apply theorem 1.2 with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\mathbb f = \mathbb q $ $ \end{document }, \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$r=\mathbb z [1/p,1/q]$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\vargamma $ $ \end{document } is the multiplicative group generated by \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$-1$$\end{document }, \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document}. since, by assumption, \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$2=\pm (p^aq^b - p^cq^d)$$\end{document } we have a solution to (1.2), theorem 1.2 yields that \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document}-\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document}-double - base expansions exist. next, we claim that we may assume \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document } are odd and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p, q>3$$\end{document}. indeed assuming that \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p\in { \left\ { { 2,3}\right\ } } $ $ \end{document }, then we can write \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\alpha \in \mathbb z [1/p,1/q]$$\end{document } in the form\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \alpha = \frac{\widetilde{\alpha } } { p^{x_p}q^{x_q } } \end{aligned}$$\end{document}with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\widetilde{\alpha } \in \mathbb z $ $ \end{document } and appropriate exponents \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$x_p$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$x_q$$\end{document}. moreover, \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\widetilde{\alpha } $ $ \end{document } has a representation of the form\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \widetilde{\alpha } = \sum _ { i\in [\ ! [{ 0},{k}]\!]}a_i p^i \end{aligned}$$\end{document}with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a_i\in { \left\ { { -1,0,1}\right\ } } $ $ \end{document}. however the computation of such a represenation can be done efficiently and takes polynomial time in the height \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$h(\alpha) $ $ \end{document }, where\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } h(n / m)=\max \{\log \left|{n}\right|, \log \left|{m}\right|, 1\ } \end{aligned}$$\end{document}provided \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$n, m\in \mathbb z $ $ \end{document } are coprime. since we may assume \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p, q>3$$\end{document }, we want to show next that a solution to eq. (4.3) necessarly takes the form\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } 2=\pm p^{-a}\pm p^{-a}q^b, \end{aligned}$$\end{document}with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a, b\ge 0$$\end{document}. we observe that a solution to (4.3) with \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a, c>0$$\end{document } or \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$b, c>0$$\end{document } does not exist, since otherwise \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p\vert 2$$\end{document } or \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q\vert 2$$\end{document}. next we note that if \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a\ne c$$\end{document } (\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$b\ne d$$\end{document } respectively) the \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document}-adic valuation (\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document}-adic valuation) on the right hand side of (4.3) would be the minimum of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$c$$\end{document } (\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$b$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$d$$\end{document } respectively) and in view of the left hand side, this minimum must be \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$0$$\end{document}. thus any solution to eq. (4.3) must be of one of the following forms:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } 2&= \pm p^aq^b \pm 1, \\ 2&= \pm p^{-a}q^{-b } \pm p^{-a}q^{-b }, \\ \end{aligned}$$\end{document}or\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } 2&= \pm p^a\pm q^b, \end{aligned}$$\end{document}where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$a$$\end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$b$$\end{document } are positive integers. obviously the first two cases have no solution and the last case has been treated in corollary 4.4. now let us write \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\alpha \in \mathbb z [1/p,1/q]$$\end{document } in the form\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } \alpha = \frac{a_0+a_1p+\cdots + a_kp^k}{q^{x_q}p^{x_p}}. \end{aligned}$$\end{document}we are now in a similar situation as in the proof of corollary 4.4. let \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$w=\sum _ { i=1}^k \left|{a_i}\right|$$\end{document}. then by similar arguments as in corollary 4.4 we find an extended signed \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document}-\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document}-double - base expansion of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\alpha $ $ \end{document } with at most \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\frac{w^2-w}{2}$$\end{document } applications of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$$$\end{document}. thus we have a polynomial in \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$h(\alpha) $ $ \end{document } time algorithm. \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\square $ $ \end{document } we can use the corollary proved above to get the following examples. let \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document } be a sophie germain prime and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q=2p+1$$\end{document}. we obtain\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\begin{aligned } 2 = q p^{-1 } - p^{-1}. \end{aligned}$$\end{document}using corollary 4.11 yields that every element of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\mathbb z [1/p,1/q]$$\end{document } has an efficient computable extended signed \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document}-\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document}-double - base expansion. the case when \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document } is a prime and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q=2p-1$$\end{document } is a prime works analogously. all the results on efficient computability in this section needed a special representation of 2. we have given some pairs \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$(p, q)$$\end{document } where the methods given here do not work. further, one could ask, whether the representations we get have a special structure. of particular interest would be an algorithm to get expansions with a small number of summands (small number of non - zero digits). for a given base pair \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$(p, q)$$\end{document } this leads to the following question how to compute a signed \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$p$$\end{document}-\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$q$$\end{document}-double - base expansion with minimal weight for a given integer ? a greedy approach for solving this question can be found in berth and imbert, some further results can be found in dimitrov and howe. | let \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\mathfrak o $ $ \end{document } be the maximal order of a number field. belcher showed in the 1970s that every algebraic integer in \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\mathfrak o $ $ \end{document } is the sum of pairwise distinct units, if the unit equation \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$u+v=2$$\end{document } has a non - trivial solution \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$u, v\in \mathfrak o ^$$\end{document}. we generalize this result and give applications to signed double - base digit expansions. |
a total of 23 neonates with a gestational age as low as 28 weeks and a mean body weight of 1,500 grams were included in the study. the mean duration of hospitalization of the infants was 50 days (range, 6 - 112 days). the most common requested radiographic examinations for the infant chest and abdomen were used in this study. all radiographic examinations were performed on one ge amx-4 and two ge vmx+ mobile x - ray units (ge medical systems, milwaukee, wi). the measured half value layers of these x - ray systems at 50 kvp were 2.24, 2.17 and 2.15 (mm al), respectively. performance tests of this equipment (such as accuracy kvp and collimation settings and tube output) were carried out according to the protocols given by the institute of physics and engineering in medicine (ipem) (3). radiographs were acquired using kodak t - mat g / ra film and kodak lanex regular screen combination (kodak health imaging, eastman kodak, rochester, ny) with a 400 relative film - screen combination speed. most examinations were carried out with the baby in an incubator and placed directly on top of the cassette, with a focus - to - film distance of 100 cm. however, some examinations were performed with the baby in a radiant warmer and the distance between the focus - to - film was measured and recorded. radcal ion chambers (model 9010 radiation monitor controller, 90 6 - 6 and 90 6 - 180 ionization chambers, mdh radcal monrovia, ca) were used for tube output and scatter radiation measurements, respectively. the tube outputs were measured over a range of tube voltages (kvp). a focus to film distance (ffd) of 100 cm was chosen for these measurements. in order to evaluate the contribution of the scatter radiation, a 5 cm perspex phantom to simulate an infant since the distance between the nicus was approximately 2 m, scattered radiation was measured at the nicu level at this distance. entrance skin doses (esds) were calculated from the tube output measurements of the x - ray units in accordance with the following formula : where the isl factor is an inverse - square law correction from the focus - to - chamber distance (100 cm) to the focus - to - skin distance (fsd), mas is the product of tube current (ma) and exposure time(s) used in the infants studies. bsf is the backscatter factor and is taken as 1.1 for the 50 - 70 kvp range used for a neonate with a body thickness of 5 cm (4). the factor is an inverse - square law correction from the focus - to - chamber distance to fsd, and is the mass energy absorption coefficient ratio of tissue to air. the mass energy absorption coefficient ratio is equal to 1.05 for the kvp range used in this study (5). lithium fluoride thermoluminescent dosimeter (tld) chips (3.7 3.7 0.9 mm) (model 100 : harshaw chemical, solon, oh) in plastic handling pockets (3 for each) were used to measure the total entrance skin dose for both chest and abdomen radiographs for 16 infants, and a model 3500 reader (harshaw chemical) was used for tld readout. these pockets were attached to a single point on the skin of a patient for each examination and a pediatrician for each examination determined these locations. in order to minimize batch - to - batch variability, a preselected group of tlds was calibrated initially and variations of the sensitivities were kept within 5%. calibration of tlds was carried out for radiographic system using the same x - ray beam qualities as with the neonate studies. a radcal ion chamber was taken as a reference chamber, and the manufacturer recommendations were considered for these calibrations. a linear regression analysis with the least squares method was used to determine the correlation between esdto and esdtld. background radiation was also measured by the use of tld chips placed outside the radiographic room over the hospitalization time for each infant. then these values were subtracted from each infant tld that was used for infant esd measurements. effective doses (ed) for each examination were calculated from esdto and monte carlo conversion factors given from pcxmc software (stuk helsinki, finland) (6). since most of the neonates in an nicu will be pre - term, fetal risk factors for estimating the risk of a childhood cancer following neonatal exposure were used for the neonate risk calculations (7). a total of 23 neonates with a gestational age as low as 28 weeks and a mean body weight of 1,500 grams were included in the study. the mean duration of hospitalization of the infants was 50 days (range, 6 - 112 days). the most common requested radiographic examinations for the infant chest and abdomen were used in this study. all radiographic examinations were performed on one ge amx-4 and two ge vmx+ mobile x - ray units (ge medical systems, milwaukee, wi). the measured half value layers of these x - ray systems at 50 kvp were 2.24, 2.17 and 2.15 (mm al), respectively. performance tests of this equipment (such as accuracy kvp and collimation settings and tube output) were carried out according to the protocols given by the institute of physics and engineering in medicine (ipem) (3). radiographs were acquired using kodak t - mat g / ra film and kodak lanex regular screen combination (kodak health imaging, eastman kodak, rochester, ny) with a 400 relative film - screen combination speed. most examinations were carried out with the baby in an incubator and placed directly on top of the cassette, with a focus - to - film distance of 100 cm. however, some examinations were performed with the baby in a radiant warmer and the distance between the focus - to - film was measured and recorded. radcal ion chambers (model 9010 radiation monitor controller, 90 6 - 6 and 90 6 - 180 ionization chambers, mdh radcal monrovia, ca) were used for tube output and scatter radiation measurements, respectively. the tube outputs were measured over a range of tube voltages (kvp). a focus to film distance (ffd) of 100 cm was chosen for these measurements. in order to evaluate the contribution of the scatter radiation, a 5 cm perspex phantom to simulate an infant was irradiated with the exposure parameters typical for clinical examinations. since the distance between the nicus was approximately 2 m, scattered radiation was measured at the nicu level at this distance. entrance skin doses (esds) were calculated from the tube output measurements of the x - ray units in accordance with the following formula : where the isl factor is an inverse - square law correction from the focus - to - chamber distance (100 cm) to the focus - to - skin distance (fsd), mas is the product of tube current (ma) and exposure time(s) used in the infants studies. bsf is the backscatter factor and is taken as 1.1 for the 50 - 70 kvp range used for a neonate with a body thickness of 5 cm (4). the factor is an inverse - square law correction from the focus - to - chamber distance to fsd, and is the mass energy absorption coefficient ratio of tissue to air. the mass energy absorption coefficient ratio is equal to 1.05 for the kvp range used in this study (5). lithium fluoride thermoluminescent dosimeter (tld) chips (3.7 3.7 0.9 mm) (model 100 : harshaw chemical, solon, oh) in plastic handling pockets (3 for each) were used to measure the total entrance skin dose for both chest and abdomen radiographs for 16 infants, and a model 3500 reader (harshaw chemical) was used for tld readout. these pockets were attached to a single point on the skin of a patient for each examination and a pediatrician for each examination determined these locations. in order to minimize batch - to - batch variability, a preselected group of tlds was calibrated initially and variations of the sensitivities were kept within 5%. calibration of tlds was carried out for radiographic system using the same x - ray beam qualities as with the neonate studies. a radcal ion chamber was taken as a reference chamber, and the manufacturer recommendations were considered for these calibrations. a linear regression analysis with the least squares method was used to determine the correlation between esdto and esdtld. background radiation was also measured by the use of tld chips placed outside the radiographic room over the hospitalization time for each infant. then these values were subtracted from each infant tld that was used for infant esd measurements. effective doses (ed) for each examination were calculated from esdto and monte carlo conversion factors given from pcxmc software (stuk helsinki, finland) (6). since most of the neonates in an nicu will be pre - term, fetal risk factors for estimating the risk of a childhood cancer following neonatal exposure were used for the neonate risk calculations (7). the mean numbers of radiographs received by one infant were 14 and 5 for chest and abdomen examinations, respectively. the mean esdto per radiograph was calculated by dividing the sum of the esdto by the total radiography numbers for each examination. the mean esdto per radiograph were 67 gy and 65 gy for the chest and abdomen, respectively. esdtld was well correlated with esdto obtained from the total chest and abdomen radiographs for each infant (r = 0.86) (fig. the measured scattered radiation range at a 2 m distance from the nicu was 11 - 17 gy per radiograph. considering the mean esd as 65 gy per radiograph, the contribution of the scatter radiation is negligible. the radiation dose of an infant received from the scatter radiation from the irradiation of other infants is approximately 1/4,600 times the direct exposure of the infant. table 1 summarizes the radiographic data, esdto and ed for each examination accrued in this study. using the overall risk factors for inducing a fatal childhood cancer in the first decade of life following prenatal radiation exposure based on icrp60 (2.8 10 sv to 13 10 sv) yields somatic risk estimates of 0.4 10 to 2 10 and 0.6 10 to 2.9 10 for chest and abdomen radiographs, respectively (7). the esds were comparable to the mean values reported by the commission of european communities (ec) as 80 gy (8) and by the national radiological protection board (nrpb) as 50 gy for chest radiographs (9). exposure of infants to radiation in the vicinity of the exposed infants in the same room is very low, practically for the range of the lowest detectable dose. the difference between esdtld and esdto may be attributable to variations on the tube outputs and errors of the focus - to - skin distance measurements. the esd values per radiograph were found to be higher than the values reported in the literature (1, 4). the use of low tube potential (kvp) values in this study probably is the reason for higher doses. according to duggan. (10), increasing the tube potential from 50 kvp to 60 kvp reduced esd by 9%. table 2 shows a comparison between exposure parameters, esdto, ed and risk factors for childhood cancer per examination for this study and other studies. this is the first dosimetry study performed for an nicu in turkey and we measured radiation near the exposed infant in the same room to check safe distances in the nicu for scatter radiation. if the high kv technique had been used in this study, the doses delivered to patients could have been substantially reduced. there is a continuing need for assessment of radiation dose in the neonate healthcare centers along with a regular review of dose reduction procedures. the results obtained from this study show that the esdtld and esdto indicated no significant differences. because of their sizes, a relatively large area of the infants was irradiated and it was more difficult to shield radiosensitive organs. in addition, measurement of infant dose must be performed in sterile conditions as soon as possible because of the high sensitivity of the infants to infection. the results of our study show that neonates received acceptable doses from common radiological examinations. although the contribution of scatter radiation to the neonatal dose is low, considering the sensitivity of the neonates to radiation, further protective action should be performed by increasing the distance between patients until the effect of scatter radiation disappears. | objectivethe aim of this work was to determine the radiation dose received by infants from radiographic exposure and the contribution from scatter radiation due to radiographic exposure of other infants in the same room.materials and methodswe retrospectively evaluated the entrance skin doses (esds) and effective doses of 23 infants with a gestational age as low as 28 weeks. esds were determined from tube output measurements (esdto) (n = 23) and from the use of thermoluminescent dosimetry (esdtld) (n = 16). scattered radiation was evaluated using a 5 cm perspex phantom. effective doses were estimated from esdto by monte carlo computed software and radiation risks were estimated from the effective dose. esdto and esdtld were correlated using linear regression analysis.resultsthe mean esdto for the chest and abdomen were 67 gy and 65 gy per procedure, respectively. the mean esdtld per radiograph was 70 gy. the measured scattered radiation range at a 2 m distance from the neonatal intensive care unit (nicu) was (11 - 17 gy) per radiograph. mean effective doses were 16 and 27 sv per procedure for the chest and abdomen, respectively. esdtld was well correlated with esdto obtained from the total chest and abdomen radiographs for each infant (r2 = 0.86). the radiation risks for childhood cancer estimated from the effective dose were 0.4 10 - 6 to 2 10 - 6 and 0.6 10 - 6 to 2.9 10 - 6 for chest and abdomen radiographs, respectively.conclusionthe results of our study show that neonates received acceptable doses from common radiological examinations. although the contribution of scatter radiation to the neonatal dose is low, considering the sensitivity of the neonates to radiation, further protective action was performed by increasing the distance of the infants from each other. |
healthcare - associated bloodstream infections (hca - bsi) rated in neonatal intensive care units (nicus) between 1.8% and 74.3% in several reports are a major cause of morbidity and mortality in nicus and affect the cost of medical care by increasing resource consumption and duration of hospitalization (1 - 3). the most common type of neonatal healthcare - associated infection (hc - ai) is bloodstream infection (bsi). a neonate may be at risk of infection through one or many intrinsic and extrinsic factors, such as gestational age and presence of a single or multiple invasive devices (4). in developed and developing countries, most nosocomial infections (nis) in nicus are related to a longer duration of hospitalization, low birth weight and gestational age, respiratory diseases, invasive interventions, and medical treatments (5). hca - bsis, device - associated hc - ai in particular, are generally common in newborns because of their insufficient immune system and mechanical barriers as well as the lack of protective flora (6). therefore, among hospitalized patients, neonates belong to those at the highest risk of hca - bsis. in addition, neonatal hca - bsis not only have high mortality but also increased risk of subsequent adverse outcomes, including white matter injury to the preterm brain and attendant neurodisability (7). a few studies have been conducted on the risk factors of hca - bsis in nicus in turkey (8, 9). in this study, we described the demographic features of the patients, the causative organisms, and the risk factors of hca - bsis in nicus. the purpose of the present study was to identify the risk factors associated with the development of hca - bsis and the most frequent causative agents of the same in nicus. knowledge of the modifiable risk factors for hca - bsis would enable developing countries to implement interventions, thereby decreasing hca - bsis and the associated complications. this retrospective study was conducted in the clinic of neonatology in dicle university between january 2011 and december 2014. the neonatal unit has 34 incubators, 20 mechanical ventilators, and 2 open intensive care cods. this study included 126 patients (infected group) with positive blood cultures and 126 randomly selected patients (uninfected control group) with negative blood cultures after four days of hospitalization. infection control doctors and nurses conducted hospital infection surveillance actively and prospectively. during the period of hospitalization, the infection control committees recorded patient information every day using the patients follow - up forms. the diagnosis of hca - bsis was made according to the criteria of the us center for disease control and prevention (10). healthcare - associated bloodstream infection (hca - bsi) : patients with no sepsis on admission and who had microorganisms isolated from blood cultures taken 48 - 72 hours after birth on suspicion of sepsis according to the clinical signs and/or laboratory findings were diagnosed as hca - bsi. clinical findings, including apnea, bradycardia, hypothermia, hyperthermia, circulatory disorder, lethargy, hypotonia, and feeding difficulty, and laboratory findings, including leukocytosis, leucopenia, thrombocytopenia, a ratio of immature / mature neutrophils > 0.25, and a c - reactive protein value of > 0,05 mg / dl, were considered significant. patients with signs of sepsis and showed no growth in culture and patients with duration of hospitalization of less than 48 - 72 hours were excluded from the study. strains of staphylococcus epidermidis were considered involved in the infection if they represented the only microorganisms isolated from the blood specimen in the presence of clinical signs or symptoms of infection. most authorities recommend obtaining two independent cultures to fulfill two workups of an episode of suspected bloodstream infection (11). the blood samples taken from patients with suspected bacteremia and/or sepsis were inoculated into blood culture bottles and incubated in bactec 9120 and 9240 (becton dickinson, md, usa) blood culture systems for 7 - 10 days at 37c. the blood samples in which bacterial growth was detected were inoculated into 5% sheep blood agar, emb agar, and chocolate agar media. these media were incubated at 35 2c for 20 - 24 hours. wound swabs and other clinical specimens were directly inoculated into 5% sheep blood agar, emb agar, and chocolate agar and incubated at 35 2c for 20 - 24 hours. all the strains isolated from the clinical specimens were identified using conventional methods and bd phoenix 100 (becton dickinson, md, usa). data were obtained from the database of the hospital infection control committee and patients medical records. gender, gestational age, birth weight, birth presentation, type of delivery, length of hospitalization, results of blood cultures, surgical operation, ventriculoperitoneal shunt, tracheostomy procedure, diagnosis with intracranial hemorrhage, phototherapy, tracheostomy procedure, exchange transfusion, (four days of mechanical ventilation and neonatologist s prediction of prolonged ventilation were the common indication), apgar score point (fifth minute), use of umbilical catheter, nasogastric or orogastric tube, urinary catheter, mechanical ventilation, use of surfactant, erythrocyte transfusion, plasma transfusion, thrombocyte transfusion, intravenous immunoglobulin, and total parenteral nutrition infusion were recorded prospectively. the cases not appropriate for hospital acquired infections (hais) because of clinical and laboratory findings and those who had a single blood culture with isolated central nervous system considered as contamination were excluded from the study. the two - sided statistical tests were performed using spss for windows (version 18.0 ; spss, inc., chicago, il). a p value of 5 days), icu admission, tracheostomy, and exposure to indwelling devices were associated with a significantly increased risk of hca - bsis by univariate analysis, and that risk factors such as antibiotic exposure, surgical intervention, trauma, central venous catheter, urinary catheter, intubation, tracheostomy, length of hospitalization (15 days), charlson index, and mccabe classification were independently associated (p < 0.05) with hca - bsis (23). found that hca - bsi was more frequent among low birth weight infants than high birth infants (28). length of hospitalization, gestational age, birth weight, mechanical ventilation, total parenteral nutrition, umbilical catheter, use of antibiotics, and intubation at birth were associated with a significantly increased risk of hca - bsis. some studies (15, 17, 29) reported that surgery, orogastric tube, central venous catheter, and nasal continuous positive airway pressure were not associated with a significantly increased risk of hca - bsis. djordjevic and aurit found that low birth weight (< 1500 g), low gestational age at birth (< 32 weeks), first - minute apgar score, endotracheal intubation at birth, mechanical ventilation and assisted ventilation by continuous positive pressure through nasal prongs, central venous catheter, parenteral nutrition, continuous enteral nutrition, premature rupture of membranes, cesarean section, male sex, aspiration, congenital anomalies, intracranial hemorrhage, and surgical intervention were associated with a significantly increased risk of hca - bsis ; in the multivariate logistic regression analyses, only low gestational age (< 32 weeks) and central venous catheter were independent risk factors for hais (22, 24). in the present study we found that surgical operation, ventriculoperitoneal shunt, use of umbilical catheter, use of nasogastric or orogastric tube, use of urinary catheter, use of mechanical ventilation, surfactant, erythrocyte transfusion, plasma transfusion, thrombocyte transfusion, total parenteral nutrition infusion, intracranial hemorrhage, length of stay, fifth - minute apgar score, and duration of total parenteral nutrition were all associated with a significantly increased risk of hca - bsis using univariate analysis. in the multivariate logistic regression analyses, only the fifth - minute apgar score, use of erythrocyte transfusion, and surgical operation were independent risk factors for hais. the main limitation of our study is the fact that it is a retrospective study with a relatively small sample size. studies with more comprehensive analyses and a larger number of patients can provide further data on these variables. this study identified the risk factors associated with hais in our nicus that are necessary for hca - bsis prevention programs and found that infection control is a significant problem in nicus. we suggest that preventive strategies for bsi in neonates in nicus should continue to focus on limiting the use of invasive devices to reduce hais. this study identified the risk factors associated with hais in our nicus that are necessary for hca - bsis prevention programs and found that infection control is a significant problem in nicus. we suggest that preventive strategies for bsi in neonates in nicus should continue to focus on limiting the use of invasive devices to reduce hais. | backgroundhealthcare - associated bloodstream infections (hca - bsi) are a major cause of morbidity and mortality in neonatal intensive care units (nicus).objectiveswe aimed to determine the causative organisms and risk factors of hca - bsis in nicus.methodsthis study was performed between january 2011 and december 2014 in the neonatal intensive care unit of dicle university, turkey. the study consisted of 126 patients (infected group) with positive blood culture and 126 randomly selected patients (uninfected control group) with negative blood culture after four days of hospitalization.resultswe found that the most common causative agents isolated from nosocomial infections (nis) were 20.7% staphylococcus epidermidis, 26.7% klebsiella spp., and 13.3% acinetobacter spp. incidences of low gestational age, low birth weight, vaginal birth type, and long length of hospitalization were higher in the infected neonates than in the uninfected neonates. in the univariate analysis, surgical operation, ventriculoperitoneal shunt, use of umbilical catheter, nasogastric or orogastric tube, urinary catheter, mechanical ventilation, surfactant treatment, erythrocyte transfusion, plasma transfusion, thrombocyte transfusion, total parenteral nutrition infusion, intracranial hemorrhage, length of hospital stay, fifth - minute apgar score, and total parenteral nutrition time were significantly associated with nis. in the multiple logistic regression analysis, fifth - minute apgar, use of erythrocyte transfusion and surgical operation were found as the independent risk factors for hca-bsi.conclusionsthis study determined the causative organisms and risk factors of hca - bsis in nicus. |
in 1970, a 51-yr - old female with apparent celiac disease was recorded with refractory malabsorption.10 an unusual histological abnormality in the small intestine was described consisting of an eosinophilic sub - epithelial hyaline - like material in the lamina propria. the deposits had histochemical staining characteristics of collagen, and ultra - structural studies confirmed the presence of an electron - dense material with the characteristic 640. a axial periodicity of collagen fibers. later reports described severe and long - standing malabsorption with diarrhea and progressive weight loss, flattened small intestinal villous architecture, and these same distinctive sub - epithelial collagen deposits. some felt that the collagen deposits simply represented a prognostic marker of a poor outcome in celiac disease.11 others considered the disorder to be an entirely new, previously unrecognized, entity poorly responsive to a gluten - free diet.12 both entities share many common elements. hyposplenism and positive endomysial antibodies have been detected in both disorders.13 moreover, some complications ordinarily associated with celiac disease have been associated with collagneous sprue. small intestinal ulceration and perforation may develop.14 atypical immunohistochemical changes with gene rearrangement defined by polymerase chain reaction reported in refractory sprue (or sprue - like intestinal disease) have been noted in collagenous sprue.14,15 malignant lymphoma may develop during the clinical course of collagenous sprue.14,16,17 as in celiac disease, both t - cell lymphoma16 and b - cell lymphoma17 have been recorded in collagenous sprue. the natural history of collagenous sprue has been characterized by continued malabsorption, usually of multiple nutrients, and a lethal outcome. some recent reports, however, with extensive biopsy studies have also noted complete disappearance of these abnormal collagen deposits after treatment with steroids for periods of up to almost four years.18 thus, the lesion may be reversible, at least temporarily, for prolonged periods. it may also be that the collagen deposits have different causes, in some instances being steroid - responsive. of note, in a recent report, collagen deposits completely revolved after resection of a localized colon cancer, suggesting a possible paraneoplastic phenomenon, expressed as this histopathologic marker in the intestinal mucosa.19 in 1976, similar deposits were detected in the colon in patients with a watery diarrhea syndrome.20,21 colorectal biopsies showed lamina propria sub - epithelial hyaline deposits similar to the deposits reported in the small intestine with collagenous sprue. although the endoscopic appearances were normal or near - normal, a microscopic mucosal inflammatory process was also present with increased lymphocytes and plasma cells. the hyaline deposits stained positively with trichrome, characteristic of collagen and ultrastructural studies confirmed the presence of collagen fibers. later reports from large registries further detailed the clinical features.22,23 most patients were middle - aged or elderly females, however, collagenous colitis has also been detected in males and children.24 diarrhea was usually watery, nonbloody, and sometimes nocturnal, often with intermittent abdominal pain and weight loss. often, the diarrhea was present for weeks or months, resolving spontaneously for variable periods of time, then recurring with remissions and relapses over many years. the pathogenesis of the diarrhea in collagenous colitis has been evaluated but still needs to be elucidated. some functional studies of the small bowel and pancreas were normal.25 interestingly, however, some early case studies both adult and childhood celiac disease in collagenous colitis.2628 serological investigations failed to show a linkage with celiac disease29 and two retrospective studies of small bowel biopsies in collagenous colitis were contradictory.30,31 however, a long - term prospective small bowel biopsy study in collagenous colitis documented celiac disease in over 20% of subjects.32 recognition of celiac disease may be important from a therapeutic perspective because a gluten - free diet may resolve the diarrhea without need for other pharmacologic treatment. in addition, other autoimmune disorders such as thyroiditis may be seen in collagenous colitis at similar frequencies to that recorded in celiac disease.32 finally, splenic hypofunction, often seen in celiac disease, has been recorded in collagenous colitis.33 some have classified collagenous colitis as a form of microscopic colitis. in part, this is due to a clinical paradigm that differentiates this entity from other inflammatory bowel disease disorders (eg, ulcerative colitis, crohn s disease) with macroscopically visible changes detected during endoscopic evaluation. another type of microscopic colitis is lymphocytic colitis that serves to emphasize the predominant cell type in cases of watery diarrhea with macroscopically normal mucosa. some believe that there may be an hypothetical relationship between lymphocytic colitis and collagenous colitis, however, the absence of collagen deposits (in lymphocytic colitis) may simply reflect their patchy and focal distribution in collagenous colitis. interestingly, though, increased epithelial lymphocytosis (without collagen deposits) has been defined in colorectal mucosal biopsies from patients with celiac disease.34 bloody diarrhea is very unusual in collagenous colitis and usually suggests that another disorder is present and, recently, evolution of collagenous colitis into severe and extensive ulcerative colitis has been documented.35 complications of collagenous colitis may also occur, and these may be seen in adult celiac disease with concomitant collagenous colitis. surface epithelial sloughing is commonly seen in colonic biopsies leaving a naked sub - epithelial collagen deposit. in some, altered mucosal permeability has been recorded and protein - losing enteropathy has been noted in the absence of small intestinal disease.8 submucosal dissection has been described.36 colonic fracturing after endoscopic instrumentation, possibly related to air insufflation and barotraumas, or insertion of barium contrast agents, has been recorded.37 recently, a report entitled cat scratch colon emphasized the macroscopic changes in the colon in collagenous colitis.38 spontaneous peritonitis with colonic perforation has also been recorded.39 a rarity of malignant disease has been noted in collagenous colitis, such as colonic carcinoma.40 other neoplasms have also been recorded including lymphoproliferative disorders41 and carcinoids.42 although lymphocytic gastritis was originally noted in patients with celiac disease or sprue - like intestinal disease,43 other chronic gastritis types may occur. in 1989, a form of chronic gastritis was initially described characterized by gastric sub - epithelial collagen deposits with a background inflammatory process.44 the presence of collagen in these deposits was confirmed using ultrastructural methods and observed in both adults and children.45 later, this entity was noted in celiac disease.46 some recent studies have shown concomitant collagen deposits elsewhere in the intestinal mucosa, suggesting that, in some instances, collagenous disease may be a far more extensive inflammatory disease process.47 diagnosis of celiac disease is usually straightforward, but occasionally, it may prove to be difficult. once established, however, the clinician should be alert to other luminal mucosal disorders, such as collagenous colitis, that may complicate the clinical course of celiac disease. conversely, collagenous colitis or other specific luminal mucosal disorders may be the presenting manifestation of underlying celiac disease. | celiac disease is a gluten - dependent intestinal disorder that appears to be associated with several clinical conditions. some involve the luminal mucosa of the stomach and intestinal tract and may, occasionally, complicate the course of celiac disease. collagenous colitis has been associated with celiac disease and may lead to chronic diarrhea. conversely, some of these clinical disorders that involve the luminal mucosa of the stomach and intestine may represent the initial clinical presentation of celiac disease. these disorders should be considered in patients with celiac disease who develop recurrent or refractory symptoms despite adherence to a strict gluten - free diet. detection of collagenous disorders that affect the luminal mucosa of the stomach or intestinal tract may result in recognition of underlying celiac disease. |
glaucoma is an optic neuropathy which generally develops with elevated intraocular pressure (iop) and leads to the enlargement of the cup disc ratio (c / d) in the optic nerve head (onh) and visual field loss (vfl) [1, 2 ]. iop measurement, assessment of onh and visual field (vf), and examination of the anterior chamber angle are required in order to diagnose and classify glaucoma. glaucomatous vfl is one of the most important symptoms of glaucoma and frequently shows correlation with anatomic damage within the onh. however, vf is affected when the axonal damage reaches 15%50%, and this is the biggest disadvantage of vf testing. electrophysiological tests provide significant data while revealing and monitoring the pathologies in the visual pathway objectively from the retina pigment epithelium (rpe) to the occipital cortex. a flash electroretinography (ferg) record is generated by the rapid changes of the retinal standing potential following retinal stimulation with a uniform light flash. it is thought that the formation of the waves during the record results from the outer retinal layers [4, 5 ]. histological studies reported that the increased reuptake of glutamine and synthesis of glial fibrillary acidic protein in mller cells are associated whit erg waves changes in glaucoma [710 ]. pattern visual evoked potential (pvep) is an electrical signal generated by the occipital visual cortex in response to the stimulation of the retina by pattern stimuli. these responses may provide information about the whole visual pathway from ganglion cells to the occipital cortex. the main purpose of pvep is to obtain information regarding high afferent visual centers [11, 12 ]. ocular hypertension (oht) is defined as iop greater than 21mmhg, no visual field defect, and no damage in ganglion cells. however, conventional visual field tests remain normal until ganglion cell damage reaches 15%50% and this results with confusion in the diagnosis and management of oht., we aimed to evaluate the possible pvep and ferg changes in patients with oht in order to identify early ganglion cell damage. fifty - five patients were enrolled for this cross - sectional study between january 2008 and february 2009. the study and control group patients were recruited from the glaucoma department and the outpatient clinic. approval for the study was obtained from the local ethics committee and performed in accordance with the tenets of declaration of helsinki. the study group (sg) of 25 patients consisted of the patients who were under followup with the diagnosis of oht in glaucoma department, and the control group (cg) of 30 patients constituted of the patients who were admitted to our outpatient clinic for refractive errors. the patients in the sg ranged in age from 30 to 65 years and had no glaucomatous vf defects as per the hodapp - parrish - anderson (hpa) (source for hpa) grading system. intraocular pressure measurements were made by goldman applanation tonometry and were corrected according to the central corneal thickness. the inclusion criteria for sg were as follows : patients who had iop of 22 mmhg or over for at least two measurements, which were made at different times, no changes in onh (diffuse or local neuroretinal rim thinning, flame shape hemorrhage, enlargement of c / d, or nerve fiber layer defects), open anterior chamber angles, normal color vision, no systemic or ocular disorder other than glaucoma to effect vf, no refraction defect over 3.0 diopter as to spherical equivalent in refraction examination, and had best corrected visual acuity (bcva) of 20/25 or better. none of them had eye surgery previously, pupil anomaly, or pupils bigger than 7 mm when dilated. the participants in the cg ranged between 30 and 60 years of age and had no glaucomatous vf defects as per hpa grading system nor any onh changes (diffuse or local neuroretinal rim thinning or flame shape hemorrhages, enlargement of c / d, and nerve fiber layer defects). control group patients showed no systemic disorder, had no ocular problems rather than refractive errors, had no previous surgery, and had iop of 21 mmhg or below. finally, control patients had no pupil anomaly and pupils bigger than 7 mm when dilated ; they had no refraction defects over 3.0 diopters as to spherical equivalent in refraction examination and had bcva of 20/25 or better. clinical protocols and specifications outlined by the international society for clinical electrophysiology of vision (iscev) were used in pvep and ferg records. dynamic glaucoma 2 program of interzeag octopus perimeter 101 device was used in vf assessment. the test 's reliability criteria determined that fixation losses, false positive responses, and false negative responses should be below 15%. all electrophysiological tests were applied between 15 and 17 o'clock to prevent the possible diurnal effects upon the tests. electrophysiological test records were made under standard conditions by the same device system and the same physician (ec). the measurements were obtained by tomey primus 2.5 electrophysiology unit (tomey gmbh am weichselgarten 19a, 91058 erlangen, germany). the measurements were performed in a silent, comfortable, and dark room. pvep was recorded with full - field black and white reversing checkerboard which was displayed on a television screen. all electrodes were set up to an impedance of less than 5 kilo ohm (k). checks subtended 30 of visual angle, viewed at 0.5 m, and were 20 sized. low and high frequency filters were, respectively, 1 and 100 hz, and analysis time was 300 ms. the mean luminance of the stimulus was 46 candle / m (cd / m), the active electrode (o2) was placed 2 cm above the protuberantia, the reference electrode (f2) was attached to the left wrist, and the neutral electrode (fpz) was applied to the forehand. while the patient was looking at the fixation point of the checkered screen, the electrical potentials on the occipital cortex were recorded. when lid or peripheral artifacts were formed, the records were repeated n75, p100, and p100-n135 amplitudes were assessed as well as the latencies of n75 forming after approximately 75 milliseconds (ms), p100 forming after approximately 100 ms, and n135 forming after approximately 135 ms. after obtaining the pvep records, 1% cyclopentolate and 1% tropicamide drops following dark adaptation for 30 minutes, the ferg record was initiated. for ferg records, a neutral electrode (which is a ground electrode) was placed on the frontal region, reference electrodes were placed on the temporal region, and active corneal electrodes were placed on the conjunctival sac under a 15 watt red light source, utilizing ganzfeld stimulation with a maximum flash intensity of 2 cd / m. band - pass filter was between 0.3 hz and 300 hz with an amplification of 5 k while artifactual signals (blinks) were automatically removed. the measurements were applied to both eyes automatically by means of the device 's software. rod responses, cone responses, maximal rod - cone responses, and oscillatory potential (op) responses were received after 30 minutes of dark adaptation. a single flash cone response and 30 hz flicker response were received after a 10-minute light adaptation. for data analysis, spss 10.0 package (spss inc., chicago, il, usa) was used and normality tests of the data were performed. regarding the test results, the mean age of the 25 sg patients was 52 7.5 years (ranging between 30 and 65). the mean age of 30 cg patients was 53.2 7.5 years (ranging between 30 and 65). the patients in the sg consisted of 12 males (48%) and 13 females (52%). the patients in the cg consisted of 15 males (50%) and 15 females (50%). there was not a statistically significant difference between the sg and cg in terms of age and gender (p > 0.05 and p > 0.05) (table 1). the mean iop of the sg group was 23.05 1.45 mmhg (between 22 mmhg and 25 mmhg) and the mean iop of the cg was 13.7 mmhg 1.45 mmhg (between 12 mmhg and 17 mmhg). the mean vertical c / d in sg group was 0.36 0.08 (ranging between 0.2 and 0.4), and the mean vertical c / d in the control group was 0.32 0.06 (ranging between 0.2 and 0.4). the difference between the two groups was not statistically significant (p = 0.135) (table 2). there was no statistically significant difference between two groups regarding the mean latency values of pvep waves. however, the mean amplitude of the sg patients was significantly lower than the mean amplitude of the cg patients (p 0.05) (table 5). in previous electrophysiological studies, it was suggested that the exposures to intraretinal synapses in glaucoma would delay the cortical responses by affecting the postretinal synapses [1416 ]. recent studies also suggested that the dorsal lateral geniculate nucleus is affected both functionally and structurally in persons with oht [17, 18 ]. the amplitude and latency of pvep might be affected in oht cases and decrease in the amplitude seems to be more significant. in this study, when compared with the cg, there was a statistically significant decrease in the amplitude of pvep in the sg (p < 0.05). in a study by lan., the correlation between the pvep and vf was evaluated, and they reported that there was no a significant correlation between them. in another study by nykanen and raitta, the correlation between fvep and the parameters of the vf was studied. they stated that there was a correlation between p120 amplitude and average deviation ; however, there was no correlation between the latencies and the parameters of vf. some studies have stated that a and b waves forming in ferg records are produced by external retinal layers and no change is seen at these waves in the cases of glaucoma. this information has led to the opinion that this test can not be used in glaucoma diagnosis [22, 23 ]. however, in some recent studies, it was shown that there was amplitude and latency changes in scotopic and photopic erg [24, 25 ]. ops amplitudes decrease both in scotopic and photopic erg and flicker response anomalies and decrease at photopic negative response (phnr) amplitudes in glaucoma patients [2530 ]. stated that they had found abnormalities at ferg parameters of patients with congenital glaucoma and that changes became evident in advanced glaucoma cases. scotopic erg, ops, and phnr originate from inner retinal layers like perg ; therefore, they are expected to be affected in glaucoma patients. machida. reported that s - cone phnr is more sensitive to glaucoma than l- and m - cone phnr. machida. suggested that acute iop elevation results in retinal thinning and may cause erg abnormalities due to decrease of choroid perfusion pressure, therefore change the electrical activity of the retina. buchi and wachtmeister reported that they observed significant changes both in the wave amplitudes (decrease) and latencies (delay) in oht cases [33, 35 ]. in our study, we did not find significant electroretinographic changes for both amplitudes and latencies of oht cases, the same for the decrease of the op wave amplitude. it may also be due to the fact that within these studies, they assess eyes with high iop and advance glaucomatous damage rather than using an assessment of oht patients. it is thought that ops waves arise from inner retinal layers, and inner retinal layers are prone to high iop levels. therefore, ops waves are expected to be affected in glaucoma and oht patients. in this study, ops wave amplitudes in ferg were found to be decreased in oht patients and this phenomenon supports the previous studies. in addition, electrophysiological tests may reveal cell damage and ganglion cell dysfunction earlier than psychophysical tests [33, 37 ]. in conclusion, a significant decrease of amplitude in pvep was detected in oht patients in our study. despite identification of decrease in ops 1 wave amplitude in ferg with delay in wave of latencies and extension in wave of latency in flicker erg, we have found that only the decrease in ops 1 wave amplitude is remarkable when these parameters are assessed in oht patients. when we compare the decrease of ops 1 wave amplitude with amplitude decrease in pvep, we have concluded that pvep can give more valuable results in oht cases. we think that decrease of pvep wave amplitude in oht patients will assist in establishing diagnosis. the study was a cross - sectional study, the patients were not followed up, the changes were not evaluated by time, perg or mferg might be more accurate to assess the erg changes in this group of patients, and the examinations and tests might have been combined with optical coherent tomography to identify retinal nerve fiber layer loss especially in the oht group ; however, only fundus examination was performed for optic disc evaluation. it has not set forth how much information should be provided by electrophysiological test parameters for oht diagnosis yet. this issue will be elucidated with the studies to be carried out on cases suspected to have oht. it is believed that the studies to be performed on this subject by electrophysiological tests, which are considered important in this study, will provide positive results. | purpose. to evaluate the changes of flash electroretinography (ferg) and pattern visual evoked potentials (pvep) in ocular hypertension (oht) patients. methods. twenty - five oht patients and 30 healthy volunteers were enrolled for this cross - sectional study. opthalmologic examinations, visual field tests, pvep and ferg were performed. the main outcome measures were the differences between pvep and ferg parameters. results. the mean age of oht patients and volunteers were 57 12.25 years (range 3065 years), and 53.25 12.0 years (range 3065 years), respectively. the mean amplitude of the pvep was statistically lower in the oht group (p 0.05). in ferg of oht group, there was a significant decrease in the amplitude of the oscillatory potentials (ops), and a significant delay in latency of rod and cone waves (all p 0.05). conclusions. although we found a decrease in ops amplitude and a prolonged latency in flicker ferg, only the decrease in ops amplitude was statistically significant between the two groups. the amplitude of ops wave and amplitude of pvep may reflect early glaucomatous damage in oht patients. |
this was a very unusual presentation of a post - operative complication after rectal surgery. this presentation necessitated early and aggressive surgical and medical treatment to avoid major complications of sepsis. in this case the patient had had a rectal surgery 2 years before that disrupted normal pre - sacral and retroperitoneal anatomy. a 61-year - old man presented to the emergency department for fever since few days with abdominal pain and lack of gas and stools. the pain had become worse and was associated with electric shocks in both lower extremities. two years before, the patient had a laparoscopic proctectomy with ileal pouch anal anastomosis protected by an ileostomy for a voluminous villous tumor of the lower rectum. this intervention was complicated at the third day of a fever that prompted an abdominal computer tomography (ct)-scan revealing intra - abdominal effusion in the left flank drained by the per - operative blake drain, syringed daily and treated by intravenous antibiotics. the patient had a high fever (tc 39.3c) but had no sign of severe sepsis (heart rate was 88 bpm and blood pressure was 113/78 mmhg). an abdominal ct - scan showed a recurrence of digestive tumor in pelvis with a digestive presacral fistulization without circumscribed fluid collection. a sagittal section abdominal ct and magnetic resonance imaging (mri) (figs. 12) showed colic fistula to the presacral collection measured to 38.8 9.54 mm with infiltration of adjacent soft tissue and which continues to the spinal canal through the sacral s1 left hole with multiple epidural abscess from l4 to s4. figure 1:axial view contrast - enhanced mdct (portal phase) with oral opacification, in a x year - old men with a large esophageal gist, showing a lesion (), well - circumscribed, with small calcifications () (rare). figure 2:coronal view of contrast - enhanced mdct showing the exophytic, non - obstructive lesion () located at the esogastric junction. axial view contrast - enhanced mdct (portal phase) with oral opacification, in a x year - old men with a large esophageal gist, showing a lesion (), well - circumscribed, with small calcifications () (rare). coronal view of contrast - enhanced mdct showing the exophytic, non - obstructive lesion () located at the esogastric junction. an intraoperative rectoscopy was performed. at the joining up end - to - end anastomozing colon a colostomy was performed to defunctionalize the fistula. on consultation with the microbiology treatment, tazobactam against the septicaemia of escherichia coli (found in blood culture) during 2 months. previous studies published about epidural abcess secondary to abdominal sepsis concern a context of appendicitis, stercoral ulcer rupture, immunocompromised patients, acutization of crohn 's disease, disadvantaged social status and bad oral conditions. one study described presacral pelvic abscess continuous with the tip of the appendix in a patient of antecedent of rectal adenocarcinoma. the other one concerns presacral pelvic abscess at the recto sigmoid junction extended into the presacral musculature and gas bubbles extended into the epidural space at l3. however, there are no studies dealing with a presacral fistula between a chronic presacral collection and spinal canal after of laparoscopic proctectomy for tubulo - villous resection of rectum with osteitis and arachnoiditis. it was sometimes necessary to realize intervertebral disc biopsy, bacteriological fluid drainage, parasitological examination of stools and lumbar puncture. the origin of the abscess was different between cases reported : presacral pelvic abscess continuous with the tip of appendix after abdominoperineal resection for adenocarcinoma and chemo radiotherapy, stercoral ulcer rupture, immunocompromised patients, acutization of crohn 's disease, disadvantaged social status, bad oral conditions, fistula after laminectomy l4 between the wound and the first sacral foramen. the abscess concerns more frequently the cervical spine but any spinal cord could be reached and cause a fistula with other soft tissue. there is no precise data in the literature about the time between the abscess and this cause. in our case, tazobactam against escherichia coli (found in blood culture) during 2 months. on the one hand, the choice may be chosen by the degree of clinical neurological and imagery damage as well as the germs found in bacteriological samples. negative gram bacilli were most frequently found especially bacteroid fragilis and e. coli and positive gram bacilli (streptocoque intermedius). on the other hand, all teams operate their patients except for two case reports of lechiche. in 2006 who decided to use only medical treatment with antibiotics. for the others, decompressed laminectomy was each time necessary in the case of neurological deficit at the clinical examination with a fluid drainage [2, 4 ]. in our case, as in the m.h. an appendectomy was necessary with a drainage of the collection for the case of carter. in 2014, an urgent hartmann 's resection for focal perforation of the recto sigmoid junction for the case of uy. and ileocecal resection of the affected bowel with drainage of the multiple abscesses in r. maggiore 's case. concerning the type of antibiotherapy, there was no consensus and each team used different initial empiric antibiotics. what can be noticed is that after antibiogram most teams used a g penicillin associated with metronidazole. only one team has chosen to switch with intravenous piperacillin tazobactam. for five of these studies a resolution of intraspinal gas and abscess but persistent sacral osteomyelitis occurred in two cases [5, 7 ]. to conclude | a 61-year - old man presented via the emergency department with a few days history of abdominal and colic occlusion symptoms. he presented signs of sepsis, midline lumbar spine tenderness and reduced hip flexion. computer tomography of the abdomen and pelvis showed a presacral collection contiguous with the posterior part of the colo - rectal anastomosis, and mri lumbar spine revealed abscess invation into the epidural space. he underwent a laparotomy with washout of the presacral abscess and a colostomy with a prolonged course of intravenous antibiotic therapy. at 3 weeks after initial presentation he had made a full clinical recovery with progressive radiological resolution of the epidural abscess. the objective of the case report is to highlight a unique and clinically significant complication of a rare post - operative complication after rectal surgery and to briefly discuss other intra - abdominal sources of epidural abscess. |
chagas disease continues to pose a serious threat to health in latin america and mexico, and is the most important emerging parasitic disease in developed countries. according to the world health organization, the overall prevalence of human trypanosoma cruzi infection is at ~1618 million cases, and ~120 million people are at risk of infection in latin america. in most patients, the early period of t. cruzi infection goes virtually unnoticed whereas others develop an acute phase that lasts several weeks and is accompanied by such nonspecific symptoms, fever, tachycardia, weakness, and lymphadenopathy [2, 3 ]. after acute control of t. cruzi, infected patients enter an indeterminate phase, defined by the absence of clinical symptoms although subclinical pathology may be present. unfortunately, 1530 years after the initial infection, 3040% of the infected patients develop life threatening dilated cardiomyopathy associated with clinical symptoms of ventricular dilation, arrhythmia, and cardiac arrest. the pathological developments and clinical symptoms vary widely among chagasic patients [2, 57 ]. not every individual infected with t. cruzi experiences the abnormalities characteristic of the three phases of chagas disease : acute, indeterminate, and chronic. these facts make chagas disease a complex disease and difficult to understand. over the years, a number of mechanisms have been proposed to explain the pathogenesis of chagas disease (reviewed in [8, 9 ]). there is growing evidence to suggest that chagasic myocardia are exposed to sustained oxidative stress - induced injuries that may contribute to disease progression. in this review, we discuss the evidence for increased oxidative stress in chagasic disease, with emphasis on mitochondrial abnormalities, as well as electron transport chain dysfunction, and its role in sustaining oxidative stress in myocardium. broadly defined, reactive oxygen species (ros, e.g., o2, oh, and h2o2) are derivatives of molecular oxygen. ros are unstable and react rapidly with other free radicals and macromolecules in chain reactions to generate increasingly harmful oxidants. ros are produced through the action of specific oxidases and oxygenases (e.g., xanthine oxidase, and nadph oxidase), peroxidases (e.g., myeloperoxidase), the fenton reaction, and are also by - products of the electron transport chain of mitochondria. nitric oxide (no) is produced by the enzymatic activity of nitric oxide synthases (nos), which oxidize l - arginine, transferring electrons from nadph. different nos isoforms have been identified, for example, inducible nos (inos) in phagocytic cells, mtnos in mitochondria, (enos) in endothelial cells, and neuronal nnos. during the course of t. cruzi infection and disease development, ros can be produced as a consequence of tissue destruction caused by toxic secretions of parasite, immune - mediated cytotoxic reactions, and secondary damage to mitochondria. in experimental studies, t. cruzi infection has been suggested to initiate ros formation via the stimulation of inflammatory mediators, for example, cytokines and chemokines, which lead to an oxidative burst of phagocytic cells. several investigators have used in vitro assay systems or animal models and demonstrated that t. cruzi - mediated macrophage activation results in increased levels of o2 formation, likely by the nadph oxidase - dependent oxidative burst [1214 ]. in addition to ros, activated macrophages can produce large amounts of no by inos. accordingly, tnf-- and ifn--dependent increased inos expression and no production is noted in splenocytes of t. cruzi - infected mice and in macrophages infected in vitro with t. cruzi. we have found increased levels of myeloperoxidase and nitrite in the plasma of t. cruzi - infected mice that are markers of neutrophil and macrophage activation, respectively. relatively few studies have been performed to elucidate inflammatory oxidative stress in human patients. in humans, the severity of cardiac disease was correlated with high plasma levels of tnf- and no. these reactive oxidants are important for the control of t. cruzi, and may elicit toxicity to host cellular components. recent studies provide evidence for enhanced mitochondrial ros generation (h2o2 and o2) in chagasic myocardium. mitochondria are the prime source of energy and many of the body 's functions, including those of cardiac metabolic and contractile activities, require mitochondrial generation of atp. electron microscopic analysis of heart biopsies from chagasic patients and experimental animals have shown that with disease development, mitochondrial degenerative changes, that is, swelling, irregular membranes, and loss of cristae, accrue in the heart with disease development [2023 ]. global microarray profiling of gene expression has identified alterations in several of the mitochondrial function related transcripts in the myocardium of infected humans and experimental animals [25, 26 ]. the biochemical evidence for the mitochondrial dysfunction was provided by documentation of a decline in the activities of respiratory complexes, nadh - ubiquinone reductase (ci) and ubiquinol - cytochrome c reductase (ciii) and atp synthase (cv) complex in chagasic murine hearts. the functional effect of these perturbations was shown by decreased mitochondrial respiration, and reduction in myocardial and mitochondrial atp levels in chagasic experimental models. the rate of electron leakage and o2 formation in mitochondria is closely related to the coupling efficiency between the respiratory chain and oxidative phosphorylation. the ci and ciii complexes are the main sites for electron leakage to o2 and o2 generation in mitochondria [32, 33 ]. we have shown a decline in complex i and complex iii activities in the myocardium was associated with excessive leakage of electrons to molecular oxygen and sustained ros production in chagasic mice. further studies identified that ci was not the main source of increased ros in chagasic hearts. instead, defects of the myxothiazol - binding site in ciii complex resulted in enhanced electron leakage towards the qo - center, and contributed to increased ros generation in chagasic cardiac mitochondria. the overall level of cellular ros and its biological effects are determined by the relative rates of ros generation and the rate of reduction by antioxidants. the principal enzymatic antioxidants are superoxide dismutase (sod), catalase (cat), peroxiredoxin (prx), and glutathione peroxidase (gpx). sod exists in different isoforms, for example, manganese sod (mnsod) in the mitochondrial matrix and cu- or zn - sod in the cytoplasm, mitochondria intermembrane space, and endothelial cell surface. the five isoforms of gpx utilize glutathione (gsh), and reduce h2o2 or lipid peroxides (rooh) to h2o or alcohols (roh), respectively. the byproduct of this reaction, gssg is recycled by glutathione s reductase. the nonenzymatic antioxidants, for example, vitamin e (-tocopherol) and vitamin c (ascorbate), are abundant in aerobic organisms. vitamin c, a highly soluble antioxidant in plasma, functions by reducing -tocopherol - lipid peroxide radicals, particularly formed in reaction with the low - density lipoproteins (ldl). the myocardium contains high concentrations of various nonenzymatic antioxidants such as reduced glutathione (gsh) and vitamins a, c, and e, and enzymatic scavengers of ros, including gpx and mn- and cuzn - sod. gsh, gpx, and mnsod are shown to be most critical in cardiac antioxidant defenses, particularly in protecting the cardiomyocytes from oxidative injury [39, 40 ]. we and others have evaluated the antioxidant / oxidant balance in experimental models of chagasic disease and human patients. our experimental studies showed that the host responds to acute t. cruzi infection by upregulating glutathione antioxidant defense constituted by gpx, gsr, and gsh. however, after the initial burst, the glutathione defense was unresponsive to chronic oxidative stress, and the cardiac levels of gsh and mnsod were significantly diminished in chagasic mice. a decline in plasma levels of gsh, the gsh / gssg ratio [42, 43 ], and gpx activity, along with decreased mnsod activity in pbmcs of seropositive chagasic patients [42, 43 ] is also noted. decreased antioxidant levels (gpx and sod) all of these observations suggest an antioxidant response is not sufficiently activated to scavenge the ros during progressive chagasic disease. ros and no, when produced in physiological quantities, play critical roles in normal developmental processes, and control signal transduction mechanisms that regulate cell proliferation, differentiation, and death [44, 45 ]. however, when ros are produced in excess or for sustained periods, they may exert toxic effects that damage cells and tissues, thereby resulting in dysfunction of physiological processes. specifically, 4-hydroxynonenal (hne) and malonyldialdehyde (mda) are products of the peroxidation of membrane phospholipids [4648 ]. these oxidized lipids are also toxic because they are highly reactive species that result in oxidative modification of proteins. for example, hne reacts with cys, his, or lys residues via a michael addition that results in irreversible alkylation and introduction of carbonyl groups into proteins. the direct oxidative attack by ros on arg, lys, pro, and thr residues can also derivatize the proteins and lead to the formation of protein carbonyls [50, 51 ]. myeloperoxidase - dependent oxidation of nitrite (no2) results in formation of nitrogen dioxide (no2) and nitryl chloride (no2cl). these reactive nitrogen species (rns) result in protein tyrosine nitration that is widely recognized as a hallmark of nitrosative stress and inflammation. because of oxidation or nitration, a functional impairment of proteins occurs, and furthermore leads to protein turnover, for example, degradation by proteases via the proteosome. dna can be oxidized by a variety of mechanisms, resulting in nucleotide damage, for example, formation of 8-oxoguanine lesions. as a result while mechanisms exist to repair these dna lesions, the level of dna damage may exceed the capacity of the cellular repair mechanisms. furthermore, mtdna is believed to be particularly susceptible to sustained damage, since mitochondria may lack appropriate dna repair mechanisms. t. cruzi has the potential to infect a wide range of host tissues. as discussed above, the inflammatory infiltrate in acutely infected host is mainly constituted of phagocytic cells (e.g., macrophages) and neutrophils that produce ros / rns through oxidative burst, inos - dependent no release, and myeloperoxidase - dependent hocl production. oxidative damage is a consequence of the extent of oxidative stress and the antioxidant capacity. a t. cruzi - infected host does respond to inflammatory oxidative stress by an upregulation of antioxidant response constituted of gpx, gsh, and gst. yet, oxidative cellular damage, evidenced by increased protein carbonyls, mda, and gssg levels, is widespread, and associated with the presence of parasite foci and inflammatory infiltrate in the heart, as well as in other muscle tissues in acutely infected mice. the acute oxidative damage, thus, appears to be a bystander effect of inflammatory responses elicited by t. cruzi, and occurs in all muscle tissues. the immune control of acute parasitemia fails to provide sterile immunity. the evolution of a chronic phase is associated with mild - to - moderate diffused inflammation in different tissues and organs. it would be an oversimplification to suggest that cardiac pathology is merely an outcome of infection and inflammation, or parasite persistence that is sufficient to drive an ongoing host immune response targeted against t. cruzi. an unvarying high degree of oxidative damage persists mainly in the myocardium of chronically infected mice, as evidenced by high levels of mda, protein carbonyl, and gssg contents in the heart compared to findings in the skeletal muscle and colon tissue. we propose the persistent activation of oxidative injurious processes plays an important role in heart - specific tissue damage in chagas disease. several observations led us to consider that ros in chronic chagasic heart are primarily produced by dysfunctional mitochondria. it is well known that ros are generated at several subcellular sites and particularly in mitochondria. in effect, ~2% of the o2 consumed by mitochondria is converted to o2 due to spontaneous electron leaks from the respiratory chain. activated skeletal and intestinal muscles intermittently require mitochondria as an energy source, while cardiomyocytes are constantly dependent upon mitochondrial functions for their energy requirement for maintaining the contractile and other metabolic activities. according to energy demand, a ~30% cell volume of cardiomyocytes is provided by mitochondria, while in other tissues mitochondria constitute only 36% of cell volume. thus, maximal o2 consumption, as would be expected based upon the number of mitochondria in the heart, would produce substantial o2 in the heart through electron leakage from the respiratory chain. thus, it can be inferred that even in normal conditions, heart tissue is maximally exposed to ros of mitochondrial origin. besides this, inefficient functioning of the respiratory complexes, as documented in chagasic hearts, would result in an inadequate coupling of the respiratory chain with oxidative phosphorylation and an excessive release of electrons to molecular oxygen, leading to an increased mitochondrial ros production. we have recently found that the rate of mitochondrial o2 generation was substantially increased in cardiac tissue of infected mice, and associated with the oxidation of several subunits of the respiratory complexes. the active - site thiol and heme proteins within respiratory complexes are particularly vulnerable to ros. the oxidative modification / degradation of heme proteins of the complexes release iron, the catalyst of the fenton reaction, resulting in the formation / release of oh radicals [6466 ]. taken together, these observations suggest that, under disease conditions, mitochondria are vulnerable to oxidative stress, as well as to becoming the site of an increasing order of ros production. we, thus, propose that the acute inflammatory oxidative stress - induced mitochondrial injuries initiate a feedback cycle of ros production and oxidative overload that causes sustained oxidative damage in the myocardium. a compromise in mitochondrial antioxidant enzyme activity (mnsod) in chagasic myocardium would further exacerbate the mitochondrial ros toxicity. the foregoing studies have pointed to the pathologic significance of oxidative responses in chagasic cardiomyopathy. it is important to note that a high degree of oxidative stress is detected in the peripheral blood of chagasic mice. the demonstration of a strong positive correlation in the heart - versus - blood levels of oxidative stress markers (mda and gssg), and antioxidants (sod, mnsod, and catalase), and the mitochondrial inhibition of respiratory complexes in chronically infected mice have made it apparent that peripheral blood will be useful for understanding the role of mitochondrial decay and oxidative stress in the initiation and progression of human chagasic disease. subsequently, observations of increased plasma levels of gssg and mda and a decline in gpx activity in seropositive humans [18, 42 ] have led to the suggestion that chagasic patients are indeed exposed to an antioxidant / oxidant imbalance. as in experimental studies, multiple mechanisms are likely to contribute to increased oxidative stress - induced damage in chagasic patients. plasma levels of inflammatory cytokines, no and myeloperoxidase activity are increased in seropositive subjects which seems to imply that the cytotoxic effects of free radicals released by immune cells would contribute to oxidative pathology in chagasic patients. the increase in plasma mda levels in chagasic patients may also be due to oxidatively modified lipids released as a consequence of cellular injuries, most likely, that are incurred in the cardiac tissue. this notion is supported by the observation of intense myocardial oxidative modifications associated with the detection of oxidatively modified lipids and proteins in the serum of mice infected by t. cruzi. additionally, sod and glutathione (gpx - gsh - gr) antioxidant defenses, utilized by mammalian cells to cope with free radicals, are found to be compromised in chagasic patients [18, 42 ]. these observations support the idea that glutathione antioxidant defenses, despite being active, may only be partially effective in balancing the oxidant level in chagasic patients. interventions that reduce the generation or the effects of ros may exert beneficial effects in preventing or arresting oxidative damage. several therapeutic interventions, for example, a vitamin e - like antioxidant, an sod mimetic [68, 69 ], and an onoo decomposition catalyst have been examined for their beneficial effects against ros in different systems. phenyl - n - tert - butylnitrone (pbn), a nitrone - based compound, is a potent antioxidant. pbn has been shown to trap or scavenge a wide variety of free radical species, including biologically relevant o2 and hydroxyl oh radicals ; to increase endogenous antioxidant levels ; and to inhibit free radical generation. in addition, pbn has been shown to inhibit the expression of a variety of inflammation - associated gene products. in a recent study, we have shown that pbn treatment of infected mice prevented an oxidative stress - mediated loss in mitochondrial membrane integrity ; preserved redox potential coupled with mitochondrial gene expression, and improved respiratory complex activities in infected myocardium. importantly, the pbn - mediated normalization of respiratory complex activities led to the inhibition of a feedback cycle of electron transport chain inefficiency, increased ros production, and energy homeostasis in acute chagasic hearts. others have shown a decline in oxidative stress in human chagasic patients given vitamin a. we propose that antioxidants capable of modulating or delaying the onset of oxidative insult and mitochondrial deficiencies in the myocardium would prove to be useful in preserving cardiac functions in chagas disease. approximately 10% of chronic chagasic patients exhibit signs of ischemic disease [74, 75 ]. the abnormalities during isovolemic contraction and the early relaxation phase, in general ascribed to asynchronous onset of contraction, are noted in chagasic patients, and are similar to that seen in patients with conventional ischemic heart disease of other etiologies. others have suggested the alterations in the coronary microcirculation contribute to ischemic tissue damage in chronic chagasic patients [75, 7780 ]. myocardial hypoperfusion owing to an affected microvasculature has also been noted in chagasic heart regions with normal or mildly impaired wall motion [75, 80 ]. hypoxia is a critical outcome of ischemia. in hypoxic tissues, low availability of oxygen results in electron accumulation in highly reduced respiratory complexes that lead to severely compromised respiration and atp synthesis [8183 ]. ischemia also influences mitochondrial function via change in calcium flux, cyt c depletion (reviewed in), and decline in intrinsic level of mnsod the mtros scavenger. the inefficient scavenging of mtros during hypoxia is complemented by increased production of ros at reperfusion. mitochondrial loss of cyt c is considered to potentate ros production at reperfusion because (a) cyt c is a catalytic scavenger for mitochondrial o2, and (b) loss of cyt c results in highly reduced state of respiratory complexes i, ii, and iii, thus, favoring electron release to molecular oxygen and o2 production [88, 89 ]. these observations suggest that mitochondrial inhibition of respiration and atp synthesis resulting from hypoxia, coupled with an increase in o2 formation and ros - induced injurious effects during reperfusion, potentially contribute to the contractile dysfunction and cell death in chagasic hearts, to be confirmed in future studies. sustained ros generation of inflammatory and mitochondrial origin, coupled with an inadequate antioxidant response, result in the inefficient scavenging of ros in the heart, and lead to long - term oxidative stress, and subsequently, to oxidative damage of the cardiac cellular components during chagasic disease. the alterations in biomarkers of oxidant and antioxidant status and in respiratory complex activities in the heart and blood / plasma of infected host appear to have same pathologic tendencies, which led to the suggestion that peripheral blood would be a useful tissue for investigating the pathologic importance of impaired mitochondrial function and oxidant / antioxidant status in chagasic disease development. further studies should examine the pathological relevance of oxidative stress in clinical severity of chronic heart disease in chagasic patients. | there is growing evidence to suggest that chagasic myocardia are exposed to sustained oxidative stress induced injuries that may contribute to disease progression. trypanosoma cruzi invasion- and replication - mediated cellular injuries and immune - mediated cytotoxic reactions are the common source of reactive oxygen species (ros) during acute infection. mitochondria are proposed to be the major source of ros in chronic chagasic hearts. however, it has not been established yet, whether mitochondrial dysfunction is a causative factor in chagasic cardiomyopathy or a consequence of other pathological events. a better understanding of oxidative stress in relation to cardiac tissue damage would be useful in the evaluation of its true role in the pathogenesis of chagas disease and other heart diseases. in this review, we discuss the evidence for increased oxidative stress in chagasic disease, with emphasis on mitochondrial abnormalities, and its role in sustaining oxidative stress in myocardium. |
glaucoma is a slowly progressive optic neuropathy with potential causative mechanisms related and unrelated to ocular hypertension.1,2,3 the only proven therapy for slowing glaucomatous visual field loss and therefore the only modifiable disease risk factor is through lowering of the intraocular pressure (iop).4,5 topical pressure - lowering medications are often successful at lowering the pressure to an acceptable level.6 determining the effectiveness of iop - lowering medications is important because glaucoma drugs are not equally effective in every patient, a problem for which few predictive parameters are available.4,7 also, once initiated, iop - lowering medications are often used throughout the lifetime of a patient.4,8,9 these drugs are costly, impact quality of life, and may have side effects.4,811 therefore, it is incumbent on the clinician to carefully assess medication effectiveness ; if a drug is found to be ineffective it should be discontinued. effectiveness is determined by comparing the intraocular pressure before starting a drug to the intraocular pressure after starting a drug.9 this sounds simple, but in clinical practice pressure changes can be very difficult to assess because of daily fluctuations in eye pressure.12 there is a 12 mmhg degree of uncertainty in an individual eye pressure measurement, and a 36 mmhg variation in an individual s eye pressure during the day, known as diurnal fluctuation.1216 considering these two types of variation added together, without making any medication changes, the pressure may be 18 mmhg on one day and 13 mmhg at another time point the next day because of normal variation and measurement inaccuracies. similarly, the pressure may be 18 mmhg on one day and then 18 mmhg the next week after starting a medication. this lack of change would suggest that the medication was not effective, when in reality, had the pressure been as high as 22 without the drops, the medication could well have been effective. finally, the expected change in the iop with the addition of a new medication ranges from 210 mmhg depending on the initial pressure and on whether initial or adjunctive medications are being added. this small pressure change is in the same range as the sum of diurnal fluctuation and measurement variability in iop. these examples show that any given measurement of iop can be significantly altered by several different uncontrollable mechanisms, which results in the difficulty of determining medication effectiveness in the clinical setting. to determine the effectiveness of a medication against the background of measurement error and diurnal fluctuation monocular trials have been used in ophthalmology for many years, but only recently has the term appeared in the literature on pressure assessment, and the monocular trial has not previously been tested against other techniques for determining medication effectiveness other than prostaglandins.17,18 with a monocular trial, the pressure is taken in each eye before starting the new medication (ie, 23 right eyes [od ], 25 left eyes [os ]), the drug is started in only one eye (od, for example), and then the pressure is measured in each eye several weeks later. if the pressure in the treated eye decreases in relation to the pressure in the untreated eye and decreases > 15% from the baseline pressure, the medication is deemed effective.19 there are several assumptions made with this technique.20 one is that the two eyes are closely correlated in their pressure fluctuation, and another is that there is no crossover effect from the medication.20,21 a recently published study of glaucoma patients agrees with this first assumption,22 in contrast to a prior study of healthy patients which suggested that the eyes are not correlated with respect to iop fluctuation. 23 with regards to the second assumption, there is published evidence that certain drugs, beta blockers in particular, do have a contralateral effect.20,24 considering these issues, our current knowledge of iop variability suggests that a monocular trial may not be the best means of determining medication effectiveness. thus, we have performed a prospective clinical data collection to further investigate the efficacy of the monocular trial in determining if a particular glaucoma medication will be effective in comparison with the gold standard method of iop measurement and treatment. the study was a prospective clinical data collection study approved by the institutional review board of the university of missouri - kansas city. all patients signed a written consent to participate and the study was performed in compliance with the declaration of helsinki.25 patients were required to have raised iop such that the clinician felt that additional pressure - lowering medication was warranted. all forms of raised iop were acceptable including primary open - angle glaucoma, pseudoexfoliation, pigmentary dispersion, and chronic angle - closure glaucoma. conditions being treated with other medications (steroids, nonsteroidal anti - inflammatory drugs) such as uveitic glaucoma and postoperative pressure elevations were excluded, as pressure elevations in these disease states may change over a short time and interfere with true assessment of iop change. iop had to be below 32 mmhg as higher pressures may necessitate more rapid intervention or the addition of multiple medications at one visit. the patient must have had no clinically apparent corneal edema or central corneal scarring which might interfere with applanation tonometry. systemic medical conditions and medication use (such as preoperative beta - blockers) guided the choice of appropriate pressure - lowering drops but were not exclusion criteria for the study. each patient completed five visits over the course of the study with a total time frame of 36 months. visit # 1 consisted of determining eligibility, obtaining consent, and measuring iop with goldmann applanation tonometry.. visit # 3 consisted of a third iop measurement and initiation of pressure - lowering medication 121 days after visit # 2. patients in this study used any one of the following medications : beta blocker, brimonidine, dorzolamide, or a prostaglandin. visit # 4 occurred 2135 days after visit # 3 and consisted of an iop measurement, the first after starting medication. visit # 5 occurred 121 days after the previous visit and consisted of an iop measurement, the second after initiating medical therapy. at this point, if the medication was deemed effective it was continued and a final visit 23 months later for iop measurement was completed. the goal of the present study was to identify if using a monocular trial of a pressure - lowering medication is an accurate determination of whether that medication is effectively lowering the iop, when compared to multiple measurements of iop before and after treatment initiation.26 mean iop measurements for the treated eye at each visit are displayed in figure 1 (panel a : visits 13 ; panel b : visits 45). in the treated eye, mean iop was reduced from 21 mmhg before initiation of medication down to 16 mmhg after starting medication, resulting in an overall reduction of 5 mmhg, a 24% reduction in iop. thus, given this iop reduction of > 15%, medical intervention was deemed effective. of the medication additions, 25/42 (60%) were considered effective by the gold standard method of multiple measurements of iop before and after treatment initiation, and 25/42 (60%) by the monocular trial method. however, the two methods agreed in only 26 patients (17 yes / yes, 9 no / no ; figure 1c). the calculated sensitivity was low at 0.68, with a specificity of 0.53. while figure 1 shows individual values for all subjects, the individual data sets comparing success of medical intervention (figure 1c) are summarized in figure 2. in our study, 42 patients with elevated eye pressure were treated with a pressure - lowering medication with pressure data recorded on three premedication visits and two post - medication visits. of the 42 patients who completed our treatment protocol, the medication addition was considered effective in 25 when measured by monocular trial. the two methods agreed in only 26 patients. thus, with a low sensitivity of 0.68 and a specificity of 0.53, it appears that the monocular trial is less effective than the gold standard of multiple pre- and post- treatment measurements. however, the monocular trial disagreed with the gold standard 38% of the time, thus the monocular trial can be deemed an unreliable measure of medication effectiveness. therefore, the gold standard of multiple measurements of iop before and after treatment initiation may need to be reevaluated with respect to reliable numbers for data points acquired before and after treatment. perhaps a more statistically powerful method of treatment would be one in which more data points could be created, taking into account several pre- and post - treatment iop measurements and to standardize treatments and measurements to specific times of day. however, we would note that in clinical practice, this many visits and measurements may be difficult or even impractical to achieve. despite the fact that only two prospective studies of the monocular trial,20,26 both with reasonably inconclusive results, have been published, it is still frequently used in the practice of treating glaucoma.26 according to a study of 26 subjects in 2009 by realini, the monocular trial is not superior to the gold standard.26 another more recent study, published by bhorade in 2010 found the monocular trial not to be an adequate method of determining a medication s response to treatment with topical prostaglandins.20 realini s study found the monocular trial to be an inadequate predictor of long - term iop reduction by prostaglandins.26 bhorade s study also found the monocular trial to be an inadequate method of determining the patient s response to pressure lowering with prostaglandins.20 like these previous two studies, our study agrees that the monocular trial provides a lower statistical reliability than the gold standard of multiple measurements of iop before and after treatment initiation, and overall is not a reliable measure of effectiveness.20,26 our study included data on 42 patients, while realini26 evaluated 26 subjects and bhorade evaluated 206. while our study evaluated only the short - term effect of the monocular trial in determining the efficacy of a given pressure - lowering medication (ie, over the course of 23 months after initiating a pressure - lowering medication), realini26 also measured long - term results which consisted of following pressure measurements for 6 months after the addition of the pressure - lowering medication.26 his results at 6 months showed the monocular trial to again be a poor predictor of long - term iop reduction.26 while our study included patients using any class of first line pressure - lowering medication, realini26 and bhorade only tested one medication, topical prostaglandins (specifically latanoprost in realini).26 we feel that our results are more reflective of the way in which medication additions are carried out in general clinical practice, as patients may be using any one of various medication options, instead of just prostaglandins. overall, we concur with previous studies that the monocular trial is less effective than measuring an unadjusted pressure in each eye in response to treatment. however, the monocular trial has a practical advantage over the gold standard in that it requires fewer clinic visits and is thus more feasible. therefore, for a subset of patients, such as individuals unable to attend multiple pre- and post - medication follow - ups, the monocular trial can provide clues as to whether a given pressure - lowering medication is effective ; however, it remains less effective than the gold standard of multiple measurements before and after medication initiation. | the monocular trial has been proposed as a test to help control for diurnal fluctuations in eye pressure when assessing medication effectiveness. we undertook a prospective study to determine the sensitivity and specificity of the monocular trial as a test for determining the effectiveness of a glaucoma medication. the efficacy of the monocular trial was compared to the diagnostic paradigm of repeated pre- and post - treatment measurements in determining whether an intraocular pressure (iop)-lowering drug is effective. forty - two patients with newly diagnosed open - angle glaucoma completed five visits : visit 1 for determining eligibility, obtaining consent, and measuring iop, visit 2 for a second pressure measurement, and visit 3 for a third pressure reading. the new medication was then started in one eye. iop measurements were made at weeks 4 and 6. the gold standard iop change was defined as the difference in mean between the pre- and post - medication visits. a medication was deemed effective if this difference was at least 15%. the monocular trial pressure change was defined as the iop change in the treated eye between the visit immediately before and immediately after the medication addition, corrected by subtracting the pressure change in the untreated eye. all 42 patients completed the full protocol with good compliance. twenty - five of 42 (60%) medication additions were considered effective by the gold standard method, and 25/42 (60%) by the monocular trial method. however, the two methods agreed in only 26 patients (17 yes / yes, 9 no / no). the calculated sensitivity was low (0.68), with a specificity of 0.53. the monocular trial can give useful clues as to whether a medication is effective, but should not be the only information used in making this determination. to obtain the most valid results, multiple pressure checks should be done before and after starting a new medication. |
brain damage following traumatic injury is a result of direct (primary injury) and indirect (secondary or delayed injury) mechanisms. the secondary injury mechanism involves the initiation of an acute inflammatory response, including breakdown of blood - brain barrier (bbb), brain edema, infiltration of peripheral blood cells, and activation of resident immunocompetent cells, as well as the release of numerous immune mediators such as interleukins and chemotactic factors. and the subsequent inflammation leads to secondary damage not only in brain but also in other organs [24 ]. nuclear factor erythroid 2-related factor2 (nrf2) is a transcription factor that regulates many kinds of antioxidant genes. several studies have demonstrated that nrf2 regulates the inflammation in the brain after traumatic brain injury (tbi). it was also showed that tbi could induce more aggravated damage in nrf2 knockout mice than in wildtype mice. on the contrary, such inflammation can be extenuated through elevating the level of nrf2 by its inducers, such as sulforaphane (sfn). it is well documented that astrocytes play a critical role in maintaining normal brain physiology and responding to injury or disease. therefore, here we analysed the influence of nrf2 on the expression of proinflammatory cytokines in primary cultured astrocytes from transgenic mice after scratch injury. primary astrocytes were obtained from postnatal 2-day - old nrf2 wide type (wt) and knockout (ko) mice (6 mice for each genotype). following decapitation, the cortices were dissected out, and the meninges and associated blood vessels were removed. the tissue was roughly chopped with a scalpel blade, incubated in 0.5% trypsin for 10 minutes at 37c, and agitated every few minutes. after digestion, the tissue was rinsed twice in dmem with 10% fbs, followed by a mechanical dissociation in dmem with 20% fbs and 5 units / ml penicillin, 5 g / ml streptomycin (complete culture medium). after incubation for 1 h, the supernatant was transferred to a new flask or dish (costar, usa) for depleting the residual epithelial cells. then the flasks or dishes were shaken at 150 rpm for 4 h to deplete the microglia and less adherent cells from the cultures. after shaking, the resulting cultures were mainly astrocytes, which were determined by immunoreactivity for gfap (sc-166481, santa cruz biotechnology, ca, usa). the cell monolayer was scratched with a sterile 26 g syringe needle, resulting in the formation of a 0.5 mm wide gap. immediately after scratch, cells were washed twice with sterile pbs, cultured with complete culture medium, and named as tbi group. cells, which did not received scratch, were used as blank control and named as sham group. 1 10/well cells were seeded to 96-well culture plates and cultivated for 24 h to adhere. astrocyte cell death was assessed by cell counting kit-8 (cck-8) (dojindo, japan) assay 24 h after scratch according to the manufacturer 's protocol. briefly, 10 l cck-8 was added into every well and incubated for 1 h. then od value was read at 450 nm using a bio - rad elisa microplate reader (bio - rad laboratories, ca, usa). the cell pellet obtained by centrifugation was resuspended in buffer containing 10 mm hepes (ph 7.9), 10 mm kcl, 0.1 mm edta, 0.1 mm egta, 1.0 mm dtt, and 0.5 mm phenylmethylsulfonyl fluoride. then 10% nonidet p-40 was added and vortexed briefly, and the nuclei were pelleted by centrifugation. the nuclear proteins were extracted with buffer containing 20 mm hepes (ph 7.9), 0.4 mm nacl, 1.0 mm edta, 1.0 mm egta, 1.0 mm dtt, and 1.0 mm phenylmethylsulfonyl fluoride. insoluble material was removed by centrifugation at 14000 rpm, and the supernatant containing the nuclear proteins was stored at 80c until use. protein concentration was determined using a bicinchoninic acid assay kit with bovine serum albumin as the standard (pierce biochemicals, rockford, il, usa). emsa was performed using gel shift assay system (promega, madison, wi, usa). consensus oligonucleotide probe (5-agttgaggggactttcccaggg-3) was end - labeled by t4-polynucleotide kinase using [-32p]-atp (free biotech., beijing, china). nuclear protein (20 g) was preincubated in 20 l binding buffer containing 10 mm tris - hcl (ph 7.5), 1 mm mgcl2, 0.5 mm nacl, 4% glycerol, 0.5 mm edta, 0.5 mm dtt, and 2 g poly di - dc for 20 minutes on ice. after addition of the 1 l 32p - labled oligonucleotide probe, the incubation was continued for 20 minutes on ice. the dna - protein complexes were separated by electrophoresis on 4% nondenaturing polyacrylamide gel in 0.5 tbe buffer (tris - borate - edta) at 390 v for 1 hour at 4c. after electrophoresis, the gel was dried and exposed to x - ray film (fuji hyperfilm, tokyo, japan). total rna was isolated with trizol (invitrogen, ca, usa), and single - stranded cdna was synthesized from 2 g of total rna with bu - script rt - kit (biunique, jiangsu, china) according to the manufacturer 's protocol. reverse transcription was conducted with gotaq green master mix (promega, wi, usa) according to the manufacturer 's protocol. the level of -actin was used as an internal standard. to obtain total protein lysates, cells were homogenized in ripa buffer (1% np40, 0.5% sodium deoxycholate, 0.1% sds, 1 mm edta, 1 mm egta, 1 mm na3vo4, 20 mm naf, 0.5 mm dtt, 1 mm pmsf, and protease inhibitor cocktail in pbs ph 7.4) and centrifuged at 12,000 g for 15 min at 4c. protein concentrations were estimated by coomassie plus protein assay reagent (pierce, il, usa). fifty micrograms of the resulting cytosolic protein extracts were heat - denatured in laemmli sample loading buffer, separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis, and electroblotted onto a nitrocellulose membrane. for immunoblotting, membranes were blocked with 5% nonfat dry milk in saline buffer overnight at 4c, and the following antibodies were used : anti--actin (sc-130657, santa cruz biotechnology, ca, usa, 43 kda) and anti - matrix metallopeptidase 9 (mmp9) (sc-6841, santa cruz biotechnology, ca, usa, 92 kda). each primary antibody was diluted appropriately in blocking buffer and then added to the blots for 1 h at room temperature. the blots were washed three times in the washing buffer and covered with the horseradish peroxidase - linked secondary antibody at a 1 : 2000 dilution for 1 h. blots were incubated with enhanced chemiluminescence (ecl) detection system (amersham biosciences, bucks, uk) and exposed to radiographic film (fuji hyperfilm, tokyo, japan). the supernatant was collected, and total protein was determined by coomassie plus protein assay reagent (pierce, il, usa). levels of tumor necrosis factor - alpha (tnf-), interleukin-1 beta (il-1), and interleukin-6 (il-6) protein were quantified using elisa kits specific for mouse according to the manufacturer 's instructions (bender medsystems inc. after incubated for 2 h at room temperature, the microwell strips were washed 3 times with wash buffer, and streptavidin - hrp were added to all wells. after incubated for 1 h, microwell strips were washed 3 times followed by adding tmb substrate. the colour intensity was measured at 450 nm using a bio - rad elisa microplate reader (bio - rad laboratories, ca, usa). the concentration of protein was determined according to the standard curve and expressed as pg / mg of total protein. cells of four groups were homogenized in lysis buffer containing 50 mm tris - hcl (ph 7.4), 150 mm nacl, 5 mm cacl2, 0.2 mm nan3, and 0.01% triton. gelatin zymography was performed according to the manufacturer 's instructions (genmed scientifics inc, ma, usa).. then the proteins were renatured by incubation in 2.5% triton x-100 and then incubated in substrate buffer for 40 h at 37c to enable the mmp9 to cleave the gelatin. after rinsing in water, each gel was stained with coomassie blue for 1 h and destained in 50% methanol. proteolytic activities were showed by clear bands in blue gel which indicates the lysis of the substrate. data were expressed as mean sd and evaluated by anova and lsd multiple comparison test. cell death was detected by microscope and cck-8 analysis at 24 h after scratch. the detachment from culture plate, cell lost, and cytoplasmic process distortion cck-8 assay also showed lower od value of group ko tbi (0.38 0.064) than that of group wt tbi (0.98 0.098) (p < 0.01), which also suggested more cell death in group ko tbi (figure 1). it has been reported that nf-b is activated in brain after tbi. here, we studied the dna - binding activity of nf-b of astrocytes from nrf2 wt or ko mice by emsa at 24 h after scratch injury. scratch injury induced activation of nf-b in astrocytes of both genotypes, while higher nf-b activity was observed in group ko tbi than in group wt tbi (2.67 0.173 versus 2.28 0.072, p < 0.01) (figure 2). as we all know, tnf-, il-1, and il-6 are regulated by nf-b and reflect the endogenous activity of nf-b. it has been revealed that these proinflammatory cytokines are increased after tbi in animals [2, 8 ]. and our previous study has proved that higher levels of such proinflammatory cytokines were observed in the brain of nrf2-deficient mice after tbi. but it is still ambiguous about the relationship between these cytokines and nrf2 in astrocytes after tbi. here, we tested the levels of tnf-, il-1, and il-6 in cultured astrocytes at 24 h after scratch injury by rt - pcr and elisa. it was shown that the mrna levels of tnf-, il-1, and il-6 were increased after scratch in both wt and ko astrocytes when compared with their sham counterparts, respectively. moreover, the mrna levels of these cytokines in group ko tbi were much higher than those in group wt tbi (1.66 0.085 versus 1.39 0.110 for tnf-, 1.34 0.064 versus 0.73 0.088 for il-1, and 1.28 0.102 versus 0.99 0.073 for il-6. the results of elisa revealed that the protein level of tnf- was upregulated after scratch injury in wt and ko astrocytes when compared with their sham counterparts. and it was also higher in group ko tbi than in group wt tbi (3.67 0.156 versus 2.31 0.087, p < 0.01) (figure 4(a)). similar tendency was observed in protein level of il-6 and il-1. for il-6, it was 36.07 0.786 for group ko tbi while 25.76 0.536 for group wt tbi (p < 0.01) (figure 4(b)). for il-1, it was 190.75 6.339 for group ko tbi while 154.50 5.348 for group wt tbi (p < 0.01) (figure 4(c)). mmp9 is an important gelatinase to induce or aggravate the inflammation process. in the present study, we elevated the mrna, protein levels, and activity of mmp9 in astrocytes at 24 h after scratch injury by rt - pcr, western blot, and gelatine zymography. expression of mmp9 was elevated after scratch injury in wt and ko astrocytes as compared with their sham counterparts. the mrna level of mmp9 was higher in group ko tbi than in group wt tbi (1.36 0.090 versus 1.01 0.068, p < 0.01) (figures 3(a) and 3(e)). significant difference was also discovered in mmp9 protein level by western blot, as 1.44 0.076 for group ko tbi and 1.13 0.048 for group wt tbi (p < 0.01) (figure 5). gelatine zymography revealed higher mmp9 activity in group ko tbi than that in group wt tbi too (101.76 6.343 versus 76.32 3.388, p < 0.01) (figure 6). the present study demonstrated that scratch injury induced the upregulation of nf-b dna binding activity and overexpression of tnf-, il-1, il-6, and mmp9 in cultured astrocytes. also we revealed that scratch injury induced higher activity of nf-b and enhanced expression of proinflammatory cytokines in nrf2 knockout cultured astrocytes than those in wildtype astrocytes for the first time. it has been demonstrated that nf-b is activated in brain and spinal cord after traumatic injury [2, 9 ]. as a transcript factor, nf-b binds with dna once it was activated and induces transcription of mmp9 and a battery of proinflammatory cytokines, including tnf-, il-1, and il-6, in brain tissues after tbi [3, 10, 11 ]. our results also revealed that scratch injury induced elevation of nf-b dna binding activity, overexpression of mmp9, and proinflammatory mediators mentioned above in cultured astrocytes. for example, tnf- and il-1 are potent stimulators for mmp9 in astrocytes [12, 13 ], and il-6 induces overexpression of mmp9 in human colon carcinoma cells, and tnf- and il-1 also can induce activation of nf-b [15, 16 ]. this autoregulatory loop extremely aggravates the damaging effect of inflammation and induces secondary injury to brain. it is a good choice for targeting on an upstream factor to prevent such autoregulatory loop after tbi. nrf2-are pathway has been proved to be the key regulator in reducing oxidative stress, inflammatory damage, and accumulation of toxic metabolites, which are all involved in tbi. enhanced level of nrf2 activates transcription of a group of antioxidant genes, such as heme oxygenase-1 (ho-1) and nad (p)h : quinone oxidoreductase-1 (nqo1), which would subsequently reduce the damage in brain. postinjury administration of sfn, an inducer of nrf2, significantly improves spatial memory of rat and decreases the immunoreactivity for 4-hydroxynonenal (4-hne), a marker of lipid peroxidation, in the cortex and the ca3 subfield of hippocampus after tbi. on the other hand,, our results revealed that overexpression of tnf-, il-1, il-6, and mmp9 after scratch injury was more aggravated in cultured nrf2 knockout astrocytes than in wildtype astrocyetes for the first time, and overexpression of these proinflammatory mediators led to more astrocytes deaths. data obtained from animal studies suggest the possibility that antioxidant effect of nrf2 may be achieved by suppression of proinflammatory pathways which are mediated by nf-b signaling. administration of sfn is found to be able to inhibit ikk / ib phosphorylation and p65 nf-b subunit nuclear translocation, consequently alleviating nf-b signaling. and nf-b activation induced by lipopolysaccharide (lps) could be attenuated by diverse nrf2 activators, such as sfn and curcumin (cur). furthermore, our previous studies indicate that depletion of nrf2 induces augmentation of nf-b activity and inflammatory response in lung, brain, and intestine after tbi [4, 5, 23 ]. results from this study further confirmed such relationship existed in cultured astrocytes after scratch injury. enhanced activation of nf-b is also discovered in lung, macrophages, and mouse embryonic fibroblasts of nrf2-deficient mice after experimental sepsis. nf-b p65 subunit repressed the nrf2-are pathway at transcriptional level by competitive interaction with the ch1-kix domain of cbp or local histone hypoacetylation. all these findings indicate the potential complicate crosstalk between nf-b and nrf2, which may be regulated by the upstream mitogen - activated protein kinase (mapks) pathway. it has been confirmed that nrf2 is mainly detected in nucleus of astrocytes after tbi. in view of the fact that nrf2 is a transcription factor which should take function mainly in nucleus, it can be reasoned that astrocytes may be one kind of respondent cells in activation of nrf2-are pathway after tbi. previous study identified the expression of tnf-, il-1, and il-6 in cultured astrocytes after treatment with lps or oxyhemoglobin [27, 28 ]. another study revealed that after middle cerebral artery occlusion, mmp9-positive astrocytes were observed in brain tissues by immunohistochemistry. but till now, there is no study focused on the relationship among astrocytes, nrf2, and proinflammatory mediators after tbi. our results demonstrated the upregulated expression of tnf-, il-1, il-6, and mmp9 in nrf2 knockout astrocytes after scratch injury for the first time. in conclusion, depletion of nrf2 induced the activation of nf-b and the expression of tnf-, il-1, il-6, and mmp9 resulting in more cell deaths in astrocytes after scratch injury. these results suggest that nrf2 may be an important target for anti - inflammatory therapy after tbi. | it has been proved that nrf2 depletion enhances inflammatory process through activation of nf-b in the brain after tbi, but little is known about the relationship between nrf2 and nf-b in astrocytes after tbi. hence, we used primary cultured astrocytes from either nrf2 wildtype or knockout mice to study the influence of nrf2 on the activation of nf-b and expression of proinflammatory cytokines in a model of tbi in vitro. primary cultured astrocytes were scratched to mimic the traumatic injury in vitro. then the dna - binding activity of nf-b was evaluated by emsa. the mrna and protein levels of tnf-, il-1, il-6, and mmp9 were also evaluated. gelatin zymography was performed to detect the activity of mmp9. the activity of nf-b and expression of proinflammatory cytokines mentioned above were upregulated at 24 h after scratch. the expression and activity of mmp9 were also elevated. and such tendency was much more prominent in nrf2 ko astrocytes than that in wt astrocytes. these results suggest that the absence of nrf2 may induce more aggressive inflammation through activation of nf-b and downstream proinflammatory cytokines in astrocytes. |
adiponectin is predominantly secreted from adipose tissues, physiological serum concentration reaches 530 g / ml and it influences systemic homeostasis, such as sensitization of insulin actions and cardiovascular protections. in patients with obesity and type 2 diabetes, the serum adiponectin levels negatively correlate with body mass index and body fat mass, and they are lower compared with normal control subjects. adiponectin levels in type 2 diabetes patients also negatively correlate with early features of nephropathy. in patients with established chronic kidney disease (stages 3 and 4), adiponectin levels are elevated, and the elevation of adiponectin levels predicts progression of disease and mortality. adipor1 is abundantly expressed in skeletal muscle, whereas adipor2 is predominantly expressed in liver tissue. in the kidney tissues, adipor1 is localized in podocytes and proximal tubular cells, and adipor2 has also been identified in proximal tubular cells. adiponectin increases the activation of adenosine monophosphateactivated protein kinase, as well as the mitogenactivated kinase pathway. the adiponectin treatment proximal tubular cells (hk2 cells) expressing adipor1 and adipor2 caused activation of adenosine monophosphateactivated protein kinase and decreased levels of the secretion of monocyte chemotactic protein1. in podocytes, adiponectin treatment improves the glomerular podocyte foot processes fusion by the activation of adenosine monophosphateactivated protein kinase and downregulation of reduced nicotinamide adenine dinucleotide phosphate oxidase 4 production1. peroxisome proliferator activated receptors (ppars) are ligandactivated transcription factors of the nuclear receptor superfamily serving as a lipid sensor, and they are involved in the control of nutrition and energy metabolism. ppar, ppar, and ppar are identified and recognized as key players of type 2 diabetes, and they are also important therapeutic targets. ppar is mainly involved in fatty acid oxidation in the liver, heart and kidney, whereas ppar is a master regulator for adipogenesis and lipid synthesis in adipose tissues. ppar and ppar ligands have been reported to lower blood pressure in experimental models of hypertension. the genetic ablation of ppar in mice shows the hypotensive phenotype, and it fits in the finding where ppar agonists, thiazolidinediones, stimulate the gene expression of renin in the kidney. serine glucocorticoid kinase1 then upregulates the several sodium transporters, such as epithelial sodium channels, which all contribute to the retention of sodium, edema and development of hypertension2. in contrast, thiazolidinediones suppress the vasoconstrictor effects of endothelin1, angiotensin ii and 5hydroxytryptamine 2b receptor agonists. the tight relationship between salt intake and blood pressure has been documented in observational studies and clinical trials, and the world health organization recommend a reduction to 5 g / day of salt in adults. however, recommending a very low salt intake in humans should be carefully considered. a randomized clinical trial documented that an extremely low sodium diet (< 50 meq / day in urinary sodium) generates a proinflammatory phenotype characterized by an increase in procalcitonin and tumor necrosis factor, and an opposite effect on an antiinflammatory cytokine, such as adiponectin3. a recently published study by zhao.4 reported the relationship between sodium intake and the regulation of glucose homeostasis through ppar/adiponectinmediated sodiumglucose cotransporter 2 (sglt2) pathway. ppar agonists or gene manipulation showed that ppar activation alleviates dyslipidemia, hyperglycemia and insulin resistance. importantly, ppar agonists exert renal protective effects in streptozotocininduced diabetic mice by increasing the expression of antiinflammatory corepressor bcell lymphoma6, which subsequently suppressed monocyte chemotactic protein1 and osteopontin expression5. zhao.4 fed wildtype (ppar) and adiposespecific ppar knockout (fabp4ppar) mice with a highsalt diet. increased natriuresis and glycosuria, as well as reduced expression of sglt2, were observed in ppar mice, and they were blunted in fabp4ppar mice. the activation of ppar by gw501516 increased expression of adiponectin in cultured adipocytes from ppar mice, but such increased adiponectin was not observed in fabp4ppar mice. the binding of important transcriptional activators, such as hepatocyte nuclear factor1 and sp1 in the promoter region of sglt2, and expression of the sglt2 gene were significantly reduced by the treatment of adiponectin in human renal tubular epithelial cells, proximal tubular cell line. in diabetic db / db mice receiving a highsalt diet, high sodium intakeinduced natriuresis is hampered as a result of increased sglt2 activities. in patients with diabetes, higher glycated hemoglobin the activation of ppar, elevation of serum adiponectin, and subsequent inhibition of sglt2 might lead to natriuresis and glycosuria, and it might be beneficial in hypertensive diabetic patients. upregulation of sodiumglucose cotransporter2 (sglt2) under hyperglycemia and development of hypertension in diabetes. a highsalt diet activates peroxisome proliferatoractivated receptor (ppar) and produces adiponectin from adipose tissues, which reduces sglt2. jun wada receives speaker honoraria from astellas, boehringer ingelheim, novartis and tanabe mitsubishi, and receives grant support from astellas, bayer, chugai, daiichi sankyo, kissei, kyowa hakko kirin, msd, otsuka, teijin, torii, pfizer, takeda and taisho toyama. | this report shed light to unrecognized mechanism for the hyperglycemiainduced sodium retention. the activation of ppar ?, elevation of serum adiponectin, and subsequent inhibition of sglt2 may lead to natriuresis and glycosuria and it may be beneficial in hypertensive diabetic patients. |
the need to decarbonize the global economy is widely recognized and, in the uk, it is enshrined in legislation in the form of the 2008 climate change act, which mandates an 80% reduction in carbon emissions by 2050 relative to 1990. to achieve this, a rapid transformation of infrastructure is required, a process which, as described by the national infrastructure plan published by the uk treasury in 2012, is aligned with the needs to overhaul and retrofit the national infrastructure to support economic growth. the infrastructure transition envisioned by the uk government includes the adoption of new, low - carbon technologies (e.g., electric vehicles for transport and wind turbines for electricity generation) at unprecedented levels. these new technologies contain a material mix that is very different to that of the current infrastructure stock, potentially introducing a reliance on critical materials at risk of supply disruption (e.g., rare earth elements, cobalt, and lithium). owing to the huge scale of infrastructure, changes thereto are likely to cause a step change in the demand for such materials. currently, policies planning the deployment of low carbon technologies are based primarily on carbon abatement potential and economic cost. the impacts in terms of new material demands, along with changing infrastructure stocks and future waste treatment, are not considered although these will significantly impact both the sustainability and resilience of future infrastructure systems. introducing technologies into infrastructure that rely on critical materials should prompt a greater effort into understanding and quantifying the changed material. the materials included in current technologies will remain embedded in infrastructure for many years, since infrastructure remains in use for lengths of time ranging from a few years to several decades or even centuries. the resulting delay between materials being introduced into infrastructure and becoming waste complicates the potential for a circular (or closed - loop) economy, a concept that has been gaining traction in policy internationally. when the materials embedded in infrastructure are critical materials that may suffer from supply shortfalls, understanding where, when, and how these materials and technologies within which they are embedded may be recovered (or better, reused) becomes important, first for enabling a closed - loop system of material use, and second to ensure the continuing functioning of basic infrastructure. to this purpose, infrastructure planning should include estimates of material demands : these estimates should be dynamic, including deployment and end - of - life, and take into account a variety of different technologies and components and their recovery and recycling potentials. by integrating such an analysis into infrastructure transition planning, scenarios can be developed that make optimal use of material resources, minimizing the risk of supply disruptions and making the best use of future end - of - life material. this article presents such a planning tool : a dynamic stocks and flows model for technologies embedded in infrastructure. previous work on dynamic material flow forecasting has established stocks and flows modeling (sfm) as a robust and useful tool for predicting future demand, in - use stocks, and waste of material resources. the approach of deriving future material demand from a service demand scenario has found wide use, with the calculation of future waste based on the lifetime characteristics of stocks in - use. past implementations of this approach, however, have limited the lifetime dynamics calculations to a single layer in the model. this is typified by the model of modaresi and mller which includes a nesting of three classes of stocks : the total vehicle stock, three different drive technologies, and three different materials. within this model, the technology stocks and flows alone this approach may be appropriate where the materials have a one - to - one correspondence with the relevant infrastructure, e.g., concrete used in building stock but falls short when we want to study materials in technologies embedded within infrastructure, where one technology relies on subcomponents, each with their own in - use dynamics and lifetime characteristics. this complex technological structure results in material flow dynamics that are difficult to predict, yet must be understood in order for supply bottle - necks to be averted, and to take advantage of recovery possibilities. in this paper, we present a novel sfm that projects the stocks and flows of technologies and materials based on low - carbon technology deployment scenarios. technology components and materials are explicitly incorporated in the model, each with their own stock and flow dynamics. this allows the projection of material dynamics to include technology components with diverse lifetimes, the recovery and reuse of technology components, and the recycling of materials, an analysis that is often discussed qualitatively in the circular economy literature but has not previously been studied quantitatively. the model provides a methodology to assist planning of technology roll - out, define the materials demand profile and potential bottlenecks, and avoid or diminish supply risks through the planning of recovery and recycling : in short, to manage critical materials in infrastructure. quantifying the potential for recycling and reuse can also act as a driver for the adoption of better material stewardship practices in a circular economy. we demonstrate the approach on the transition in personal transportation vehicles in the uk from internal combustion engine to electric vehicles. this transition involves the potential introduction of large quantities of lithium and cobalt (in electric vehicle batteries) and the rare - earth metal neodymium (in electric vehicle motors), while releasing the platinum in catalytic converters, unnecessary in electric vehicles. all four of these materials have been included in previous assessment of material criticality at national and eu scale and found to be of interest. with our model, we show how the demand for these materials and their anthropogenic stocks and waste flows change over time and how different recovery scenarios affect these stocks and flows. the model we present has been designed to study the relationships between the attributes of technologies that make up infrastructure and the stock and flow dynamics of the material contained in these technologies. to enable this, the model has three key features : first, a dynamic representation of stocks and flows ; second, a focus on infrastructure transitions with the adoption of new technologies ; third, the potential for recovery and substitution to occur at the level of technology as well as materials. the first feature is already included by the methodology for dynamic material flow modeling developed by mller, and it is this approach that we build on. to incorporate the second and third feature technologies and their components are explicitly included with their own dynamic stocks and flows. as the purpose of this model is to study the relation between infrastructure and technology dynamics and material flows, the focus is on the in - use phase of the material life - cycle, including the recovery of end - of - life stock for reuse or recycling. furthermore, the purpose of this model is not to produce a perfect representation of every processing step involved in the waste management phases of the infrastructure lifecycle. rather, we design the model to allow us to identify the availability of end - of - life stocks for reuse or recycling. elements of the hierarchical stocks and flows model, from infrastructure stocks to technological structures and components and their material requirements, each resulting in in- and outflows. the model separates an infrastructure system into three distinct classes of stocks:1.infrastructure stocks represent the service level an infrastructure provides, e.g., vehicles providing transportation. this stock does not refer directly to physical objects, and hence, no physical flows are necessary.2.technology stocks represent the technologies that provide the infrastructure service and are further disaggregated into technology structures, which directly provide the service (e.g., vehicles that provide transportation services), and their components (e.g., batteries, motors, magnets), which can be nested to any depth.3.material stocks that are contained in the technology stocks described above, e.g., lithium contained in an electric vehicle li - ion battery. infrastructure stocks represent the service level an infrastructure provides, e.g., vehicles providing transportation. this stock does not refer directly to physical objects, and hence, no physical flows are necessary. technology stocks represent the technologies that provide the infrastructure service and are further disaggregated into technology structures, which directly provide the service (e.g., vehicles that provide transportation services), and their components (e.g., batteries, motors, magnets), which can be nested to any depth. material stocks that are contained in the technology stocks described above, e.g., lithium contained in an electric vehicle li - ion battery. in any implementation of the model an infrastructure service could be provided by any number of different technology structures, each of which could be made up of multiple components. a single component stock can also be shared by more than one structure, as would be the case in two types of electric vehicle that share a common motor design. the same is true for materials, where one material stock can represent material contained in several technology components and structures. each of the stocks in the model has its own properties and associated inflows and outflows (see supporting information 2 for a full stocks and flows diagram). this means each structure and component can have different lifetimes, and the outflows from each stock will depend on its own lifetime as well as the dynamics of the stocks in which it is contained. this interaction can result in significant differences to stocks and flows dynamics compared to a simpler model that only considers the lifetime of either vehicle or battery (see the supporting information for an illustration of the difference). the separate representation of each stock requires a separate treatment of these stocks at end - of - life. any of the structures, components, or materials can potentially be recovered at end - of - life and reused or recycled to displace virgin inflow. the calculation of the stocks and flows is done for each class of stocks from the top of the hierarchy down. infrastructure stocks are determined from historical data and a deployment scenario for future dates. the technology structure stocks follow from a combination of the infrastructure stocks and a technology mix that describes what split of technologies is used to provide the infrastructure service. technology component stocks must then match the stock levels of the structures (or other components) of which they are constituent parts. finally, the material stocks are determined by the material intensities of the technology stocks which they make up. central to the calculation of every stock and flow in the model is the balance equation1where km(t) is the stock amount (kapital) of structure, component, or material m at time t and im(t) and om(t) are the corresponding inflows and outflows of m, respectively. from this balance equation, the determination of stock and flow time - series can proceed through either a flow driven or a stock driven approach. a flow driven approach is appropriate where the inflow and outflow are known or straightforward to model. this would be the case particularly with consumable objects that do not have a complex or long - lived in - use phase, such as aluminum cans or plastic cups. a stock driven approach determines the inflow and outflow from known stock levels and the dynamics of in - use stocks. this is more appropriate where the in - use dynamics are more complicated, for example, in the case of infrastructure where technologies and materials remain in use for long periods and there is a long delay between the inflow of material and it becoming available for recycling. following the stock driven approach, the outflow of any stock is determined by a lifetime function that determines the fraction of the stock added at any previous time that reaches end - of - life at the current time, i.e.,2where lm(,t) is the lifetime function that gives the fraction of stock added in year that reaches end - of - life in year t and the integral goes over all historical inputs to the current time. the lifetime function is assumed to take the form of a gaussian ; for further details, see the supporting information. given this and the required stock level, km(t), the calculations are complicated by the additional outflow due to a parent stock reaching end - of - life. the potential for future reuse or recycling is handled in the model by a recovery process that is described in technical detail in the supporting information. technology structures and components that reach end - of - life have the potential to be reused at the same system level or lost as a waste stream. reuse of technology will usually involve a remanufacturing process that, like primary production, is not included in our model. lithium - ion batteries for example would require remanufacturing before reuse in vehicles is practical, whereas ndfeb magnets could be reused directly without a remanufacturing step. for consistency, we use the term reuse to refer to both possibilities. what was termed reuse for technology structures and component, we call recycling for materials ; recycling is thus defined as a process that occurs strictly at the same system level and is distinct from down - cycling (without a measure of the function or quality of materials and components, it is difficult to define down - cycling anyway). both components and materials can also be contained in parent structures or components that are reused at end - of - life. the model tracks these as embedded stocks. for both technology structures and components, and materials, the term waste is used in the sense of no longer being of use for its previous purpose. this does not preclude the stock being down - cycled and its constituent components or materials being reused or recycled. these definitions of reuse, recycling, and waste are intended to be compatible with the definitions commonly used in circular economy literature and eu waste framework and end - of - life vehicle directives. in the model, the split of end - of - life stock into waste and reuse flows is supplied to the model as a recovery scenario. the purpose of this approach to reuse and recycling is not to give an accurate representation of the end - of - life treatment of technology but to account for the availability of end - of - life stock for recovery and highlight the potential impact of adopting different recycling policies. the transition to low carbon personal transportation is vital to the uk meeting its carbon emission reduction targets, as the transport sector accounts for almost a quarter of ghg emissions in the uk. the department of energy and climate change (decc) publishes a series of scenarios for decarbonization that would achieve emissions reduction targets and has an online pathways the scenarios are published by decc on five year increments ; to get a realistic timeline, we apply a cubic interpolation algorithm to calculate consistent yearly increments. we use one of the core scenarios from this work as the driver for infrastructure service and technology roll - out in our model. the scenarios detail the fleets of internal combustion engine vehicles (icevs), plug - in hybrid electric vehicles (phevs), and fully electric vehicles (evs). we use the renewables scenario, which is biased toward the adoption of renewable energy production. this scenario forecasts a decline of icevs starting in 2020 with phevs becoming the most common technology around 2030 and evs taking over in about 2040, as illustrated in figure 2. total in - use stocks of vehicles for the uk deployment of electric vehicles under the decc pathway analysis renewables scenario used in the model. the materials we are interested in tracking in this study, lithium, neodymium, cobalt, and platinum, are contained in the batteries, motors, and catalytic converters of vehicles. we take most of the material intensities of these components from the us department of energy as shown in table 1, and they are consistent with a number of similar studies. the range of material intensities for li - ion batteries is due to uncertainty in the battery chemistry that will be used. a number of candidates exist, each of which has their own advantages and drawbacks, well described by gaines. in the model, these ranges the lifetime of all three vehicle types is assumed to remain at 13 years with a standard deviation of 3 years (c.f. supporting information). catalytic converters and electric motors in modern cars are designed to last for the full lifetime of the vehicle and will not usually be replaced, so there is no lifetime for these separate from the vehicle lifetime. the li - ion batteries found in both phevs and evs today are sold with a warranty of 8 years. due to the relatively recent introduction of these batteries, there is no reliable statistical data for their lifetimes. we hence use a lifetime of 8 years with a variance of 2 years for these batteries in the model. we note that the model has the capability for both material intensities of technology and technology lifetimes to change over time ; however, due to a lack of reliable forecasts for what technological changes may bring, we make the conservative estimate that they will remain constant. the supporting information includes a sensitivity analysis for both the vehicle and battery lifetimes. recycling of materials from end - of - life vehicle stock are limited by both the efficiency of recycling processes and collection efficiency. a combination of these two factors leads to realistic recycling rates of 70% for lithium, 90% for cobalt, 70% for platinum, and 80% for neodymium (for detailed sources, see the supporting information). the limits to lithium recycling lie mostly in the difficulty of chemical separation of battery material whereas cobalt and neodymium recycling are limited mostly by collection efficiencies (which we assume to be very high due to the eu end - of - life vehicle directive). the reuse of remanufactured li - ion batteries we analyze in this paper is highly speculative. there is currently no commercial activity in this direction, although research projects are beginning to investigate the possibility. the reuse of ndfeb permanent magnets in motors is also failing to see commercial application, although the process is much simpler as magnets degrade only negligibly over the lifetime of a vehicle. in the absence of more detailed information, we assume an optimistic rate of 95% for both of these, to demonstrate the model s potential. more detailed justifications of recycling and reuse rates are given in the supporting information. figure 3 shows the stocks and flows of cobalt, lithium, neodymium, and platinum under the renewables scenario assuming no recycling or reuse of any material or technology. for the three materials found in low carbon transport technologies (cobalt, lithium, and neodymium), we see the expected steep increase in in - use stock from 2020. for cobalt and lithium, there is a very steep increase between about 2020 and 2025, which then continues to increase at a slower rate. neodymium use, in contrast, shows a very rapid increase between 2020 and 2025 and then stabilizes after 2025. this difference can be explained by the lower material intensity of cobalt and lithium in phev batteries compared to ev batteries. neodymium, however, has equal material intensity in both types of vehicles ; hence, a switch from phevs to evs results in no further increase in material inflow. solid lines indicate the high estimate for material intensity with the low estimate shown as fainter lines (the low estimate for cobalt being zero). use stocks are initially high and drop from 2020 onward, mirroring the decline in icev stock. materials (cobalt, lithium, and neodymium) is that the uk demand for these materials for the transport sector will increase rapidly from 2020. by 2030, the uk would require over 30 kilotons of cobalt, between 10 and 45 kilotons of lithium, and between 0.7 and 1.5 kilotons of neodymium per year (depending on the technologies used). to provide a sense of scale, in 2010 world production was 88 megatons of cobalt, 28.1 kilotons of lithium, and 22 kilotons of neodymium. this puts the high estimate scenario results in 2030 at 0.03%, 160%, and 7% of 2010 world production for cobalt, lithium, and neodymium, respectively. while it is important to note that we make no forecast for future world mine production, which would be required for fair comparison, or any assessment of any other factors that would lead to potential material criticality, these results are still significant. the relatively short time horizon of the step - change in demand for lithium from 2020 and the scale of this step - change being on the order of 2010 world production is enough to suggest that concern for the supply of lithium is warranted. the scale of the step - change for neodymium is also of concern, especially in context of the wider uses for neodymium which include other low - carbon technologies such as permanent magnet wind turbines. cobalt, however, from a purely supply vs demand perspective does not appear to be particularly critical. there is a step change in demand due to uk electric vehicle estimates, but it is not significant compared to global production. the results from this model are clearly a good starting point for highlighting the potential risks to infrastructure from critical materials. the outflows for all materials (shown in figure 3) and technology components are split in the model into waste flow, recycling / reuse flow, and embedded flow (material or components that are embedded in reused technology). to illustrate the potential for recycling or reuse to displace virgin material or component inflow, we model a set of possible recovery scenarios. three scenarios are modeled with an initial recycling / reuse rate of zero that increases, beginning in 2015, 2025, and 2035, to a set maximum linearly over a period of ten years. the scenario beginning in 2015 represents a highly optimistic roll - out of recycling infrastructure and almost immediate adoption of design standards for reuse. the 2025 scenario represents a more realistic estimate assuming still ambitious targets for policy action and subsequent changes in practice. the 2035 scenario represents late action, with a time scale that will miss most of the alarming demand projections identified above. for lithium, cobalt, and neodymium, the maximum recycling rates are 70%, 90%, and 80%, respectively. for li - ion batteries and ndfeb, the results of applying these scenarios for lithium and neodymium are shown in figure 4. the result for cobalt is not shown because the shape is identical to the lithium result ; only the scale is different. recovery scenarios for material recycling and component recovery applied to lithium and neodymium in the renewables scenario with a high estimate for material intensity. graphs show the virgin inflow, reuse inflow (recycled material), and embedded inflow (in reused components) along with the recovery fraction which is also indicated on the graph by the year recovery begins. the material recycling results for lithium show that a large reduction in virgin inflow is possible with the use of recovered material. it is not possible to completely displace virgin inflow as there will not be enough secondary stock, but the volume of recycled material can be greater than virgin material by 2030 if recycling facilities are in place before then. the peak requirement of about 15 kilotons by 2024 is unavoidable, as there is no vehicle end - of - life stock available for recycling at that time but the no - recovery level of 25 kilotons in 2030 can be reduced to around 15 kilotons. the reductions grow progressively more significant toward 2050 where the requirement for virgin material disappears completely. the effect of reuse of li - ion batteries on the demand for virgin lithium is very similar to the material recycling option, despite the much higher recovery fraction (70% to 95%). the reason for this is that batteries from phevs are not the same as those needed for evs. this highlights the higher flexibility in recycling materials than trying to reuse more specific technology components. the results for neodymium recycling are similar to those of lithium, i.e., an unavoidable peak in demand in 2024. the timing of the impacts of recovery are different because of the longer lifetime of the ndfeb motor compared to li - ion batteries, so there is little difference between the 2025 and the 2035 recovery scenarios. the second peak in demand of 1400 tons seen around 2039 (figure 3) can be reduced to a peak of just 400 tons by material recycling. the effect of ndfeb motor reuse has the potential to reduce this peak even further to 220 tons, a reduction of over 80%. the application of material recycling on platinum is obvious already from the results in figure 3. this shows that outflows of platinum are significantly greater than inflows in almost every year. recovery and recycling of platinum with a modest recycling rate would thus clearly reduce virgin platinum requirements to almost zero as soon as it is applied (for details, see the supporting information). the remaining recycled platinum surplus would likely also find use in other technologies, given the high value and demand for platinum. the comparison of material recycling and technology reuse allowed by this model enables two important results. first, the explicit inclusion of components with distinct lifetimes in the model is needed for an accurate prediction of the availability of end - of - life resources for recovery. this accounts for the earlier impact of lithium recycling compared to neodymium recycling because the battery lifespan is only 8 years as compared to a 13 year vehicle lifespan. second, the incompatibility of li - ion batteries between phevs and evs is representative of a general feature of remanufacturing and reuse of components : there is a loss of flexibility which must be balanced against the potentially lower efficiency and higher cost of disassembly and material recycling. this type of trade - off is evident only through using technology - specific dynamic modeling, such as the model presented here. the transition from internal combustion engine to electric vehicles, as shown in the decc scenarios, has the potential to make a significant contribution to the planned uk transition to low carbon personal transport. we have now seen that this technology change will be accompanied by the introduction of lithium and neodymium into infrastructure in amounts that will significantly increase uk demand for these materials. the possibility of shortages in supply of these materials constraining a successful transition to low carbon transport should prompt policy actions to mitigate against this. by including the possibilities for material and technology recovery, we have shown how the potential for reuse can be used to mitigate potential supply bottlenecks and support a circular economy, as well as when this option is not viable, due to a lack of available secondary resources. in the case of lithium (and less critically cobalt) for li - ion batteries, our results indicate that there exists a trade - off between a battery remanufacturing approach and a lithium recycling approach. the difficulty in component reuse is likely to be compounded by the variety of different li - ion battery chemistries that exist. the implication is that a policy of encouraging the development of material recycling from li - ion batteries is likely to be more fruitful in the medium term, with benefits most significantly felt if recycling infrastructure is in place by 2025. although material recycling is effective in this case, the higher rate component reuse leads to greater demand reductions. furthermore, the properties of permanent magnets are such that reuse could require only minimal remanufacturing, given appropriate design for reuse. material recycling provides no significant flexibility advantage as magnet technology is relatively mature and uniform (reflected by the smaller range in material intensity). the appropriate policy intervention in this case would be to enable efficient reuse of magnets in ndfeb motors through high collection efficiency and design standards that allow reuse without remanufacturing. in the example of a transition to electric vehicles for personal transportation, these results highlight the need for an evidence based material stewardship policy. understanding where materials go into infrastructure, when they will reach end - of - life, the potential for either material recycling or technology remanufacturing and reuse, and when to prioritize one over the other is crucial to achieving a circular economy. beyond personal transportation, the model could also be applied to wider infrastructure transitions involving many more technologies and materials. a nation - wide study involving interdependent infrastructure systems which share common material bases would have the potential to highlight the full scale of nationally relevant supply bottlenecks and identify significant reuse opportunities for technologies and materials. the trade - off between higher efficiency component remanufacturing and reuse and the lower efficiency, more flexible material recycling, that allows materials to be recycled between different technologies and infrastructures, could be extended in such a study to the reuse of components between different infrastructures, such as ev batteries reused for grid - attached storage. quantifying this trade - off for specific infrastructure systems and technologies where the recovery efficiencies are known could thus inform policies that foster industrial strategies toward optimizing material efficiency. in a broader context, the results from this model bring into focus challenges in the transitions to a low carbon economy. these transitions are often discussed with reference to two separate ideas : the use of low carbon technologies and the move to a circular economy. there is a fundamental short - to - medium term conflict between these two ideals : low carbon technologies have a radically different material mix compared to existing infrastructure stock. for these critical materials, a truly circular economy is therefore not possible until the infrastructure has reached a low - carbon equilibrium state where end - of - life stock is available to substitute for virgin material demand. | the transition to low carbon infrastructure systems required to meet climate change mitigation targets will involve an unprecedented roll - out of technologies reliant upon materials not previously widespread in infrastructure. many of these materials (including lithium and rare earth metals) are at risk of supply disruption. to ensure the future sustainability and resilience of infrastructure, circular economy policies must be crafted to manage these critical materials effectively. these policies can only be effective if supported by an understanding of the material demands of infrastructure transition and what reuse and recycling options are possible given the future availability of end - of - life stocks. this article presents a novel, enhanced stocks and flows model for the dynamic assessment of material demands resulting from infrastructure transitions. by including a hierarchical, nested description of infrastructure technologies, their components, and the materials they contain, this model can be used to quantify the effectiveness of recovery at both a technology remanufacturing and reuse level and a material recycling level. the model s potential is demonstrated on a case study on the roll - out of electric vehicles in the uk forecast by uk department of energy and climate change scenarios. the results suggest policy action should be taken to ensure li - ion battery recycling infrastructure is in place by 2025 and ndfeb motor magnets should be designed for reuse. this could result in a reduction in primary demand for lithium of 40% and neodymium of 70%. |
adult (68 week) c57bl/6j males and females were purchased from the animal resources centre (perth, australia) and kept in individually vented cages on a 12-hour light/12-hour dark cycle with free access to standard chow (irradiated rat and mouse diet, specialty feeds) for at least three days before mating. mating pairs were left together continuously and females were checked each morning for the presence of a vaginal plug. when a plug was detected (designated 0.5 days post coitum) the male was removed from the cage and a bottle containing either 10% (v / v) ethanol or water was supplied to the female. the solutions were replaced daily and the volume of liquid (ml) consumed in the last 24 h was recorded. after 8 days of exposure, all females were provided with water until their litters were weaned. offspring were weaned at postnatal day (p)21, after which male offspring were caged singly and female offspring were co - caged until tissue collection. a total of six age- and sex - matched animals, from 3 to 5 litters, were analyzed per group (i.e. ethanol - exposed and controls). the hippocampus and caudate putamen were dissected from the same adult male animals at p87. for the caudate putamen, a brain blocker / slicer (aster industries, usa) was used to cut coronal sections at 1 mm intervals and tissue was collected from the fifth slice from the anterior end of the brain. the hippocampus was also collected from female offspring at p87 and male offspring at p21. following dissection, tissues were immediately snap - frozen in liquid nitrogen and stored at 80 c. total rna was prepared using the rneasy plus mini kit (qiagen) according to the manufacturer 's instructions. tissues were homogenized in buffer rlt plus by passing 10 times through a 27-gauge needle attached to a sterile plastic syringe. rna integrity and concentration were assayed using the agilent 2100 bioanalyzer system and rna 6000 nano kit, following the manufacturer 's instructions. all samples used for gene expression profiling had rna integrity numbers (rins) above 8.0. illumina 's direct hybridization assay and mousewg-6 v2.0 expression beadchips were used to profile > 45,200 transcripts per sample. for each sample, labeled complementary rna (crna) was synthesized from 500 ng of total rna using the totalprep rna amplification kit (illumina) according to the manufacturer 's instructions. the crna (1.5 g per sample) was then hybridized to a mousewg-6 v2.0 expression beadchip at 58 c for 16 h, according to the manufacturer 's instructions. the sample probe profile was exported from genomestudio gene expression module (v1.9.0) into genespring gx11 (agilent) and analyzed for differential expression between groups. briefly, the biological significance workflow was followed in which replicate samples were grouped and probesets were filtered by expression. statistical analyses utilized the mann - whitney test (unpaired) ; p - value computation was set as permutation with a significance level of 0.05 and a fold change cut - off of 1.5. adult (68 week) c57bl/6j males and females were purchased from the animal resources centre (perth, australia) and kept in individually vented cages on a 12-hour light/12-hour dark cycle with free access to standard chow (irradiated rat and mouse diet, specialty feeds) for at least three days before mating. mating pairs were left together continuously and females were checked each morning for the presence of a vaginal plug. when a plug was detected (designated 0.5 days post coitum) the male was removed from the cage and a bottle containing either 10% (v / v) ethanol or water was supplied to the female. the solutions were replaced daily and the volume of liquid (ml) consumed in the last 24 h was recorded. after 8 days of exposure, all females were provided with water until their litters were weaned. offspring were weaned at postnatal day (p)21, after which male offspring were caged singly and female offspring were co - caged until tissue collection. a total of six age- and sex - matched animals, from 3 to 5 litters, were analyzed per group (i.e. ethanol - exposed and controls). the hippocampus and caudate putamen were dissected from the same adult male animals at p87. for the caudate putamen, a brain blocker / slicer (aster industries, usa) was used to cut coronal sections at 1 mm intervals and tissue was collected from the fifth slice from the anterior end of the brain. the hippocampus was also collected from female offspring at p87 and male offspring at p21. following dissection, tissues were immediately snap - frozen in liquid nitrogen and stored at 80 c. total rna was prepared using the rneasy plus mini kit (qiagen) according to the manufacturer 's instructions. tissues were homogenized in buffer rlt plus by passing 10 times through a 27-gauge needle attached to a sterile plastic syringe. rna integrity and concentration were assayed using the agilent 2100 bioanalyzer system and rna 6000 nano kit, following the manufacturer 's instructions. all samples used for gene expression profiling had rna integrity numbers (rins) above 8.0. illumina 's direct hybridization assay and mousewg-6 v2.0 expression beadchips were used to profile > 45,200 transcripts per sample. for each sample, labeled complementary rna (crna) was synthesized from 500 ng of total rna using the totalprep rna amplification kit (illumina) according to the manufacturer 's instructions. the crna (1.5 g per sample) was then hybridized to a mousewg-6 v2.0 expression beadchip at 58 c for 16 h, according to the manufacturer 's instructions. the sample probe profile was exported from genomestudio gene expression module (v1.9.0) into genespring gx11 (agilent) and analyzed for differential expression between groups. briefly, the biological significance workflow was followed in which replicate samples were grouped and probesets were filtered by expression. statistical analyses utilized the mann - whitney test (unpaired) ; p - value computation was set as permutation with a significance level of 0.05 and a fold change cut - off of 1.5. four genes were identified to be differentially expressed the adult (p87) male hippocampus in ethanol - exposed mice compared to controls (fold change > 1.5, uncorrected p 0.05). the genes were indolethylamine n - methyltransferase (inmt), melanoma inhibitory activity 1 (mia1), solute carrier family 17 member 6 (slc17a6) and teashirt zinc finger family member 2 (tshz2). further filtering of the four genes involved removing any transcripts with low fluorescence intensity (500) and homology (blat) searches to confirm that the array probes were targeting the correct transcripts. gene expression in the appropriate brain region was also checked using the allen brain atlas. after filtering, two candidate genes slc17a6 and tshz2 were selected for follow - up qrt - pcr experiments which confirmed ethanol - associated increased expression of slc17a6 in the adult male hippocampus. no genes were found to be differentially expressed between groups in the p87 male caudate putamen, p87 female hippocampus or p21 male hippocampus, indicating that the effect of prenatal ethanol exposure on slc17a6 expression is tissue-, sex- and age - specific. | exposure to alcohol during early embryonic or fetal development has been linked with a variety of adverse outcomes, the most common of which are structural and functional abnormalities of the central nervous system [1 ]. behavioural and cognitive deficits reported in individuals exposed to alcohol in utero include intellectual impairment, learning and memory difficulties, diminished executive functioning, attention problems, poor motor function and hyperactivity [2 ]. the economic and social costs of these outcomes are substantial and profound [3 ], [4 ]. improvement of neurobehavioural outcomes following prenatal alcohol exposure requires greater understanding of the mechanisms of alcohol - induced damage to the brain. here we use a mouse model of relatively moderate ethanol exposure early in pregnancy and profile gene expression in the hippocampus and caudate putamen of adult male offspring. the effects of offspring sex and age on ethanol - sensitive hippocampal gene expression were also examined. all array data are available at the gene expression omnibus (geo) repository under accession number gse87736. |
the spread of cervical cancer usually exhibits stepwise progression, from regional pelvic lymph nodes to para - aortic lymph nodes (pan), followed by distant metastases with the prevalence of pan metastases increasing progressively with stage. extended field irradiation (efi) has therefore been utilized for treatment of occult pan metastases in patients with advanced cervical cancer [2 - 7 ]. one randomized trial found that efi had no effect on locoregional tumor control, but showed an association with increased overall survival (os) rate, whereas a second randomized trial found that efi did not affect locoregional control or survival, but reduced the rates of pan and distant metastases without pelvic failure. in both studies, the use of concurrent chemoradiotherapy (ccrt) has complicated findings regarding the efficacy and safety of efi [7 - 10 ]. in a comparison between efi without chemotherapy and pelvis only field with ccrt in patients with locally advanced cervical cancer, ccrt significantly improved survival rate but had no effect on late toxicity. in contrast, many retrospective studies have shown that efi with ccrt is effective : thus, whether the combination of efi with ccrt is effective or not because of associated toxicity is unclear [2,9,11 - 13 ]. this study therefore assessed the efficacy of efi in patients with locally advanced cervical cancer without pan involvement. between january 1996 and december 2010, 241 patients with locally advanced cervical cancer underwent radiotherapy as primary treatment at keimyung university dongsan medical center. of 241 patients, 14 patients with an incomplete course of radiotherapy, 20 patients without regular follow - up after completion of radiotherapy, and four patients with neuroendocrine carcinoma were excluded, and 203 patients were analyzed in this study. locally advanced cervical cancer was defined according to international federation of gynecology and obstetrics (figo) staging as stage ib2, iia (tumor size > 40 mm or pelvic lymph node metastases), iib, iiia, and iiib. patient evaluation included medical history, pelvic examination, complete blood count, including hemoglobin concentration, liver and renal function tests, urinalysis, and chest radiography. patients also underwent pelvic magnetic resonance imaging (mri) or computed tomography (ct) for evaluation of tumor size and lymph node status. malignancy criteria for lymph node metastases were a lymph node with diameter of 1 cm or more, spherical shape or having central necrosis. performance status was evaluated according to the eastern cooperative oncology group (ecog) score. all patients received external beam radiotherapy (ebrt), followed by high dose - rate brachytherapy. ebrt was delivered with 6 to 20 mega - voltage photon beams using 4-field box techniques. of the 203 patients, 115 (56.7%) were treated with a pelvis only field, as irradiation of the entire pelvis with the l4-l5 interspace as the superior border. the l5-s1 interspace was considered the superior border in patients who were relatively older or in poor general condition. the l3-l4 interspace was considered the superior border in patients who had extensive pelvic lymph node involvement. the remaining 88 patients (43.3%) were treated with efi, defined as irradiation of the entire pelvis and pan area with continuous fields using 4-field box techniques. the superior border was extended to encompass sufficient pan spaces ; 42 patients with l2-l3 interspace as the superior border, 17 patients with l1-l2 interspace and 29 patients with t12-l1 interspace. midline shield and field size reduction were adapted after 36 to 45 gy of ebrt. the median total ebrt dose to the pelvis was 54 gy, ranging from 43.2 to 54 gy. the median dose to pan in patients treated with efi was 45 gy, ranging from 36 to 45 gy. nineteen patients received 36 gy, one patient received 41.4 gy, and 68 patients received 45 gy. dose to the pan area was decided according to patients ' condition or disease status. following ebrt, patients were treated with high dose - rate brachytherapy using co or ir sources ; co was used until october 1998 and ir was used thereafter. under local anesthesia, tandem and ovoids median brachytherapy dose to a - point was 30 gy, ranging from 20 to 35 gy. combining the ebrt dose with brachytherapy dose, median total biologically equivalent dose for a 2 gy fraction to a - point was 85.8 gy, ranging from 77 to 90.6 gy. the median overall treatment time was 64 days, ranging from 52 to 90 days. platinum based chemotherapy regimens were administered concurrently to 133 patients (65.5%). until 2002, 37 patients received two cycles of continuous infusions of 5-fluorouracil and cisplatin every four weeks. forty - nine patients received three cycles of paclitaxel and carboplatin or cisplatin every three weeks until 2006 and, since then, 47 patients received cisplatin every week. none of the patients received consolidation chemotherapy after completion of ccrt, but 12 patients underwent radical hysterectomy. during treatment, each patient 's performance status and complete blood count were evaluated weekly. red blood cell transfusions were administered to patients with hemoglobin levels below 10 g / dl. when the absolute neutrophil count was below 1,000/mm or the platelet count was below 50,000/mm, treatment was delayed until the blood count recovered. in summary, four different treatment modalities were used in this study : efi with ccrt in 62 patients (30.5%), pelvis only field with ccrt in 71 patients (35.0%), efi without chemotherapy in 26 patients (12.8%), and pelvis only field without chemotherapy in 44 patients (21.7%). after completion of treatment, patients were evaluated regularly by radiation oncologists and gynecologic oncologists. responses were defined as follows : complete response (cr), disappearance of the gross tumor on pelvic examination or pelvic mri or ct ; partial response (pr), 30% reduction of the initial tumor volume ; progressive disease (pd), a 20% increase in tumor volume or occurrence of a new lesion ; and stable disease, neither sufficient shrinkage for pr nor sufficient increase for pd. failure patterns were classified according to two different categories : locoregional failure, any recurrences in the pelvis, including the primary cervix and pelvic lymph nodes ; distant metastases, both pan metastases and metastases to distant lymph nodes or organs. treatment - related toxicities were graded according to common terminology criteria for adverse events ver. os was calculated from the start of treatment to death from any cause or last follow - up visit. disease - specific survival (dss) was calculated from the start of treatment to death from disease or last follow - up visit. disease - free survival (dfs) was calculated from the end of treatment to the date of disease failure or last follow - up visit. the kaplan - meier method was used for calculation of os and dfs, and the log - rank test was used for evaluation of prognostic factors. the chi - square test was used for comparison of patient characteristics and other factors between two groups. between january 1996 and december 2010, 241 patients with locally advanced cervical cancer underwent radiotherapy as primary treatment at keimyung university dongsan medical center. of 241 patients, 14 patients with an incomplete course of radiotherapy, 20 patients without regular follow - up after completion of radiotherapy, and four patients with neuroendocrine carcinoma were excluded, and 203 patients were analyzed in this study. locally advanced cervical cancer was defined according to international federation of gynecology and obstetrics (figo) staging as stage ib2, iia (tumor size > 40 mm or pelvic lymph node metastases), iib, iiia, and iiib. patient evaluation included medical history, pelvic examination, complete blood count, including hemoglobin concentration, liver and renal function tests, urinalysis, and chest radiography. patients also underwent pelvic magnetic resonance imaging (mri) or computed tomography (ct) for evaluation of tumor size and lymph node status. malignancy criteria for lymph node metastases were a lymph node with diameter of 1 cm or more, spherical shape or having central necrosis. performance status was evaluated according to the eastern cooperative oncology group (ecog) score. all patients received external beam radiotherapy (ebrt), followed by high dose - rate brachytherapy. ebrt was delivered with 6 to 20 mega - voltage photon beams using 4-field box techniques. of the 203 patients, 115 (56.7%) were treated with a pelvis only field, as irradiation of the entire pelvis with the l4-l5 interspace as the superior border. the l5-s1 interspace was considered the superior border in patients who were relatively older or in poor general condition. the l3-l4 interspace was considered the superior border in patients who had extensive pelvic lymph node involvement. the remaining 88 patients (43.3%) were treated with efi, defined as irradiation of the entire pelvis and pan area with continuous fields using 4-field box techniques. the superior border was extended to encompass sufficient pan spaces ; 42 patients with l2-l3 interspace as the superior border, 17 patients with l1-l2 interspace and 29 patients with t12-l1 interspace. midline shield and field size reduction were adapted after 36 to 45 gy of ebrt. the median total ebrt dose to the pelvis was 54 gy, ranging from 43.2 to 54 gy. the median dose to pan in patients treated with efi was 45 gy, ranging from 36 to 45 gy. nineteen patients received 36 gy, one patient received 41.4 gy, and 68 patients received 45 gy. dose to the pan area was decided according to patients ' condition or disease status. following ebrt, patients were treated with high dose - rate brachytherapy using co or ir sources ; co was used until october 1998 and ir was used thereafter. under local anesthesia, tandem and ovoids median brachytherapy dose to a - point was 30 gy, ranging from 20 to 35 gy. combining the ebrt dose with brachytherapy dose, median total biologically equivalent dose for a 2 gy fraction to a - point was 85.8 gy, ranging from 77 to 90.6 gy. the median overall treatment time was 64 days, ranging from 52 to 90 days. platinum based chemotherapy regimens were administered concurrently to 133 patients (65.5%). until 2002, 37 patients received two cycles of continuous infusions of 5-fluorouracil and cisplatin every four weeks. forty - nine patients received three cycles of paclitaxel and carboplatin or cisplatin every three weeks until 2006 and, since then, 47 patients received cisplatin every week. none of the patients received consolidation chemotherapy after completion of ccrt, but 12 patients underwent radical hysterectomy. during treatment, each patient 's performance status and complete blood count were evaluated weekly. red blood cell transfusions were administered to patients with hemoglobin levels below 10 g / dl. when the absolute neutrophil count was below 1,000/mm or the platelet count was below 50,000/mm, treatment was delayed until the blood count recovered. in summary, four different treatment modalities were used in this study : efi with ccrt in 62 patients (30.5%), pelvis only field with ccrt in 71 patients (35.0%), efi without chemotherapy in 26 patients (12.8%), and pelvis only field without chemotherapy in 44 patients (21.7%). after completion of treatment, patients were evaluated regularly by radiation oncologists and gynecologic oncologists. responses were defined as follows : complete response (cr), disappearance of the gross tumor on pelvic examination or pelvic mri or ct ; partial response (pr), 30% reduction of the initial tumor volume ; progressive disease (pd), a 20% increase in tumor volume or occurrence of a new lesion ; and stable disease, neither sufficient shrinkage for pr nor sufficient increase for pd. failure patterns were classified according to two different categories : locoregional failure, any recurrences in the pelvis, including the primary cervix and pelvic lymph nodes ; distant metastases, both pan metastases and metastases to distant lymph nodes or organs. treatment - related toxicities were graded according to common terminology criteria for adverse events ver. os was calculated from the start of treatment to death from any cause or last follow - up visit. disease - specific survival (dss) was calculated from the start of treatment to death from disease or last follow - up visit. disease - free survival (dfs) was calculated from the end of treatment to the date of disease failure or last follow - up visit. the kaplan - meier method was used for calculation of os and dfs, and the log - rank test was used for evaluation of prognostic factors. the chi - square test was used for comparison of patient characteristics and other factors between two groups. pathologic examination showed that 179 patients (88.2%) had squamous cell carcinomas, 16 patients (7.9%) had adenocarcinomas, six patients (3.0%) had adenosqua - mous carcinomas, and two patients (1.0%) had poorly differentiated carcinomas. patients in the efi and pelvis only field groups differed with regard to age, pelvic lymph node involvement, and tumor size. in the efi group, patients were younger and a higher percentage of patients had pelvic lymph node involvement and large (> 40 mm) tumor size. three months after completion of treatment, 197 patients (97.0%) achieved cr and six (3.0%) achieved pr, with similar response rates in patients treated with efi and pelvis only field (p=0.615). the median follow - up period was 60 months (range, 4 to 184 months). at the time of the last follow - up, 133 patients (65.5%) were alive without evidence of disease, three (1.5%) were alive with disease, 46 (22.7%) had died from cervical cancer, and 21 (10.3%) had died from other causes. locoregional failures were observed in 27 patients (13.3%), including 15 with local failure including the cervix or vagina, and two with regional failure, defined as recurrences within the pelvic irradiation fields. twenty - nine patients (14.3%) had distant metastases, including three with pan metastases, 22 with metastases to supraclavicular nodes or distant organs, and four with both. of these 29 patients, 12 had been treated with efi and 17 with pelvis only field. para - aortic metastases were observed in seven patients (3.4%), four treated with efi and three with pelvis only field, however, the occurrence rates did not differ significantly between the two treatment groups (p=0.454). of the patients who experienced distant metastases, nine had pulmonary metastases ; four had hepatic metastases ; four had distant lymph node metastases, including metastases to the left and right supraclavicular nodes ; three had bone metastases ; three had carcinomatosis peritonei ; two had brain metastases ; and one had transverse colon metastases. disease failure was observed in 20 patients (22.7%) in the efi group and in 31 (27.0%) in the pelvis only field group (p=0.495). regarding patterns of failure in the two groups, we observed no significant between - group differences in locoregional, pan, and distant failures. patients treated with efi had 2- and 5-year os rates of 87.0% and 71.7%, whereas patients treated with pelvis only field had 2- and 5-year os rates of 88.4% and 74.8%, respectively (p=0.699) (fig. similar 2- and 5-year dss rates were observed for patients treated with efi (90.3% and 77.4%, respectively) and pelvis only field (89.2% and 79.5%, respectively) (p=0.791). similar 2- and 5-year dfs rates were also observed for patients treated with efi (82.2% and 75.8%, respectively) and pelvis only field (81.4% and 74.5%, respectively) (p=0.668). when analyzed patients treated with radiotherapy alone without concurrent chemotherapy, the 2- and 5-year os rates were 92.1% and 72.1% in patients treated with efi, and 75.0% and 60.5%, respectively, in patients treated with pelvis only field (p=0.056) (fig. the 2- and 5-year dss rates were 95.8% and 82.8% in patients treated with efi and 76.7% and 69.0%, respectively, in patients treated with pelvis only field (p=0.078). the 2- and 5-year dfs rates were 87.5% and 74.6% in patients treated with efi and 72.4% and 63.6%, respectively, in patients treated with pelvis only field (p=0.110). in patients treated with ccrt, however, treatment field had no significant effect on os or dfs. the 2- and 5-year os rates were 84.9% and 72.3% in patients treated with efi, and 97.1% and 84.3%, respectively, in patients treated with pelvis only field (p=0.140) (fig. the 2- and 5-year dss rates were 88.0% and 75.0% in patients treated with efi and 97.1% and 86.2%, respectively, in patients treated with pelvis only field (p=0.175). the 2- and 5-year dfs rates were 80.0% and 78.0% in patients treated with efi and 87.0% and 81.3%, respectively, in patients treated with pelvis only field (p=0.379). significantly lower os was observed in patients treated with pelvis only field without chemotherapy than in the other three groups (p=0.001). however, no significant intergroup differences in os were noted among the other three treatment modalities. table 3 shows the results of univariate analysis for prognostic factors associated with os and dfs. good ecog performance status (p=0.003), low figo stage (p=0.043), and use of concurrent chemotherapy (p=0.001) were prognostic factors for prolonged os. squamous cell pathology (p=0.018) and use of concurrent chemotherapy (p=0.035) were the only prognostic factors for dfs. a summary of acute and late grade 3 - 4 toxicities is shown in table 4. nine patients (4.4%) experienced hematologic toxicities, including anemia and neutropenia, but all patients were properly managed and recovered sufficiently to continue treatment. two patients (1.0%) two patients (1.0%) experienced late gastrointestinal toxicities : one was treated with pelvis only field and experienced perforation of the small intestine and one was treated with efi and experienced rectal perforation. one patient experienced urinary tract obstruction and still remains in stent insertion state, whereas the other three experienced grade 3 hematuria. no significant differences in the rates of acute or late grade 3 - 4 toxicities were observed between patients treated with efi and pelvis only field. pathologic examination showed that 179 patients (88.2%) had squamous cell carcinomas, 16 patients (7.9%) had adenocarcinomas, six patients (3.0%) had adenosqua - mous carcinomas, and two patients (1.0%) had poorly differentiated carcinomas. patients in the efi and pelvis only field groups differed with regard to age, pelvic lymph node involvement, and tumor size. in the efi group, patients were younger and a higher percentage of patients had pelvic lymph node involvement and large (> 40 mm) tumor size. three months after completion of treatment, 197 patients (97.0%) achieved cr and six (3.0%) achieved pr, with similar response rates in patients treated with efi and pelvis only field (p=0.615). the median follow - up period was 60 months (range, 4 to 184 months). at the time of the last follow - up, 133 patients (65.5%) were alive without evidence of disease, three (1.5%) were alive with disease, 46 (22.7%) had died from cervical cancer, and 21 (10.3%) had died from other causes. locoregional failures were observed in 27 patients (13.3%), including 15 with local failure including the cervix or vagina, and two with regional failure, defined as recurrences within the pelvic irradiation fields. twenty - nine patients (14.3%) had distant metastases, including three with pan metastases, 22 with metastases to supraclavicular nodes or distant organs, and four with both. of these 29 patients, 12 had been treated with efi and 17 with pelvis only field. para - aortic metastases were observed in seven patients (3.4%), four treated with efi and three with pelvis only field, however, the occurrence rates did not differ significantly between the two treatment groups (p=0.454). of the patients who experienced distant metastases, nine had pulmonary metastases ; four had hepatic metastases ; four had distant lymph node metastases, including metastases to the left and right supraclavicular nodes ; three had bone metastases ; three had carcinomatosis peritonei ; two had brain metastases ; and one had transverse colon metastases. disease failure was observed in 20 patients (22.7%) in the efi group and in 31 (27.0%) in the pelvis only field group (p=0.495). regarding patterns of failure in the two groups, we observed no significant between - group differences in locoregional, pan, and distant failures. patients treated with efi had 2- and 5-year os rates of 87.0% and 71.7%, whereas patients treated with pelvis only field had 2- and 5-year os rates of 88.4% and 74.8%, respectively (p=0.699) (fig. similar 2- and 5-year dss rates were observed for patients treated with efi (90.3% and 77.4%, respectively) and pelvis only field (89.2% and 79.5%, respectively) (p=0.791). similar 2- and 5-year dfs rates were also observed for patients treated with efi (82.2% and 75.8%, respectively) and pelvis only field (81.4% and 74.5%, respectively) (p=0.668). when analyzed patients treated with radiotherapy alone without concurrent chemotherapy, the 2- and 5-year os rates were 92.1% and 72.1% in patients treated with efi, and 75.0% and 60.5%, respectively, in patients treated with pelvis only field (p=0.056) (fig. the 2- and 5-year dss rates were 95.8% and 82.8% in patients treated with efi and 76.7% and 69.0%, respectively, in patients treated with pelvis only field (p=0.078). the 2- and 5-year dfs rates were 87.5% and 74.6% in patients treated with efi and 72.4% and 63.6%, respectively, in patients treated with pelvis only field (p=0.110). in patients treated with ccrt the 2- and 5-year os rates were 84.9% and 72.3% in patients treated with efi, and 97.1% and 84.3%, respectively, in patients treated with pelvis only field (p=0.140) (fig. 3). the 2- and 5-year dss rates were 88.0% and 75.0% in patients treated with efi and 97.1% and 86.2%, respectively, in patients treated with pelvis only field (p=0.175). the 2- and 5-year dfs rates were 80.0% and 78.0% in patients treated with efi and 87.0% and 81.3%, respectively, in patients treated with pelvis only field (p=0.379). significantly lower os was observed in patients treated with pelvis only field without chemotherapy than in the other three groups (p=0.001). however, no significant intergroup differences in os were noted among the other three treatment modalities. table 3 shows the results of univariate analysis for prognostic factors associated with os and dfs. good ecog performance status (p=0.003), low figo stage (p=0.043), and use of concurrent chemotherapy (p=0.001) were prognostic factors for prolonged os. all three factors remained statistically significant in multivariate analyses. squamous cell pathology (p=0.018) and use of concurrent chemotherapy (p=0.035) were the only prognostic factors for dfs. a summary of acute and late grade 3 - 4 toxicities is shown in table 4. nine patients (4.4%) experienced hematologic toxicities, including anemia and neutropenia, but all patients were properly managed and recovered sufficiently to continue treatment. two patients (1.0%) two patients (1.0%) experienced late gastrointestinal toxicities : one was treated with pelvis only field and experienced perforation of the small intestine and one was treated with efi and experienced rectal perforation. one patient experienced urinary tract obstruction and still remains in stent insertion state, whereas the other three experienced grade 3 hematuria. no significant differences in the rates of acute or late grade 3 - 4 toxicities were observed between patients treated with efi and pelvis only field. in recent decades, radiotherapy has become the standard treatment for patients with locally advanced cervical cancer. ebrt followed by intracavitary brachytherapy was the standard treatment until the 1990s ; since then, ccrt has become the standard treatment method [7,18 - 22 ]. to date, however, the role of efi has not been clearly established, especially in patients undergoing ccrt. in the absence of concurrent chemotherapy, the 5- and 10-year os rates were estimated to be 67% and 55% for patients treated with efi, and 55% and 44%, respectively, for patients treated with pelvis only field. although a second randomized study found no significant difference in os, the rate of distant metastases with local control was 2.4-fold greater and the rate of pan metastases was 2.8-fold greater in patients treated with pelvis only field than in patients treated with efi. the results observed in the absence of concurrent chemotherapy were similar to these earlier findings. higher 5-year os rates were observed in patients treated with efi than in patients treated with pelvic irradiation alone (72.1% vs. 60.5%). in the absence of concurrent chemotherapy, although the difference was marginally significant (p=0.056), prophylactic irradiation of the pan area may be effective if toxicity is not a concern. however, in a previous randomized trial, the cumulative incidence of grade 4 and 5 toxicities was higher in patients treated with efi (8% vs. 4%), with the difference being much greater in patients who had surgical staging or had undergone previous abdominal surgery. similarly, a second randomized trial showed that severe digestive complications were 2.3-fold more frequent in patients treated with efi. in this study, however, the incidence of toxicities did not differ significantly. a trial comparing efi without chemotherapy and pelvis only field with ccrt using 5-fluorouracil and cisplatin in patients with locally advanced cervical cancer found that os and dfs were longer in the latter group, with 5-year os rates of 52% and 73%, respectively. however, the rates of para - aortic failure did not differ between these two groups, and os benefits were statistically significant only in stage ib to iib patients. several studies have evaluated the efficacy of efi with ccrt [6,10 - 13,23 ]. a phase i / ii trial found that concurrent extended field ccrt with high dose - rate brachytherapy yielded a 5-year os rate of 77%, with serious bowel toxicity observed in 6% of patients, suggesting that this regimen is safe and effective. in this study, concurrent chemotherapy significantly increased os compared with radiotherapy alone (p=0.001), however, treatment field had no benefit, with 5-year os rates of 72.3% in patients treated with efi and 84.3% in patients treated with pelvis only field (p=0.140). the toxicity findings in patients treated with efi plus ccrt are conflicting. one trial reported acute hematologic toxicity and acute gastrointestinal toxicity rates of 10% and 2%, whereas another reported rates of 77.5% and 25%, respectively. in this study, 4.8% of patients who received efi with ccrt had acute hematologic and 1.6% had acute gastrointestinal toxicities, with no difference in toxicity rates according to treatment field. only one patient experienced late toxicity, compared with 2% to 14% of patients in previous studies. patients in this study were treated with four different treatment modalities : efi with or without concurrent chemotherapy, pelvis only field with or without concurrent chemotherapy. significantly lower os was observed in patients treated with pelvis only field without chemotherapy than in the other three groups. these results suggest that efi may be reliable in the absence of chemotherapy by reducing the risk of systemic metastases. when combined with ccrt, however, the efficacy of efi seems to be decreased, because chemotherapy has cytotoxic effects in controlling micrometastases of pan and has radiation sensitizing effects in controlling pelvic disease. this study was designed to show the efficacy of efi and the results shed much light on the use of efi. however, there were still some limitations, including the retrospective design. because this study was not prospective, patients were not well matched in the treatment field groups and ccrt groups. patients treated with efi tended to be younger, positive for pelvic node metastases, and to have large - sized tumors. patients treated with ccrt also tended to be younger and positive for pelvic node metastases. in addition, each group included a different number of patients, making comparisons difficult. in addition, chemotherapeutic regimens differed. from january 2001 to december 2002, 37 patients were treated with 5-fluorouracil and cisplatin. from january 2003 to december 2006, 49 patients were treated with paclitaxel and carboplatin or cisplatin after several studies demonstrated the advantages of these regimens. since january 2007 although no significant differences in survival were observed among patients receiving these chemotherapeutic regimens, the differences in these regimens may have affected our results. because this study was retrospective in design and medical records were incomplete, we may have underestimated toxicities. we found that efi did not have a significant impact on survival outcomes in locally advanced cervical cancer patients without pan involvement. although this study was conducted retrospectively and had some limitations, these results may be useful when determining the optimal radiation treatment fields in patients. in the absence of ccrt, efi may be appropriate ; however, in patients administered concurrent chemotherapy, efi may not be effective. conduct of well - designed prospective or case matched studies will be necessary in order to confirm these results. | purposethis study evaluated the efficacy of extended field irradiation (efi) in patients with locally advanced cervical cancer without para - aortic nodal involvement.materials and methodsa total of 203 patients with locally advanced cervical cancer (international federation of gynecology and obstetrics [figo ] stage, ib2-iiib) treated with radiotherapy at keimyung university dongsan medical center from 1996 to 2010 were retrospectively analyzed. the median patient age was 59 years (range, 29 to 83 years). none of the patients had para - aortic node metastases. of the 203 patients, 88 underwent efi and 115 underwent irradiation of the pelvis only. concurrent chemoradiotherapy (ccrt) was administered to 133 patients. efi field was used for treatment of 26 patients who received radiotherapy alone and 62 who received ccrt.resultsthe median follow - up period was 60 months. the 2- and 5-year overall survival (os) rates were 87.8% and 73.5%, respectively, and the 2- and 5-year disease - free survival rates were 81.7% and 75.0%, respectively, however, no survival differences were observed between the two treatment field groups. efi tended to increase os in the radiotherapy alone group, but not in the ccrt group.conclusionthese findings suggest that efi does not have a significant effect in patients with locally advanced cervical cancer, especially in patients receiving ccrt. conduct of additional studies will be required in order to confirm these findings. |
hepatocellular carcinoma (hcc) is the fifth most common malignant tumor worldwide, accounting for 5.6% of all human cancers, and is the most common primary liver cancer. the number of new cases is estimated to range from 500,000 to 1 million per year. liver transplantation appears to be effective treatment approach because it treats both the cancer and the underlying liver cirrhosis. liver resection for hcc is now considered to be a safer procedure than was previously believed owing to technical advances and improvements in postoperative patient management [3 - 6 ]. accordingly, in many centers, liver resection is still the first - line treatment for hcc in patients with compensated cirrhosis. since the first laparoscopic liver wedge resection was reported in 1992, an increasing number of reports have described the feasibility, safety, and adequacy of laparoscopic hepatic procedures [8 - 11 ]. now, laparoscopic liver resection (llr) is commonly performed in patients with hcc and chronic liver disease. initially, llr was limited to the treatment of benign diseases. however, with increasing know - ledge of this procedure, its indications have widened to include malignant disease such as hcc and liver metastasis of colorectal cancer. the extent of resection has also grown over time. major liver resection, such as right or left hemihepatectomy, has been performed more frequently in recent years. laparoscopic left lateral sectionectomy is now regarded as a standard treatment option. by contrast, it will take many years for llr to become a standard procedure for treating all kinds of hcc. extending the indications, the introduction of advanced techniques, and outcomes similar to those of open liver resection (olr) are required for llr to become a standard procedure in hcc. the aim of this review is to assess the current indications, advantages, and limitations of laparoscopic surgery for hcc resection. we will also discuss the feasibility of llr and its oncologic outcomes compared to olr. unlike laparoscopic cholecystectomy, laparoscopy is not widely accepted for liver resection because of the technical difficulty associated with parenchymal transection, hemostasis at the transection plane, the risk of air embolism, and limited ability to explore the deeper regions of the liver. therefore, llr has been reserved for patients who require limited resection of tumors located on the left side of the liver. the recent improvements in laparoscopic techniques and the introduction of new technologies mean that llr is technically feasible and safe for tumors on the right side of the liver. the first international position statement on llr published in 2008 stated that the best indications for llr were patients with solitary lesions, 5 cm in diameter, located in the peripheral liver segments (i.e. segments 26 ; fig. laparoscopic left lateral sectionectomy should be considered as the standard of care, but major hepatectomy, such as right hepatectomy, should be reserved for experienced surgeons. improved laparoscopic techniques, better visualization of the operative field using a flexible laparoscope, and routine use of a laparoscopic cavitron ultrasonic surgical aspirator for transecting the deeper portion of the liver parenchyma have allowed laparoscopic left lateral sectionectomy to be performed more widely [18 - 20 ]. llr for hcc located in the posterosuperior segments in selected patients was reported to be safe and feasible, and offered comparable oncologic outcomes to those of olr. other benefits of llr include reduced blood loss, fewer complications, and shorter postoperative hospital stay compared with open resection. asian countries, especially, have a disproportionately high prevalence of hcc, mainly because hepatitis b and c viruses are endemic in these countries, and chronic infection is associated with high risk of liver cirrhosis and hcc. when considering liver resection in patients with liver cirrhosis, it is important to consider the degree of surgical stress placed on the patient and the liver, as well as the oncological outcomes. decompensated cirrhosis is generally considered to be a contraindication to liver resection and thereby llr. uncontrolled portal hypertension, including esophageal varices and low platelet count, is also usually considered as an exclusion criterion for llr. anatomical liver resection is preferred for hcc because of its tendency to invade the portal veins and spread along the intrasegmental branches. major advantages of laparoscopy are the rapid recovery of patients and the shorter hospital stay compared with open surgery, as previously reported for llr of hcc. these advantages are related to less postoperative pain, early ambulation, early return of oral feeding, and lower incidence of postoperative complications after llr. another important advantage of llr in cirrhotic patients is the lower incidence of postoperative liver failure and ascites. this may be due to the reduced invasiveness of laparoscopy, which helps to preserve the abdominal musculature by avoiding large abdominal incisions, preserve the parietal circulation, and minimize liver manipulation. unlike laparoscopic cholecystectomy, laparoscopy is not widely accepted for liver resection because of the technical difficulty associated with parenchymal transection, hemostasis at the transection plane, the risk of air embolism, and limited ability to explore the deeper regions of the liver. therefore, llr has been reserved for patients who require limited resection of tumors located on the left side of the liver. the recent improvements in laparoscopic techniques and the introduction of new technologies mean that llr is technically feasible and safe for tumors on the right side of the liver. the first international position statement on llr published in 2008 stated that the best indications for llr were patients with solitary lesions, 5 cm in diameter, located in the peripheral liver segments (i.e. segments 26 ; fig. laparoscopic left lateral sectionectomy should be considered as the standard of care, but major hepatectomy, such as right hepatectomy, should be reserved for experienced surgeons. improved laparoscopic techniques, better visualization of the operative field using a flexible laparoscope, and routine use of a laparoscopic cavitron ultrasonic surgical aspirator for transecting the deeper portion of the liver parenchyma have allowed laparoscopic left lateral sectionectomy to be performed more widely [18 - 20 ]. llr for hcc located in the posterosuperior segments in selected patients was reported to be safe and feasible, and offered comparable oncologic outcomes to those of olr. other benefits of llr include reduced blood loss, fewer complications, and shorter postoperative hospital stay compared with open resection. asian countries, especially, have a disproportionately high prevalence of hcc, mainly because hepatitis b and c viruses are endemic in these countries, and chronic infection is associated with high risk of liver cirrhosis and hcc. when considering liver resection in patients with liver cirrhosis, it is important to consider the degree of surgical stress placed on the patient and the liver, as well as the oncological outcomes. decompensated cirrhosis is generally considered to be a contraindication to liver resection and thereby llr. uncontrolled portal hypertension, including esophageal varices and low platelet count, is also usually considered as an exclusion criterion for llr. anatomical liver resection is preferred for hcc because of its tendency to invade the portal veins and spread along the intrasegmental branches. major advantages of laparoscopy are the rapid recovery of patients and the shorter hospital stay compared with open surgery, as previously reported for llr of hcc. these advantages are related to less postoperative pain, early ambulation, early return of oral feeding, and lower incidence of postoperative complications after llr. another important advantage of llr in cirrhotic patients is the lower incidence of postoperative liver failure and ascites. this may be due to the reduced invasiveness of laparoscopy, which helps to preserve the abdominal musculature by avoiding large abdominal incisions, preserve the parietal circulation, and minimize liver manipulation. because the potential applications for llr have expanded considerably in the last 15 years, an first international consensus conference on llr was convened in louisville, kentucky, in 2008. this consensus statement defined the current international position on laparoscopic liver surgery as a safe and effective approach for the management of surgical liver disease in the hands of trained surgeons with experience in hepatobiliary and laparoscopic surgery. it also stated that the best indications for llr were patients with solitary lesions, 5 cm in diameter, located in the peripheral liver segments (i.e. segments 26) and that laparoscopic left lateral sectionectomy should be considered as the standard of care. if local resection of hcc is performed, it should involve anatomical segmental resection, if possible, considering the overall function of the liver. this is because this procedure is associated with lower local recurrence rates and should be used instead of tumorectomy. since then, llr has been introduced to middle - tier centers as well as high - volume and/or specialized centers. moreover, the number of hcc cases treated by llr has increased over the last 5 years, especially in asia and europe. six years later, the second international consensus conference on llr was held to evaluate the current status of llr and to develop recommendations and guidelines. this goal was achieved through analysis of the available literature and expert presentations, which including videos presented to an independent jury. the expert panel comprised 34 members, with demonstrated experience in llr, and the jury contained 9 members. the organizing committee prepared 17 questions in 2 categories benefits and risks, and techniques of llr. each question was assigned to a working group of 37 members of the expert panel who were selected based on their scientific and clinical activities. the jury concluded that minor llrs had become standard practice (ideal 3) and that major liver resections were innovative procedures in the exploratory phase (ideal 2b) all of the evidence available for scrutiny was considered to be of low quality by grade, which prompted the recommendation for higher quality evaluative studies. the expert panel developed recommendations regarding preoperative evaluation, bleeding control, transection methods, anatomical approaches, and equipment. both the expert panel and jury recognized the need for a formal structure of education for surgeons interested in performing major llr because of the steep learning curve. over the past decade, llr has progressed internationally following advances in technology and the increasing experience of liver surgeons. indeed, more than 9,000 procedures were reported in the english literature. with the proper selection of patients, llr is considered as a safe technique, with mortality and morbidity rates of 0% and 15%, respectively. since the first case was reported, an increasing number of case - series have been published especially from the beginning of new millenium. llr was initially performed for low - risk operations, including the excision of benign hepatic lesions. the techniques have gradually become incorporated into the practices of most liver centers, and llr is now widely accepted for the management of benign and malignant liver tumors. in a global survey of the current practices of liver surgery, yoshihiro. reported that 88% of the participating centers had incorporated laparoscopic approaches into liver surgery. to our knowledge, no randomized controlled trials (rct) have compared the outcomes between llr and olr. however, several retrospective case llr was associated with less intraoperative blood loss, less postoperative pain medication requirement, earlier return of oral feeding, and shorter hospital stay compared with olr. in addition, from a financial standpoint, although the minimally invasive llr approach was associated with higher operating room costs in some studies, the total hospital costs were either offset or improved by llr because of the shorter hospital stay. in addition, llr did not compromise oncological measures such as margin status, disease - free survival, or overall survival, but did improve short - term perioperative outcomes. a systematic review published in 2012 compared llr with olr. the data analysis suggested that llr was associated with improvements in most of the perioperative factors, including blood loss, the number of patients requiring transfusion, and the use of portal triad clamping. however, all of these significant results were associated with significant heterogeneity in the evaluated studies. there were no differences between the two groups in terms of adverse outcomes in the early postoperative period. nevertheless, a significant finding was the lower number of positive resection margins in the llr group than in the olr group. the other variables associated with oncological clearance were not significantly different between llr and olr. another important result was that llr was associated with a significant reduction in overall morbidity compared with olr. in the last 5 years, several meta - analyses of studies comparing llr and olr for malignant lesions have been published (table 1). all of these meta - analyses concluded that llr is superior to olr in terms of perioperative outcomes. the operation time was not significantly different between llr and olr, even though operation time was shorter for olr in prior studies. the absence of a difference in the meta - analyses could be explained by recent advances in surgical instruments, accumulated experience, and overcoming the learning curve. unfortunately, it is impossible to reach a convincing conclusion regarding the bene - fits and risks of llr over olr in the absence of rcts. however, abraham. recently reported that a meta - analysis of well - designed non - randomized controlled trials of surgical procedures is probably as reliable as a meta - analysis of rcts. llr not only achieve equivalent short - term postoperative outcomes but also provide favorable long - term survival prognosis to olr. several studies have reported that llr is less invasive and is associated with similar disease - free survival and overall survival rates to olr in patients with hcc. however, we still lack data on the long - term oncological outcomes of llr particularly in patients with hcc. to date, there have been no prospective rct comparing the outcomes between llr and olr. however, many meta - analyses, retrospective studies, and case - matched studies with propensity score matching comparing the long - term outcomes of llr and olr in patients with hcc have been published in recent years (table 2). these studies showed that the survival rates at 1, 3, and 5 years were similar between patients undergoing llr and patients undergoing olr for hcc, as were the overall recurrence rate, mortality rate, overall survival rate, and disease - free survival time [46,50 - 54 ]. one study determined the long - term survival of patients with hcc in reference to the stage of the disease. llr is now considered as a standard procedure in the management of hcc in some settings, and it is increasingly being performed worldwide. the short- and long - term outcomes of llr were comparable to those of olr. | laparoscopic liver resection (llr) is becoming widely accepted for the treatment of hepatocellular carcinoma (hcc). laparoscopic left lateral sectionectomy and minor laparoscopic liver resection are now considered standard approaches, especially for tumors located in the anterolateral segments of the liver. laparoscopic left lateral sectionectomy in adult donors is also gaining acceptance for child liver transplantation in many centers. major llrs, including left hepatectomy and right hepatectomy, have been recently attempted. laparoscopic donor hepatectomy is becoming more popular owing to increasing demand from young living donors who appreciate its minimal invasiveness and excellent cosmetic outcomes. several centers have performed total laparoscopic donor right hepatectomy in adult - to - adult living donor liver transplantation. many meta - analyses have shown that llr is better than open liver resection in terms of short - term outcomes, principally cosmetic outcomes. although no randomized control trials have compared llr with open liver resection, the long - term oncologic outcomes were similar for both procedures in recent case - matched studies. |
dna and rna helicases are a ubiquitous yet diverse group of enzymes present in viruses, bacteria and eukaryotes (15). helicases convert chemical energy of nucleoside triphosphate (ntp) hydrolysis to the mechanical energy necessary to transiently separate the strands of duplex nucleic acids. helicases provide the single - stranded dna (ssdna) intermediates necessary for replication, recombination and repair. different helicases can be distinguished by co - factor utilization, substrate preference, directionality of unwinding, processivity and effects of other proteins on their activity. the clinical abnormalities in these diseases are quite diverse, suggesting that different processes involving dna manipulation are defective (6). some helicases are encoded by viruses and are targets for antiviral drug development such as herpes simplex virus and hepatitis c virus (7,8). the prominent role of both human and viral helicases in human disease, coupled with the central importance of these proteins in the most basic aspects of nucleic acid metabolism, makes this class of enzymes an attractive target for study. substantial progress has been made in the past five years by a number of research groups studying helicase mechanisms. much of the biochemical knowledge of dna helicases comes from the study of bacterial and phage enzymes. two recent review articles from delagoutte and von hippel provide excellent summaries of many current models for helicase function (2,3). helicases can function as monomers, dimers or higher - order oligomers (911), and translocate along ssdna with different directional biases (1217). there are enormous differences in processivity among helicases, and the mechanistic and kinetic details of translocation and unwinding also vary considerably. recbcd helicase, for example, utilizes two motors bound to each strand of the dna duplex to create a rapid and highly processive helicase (18,19), which has been visualized at the single molecule level (20,21). hexameric helicases appear to exclude one strand of the duplex from the central channel of the hexamer to unwind double - stranded dna (dsdna), although they can accommodate both strands and function as molecular dna pumps in other cases (4,2224). a dimeric inchworm mechanism has been proposed for uvrd and rep helicases (10,25). t4 dda and hcv ns3 helicases are functional as monomers but more processive when acting cooperatively (2729). some helicases have been found to function as molecular motors that can displace proteins in their paths (3033). dna and rna helicases are a ubiquitous yet diverse group of enzymes present in viruses, bacteria and eukaryotes (15). helicases convert chemical energy of nucleoside triphosphate (ntp) hydrolysis to the mechanical energy necessary to transiently separate the strands of duplex nucleic acids. helicases provide the single - stranded dna (ssdna) intermediates necessary for replication, recombination and repair. different helicases can be distinguished by co - factor utilization, substrate preference, directionality of unwinding, processivity and effects of other proteins on their activity. the clinical abnormalities in these diseases are quite diverse, suggesting that different processes involving dna manipulation are defective (6). some helicases are encoded by viruses and are targets for antiviral drug development such as herpes simplex virus and hepatitis c virus (7,8). the prominent role of both human and viral helicases in human disease, coupled with the central importance of these proteins in the most basic aspects of nucleic acid metabolism, makes this class of enzymes an attractive target for study. substantial progress has been made in the past five years by a number of research groups studying helicase mechanisms. much of the biochemical knowledge of dna helicases comes from the study of bacterial and phage enzymes. two recent review articles from delagoutte and von hippel provide excellent summaries of many current models for helicase function (2,3). helicases can function as monomers, dimers or higher - order oligomers (911), and translocate along ssdna with different directional biases (1217). there are enormous differences in processivity among helicases, and the mechanistic and kinetic details of translocation and unwinding also vary considerably. recbcd helicase, for example, utilizes two motors bound to each strand of the dna duplex to create a rapid and highly processive helicase (18,19), which has been visualized at the single molecule level (20,21). hexameric helicases appear to exclude one strand of the duplex from the central channel of the hexamer to unwind double - stranded dna (dsdna), although they can accommodate both strands and function as molecular dna pumps in other cases (4,2224). a dimeric inchworm mechanism has been proposed for uvrd and rep helicases (10,25). t4 dda and hcv ns3 helicases are functional as monomers but more processive when acting cooperatively (2729). some helicases have been found to function as molecular motors that can displace proteins in their paths (3033). many sf1 and sf2 helicases are proposed to function via inchworm mechanisms that require coordinated alternate binding of nucleic acid at two different sites within the functional unit of the helicase. this can be accomplished by a monomer containing two binding sites or by a dimer with a single binding site per subunit. both variations of this mechanism have been supported by structural and biochemical studies to account for the activities of different helicase enzymes. the most thorough structural characterization of an sf1 helicase is for pcra, which is essential for replication in bacillus subtilis and staphylococcus aureus. based on x - ray crystallographic, biochemical and biophysical studies, a detailed description of the mechanism for pcra has been proposed (5,9,26,34,35). the mechanism describes specific conformational changes within the dna - binding site that are coupled to atp binding and hydrolysis. product complex structure (sulfate - bound) reveals conformational changes associated with atp hydrolysis consistent with an inchworm mechanism for translocation (9). nucleotide binding results in closure of the binding cleft and repositioning of dna - binding domains in a manner that increases the affinity of the enzyme for duplex dna. translocation is proposed to occur via alternate binding of dna at two different sites within the pcra monomer coordinated by atp binding and hydrolysis. the dimeric inchworm model for escherichia coli uvrd and rep helicases is based on extensive structural and biochemical studies including single molecule experiments (10,25). rep helicase has been crystallized in two different conformations bound to ssdna (36). as with pcra, these conformational differences suggest that nucleotide binding and hydrolysis cyclically alter the nucleic acid binding properties of the enzyme in order to regulate translocation. however, dimer formation is required for rep activity in vitro (37), with nucleotide co - factors regulating cooperativity of nucleic acid binding to the two sites within each dimer (38). biochemical and single molecule studies of uvrd have demonstrated that dimer formation is also critical for helicase activity of this enzyme (10). monomeric uvrd binds specifically to ssdna / dsdna junctions, but association of a second monomer with the protein the low stability of the dimeric complex is proposed to account for the low processivity of uvrd helicase. some helicases are active as monomers but exhibit enhanced unwinding activity under conditions in which multiple monomers are able to function cooperatively (2729). the unwinding mechanisms of these helicases are not as well characterized as those of the strictly monomeric or dimeric helicases. in the case of dda, cooperativity is presumed to be associated with transient interactions between monomers bound to the same nucleic acid substrate molecule and traveling in the same direction on dna despite the absence of any observed quaternary structure (27,28). chemical cross - linking and gel filtration chromatography indicate that dda does not form an oligomeric species in solution (39). unwinding activity of wild - type dda was not significantly reduced by the addition of an atpase - deficient mutant, indicating no dominant - negative effect (39). unwinding by dda under pre - steady - state conditions exhibited biphasic kinetics with the amplitude of the first phase equivalent to the enzyme concentration (40). taken together,. however, dda exhibits greater activity for unwinding partial - duplex substrates that are of sufficient length to allow binding of multiple monomers (figure 1) (28). multiple molecules of dda can unwind more substrate under single - turnover conditions because of the enhanced likelihood that a molecule will complete the unwinding process before dissociating from the substrate. these results indicate that the binding of adjacent molecules along the dna strand contributes to the increased unwinding or displacement activity of dda via transient protein the authors have proposed a variation of the inchworm model for helicase activity by dda termed the cooperative inchworm model. the essence of this model is that helicase monomers can function independently during translocation, but when the monomers encounter a challenge ', such as duplex dna or a protein block, multiple monomers enhance the likelihood of overcoming the challenge. as the challenge increases in difficulty, such as with the displacement of streptavidin, then the importance of cooperativity in enzyme activity increases. levin and patel (41) demonstrated that both atpase and unwinding activities of ns3 are dependent on protein concentration and that an atpase - deficient mutant has a dominant - negative effect on unwinding by wild - type ns3. (42) showed that efficient unwinding by ns3 requires binding of multiple monomers per nucleic acid substrate molecule. (43) crystallized two ns3 helicase monomers with a weak protein interface bound to a single oligonucleotide. however, the mutations at the interface did not dramatically influence helicase activity in vitro. most helicases require an ssdna overhang adjacent to duplex dna in order to initiate unwinding. the strand containing the overhang is referred to as the loading strand whereas the complementary strand is referred to as the displaced strand. the specifics of the interactions of particular helicase enzymes with the loading and/or displaced strands vary considerably depending on the unwinding mechanism of each helicase. pcra helicase interacts with both single - stranded and duplex regions of the unwinding substrate (9). mutation of the duplex interaction domains impairs unwinding activity but does not affect translocation on ssdna (44). in contrast, deletion of a homologous domain from rep helicase does not impair unwinding activity (45), suggesting that the sort of duplex interaction required for unwinding by pcra may not be critical to the rep helicase unwinding mechanism. several studies have examined the effects of modified nucleic acid substrates on unwinding by helicase enzymes. replacing the displaced strand with a peptide nucleic acid (pna) mimic has no effect on unwinding by dda helicase. dda was able to unwind dna pna substrates at rates similar to those observed for dna dna substrates (46), indicating that the rate - limiting step for unwinding of short oligonucleotides by dda is insensitive to the chemical nature of the displaced strand and the thermal stability of oligonucleotide substrates. dna unwinding by dda can occur simply as a consequence of translocation along the loading strand. the effects of modification of the loading strand of dna on unwinding by dda helicase have also been studied using a 5-dna pna a single molecule of dda is not able to translocate efficiently through the dna lesion. however, multiple dda molecules can bypass the lesion with no reduction in unwinding rate compared to that observed for a dna substrate (47). this implies that the bypass of the lesion is not due to an increase in the number of chances for bypass, but instead is due to a change in the activity of the lead molecule of helicase, consistent with the cooperative inchworm model. strand specificity for the sf2 rna helicase nph - ii has been investigated by introducing specific chemical modifications into each strand of the rna substrate. nph - ii required physical continuity of the phosphodiester linkages, suggesting that this enzyme tracks along the rna backbone (48). rep helicase is able to initiate unwinding of a dna substrate despite the presence of polyglycol lesions in the 3-overhang region of the loading strand (49). ns3 helicase is able to translocate through polyglycol lesions in the duplex region of the loading strand of an rna substrate (50), indicating that translocation by these enzymes does not require continuous specific interaction with the unwinding substrate. vaccinia helicase nph - ii, in contrast, can not translocate past polyglycol discontinuities (50), suggesting a translocation mechanism significantly different from that of rep and ns3. nph - ii appears to recognize the ribose moieties to distinguish dna from rna (51). one of the major mechanistic issues related to helicase activity is the kinetic and physical step size of the enzyme. the physical step size is the number of base pairs unwound during a single atp hydrolysis event whereas the kinetic step size is the number of bases unwound per rate - limiting kinetic cycle. the kinetic step size and the physical step size may not be equivalent and depend on the specific mechanism utilized. this area of investigation has been pioneered by the lohman laboratory (52,53), and kinetic step sizes of 45 bp have been determined for the uvrd (52) and recbcd helicases (54). a recent study from the bujalowski laboratory has determined the kinetic step size of a hexameric helicase, dnab, to be 1 bp (55). these investigators made the observation that several base pairs near the end of a duplex can melt spontaneously owing to thermal instability and the presence of the enzyme bound to the dna. recent studies of t4 dda and hcv ns3 helicases indicate that translocation by monomeric helicases may proceed in a series of non - uniform steps punctuated by pauses of varying lengths (5658). most recently, a model incorporating brownian motion has been proposed for the ns3 helicase domain and the gene 4 helicase from bacteriophage t7 (59,60). this proposed mechanism does not require two intrinsic binding sites for nucleic acid within the active site of a helicase, unlike the mechano - chemical mechanism described by the inchworm model. helicases and other enzymes that move along dna or rna are likely to encounter proteins that are bound to the nucleic acid. the resulting protein protein collision can lead to dissociation of the helicase from the dna, displacement of the dna - binding protein or temporary stalling of the motor. the biological relevance of such protein protein interactions is gaining attention of researchers in this field. enzymes containing helicase motifs have been shown to remove proteins bound to dna (30,31) and rna (32,33). chromatin remodelers disrupt the interaction between dna and histones but do not necessarily unwind dsdna. a number of models have been proposed for how remodeling can occur including nucleosome sliding, nucleosome dissociation or histone replacement with a variant histone. one helicase - like protein that is involved in dna repair is the mfd protein (63). when rna polymerase is stalled at a site of dna damage, mfd is thought to alternatively, mfd can completely displace rnap from the dna, thereby allowing dna repair to occur. kaplan and o'donnell (64) showed that dnab can displace dsdna - binding proteins during translocation on dsdna. for example, dnab is stopped upon encountering the replication terminator protein tus (65). the ability of dnab to dislodge proteins from dna was proposed to facilitate branch migration in dna recombination or dna repair. in saccharomyces cerevisiae, termination of replication forks is controlled in a sequence - specific fashion by the interaction of the fob1p replication terminator protein (66). the action of rrm3p is modulated by other proteins such as tof1p csm3p complex (67). hence, a complex series of protein collisions controls the number of replication forks that can proceed through normal termination sites in this organism. structural reorganization of ribonucleoprotein complexes was catalyzed in vitro by the activity of the rna helicase nph - ii (33). the ability of rna helicases to remove proteins from dsrna in the absence of rna unwinding has also been demonstrated previously (32). the ability of helicases to displace proteins bound to dna was used to investigate the mechanism of dda helicase. dda was found to catalyze dissociation of streptavidin from the 3 end of a biotinylated oligonucleotide, but not from the 5 end (15). these results indicated that dda travels with a strong directional bias on ssdna and illustrated that helicases generate force during translocation (figure 1b). other helicases such as ns3 were later shown to translocate in the opposite direction as dda, but were also capable of displacing streptavidin (16). it was initially surprising to determine that helicases can displace such tightly bound proteins as streptavidin from biotinylated dna. however, there exists a relationship between force production and disruption of normal equilibria such that even a small force can lead to a substantial change in the equilibrium binding constant for a protein and its ligand (70). in this case, the protein was streptavidin and the ligand was biotin. dda can displace proteins from dna including the e.coli lac repressor (71) and the e.coli ter protein (72). however, not all protein dna complexes are displaced by dda. dda was unable to dislodge a gal4dna complex, even under conditions which should favor binding of more than one molecule of dda to the substrate (73). dna complexes are able to sequester dda in a manner that appears to trap dda and reduce the atp hydrolysis activity of the enzyme. it is possible that the gal4dna complex adopts a unique structure that perturbs dda 's interaction with dna. the mechanism for protein displacement by dda helicase was investigated by designing a substrate containing a dna - binding site for the e.coli trp repressor (74). the monomeric form of dda was insufficient to displace the e.coli trp repressor from dsdna under single - turnover conditions. when the substrate was designed to allow more than one dda helicase to bind, these results indicate that multiple dda molecules act to displace dna - binding proteins in a manner that correlates with previously reported dna unwinding activity and streptavidin displacement activity. in summary, helicases in the superfamily 1 and superfamily 2 classes have been proposed to function in an inchworm fashion. the fundamental aspects of this mechanism can be accommodated by monomeric forms of these enzymes ; however, some helicases function as dimers and there is still debate regarding the role of specific subdomains in the overall mechanism for dna unwinding. the activity of some of these helicases increases through functional cooperativity when multiple molecules assemble along ssdna. future work in this area will focus on the interaction of helicases with other dna - binding proteins, such as single - stranded binding proteins, polymerases and recombinases. it is likely that these interactions will modulate helicase activity significantly, as has already been shown for pcra and rep helicases (75,76). cooperative inchworm model for activities exhibited by dda. (a) increased activity is observed for dna unwinding, bypass of dna lesions and for the displacement of dna - binding proteins. when monomeric dda dissociates from the substrate, reannealing can occur if insufficient base pairs are unwound. when multiple dda molecules are bound, unwinding can continue after dissociation of one of the monomers. (b) multiple molecules assembled along the ssdna function together to increase the rate of displacement of streptavidin from biotin - labeled oligonucleotides. | dna helicases are required for virtually every aspect of dna metabolism, including replication, repair, recombination and transcription. a comprehensive description of these essential biochemical processes requires detailed understanding of helicase mechanisms. these enzymes are ubiquitous, having been identified in viruses, prokaryotes and eukaryotes. disease states, such as xeroderma pigmentosum, cockayne 's syndrome, bloom 's syndrome and werner 's syndrome, have been linked to defects in specific genes coding for dna helicases. helicases have been placed into different subfamilies based on sequence comparison. the largest subgroups are termed superfamily 1 and superfamily 2. a proposed mechanism for helicases in these classes has been described in terms of an inchworm model. the inchworm model includes conformational changes driven by atp binding and hydrolysis that allow unidirectional translocation along dna. a monomeric form of the enzyme is proposed to have two dna - binding sites that enable sequential steps of dna binding and release. significant differences exist between helicases in important aspects of the models such as the oligomerization state of the enzyme with some helicases functioning as monomers, some as dimers and others as higher - order oligomers. |
glandular odontogenic cyst (goc) was first documented as sialo - odontogenic cyst by padayachee and van wyk in 1987 ; who published two cases that resembled both the botryoid odontogenic cyst and the central mucoepidermoid tumor of jaws. gardner., in 1988 characterized histopathological features and biological behavior of goc and established it as a distinct entity and proposed term goc. high., (1996) proposed the term polymorphous odontogenic cyst for this cyst because of its aggressive growth pattern. (1) a true cyst of glandular origin from either entrapped salivary gland primodia or undifferentiated primitive epithelial rests that differentiates into glandular epithelium. (2) an odontogenic primodial origin cyst in which the epithelial lining undergoes prosoplasia (metaplasia from a less specific differentiation to a more specific differentiation) into glandular epithelium. (3) low - grade mucoepidermoid carcinoma that forms an initial single cystic space instead of the usual multicystic spaces. the most common mode of presentation is a slow growing intraosseous lesion in the anterior mandible (nearly 87.2%) and most of these are seen crossing the midline. this cyst occurs in wide age range but is common in middle - aged adults with a mean age of 49.5 years. may be asymptomatic ; however, large cysts often produce clinical expansion, which sometimes can be associated with pain or paresthesia. radiographically, the lesion may appear as a unilocular or, more commonly, multilocular radiolucency. characteristic histopathologic features are variable thickness of nonkeratinized stratified epithelium, with superficial layer of epithelium consisting of columnar or cuboidal cells, occasionally seen with cilia and numerous goblet cells. the epithelium has glandular or pseudoglandular structure, with intra - epithelial crypt or microcyst formation. goc is very rare, so here we present a unique case of a goc and clinico - histopathological features of this rare cyst. a 40 year old male patient reported with chief complaint of painful swelling in lower left front tooth region since 5 months. intraoral examination revealed a single buccal swelling in the left mandibular region extending from 34 to 36, approximately 2 1 cm in size [figure 1 ]. the swelling extended supero - inferiorly from attached gingiva to the entire depth of the buccal vestibule. on palpation, the swelling was firm, non - tender, non - mobile and non pulsatile. submandibular lymph nodes on left side were palpable and tender. a provisional diagnosis of ameloblastoma and differential diagnosis of odontogenic keratocyst was given. radiographic examination revealed a multilocular radiolucent area with sclerotic border extending from 36 to 43 region [figure 2 ]. intraoral photograph showing buccal left mandibular swelling multilocular radiolucency extending from 36 to 43 numerous hard and soft tissue specimens were received. hard tissue consisted of 34, 35 and 36 with soft tissue bits attached to apical region of these hard tissue specimens. soft tissue showed cystic cavity surrounded by fibrous capsule and was soft in consistency and creamish white in color [figure 3 ]. gross specimen : multiple soft tissue bits with extracted teeth the cyst was lined by a nonkeratinized stratified squamous epithelium of variable thickness, with flat epithelial connective tissue interface [figure 4 ]. the superficial layer of the epithelial lining consisted of cuboidal and in some areas columnar cells with cilia or filiform - like extensions of the cytoplasm and the epithelium showed spherule arrangement at some places [figure 5 ]. small microcysts lined by single layer of cuboidal or columnar cell were present within the epithelium [figure 6 ] which contained periodic acid schiff [pas ] positive secretory product. numerous pas - positive goblet cells were present, mainly in the superficial part of the epithelium [figure 7 ]. photomicrograph showing cystic lining exhibiting variable thickness of epithelium, some areas of papillary projection and numerous microcysts formation (h&e stain, 40) photomicrograph revealing cystic epithelium exhibiting spherule formation with few superficial ciliated cuboidal cells (h&e stain, 200) photomicrograph showing numerous microcysts lined by eosinophilic cuboidal cells (h&e stain, 400) photomicrograph showing pas - positive mucous cells (pas stain, 400) goc is an uncommon jaw cyst of odontogenic origin. to the best of our knowledge, only 111 cases of goc have been reported in the literature and magnusson., observed that only 0.012% of the cysts seen on the oral cavity have fulfilled the criteria of goc microscopically. literature review showed that goc may mimic a wide clinicopathologic spectrum ranging from lpc to a destructive malignant neoplasm such as central mucoepidermoid carcinoma cmec. there is a slight male predilection and lesions occur mostly in middle - aged patients. the main clinical finding in this cyst is a painless local swelling ; the clinical picture, however, is non - specific. the lesion may cause pain due to compression of a neurovascular bundle or secondary infection ; inflammation, however, is uncommon. the anterior mandible is the most common site for occurrence of this cyst. in this case lack of consistency in the clinical manifestations and the intraosseous development of these lesions demonstrate the importance of radiographs for this lesion. radiographic findings include a rounded or oval lesion, unilocular or multilocular lesion, usually with well - defined borders. the differential diagnosis includes botryoid cysts, keratocysts, residual cysts, central mucoepidermoid carcinoma (cmec) and ameloblastoma. the histopathological characteristic features of goc given by gardner. and kaplan. proposed a list of microscopic criteria for goc such as non - keratinized stratified squamous epithelium, epithelial whorls or spheres within the lining, eosinophilic cuboidal or columnar cells which are occasionally ciliated and presence of mucous cells with microcystic areas. histopathologically, goc should be differentiated from lateral periodontal cyst (lpc) and cmec as they exhibit considerable overlap of histological features. the lining of lpc exhibits focal thickenings and glycogen - rich epithelial cells, similar to those observed in goc. however, the identification of ciliated epithelium and duct - like spaces with mucous cells specifically differentiate goc from lpc and botryoid odontogenic cyst (boc) and favors the diagnosis of goc. however, cmecs do not show superficial cuboidal cells, epithelial whorls, ciliated cells and intraepithelial microcyst or duct - like structures. the central mec and the goc are distinct entities with different cytokeratin (ck) profiles and the differential expression of cks 18 (cmec) and 19 (goc) could be useful adjunctive tools in differentiating these two entities. of interest is the discovery within the past few years that most mecs exhibit a t (11:19)(q21:p13) translocation resulting in the mect1:maml2 fusion protein. the aggressive biologic behavior of goc and its propensity for recurrence might be associated with cell kinetics in the lining epithelium. (2000) investigated the expression of bcl-2 protein, ki-67 antigen and p53 protein in gocs. the authors concluded that the increased expression of the anti - apoptotic bcl-2 may be associated with deregulation of cell death in the lining epithelium of the gocs, whereas ki-67 and p53 status did not seem to play a significant part in cell proliferation. surgical treatment of large lesions should include enucleation with peripheral ostectomy for unilocular cases and marginal resection or partial jaw resection in multilocular cases. follow up should be continued for at least 3 years (up to 7 years in cases with features associated with increased risk of recurrence rate due to its intrinsic biological behavior, multilocularity of the cyst and incomplete removal of the lining following conservative treatment). purpose of this case presentation is to increase existing knowledge of this rare entity as histopathological diagnosis and differential diagnosis of goc is challenging for a pathologist. adequate treatment of goc is required because of its aggressive biologic behavior and propensity for recurrence. | glandular odontogenic cyst (goc) is an uncommon developmental odontogenic cyst of jaws with a relative frequency between 0.012 and 1.3%. goc is very rare and only 111 cases have been documented in the english literature so far. generally, this cyst is encountered in the anterior areas of the mandible and is more common with a wide age range, the mean age being 49.5 years and has a tendency to recur. goc is often misdiagnosed because of its overlapping histopathological features with that of other odontogenic cysts such as lateral periodontal cyst (lpc) or botryoid cyst and central low - grade mucoepidermoid carcinoma. histopathological diagnosis and differential diagnosis of goc is challenging for pathologist. here, we present a case of goc in a 40 year old male patient in left mandibular region that crossed the midline. |
the history of corneal transplantation dates back over 200 years. in 1905, eduard zirm performed the first successful full - thickness penetrating keratoplasty (pk).1 techniques using allografts and xenografts for full - thickness keratoplasty were first performed in the early 1800s ; there was a relatively high rate of failure due to endothelial rejection. steroids and improvement in surgical instrumentation in the 1950s led to a steady rise in the survival rates of corneal grafts. in the early 2000s, with the emergence of selective lamellar keratoplasty, the femtosecond laser, modern instrumentation, and in particular newer anti - inflammatories led to better success. all of these improvements allowed physicians and patients a more rapid postoperative recovery due to earlier removal of sutures and a reduction in the rates of corneal graft failure.2 furthermore, we started to understand the importance of the ocular surface and the significance of healthy limbal stem cells and epithelium. this has led to a change in practice patterns, where we try to get away from preservatives and their effects on goblet cells in the conjunctiva as well as increasing the hydration of the epithelium. a number of articles were found in our literature review on corneal transplants and the use of anti - inflammatory drugs. while the focus of the articles was on reducing graft rejection maumenee was the first to report on the mechanism of corneal graft rejection in the 1950s.3 in that work, the mechanism of antigen - antibody reactions was described, as well as immediate and late hypersensitivity responses in an avascular corneal graft.4,5 follow - up investigative studies analyzed immune reactions following pk. the number of immune cells and in particular macrophages, monocytes, and lymphocytes were shown to correlate directly with the severity of endothelial rejection.5,6 this is why surgeons use immunomodulating medications, particularly topical and/or systemic steroids following pks. one method is by effectively inhibiting phospholipase a2 (used in converting membrane phospholipids to arachidonic acid) in the inflammatory cascade ; arachidonic acid is a leading compound in initiation of the inflammatory response. steroids also decreased the formation of all eicosanoids by reducing the production of cyclooxygenase and lipoxygenase. despite their noteworthy efficacy in reducing host immune responses, first - generation steroids, ie, dexamethasone, have posed their own unique challenges to patients and physicians who have had to prescribe them routinely to patients from the early days of this procedure. among some of these issues, exacerbation of ocular surface disease as a result of preservatives within the ocular steroid medications and steroid - induced intraocular pressure (iop) elevation rank high on the list. such events reduce the level of adherence to typical steroid drops.7 nonsteroidal anti - inflammatory drugs (nsaids) work solely by inhibiting the cyclooxygenase enzyme and blocking prostaglandin production. nsaids are not used in patients following pk for reducing intraocular inflammation or pain. for many years, researchers have sought the triggering pathophysiological events and mechanisms causing rejection and pain post - pk. increased understanding of the triggering event(s) allows clinicians to target the treatment with more specific drugs. in one such recent discovery, it was shown that majority of corneal resident stromal dendritic cells (dcs) undergo maturation by acquiring high expression of major histocompatibility complex ii antigens and costimulatory molecules.8 these donor - derived dcs migrate to host cervical lymph nodes to activate host t cells via the direct pathway. targeting either the dcs or the host t cells should help to reduce the overall host immune - response rate to the donor cornea following pk. the same authors later found the infiltration of monocular and polymorphonuclear cells may be the mechanism of corneal graft failure. to counter the monocular and polymorphonuclear cell response, an injection of -melanocyte - stimulating hormone was shown to reduce the number of inflammatory response cells, resulting in an increased survival rate.9 ma showed endostatin (from collagen xviii), restin (from collagen xv), thrombospondin, and tissue inhibitor of metalloproteinase-3 play a significant role in a series of inflammatory cascades following pk.10 this study also discussed the integral role that healthy limbal stem cells and healthy epithelial basement membrane play in suppressing the impetus for corneal vascularization by decreasing these processes and in the restoration of corneal avascularity.10 two other studies found corneal neovascularization and eosinophilic infiltration to be additional factors in cases of graft failure.11,12 inhibition and reversal of such events would certainly extend the survival rate of corneal grafts. multiple medications targeting more than one site in the inflammatory pathway may also improve success post - pk. in a series of reports, investigators showed that combinations of two or more systemic immune suppressive agents (oral prednisone, azathioprine, and cyclosporine) led to more successful outcomes in the management of corneal graft failure.13 other agents may also extend graft longevity or reverse graft rejection : intravenous pulse methylprednisolone, mycophenolate mofetil with cyclosporine a, topical birch - leaf extract (betula pendula), rapamycin, and/or systemic tacrolimus have been evaluated as possible candidates to decrease rejection.1421 the studies showed that pathways leading to t - cell activation and interleukin 1, a potent proinflammatory cytokine, to be critical factors in initiating and maintaining intraocular inflammation following pks. these pioneering works helped ophthalmologists to appreciate the contribution that steroids have had in suppressing the inflammatory cascade following pks. nearly a half - century after ophthalmologists started to use prednisolone acetate 1% for management of rejection and pain post - pk, a survey published in 2005 by randleman and stulting showed that between 37% and 90% of the 396 cornea society members responding preferred to use prednisolone acetate 1% in when prescribing anti - inflammatory medications after pk. loteprednol etabonate (le) had been introduced, and 6%12% of respondents solely used le when continuing steroids longer than 6 months after pk.22 prior to this survey, a similar survey was published in 1992. topical prednisolone acetate, alone or in combination, was shown to be the preferred prescription for the routine postoperative immunosuppressive regimen as well as in the prevention and treatment of graft - rejection cases.23 in the us, the currently available topical ophthalmic steroids include : prednisolone acetate 1% (pred forte ; allergan, irvine, ca, usa), rimexolone suspension 1% (vexol ; alcon laboratories, fort worth, tx, usa), fluorometholone 0.1% (fml, allergan) and loteprednol acetate 0.2% or 0.5% suspension, gel, or ointment (alrex 0.2%, lotemax 0.5% ; bausch and lomb incorporated, rochester, ny, usa). pivotal trials showed that it was a lower - potency steroid compared to prednisolone, but it may have a role in the routine management of ocular inflammation following pk. loteprednol gel 0.5% (and ointment) is free of preservatives and stays on the ocular surface longer than drops, so it may have a place as well for post - pk patients. in april 2011, the us food and drug administration (fda) approved le 0.5% ointment (lotemax 0.5% ointment) for the treatment of postoperative inflammation and pain following ocular surgery (figure 1). ointments allow medication delivery with a base - delivery system that is free of many compounds seen in drops and gels. additionally, they can be preservative - free. le 0.5% ointment is preservative - free and does indeed have longer surface contact for drug delivery than drops. lotemax ointment may have improved long - term tolerability and less epithelial toxicity because it contains mineral oil without benzalkonium chloride (bak).24 increased iop as a result of topical steroids (steroid responder) is a well - documented side reaction described in the literature, which has certainly declined with the advent of lotemax ointment or suspension.25 as a result, an increasing survival of corneal grafts may be appreciated due to a reduction in endothelial cell loss. the molecular formula of le is c24h31clo7 (figure 2).26 le is synthesized through structural modifications of prednisolone - related compounds. the ointment also contains inactive ingredients of white petrolatum, mineral oil without the preservative bak. as a glucocorticoid compound, it inhibits prostaglandin production through several independent mechanisms and reduces the early inflammatory response by suppressing a variety of inciting agents. additionally, glucocorticoids reduce capillary proliferation, fibroblast proliferation, collagen deposition, and cicatrization. le is lipid - soluble (ten times greater lipophilicity than dexamethasone) and can penetrate into cells. it is an ester - based corticosteroid as opposed to a ketone - based corticosteroid (carbon-20 position is replaced with chloro methyl ester and the 17-hydroxyl group with a carbonate moiety), such as dexamethasone or prednisolone. when the ester group is cleaved from loteprednol etabonate, it results in the formation of inactive carboxylic acid metabolites pj-91 and pj-90, neither of which binds to the glucocorticoid receptor. receptor - binding studies have shown that le has 4.3 times greater binding affinity than dexamethasone for glucocorticoid (type ii) receptors and binds competitively to transcortin, a corticosteroid - binding plasma protein. the functional ester group at the c-20 of le, instead of a ketone group, is believed to result in a reduced propensity for elevation in iop compared to ketone corticosteroids.27,28 le undergoes a relatively rapid transformation to an inactive metabolite, which improves its safety profile and reduces the risk of steroid response ; this makes le a good candidate for inflammatory ocular conditions.28 after installation of topical le, research has shown that plasma levels of le suspension and its metabolites are below the limit of quantification (1 ng / ml) following ocular administration of le 0.5% eight times daily for 2 days and/or four times daily for 42 days.29 the study concluded that chronic exposure to le at a concentration and frequency equal to or greater than the intended therapeutic dose does not result in detectable systemic levels or hypothalamic pituitary axis suppression. the existing literature on the pharmacokinetics and mode of le ointment action describes these to be similar to the commercially available suspension / gel. all clinical studies have investigated the efficacy of lotemax ophthalmic suspension or the gel rather than the ointment. loteprednol has been shown to be efficacious in the treatment of inflammation related to seasonal allergic conjunctivitis, giant papillary conjunctivitis, anterior uveitis, dry eye, and cataract surgery. a comprehensive literature review including the keywords loteprednol etabonate and efficacy (pubmed search 19912013) resulted in 103 articles, of which only four were related to corneal transplant surgery.7,22,29 however, corneal transplant surgery has evolved like medication options, so researchers have looked at endothelial survival after descemet s stripping automated endothelial keratoplasty (dsaek).30 this study reported switching some patients to le during the course of postoperative treatment. the primary focus of other studies looking at the efficacy of le was where it is used to treat ocular inflammation, the safety and level of pain control following cataract surgery, and other conditions unrelated to pk surgery (such as vernal or seasonal allergic conjunctivitis).3336,41 there seems to be a change in practice patterns where corneal surgeons use le as an option for post - pk and -dsaek patients. at the same time, we are seeing a movement away from preserved drops in the clinical setting, so the use of le ointment is occurring, but we are unable to provide any direct citations on the efficacy or safety of lotemax ointment in treatment of inflammation and pain following pk. however, lotemax suspension or gel comparative efficacy studies on the control of inflammation and pain following other forms of intraocular surgeries can be indirectly attributed to lotemax ointment, as it contains the same active ingredient without bak preservative. for studies published on lotemax gel or suspension, we found a multicenter investigator - masked randomized trial by lane and holland showing the le 0.5% (lotemax) suspension to be equivalent to prednisolone acetate 1.0% (pred forte) in control of inflammation following cataract surgery. the efficacy of le was examined in 88 patients with a 3-week follow - up ; there was less iop fluctuation on days 1 and 3.31 statistical significance was not published. both le and prednisolone acetate medications were well tolerated by patients. in the pivotal fda trials looking at postoperative patients in a randomized, double - masked, vehicle - controlled evaluation of the efficacy and safety of le after cataract surgery, the resolution of anterior chamber inflammation was observed in 55% of 203 patients in the le group and in 28% of the vehicle group (p<0.001) after 14 days. no adverse outcome was observed in either group, and no iop elevation was noted in the le group.31 in another randomized study by stewart to evaluate the efficacy and safety of le drops in controlling ocular inflammation, effective resolution of anterior chamber inflammation was found in 64% of patients in the le group and in 29% of patients in the control (vehicle) group.32 in evaluating the efficacy of le in the management of pain following cataract surgery, comstock and usner showed 84% control of pain for the le group and 56% for the placebo group (p<0.005). in controlling discomfort, their study showed 79% efficacy for the le group and 42% for the placebo group.33 in a prospective randomized study to evaluate the efficacy of le gel 0.5% in controlling pain and inflammation, fong showed 31.1% of le - treated patients and 13.9% of vehicle - treated patients had complete resolution of anterior chamber cells at 8 days. furthermore, the authors showed 75.7% of le - treated patients and 45.8% of vehicle - treated patients had no pain (grade 0).34 in comparative studies evaluating le suspension 0.5%, other corticosteroids, or nsaids, stewart found no statistically significant difference in efficacy between the le- and fluorometholone acetate 0.1%-treated groups. this was a randomized double - masked study of 30 postoperative cataract patients looking at the resolution of the anterior segment inflammation. no adverse outcome was observed in either group.35 in another randomized comparative study, oner looked at the efficacy of le 0.5% suspension versus fml 0.1% versus prednisolone acetate 1% (pf 1%) in the treatment of vernal keratoconjunctivitis. the authors showed no statistically significant differences in outcome measures between the le and pf groups for the 57 enrolled patients. the study also showed statistically significant iop elevation after the third day of treatment with pf. the authors concluded le was as effective as pf and more effective than fml in treatment of vernal keratoconjunctivitis without side effects.36 holzer published a prospective randomized comparative study of le suspension 0.5% and ketorolac tromethamine ophthalmic solution 0.5% for treatment of inflammation after cataract surgery, and showed no statistically significant difference in any final outcome parameters between the two groups up to 30 days postoperatively. the authors noted no adverse side effects in either group.37 a more recent multicenter, randomized, double - masked study by rajpal evaluated the efficacy of le gel 0.5% compared to vehicle for resolving inflammation and pain following cataract surgery. the authors showed le gel had superior efficacy in reducing anterior chamber cells and flare in patients following cataract surgery in comparison to the vehicle. the authors concluded that le gel 0.5% would likely be more suitable in treatment of ocular inflammation following ocular surgery. because of formulation improvements, including no preservatives and a more physiological ph, the authors felt it may provide added benefit to patients.38 we were unable to identify any publications supporting lotemax (in any form) as the preferred choice of ocular inflammation following pk surgeries. the randleman and stulting survey showed that of the 396 corneal transplant surgeons participating, 37%90% used topical prednisolone as their primary or preferred routine anti - inflammatory drug of choice following pk. also, 81%91% used topical prednisolone acetate 1% (pf) for various manifestations of graft rejection at all time points. that study, as well as others, concluded that topical prednisolone remained the mainstay for the prevention and treatment of corneal graft rejection ; however, they pointed out that the role of le seems to have been expanding.22,39 in a more recent retrospective study of 30 patients by holland to evaluate for a clinical reduction in iop in known steroid responders using le 0.5% ophthalmic suspension as second - line rescue therapy after corneal transplantation, the authors concluded that switching to le from pf was successful in reducing iop. reduction of iop was noted in all 30 patients who were switched from pf to le. additionally, they recommended that physicians consider le 0.5% in the prophylaxis of allograft rejection in steroid responders, due to its lower potential for causing elevated iop.40 in a prospective randomized multi - centered double - masked trial, rajpal compared le gel 0.5% to a vehicle and showed le gel 0.5% to be efficacious and safe in treating postoperative inflammation and pain. the study included 203 patients followed for 18 days after cataract surgery.41 a total of four treatment - emergent serious adverse events were noted during the study ; none was felt related to the study drug. in both treatment groups, the mean iop remained stable, and no cases of steroid response were observed. finally, in a large randomized, double - masked, parallel - group, vehicle - controlled study of le, comstock published data on 805 patients assessed for safety and efficacy of le ophthalmic ointment 0.5% for the treatment of inflammation and pain following cataract surgery. the study showed le ointment to be both efficacious and well tolerated in the treatment of ocular inflammation and pain following cataract surgery.42 mean iop for all study eyes in both treatment arms (le and prednisolone) was consistently lower than baseline at all posttreatment visits. this is not surprising, as many studies have shown decreased iop after cataract surgery.43 one patient in the le ointment - treated group experienced cystoid macular edema, requiring the patient to exit from the study. the authors, in their conclusion, asserted that the integrated results of all published studies on le ointment show the medication to be effective and well tolerated in the treatment of postoperative inflammation and pain following ocular surgery.42 tables 1 and 2 summarize the available published literature on efficacy of lotemax and intraocular inflammation. the safety and tolerability profile of lotemax has been evaluated primarily as a 0.5% ophthalmic suspension (new drug application 20583) in clinical trials. in a clinical evaluation of le ointment, comstock concluded that the preservative - free ointment formulations of le may provide a safety advantage over fml ointment and allow physicians a choice of dosage forms in treating ocular inflammation following ocular surgery.42 howes reported that le is a corticosteroid designed using the soft drug concept of bodor, and in comparison with other steroids, le has a superior safety profile, which has been attributed to its soft - drug characteristics.44 soft drugs are new therapeutic agents that undergo predictable metabolism to inactive metabolites after exerting their therapeutic effect. hence, they are obtained by building into the molecule, in addition to the activity, the most desired way in which the molecule is to be deactivated and detoxified.30 during early phase fda toxicity evaluation, rabbits and dogs were followed for 28 days ; there were no significant toxicity findings, except for the transient irregular aspect of the ocular surface (in both treated and control groups), felt to be caused by the viscous consistency of the ointment vehicle. le has not been studied in pregnant or nursing women, but has been found to be teratogenic in animals. as a result, le should not be used in pregnant or nursing women unless the benefits to the mother clearly outweigh the risk to the fetus or the nursing child. in animal studies, oral administration of le the safety of le ointment in pediatric patients has not been established, and it should be used with caution, as it may interfere with amblyopia treatment. two large prospective clinical studies evaluated the safety of le ointment for the fda clinical analysis (clinical studies 52532 and 52655). when both studies were pooled to create a common database of 405 subjects, analysis for safety was done, and the most common ocular adverse events were anterior chamber inflammation, corneal edema, photophobia, conjunctival hyperemia, eye pain, and iritis. these same events happened with the placebo or vehicle ; however, le had a lower frequency of these events. the studies showed le was well tolerated by patients receiving the medication. in individuals treated for 28 days or longer with le suspension, the incidence of significant elevation of iop ($ 10 mmhg) was 2% among patients receiving le and 0.5% among patients receiving placebo. clinical trials did not show any significant difference in occurrence of serious and nonserious systemic adverse events between le and placebo. randomized controlled trials comparing active corticosteroid components looked at the cost - effectiveness of loteprednol compared to other commonly used steroids in the management of ocular inflammation occurring as postoperative inflammation, acute anterior uveitis, giant papillary conjunctivitis, or seasonal allergic conjunctivitis. forte showed that the total cost of treating ocular inflammation was higher in the prednisolone arm due to the higher probability of elevated iop and the resources consumed in its management.45 druzgala showed that the levels of le and its metabolites were highest in the cornea, and so was the ratio of metabolites to unchanged drug, suggesting that the primary site of deactivation of the drug and systemic presence of the drug would be minimal.46 in their review article, amon and busin concluded that le had similar efficacy to rimexolone and difluprednate by offering similar rates in the resolution of ocular inflammation with fewer clinically significant increases in iop ($ 10 mmhg) ; thus, they found le was a clinically safer ophthalmic corticosteroid.47 concern continues today, as over the last few decades, about causing significant and intractable steroid - related iop elevation following pk. when grafts done for a variety of conditions, such as fuchs corneal dystrophy or keratoconus (kcn), need immunosuppression and when iop rises, it confounds the ability to use pressure - rising steroids, which would inevitably lead to a choice between corneal graft failure or visual field loss. in a retrospective review of 100 patients who underwent pk, erdurmus found that steroid - induced iop elevation or glaucoma after pk was not unusual in eyes with kcn or fuchs dystrophy (73% in the kcn group and 60.3% in the fuchs dystrophy group).7 le would be an ideal alternative steroid in such cases. applying ophthalmic ointment immediately following teaching patients or companions how to apply the ointment is also time - consuming, and doctors vary in how they have patients apply the medication. additionally, there is a concern about the inadvertent entrance of the ointment into the anterior chamber.48 optimal care must be taken to have a watertight closure of the incision sites and to instruct the patients to not rub their eyes in cases where le ointment is considered following the surgery.49 numerous reports of intraocular ophthalmic ointments have recently appeared in the literature linking the presence of the ointment with the initiation of toxic anterior segment syndrome, glaucoma, and recurrent uveitis.4954 however, in a two - arm study published in 2013 evaluating the efficacy of lotemax gel used for treatment of postoperative ocular inflammation and pain, rajpal reported that 85% of patients reported no discomfort on instillation of the gel.41 furthermore, the study showed that the majority of the 406 patients in both treatment groups had no dryness, itching, or discharge. the authors felt moving away from shaking the bottle (in order to resuspend the drug particles) may increase compliance. the nonsettling nature of the gel formulation as well as the ointment would eliminate the need to shake the bottle.45 a reduced level of bak and more physiological ph of le gel resulted in improved patient tolerance, enhanced comfort, and better overall satisfaction. similarly, lotemax ointment does not contain bak, and may provide even further ocular surface tolerance and comfort by containing mineral oil and white petrolatum, an ideal medication for treatment of ocular inflammation and ocular surface disease following pk procedures. as with other ocular ointment formulations containing mineral oil, a transient reduction in visual acuity is expected, and patients need to be informed of such an expected side effect following application of the ointment. following a comprehensive review of published articles on lotemax 0.5% suspension, gel, and ointment, our conclusion is as follows. the clinical application of lotemax ointment offers significant advantage over other currently available steroid medications in the treatment of mild - to - moderate ocular inflammatory conditions. lotemax ointment should be considered as a first - line therapeutic agent in the treatment of ocular inflammation in adult or pediatric patients following cataract surgery when the patients suffer from comorbid ocular surface disease, chronic ocular allergy, dry eyes, or have a history of steroid response or ocular hypertension. the safety and efficacy of the anti - inflammatory application of this drug has well been established in the literature. lotemax ointment may also have potential as a first - line anti - inflammatory agent of choice in postoperative settings of strabismus, penetrating glaucoma, and following low - risk pk procedures. lotemax ointment may also have a significant role where patients have arthritis or a tremor and can not place drops easily. in clinical settings, where steroid ointment needs to be applied chronically in children or low - vision individuals, utmost care should be taken to avoid the onset of amblyopia and adverse health outcomes. future double - masked randomized clinical trials will establish the safety and efficacy of lotemax ointment in the treatment of postoperative inflammation following strabismus, glaucoma, and pk surgeries, and will corroborate our asserted clinical application of this drug. following a comprehensive review of published articles on lotemax 0.5% suspension, gel, and ointment, our conclusion is as follows. the clinical application of lotemax ointment offers significant advantage over other currently available steroid medications in the treatment of mild - to - moderate ocular inflammatory conditions. lotemax ointment should be considered as a first - line therapeutic agent in the treatment of ocular inflammation in adult or pediatric patients following cataract surgery when the patients suffer from comorbid ocular surface disease, chronic ocular allergy, dry eyes, or have a history of steroid response or ocular hypertension. the safety and efficacy of the anti - inflammatory application of this drug has well been established in the literature. lotemax ointment may also have potential as a first - line anti - inflammatory agent of choice in postoperative settings of strabismus, penetrating glaucoma, and following low - risk pk procedures. lotemax ointment may also have a significant role where patients have arthritis or a tremor and can not place drops easily. in clinical settings, where steroid ointment needs to be applied chronically in children or low - vision individuals, utmost care should be taken to avoid the onset of amblyopia and adverse health outcomes. future double - masked randomized clinical trials will establish the safety and efficacy of lotemax ointment in the treatment of postoperative inflammation following strabismus, glaucoma, and pk surgeries, and will corroborate our asserted clinical application of this drug. | purposeto review comprehensively the available peer - reviewed published articles in the literature on loteprednol suspension, gel, and ointment in the treatment of ocular inflammation and pain following ocular surgery.methodswe conducted a pubmed literature search review of all published articles on keywords associated with loteprednol etabonate and ocular surgery.resultsa total of 59 peer - reviewed articles were found in the literature. the focus of the majority of the articles was on the safety and efficacy of loteprednol etabonate 0.5% in postoperative control of inflammation and pain following cataract surgery. there were only three articles with a remote association between loteprednol etabonate and keratoplasty.conclusionlotemax ointment may also have potential as a first - line anti - inflammatory agent of choice in postoperative settings of strabismus and penetrating glaucoma, and following low - risk penetrating keratoplasty procedures. |
betagene participants are mexican - american adults (both parents and three or more grandparents are mexican or of mexican descent) who are 1) women who had gestational diabetes mellitus (gdm) within the previous 5 years, 2) siblings or cousins of those with a history of gdm, or 3) women with normal glucose levels during pregnancy in the past 5 years. women documented with and without previous gdm were identified from the los angeles county / university of southern california medical center, kaiser permanente southern california s delivery population, and obstetrical / gynecological clinics at local southern california hospitals. women without previous gdm were frequency - matched to gdm cases by age, bmi, and parity. details regarding recruitment have been previously described (14). all protocols for betagene were approved by the institutional review boards of participating institutions, and all participants provided written informed consent before participation. research data were collected in two separate visits to the general clinical research center at the university of southern california. the first visit consisted of a physical examination, dietary and pa questionnaires, a 2-h, 75-g oral glucose tolerance test (ogtt), and fasting blood for lipid measurements (15). participants with fasting glucose 0.28 for each trait after including sex in the model, details by sex analyses) (supplementary tables 1 and 2) except ogtt fasting glucose (p = 0.037). age - adjusted fasting glucose decreased with increasing pa in women (mean sem for low = 5.1 0.04 mmol / l, moderate = 5.0 0.04 mmol / l, and high = 4.9 0.06 mmol / l ; p = 0.013) but not in men (low = 5.2 0.08 mmol / l, moderate = 5.1 0.05 mmol / l, and high = 5.2 0.06 mmol / l ; p = 0.35). after further adjustment for sex, the association between pa and percent body fat was no longer significant (p = 0.38) (table 2). the significant associations for 2-h glucose, fasting, and 2-h insulin and di observed in the age - adjusted analyses remained after further adjustment for sex (table 2). an increasing level of pa was significantly associated with a lower waist - to - hip ratio (p = 0.012) and marginally associated with decreasing fasting glucose (p = 0.10) and increasing si (p = 0.076) after adjustment for age and sex. comparison of metabolic traits across the three pa groups we assessed the relative contribution of body fat to the observed associations between pa and diabetes - related traits by additionally adjusting for percent body fat, bmi, or waist - to - hip ratio. age-, sex-, and percent body fat adjusted means for ogtt fasting and 2-h glucose and insulin are shown in fig. analogously, adjusted means for si, airg, and di are shown in fig. 2. associations between pa and 2-h glucose, fasting insulin, 2-h insulin, and di remained significant after further adjusting for percent body fat, and the regression coefficients were only slightly reduced (75% of the participants in this cohort were overweight or obese (25th percentile of bmi was 25.5 kg / m). two previous studies evaluated short - term exercise training and changes in -cell function before and after training. one of the studies included 12 subjects > 60 years of age (11). the other study included overweight adults and demonstrated that both moderate and vigorous exercise training improved insulin sensitivity and -cell function, although the improvement of -cell function was not statistically significant for vigorous activity (12). although the biological mechanisms of the impact of pa on -cell function have not been clarified, there has been evidence that exercises expanded -cell mass by stimulating its proliferations and preventing its apoptosis (25,26). in these rat studies, exercises were shown to enhance the expression of insulin receptor substrate-2, which is crucial for -cell growth and survival. the beneficial effect of exercises on -cell function may also be the improvement of adipose tissue biology such as increasing adiponectin and reducing inflammation (27). recently, we showed that declining adiponectin was significantly associated with -cell function deterioration in a longitudinal study independent of weight gain (28). the mechanism for this association may promote -cell function and survival by increasing ceramidase activity, decreasing intracellular ceramide levels, and increasing antiapoptotic metabolite sphingosine-1 phosphate levels (29,30). taken together, the results from this report and previous reports suggest that greater amounts of daily living activity might protect -cell function, even in overweight and obese individuals. a cross - sectional study in mexican children suggested that the impact of pa on -cell function could be mediated by body fat (31). they found that the higher cardiorespiratory fitness, which reflects chronic pa behavior, was significantly correlated with -cell function as well as insulin resistance. we did not observe a significant association between percent body fat or bmi and self - reported pa groups after adjustment for age and sex. in addition, the adjustment for percent body fat and bmi did not significantly reduce the association between pa and -cell function. the lack of association between pa and bmi or percent body fat in this adult cohort may be due to the fact that our cohort is primarily composed of women with a history of gdm and their family members, the majority of whom are overweight or obese and are presumably at higher than normal risk for diabetes. we did not measure fitness levels, and pa was self - reported and included work - related activities such as moving heavy furniture, loading trucks, and gardening, as well as sports activities such as aerobics. our finding was consistent with the results from several large studies with long - term follow - up, which showed that self - reported pa was associated with a lower incidence of diabetes independent of bmi (32). in other previous studies, energy intake was shown to confound the effect of exercise on body weight or insulin resistance (33,34). however, in our analysis, the associations between -cell function, glucose, insulin profiles, and pa were not significantly changed by the adjustment for caloric intake. therefore, our results indicated a more direct contribution of pa in preserving -cell function. moreover, our findings are consistent with the results of a recent study in rats, which demonstrated that voluntary exercise was beneficial for sustaining -cell compensation without preventing dyslipidemia or obesity (35). one possible mechanism for such an effect would be mitigation of the adverse metabolic effects of obesity. since pancreatic biopsies can not be performed, a surrogate measure would have been the computed axial tomography scan estimate of peritoneal fat or an ultrasound assessment of hepatic fat content. although the questionnaire has been used in previous studies in mexican americans (18), it is well known that self - reported pa tends to be overreported on questionnaires (36,37). dhhs recommendation for pa instead of using the minutes of pa as a continuous variable to reduce the impact of measurement errors. as evidence of potential overreporting in this cohort, 57% of participants reported meeting or exceeding the dhhs pa guideline, as compared with 36% for mexican americans in a national report of participation in aerobic activity (38). however, we also note that our questionnaire included work - related pas, which might explain the higher than expected percentage. second, we did not measure physical fitness, which is more objective and a better predictor than self - reported pa for many health outcomes, such as diabetes and cardiovascular diseases (39,40). third, the cross - sectional and observational design of our study precludes us from examining the dynamic impact of pa on the change in metabolic traits. the strength of the current study is the unique sample, which includes a large cohort of mexican americans with detailed ogtt- and ivgtt - based measures of glucose tolerance, insulin sensitivity, and -cell function. unlike other studies that mostly examined the short - term effect of exercise training / intervention on insulin secretion and insulin resistance with small sample sizes, we described the association with pa in a free - living environment to provide a more realistic model than the impact of a specific, short - term exercise intervention. we showed that increasing pa is associated with better -cell function in a population without overt diabetes. our results suggest that an effect on diabetes prevention by lifestyle change (1,2) may be mediated by the improvement of -cell function. our findings have implications for a real - world approach to the delay, prevention, and/or early treatment of type 2 diabetes. in conclusion, our study indicates that a greater level of pa might play a role in improving glucose tolerance and protecting -cell function in mexican americans who are at high risk of developing diabetes. the beneficial impact of pa on -cell function does not depend on bmi, percent body fat, and energy intakes. our findings have important public health implications to prevent / slow down the deterioration of -cell function that leads to type 2 diabetes. | objectiveto examine the association between self - reported physical activity (pa) and diabetes - related quantitative traits.research design and methodsthe observational cohort was 1,152 mexican american adults with dual - energy x - ray absorptiometry, oral and intravenous glucose tolerance tests, and self - reported dietary and pa questionnaires. pa was categorized into three mutually exclusive groups according to the u.s. department of health and human services pa guidelines for americans : low (vigorous < 75 min / week and moderate < 150 min / week), moderate (vigorous 75 min / week or moderate 150 min / week), and high (vigorous 75 min / week and moderate 150 min / week). trends in pa groups were tested for association with metabolic traits in a cross - sectional analysis.resultsthe participants mean age was 35 years (range, 1866 years), mean bmi was 29.6 kg / m2, and 73% were female. among them, 501 (43%), 448 (39%), and 203 (18%) were classified as having low, moderate, and high pa, respectively. after adjustment for age, a higher pa was significantly associated with lower 2-h glucose, fasting insulin, and 2-h insulin and greater -cell function (p = 0.001, 0.0003, 0.0001, and 0.004, respectively). the association did not differ significantly by sex. results were similar after further adjustment for age, sex, bmi, or percent body fat.conclusionsan increasing level of pa is associated with a better glucose and insulin profile and enhanced -cell function that is not explained by differences in bmi or percent body fat. our results suggest that pa can be beneficial to -cell function and glucose regulation independent of obesity. |
endosseous implants are increasingly being used in maxillofacial, dental and orthopedic surgery. implant failure and loss may have a number of causes, including factors related to the design of the implant system, a poor surgical technique, excessive loading or unfavorable host reaction. it has been clearly demonstrated that implant - retained prosthesis may be placed successfully and linger functional for many years. there is adequate data suggesting excessive mechanical stresses and poor initial stability at placement as the causes of early failure of implants. proper primary stability and postponing loading of the implant to about 36 months after the surgery have long been considered as the conditio sine qua non to provide the required situations for implant osseointegration. however, the necessity to wait that long before loading an implant has been based upon clinical experience and thoughts rather than being evidence based. adequate stability of an implant in the bone is an essential matter for favorable repair process, bone formation and also distribution of mastication forces. primary stability is critical and believed to be influenced by length, geometry, bone - to - implant contact area, cortical to trabecular bone ratio and the placement technique. secondary stability is a consequence of secondary woven and lamellar bone formation [1,2,59 ]. advances in implant dentistry towards improved osseointegration and accelerated loading protocols are based on enhanced implant designs and surface features along with a better understanding of the restorative options for such approaches. high success rates in implant patients following conventional loading protocols can similarly be achieved with the early and immediate loading protocols in appropriately selected cases [1015 ]. accordingly, application of a simple, clinically feasible, noninvasive test to assess implant stability and osseointegration is believed to be highly desirable. the most widely used clinical technique in this matter is the radiographic method which is criticized for being two dimensional and difficult to standardize. it seems a quantitative reproducible method for evaluating the stability of solid dental implants in clinic and it may be helpful. the periotest (niva, charlette, nc) is another transient excitation tool that could not be a trustable device due to lack of sensitivity in implant stability measurement. around the mid-90s, meredith reported the use of a transducer directly attached to an implant body or to the abutment to achieve a clinical, noninvasive measure of stability to presume osseointegration of implants expressed as implant stability quotient (isq) units, which were scaled from 1 to 100 [1820 ]. it has been demonstrated that this device is efficacious in assessing changes in interfacial stiffness during osseous healing, osseointegration and the supracrestal dimensions of bone - implant interface[1,3,1920 ]. histomorphometric studies suggest that rf values correlate well with levels of bone - implant interface [2122 ]. these findings support the use of rfa in assessing changes in the bone healing and osseointegration processes following implant placement. although isq values can not be directly linked to actual cellular activities, they provide a reproducible assessment of the condition of the bone - implant interface [1821 ]. therefore, they can be used to monitor and control the biologic conditions of bone - implant interface. this device is now wireless and have an aluminum peg (smart peg) that attached on to the implant, utilizing aluminum peg (smart peg) attached to the implant or the abutment, utilizing electromagnetic pulses across a frequency range and then analyzing the response of the smart peg. the result is two - dimensional through a planar measurement instead of the linear one used with the previous device. this improved technology presents more reproducible and representative results around the implant (360) via a mathematical algorithm. the aim of this clinical study was to determine the primary stability and to assess changes in implant stability during the early phase of healing, applying the noninvasive rfa technique with the use of a new device osstell mentor (osstell ab, gamlestadsvgen, gteborg, sweden) in an attempt to determine the best time for loading of roughened - surface nobelbiocare replace select tapered tiunite implants (nobel biocare, guttenberg, sweden) and iti sla (sandblasted, large - grit, and acid - etched) solid - screw implants (straumann, basel, switzerland) with different lengths and diameters, placed in different quality types of bone through single - stage surgery. this clinical trial was designed to assess implant stability changes with an rf analyzer (osstell mentor ; integration diagnostics ab, sweden) in two different implant systems with different designs in the critical early healing phase (first 60 days after implant placement). the samples consisted of sixty - eight 18 to 70-year - old patients for each implant system (30 males, 38 females), treated in the department of implantology in tehran university of medical sciences during the past two years. nobelbiocare replace select tiunite tapered implants were 10 mm (n=60) and 13 mm (n=91) long with different diameters of 3.5 mm (n=26), 4.3 mm (n=89) and 5.0 mm (n=38) ; iti sla solid - screw implants were 10 mm (n=75) and 12 mm (n=76) long with different diameters of 3.3 mm narrow body (nb) (n=17), 4.1 mm regular body (rb) (n=95) and 4.8 mm wide body (wb) (n=39). the effect of implant length, diameter, location, bone type, patient age and gender was evaluated on implant stability expressed as isq units. data were analyzed by descriptive statistics, student s t - test and anova using spss software. after informed consent forms were signed by the patients, all the implants [61 replace implants (39.89%) in the maxilla and 92 (60.11%) in the mandible and 70 iti implants (46%) in the maxilla and 81 (54%) in the mandible ] were placed using a non - submerged technique, following the manufacturer s instructions (table 2). bone density was categorized as type i, ii, iii or iv at the time of surgery according to lekholm and zarb index in 1985 that was approved by the judgment of the tactile sense of the surgeon (table 3). immediately after implant placement and at 14-, 30-, and 60-day intervals post - operatively the proper smart peg for each implant (iti ; types 4 & 17, nobelbiocare replace ; type 13) was screwed onto the fixture and the implant stability was measured by the rf analyzer and expressed in isq units. an increased isq value indicated greater stability than before, whereas decreased values indicated a decrease in implant stability. readings were performed three times for each implant ; one from the top, one from the buccal and one from the lingual side of the smart peg ; then the mean was calculated. to reduce observer bias, after informed consent forms were signed by the patients, all the implants [61 replace implants (39.89%) in the maxilla and 92 (60.11%) in the mandible and 70 iti implants (46%) in the maxilla and 81 (54%) in the mandible ] were placed using a non - submerged technique, following the manufacturer s instructions (table 2). bone density was categorized as type i, ii, iii or iv at the time of surgery according to lekholm and zarb index in 1985 that was approved by the judgment of the tactile sense of the surgeon (table 3). immediately after implant placement and at 14-, 30-, and 60-day intervals post - operatively the proper smart peg for each implant (iti ; types 4 & 17, nobelbiocare replace ; type 13) was screwed onto the fixture and the implant stability was measured by the rf analyzer and expressed in isq units. an increased isq value indicated greater stability than before, whereas decreased values indicated a decrease in implant stability. readings were performed three times for each implant ; one from the top, one from the buccal and one from the lingual side of the smart peg ; then the mean was calculated. to reduce observer bias, isq values showed a high level of reproducibility, with an accuracy of 2 units. according to the isq values iti implants showed an increase in isq values with time, but replace implants remained rather constant. the mean isq values for replace implants were higher than those for iti implants at all times, the difference being significant at all the measurement intervals (p0.05). the 10- and 13-mm - long replace implants showed relatively the same isq values at all the four measurement intervals (p>0.05), whilst in the iti implants differences were observed at the 14-day interval and 12-mm - long implants, demonstrating higher stability than 10-mm - long ones ; the difference was not significant either (p>0.05). the results showed that isq values for 10- and 13-mm - long replace implants were higher than those for 10- and 14-mm - long iti implants and the values remained rather constant for 10- and 13-mm - long replace implants. regarding different diameters in iti implants, the greatest difference was seen at the 30-day interval between 4.8 and 4.1-mm (p>0.05) and also between 4.1- (rb) and 3.3-mm - diameter implants (nb) (p > 0.05). although 4.8-mm - diameter implants had higher stability compared to 4.1- and 3.3-mm - diameter ones, there was no significant difference in isq values with regard to different implant diameters (p>0.05). concerning replace tapered implants at all the measurement t intervals, it was noted that the greater the implant diameter, the greater the isq value and consequently, the greater the stability (p0.05) (diagram 2). regarding type ii bone, the patterns were rather the same with no significant differences ; however, replace tapered implants were slightly more stable (p>0.05) (diagram 3). regarding iti implants, no significant changes in stability from baseline readings were observed in type ii bone (p>0.05) ; however, these changes in other bone types were significant (p0.05) and these implants proved more stable compared to iti implants, particularly when placed in type iii and type iv bone (diagrams 25). generally, in both systems, implants placed in the lower jaw were more stable than those in the upper jaw and contrary to what was seen in the maxilla, the pattern of stability changes in the mandible were similar in both systems (p0.05) (diagram 7). rfa offers a noninvasive stability measurement in the periphery (360) of implants with osstell mentor device. as the smart peg and implant structure are constant, any changes in rfa reveals changes in implant - bone interface, either in quality or quantity. in this study, implant stability was measured at four intervals for each implant ; namely, immediately after placement as the primary stability, day 14 as the time for the newly formed woven bone around the implant, day 30 as the time when the woven bone lines most parts of the implant surface and the start of the remodeling phase, and finally day 60 as the time at which the implant surface is lined with lamellar bone as accepted in the literature for loading [2426 ]. the present study seems to have allowed a proper evaluation of stability changes in both implant systems during the early stages of healing, leading to valuable and interesting biological and clinical insights. it was noted that the number of implants and mean isq values were higher in replace system compared to iti system at all the measurement intervals. iti implants are parallel - sided, differing from replace implants, which are tapered. osullivan reported in 2000 that parallel - sided implants can reach their maximum stability if the coronal part is placed in cortical bone ; however, tapered implants apply a lateral compression force to the surrounding walls while being placed, making them more stable at the time. their higher installation torque value (itv) compared to the parallel - sided implants might be attributed to the same factor emphasized by molly in 2006. accordingly, the distance between the threads in iti implants is about twice that in replace implants ; thus, incorporating more threads per surface area can make them more stable, especially at the time of installation. tiunite coating on replace implants tends to increase the surface area by 37%, while sla coating on iti implants accomplishes the same task by 33% ; this little difference does not seem to contribute significantly to the dissimilar implant stability during the early healing phase[2930 ]. as a rule, although implant surface condition is important during the healing phase, the implant design is the major feature of an implant body during the loading period. mean implant stability levels were rather equal at baseline, 14- and 30-day intervals and higher at the 60-day interval in each system individually, with no significant differences at the 60-day interval in either of the implant systems, which might be explained by remodeling process at the bone - implant interface and the increase in bone - implant contact area as time goes by [3234 ]. the recent finding can also be explained with regard to carlos aparicio s theory in 2005, stating that stability of implants gets closer to each other with time due to bone density homogeneity. implant length was not found to be a significantly effective factor influencing stability in both implant systems, which is consistent with the results of other studies [3538 ]. many previous studies have also reported that the success rate and/or the resorption rate of bone do not undergo changes when different implant lengths are used.. it is probable that once the bone - implant contact is established at the marginal level and the implant is firm, a 2- or 3-mm difference in length in the apical region, which is classically composed of cancellous bone, does not result in a significant increase in the overall implant stability. accordingly, it is likely that placing a great deal of emphasis on the use of the longest implant applicable is not always the best decision. in the present study, implant diameter had a positive influence on isq values in both systems, which might be attributed to greater implant - bone contact area as the diameter increases. however, in iti implants this effect was not significant compared to the replace system, which was attributed to the conical design of replace implants, applying more lateral compression force to the surrounding bone with diameter increase ; therefore, providing more lateral stiffness and isq values. in previous studies, concerning bone type, in iti implants in the present study, stability patterns in different bone types were noticeably different. nevertheless, in replace tapered implants, the patterns in all the four bone types were fairly the same. as for bone type i in iti implants, a rather high primary stability was noted (mean isq=75). the reason might be the thick cortical bone layer with a small amount of trabecular core. it might also be attributed to the press - fit of the slightly larger diameter of the implant against cut bone surface. interestingly, as time went by, the stability demonstrated a slight decline up to day 60, with mainly two possible reasons : 1. overheating during drilling ; the phenomenon is more likely to happen in type i bone than other bone types and might result in marginal bone loss and an increase in effective implant length [2843 ] 2. this bone type is almost completely cortical and the capacity of regeneration is impaired because of poor blood supply. in both systems in type ii bone, a slight non - significant decline was observed in isq values during the first 30 days, which began to increase until day 60 afterwards. this finding confirmed the ones in roberts report that bone density / quality is indeed dynamic, changing in relation to implant surface. it appears that type ii bone is a proper bone type for both tapered and parallel wall implants from implant stability viewpoint because of the thick cortical layer with a dense trabecular core and good blood supply. however, this non - significant decline during the first month and the subsequent increase reflect a discrepancy with the results of studies by friberg, which might be attributed to the effect of the rough surface coating and the subsequent reaction at the interface. iti implants in bone type iii and iv exhibited considerably lower primary stabilities at the baseline compared to that in type i and type ii bones, probably due to less cortical bone and the larger trabecular core with lower density. the subsequent rise in isq values after the baseline is consistent with the improved bone formation around the roughened implant surface. on the other hand, it has already been shown that implants with lower isq values will exhibit greater increase in isq values with time [49,9,50,51 - 53 - 26 ]. in replace tapered implants, the primary stability and the pattern of stability changes in all the four bone types were fairly the same. isq values in bone types i, ii and iii were rather high (more than 70) ; however, in type iv bone, although isq values followed the same pattern, they were lower compared to other bone types due to the thinner cortical bone and the larger trabeculae. these findings might be attributed to the geometry and tapered design of replace implants, which provide more lateral compression and stiffness, compensating lower bone density. a comparison of stability patterns of mandibular and maxillary implants in both systems showed that the overall stability level was higher in the mandible. in replace implants, the similar pattern of stability changes and non - significant values between the jaws in contrast to iti implants were attributed to the tapered geometry of these implants, which can create higher lateral compression and secure the high primary stability. these results are consistent with reported higher survival rates of implants in the mandible compared to the maxilla, as a result of differences in bone density [4850 ]. denser bone exists in the mandible with 2550% greater integrative success in the anterior mandible compared to the maxillary posterior region. in general, it was noted that the denser the bone, the higher the primary stability in both systems ; however, replace implants could secure the initial stability and prevail over the bone remodeling stages during the critical first two months of the osseointegration process due to their tapered design and more lateral bone compression during installation, resulting in more lateral stiffness. as a result, when using replace implants in bone types i, ii and iii, bone type had no effect on isq values in the present study, which is an interesting finding attributable to the implant design. in vivo and histomorphometric studies have confirmed that isq values associate well associate well with levels of bone - implant contact area. in a recent study, it was shown that the values measured by the magnetic device used in the present study correlate well with those of the electronic one ; the amount measured by the former equals 812 units less than that measured by the latter. on the other hand, studies have suggested that implants with isq values of more than 60 (measured by the electronic device) are eligible to undergo immediate loading as if a stable fixation exists between the bone and the implant ; even minute inter - fragmentary movements can be avoided and dynamic load bearing can be withstood. therefore, in implants with high primary stability and no significant changes with time, an immediate loading protocol can be indicated. as a result, given the values measured for replace tapered implants in bone types i, ii and iii, which indicate no significant changes during the study period, it is possible to consider immediate loading for these implants ; however, in type iv bone, just to be on the safe side, it would be better to consider early loading protocol because of the poor bone quality and lack of fully acceptable mean primary isq values (under 68). in iti implants, it is difficult to make a firm clinical decision about the immediate loading protocol in type i bone because isq values slightly decreased over time. nonetheless, isq values were in the higher limits (more than 65) at all intervals during the study with only a 2% change in mean isq value after 30 days. on the other hand, it is suggested that for implants with high primary isq values, decrease in implant stability during the first 3 months of healing should be supposed as a common occurrence that does not require modifications in routine follow - up procedures. due to the isq values in type i bone, which were over 65 with little decrease in high primary stability after two months in the present study, immediate loading in iti sla implants in type i bone is tempting. however, continuous decreases in isq levels in type i bone and the least mean isq values after 60 days compared to the other three earlier measurements favor the early loading protocols. it appears that in iti implants, proper conditions for immediate loading protocol were only seen in type ii bone. as histological bone analysis has been established as the gold standard to determine the bone type in the literature, perhaps it was better for us to determine the bone type in this manner anyway, the large number of samples and the highly professional surgeons who were involved in this study made our results more accurate. on the other hand, a large number of previous studies have utilized the surgeon s professional common sense to determine the bone type. in addition, trisi showed that the surgeon s sense can determine the bone type appropriately. in general, this study appears to have provided valuable insights into implant stability changes in the two systems throughout the important early stages of healing. as there is a recent interest in immediate loading of single - unit restorations and none of the implants were immediately loaded in this study, a study involving monitoring of the stability patterns of single - unit, immediately loaded, roughened - surface implants would offer more results to validate our results. the effect of splinting versus non - splinting will possibly be compared in an rfa study on immediate hybrids and immediate single - unit restorations. it would also be valuable in these studies to examine occlusal factors as potential variables in the healing process. this study demonstrated that in parallel wall implants the primary stability and pattern of stability changes are different between different bone types, but tapered implants can inhibit decreases in primary stability in all bone types. bone type and geometry of the implants are the most important factors for implant stability during the first 60 days of healing. in parallel and tapered wall implants, with regard to primary stability and pattern of stability changes, maybe immediate and early loading protocols are appropriate alternatives in type ii and types i, ii, iii bone, respectively. implant diameter was found to be ineffective in iti parallel wall system, but in replace tapered system, wider implants were more stable. patient sex, age and implant length were not significantly effective in implant stability according to isq values in either of the two systems. maybe future studies, examining occlusal factors as possible variables in the healing process and also evaluating the effects of splinting versus non - splinting procedures can be beneficial to a better understanding of the results of the present study. | objectiveto determine the pattern of stability changes as a reflection of early healing around single - stage roughened - surface implants in humans utilizing resonance frequency analysis (rfa).materials and methodshundred twenty - five patients who demanded dental implants were treated with two different implant (nobel biocare replace and strumman iti) systems. bone type was classified into four groups. rfa was used for direct measurement of implant stability on the day of implant placement and consecutively at 14, 30 and 60 days after placement. the data were analyzed with student t test and regression analysis.resultsthree-hundred four roughened surface implants placed in the maxilla and mandible were evaluated. in replace implants the lowest mean stability measurement was at 30 days for all bone types and the stability did not change significantly in any of the bone types (p>0.05). iti implants demonstrated the lowest stability at 60 days for type 1 and 30 days and baseline for type 2, 3 and 4 bones. in addition, there was significant differences in implant stability between bone types 1 and 4 (p0.05). no significant difference was observed regarding gender, age and lengths in both systems.conclusionin comparison to iti implants, replace implants revealed no significant difference in the pattern of stability changes among different bone types. |
data from randomized clinical trials have demonstrated that implantable cardioverter defibrillators (icds) provide a significant reduction in arrhythmic mortality in patients with ischaemic and non - ischaemic cardiomyopathy, both in primary and secondary prevention. in addition, cardiac resynchronization therapy (crt) has been shown to improve symptoms, reduce hospitalizations, and to reduce mortality in patients with refractory heart failure (hf). despite the advances in medical therapy, commonly used risk factors that predict prognosis in icd recipients with hf include nyha functional class, qrs width, and left ventricular ejection fraction (lvef). however, the majority of patients has more than one condition affecting their health state. recent studies suggest that comorbidity as renal failure and diabetes further influence the prognosis of icd recipients. the role of comorbidity in the short- and long - term prognosis of hf patients implanted with an icd capable of cardiac resynchronization therapy (crt - d) has not been adequately studied. the charlson comorbidity index (cci) the index is based on comorbid conditions and cardiovascular risk factors of known prognostic value with varying assigned weights. the aim of the present study was to determine whether the pre - implant cci predicts long - term survival and whether the cci has the potential to identify those patients who would benefit less from crt - d implantation. two prospective icd registries of the cardiology departments of the erasmus mc and the university hospital of basel were the basis for this study. out of these registries, we identified all patients who received a crt - d. the following selection criteria for crt were applied : symptomatic hf despite optimal drug therapy, impaired lvef (lvef 35%), inter- or intra - ventricular conduction delay (qrs duration 120 ms), and lv end - diastolic diameter > 55 mm. secondary prevention was defined as cardiac arrest without transient or reversible cause or spontaneous symptomatic sustained ventricular arrhythmias. primary prevention as indication for icd therapy was defined as the presence of lvef 35% with ischaemic or non - ischaemic cardiomyopathy in the absence of a history of cardiac arrest or sustained ventricular arrhythmia. as a certain period of follow - up was warranted, only patients who were followed for at least 12 months were eligible for the analysis. the mean ventricular tachycardia detection rate was 353 24 ms, the mean ventricular fibrillation detection rate was 284 15 ms. for all devices, antitachycardia pacing in combination with cardioversion / defibrillation therapy features was activated. for resynchronization therapy, the atrio - ventricular delay was optimized by 2d echocardiography to provide the longest diastolic filling time and the highest left ventricular outflow tract velocity timed integral. comorbidity as present before icd implantation was identified via patient history, laboratory values, and review of patients ' clinical data. for all patients, the renal function was assessed by estimating the baseline glomerular filtration rate (egfr) using the abbreviated modification of diet in renal disease (mdrd) study equation : egfr (ml / min/1.73 m of body surface area) = 186 (serum creatinine in mg / dl) (age) 0.742 in female subjects. impaired renal function was defined as an egfr 2 mean values was performed by one - way analysis of variance. baseline clinical variables and previously identified variables associated with mortality (p 55 mm. secondary prevention was defined as cardiac arrest without transient or reversible cause or spontaneous symptomatic sustained ventricular arrhythmias. primary prevention as indication for icd therapy was defined as the presence of lvef 35% with ischaemic or non - ischaemic cardiomyopathy in the absence of a history of cardiac arrest or sustained ventricular arrhythmia. as a certain period of follow - up was warranted, only patients who were followed for at least 12 months were eligible for the analysis. the mean ventricular tachycardia detection rate was 353 24 ms, the mean ventricular fibrillation detection rate was 284 15 ms. for all devices, antitachycardia pacing in combination with cardioversion / defibrillation therapy features was activated. for resynchronization therapy, the atrio - ventricular delay was optimized by 2d echocardiography to provide the longest diastolic filling time and the highest left ventricular outflow tract velocity timed integral. comorbidity as present before icd implantation was identified via patient history, laboratory values, and review of patients ' clinical data. for all patients, the renal function was assessed by estimating the baseline glomerular filtration rate (egfr) using the abbreviated modification of diet in renal disease (mdrd) study equation : egfr (ml / min/1.73 m of body surface area) = 186 (serum creatinine in mg / dl) (age) 0.742 in female subjects. impaired renal function was defined as an egfr 2 mean values was performed by one - way analysis of variance. baseline clinical variables and previously identified variables associated with mortality (p 80 years, history of atrial fibrillation, renal dysfunction (creatinine 1.8 mg / dl), and nyha class iii or iv. patients with two or more of these factors had an increased risk for early mortality after device implantation, with renal dysfunction as comorbidity. a recent analysis of the second multicenter automatic defibrillator implantation trial (madit ii) demonstrated that a point score based on clinical variables (age > 65 years, diabetes, nyha class > ii, blood urea nitrogen > 28 mg / dl, and non - sinus rhythm) can identify patients at high risk for death during long - term follow - up. at 6-years follow - up, patients with high risk (at least three risk factors), medium risk (one to two risk factors), and low risk (no risk factors) had a cumulative mortality of 68, 43, and 19%, respectively. in a study by bruch. the prognostic impact of comorbidities in hf patients treated with an icd was examined. in this study, patients with all of these variables had an event - free survival of 15% at 1400 days follow - up. the previous studies identified renal failure as a predictor of mortality, next to traditional markers as nyha functional class and advanced age. the effect of cardiac and non - cardiac conditions on survival has been evaluated in a large community - based examination of icd recipients. this study revealed that the presence of non - cardiac comorbidity and prior hf was a significant predictor of death. the adjusted hr for death was 2.98 for patients with at least three comorbid conditions. in our study all patients had hf, but consistent results were observed with increased mortality for those with a high comorbidity burden. the results of the present study may have implications for the translation of the expanded indications for icd therapy from randomized trials into clinical practice. evidence from randomized clinical trials indicates that the icd reduces arrhythmic mortality in hf patients with ischaemic and non - ischaemic cardiomyopathy, both in primary and secondary prevention. in addition, the efficacy and survival benefits of crt have been proved in observational studies as well as in randomized trials. taken this together, the addition of defibrillation to crt is reasonable, as the crt - d targets both hf and arrhythmic mortality. despite the effectiveness of terminating ventricular tachyarrhythmias by the implantable defibrillator, competing non - cardiac comorbidity bai., demonstrated that renal failure and diabetes are strong independent predictors of mortality in patients treated with crt. both comorbid conditions are incorporated in the charlson model as applied in the present study. the rate of appropriate icd therapy was twice as likely in secondary prevention compared with primary prevention., it is of particular interest to identify patients who might not benefit from icd implantation. in our study, the majority of patients who died prior to appropriate icd therapy had a primary prevention indication. taken all together, the findings of this study may assist the clinician contemplating icd insertion as primary prevention. however, it is still a personal decision about how high the risk of death from non - cardiac comorbidity should be before icd therapy is no longer justified. unfortunately, appropriate icd interventions can not be predicted by the comorbidity index. another possible limitation is the assessment of comorbidity, which was partly based on administrative data sources. another possible limitation is the assessment of comorbidity, which was partly based on administrative data sources. these sources have a likelihood of underreporting. however, an analysis of administrative data suggested a high degree of specificity. comorbidity is common in hf patients with a crt - d, which has a major impact on survival. a high comorbidity burden was a significant predictor of death in crt - d recipients. the abbreviated cci is a useful and easy tool to assess the burden of comorbidity at baseline. our findings may assist clinicians contemplating icd insertion as primary prevention in patients with hf in the presence of non - cardiac comorbidity. however, further research is still needed to characterize other specific comorbid conditions as predictors of survival, and to predict who will receive appropriate icd therapy. b.a.s. was supported by a grant from the swiss national fund (izk0z3 - 12146/1) and from st jude medical. funding to pay the open access publication charges was provided by the department of cardiology, thoraxcenter, erasmus mc, rotterdam, the netherlands. | aimscomorbidity, such as myocardial infarction, diabetes, and renal failure, plays a pivotal role in the prognosis of a patient with arrhythmias. however, data on the prognostic impact of comorbiditiy in heart failure patients with cardiac resynchronization therapy and defibrillation (crt - d) are scarce. the purpose of this study was to determine the impact of comorbidity on survival in crt - d patients.methods and resultsthe study population consisted of 463 heart failure patients who received a crt - d between 1999 and 2008 in rotterdam and basel. the charlson comorbidity index (cci) is often used as an adjusting variable in prognostic models. the cox proportional hazards analysis was performed to determine the independent effect of comorbidity on survival. during a median follow - up of 30.5 months, 85 patients died. mortality rates at 1 and 7 years were 6.3 and 32.3%. cumulative incidence of implantable cardioverter defibrillator (icd) therapy at 7 years was 50%, and death without icd therapy was observed in 9% of patients. at least three comorbid conditions were observed in 81% of patients. patients who died had a higher cci score compared with those who survived (3.9 1.5 vs. 2.9 1.5 ; p < 0.001). an age - adjusted cci score 5 was a predictor of mortality (hazard ratio 3.69, 95% ci 2.066.60 ; p < 0.001) independent from indication for icd therapy, and from icd interventions during the clinical course.conclusioncomorbidity is often present in heart failure patients, and a high comorbidity burden was a significant predictor of mortality in crt - d recipients. comorbidity can not predict appropriate icd therapy. death without prior icd therapy occurs in a minor proportion of patients. |
lower - extremity musculoskeletal dysfunctions are commonly encountered by various health care providers and are known to negatively impact the quality of life1, 2. according to the international classification of functioning, disability, and health (icf) model3, comprehensive assessment of musculoskeletal dysfunctions requires clinicians to quantify the effect of the dysfunction on the various health - related domains, namely, impairment of body structure and function, activity limitation, and participation restriction. the y balance test (ybt), derived from the star excursion balance test (sebt)6, has been reported to be a valid and reliable measure of dynamic balance6,7,8,9 ; furthermore, the results of the ybt have been reported to be related to lower - extremity impairments10, 11 and to be predictors of injuries12, 13. for application of the ybt in daily clinical practice, reference values are required for an accurate interpretation of the test results. these normative values would be used by clinicians to determine the performance levels of patients. because ybt performance differs among cultures14, establishment of culture - specific ybt reference values activity limitation, an important health - related domain, can be quantified using patient - reported outcome measures in people with lower - extremity musculoskeletal dysfunctions15,16,17,18. the lower extremity functional scale (lefs) is a region - specific patient - reported outcome measure that can be used to determine activity limitation in people with lower - extremity musculoskeletal dysfunctions19,20,21. this scale was recently cross - culturally adapted into the arabic language (lefs - ar)22. lefs - ar showed excellent measurement properties, suggesting its usefulness for both daily clinical practice and for research purposes22. similar to ybt, lefs - ar use in daily clinical practice could be enhanced by establishment of reference values that can be used to analyze the scores of the patients. therefore, this study aimed to establish gender - specific reference values for the ybt and lefs - ar in healthy young adults in saudi arabia, and to examine gender differences in the ybt and lefs - ar values. the study design was cross - sectional, wherein all the participants were tested in a single testing session. healthy males and females who were 1829 years old were recruited for this study. subjects were excluded if they showed any lower - extremity or spinal dysfunction or had undergone any surgery, had a history of dizziness or falls, showed any visual or inner ear problems, showed any neurological dysfunctions, showed altered feet sensation, or were pregnant. the participants were college students at king saud university in riyadh, saudi arabia. all of the participants signed informed consent forms approved by the college of applied medical sciences human subjects review board at king saud university before participation. the procedure of the testing session was as follows : completion of a general information form by each participant, ybt practice trials, completion of lefs - ar, followed by ybt actual test trials, in that order ; the session ended with measurement of the weight, height, and lower - extremity length of each participant. barefooted participants started the ybt with 6 practice trials in each direction before they underwent the formal testing. the order of the practice trials was right anterior reach (6 trials), left anterior reach (6 trials), right posteromedial reach (6 trials), left posteromedial reach (6 trials), right posterolateral reach (6 trials), and left posterolateral reach (6 trials). the formal testing trials were performed in the same order as the practice trials, with 3 trials performed in each direction. in each trial, the participants were instructed to reach as far as they could by using their reach foot while keeping their reach foot in contact with the reach indicator, and then return to the starting point while they maintained their balance on the stance limb. the maximum reach distance was recorded to the nearest 0.5 cm in each reach trial. the maximum reach distance of the 3 formal trials in each direction was used for the analysis. reach distances recorded in centimeter (cm) were also normalized to each participant s leg length by dividing the reach distance by limb length and then multiplying by 100 to account for the influence of the leg length on test performance23. normalized composite reach distance was computed for each leg as the sum of the maximum reach distances (in centimeter [cm ]) in the 3 directions, divided by 3 times the limb length, and then multiplied by 100. each item was scored on a scale of 04, where 0 indicates extreme difficulty or inability to perform the activity, and 4 indicates no difficulty. the scores of the items were summed up to yield a total score, ranging from 0 to 80, with lower scores representing greater degrees of activity limitation. lefs - ar has been shown to be a valid and reliable measure of activity limitation in patients with lower - extremity musculoskeletal dysfunction22. lower - limb length was measured from the anterior superior iliac spine to the most distal part of the medial malleolus for each participant by using a tape measure while the participant lay in the supine position. the dominant lower extremity for the participants was determined on the basis of their response to the question which foot do you use to kick a ball with. the required sample size to estimate the mean ybt reach distance with 95% confidence level (ci) was computed using a standard deviation of 7 cm7 and an acceptable error of 2.5 cm above and below the mean24, 25. this computation revealed a required sample size of 30 participants. the required sample size to estimate the mean lefs - ar score with 95% confidence level (ci) was computed using a standard deviation of 5 scale points and an acceptable error of 5 scale points above and below the mean24, 25. because the aim of this study was to establish gender - specific reference values, a sample consisting of 30 males and 30 females would be adequate for the establishment of gender - specific reference values for the ybt and lefs - ar. the reference values for males and females were obtained by computation of means, standard deviations, and 95% ci for each reach direction in the ybt and also for the lefs - ar scores. independent t - tests were used to examine gender differences in ybt and lefs - ar, whereas paired t - tests were used to examine interlimb differences in the ybt. thirty - one females and 30 males participated in this study (table 1table 1.characteristics of the participantsvariablefemalesmean sdmalesmean sdage (year)20.61 1.121.40 1.4height (m)1.56 0.041.74 0.08mass (kg)54.8 12.977.6 19.9body - mass index (kg / m)22.4 4.825.6 5.6leg length (cm)87.6 3.493.2 5.2sd : standard deviation. the males were slightly older, had higher body weight, and were taller than the females were (table 1). reference values for the ybt for both the females and males are shown as percentage of the leg length in table 2table 2.reference values for the y balance test (expressed as a percentage of the leg length [% ll ]) and lefs - arvariablefemalesmalesgender difference mean sd 95% cimean sd95%cimean difference (95% ci)anterior (% ll)right 70.1 4.168.671.673.1 7.370.475.82.9 (0.08 to 6.0)left 70.4 4.368.871.973.5 8.570.476.73.2 (0.32 to 6.6)dominant70.2 4.368.671.773.0 7.570.275.82.8 (0.3 to 6.0)non - dominant70.3 4.168.871.973.6 8.370.676.73.3 (0.1 to 6.7) average70.3 3.968.871.773.3 7.070.775.93.1 (0.1 to 6.0)posteromedial (% ll)right 93.7 7.391.096.4104.2 8.4101.1107.410.5 (6.5 to 14.6)left 92.9 7.890.095.8107.0 8.7103.8110.214.1 (9.8 to 18.3)dominant93.4 7.490.796.1104.3 8.6101.0107.510.8 (6.7 to 14.9)non - dominant93.2 7.990.396.1107.0 8.5103.8110.213.8 (9.6 to 18.0)average93.3 7.390.696.0105.6 7.8102.7108.612.3 (8.4 to 16.2)posterolateral (% ll)right 92.3 8.089.495.3105.0 10.0101.3108.812.6 (8.0 to 17.3)left 92.8 9.089.596.1105.3 11.6101.0109.712.5 (7.2 to 17.8)dominant92.3 8.589.295.4105.8 10.5101.9109.713.5 (8.7 to 18.4)non - dominant92.9 8.689.896.0104.5 11.2100.4108.711.6 (6.5 to 16.7)average92.6 8.089.695.5105.2 10.3101.3109.012.6 (7.8 to 17.3)composite (% ll)right 85.4 5.783.387.594.1 7.291.496.88.7 (5.4 to 12.1)left 85.4 6.383.087.795.3 7.492.598.19.9 (6.4 to 13.4)dominant85.3 6.083.187.594.1 7.091.596.88.8 (5.5 to 12.2)non - dominant85.5 6.183.287.795.3 7.692.598.19.8 (6.3 to 13.3)average85.4 5.883.287.594.7 7.092.197.39.3 (6.0 to 12.6)lefs - ar74.3 6.671.976.774.8 5.272.876.70.44 (2.6 to 3.5)%ll : percentage of leg length ; ci : confidence interval ; lefs - ar : arabic version of the lower extremity functional scale. average of both the legs ; significant difference between males and females (p 0.25), whereas the males showed significant interlimb differences only in the posteromedial direction (right versus left, p = 0.04 ; dominant versus non - dominant leg, p = 0.03 ; table 3table 3.interlimb differences in the y balance test performancevariablefemalesmalesmean difference (95% ci)mean difference (95% ci)right minus leftanterior (cm)0.2 (1.2 to 0.8)0.4 (3.0 to 2.1)posteromedial (cm)0.7 (0.7 to 2.2)2.5 (4.9 to 0.1)posterolateral (cm)0.4 (2.2 to 1.4)0.3 (2.6 to 2.0)composite score (% ll)0.0 (1.1 to 1.2)1.2 (2.7 to 0.4)dominant minus non - dominantanterior (cm)0.2 (1.2 to 0.8)0.6 (3.2 to 1.9)posteromedial (cm)0.2 (1.2 to 1.7)2.6 (5.0 to 0.2)posterolateral (cm)0.6 (2.4 to 1.2)1.2 (1.1 to 3.5)composite score (% ll)0.2 (1.3 to 0.9)1.2 (2.8 to 0.4)ci : confidence interval ; % ll : percentage of leg lengthsignificant interlimb difference (p 3 cm in males and of > 1.2 cm in females is beyond the normal interlimb differences in the anterior direction (table 3). an interlimb difference of > 4 cm in ybt anterior direction was associated with an increased risk of lower - extremity injury12, 34 ; these results suggest that interlimb comparison could be a useful and rapid screening tool for lower - extremity dysfunctions. the males in the current study showed higher normalized reach scores in all 3 direction of the ybt and also showed higher composite reach scores than the females did. furthermore, the males showed greater absolute interlimb reach difference in the posteromedial direction of the ybt than the females did. these results are in line with the previous results, which indicated that males showed greater normalized reach distances in the posteromedial and posterolateral directions and higher composite reach scores than the females did27. in another study, males seemed to show higher composite scores and greater normalized reach distances in all directions than females did, although this difference was not statistically tested by the authors26. many previous studies27, 35 indicated greater interlimb differences in males than in females in the anterior reach direction, whereas the results of the current study indicate gender difference in the magnitude of interlimb difference in only the posteromedial direction. the lefs - ar score ranges from 0 to 80, with lower scores representing higher levels of activity limitation19, 22. when patient - reported outcome measures are used, clinicians are faced with the challenge of determining a target for their patients36. with improvement in patient s physical function, lefs - ar score is expected to increase, and this increase could be judged as real and important by comparing it to the minimal detectable change on the scale and minimal clinically important difference19, 22 ; however, the question about what should be the target for the patient remains unanswered. the 95% ci of the mean lefs - ar score obtained in the current study could be used by clinicians as the target for their patients. lefs - ar scores of 7277 in females and 7377 in males could serve as targets during treatment of lower - extremity dysfunctions in young adults who have similar characteristics as the participants in this study. the current study established gender - specific reference values for the ybt and lefs - ar in healthy young adults in saudi arabia. however, further efforts are needed to establish reference values for the same outcome measures in different age groups to enhance the clinical usefulness of these measures in daily clinical practice. | [purpose ] this study aimed to establish gender - specific reference values for the y balance test (ybt) and the arabic version of the lower extremity functional scale (lefs - ar) in healthy young adults in saudi arabia, and to examine gender differences in the ybt and lefs - ar values. [subjects and methods ] healthy young adults (31 females, 30 males) completed the ybt and lefs - ar in 1 test session. descriptive statistical analysis (mean, standard deviation, 95% confidence interval) was used to compute the ybt and lefs - ar reference values. independent t - tests were used to examine gender differences in the ybt and lefs - ar values. [results ] gender - specific reference values were obtained for the right, left, dominant, and non - dominant leg as well as for the average performance of both the legs. males showed greater ybt normalized reach distances than females did in the anterior, posteromedial, and posterolateral directions ; furthermore, males showed higher ybt composite scores than females did. however, the lefs - ar values did not differ between males and females. [conclusion ] gender - specific reference values were obtained for the ybt and lefs - ar in healthy young adults in saudi arabia. males performed better than females did in the ybt. however, no gender differences were noted in lefs - ar. |
targeted measurements, using selected reaction monitoring (srm ; aka multiple reaction monitoring (mrm)) that is typically performed on triple quadruple (qqq) instruments, have emerged as a powerful, multiplexed quantification technology for biomarker development and systems biology studies. by the application of two stages of mass filters, specific to a target peptide and avoiding the constraints of an ion trapping step, srm using qqq instruments arguably provides the best overall combination of sensitivity and specificity presently achievable by mass spectrometry for proteomics. moreover, with prior knowledge of peptide liquid chromatography retention times, highly multiplexed analysis (e.g., hundreds of peptides in a single analysis) can be performed using a scheduled srm strategy, and this method is now widely used in biomedical and systems biology research, such as biomarker verification in biofluids, protein post - translational modifications (ptms), and studies of signaling pathways. despite the increasing popularity, an underappreciated cost of routine targeted proteomics experiments lies in the time and effort necessary to establish a sensitive srm assay. in general, for srm assay development the first step is the peptide transition selection, which can be carried out either by extracting information from an existing shotgun proteomics peptide library and data repository or actual analysis of synthetic peptides on the qqq instrument. most shotgun proteomics peptide libraries and data are typically constituted from ion trap collision induced dissociation (it - cid) data and thus are often used to facilitate srm method development. however, peptide fragmentation patterns from it - cid (resonance excitation of a specified m / z window and involving many low - energy collisions) are generally significantly different from the peptide spectra obtained from qqq (beam - type) cid, which uses ions that have significantly higher initial energies. while the higher energies are gradually dissipated by collisions, further fragmentation contributions are introduced due to additional fragmentation of fragments that are initially formed by the higher - energy collisions. recently, a fragmentation approach, termed higher - energy collision dissociation (hcd), has been made available with orbitrap analyzers that provides higher mass resolution and mass accuracy fragmentation data. given the benefit of high mass accuracy and no low mass cutoff it has also been pointed out that hcd ms / ms data share a higher degree of similarity with qqq - based ms / ms data than with it - cid data, but it also has differences due to details of the collision conditions and different m / z biases of the mass analyzers employed. however, a detailed evaluation comparing the hcd - derived and qqq - optimized results has not been reported for better understanding the feasibility of using hcd data for accelerating and automating srm assay development. in addition to transition selection, it is also important to optimize the collision energy (ce) for each transition to improve srm sensitivity. ce can be selected using existing empirical formulas (available within the widely used skyline software) or obtained for individual case using synthetic peptides and experimental optimization. for large - scale accurate quantification of high- and moderate - abundance proteins, peptide transitions are often selected from either existing discovery data or by using ces predicted by an empirical formula. by contrast, for quantification of extremely low - abundance proteins or protein ptms in complex biological samples such as human blood plasma / serum, highly sensitive srm assays are required and typically achieved by optimization using synthetic peptides through direct infusion or lc srm analysis using the actual qqq instrumentation. however, such qqq - based peptide optimization is low - throughput and labor - intensive, and it greatly increases the cost and time required for the development of large - scale sensitive srm assays. herein, we utilized a relatively large set of 215 synthetic peptides to explore the use of hcd ms / ms data to rapidly establish optimal srm assays for large - scale srm quantification. we first manually optimized each of 215 synthetic peptides with qqq instruments by direct infusion (i.e., the conventional method), including selecting the most intense fragment ions and determining the optimal ce for each transition using qqq ms / ms measurements. using the qqq ms / ms spectra and optimal ces determined in this manner as the standards, we then systematically compared the hcd and cid ms / ms spectra for each peptide from lc ms / ms analyses to the direct infusion ms / ms results. on the basis of the ms / ms comparisons and a statistical analysis taken together, our results demonstrated that the availability of hcd spectra together with refined ce prediction can expedite the development of optimal srm assays and facilitate large - scale targeted proteomics applications. all peptides were selected using the following criteria (unless indicated otherwise) : fully tryptic, less than 25 amino acids in length, no miscleavage (lysine and arginine before proline are acceptable), unique for target proteins, moderate hydrophobicity, and peptides with methionine are not preferred but were retained if there is no better choice. peptides detected in our own previous shotgun analyses were preferred, followed by those reported in public data repositories such as peptideatlas and global proteome machine (gpm). for target proteins without the existing ms / ms data, the surrogate peptides were selected on the basis of in silico digestion and then evaluated by using prediction tools such as consequence software. details of all of the peptides used in this study and their corresponding proteins are available in supporting information table 1. crude synthetic peptides labeled with either heavy lysine ([c6,n2]-lysine) or arginine ([c6,n4]-arginine) were purchased from thermo scientific (san jose, ca). in total, 215 crude heavy peptides were used for method development. a small subset of peptides (78) was first used to validate the previously reported conclusion that hcd is more similar to beam - type cid than cid (analyzed by both tsq (srm) and orbitrap (both cid and hcd)) ; another larger subset of peptides (137) was further analyzed to extensively compare how similar it is between hcd and beam - type cid (analyzed by tsq (srm) and orbitrap (hcd only)), and new ce prediction equations were built based on this combined result from 215 peptides. we then further validated the effectiveness of new ce equations using an independent set of peptides (92) (analyzed by tsq (srm)) (see supporting information table 1 for details). for direct infusion analysis, synthetic peptides were analyzed individually, and the nominal concentration of crude peptides was 200 fmol/l in 0.1% formic acid and 30% acetonitrile. for lc ms / ms analysis, all crude peptides were diluted and pooled together for one sample with a final nominal concentration of 50 fmol/l in 0.1% formic acid. direct infusion was performed using a 250 l syringe (hamilton, reno, nv) directly connected to a tsq - quantum qqq mass spectrometer (thermo scientific, san jose, ca) with a homemade spray tip (20 m i.d.). the qqq was first operated in q3 ms mode with unit resolution (peak width 0.7) for observation of potential precursors with the following parameters : spray voltage, 2400 v ; capillary temperature, 325 c ; capillary offset, 35 v ; tube lens offset, 185 v ; and collision gas pressure, 1.5 mtorr. for each peptide with different charge states, the precursor with highest intensity was selected for peptide optimization. if multiple precursors with different charge states existed with similar intensities for a given peptide, then all were retained. the qqq was then operated in ms / ms mode targeting the selected precursors for fragment information with a minimum of 10 ms / ms spectrum acquired using collision gas pressure of 1.5 mtorr. the top 6 to 7 fragment ions from ms / ms spectra were selected for further ce ramping, and the qqq srm optimization mode was used to determine the optimal ce values. for each peptide, 4 to 5 transitions were retained as the qqq - optimized transitions based on their intensities. the in - house lc system was custom - built using agilent 1200 nanoflow pumps (agilent technologies, santa clara, ca), valco valves (valco instruments co., houston, tx), and a pal autosampler (leap technologies, carrboro, nc). reversed - phase columns were prepared in - house by slurry packing 3 m jupiter c18 (phenomenex, torrence, ca) into 35 cm 360 m o.d. 75 m i.d fused silica (polymicro technologies inc., phoenix, az) using a 1 cm sol gel frit for media retention. mobile phases consisted of 0.1% formic acid in water (mobile phase a) and 0.1% formic acid in acetonitrile (mobile phase b) with a 100 min gradient using the follow profile (minute : % b) : 0:0, 2:8, 20:12, 75:35, 97:60, and 100:85. after 100 min, mobile phase b was maintained at 100% for 10 min, and then mobile phase a was set at 100% and maintained for 10 min to recondition the column. the solvent gradient was started at 40 min after the sample was injected, and mass spectra acquisition began 10 min later to account for the column dead volume. ms / ms analysis of the peptide mixture was based on an inclusion list built by skyline for each peptide with both charge 2 + and 3 + precursors using an ltq - orbitrap velos pro mass spectrometer (thermo scientific) interfaced with a home - built electrospray ionization (esi) source. the heated capillary temperature and spray voltage were 350 c and 2.4 kv, respectively. orbitrap spectra were recorded from 300 to 1800 m / z at a resolution of 100 000 followed by hcd of the 10 most abundant ions in each scan that matched with the target list of ions provided. for hcd settings, isolation width of 2 m / z, normalized collision energy 32%, activation time 0.1 s, and automated gain control (agc) set at 3 10 were used. a dynamic exclusion time of 60 s was used to discriminate against previously analyzed ions. a mixture of 92 synthetic peptides was separated by reversed - phase lc column (waters, 10 cm 75 m i.d) using a nanoacquity uplc system (waters, milford, ma) with the following 50 min gradient (minute:%b) : 0:0, 13.5:10,17:15, 38:25, 49:38.5, and 50:95. after 50 min, mobile phase b was maintained at 100% for 10 min, and then mobile phase a was set at 100% and maintained for 10 min to recondition the column. the eluent was analyzed using a tsq - vantage (thermo scientific) operated in srm mode with the following parameters : spray voltage, 2400 v ; capillary temperature, 325 c ; collision gas pressure, 1.5 mtorr ; using tuned s - lens value ; q1 and q3 unit resolution. the ce ramping method was constructed according to skyline instruction, while the ramping step was set to 2 v to cover a larger ce range. the method was then imported to the instrument, and the optimal ce was defined as that giving the highest intensity for the individual transition. although tsq - quantum and tsq - vantage instruments were used for direct infusion and lc srm analysis, respectively, our previous data have shown that at 1.5 mtorr collision gas pressure (used in this study) the difference of optimal ce values obtained from these two instruments is rather small. to ensure consistency, we recently randomly selected 10 from the list of 215 peptides and reoptimized their ce values on both the tsq - quantum and tsq - vantage instruments. a comparison of their optimal ce values showed their median difference between these two qqq instruments was less than 2 v (supporting information table 2). for direct infusion analysis, the best transition for each peptide and the optimal ce for each transition were recorded manually, and the peptide sequences, including the optimized transitions, were imported to skyline. for lc ms / ms data (hcd or cid), ms / ms spectra of the peptide mixtures were searched against the human swiss - prot database (released on september 18, 2013) using the ms - gf+ algorithm with the following parameters : precursor tolerance, 25 ppm ; fixed modifications, cysteine carbamidomethylation (c + 57.0215 da), heavy lysine (k + 8.014 da), heavy arginine (r + 10.009 da) ; partially tryptic cleavage rule ; and decoy search. after database searching, identified peptides were filtered to a false discovery rate (fdr) of < 1% at the spectrum level by applying a msgf spectrum probability filtering criterion (< 1.52 10). a peptide library was then built by importing the hcd results into skyline in pepxml format, followed by manual inspection in skyline. the ranking of the fragment ions in hcd ms / ms spectra was then exported and analyzed for correlation to the direct infusion optimized result. in cases where one fragment ion was missing in the hcd spectra, the rank of this product ion was set as 50. for the calculation of pearson correlations between hcd / cid and qqq data, we included both y and b fragment ions for the 78 crude peptides, with fragment peaks across 10 ms / ms scans of qqq direct infusion data being averaged. for orbitrap hcd and cid data, the ms / ms scan with the best spectrum probability score was retained for each peptide / charge state. for all of the commonly detected product ions between hcd / cid and qqq ms / ms spectra, the pearson correlation was calculated using product ion intensities with in - house software. for calculating the intensity ratio of the new prediction formula to the skyline prediction, the area of each transition with different ce was exported from skyline and analyzed. selecting the best transitions and optimizing their ces are crucial steps for the development of optimally sensitive srm assays. to explore the feasibility of accelerating this process of srm assay development using pre - existing shotgun proteomics data, we compared the ms / ms orbitrap hcd or cid fragmentation data with the optimized qqq data (figure 1). ms / ms on an ltq - orbitrap velos instrument to generate hcd / cid data. srm parameters for the 215 peptides were also optimized individually through direct infusion with the qqq instrument. for orbitrap data, two synthetic peptide mixtures were analyzed separately : a peptide mixture with 78 peptides was analyzed in both cid and hcd fragmentation mode for comparison of similarity between hcd / cid and qqq cid fragmentation, and another peptide mixture with 137 peptides was analyzed in hcd mode only for a more detailed comparison between hcd and qqq cid. peptides identified on orbitrap were first filtered to achieve < 1% fdr at the spectrum level with a median spectrum probability score of 3.60 10, and only spectra with the best spectrum probability values were retained for comparison. for the qqq data, 215 peptides were optimized individually using direct infusion, including transition selection with highest response as well as optimal ce for each transition (figure 1, right). these manually optimized parameters (i.e., best transition and optimal ce) were considered as the gold standard for srm assay development and used for comparison with the orbitrap hcd / cid results. for each peptide, 4 to 5 product ions were selected on the basis of their intensities, most of which were y ions (90.4%) with some b ions (9.6%) and 2 + product ions (11.4%) (b1 and y1 ions were excluded). at least one product ion with m / z higher than precursor was included for each peptide. a systematic comparison was made between orbitrap hcd / cid and beam - type qqq cid. (left) ms / ms spectrum (hhgllasar, arginine + 10) was acquired in hcd / cid mode by ltq - orbitrap velos ; (right) ms / ms spectrum (hhgllasar, arginine + 10), as well as optimal ce, was acquired in the qqq using cid. in general, the qqq cid had greater similarity with orbitrap hcd than with the cid, as expected and as illustrated in figure 2a c. when comparing the cid spectrum to the hcd and qqq cid spectrum, there was a dominant b5 fragment ion present in cid spectrum, whose intensity was significantly lower in either the hcd or qqq cid spectra. the less intense b fragment ions were most likely due to multiple stages of fragmentation that were inherent with the higher - energy injection of ions into the collision gas to produce the qqq cid spectrum. more comparison of peptide spectra from orbitrap hcd / cid versus qqq cid can be found in supporting information figure 1. comparison of spectrum and pearson correlation between ltq - orbitrap velos cid / qqq cid and hcd / qqq cid. (ac) comparison of ms / ms spectrum for doubly charged peptide gtlphplqr (arginine + 10), either hcd (a), qqq cid (b), or cid (c). (d, e) pearson product - moment correlation coefficients for hcd / cid versus qqq cid for 78 crude heavy peptides. distribution of pearson correlation displayed in histogram for both hcd / qqq cid (lower left) and cid / qqq cid (lower right), which showed a significantly higher correlation in hcd compared to that in cid with a p - value of 0.01972 (welch s two sample t - test). the x axis is the correlation coefficient, and the y axis is the data density. we further calculated the pearson correlation between the measurements using the 78 synthetic peptide mixtures : orbitrap cid vs qqq cid and hcd vs qqq cid (see experimental section). the distributions of pearson correlation coefficients for cid vs qqq cid (lower right) and hcd vs qqq cid (lower left) are shown in figure 2d and 2e, respectively. overall, hcd showed a statistically significant higher correlation with qqq cid spectra compared to cid data (welch s two sample t test p - value = 0.01972), which was consistent with a previous study. therefore, choosing orbitrap hcd data over cid data is more effective for selecting peptide transitions in srm assay optimization. for a more detailed comparison between hcd data and qqq - optimized results altogether, 182 out of 215 peptides were identified after database searching and filtering from the hcd data (including 11 peptides identified with both 2 + and 3 + precursors). the median peptide length for those identified peptides is 12 amino acid residues. in order to facilitate the comparison between hcd data and qqq - optimized results, we assembled a peptide library for those crude heavy peptides in skyline using hcd data, which facilitated selecting product ions and exporting the rank information on each product ion. then, we mapped the rank of the product ions to the qqq - optimized result (figure 3a and supporting information table 3). different types of fragment ions from hcd spectrum were further mapped to qqq - optimized transitions, either for all fragment ions (a) or y fragment ions only (b), and the distribution of peptides containing specific number of optimal transitions after selection of top y fragment ions is displayed (c). (a, b) the ranks of fragment ions in hcd spectrum were summarized from skyline and are labeled on the x axis ; the rank of product ion is set as 50 if it was missing in the hcd spectrum or below noise level. the y axis is the cumulative proportion of matched qqq - optimized transitions among all qqq - optimized transitions. (c) the x axis is the number of optimal transitions for one peptide ; the y axis is the number of peptides containing specific number of optimal transitions. as shown in supporting information table 3, 149 out of 193 (77%) top - ranked hcd product ions were among the qqq - optimized 4 to 5 best transitions, compared to a decreased 65% of the second - ranked hcd product ions that were matched. by including higher - ranked product ions, the cumulative proportion (i.e., the sum of proportions for selected product ion ranked either equal or smaller) of mapped optimal transitions increased. as shown in figure 3a and supporting information table 3, the matched number as well as a cumulative proportion of optimized results continued to increase as the rank of the product ion increased. however, typical srm experiments need to limit the number of transitions for each peptide to avoid longer scan times or reduced signal intensities and degraded quantification. when the top 7 hcd product ions were selected, a cumulative 80% of qqq - optimized transitions were covered. we noted that while the elimination of b ions and doubly charged y product ions resulted in a slight decrease in the matched number of optimized results (supporting information figure 2a), the mapping of the remaining results (rank unchanged) still covered a larger proportion of the optimized results (figure 3a), which suggested a preference of y ions over b ions and doubly charged y product ions. as shown in figure 3a for mapping the top 7 ranked hcd product ions, the cumulative proportion was increased from 77 to 79% by eliminating b ions and was further increased to 84% by the elimination of doubly charged y product ions. because b ions were less favored due to the potentially less accurate quantitative information from the heavy - isotope labeled synthetic peptides, we examined the scenario where only y ions were considered, which shifted the ranking of product ions as well. as shown in figure 3b and supporting information table 4, 82% of top - ranked y ions matched to the optimized product ions ; this proportion decreased to 74% for the second - ranked y ions. similarly, only 21% of optimized product ions were covered if only top - ranked y fragment ions were retained. in comparison, 81% of all optimized product ions the proportion of mapped optimized product ions was further increased from 81 to 86% (figure 1b and supporting information table 4) when doubly charged y ions were not considered, although the absolute number decreased (see supporting information figure 2b). in summary, by selection of the top 6 y product ions in the hcd data, up to 86% of all qqq - optimized results (y fragment ion) could be retained, thus allowing for rapid, automated selection of optimal transitions for most srm assays. to reduce the chance of having interference in the transition list, especially in complex sample matrices such as blood plasma / serum, we made sure that there is at least one transition with m / z higher than that of the precursor for each peptide. however, detailed tests are warranted for a given sample matrix in order to completely rule out potential interferences. after showing that the selection of the top 6 y product ions from hcd data coincided with 86% of qqq - optimized results, we next examined the distribution of peptides having specific numbers of optimized transitions (it is generally desired for srm assays that each peptide have at least three transitions). figure 3c shows the distribution of peptides versus the number of optimal transitions after the selection of a different number of top - ranked hcd product ions (y ion only) (figure 3c). the distribution of peptides for all product ions mapping is illustrated in supporting information figure 3. as shown in figure 3c, when the top 4 product ions were selected, 100 out of 193 peptides (52%) contained equal or greater than three optimal transitions, whereas 34 peptides (18%) had equal or less than one transition ; in contrast, when the top 7 product ions were selected, more than 140 peptides (72%) could have at least three transitions, whereas only 6 peptides (3%) had equal or less than one transition. we also noticed that the result was quite comparable for top 6 and top 7 transition selection from y product ions, with a very similar distribution. in contrast, by selection of the top 7 ions from all product ions (supporting information figure 3), about 122 (63%) peptides could have at least three transitions, which was much lower compared to that for selection of the top 6 y ions. therefore, combining the information from the transition coverage and peptide distribution, we concluded that selecting the top 6 hcd y product ions was sufficient for automated srm assay development. besides the transition selection, there are a number of approaches available for optimizing the ce, such as lc ms - based ce ramping optimization, which enables automated and high - throughput ce optimization using skyline, as well as theoretical prediction, which is an important complement to manual optimization. however, to obtain a gold standard set of ce values for the comparison, our optimal ce values for peptides were obtained by direct infusion of peptides into qqq, which was considered to be the most accurate irrespective of the lc elution profile. we calculated the difference between optimal ce and ce predicted using skyline for each transition (figure 4). for charge 2 + precursors (figure 4a), the difference between predicted ce and optimal ce was quite small : most of the transitions (87%) fell within a 5 ev window, with a median of 0.2 ev, which was consistent with a previous study ; however, for charge 3 + precursors (figure 4b), the difference between predicted ce and empirical ce was much larger compared to that for the charge 2 + precursors, with a wide and flat distribution and a median of 6.3 ev. this indicated that the ce prediction formula for charge 3 + precursors needed further refinement in order to establish an optimal srm assay. distribution of the difference between the skyline - predicted ce and optimal ce obtained from a qqq instrument was demonstrated for all transitions either from charge 2 + precursors (a) or charge 3 + precursors (b). the x axis is the difference between predicted ce and optimal ce, and the y axis is the number of transitions. we next constructed two new ce prediction equations based on qqq - optimized results for charge 2 + and 3 + precursors, respectively (figure 5a, b), and the improvement was further validated in an independent lc ramping - based ce optimization experiment (using 92 synthetic peptides ; see experimental section). as shown in figure 5c, the differences of ce between the predicted values (both skyline prediction and the new equation) and the lc ramping optimization results are depicted. for charge 2 + precursors (red), the difference between the two prediction approaches and the gold standard was negligible, with a mean of 0.42 for skyline and 0.61 for new equation prediction. however, for charge 3 + precursors (blue), the mean of the difference between skyline and the optimized result was 3.7, demonstrating that the predicted ce was too high for charge 3 + precursors ; in contrast, the mean of the difference between the new equation and the optimized result was only 0.33. these results demonstrated that significantly better ce prediction can be achieved from the new equation than when applying skyline. construction of new ce prediction equations and the comparison to skyline prediction in an independent data set. a new ce prediction equation was constructed for both charge 2 + and 3 + precursors and further compared to skyline predicted results in an independent data set consisting of 92 synthetic peptides. (a, b) construction of new ce prediction equation for charge 2 + (a) and charge 3 + (b) precursor related transitions. the x axis shows the m / z of the precursor, and the y axis represents the value of ce. (c) comparison of the difference between skyline prediction / new equation prediction and optimal ce for either charge 2 + (red) and charge 3 + (blue) precursor related transitions. the x axis plots either skyline or the new equation, and the y axis is the ce difference (in volts) between the predicted ce and the optimal ce. (d) the distribution of intensity ratio for new equation prediction / skyline prediction to optimal ce, either for charge 2 + precursor (red) or charge 3 + precursor (blue). the x axis plots either skyline or new equation, and the y axis is the ratio to optimal intensity. we further calculated the gain in signal intensity for the new equation when compared to the skyline prediction for charge 2 + and charge 3 + precursors using the ce ramping result (92 synthetic peptides). as depicted in figure 5d, for charge 2 + precursor related transitions (red), there was almost no difference between skyline and the new equation predictions : both had a mean of ratio 0.93. for charge 3 + precursor (blue), the mean of the new equation was significantly higher than that for skyline predictions (0.87 vs 0.78 ; t test, p - value 0.001724), which confirmed the usefulness of the new equation for charge 3 + precursor related transitions. we also compared intensities from skyline to the new equation predictions directly, which (supporting information figure 4) had similar results, showing almost no difference for charge 2 + precursor related transitions, whereas for charge 3 + precursor related transitions, the maximum increase in intensity from the new equation was 2.7-fold greater than with skyline, with an overall mean ratio of 1.2. srm has been widely used for accurate protein quantification due to its high sensitivity and specificity. the development of optimal srm assays is of critical importance for sensitive detection and accurate quantification of target proteins in complex biological samples. in this work, we demonstrated the utility of readily obtainable hcd data for the selection of the best transition for a given peptide and the determination of optimal ce, both of which are important steps in streamlining the assay optimization process. we have systematically compared the ms / ms data resulting from shotgun proteomics (cid and hcd) with qqq manually optimized data through analysis of a relatively large set of 215 synthetic peptides. for transition selection, it was determined that selection of the top 6 y product ions from hcd spectra could cover as much as 86% of the best transitions. we further showed that the selection of the top 6 hcd y product ions was sufficient to cover the optimal transitions for most peptides, with at least 3 of the qqq optimal transitions for each peptide. for ce optimization, we found that the skyline - predicted ce was accurate for most charge 2 + precursor transitions ; however, it was too high for most charge 3 + precursor transitions. by using the newly constructed prediction equation established from our qqq experimental data, we obtained as much as a 2.7-fold increase (1.2-fold average) in intensity for charge 3 + precursor transitions, which was higher than previous reports. finally, we validated the usefulness and accuracy of the new, refined formula using a completely independent set of synthetic peptides. we recognize that the ce optimization results may not be applicable to all qqq instruments from different vendors ; however, our work demonstrated the proof of principle for generating more accurate ce prediction equations that require large sets of peptides, and similar experiments can be pursued by applying the same principles for different types of qqq instruments. in summary, our results demonstrated the feasibility of automating the selection of the best transitions from the existing hcd results (i.e., discovery results) without using synthetic peptides and obtaining optimal ce conditions for the most responsive transitions, which would accelerate and improve large - scale targeted proteomic experiments with sensitive measurements of hundreds of target proteins in complex biological matrices. | because of its high sensitivity and specificity, selected reaction monitoring (srm)-based targeted proteomics has become increasingly popular for biological and translational applications. selection of optimal transitions and optimization of collision energy (ce) are important assay development steps for achieving sensitive detection and accurate quantification ; however, these steps can be labor - intensive, especially for large - scale applications. herein, we explored several options for accelerating srm assay development evaluated in the context of a relatively large set of 215 synthetic peptide targets. we first showed that hcd fragmentation is very similar to that of cid in triple quadrupole (qqq) instrumentation and that by selection of the top 6 y fragment ions from hcd spectra, > 86% of the top transitions optimized from direct infusion with qqq instrumentation are covered. we also demonstrated that the ce calculated by existing prediction tools was less accurate for 3 + precursors and that a significant increase in intensity for transitions could be obtained using a new ce prediction equation constructed from the present experimental data. overall, our study illustrated the feasibility of expediting the development of larger numbers of high - sensitivity srm assays through automation of transition selection and accurate prediction of optimal ce to improve both srm throughput and measurement quality. |
passer en revue les mcanismes daction sdatifs - hypnotiques par rapport au risque de delirium imparti par les mdicaments qui agissent sur les rcepteurs de lacide -amino - butyrique de type a (gabaa) et les adrnocepteurs 2. une recherche a t effectue dans la base de donnes medline pour en extraire les articles pertinents. lapparition dun tat de confusion aigu de delirium est associe des dures prolonges de sjour lunit des soins intensifs (usi) et lhpital, un risque significativement plus lev de dclin fonctionnel et une mortalit accrue. la perturbation du sommeil est un facteur de risque modifiable qui pourrait contribuer au delirium et la dysfonction cognitive chez les patients de lusi. la rparation des processus dficients et le rtablissement du cerveau un tat prpar acqurir de nouvelles connaissances sont certaines des fonctions du sommeil. le delirium survient suite une interaction complexe entre la vulnrabilit fondamentale du patient (les facteurs de risque avant lhospitalisation prdisposant le patient au delirium) et des facteurs ou lsions prcipitants (vnements modifiables survenant pendant lhospitalisation). nous prsentons lhypothse que ces deux facteurs ont un lien de causalit par le biais deffets sur la mmoire. notre hypothse explique pourquoi il est moins probable que des patients randomiss recevoir un agoniste de ladrnocepteur 2 manifestent un delirium (et la dysfonction cognitive concomitante) que des patients randomiss recevoir des benzodiazpines. nous prsentons ici notre hypothse selon laquelle des mcanismes daction hypnotique diffrents pourraient permettre de distinguer les proprits dlirognes des deux classes de sdatifs. les tudes devraient lavenir essayer de dterminer sil existe une relation de causalit entre ladministration de sdatifs, les perturbations du sommeil et le delirium. sleep is under control of two processes, a circadian clock that regulates the appropriate timing of sleep and wakefulness across the 24-hr day and a homeostatic process (sleep homeostasis) that regulates sleep need and intensity according to the time spent awake or asleep.1 sleep is a non - homogenous state that can be divided into non - rapid eye movement (nrem) sleep and rapid eye movement (rem ; paradoxical) sleep. neurochemical changes accompany these different types of sleep, with cholinergic (in brain stem and forebrain), noradrenergic (locus ceruleus), and serotonergic (dorsal raphe) activity all becoming less active in nrem sleep and cholinergic activity increasing in rem sleep2 (fig. activity in the ventrolateral pre - optic nucleus (vlpo) is increased in nrem sleep, and the -aminobutyric acid (gaba)ergic / galanin input from vlpo inhibits the histaminergic tuberomammillary nucleus3 (fig. a wakefulness is promoted by the release of the arousal - promoting monoamine (red) neurotransmitters, norepinephrine (ne), serotonin (5-ht), and histamine (his), from the locus ceruleus (lc), dorsal raphe nucleus (dr), and tuberomammillary nucleus (tmn), respectively, as well as acetylcholine (ach ; orange) from the pedunculopontine and laterodorsal tegmental nuclei (pptg and ldtg) and orexin (ox ; green) into the cortex, forebrain, and subcortical areas. conversely, during the deeper stages of nrem sleep, the activity is reversed by the inhibitory action of gaba and galanin (gal ; purple) released from the ventrolateral pre - optic nucleus (vlpo). b, c activity in brain nuclei involved in sleep pathways under sedation with a (b) gabaergic agent and c 2 adrenoceptor agonist. abbreviations : gaba gal = neurons containing gaba and galanin ; his = histamine ; na = noradrenergic ; orx = orexin ; lc = locus ceruleus ; pef = perifornical nucleus ; tmn = tuberomammillary nucleus ; vlpo = ventrolateral pre - optic nucleus. reproduced with permission from nelson. (a)27 and modified with permission (intensetimes issue 9 ; available at www.intensetimes.eu) from sanders. (b, c)1 neural mechanisms of -aminobutyric acid (gaba)ergic and 2 adrenoceptor agonist sedation. a wakefulness is promoted by the release of the arousal - promoting monoamine (red) neurotransmitters, norepinephrine (ne), serotonin (5-ht), and histamine (his), from the locus ceruleus (lc), dorsal raphe nucleus (dr), and tuberomammillary nucleus (tmn), respectively, as well as acetylcholine (ach ; orange) from the pedunculopontine and laterodorsal tegmental nuclei (pptg and ldtg) and orexin (ox ; green) into the cortex, forebrain, and subcortical areas. conversely, during the deeper stages of nrem sleep, the activity is reversed by the inhibitory action of gaba and galanin (gal ; purple) released from the ventrolateral pre - optic nucleus (vlpo). b, c activity in brain nuclei involved in sleep pathways under sedation with a (b) gabaergic agent and c 2 adrenoceptor agonist. abbreviations : gaba gal = neurons containing gaba and galanin ; his = histamine ; na = noradrenergic ; orx = orexin ; lc = locus ceruleus ; pef = perifornical nucleus ; tmn = tuberomammillary nucleus ; vlpo = ventrolateral pre - optic nucleus. reproduced with permission from nelson. (a)27 and modified with permission (intensetimes issue 9 ; available at www.intensetimes.eu) from sanders. (b, c)1 applying electroencephalogram (eeg) criteria, nrem sleep is composed of four distinct stages. stages 1 and 2 reflect light sleep and are followed by stages 3 and 4 of a deep sleep plane. stages 3 and 4 are often paired together as slow - wave sleep (sws), as the eeg in these stages is dominated by a delta rhythm (frequency 0.5 - 4 hz). slow - wave sleep may be the mechanism that drives sleep homeostasis, as it peaks early on during sleep and decreases with the decline in sleep pressure.1 physiologic repair of the organism is accelerated during sws, as evidenced by the increase in the rate of anabolism.4 within the brain, the slow wave activity (the power in the delta rhythm range) diminishes strengthening of synapses that have occurred during wakefulness5,6 and restores the brain to a state that is subsequently capable of appropriately processing new sensory input in the succeeding period of wakefulness.7 these synaptic homeostatic processes6 accommodate the brain s energy8 and space9 requirements and allow the brain to acquire new information, which would not be possible in the absence of downscaling synaptic strength. the different forms of memory, referred to as declarative or explicit (consciously accessible memories of fact - based information knowing what) and non - declarative or implicit (procedural memory knowing how) develop over time through several unique stages (acquisition, translocation, consolidation [comprising stabilization and enhancement ], and reconsolidation). deeper stages of nrem as well as rem sleep are required for some of these stages of learning and memory.2,10 - 12 truncating stages of sleep can result in development of cognitive dysfunction,2,13 the most severe of which occurs following total sleep deprivation.10 we consider that impairment in the formation and retrieval of memories may account for much of the cognitive dysfunction associated with delirium. it seems intuitive that memory deficits combined with a fluctuating level of arousal (both symptoms of sleep deprivation) could produce a disorientated patient with reduced attention (box) a description of the delirious patient. nonetheless, sedative medication also directly affects memory (independently from effects on sleep), and this likely also contributes to the delirium phenotype.box delirium is defined by the presence of disturbed consciousness (reduced clarity of awareness of the environment with reduced ability to focus, to sustain, or to shift attention) and a change in cognition (such as memory deficit, disorientation, or language disturbance) or the development of a perceptual disturbance that is not better accounted for by a pre - existing, established or evolving dementia. the disturbance develops acutely (usually hours to days) and tends to fluctuate during the course of the day. key risk factors for delirium include age, co - morbidity, an acute inflammatory precipitant, sleep deprivation and sedative medication that targets -aminobutyric acid (gaba)a receptors.reference : american psychiatric association. early polysomnographic studies had revealed extreme sleep disruption in icu patients, with decreases in total sleep time, altered sleep architecture (predominance of stages 1 and 2 sleep, decreased or absent stages 3 and 4 and rem sleep, and shortened rem periods), sleep fragmentation,14,15 and up to 50% of total sleep time occurring during the light phase. among the causes contributing to sleep disruption in the icu are those related to the patient s acute illness and co - morbidities, environmental factors (including noise and inappropriate light), and iatrogenic factors, including frequent care - related interruptions and medications prescribed for analgesia and sedation. among the causes potentially amenable to modification, excessive noise appears not to contribute as much as was anticipated,16 and attention has focused on sedative practices.17,18 several studies have now demonstrated the association between benzodiazepine use and both greater incidence19 and duration20 of delirium in medical icu patients, although the relationship of the development and duration of delirium to sleep disruption was not ascertained. acute withdrawal from long - term sedation with benzodiazepines and opiate narcotics results in profound sleep disruption.21 interestingly, although the 2 agonists can be used to treat symptoms of acute withdrawal from psychoactive drugs, the effect they have on withdrawal - induced sleep disturbances has not been reported. benzodiazepines enhance fast inhibitory neurotransmission by modulating the activity of gabaa receptors in postsynaptic membranes. the gabaa receptor is a heteropentamer, and most gabaa receptors have a binding site for benzodiazepines (formed by and 2 subunits) in addition to binding sites for the physiological neurotransmitter gaba (formed by and subunits).22 knock - in studies perturbing the gabaa receptors in mice have revealed that the 1 subunit in glutamatergic forebrain neurons is necessary for changes in locomotion (sedation), while the 2 subunit in hypothalamic nuclei is required for the transduction of the hypnotic properties (and its attendant eeg properties) of benzodiazepines.23,24 benzodiazepine hypnotics depress slow - wave activity in nrem sleep, not only during the night when subjects receive the drugs but also during the subsequent night.25 neither sleep homeostasis nor circadian rhythm is altered by acute benzodiazepine administration. recently, the dopaminergic action of benzodiazepines has been revealed, which is mediated through the 1 subunit containing gabaa receptors in the reward centre (nucleus accumbens). the gabaa receptors likely contribute to the addictive features of benzodiazepines.26 in a series of studies involving gabaergic agents, we reported that, unlike nrem sleep, these hypnotic agents did not alter noradrenergic activity in the locus ceruleus (fig. these agents converged on the nrem sleep pathway at the level of the hypothalamus.28 nonetheless, short - term administration of the gabaergic agent, propofol, permits normal recovery after a period of sleep deprivation, indicating similarities between propofol - induced hypnosis and sleep.29 benzodiazepines also exert significant memory - modulating effects, though the extent to which they impair explicit and implicit memory appears paradigm dependent.30 while some have suggested that both implicit and explicit memory are impaired following administration of midazolam,31 only explicit memory is affected in children.32 we have shown that 2 agonists transduce their hypnotic response after binding to the 2a receptor subtype33 through effects in the locus ceruleus (lc).34,35 the noradrenergic neurons become hyperpolarized and are less likely to achieve an action potential due to signalling processes that involve both pertussis toxin - sensitive g proteins36 and effector mechanisms, including inhibition of adenylyl cyclase34 and ligand - gated calcium channels as well as activation of inwardly - rectifying potassium channels.37 the relatively quiescent lc facilitates a series of changes, including activation of the galanin / gaba - containing neurons of the vlpo nucleus that terminate on and inhibit aminergic neurons within the tuberomammillary nucleus (fig. 1c).38 thus, 2 agonists are associated with similar changes in neuronal activity as is seen in nrem sleep,3,39 apart from the absence of an inhibitory effect on the orexinergic neurons in the perifornical nucleus.28 in a functional magnetic resonance imaging (fmri) study comparing sedation with 2 agonists and benzodiazepines, we showed that a thalamic nucleus receiving afferent input from orexinergic neurons is activated during an arousal stimulus in 2 agonist - sedated subjects but not in benzodiazepine - sedated subjects.40 the preservation of orexin signalling may account for the patient rousability noted with dexmedetomidine sedation. in turn, this clinical effect may be important in permitting weaning from mechanical ventilation and patient examination. compatible with overlapping neural substrates, dexmedetomidine induces a very similar eeg pattern in human volunteers as that seen in stages 2 - 4 of nrem sleep.41 children sedated with dexmedetomidine exhibited an eeg pattern that was similar to that seen in stage 2 nrem sleep.42 dexmedetomidine and sleep also share similarities in hypercarbic ventilator,43 hormonal,44 and auditory evoked response.45 recently, veselis. addressed the effects of dexmedetomidine in a particular memory paradigm (continuous recognition task) and reported less memory perturbation (if any) than was seen with gabaergic agents.46 in animal studies, acutely - administered dexmedetomidine was noted to have variable effects on learning and memory depending on the dose.47 recently reported rat studies showed that dexmedetomidine interferred only with memory formation if perception of sensory input was decreased during very deep levels.48 two randomized controlled trials (rcts) investigated whether dexmedetomidine could provide superior sedation to benzodiazepine sedation. the maximizing efficacy of targeted sedation and reducing neurological dysfunction (mends) rct compared dexmedetomidine and lorazepam sedation in 106 mechanically ventilated patients (three patients were withdrawn).17 sedation with dexmedetomidine resulted in more days thriving without delirium or coma, a lower prevalence of coma, and more on - target sedation than lorazepam administration.17 the follow - up safety and efficacy of dexmedetomidine compared with midazolam (sedcom) trial randomized 375 patients to dexmedetomidine or midazolam sedation.18 though no difference in time at target sedation was observed, patients sedated with dexmedetomidine had a reduced prevalence of delirium with a reduced duration of mechanical ventilation.18 while we did not randomize patients according to whether they were septic on admission to our mends rct,17 we had decided a priori to perform a post - hoc analysis of septic vs non - septic subgroups of patients who received dexmedetomidine - based or lorazepam - based sedation for up to five days.49 more than half of the 103 patients included (63 patients ; 31 dexmedetomidine, 32 lorazepam) were admitted with sepsis. demographic and severity data were balanced between the two cohorts. compared with septic patients who received lorazepam, the septic patients who received dexmedetomidine had 3.2 more delirium / coma - free days and more ventilator - free days on average (95% confidence intervals for difference, 1.1 - 4.9 and 0.3 - 11.1, respectively) (fig. 2). the risk of dying at 28 days was reduced by 70% (hazard ratio 0.3 : 0.1 - 0.9) in dexmedetomidine patients with sepsis compared with the lorazepam patients (fig. in addition to alternate effects on innate immunity and physiological response to the infection,49,50 we speculate that the immune dysfunctional effects of sleep deprivation in the lorazepam group may have contributed to the higher death rate from infection. our speculation is supported by data from the sedcom trial in which the rate of infection was 50% lower in the dex group.18fig. 2days free from complications associated with acute brain failure in septic intensive care unit patients sedated with the 2 adrenoceptor agonist, dexmedetomidine, or the benzodiazepine, lorazepam. data are represented in a box and whisker plot reflecting the median, lower, and upper quartiles and the lower and upper extremes of days / patient. 3kaplan - meier curve showing the probability of survival according to sedation group during the first 28 days following admission to the intensive care unit for sepsis. avoidance of lorazepam sedation using dexmedetomidine decreased the probability of dying within 28 days by 70%. reproduced with permission from pandharipande.49 days free from complications associated with acute brain failure in septic intensive care unit patients sedated with the 2 adrenoceptor agonist, dexmedetomidine, or the benzodiazepine, lorazepam. data are represented in a box and whisker plot reflecting the median, lower, and upper quartiles and the lower and upper extremes of days / patient. reproduced with permission from pandharipande.49 kaplan - meier curve showing the probability of survival according to sedation group during the first 28 days following admission to the intensive care unit for sepsis. avoidance of lorazepam sedation using dexmedetomidine decreased the probability of dying within 28 days by 70%. reproduced with permission from pandharipande.49 functional mri was performed in volunteers tested on three separate occasions during which they received saline, dexmedetomidine, or midazolam.40 subjects were infused to achieve a target concentration that produced equivalent sedation, as assessed by electroencephalography (bispectral index [bis ]) and observer rating (observer assessment of alertness / sedation [oaa / s ]). in a single subject, sleep occurred during saline infusion while undergoing fmri. subtraction scans were performed to yield the difference in blood oxygen level - dependent (bold) activity between natural sleep and the sedated states provided by either dexmedetomidine or midazolam. there were fewer voxels of bold activity seen in the subtraction scan between dexmedetomidine - sedation and natural sleep (fig. 4a) than between midazolam - sedation and natural sleep (fig. 4b).fig. 4sedation with 2 adrenoceptor agonist produces a more natural sleep response than sedation with benzodiazepine. functional magnetic resonance imaging (fmri) was performed in volunteers tested on three separate occasions, during which they received saline, dexmedetomidine, or midazolam.40 subjects were infused to achieve a target concentration that produced equivalent sedation as assessed by electroencephalography (bispectral index, bis) and observer rating (observer assessment of alertness / sedation, oaa / s). in a single subject, subtraction scans were performed yielding the difference in blood oxygen level - dependent (bold) activity between natural sleep and the sedated states provided by either dexmedetomidine or midazolam. there were fewer voxels of bold activity seen in the subtraction scan between dexmedetomidine - sedation and natural sleep (a) than seen between midazolam - sedation and natural sleep (b) sedation with 2 adrenoceptor agonist produces a more natural sleep response than sedation with benzodiazepine. functional magnetic resonance imaging (fmri) was performed in volunteers tested on three separate occasions, during which they received saline, dexmedetomidine, or midazolam.40 subjects were infused to achieve a target concentration that produced equivalent sedation as assessed by electroencephalography (bispectral index, bis) and observer rating (observer assessment of alertness / sedation, oaa / s). in a single subject, sleep occurred during saline infusion while undergoing fmri. subtraction scans were performed yielding the difference in blood oxygen level - dependent (bold) activity between natural sleep and the sedated states provided by either dexmedetomidine or midazolam. there were fewer voxels of bold activity seen in the subtraction scan between dexmedetomidine - sedation and natural sleep (a) than seen between midazolam - sedation and natural sleep (b) the changes in neuronal activity that benzodiazepines induce are inconsistent with the deeper stages of nrem sleep. consequently, the restorative properties of natural sleep are lacking in patients on prolonged benzodiazepine infusions, resulting in acute brain and immune system dysfunction that may complicate the recovery of critically ill patients. the addictive properties of benzodiazepines result in a rapid escalation in dose requirements. when benzodiazepines are part of the sedative regimen, it is difficult to perform interruption of sedation standard of nursing care because of the likelihood of the supervention of withdrawal phenomena, including a hypernoradrenergic state and anxiogenesis. sedative - hypnotic agents contribute to the development of delirium in critically ill patients.17 - 19 we hypothesize that 2 adrenoceptor agonists are beneficial relative to benzodiazepines due to subtle differences in their mechanisms of action. in particular, we suggest that dexmedetomidine sedation may provide a more restorative perhaps natural sleep - like - state than gabaergic sedatives, such as the benzodiazepines. our proposition centres on the discovery that 2 adrenoceptor agonists act on the sleep pathway at the brainstem level, while gabaergic agents act at the level of the hypothalamus. the dissimilar actions produce different sedative profiles for the two classes of agents, and we suspect they contribute to the risk of delirium in the intensive care unit through alternate effects on the restorative nature of the sedation. this may also explain why outcomes from sepsis49 and infection18 are very different for 2 adrenoceptor agonists than they are for gabaergic agents (though we suspect ongoing studies will identify the importance of the immune actions of the two drug classes). furthermore, 2 adrenoceptor agonists may provide a state from which patients are rousable, possibly through preserved orexinergic signalling. in addition to preventing the cognitive consequences of sleep deprivation, the drugs alternately affect memory formation. we suggest that the impairment of memory formation by gabaergic drugs contributes to the acute confusion in delirium, while 2 adrenoceptor agonists produce little in the way of memory impairment and thus reduce the burden of patient disorientation. clinical studies continue to reveal the benefits of understanding the differences in sedative - hypnotic mechanisms, and as further mechanistic understanding can drive advances in clinical medicine, we urge clinicians and scientists alike to continue this fruitful path of discovery to aid patient care at the bedside. the adoption of sedation holidays51 and spontaneous breathing trials52 have shown that sedation in our most vulnerable patients is an important determinant of outcome. we now have the opportunity to define the agents for best sedating our patients, and we suggest that 2 adrenoceptor agonists may offer particular advantages in the critically ill.17,18,49,50 | purposeto review the mechanisms of sedative - hypnotic action with respect to the risk of delirium imparted by drugs that act on -amino - butyric - acid type a receptors or 2 adrenoceptors.sourcemedline was searched for relevant articles.principal findingsdevelopment of the acute confusional state of delirium is associated with longer intensive care unit (icu) and hospital lengths of stay, significantly higher risk of functional decline, and increased mortality. disruption of sleep is a modifiable risk factor that may contribute to delirium and cognitive dysfunction in icu patients. among the functions of sleep are repair of defective processes and restoration of the brain to a state in which it is ready to acquire new knowledge. it is logical that disruption of these processes may produce acute confusion. delirium develops through a complex interaction between the patient s baseline vulnerability (patient s predisposing risk factors before hospitalization) and precipitating factors or insults (modifiable events that occur during hospitalization). the latter factors include both sleep disruption and sedation. we present a hypothesis that these two factors are causally linked through effects on memory. our hypothesis explains why patients randomized to receive an 2 adrenoceptor agonist are less likely to develop delirium (and the attendant cognitive dysfunction) than those randomized to receive benzodiazepines.conclusionherein we present our hypothesis that alternate mechanisms of hypnotic action may differentiate the deleriogenic properties of the two classes of sedatives. future studies should focus on whether a causal relationship can be established between sedative administration, sleep disruption, and delirium. |
the last decade has seen an exponential rise in the availability and accessibility of assisted reproductive treatment opportunities in the indian subcontinent. couple 's desires to achieve maximum chances of conceiving as well as the option of fetal reduction are important reasons for multiple embryo transfer in an assisted reproductive technique (art) cycle. balancing benefit (increased pregnancy rate) against the disadvantage of multiple embryo transfer is not easy as both the clinician and the couple very easily appreciate the benefit, whereas the disadvantages (pregnancy loss, preterm delivery, maternal and/or neonatal morbidity / mortality) are more distant consequences. therefore, in the absence of any standardized legislature to guide the number of embryos transferred after an art procedure, multiple pregnancies have become one of the most important outcomes to be considered in an art conception. the risk of pregnancy loss and preterm delivery leading to neonatal morbidity and mortality increases in the presence of multiple pregnancy, especially higher order gestation like triplet or more. maternal complications for women carrying high - order multiple gestations include increased incidence of preeclampsia, cesarean delivery, postpartum hemorrhage, and fatty liver. many studies in the past have evaluated the risk of continuation of triplet conception versus reduction to twin or singleton pregnancy to improve perinatal outcomes. while some studies have found an increase in gestational age at delivery in triplet pregnancy after fetal reduction, some have not found any significant advantage. the role of multifetal pregnancy reduction (mfpr) is more clearly advantageous in quadruplets or higher order gestation. a fetal loss of 8%16% has been reported in literature after mfpr although this incidence depends not only on operator 's experience but also on gestational age at reduction, number of fetuses reduced, patient factors, etc. in many cases, spontaneous fetal reduction (sfr) is seen, wherein one or several embryos naturally disappear. pregnancies undergoing sfr have found to be at higher risk of preterm delivery and poorer neonatal outcomes, especially when they were reduced to singleton from twin and more so when reduced to a twin from triplets. this retrospective analysis was performed in the department of reproductive medicine and surgery from january 2012 to december 2015. details of any pregnancy conceived after art in vitro fertilization (ivf) or intracytoplasmic sperm injection (icsi) was recorded in the departmental record in the form of an individual patient file which is periodically updated either at the time of patient follow - up visit or telephonic enquiry. records of patients who had conceived triplet gestation after ivf / icsi and had delivered were evaluated for the purpose of this study, and age, parity, number of embryo transferred, calculated last menstrual period, number of gestational sacs, antenatal course, pregnancy outcome, date of delivery, birth weight, and neonatal course were collected from them. the patients with three gestational sacs (trichorionic triamniotic) with cardiac activity seen at 6 weeks of gestation on transvaginal scan were considered for the study. patients, who were lost to follow - up, had heterotopic pregnancies, had previous pregnancy losses, or continued with triplet or higher order gestation beyond 12 weeks and/or whose records were incomplete were excluded from the study. as per departmental protocol, ultrasonography (usg) was initially performed to determine the location and number of gestational sacs when quantitative beta - human chorionic gonadotropin levels were expected to be 2000 miu / ml or more between 5.5 and 6.5 gestational weeks (3.54.5 weeks after embryo transfer). pregnant women were followed up in the department under a fetal medicine specialist until 12 weeks. patients not under regular care were periodically followed contacted via telephone. for the purpose of the study, sfr was defined as disappearance of gestational sac or loss of cardiac activity in one or two gestational sacs (after its identification) out of the triplet pregnancies. a single operator performed mfpr at 1113 weeks in cases where cardiac activity was seen in all three gestational sacs between 10 and 12 weeks gestation. the reduction was done abdominally under ultrasound guidance with intracardiac kcl injection such that single fetus was reduced in triplet gestation. fetuses were selected for reduction by : (1) discordant fetal growth, (2) the presence of increased nuchal translucency, (3) distance of the amniotic sac from the internal os, and (4) accessibility to transabdominal reduction. no cases of quadruplet or higher order gestation were noted / considered in the study population. in the mfpr group, triplet gestation reduced to singleton was not considered for the study to reduce confounding factors. abortion was defined as disappearance of cardiac activity in utero after sfr / mfpr or delivery before 28 completed weeks of gestation. preterm delivery was defined as the birth of a viable baby (after 28 weeks) at or before 37 completed weeks of gestation. neonatal death was defined as the death of a live baby within 4 weeks of delivery. restricted fetal growth or intrauterine growth restriction (iugr) was defined as a birth weight less than the 10 percentile for gestational age on the basis of national singleton birth weights. eighty pregnancies with triplet gestation at 6 weeks scan fulfilled the inclusion criteria and underwent spontaneous or mfpr before 1213 weeks of gestation. the patients were divided into two groups sfr and mfpr according to the reduction method. secondary outcome measures were live birth rate, average birth weight, and preterm birth rate. the outcome variables studied in the present study were pregnancy loss, weeks of gestation at delivery, birth weight of the baby, incidence of iugr, incidence of preterm labor, and incidence of single and twin delivery. the maternal and fetal parameters of the two groups were compared using chi - square test and t - test wherever applicable to determine statistical significance. association of the type of fetal reduction with fetal outcome was evaluated using chi - square test. the average age of patients in the present study was 32.76 years. only 12 (15%) had a history of previous conception. of 80 patients considered for the study, 34 had sfr, whereas 46 underwent mfpr as per protocol. of eighty triplet pregnancies considered in the present study, a total of 15 patients aborted before the period of viability (28 weeks). the difference in probability of abortion in both groups was not statistically significant (p = 0.3942), even if only early abortions are considered (gestational age 12 weeks) may not be beneficial to the patient because patients in mfpr group were selected for reduction by discordant growth, increased nuchal translucency as already mentioned in the materials and methods. in an observational study by papageorghiou., the rate of miscarriage (pregnancy loss before 24 weeks) was 8.3%, while the rate of early preterm delivery was 9.7%. the rate of abortion is lower to our own (15.2%) as the period of viability considered by us is 28 weeks as against 24 weeks in the above - mentioned study. our percentage of abortion is higher than some previous studies as well. as ours is a retrospective analysis and the follow - up of patients beyond 12 weeks was not done at our own center in all cases, the reasons for such high abortion rates are not clear. it is possible that some of our patients were not under expert medical care after the second trimester and therefore were not as closely monitored as was required. our study shows that loss of fetus occurred after mfpr occurred in 1 patient within 2 weeks. however, in over 80% cases, interval between mfpr and miscarriage was more than 2 weeks. it is, therefore, important to counsel the couple who choose to have a fetal reduction that most of the excess loss with mfpr occurs several weeks after the procedure and is likely to be the consequence of the resorbing dead fetoplacental tissue, rather than the technique itself. when we look into the pattern of miscarriage in the sfr group, we found that miscarriage of the remaining fetuses in 37.5% (3/8) occurred with 2 weeks of sfr. this shows that counseling needs to be done in weeks following sfr in comparison to those who have undergone mfpr. in the mfpr group, only 2 (4.35%) patients out of 46 underwent loss of remaining fetuses within 2 weeks of reduction as against 8.8% (3/34) in the sfr group., 14.4% (13/90) patients undergoing mfpr from triplet to twins had fetal losses within 1 week (7.7%) and rest within 4 weeks. in the study by dickey., the average gestation of patients with sfr was shortened by 4 days in comparison to unreduced twin gestation. although the comparison of gestational age of delivery of reduced and unreduced pregnancies is beyond the scope of the present study, it is expected that in twin gestations delivered after sfr, the patients delivered earlier than unreduced twin pregnancies. the average gestational age at delivery in our study is about 30 weeks, which is much lower than that of dickey. (35 weeks). this may be secondary to patient factors and lower degree of maternal care in some of our cases who did not have access to higher centers., in their study, showed that triplet gestation undergoing sfr in the first trimester had more propensity of delivering earlier than their twin or singleton counterparts. our study has compared the risk of preterm birth in spontaneous versus reduced multifetal gestation. this study shows that in comparison to sfr, mfpr offers a higher chance of delivering at later gestation. it is important to point out that the average gestation in both cases remains in the preterm range and therefore practically neither of the two procedures offers a chance to prevent preterm birth. the sfr group had earlier delivery probably because the sfr occurred due to certain maternal and/or uterine factors, which eventually led to preterm delivery too. however, determination of the reason for lower average gestation in sfr group in comparison to mfpr requires further studies. in an indian prospective study, this is very similar to our own study, wherein 44.2 (29/65) patients delivered at term even though the average gestational age of the entire cohort was 32.14 weeks. of the two groups even though the average gestational age of sfr group at delivery is lesser, 53.84% (14/26) delivered at or after 37 weeks in comparison to 38.46% (14/39) in the mfpr group. however, this difference in the term delivery rate in the two groups is not statistically different. in the above - mentioned study, the mean gestational age at delivery was 35.4 weeks which is a little higher than our own (32 weeks). the sample size in the former is much lesser than our own and could lead to a difference in the result. some studies have reported that sfr improved neonatal prognosis while others have found conflicting results. in these studies, the authors have compared the perinatal outcomes after reduction with pregnancies where no reduction was required (singleton) or was not done (twins). it depends on the gestational age of fetal reduction, maternal factors influencing pregnancy, as well as number of gestational sacs, to begin with. our study shows that while these factors indeed may alter neonatal prognosis, effect of nature of fetal reduction (sfr or mfpr) is not a clinically significant factor, especially if triplet to twin reduction is considered. in our study, triplets ' pregnancy underwent mfpr to twins if sfr did not occur by 12 weeks. therefore, the two groups formed (sfr and mfpr) were mutually exclusive. in the study by zhang. this study shows that in patients with only mfpr, the perinatal outcome was significantly better than those in sfr group. this may be because loss of fetuses in sfr group was secondary to mfpr itself or some other confounding factor in this group. these results may be difficult to compare with our own study due to the difference in design ; however, as neonatal prognosis is inversely related to gestational age at reduction, waiting for sfr in advanced gestation (> 12 weeks) may not be beneficial to the patient. at the same time, as most sfr occurred within 810 weeks of gestation, it is appropriate to wait for sfr before planning for mfpr for the patient. it is reported that sfr rate is 12%30% in art cycles and even as high as 50%80% in triplet or higher order gestation. association of sfr with increasing maternal age was found in these studies as well. in the present study, 34 out of eighty triplet pregnancies (42.5%) underwent sfr. although the percentage of sfr in previous studies is similar to our own, we did not find any difference or association with maternal age in both groups because average maternal age in our study was less (32.76 years). in a large study by zhang. therefore, it can be postulated that multiple gestational sacs in it predispose to the loss of one or more fetuses in utero. the possible reasons may be small uterine space and the relative lack of blood supply of the gestation sac caused by multiple pregnancies. zhang. have found that sfr occurred within 8 weeks in 78.4% of cases. in patients who underwent sfr later in their gestation, they found an increasing trend of low birth weight and very low birth weight rates. therefore, we believe that although our study does not show any significant difference in the perinatal outcome between sfr and mfpr groups, waiting for sfr in advanced gestation (> 12 weeks) may not be beneficial to the patient because patients in mfpr group were selected for reduction by discordant growth, increased nuchal translucency as already mentioned in the materials and methods. in an observational study by papageorghiou., the rate of miscarriage (pregnancy loss before 24 weeks) was 8.3%, while the rate of early preterm delivery was 9.7%. the rate of abortion is lower to our own (15.2%) as the period of viability considered by us is 28 weeks as against 24 weeks in the above - mentioned study. our percentage of abortion is higher than some previous studies as well. as ours is a retrospective analysis and the follow - up of patients beyond 12 weeks was not done at our own center in all cases, the reasons for such high abortion rates are not clear. it is possible that some of our patients were not under expert medical care after the second trimester and therefore were not as closely monitored as was required. our study shows that loss of fetus occurred after mfpr occurred in 1 patient within 2 weeks. however, in over 80% cases, interval between mfpr and miscarriage was more than 2 weeks. it is, therefore, important to counsel the couple who choose to have a fetal reduction that most of the excess loss with mfpr occurs several weeks after the procedure and is likely to be the consequence of the resorbing dead fetoplacental tissue, rather than the technique itself. when we look into the pattern of miscarriage in the sfr group, we found that miscarriage of the remaining fetuses in 37.5% (3/8) occurred with 2 weeks of sfr. this shows that counseling needs to be done in weeks following sfr in comparison to those who have undergone mfpr. in the mfpr group, only 2 (4.35%) patients out of 46 underwent loss of remaining fetuses within 2 weeks of reduction as against 8.8% (3/34) in the sfr group. in the study by zhang., 14.4% (13/90) patients undergoing mfpr from triplet to twins had fetal losses within 1 week (7.7%) and rest within 4 weeks. in the study by dickey., the average gestation of patients with sfr was shortened by 4 days in comparison to unreduced twin gestation. although the comparison of gestational age of delivery of reduced and unreduced pregnancies is beyond the scope of the present study, it is expected that in twin gestations delivered after sfr, the patients delivered earlier than unreduced twin pregnancies. the average gestational age at delivery in our study is about 30 weeks, which is much lower than that of dickey. (35 weeks). this may be secondary to patient factors and lower degree of maternal care in some of our cases who did not have access to higher centers. dickey., in their study, showed that triplet gestation undergoing sfr in the first trimester had more propensity of delivering earlier than their twin or singleton counterparts. our study has compared the risk of preterm birth in spontaneous versus reduced multifetal gestation. this study shows that in comparison to sfr, mfpr offers a higher chance of delivering at later gestation. it is important to point out that the average gestation in both cases remains in the preterm range and therefore practically neither of the two procedures offers a chance to prevent preterm birth. the sfr group had earlier delivery probably because the sfr occurred due to certain maternal and/or uterine factors, which eventually led to preterm delivery too. however, determination of the reason for lower average gestation in sfr group in comparison to mfpr requires further studies. in an indian prospective study, 45% patients (5/12) carried the pregnancy to term. this is very similar to our own study, wherein 44.2 (29/65) patients delivered at term even though the average gestational age of the entire cohort was 32.14 weeks. of the two groups even though the average gestational age of sfr group at delivery is lesser, 53.84% (14/26) delivered at or after 37 weeks in comparison to 38.46% (14/39) in the mfpr group. however, this difference in the term delivery rate in the two groups is not statistically different. in the above - mentioned study, the mean gestational age at delivery was 35.4 weeks which is a little higher than our own (32 weeks). the sample size in the former is much lesser than our own and could lead to a difference in the result. some studies have reported that sfr improved neonatal prognosis while others have found conflicting results. in these studies, the authors have compared the perinatal outcomes after reduction with pregnancies where no reduction was required (singleton) or was not done (twins). it depends on the gestational age of fetal reduction, maternal factors influencing pregnancy, as well as number of gestational sacs, to begin with. our study shows that while these factors indeed may alter neonatal prognosis, effect of nature of fetal reduction (sfr or mfpr) is not a clinically significant factor, especially if triplet to twin reduction is considered. in our study, triplets ' pregnancy underwent mfpr to twins if sfr did not occur by 12 weeks. therefore, the two groups formed (sfr and mfpr) were mutually exclusive. in the study by zhang. this study shows that in patients with only mfpr, the perinatal outcome was significantly better than those in sfr group. this may be because loss of fetuses in sfr group was secondary to mfpr itself or some other confounding factor in this group. these results may be difficult to compare with our own study due to the difference in design ; however, as neonatal prognosis is inversely related to gestational age at reduction, waiting for sfr in advanced gestation (> 12 weeks) may not be beneficial to the patient. at the same time, as most sfr occurred within 810 weeks of gestation, it is appropriate to wait for sfr before planning for mfpr for the patient. mfppr have a better prognosis than sfr in terms of gestational age at delivery, fetal birth weight as well as abortion rates although the differences are not clinically significant. as neither strategy offers a benefit when compared to singleton pregnancies or unreduced pregnancies as per previous studies, the primary aim of any art should be to reduce multiple embryo transfer in the first place. | introduction : with the advent of assisted reproductive treatment options, the incidence of multiple pregnancies has increased. although the need for elective single embryo transfer is emphasized time and again, its uniform applicability in practice is yet a distant goal. in view of the fact that triplet and higher order pregnancies are associated with significant fetomaternal complications, the fetal reduction is a commonly used option in such cases. this retrospective study aims to compare the perinatal outcome in patients with triplet gestation who have undergone spontaneous fetal reduction (sfr) as against those in whom multifetal pregnancy reduction (mfpr) was done.materials and methods : in the present study, eighty patients with triplet gestation at 6 weeks were considered. the patients underwent sfr or mfpr at or before 1213 weeks and were divided into two groups (34 and 46), respectively.results:our study found no statistical difference in perinatal outcome between the sfr and mfpr groups in terms of average gestational age at delivery, abortion rate, preterm delivery rate, and birth weight. the study shows that the risk of aborting all fetuses after sfr is three times (odds ratio [or ] = 3.600, 95% confidence interval [ci ] = 0.279446.388) that of mfpr in subsequent 2 weeks. there were more chances of loss of extra fetus in sfr (23.5%) group than mfpr group (8.7%) (or = 3.889, 95% ci = 1.03014.680). as neither group offers any significant benefit from preterm delivery, multiple pregnancies continue to be responsible for preterm delivery despite fetal reduction.conclusion:there appears to be some advantages of mfpr in perinatal outcome when compared to sfr, especially if the latter happens at advanced gestation. therefore, although it is advisable to wait for sfr to occur, in patients with triplet gestation at 1112 weeks, mfpr is a viable option to be considered. |
forensic odontology is a speciality in dentistry which occupies a primary place within the total spectrum of methods applied to medico - legal identification. identification of the deceased becomes challenging during mass disasters and is a prime requisite for certification of death and personal, social and legal reasons. dna, fingerprint and dental record comparisons are the most commonly used scientific methods of forensic identification. constraints to the use of fingerprints occur in situations where the hands are charred or mutilated. though teeth are more durable, it is however not practical to employ them in identifying the edentulous persons. a useful method of human identification in these circumstances is by examining the palatal rugae pattern (palatal rugoscopy). palatal rugae are the ridges present on the anterior part of the palatal mucosa on either side of the median palatal raphae and behind the incisive papilla. they are also stable and consistent in shape throughout the life following completion of growth. rugae are well protected by the lip, cheek, tongue, buccal pad of fat and teeth. hence, it can resist the incidents of fire and high - impact trauma and can also resist decomposition up to 7 days. these patterns are analyzed in various population and found to be differing among people of different geographical locations and gender. thus, the objective of the present study was to record the distribution of the predominant rugae pattern (palatal rugae number, shape, length, unification and location) in kerala population and to compare the distribution of these parameters between males and females to know if gender differentiation is possible. the study sample consisted of 100 students (n = 100) studying in college of dental sciences, davangere, within the age group of 17 - 25 years, of which 60 were females and 40 were males. all of them belonged to the same geographical population, kerala and were healthy, free of congenital abnormalities (e.g., cleft palate), inflammation, trauma, orthodontic treatment or any other palatal pathology. the purpose of this study was explained to the subjects and after obtaining informed consent from them, the impression of their maxillary arch was recorded using alginate and models were prepared by pouring dental stone in the impressions. the rugae pattern were highlighted by a blue marker pen on the cast [figure 1 ] and the method of rugae analysis used in this study was based on the classification given by thomas and kotze [figure 2 ]. for location analysis, rugae pattern analysis using dental cast of subjects pictorial representation of the analysis of various shapes of palatal rugae (according to thomas and kotze) pictorial representation of the analysis of location of palatal rugae (according to hermosilla.) chi - square test was used for analysis and association of length, shape, unification and location in males and females while unpaired t - test was employed to compare the number of rugae. chi - square test was used for analysis and association of length, shape, unification and location in males and females while unpaired t - test was employed to compare the number of rugae. the total number of rugae were more in females than males, which was statistically significant (p 0.001, significant) [table 1 ]. unification for palatal rugae did not show any significant difference between males and females and diverging pattern constituted more percentage than converging pattern [table 2 ]. on observing the length of rugae, primary rugae were predominant compared to secondary and fragmentary in both males and females [table 3 ] and no significant gender differentiation was noted (p = 0.82). rugae were found predominantly in location d followed by e, c, and b both in males and females [table 4 ]. on observing rugae shape, we found wavy pattern to be more common, followed by curve and straight pattern in both males and females (chi - square = 11.37, p = 0.05) [table 5 ]. circular pattern was significantly more in males as compared to females, aiding in gender differentiation. analysis of total number of palatal rugae in kerala population analysis of unification pattern of palatal rugae in kerala population analysis of length of palatal rugae in kerala population analysis of location of palatal rugae in kerala population analysis of different shapes of palatal rugae in kerala population the potential use of palatal rugoscopy (palatoscopy, rugoscopy) in forensic identification has advantages because of their low utilization cost, simplicity, and reliability. palatal rugae patterns are sufficiently characteristic to discriminate between individuals and are also stable under severe burn cases, unaltered by chemicals like nicotine, ethanol, acetyl salicylate and physical irritants. they are applicable to edentulous patients and are proved to be the same before and after orthodontic treatment and remains stable after completion of growth thus emerging to be one of the reliable applications in forensic science. palatal rugae patterns show variations with racial and geographical variations and are applicable for gender differentiation. in spite of these advantages of rugoscopy, the scale of reliability on this technique is unclear, with some studies contradicting their utility in forensic medicine. moreover availability of ante mortem casts or any records like photographs is must for identification using palatoscopy. in the present study, the number of palatal rugae was slightly more in females (mean = 10.18) than males (mean = 9.9), which is consistent with other reports from other populations. among the unification patterns, diverging pattern was observed more in both males and females than converging pattern, which is consistent with previous studies done on kerala population. in contrast, statistical analysis for assessing sex differences in the rugae shapes showed significant difference in unification type in three south indian population studies. depending on the length of the palatal rugae, they were classified into primary, secondary and fragmentary rugae and on analysis ; their distribution was almost equal between males and females. primary rugae (82% in males and 81% in females) were observed predominantly, followed by secondary rugae (12% in both gender) and fragmentary rugae (6% in males and 7% in females) and results were similar to previous reports. considering the location of rugae patterns, in both males and females, rugae were found predominantly in the d region, between mesial aspect of first premolar and mesial aspect of second premolar, (45% in males and 42% in females), followed by e (29% in males and 32% in females), c (23% in males and 24% in females), and b (3% in males and 2% in males). the region a is not involved by any of the rugae examined and no rugae were found beyond e region. only few studies have analyzed the location wherein more rugae were found in the e region (between mesial aspect of second premolar to distal aspect of second premolar) followed by d region. on observing the rugae shape, we found wavy pattern to be the most common in both the genders, followed by curve and straight pattern. circular pattern was very few in number and was significantly (p = 0.05) more in males than females and hence can be utilized as a valuable parameter for gender determination. our results are again consistent with other reports, however some have reported a predominance of straight patterns. thus, difference in predominant shape was noted in different geographical regions within india and discrete variables such as rugae shape can be better adopted for population differentiation and gender discrimination, rather than considering continuous variables like rugae length, as previously suggested. all the rugae patterns analyzed in our study were unique to each subject and did not show similarity with any other persons, reflecting the individuality of these patterns. beyond the foresaid limitations on rugoscopy, the individuality and uniqueness of palatal rugae pattern is highly promising. to improve the specificity and sensitivity of palatoscopy on population discrimination and gender identification, in the kerala population, among the palatal rugae, the primary rugae are more in number, wavy pattern predominates in shape and more number of rugae is located in between mesial aspect of first premolar to mesial aspect of second premolar. the mean number and shape of rugae reveal significant differences between the two genders, which may be employed for gender determination. they are observed to be highly unique to an individual similar to fingerprint patterns, and with provision of ante mortem cast, they can be used for person identification. | background : analysis of palatal rugae patterns, which are similar to fingerprints, is one of the techniques used in forensic sciences for human identification. as palatal rugae patterns are genetically determined, they can also be used in population differentiation and gender determination. hence, we aimed to record the distribution of the predominant rugae pattern in kerala population.materials and methods : a total of 100 maxillary study models (40 males and 60 females) recorded from kerala population within the age group of 17 - 25 years were analyzed. the dental casts were examined for the interpretation of the total number, length, shape, location and unification of rugae. chi - square test and unpaired t - test were employed for statistical analysis.result:the total number of rugae was significantly (p < 0.001) greater in females than males. regarding the shape, wavy pattern predominated in both males and females, followed by curve, straight, divergent, convergent and circular pattern. circular pattern was more in males than females. the rugae patterns were located more in between mesial aspect of first premolar to mesial aspect of second premolar.conclusion:the palatal rugae and their features of an individual may be considered as a reliable guide for identification purpose, provided antemortem casts are available. nevertheless, gender differentiation is evident in terms of number and shape of rugae. |
glaucoma is a neurodegenerative disease of the optic nerve (on) that is characterized by the loss of retinal ganglion cell (rgc) somas and axons. in 2013, it was estimated that approximately 65 million people had glaucoma, making it the leading cause of blindness in the world. an array of pathologic events appears to contribute to glaucoma : (1) the blockade of on axonal transport, which decreases the supply of neurotrophic factors to rgcs and could trigger apoptosis ; (2) an insufficient ocular blood supply, attributable to elevated intraocular pressure (iop) or vascular abnormalities ; (3) the high level of extracellular glutamate released by dying cells ; (4) excessive gliosis, which results in the discharge of toxic substances ; and (5) the overproduction of reactive oxygen species (ros) and the subsequent oxidative stress generated in the trabecular meshwork (tm) (which is involved in aqueous humor drainage), glial cells, inner retina, or on. the development of satisfactory therapies for glaucoma has been hindered by the incomplete elucidation of the molecular mechanisms that lead to the condition.7, 8 the results of several recent studies have suggested that mitochondrial dysfunction could be a key player in the pathogenesis of glaucoma, because rgcs are highly sensitive to impairment of their energy supply. this is probably due to their atypical structure ; inside the eye, their axons lack myelin sheaths, which implies an extremely high energy requirement for generating and propagating action potentials. mitochondrial dysfunction is responsible for hereditary optic atrophies such as leber hereditary optic neuropathy and dominant optic atrophy, which also result in rgc loss and on dysfunction leading to vision loss. in primary open - angle glaucoma, the activity of respiratory chain complex i (ci) is reduced in patient lymphoblasts and fibroblasts. lascaratos and colleagues demonstrated that healthy mitochondria efficiently prevent glaucomatous optic neuropathy in patients who have exhibited elevated iop for many years. accordingly, therapeutic approaches aimed at preserving mitochondrial integrity could sustain visual function in patients by protecting their rgcs against degeneration. this protein of 151 amino acids, identified in vertebrates as a member of the globin superfamily, is abundant in various regions of the brain and in the eye and is considered a powerful neuroprotectant. we previously showed that rodent rgcs and ons possess high levels of neuroglobin (ngb). we also demonstrated that ngb was enriched in mitochondrial fractions and that knock down of the ngb gene in rat rgcs caused cell death, optic neuropathy, and defects in respiratory ci and iii that led to visual function impairment. harlequin mice exhibit optic neuropathy caused by the depletion of the mitochondrial apoptosis - inducing factor (aif), leading to respiratory chain impairment. a 2-fold decrease in the steady - state levels of ngb was observed in retinas from these mice ; hence, ocular gene therapy mediated by an adeno - associated viral vector serotype 2 (aav2/2) driving the synthesis of ngb (aav2/2-ngb) was performed before the onset of optic atrophy. this approach prevented rgc loss and preserved respiratory chain activity in ons and visual function. our current objective is to increase our understanding of the link between mitochondrial impairment and glaucoma and to develop a therapeutic approach that uses ngb, with the aim of preserving organelle integrity in an experimental model of glaucoma. the dba/2j mouse strain exhibits iris atrophy and elevated iop due to the release of pigment clumps into the anterior chamber of the eye.21, 22 in these mice, rgc degeneration, optic neuropathy, and a visual function deficit are evident by the age of 12 months.23, 24 we demonstrated that mitochondrial dysfunction in the retina and on precedes the development of the glaucomatous phenotype in dba/2j mice. administering aav2/2-ngb to mice several months before the onset of rgc degeneration leads to increased abundance of ngb in the retinas, which strongly correlates with the preservation of on morphology and function. moreover, when ngb therapy is administered after neuronal loss has already begun, the surviving neurons are able to enhance visual cortical function via morphologic changes within the retina and the preservation of respiratory chain activity in the ons. to define iris pathology and corneal changes, we examined dba/2j mice aged 2 to 12 months by in vivo confocal microscopy (figure 1a). the eyes of 4-month - old mice had normal superficial epithelium and stroma, with scattered hyperreflective patterns in the endothelium. additionally, at this age, the iris contained numerous filamentous and hyperreflective aggregates (figure 1a, panel j, white arrowhead). the degenerative process in both the cornea and iris became aggravated 4 months later : we observed activated keratocytes with a stellar shape in the stroma (figure 1a, panel m, black arrowhead) ; the density of hyperreflective dots and pigment clumps increased in the endothelial layers (figure 1a, panel n, black arrowhead) ; and it was difficult to visualize the iris because of the presence of numerous pigment clumps among the inflammatory cells (figure 1a, o, white arrowhead). the 1-year - old mice showed corneal epitheliopathy, with numerous dark microcysts (round vesicles containing fluid and cellular debris) and epithelial cells with disrupted morphology. the other corneal layers also exhibited pathologic changes : the basal epithelium was abnormal, with many dense and hyperreflective polyhedral structures ; the stroma exhibited holes and nearby fibrotic reactions (figure 1a, r, black arrowhead) ; and the endothelial layer included numerous hyperreflective pigment clumps (figure 1a, s, white arrowhead). the irises of 1-year - old mice contained fewer pigment clumps than did the irises of 8-month - old mice. to determine whether the progressive iris disease correlated with ocular hypertension, we measured the iop in dba/2j mice aged between 2 and 14 months (figure 1b). the iop of dba/2j mice increased from the age of 7 months and reached a maximum in 11-month - old mice. thereafter, ocular hypertension declined progressively, reaching the baseline in 14-month - old mice (figure 1b). figure 1b also shows the iop in c57bl/6j mice at various ages. the congenic c57bl/6j strain is considered a control for dba/2j mice, as c57bl/6j mice lack the mutations in the gpnmb and tyrp1b genes that are responsible for iris pathology.21, 25 no significant changes in iop were observed in these mice, with the mean values being between 13 mm hg (in 2- and 8-month - old mice) and 11.8 mm hg (in 14-month - old mice). hence, the fibrosis and inflammation in the corneas and irises noticed at first in dba/2j mice aged 4 months and which aggravate progressively up to 1 year appeared to be correlated with changes in iop and might contribute to the subsequent neuronal loss in the inner retina, as previously described.figure 1anterior segment and intraocular pressure changes in dba/2j mice with age(a) in vivo confocal microscopy images of the anterior segments of dba/2j mice, including the corneal superficial epithelium (column 1), basal epithelium (column 2), stroma (column 3), endothelium (column 4), and iris (column 5), for dba/2j mice aged 2 months (row 1), 4 months (row 2), 8 months (row 3), and 12 months (row 4). for each age group, the black and white arrowheads indicate changes in the cornea and the iris during aging. (b) male dba/2j and c57bl/6j mice aged between 2 and 14 months were subjected to noninvasive iop measurements that were performed monthly on both eyes during daylight. the histogram shows the means sems, as well as the age in months (m) and the number of eyes evaluated in each group. although iop measurements can differ between the right and left eyes in some animals, the data shown did not discriminate between the values for individual eyes. the p values were calculated with respect to measurements collected from 2-month - old dba/2j mice ; only the values close to significance or significant are shown (for mice aged 712 months). anterior segment and intraocular pressure changes in dba/2j mice with age (a) in vivo confocal microscopy images of the anterior segments of dba/2j mice, including the corneal superficial epithelium (column 1), basal epithelium (column 2), stroma (column 3), endothelium (column 4), and iris (column 5), for dba/2j mice aged 2 months (row 1), 4 months (row 2), 8 months (row 3), and 12 months (row 4). for each age group, the black and white arrowheads indicate changes in the cornea and the iris during aging. (b) male dba/2j and c57bl/6j mice aged between 2 and 14 months were subjected to noninvasive iop measurements that were performed monthly on both eyes during daylight. the histogram shows the means sems, as well as the age in months (m) and the number of eyes evaluated in each group. although iop measurements can differ between the right and left eyes in some animals, the data shown did not discriminate between the values for individual eyes. the p values were calculated with respect to measurements collected from 2-month - old dba/2j mice ; only the values close to significance or significant are shown (for mice aged 712 months). retinal sections from mice aged between 2 and 15 months were immunolabeled with an antibody against brn3a, a transcription factor that accumulates in most rgcs in rodent retinas. it has been reported that dba/2j mice aged 2 to 4 months do not exhibit signs of retinal degeneration ; the earliest detectable changes occur at 8 to 10 months of age, with the number of animals showing degeneration reaching a peak by 11 to 12 months of age.23, 28, 29, 30 therefore, we compared the rgc population in groups of dba/2j mice aged between 2 and 15 months (figure 2). there were 13 retinas from 8-month - old mice that were evaluated, of which only two showed a decrease (of 30% and 35%) in the number of rgcs relative to that in 2-month - old mice. conversely, in 58 retinas from mice aged 10 months or older, there were noticeably fewer brn3a - positive cells in the ganglion cell layer (gcl) when compared to the gcl of 2-month - old mice. the equivalent of 65% of the rgcs had disappeared in dba/2j mice aged 10 months or older, as compared to 2-month - old mice, which is consistent with previous reports (figures 2a and 2b).23, 28, 29figure 2ganglion cell loss and gliosis in retinas of dba/2j mice during the progression of glaucoma(a) immunohistochemical staining for brn3a (red) and gfap (green) in retinas from mice aged 2, 8, and 15 months ; the nuclei were stained with dapi (blue) for contrast. abbreviations : onl, outer nuclear layer ; inl, inner nuclear layer ; gcl, ganglion cell layer ; opl, outer plexiform layer ; ipl, inner plexiform layer. the scale bar represents 20 m. (b) the overall number of rgcs was estimated in dba/2j mice of different ages by counting brn3a - positive cells in the gcl after reconstructing retinal sections, as described in the materials and methods section. the histogram shows the number of rgcs as the mean sem ; the number of mice evaluated by age group in months (m) is shown in brackets (n) below each bar. (c) the intensity of the gfap labeling was estimated with imagej in whole retinas from mice in the three age groups : 2 months (healthy), 8 to 10 months (with well - established glaucoma), and 12 to 15 months (with advanced glaucoma). the histogram illustrates the data for each age group ; the number below each bar corresponds to the number of independent retinal sections evaluated per group (n). the p values in (b) and (c) were calculated with respect to data collected in 2-month - old dba/2j mice ; only the values close to significance or significant are shown. ganglion cell loss and gliosis in retinas of dba/2j mice during the progression of glaucoma (a) immunohistochemical staining for brn3a (red) and gfap (green) in retinas from mice aged 2, 8, and 15 months ; the nuclei were stained with dapi (blue) for contrast. abbreviations : onl, outer nuclear layer ; inl, inner nuclear layer ; gcl, ganglion cell layer ; opl, outer plexiform layer ; ipl, inner plexiform layer. the scale bar represents 20 m. (b) the overall number of rgcs was estimated in dba/2j mice of different ages by counting brn3a - positive cells in the gcl after reconstructing retinal sections, as described in the materials and methods section. the histogram shows the number of rgcs as the mean sem ; the number of mice evaluated by age group in months (m) is shown in brackets (n) below each bar. (c) the intensity of the gfap labeling was estimated with imagej in whole retinas from mice in the three age groups : 2 months (healthy), 8 to 10 months (with well - established glaucoma), and 12 to 15 months (with advanced glaucoma). the histogram illustrates the data for each age group ; the number below each bar corresponds to the number of independent retinal sections evaluated per group (n). the p values in (b) and (c) were calculated with respect to data collected in 2-month - old dba/2j mice ; only the values close to significance or significant are shown. retinal sections were also immunolabeled with an antibody against glial fibrillary acidic protein (gfap), which is a sensitive marker for glial activation in astrocytes and mller cells in response to a retinal stress. intense gfap staining extending to the outer nuclear layer (onl) was observed in retinas from 8- and 15-month - old mice, indicating that the amount of protein had increased in all mller - cell compartments. the significantly increased intensity of gfap staining in retinal sections from mice aged 8 months or older confirmed the activation of mller cells and astrocytes in mouse retinas during glaucoma progression (figures 2a, 2c, and s1). by using qrt - pcr, we evaluated the steady - state levels of brn3a and gfap mrna in retinas from mice aged between 2 and 15 months. by the age of 12 months, brn3a mrna decreased by approximately 75%, whereas gfap mrna increased by 300% relative to the amount detected in retinas from 2-month - old mice (figures s2a and s2b). moreover, 15-month - old dba/2j mice exhibited a reduction in the thickness of the onl and inner nuclear layer (inl) relative to the corresponding layers in 2-month - old dba2/j mice and 15-month - old c57bl/6j mice, indicating that the change was not age related (figure s3). these data are consistent with a recent report that cell loss is not limited to the gcl in advanced stages of the disease. next, we estimated the extent of rgc axonal disappearance in sections of ons from dba/2j mice by using antibodies against the heavy - chain subunit of neurofilaments (nf200). figure 3a shows a reduced number of immunopositive dots in the ons of 12-month - old dba/2j mice. axonopathy was measured by counting nf200-positive spots (each spot represents a single nerve fiber) in mice aged 2, 8, or 12 months (figure 3b). after the results were normalized against the average value for 2-month - old mice, 8-month - old mice exhibited an axonal loss of 33.3%, despite the survival at this age of rgc somas (equivalent to 89% of the rgcs in 2-month - old mice). thereafter, the pathologic process became aggravated ; 12-month - old mice retained only 22% of the optic fibers and approximately 35% of the rgc somas seen in 2-month - old mice.figure 3histopathologic changes in dba/2j optic nerves over the course of disease(a) proximal on transverse sections (near the globe) for mice aged 2, 8, and 12 months were subjected to immunohistochemical staining with antibodies against nf200 (green) and gfap (an astrocyte marker) (red).(b) bar graph of axon numbers (mean sem) for optic nerves collected from mice aged 2, 8, and 12 months, as displayed with graphpad prism 6. p values were calculated with respect to fiber number in 2-month - old dba/2j mice ; the number of mice evaluated (n) is shown in brackets below each bar of the histogram. (c) immunohistochemical staining with antibodies against iba1 (green) and vimentin (red). both proteins were more abundant in on sections from the older mice than in those from 2-month - old mice. the scale bar represents 50 m for (a) and (c). (d) the bar chart illustrates the normalized values of the fluorescence intensities in ons for gfap, iba1, and vimentin labeling as evaluated in mice at 2 months, 8 to 10 months, or 12 to 14 months of age. the results were normalized against the mean fluorescence in ons from 2-month - old mice. the number of on sections evaluated with imagej (n) is indicated in brackets below each bar corresponding to a specific age group. histopathologic changes in dba/2j optic nerves over the course of disease (a) proximal on transverse sections (near the globe) for mice aged 2, 8, and 12 months were subjected to immunohistochemical staining with antibodies against nf200 (green) and gfap (an astrocyte marker) (red).(b) bar graph of axon numbers (mean sem) for optic nerves collected from mice aged 2, 8, and 12 months, as displayed with graphpad prism 6. p values were calculated with respect to fiber number in 2-month - old dba/2j mice ; the number of mice evaluated (n) is shown in brackets below each bar of the histogram. (c) immunohistochemical staining with antibodies against iba1 (green) and vimentin (red). both proteins were more abundant in on sections from the older mice than in those from 2-month - old mice. the scale bar represents 50 m for (a) and (c). (d) the bar chart illustrates the normalized values of the fluorescence intensities in ons for gfap, iba1, and vimentin labeling as evaluated in mice at 2 months, 8 to 10 months, or 12 to 14 months of age. the results were normalized against the mean fluorescence in ons from 2-month - old mice. the number of on sections evaluated with imagej (n) is indicated in brackets below each bar corresponding to a specific age group. we performed immunohistochemical staining on sections of ons with antibodies against three markers : gfap, ionized calcium - binding adaptor molecule 1 (iba1), and vimentin (a cytoskeleton marker that is especially abundant in astrocytes). the antibodies against gfap and vimentin yielded stronger signals with ons from mice aged 8 or 12 months than with ons from 2-month - old mice (figures 3a and 3c) ; astrocytes probably replaced the axon bundles that disappeared progressively during glaucoma progression. we also saw more substantial iba1 staining in ons from mice aged 8 and 12 months than in ons from young mice. the fluorescence intensity profiles calculated with imagej software for each antibody over the whole area of on sections from mice aged 2, 8, and 12 months are shown in figure 3d. the data suggest that activation of microglia and astrocytes in ons occurred in 8-month - old mice, preceding the start of rgc loss by 2 months. we examined retinas and ons from dba/2j mice of various ages by a spectrophotometric method that assesses the enzymatic activities of respiratory chain complexes. two independent assays were devised to sequentially measure the enzymatic activities of ci, cv, civ, cii + ciii, and ciii in single - tissue homogenates. table 1 presents data obtained in dba/2j retinas : cv enzymatic activity did not change with age, whereas a significant ci defect was evident in the retinas of mice aged 5 to 16 months when compared to retinas from 2-month - old mice ; the reduction in ci activity reached approximately 50% in 10-month - old mice. calculating the ci / cv ratios confirmed that there was a ci activity defect in dba/2j mice aged 8 months or older, as compared to 2-month - old mice. the activities of civ, cii + ciii, and ciii were also reduced in mice aged 10 months or 14 to 16 months when compared to the corresponding activities in 2-month - old mice (table 1). for instance, ciii activity in mice aged 10 months or 14 to 16 months was severely diminished at 34% to 35% of the value measured in 2-month - old mice. because the rgc population in rodent retinas accounts for only 1% of the total retinal neurons, our results suggest that other retinal neurons exhibited compromised energetic metabolism. furthermore, we observed a severe defect in all the complexes, except cv, in ons. when mice aged 10 to 12 months were compared with 2-month - old mice, there were overall reductions of 60%, 48%, 45%, and 50% in the enzymatic activities of ci, civ, cii + ciii, and ciii, respectively (figure 4). remarkably, ons from 5-month - old mice also exhibited significant reductions in complex activities when compared to ons from 2-month - old mice : the reductions were 47%, 55%, and 52% for ci, ciii, and civ, respectively. hence, bioenergetics failure in ons from dba/2j mice begins 5 months before rgc degeneration becomes measurable.figure 4respiratory chain activity in optic nerves from dba/2j mice at various agesthe enzymatic activities of complexes i, ii + iii, iii, iv, and v were measured in single ons isolated from dba/2j mice of different ages, namely 2, 5, 8, 10 to 12, and 14 to 16 months. the values in each histogram represent the mean sem of triplicates (ci and cv) or of duplicates (cii + ciii and ciii and civ) for the samples evaluated ; the ci / cv ratio is also shown. p values were calculated with respect to the activity assessed in 2-month - old dba/2j mice. the age of the group in months (m) and the number of independent measurements performed is shown beneath each bar.table 1respiratory chain complex enzymatic activities in retinas of dba/2j micespecific activity sem2 months5 months8 months10 months1416 monthscomplex ia40.5 1.9 (n = 26)b32.14 1.7 (n = 10)31.8 1.1 (n = 10)21.5 1.6 (n = 18)24.7 1.6 (n = 20)p value versus 2-month - old mice0.020.009<0.0001<0.0001complex v103 4.2 (n = 26)96.7 7.7 (n = 10)102.8 5.0 (n = 10)94.8 4.3 (n = 18)97.1 6.6 (n = 20)p value versus 2-month - old mice0.410.990.260.85ci / cv0.42 0.030.36 0.030.30 0.020.24 0.0210.25 0.016p value versus 2-month - old mice0.370.02<0.0001<0.0001complexes ii + iiic48.5 4.2 (n = 24)ndnd30.3 2.6 (n = 17)24.3 1.6 (n = 22)p value versus 2-month - old mice0.0055<0.0001complex iiid247.9 31.3 (n = 24)ndnd86.1 9.5 (n = 17)82.9 12.1 (n = 22)p value versus 2-month - old mice0.0007<0.0001complex ive357.0 9.7 (n = 24)ndnd255.3 19.4 (n = 17)246.4 13.97 (n = 22)p value versus 2-month - old mice<0.0001<0.0001acomplex i and complex v activities are expressed as nanomoles of oxidized nadh / min / mg protein.bthe number of independent retinas evaluated is indicated in brackets.ccomplex ii + iii activity is expressed as nanomoles of reduced cytochrome c / min / mg protein.dcomplex iii activity is expressed as nanomoles of oxidized decylubiquinone / min / mg protein.ecomplex iv activity is expressed as nanomoles of oxidized cytochrome c / min / mg protein. respiratory chain activity in optic nerves from dba/2j mice at various ages the enzymatic activities of complexes i, ii + iii, iii, iv, and v were measured in single ons isolated from dba/2j mice of different ages, namely 2, 5, 8, 10 to 12, and 14 to 16 months. the values in each histogram represent the mean sem of triplicates (ci and cv) or of duplicates (cii + ciii and ciii and civ) for the samples evaluated ; the ci / cv ratio is also shown. p values were calculated with respect to the activity assessed in 2-month - old dba/2j mice. the age of the group in months (m) and the number of independent measurements performed is shown beneath each bar. respiratory chain complex enzymatic activities in retinas of dba/2j mice complex i and complex v activities are expressed as nanomoles of oxidized nadh / min / mg protein. complex ii + iii activity is expressed as nanomoles of reduced cytochrome c / min / mg protein. complex iii activity is expressed as nanomoles of oxidized decylubiquinone / min / mg protein. complex iv activity is expressed as nanomoles of oxidized cytochrome c / min / mg protein. we evaluated the steady - state levels of several mitochondrial proteins in retinas from dba/2j mice aged 2 months (the young group, y) or 12 months (the old group, o). there were nine proteins involved in energetic metabolism, antioxidant defense, organelle morphology, or biosynthesis that were analyzed by western blotting, namely ndufa9 (nadh : ubiquinone oxidoreductase subunit a9), atp synthase subunit, cytochrome c (cyt - c), aif, ngb, sod2 (superoxide dismutase), hsp60 (heat shock protein 60), tomm20 (translocation of outer mitochondrial membrane 20), and opa1 (optic atrophy 1). in the old mice, the amounts of ndufa9 (ci subunit), atp synthase (cv subunit), aif, ngb, opa1, and sod2 reached 35.8%, 36.7%, 42%, 44%, 47%, and 49%, respectively, of the amounts measured in the young mice. the hsp60 and tomm20 levels in the old mice were 66% and 82%, respectively, of those in the young animals, but these reductions were still significant (p = 0.003), whereas the abundance of cyt - c was unchanged in the retinas evaluated. the abundance of gfap was also measured in mice of both age groups, and the amount of gfap was increased 2-fold in retinas from old mice, relative to retinas from 2-month - old mice, confirming that mller cells and astrocytes underwent reactive changes correlated with rgc loss (figures 5a and 5b).figure 5mitochondrial protein abundance in retinas from young and old dba/2j mice(a) western blots were performed with protein extracts from mice aged 2 months (the young group, y) or 12 months (the old group, o), using various antibodies against mitochondrial proteins. the signals obtained with the antibody against -actin (the loading control) and with two other antibodies against mitochondrial proteins are shown for five independent membranes. with the antibody against ngb, the strongest signal was detected at 17 kda, and additional faint signals were often detected at approximately 19, 21, 25, and 34 kda. we had previously observed the 19-kda and 21-kda proteins in rodent retinas.18, 20 the other signals corresponding to higher apparent molecular masses may indicate post - translational modifications such as phosphorylation or dimerization of the protein. the bottom row shows a membrane that was incubated with antibodies against two proteins simultaneously (1 and 2). (b) bar charts showing the means sems calculated from separate immunoblots after they were scanned and their signals quantified with the quantity one software. the relative levels of mitochondrial proteins were normalized against -actin signals. for each protein, p values were calculated as the difference between the signals obtained in young and old dba/2j mice. the number of individual signals for independent retinas used for the calculations is shown for each protein below the corresponding bars. mitochondrial protein abundance in retinas from young and old dba/2j mice (a) western blots were performed with protein extracts from mice aged 2 months (the young group, y) or 12 months (the old group, o), using various antibodies against mitochondrial proteins. the signals obtained with the antibody against -actin (the loading control) and with two other antibodies against mitochondrial proteins are shown for five independent membranes. with the antibody against ngb, the strongest signal was detected at 17 kda, and additional faint signals were often detected at approximately 19, 21, 25, and 34 kda. we had previously observed the 19-kda and 21-kda proteins in rodent retinas.18, 20 the other signals corresponding to higher apparent molecular masses may indicate post - translational modifications such as phosphorylation or dimerization of the protein. the bottom row shows a membrane that was incubated with antibodies against two proteins simultaneously (1 and 2). (b) bar charts showing the means sems calculated from separate immunoblots after they were scanned and their signals quantified with the quantity one software. the relative levels of mitochondrial proteins were normalized against -actin signals. for each protein, p values were calculated as the difference between the signals obtained in young and old dba/2j mice. the number of individual signals for independent retinas used for the calculations is shown for each protein below the corresponding bars. we performed immunohistochemical staining of retinal sections with antibodies against mitochondrial proteins to strengthen the data on the differential accumulation of these proteins in young and old mice and also to define the staining pattern in each retinal cell layer (figure 6). the immunoreactivities of ngb, opa1, and sod2 within the cytoplasm were similar ; only weak signals were obtained in the onl, probably because few mitochondria are present in that layer, whereas strong signals were obtained in the inl, the gcl, the inner plexiform layer (ipl), and the inner segment of photoreceptors (is), indicative of the high density of mitochondria in those compartments. in the inl, the ipl showed consistent labeling ; this layer contains a highly complex network of interconnecting dendrites and synaptic terminals involving bipolar, amacrine, horizontal, and retinal ganglion cells. in old dba/2j mice, all the retinal cell layers showed weaker fluorescent signals for these proteins (figure 6), consistent with the results of western blot analyses (figure 5). the reduced accumulation of several key mitochondrial proteins can alter organelle functionality and exacerbate rgc injury.figure 6mitochondrial protein abundance and distribution in different retinal cell layersthe abundance and cellular distribution of the mitochondrial proteins ngb, opa1, and sod2 was examined by indirect immunofluorescence in retinal sections from 2- and 12-month - old dba/2j mice (approximately six mice were evaluated for each age group). the scale bars represent 20 m. abbreviations : onl, outer nuclear layer ; is, inner segments of photoreceptors ; inl, inner nuclear layer ; gcl, ganglion cell layer ; opl, outer plexiform layer ; ipl, inner plexiform layer. mitochondrial protein abundance and distribution in different retinal cell layers the abundance and cellular distribution of the mitochondrial proteins ngb, opa1, and sod2 was examined by indirect immunofluorescence in retinal sections from 2- and 12-month - old dba/2j mice (approximately six mice were evaluated for each age group). the scale bars represent 20 m. abbreviations : onl, outer nuclear layer ; is, inner segments of photoreceptors ; inl, inner nuclear layer ; gcl, ganglion cell layer ; opl, outer plexiform layer ; ipl, inner plexiform layer. to establish whether restoring ngb levels in rgcs could prevent neuronal injury, gene therapy was performed by using a recombinant aav2/2 vector encompassing the mouse ngb open reading frame (orf) in association with the full - length 5 and 3 utrs (figure s4a). we performed gene therapy in 2-month - old dba/2j mice (the early treatment group) with the goal of preventing rgc loss and in 8-month - old mice (the late treatment group) to establish whether the course of the disease could be changed despite its having reached an advanced stage. because ngb sequences were inserted into the paav - hrgfp vector, we used the gfp to assess the transduction yield in the retinas of mice that received early treatment. reconstructions of entire retinal sections from injected eyes clearly showed homogeneous and intense gfp labeling that was restricted to the gcl (figure s4b). when seven mice that received early treatment were evaluated 10 months later, approximately 79% of their rgcs had accumulated gfp (the cells showed intense brn3a and gfp signals), indicating both efficient cellular transduction and stable transgene expression (figure s4c). we next performed immunohistochemical staining for ngb on retinal sections, and the immunofluorescence signal was noticeably more intense in the gcl from a treated retina than in its untreated counterpart from a 12-month - old mouse (figure s5a). higher - magnification images of retinas from untreated mice aged 2 and 12 months and from mice after aav2/2 administration are also shown in figure s5b. the intensity of the ngb signal decreased with age, whereas in treated retinas, both the intensity and the number of positive cells increased. the punctuate labeling in cells exhibiting strong fluorescent signals was similar to that described for mitochondrial proteins in retinal neurons.35, 36 the steady - state levels of ngb mrna, as determined by qrt - pcr, were significantly higher in retinas from eyes that received early or late treatment than in retinas from untreated eyes ; the increases were 3.4- and 3.6-fold, respectively (figure s5c). next, we used western blot analysis to evaluate the protein abundance in retinas from treated eyes of mice that received early treatment and in retinas from the contralateral untreated eyes (all mice were euthanized at 1 year of age). the ngb level increased 2-fold in retinas from treated eyes, as compared to retinas from untreated eyes, whereas no change was evident in the steady - state levels of the ndufa9 and atp synthase proteins (figures s5d and s5e). hence, administering aav2/2-ngb to dba/2j eyes resulted in increased levels of both the ngb transcript and the protein in the eyes up to 10 months after they underwent gene therapy. to evaluate whether ngb overexpression could prevent rgc loss and the active growth of mller - cell processes, we performed immunohistochemical staining for brn3a and gfap on retinal sections from dba/2j mice that received early or late treatment and were euthanized at the age of 12 months. gfap reactivity was less prominent in treated retinas than in untreated ones, regardless of when the treatment was carried out (figures 7a and 7b). indeed, the gfap intensities in retinas subjected to early or late treatment were, respectively, 34.4% and 42% of that measured in 12-month - old untreated mice, suggesting a diminution of glial cell activation due to the presence of high levels of ngb (figure 7d). moreover, there were more brn3a - positive cells in the retinas of the treated eyes of mice that received early treatment than in the retinas of untreated eyes. conversely, the retinas of mice that received late treatment contained very few brn3a - positive cells (figure 7b). an estimate of the rgc numbers confirmed these observations : early treatment resulted in significant protection against rgc loss, with the number of rgcs in treated eyes being 82.4% of that in 2-month - old mice and 2.6 times more than that in age - matched untreated eyes. in contrast, in retinas from mice that received late treatment, the rgc count was 34.2% of that in the retinas of 2-month - old mice, and the extent of neuronal loss was very similar to that in the retinas of untreated 1-year - old mice (p = 0.71) (figure 7c).figure 7effects of aav2/2-ngb treatment on dba/2j retinas(a) immunofluorescence analysis of retinal sections from a 1-year - old mouse in which one eye underwent intravitreal injection of aav2/2-ngb at 2 months of age (early treatment) and the contralateral eye remained untreated. (b) immunofluorescence analysis of retinal sections from a 1-year - old mouse in which one eye underwent intravitreal injection of aav2/2-ngb at 8 months of age (late treatment) and the contralateral eye remained untreated. for (a) and (b), confocal images illustrate immunolabeling for brn3a (red) and gfap (green). the scale bars represent 20 m. abbreviations : onl, outer nuclear layer ; inl, inner nuclear layer ; gcl, ganglion cell layer. (c) the overall number of rgcs was estimated by counting brn3a - positive cells in retinas from the treated eyes of dba/2j mice that underwent intravitreal injection of aav2/2-ngb at 2 months (early treatment) or 8 months (late treatment) of age ; all of the mice were euthanized at 1 year of age. the values obtained for treated retinas were compared to those obtained for untreated retinas from 1-year - old mice. the bar chart illustrates the mean numbers of rgcs sems ; the number of mice evaluated in each group is shown in brackets. p values in treated retinas were calculated with respect to rgc values in untreated retinas from 1-year - old mice. (d) the bar chart illustrates the normalized values of the fluorescence intensity for gfap labeling in entire retinal sections. the values were normalized against the mean fluorescence in retinas from 12-month - old mice. the number of retinal sections from independent mice evaluated with imagej is indicated below each bar. effects of aav2/2-ngb treatment on dba/2j retinas (a) immunofluorescence analysis of retinal sections from a 1-year - old mouse in which one eye underwent intravitreal injection of aav2/2-ngb at 2 months of age (early treatment) and the contralateral eye remained untreated. (b) immunofluorescence analysis of retinal sections from a 1-year - old mouse in which one eye underwent intravitreal injection of aav2/2-ngb at 8 months of age (late treatment) and the contralateral eye remained untreated. for (a) and (b), confocal images illustrate immunolabeling for brn3a (red) and gfap (green). the scale bars represent 20 m. abbreviations : onl, outer nuclear layer ; inl, inner nuclear layer ; gcl, ganglion cell layer. (c) the overall number of rgcs was estimated by counting brn3a - positive cells in retinas from the treated eyes of dba/2j mice that underwent intravitreal injection of aav2/2-ngb at 2 months (early treatment) or 8 months (late treatment) of age ; all of the mice were euthanized at 1 year of age. the values obtained for treated retinas were compared to those obtained for untreated retinas from 1-year - old mice. the bar chart illustrates the mean numbers of rgcs sems ; the number of mice evaluated in each group is shown in brackets. p values in treated retinas were calculated with respect to rgc values in untreated retinas from 1-year - old mice. (d) the bar chart illustrates the normalized values of the fluorescence intensity for gfap labeling in entire retinal sections. the values were normalized against the mean fluorescence in retinas from 12-month - old mice. the number of retinal sections from independent mice evaluated with imagej is indicated below each bar. the values were plotted using graphpad prism 6 as means sems. to determine whether the increased accumulation of ngb in transduced cells could lead to structural changes in neurons, retinas mounted with the vitreal side (corresponding to the gcl) uppermost were double labeled with antibodies against brn3a and 3-tubulin, a specific marker for dendrites and axons of rgcs and amacrine cells. retinas from the treated eyes of mice that received early (n = 7) or late (n = 10) treatment were compared with retinas from untreated mice aged 2 months (n = 7) or 12 months (n = 8). the periphery of the retina displays more clearly the somas, axons, and dendrites of isolated neurons within the gcl, enabling a better evaluation of their morphology by confocal microscopy (figures 8 and 9). few rgcs were observed in the retina from the 12-month - old untreated mouse or in the treated retina collected from the mouse that received late treatment, whereas transduced retinas from mice subjected to early treatment displayed a density of rgcs comparable to that found in the retina from the young mouse. the overall morphology of the rgcs and their connections appeared to be preserved in transduced retinas independently of when the treatment was performed. this point is illustrated in the 3-tubulin panels of figures 8 and 9, in which some brn3a - positive cells (identified by white arrowheads) have short / few dendrites and other brn3a - positive cells (identified by red arrowheads) have longer dendrites.figure 8morphology of neurons in the ganglion cell layer after early treatment with aav2/2-ngbflat - mounted retina preparations (vitreal side up, with the gcl visible) were subjected to immunohistochemical staining with antibodies against brn3a (red) and 3-tubulin (green). the results shown were obtained with three retinas : one isolated from a 2-month - old untreated mouse and two from a 12-month - old mouse subjected to aav2/2-ngb administration at the age of 2 months (early treatment) and euthanized 10 months later. the observations were performed with a confocal microscope and regions from the periphery are illustrated. some brn3a - positive cells are highlighted : white arrowheads indicate cells displaying short or few dendrites (untreated retina), and red arrowheads indicate cells with long dendrites (transduced retinas).figure 9morphology of neurons in the ganglion cell layer after late treatment with aav2/2-ngbflat - mounted retinas from two untreated 12-month - old mice were compared to retinas from two mice that underwent intravitreal injection of aav2/2-ngb in each of their eyes at 8 months of age (late treatment). some brn3a - positive cells are highlighted : white arrowheads indicate cells displaying short dendrites (untreated retinas from old mice), and red arrowheads indicate cells with long dendrites (transduced retinas). morphology of neurons in the ganglion cell layer after early treatment with aav2/2-ngb flat - mounted retina preparations (vitreal side up, with the gcl visible) were subjected to immunohistochemical staining with antibodies against brn3a (red) and 3-tubulin (green). the results shown were obtained with three retinas : one isolated from a 2-month - old untreated mouse and two from a 12-month - old mouse subjected to aav2/2-ngb administration at the age of 2 months (early treatment) and euthanized 10 months later. the observations were performed with a confocal microscope and regions from the periphery are illustrated. some brn3a - positive cells are highlighted : white arrowheads indicate cells displaying short or few dendrites (untreated retina), and red arrowheads indicate cells with long dendrites (transduced retinas). morphology of neurons in the ganglion cell layer after late treatment with aav2/2-ngb flat - mounted retinas from two untreated 12-month - old mice were compared to retinas from two mice that underwent intravitreal injection of aav2/2-ngb in each of their eyes at 8 months of age (late treatment). some brn3a - positive cells are highlighted : white arrowheads indicate cells displaying short dendrites (untreated retinas from old mice), and red arrowheads indicate cells with long dendrites (transduced retinas). in retinas from mice subjected to early treatment and euthanized at the age of 12 months, the structural hallmarks of rgcs ; i.e., their density, their branching, and the extent of their dendrites, were comparable to those of rgcs of young mice. however, in the retinas from the contralateral untreated eyes, not only was the number of rgc somas diminished, but the surviving cells exhibited few connections with the neighboring neurons (figure 8). when we compared retinas from two mice that received late treatment and retinas from two age - matched untreated mice, it was clear that neurons in retinas of treated mice had better - preserved morphology with respect to their dendritic profiles (figure 9). hence, aav2/2-ngb administration protects against neuronal death and is able to preserve the structural organization of the surviving neurons. we estimated the number of nf200-positive spots in on sections from the treated eyes of mice that received early or late treatment and in ons from age - matched untreated animals (figures 10a and 10b). there was no significant loss of nerve fibers in the ons of the treated eyes of mice that received early treatment when compared to the ons of young animals (p = 0.51), whereas ons from mice that received late treatment exhibited a 78% reduction in the number of nerve fibers when compared to the ons of young mice ; this decrease was similar to that seen in untreated age - matched animals (p = 0.85) and confirmed that treatment at the later age was unable to prevent rgc degeneration. we also performed immunohistochemical staining of sections of ons with antibodies against gfap, iba1, and vimentin (figures 10b and 10d) ; remarkably, ons from treated animals showed a noticeable diminution in the intensity of the fluorescent signals obtained with these antibodies. figure 10d shows the mean fluorescence for the three antibodies in ons of treated eyes, normalized against the results obtained with 12-month - old untreated mice. hence, the microglial and astrocyte activation that accompanies glaucoma progression may be reduced as a result of the increased amount of ngb in rgcs.figure 10optic nerve morphology in retinas transduced with aav/2-ngb(a) proximal on transverse sections were subjected to immunohistochemical staining with antibodies against nf200 (green) and gfap (red). to bottom : untreated 2-month - old mouse ; untreated 1-year - old mouse ; 1-year - old mouse subjected to early treatment ; and 1-year - old mouse subjected to late treatment. (b) bar chart of estimated axon numbers (nf200-positive spots) for mice in the same groups as in (a) ; the number of mice evaluated in each group is shown in brackets below each bar (n). p values were calculated with respect to the number of fibers in untreated 2-month - old dba/2j mice. (c) results of immunohistochemical staining with antibodies against iba1 (green) and vimentin (red) of on sections from three 12-month - old mice. from top to bottom : untreated mouse ; mouse treated at 2 months of age (early treatment) ; and mouse treated at 8 months of age (late treatment). the nuclei were stained with dapi (blue). (d) normalized values (against the mean fluorescence in 12-month - old mice) for gfap, iba1, and vimentin labeling for the number of on sections indicated beneath each bar (n). the values were plotted using graphpad prism 6 as means sems. optic nerve morphology in retinas transduced with aav/2-ngb (a) proximal on transverse sections were subjected to immunohistochemical staining with antibodies against nf200 (green) and gfap (red). to bottom : untreated 2-month - old mouse ; untreated 1-year - old mouse ; 1-year - old mouse subjected to early treatment ; and 1-year - old mouse subjected to late treatment. (b) bar chart of estimated axon numbers (nf200-positive spots) for mice in the same groups as in (a) ; the number of mice evaluated in each group is shown in brackets below each bar (n). p values were calculated with respect to the number of fibers in untreated 2-month - old dba/2j mice. (c) results of immunohistochemical staining with antibodies against iba1 (green) and vimentin (red) of on sections from three 12-month - old mice. from top to bottom : untreated mouse ; mouse treated at 2 months of age (early treatment) ; and mouse treated at 8 months of age (late treatment). the nuclei were stained with dapi (blue). (d) normalized values (against the mean fluorescence in 12-month - old mice) for gfap, iba1, and vimentin labeling for the number of on sections indicated beneath each bar (n). the values were plotted using graphpad prism 6 as means sems. to establish whether morphologic changes in retinas and ons can result in improved energy metabolism, we assessed the respiratory chain function in the ons of the treated eyes of mice that underwent aav2/2-ngb administration at 2 or 8 months of age (figure 11a). the cv activity did not change in any of the groups evaluated, as demonstrated in untreated dba/2j mice at various ages (figure 4). the specific activity of ci, expressed as nanomoles of oxidized nadh / min / mg, in ons of treated eyes of mice that received early or late treatment (9.22 0.49 and 7.83 0.46, respectively) corresponded to 76.7% and 65%, respectively, of that measured in the ons of untreated 2-month - old mice (12.02 0.86) (figure 4). hence, ons of treated eyes of mice that received early or late treatment exhibited, respectively, a 2-fold or 1.7-fold increase in ci activity when compared to ons of age - matched untreated mice (4.62 0.3). the differences in ci activity between the treated and untreated groups were significant (p < 0.0001), regardless of when gene therapy was performed (figure 11a). determining the ci / cv ratio increased the robustness of the calculated ci activity in ons as a consequence of ngb overexpression : increases in activity of 78% and 50% were observed in ons of treated eyes of mice that received early and late treatment, respectively, when compared with ons of age - matched untreated mice (p < 0.0001).figure 11effect of ngb overexpression on respiratory chain activity in optic nerves and on visual cortex activitythe enzymatic activities of complexes i, ii + iii, iii, iv, and v were measured in the following samples from 12-month - old mice : (1) 26 ons from the treated eyes of mice that underwent intravitreal injection of aav2/2-ngb at 2 months of age (early treatment) ; (2) 26 ons from the untreated contralateral eyes of those same mice ; and (3) 20 ons from eyes that underwent intravitreal injection of aav2/2-ngb at 8 months of age (late treatment). (a) the values shown in each bar chart represent the mean sem of triplicates for ci and cv ; the ci / cv ratio is also shown. (b) the values shown in each bar chart represent the mean sem of duplicates for cii + ciii, ciii, and civ for the samples evaluated. p values were calculated with respect to each activity as assessed in untreated 12-month - old mice. (c) plots of f - vep recordings with the n1 and p1 waveforms from two untreated dba/2j mice aged 2 months and 1 year, one 1-year - old dba/2j mouse in which one eye received early treatment, and one 1-year - old dba/2j mouse in which both eyes received late treatment. (d) bar chart of the peak amplitudes of the n1 waves for the four groups of mice evaluated. p values were calculated with respect to data recorded in 12-month - old untreated mice ; the number of individual responses for each group is indicated in brackets. effect of ngb overexpression on respiratory chain activity in optic nerves and on visual cortex activity the enzymatic activities of complexes i, ii + iii, iii, iv, and v were measured in the following samples from 12-month - old mice : (1) 26 ons from the treated eyes of mice that underwent intravitreal injection of aav2/2-ngb at 2 months of age (early treatment) ; (2) 26 ons from the untreated contralateral eyes of those same mice ; and (3) 20 ons from eyes that underwent intravitreal injection of aav2/2-ngb at 8 months of age (late treatment). (a) the values shown in each bar chart represent the mean sem of triplicates for ci and cv ; the ci / cv ratio is also shown. (b) the values shown in each bar chart represent the mean sem of duplicates for cii + ciii, ciii, and civ for the samples evaluated. p values were calculated with respect to each activity as assessed in untreated 12-month - old mice. (c) plots of f - vep recordings with the n1 and p1 waveforms from two untreated dba/2j mice aged 2 months and 1 year, one 1-year - old dba/2j mouse in which one eye received early treatment, and one 1-year - old dba/2j mouse in which both eyes received late treatment. (d) bar chart of the peak amplitudes of the n1 waves for the four groups of mice evaluated. p values were calculated with respect to data recorded in 12-month - old untreated mice ; the number of individual responses for each group is indicated in brackets. next, we evaluated the activities of cii + ciii, ciii, and civ. based on the samples tested, treatment at 2 or 8 months of age was significantly beneficial in all cases when the results were compared with those obtained in 12-month - old untreated mice (figure 11b). for cii + ciii activity, we observed increases of 52.8% and 53.0% in ons of treated eyes of early and late - treated animals, respectively, as compared to the activity in age - matched untreated controls (p < 0.0001 and p = 0.008 for early and late treatment, respectively). for ciii activity, the increases were 67.4% and 53.8% for early and late treatment, respectively (p < 0.0001 and p = 0.0022, respectively). for civ activity, the increases in ons of treated eyes of mice that received early or late treatment were 66.9% and 64.8%, respectively, relative to that in age - matched untreated animals (p < 0.0001). thus, ngb overexpression compensated for respiratory chain deficiency in ons, which could lead to improved rgc functionality. we recorded flash visual evoked potentials (f - veps) in treated dba/2j mice to assess whether the preserved morphologic hallmarks of rgcs, along with the improved respiratory chain activity in ons, could enhance visual function. f - veps are used to monitor communication from the rgc soma through the axon to the visual cortex by recording electrical potentials from the brain after visual stimulation. f - veps in young dba/2j mice produce robust and reproducible signals, but the signals are severely diminished in old animals.38, 39 four groups were evaluated : (1) 19 untreated 2-month - old dba/2j mice ; (2) 21 untreated 1-year - old dba/2j mice ; (3) 27 1-year - old dba/2j mice that received early treatment ; and (4) 18 1-year - old dba/2j mice that received late treatment. light - adapted electroretinograms (ergs) were first obtained to measure the functionality of the photoreceptor visual pathways of the mice. recordings made under these conditions essentially consist of a fast positive b - wave that reflects the cone response to light stimulation (figure s6, left ; table s1). in some 1-year - old dba/2j mice, we observed a decrease in the b - wave amplitude that might have been associated with iris or corneal injury. mice in which b - wave amplitudes reached only 25% or less of the values measured in untreated 2-month - old mice and which exhibited severe corneal pathology were excluded from subsequent analyses. the most consistent components of f - veps are a negative n1 and a positive p1 peak, as shown in figure 11c (left panel). we found no differences in the peak latencies or peak - to - peak amplitudes when the responses for right and left cortices were compared, probably because at the optic chiasm of mice, more than 95% of the fibers from the nasal part of the retina decussate and join the uncrossed temporal fibers of the opposite nerve to form the optic tracts. thus, responses from right and left visual cortices were averaged, because their signals originate from fibers of each eye. the latencies of the n1 and p1 peaks, along with the p1-wave amplitudes, were similar in all mice evaluated (table s1). conversely, in the 12-month - old untreated dba/2j mice, there was a decline of 42.3% in the calculated n1-wave amplitudes, as compared to those in young mice (p = 0.0003). aav2/2-ngb administration in mice aged 2 or 8 months undeniably led to a significant enhancement of n1-wave amplitudes, which reached 188% or 189%, respectively, of those in 1-year - old untreated mice (figure 11c, right panel). furthermore, n1-wave amplitudes in treated mice, regardless of when the treatment was performed, were not significantly different to the amplitudes measured in 2-month - old mice (p = 0.93 and 0.33 for mice that received early and late treatment, respectively). thus, ngb overexpression resulted in functional recovery, and rgcs became capable of providing high electrical inputs to the brain, which eventually induced enhanced visual cortex activity. glaucoma is characterized by a complex and progressive pattern of molecular changes that ultimately leads to blindness, although there are substantial differences among patients. because elevated iop is a major risk factor for glaucoma, the current treatment strategies are aimed at reducing iop, but there is no effective cure. the fundamental cause of glaucoma is the degeneration of rgc somas and axons, as occurs in hereditary optic neuropathies. the nerve - fiber layer within the retina requires high energy for electrical conduction in the unmyelinated axons within the prelaminar and laminar parts of the on ; consequently, these fibers have a high density of mitochondria. our objective was to determine whether mitochondrial impairment could be directly involved in glaucoma pathogenesis. the hallmarks of eye pathology in dba/2j mice were described many years ago;21, 44, 45 elevated iop due to the release of iris pigment clumps into the anterior chamber of the eye is responsible for rgc loss and optic neuropathy. we thoroughly characterized these mice and identified several phenotypic hallmarks : (1) iris fragmentation was observed in 4-month - old mice ; (2) increased iop was detected in 7-month - old mice, with the levels remaining high until the age of 12 months and diminishing thereafter ; (3) rgc loss was evident in 10-month - old mice, whose retinas had less than 30% of the number of rgcs seen in young dba/2j mice ; (4) in retinas of 8-month - old dba/2j mice, mller cells responded to rgc injury by undergoing hypertrophy, with targeted cellular migration across the plexiform layers ; (5) the activation of astrocytes and glial cells in ons was obvious several months before the disappearance of rgc axons, as previously described ; and (6) axonal degeneration was initiated in 8-month - old animals, with the loss of 33.3% of the nerve fibers present in healthy mice, thus preceding rgc soma disappearance by 2 months. for the first time, we have demonstrated a consistent reduction in the enzymatic activities of respiratory chain complexes ci, cii + ciii, ciii, and civ in retinas and ons, with the decreases largely preceding the onset of neuronal loss. energy supply defects may exacerbate the neurodegenerative process and certainly play a key role in optic neuropathy and vision loss. moreover, retinas from dba/2j mice aged 12 to 14 months exhibited a significant reduction in the steady - state levels of mitochondrial proteins involved in energetic metabolism, organelle dynamics, or antioxidant defenses. proteomic studies investigating human retina samples from glaucomatous or ocular hypertensive patients established that an array of mitochondrial proteins displayed significant level reductions.47, 48 consequently, insufficiency in the energy supply could initiate defects in electrical conduction and axonal transport, thereby leading to neuronal cell loss and, ultimately, glaucoma. our data on the impairment of energy metabolism and the diminution of some mitochondrial protein amounts in dba/2j mice support the notion that generalized organelle dysfunction could be a key player in the course of glaucomatous neurodegeneration. hence, it is feasible to attempt therapeutic targeting of rgc mitochondria to preserve their function, with the aim of prolonging neuronal survival. we chose to evaluate the effect of enhancing ngb expression in rgcs via a single intravitreal injection of an aav2/2 vector, because ngb levels were almost halved in the retinas of 1-year - old dba/2j mice, as compared to those of 2-month - old mice. since its identification in 2000, ngb has been implicated in neuronal protection from hypoxia and oxidative stress. in rodent or human retinas, ngb is differentially distributed in the retinal cell layers, with an increased abundance in the gcl and especially in rgcs,50, 51, 52 as we showed in retinas from dba/2j mice. a recent article reviewed the available data on the neuroprotective role of ngb in a range of pathologic conditions. the possible mechanism of action that leads to the beneficial effect of ngb on nerve - cell survival appears to be linked to mitochondrial function by (1) the preservation of the atp synthesis rate, ros homeostasis, and mitochondrial membrane potential and (2) the modulation of death signaling via the shutdown of the apoptotic cascade. for instance, the human ngb protein can efficiently scavenge a variety of ros (superoxide anions, hydrogen peroxide, and hydroxyl radicals) and also reactive nitrogen species (rns), such as nitric oxide. as for how ngb modulates the apoptotic process, it is envisaged that it depends on interactions with two mitochondrial proteins : the voltage - dependent anion channel (vdac) and cyt - c, a component of the respiratory chain. binding between vdac and ngb can modify the permeability of the outer membrane, and because ngb is able to reduce cyt - c, its leakage from damaged mitochondria and the subsequent caspase 9 activation could be impeded.56, 57 furthermore, a recent study of mouse cortical neurons in culture demonstrated an interaction between ngb and cyc1, a subunit of ciii. within this complex, electrons are sequentially transferred from ubiquinol to cyc1 and cyt - c, and ngb could interfere in this transfer between cyc1 and cyt - c. interestingly, our experiments showed that ngb overexpression leads to increased enzymatic activity of ci and ciii. hence, the impediment of noxious accumulation of ros or rns in the mitochondria and the protein - protein binding and intermolecular electron exchanges between cyt - c / cyc1 and ngb could ultimately lead to better performance of respiratory chain enzymes in ons from dba/2j eyes treated with aav2/2-ngb. in 2014, we demonstrated that the retinas of harlequin mice exhibited decreased steady - state levels of ngb. these mice display optic neuropathy due to a profound respiratory chain impairment,19, 59 which was efficiently prevented by injecting aav2/2-ngb into the vitreous humor of young mice. in this study, we confirmed the ability of ngb to sustain mitochondrial function ; indeed, increased ngb expression in the rgcs of 2- and 8-month - old dba/2j mice resulted in significant protection of respiratory chain function in the ons. these data highlight the fact that, regardless of the molecular mechanism involved in mitochondrial dysfunction, ngb efficiently protects against a failure in energy metabolism. the administration of aav2/2-ngb to 2-month - old mice prevented rgc loss and nerve - fiber disappearance. in contrast, performing the same treatment in 8-month - old mice failed to prevent neuronal loss ; however, the enhanced energy metabolism of the surviving rgcs led to the preservation of visual cortex activity. the n1 and p1 peaks are generated by retino - geniculate fibers, which represent the main connection between the on and the occipital cortex. if rgcs are functionally compromised, the sensory input after light stimulation can not reach the visual cortex ; therefore, the f - vep is considered a quantitative index of visual function. we demonstrated that 12-month - old dba/2j mice displayed a 42% reduction in the n1-wave amplitude relative to the values observed in 2-month - old dba/2j mice, which is consistent with the extensive rgc injury. aav2/2-ngb administration led to an effective restoration of rgc functionality, because no significant difference was found between the n1-wave amplitudes in young mice and those in their 1-year - old counterparts, which accumulated increased amounts of ngb in their rgcs as a result of undergoing gene therapy at the age of 2 or 8 months. in the latter animals, the rgc number was low at the time of euthanasia ; nevertheless, respiratory chain function in the ons was preserved, as were the cortical responses to light stimulation. thus, the surviving rgcs elicited improved visual cortex activity, for which there are several possible explanations : (1) there are more intense action potentials from the residual rgcs ; (2) rgc axons constitute more synapses in their target area (the superior colliculus [sc ]) and are thus able to connect more neurons ; or (3) sc neurons can generate additional axonal collaterals and sprouts, with positive consequences for visual function. these situations have been described in several models : in adult hamsters, single regenerated rgc axons efficiently contacted multiple sc neurons, and a limited number of rgcs with regenerated axons were able to drive a much larger number of neurons in the occipital cortex, resulting in increased behavioral responses to light. in a rodent model of glaucoma due to elevated iop, at a late stage of the disease, compensatory functional changes were evident in the terminals of surviving cells, possibly as a result of plasticity, leading to increased synaptic transmission in the sc.61, 62 in a model of glaucoma induced by cauterizing the episcleral vein, changes were observed in the inl, such as newly formed synapses between rgcs and bipolar cells and the expansion of rgc dendrites. by carefully comparing flat - mounted retinas from ngb - treated and untreated 1-year - old mice, we observed distinct changes in rgc morphology, suggesting that neuronal remodeling and synaptic plasticity occurs inside the retina. this could explain, at least partially, the enhanced visual cortex activity in treated mice. because mitochondrial integrity, and especially organelle motility, is required to provide energy for synaptic signaling and plasticity, we postulate that ngb, by virtue of its ability to protect the respiratory chain, is responsible for preventing rgc loss and axonopathy when administered to young dba/2j mice. when the treatment was administered at an advanced stage of the disease, the surviving rgcs were able to deliver a consistent electrical input to the brain. hence, ngb overexpression, by preserving the rgc energy metabolism status, leads to functional synaptic transmission through the on to the occipital cortex. furthermore, the enhancement of the amount of ngb in rgcs results in the reduction of both microglial activation and astrocyte proliferation in ons, and the attenuation of inflammatory responses could also improve the transmission of nerve impulses to the central visual system. in dba/2j mice, damage to rgcs and their subsequent loss occur in progressive stages that are initiated by ocular hypertension and involve the whole visual pathway. most of the 1-year - old dba/2j mice studied here exhibited extensive rgc death and axonal degeneration (with losses of 67% and 78%, respectively, relative to the numbers in 2-month - old mice). aav2/2-ngb is a single - stranded parvovirus ; therefore, the number of transduced rgcs is expected to reach a maximum between 4 and 6 weeks after vector injection into the vitreous body, as a result of the delay required for the conversion of the single - stranded viral genomes to double - stranded dna molecules and their subsequent transcription. the aim of treating 8-month - old mice was not to induce cell survival, as the therapeutic window had already passed, but to mimic the clinical situation, in which patients develop severe visual impairment long after the disappearance of rgcs has begun. in this regard, ngb was able to halt the degeneration of the remaining rgc axons, thereby maintaining both their bioenergetics and the ability to transmit signals to the visual cortex. in conclusion, we have demonstrated that respiratory chain activity in the retinas and ons of dba/2j mice is compromised several months before the onset of rgc loss. furthermore, 1-year - old mice exhibiting glaucoma accumulated in their retinas low levels of several mitochondrial proteins that can further compromise organelle functionality. therefore, the beneficial and sustained effect of ngb on rgc viability and functional integrity encourages its use as a powerful means of maintaining robust and long - lasting mitochondrial activity within neurons, with the aim of treating visual impairment in glaucomatous patients. mice of the dba/2j strain and the congenic c57bl/6j strain were obtained from charles river laboratories (larbresle, france). there were 2-month - old dba/2j mice that were used as controls, as these mice do not develop glaucoma until they are 8 to 10 months of age. for some experiments, c57bl/6j mice were also evaluated as controls that did not exhibit visual function impairment with aging.25, 29 the mice were housed one to four per cage in a temperature - controlled environment, with a 12 hr light / dark cycle and free access to food and water, in a pathogen - free barrier facility. the studies were conducted in accordance with the official guidelines for the care and use of animals in research and were approved by the french ministry of agriculture and the veterinarian department of paris (permit no. 5575), and the ethics committees of the university of paris 6 and inserm (authorization no. 75 - 1710). for noninvasive measurement of iop, an icare tonolab tonometer (icare) was used. the assessment is based on a rebound method, which allows the iop to be calculated accurately, rapidly, and without the need for local anesthetic. the instrument takes six individual measurements, each repeated three times, and presents the mean of 18 values as a single reading displayed in mm hg. dba/2j and c57bl/6 mice were studied between the ages of 2 and 15 months ; measurements were performed monthly on both eyes and were made during daylight. a laser - scanning in vivo confocal microscope (ivcm) (heidelberg retina tomograph [hrt ] ii / rostock cornea module [rcm ] ; heidelberg engineering) was used to examine the entire cornea, including the superficial epithelium (at zero depth), basal epithelium (at a depth of 815 m), stroma (at a depth of 1540 m), and endothelium (at a depth of 6580 m). we used the protocol to visualize the iris at depths ranging from 80 m to 160 m. groups of four mice aged 2, 4, 8, or 12 months were each subjected twice to this analysis. photopic ergs and f - vep responses were recorded simultaneously from electrodes placed on the cornea and overlaying the visual cortex, respectively. photopic ergs were assessed using two gold loop electrodes with light stimuli (10 cd.s / m) applied on a light background (20 cd / m) as previously described. for f - veps, deep anesthesia was induced in the mice 7 days before the recording and maintained with 2% to 3% isoflurane (axience and abbott) administered through a face mask. two stainless - steel screws (diameter, 0.9 mm and length, 2.4 mm) were implanted, using x and y stereotaxic coordinates, into the right and left visual cortices and fixed in place with surgical glue. each electrode was positioned 2.7 mm posterior to the bregma and 2.5 mm lateral to the right or left lambda suture and penetrated the cortex to a depth of 1 mm. platinum needles in the forehead and at the base of the tail served as reference and ground electrodes, respectively. on the day of electrophysiologic recording, mice were anesthetized with an intraperitoneal injection of a mixture of ketamine (100 mg / kg) and xylazine (10 mg / kg). their body temperatures were maintained at 37c to 38c with a heating pad, and their pupils were dilated with a single dose of 1% tropicamide and 5% phenylephrine. stimuli for the ergs and f - vep response recordings were generated and controlled by an espion e2 system (diagnosys). a single flash stimulus was delivered in a ganzfeld dome. for photopic ergs, each flash had a duration of 4 ms, and the signals were differentially amplified and digitized at a rate of 5 khz with a band - pass filter (0300 hz). vep responses were elicited by 100 flashes of white light (10 cd / mm each), with a duration of 4 ms each and a frequency of 1 hz, delivered with the flash photostimulator placed 15 to 20 cm from each eye with a band - pass filter (1080 hz). photopic ergs consist of a b - wave with positive polarity derived from the inner retina, which corresponds to the cone responses after light stimulation. the mouse f - vep is dominated by a negative polarity component (n1) that peaks at 50 to 80 ms after stimulus presentation. the amplitude of the f - vep was measured from the n1 negative peak to the ensuing positive peak (p1). the amplitude and timing of the erg and vep components were measured with the espion software by placing a cursor at a subjectively determined turning point (the peak or trough) for each component of the individual recordings. there were two experimenters that performed the evaluations independently without knowing what treatment the mice had received. in some 12-month - old dba/2j mice, a decreased response in the erg might be associated with iris or corneal injury impeding light stimulation of the inner retina. hence, mice in which the erg responses attained values that were only 25% or less of those measured in untreated 2-month - old mice and which exhibited severe corneal injury were excluded from subsequent analyses. four mice in the untreated 12-month - old group and five mice in each of the treated groups were excluded on this basis. briefly, the recombinant paav - ires - hrgfp vector (agilent technologies) contains the coding sequence (453 bp), 5 utr (279 bp), and 3 utr (895 bp) of the mouse ngb gene. aav vectors were produced by the inserm umr1089 research unit (nantes, france). for intravitreal injections, dba/2j mice were anesthetized with 2% to 3% isoflurane (axience). the tip of a 33-gauge needle, mounted on a 10 l hamilton syringe (hamilton bonaduz), was advanced through the sclera and 2 l of the aav2/2-ngb vector suspension (2 10 vector genomes) was injected intravitreally into the superior area of the retina, avoiding structural disruption, bleeding, or lens injury. in terms of disease progression, two types of gene therapy were performed : early treatment, in which the vector was administered to 55 2-month - old mice in one eye only, and late treatment, in which the vector was administered to 18 8-month - old mice ; in the latter group, 16 of the 18 mice received the vector in both eyes. all surviving mice were euthanized at 12 months of age. in the early treatment group, nine mice died from natural causes before reaching 12 months of age and were, therefore, excluded from subsequent studies. mice under anesthesia were killed by cervical dislocation, whereupon their eyes were enucleated immediately and dissected. after the anterior segment and vitreous humor had been removed from each eye, the retinas and ons were collected, fixed in 4% paraformaldehyde (pfa) at 4c, then cryoprotected by overnight incubation in pbs containing 30% sucrose at 4c. retinas were embedded in optimum cutting temperature (oct) medium (neg 50 ; richard - allan scientific) and frozen in liquid nitrogen. ons were embedded in a solution of pbs + 7.5% type a gelatin from porcine skin (sigma - aldrich) and 10% sucrose and frozen in a 2-methyl - butane solution at 45c. sections of retinas and ons were cut (at a thickness of 10 m) on a cryostat (microm hm 560 ; thermo scientific) at 20c and mounted on superfrost plus slides. for the retinas, approximately 16 consecutive slides were obtained for each eye, half corresponding to the superior side. for immunohistochemical analysis, retinal and on sections were treated for 10 min with pbs + 0.1% triton and then for 1 hr with a solution of 1% bsa, 0.1% triton, 0.05% tween 20, and 5% normal goat serum (sigma - aldrich) and incubated with the primary antibodies overnight at 4c. next day, the sections were washed in pbs (three times for 10 min each) and incubated with the appropriate secondary antibodies and dapi (sigma - aldrich) for 2 hr at room temperature. finally, the sections were washed three times with pbs, rinsed with sterile water, and mounted on glass slides. flat - mounted retinas were obtained after enucleating eyes and removing the anterior segment and vitreous humor. next day, they were rinsed twice with pbs (15 min per wash) then permeabilized with pbs and 1% they were then incubated in 3% bsa, 0.1% triton x-100, and 0.05% tween 20 for 2 primary antibodies were added at the appropriate concentrations to the same solution used for the saturation step and incubation was performed overnight at 4c with gentle stirring. next day, the retinas were washed twice with pbs (15 min per wash) at room temperature and incubated with secondary antibodies and dapi for 2 hr at room temperature in the dark with gentle stirring. after this incubation, the retinas were rinsed twice with pbs (15 min per wash) and two incisions were made at each end under binocular magnification. the retinas were then carefully flattened and mounted on glass slides with the vitreal side, corresponding to the gcl, uppermost. fluorescence labeling was monitored with a confocal laser scanning microscope (olympus fv1000 or leica tcs sp8) ; images were acquired with olympus fluoview or las x software. retinal sections were also scanned with a nanozoomer digital pathology (ndp) 2.0 ht scanner (hamamatsu photonics), using the fluorescence unit option (l11600 - 05) and the nanozoomer s 3-ccd tdi camera. after whole retinal sections scanned with the ndp 2.0 ht scanner (hamamatsu photonics) had been reconstructed, the number of rgcs was estimated using the ndp analyze software. for each mouse, the number of cells that were positive for brn3a was counted over the entire length of three or four retinal sections. published data obtained from mice indicate that a high - density region for rgcs localizes to the superior retina as a horizontally oriented area extending nasotemporally, approximately 1 mm dorsal to the optic disk. thus, the sections counted corresponded to the superior retina at a depth of 400 to 600 m from the on. the same regions were chosen for evaluating the rgc number after gene therapy, because aav2/2-ngb was administered to the superior side of the eye. additionally, eye elongation related to iop elevation has been described in dba/2j mice ; one study found that the axial length increased progressively after the age of 6 months and reached a approximately 5 months later. in our hands, the retinal length in reconstructed scanned images increased in mice aged 8 months or older relative to that seen in 2-month - old mice ; no changes were observed after aav2/2-ngb treatment (table s3). hence, for each mouse, we considered the average total number of rgcs in the retinal sections evaluated, regardless of their length. imagej software (national institutes of health) was used to create binary images by thresholding. the intensity of gfap staining was estimated by measuring the mean fluorescence with the plot profile routine of imagej after reconstructing whole retinal sections with the ndp 2.0 ht scanner. there were three or four independent retinal sections that were evaluated for each mouse. in the on sections, the number of rgc axons was deduced from the fluorescent spots revealed by the nf200 antibody. the total number of particles ; i.e., the number of axons in each image, was automatically estimated for each mouse by analyzing three independent on sections, as described previously. the intensity of the labeling for vimentin, iba1, and gfap was also estimated in the on sections by measuring the mean fluorescence, using the plot profile routine of imagej on three or four independent on sections for each mouse assessed. total rna was extracted from retinas with an rneasy plus mini kit (qiagen). the rna was treated with rnase - free dnase (qiagen) then cleaned with an rneasy minelute cleanup kit (qiagen). there was 1 g of total rna that was reverse transcribed using oligo - dt and superscript ii reverse transcriptase (life technologies). qpcr reactions were performed using an abi 7500 fast real - time pcr system (applied biosystems) and the specific primers listed in table s4, as described earlier. briefly, for each gene, the equivalents of 2 ng and 10 ng of cdna were used as templates for qpcr reactions performed using power sybr green pcr master mix (applied biosystems). each biological sample was assayed in triplicate for each gene ; the cycle threshold (ct) values (the numbers of cycles required for the fluorescent signal to cross the background threshold) were obtained with the abi 7500 software (v.2.0.4). to determine the relative mrna amount for each gene studied the mitochondrial atp6 gene was used as the normalizing gene, because its mrna steady - state levels remained almost unchanged in all the samples evaluated, as previously reported. for western blot analysis, retinas were isolated from 17 untreated 2-month - old mice (the young group) and 17 untreated mice aged 12 to 14 months (the old group). a further seven retinas were isolated from the treated eyes of mice that underwent aav2/2-ngb administration at 2 months of age and were euthanized 10 months later, along with seven retinas from the untreated contralateral eyes of the same mice. the retinas were homogenized in 50 l of 20 mm hepes, 60 mm mannitol (ph 7.2), and protease inhibitor cocktail (sigma - aldrich) at 4c with a 200 l hand - driven glass - glass potter - elvehjem micro tissue grinder. large cellular debris was concentrated by centrifugation (1,000 g for 5 min at 4c) and discarded. then the amount of protein in the supernatants was quantified with bradford assay reagent (sigma - aldrich) before western blotting was performed. after incubation at 95c for 10 min, 15 or 30 g of each sample was resolved by 12% sds - page and transferred to a pvdf membrane. the membranes were incubated with antibodies against mitochondrial proteins ; immunoreactive bands were labeled with appropriate secondary antibodies coupled to horseradish peroxidase (table s2) then detected with pierce ecl plus western blotting substrate (thermo scientific). the apparent molecular mass of each protein was estimated by comparing each specific signal on the blots to the pageruler plus prestained protein ladder (thermo scientific). signals obtained were visualized with a g : box chemi xx6 gel imaging system (syngene europe) and analyzed with genesys software. quantifications for different immunoblots were performed with quantity one analysis software (bio - rad). we conducted these assays within the linear dynamic range of our detection method and corrected the intra- and interblot variability by loading two quantities of the protein extracts on the same gels / blots and including common samples in each independent experiment. the signal obtained with the antibody against ngb generally revealed three bands, and we quantified the signal for the entire area encompassing these three bands. the incubation of the membranes with reblot plus strong solution (millipore) allowed three different antibodies to be used sequentially. samples from retinas and ons were prepared by homogenization in 200 l of extraction buffer (0.25 mm sucrose, 40 mm kcl, 2 mm egta, 1 mg / ml bsa, 20 mm tris - hcl, ph 7.2) at 4c with a 200 l hand - driven glass - glass potter - elvehjem tissue grinder. the homogenates were subjected to low - speed centrifugation (1,000 g for 8 min), and the supernatants were collected and frozen at 80c until use. respiratory chain enzymatic activities were measured using a cary 50 uv - vis spectrophotometer (agilent technologies). we performed two spectrophotometric assays to measure sequentially the activity of the five respiratory chain complexes in a single retina or on. the first assay measured the activity of the rotenone - sensitive nadh decylubiquinone reductase (ci) and the atp hydrolase activity of cv, which is oligomycin sensitive. each measurement was made in triplicate with 50 l of the homogenate. in the second assay, the activity of cytochrome c oxidase (civ) was measured by adding reduced cyt - c and recording the oxidation rate. next, the activity of succinate - cytochrome c reductase (cii + ciii) was initiated by adding succinate, which triggers the reduction of cyt - c. adding the sdh competitive inhibitor malonate fully inhibited the sdh - dependent activity. finally, after metal chelation with edta, decylubiquinol was added to initiate the reduction of cyt - c by ciii. after the protein had been quantified by the bradford method, the values obtained from the assays were converted to specific activities for each complex, as presented in table 1. all the chemicals used for the assays were of the highest grade available from sigma - aldrich. statistical analyses were performed with graphpad prism 6.0 software, assuming a confidence interval of 95%. generally, the observations within each group did not fit a normal distribution ; therefore, nonparametric methods were applied to evaluate the significance. data were compared using the mann - whitney u test for unpaired nonparametric significance. for mice that received gene therapy in only one eye, a comparison of the treated eyes and their untreated counterparts, t.d., and m.c.- d. performed the experiments : h.c.- t., c.l., s.a.,, e.r., h.l., f.b.- b., a. mohammad, a. maron, t.d., h.l., and m.c.- d. wrote the paper : h.c.- t., s.a., c.l., and m.c.- d. t.d. and a. maron are employed by sanofi fovea - ophthalmology, which supported the study. an international application for a patent has been filed on neuroglobin (pct / fr2013/05232). the authors have no other patents, marketed products, or products in development to declare. | mitochondrial dysfunction is responsible for hereditary optic neuropathies. we wished to determine whether preserving mitochondrial bioenergetics could prevent optic neuropathy in a reliable model of glaucoma. dba/2j mice exhibit elevated intraocular pressure, progressive degeneration of their retinal ganglion cells, and optic neuropathy that resembles glaucoma. we established that glaucoma in these mice is directly associated with mitochondrial dysfunction : respiratory chain activity was compromised in optic nerves 5 months before neuronal loss began, and the amounts of some mitochondrial proteins were reduced in retinas of glaucomatous mice. one of these proteins is neuroglobin, which has a neuroprotective function. therefore, we investigated whether gene therapy aimed at restoring neuroglobin levels in the retina via ocular administration of an adeno - associated viral vector could reduce neuronal degeneration. the approach of treating 2-month - old mice impeded glaucoma development : few neurons died and respiratory chain activity and visual cortex activity were comparable to those in young, asymptomatic mice. when the treatment was performed in 8-month - old mice, the surviving neurons acquired new morphologic and functional properties, leading to the preservation of visual cortex activity and respiratory chain activity. the beneficial effects of neuroglobin in dba/2j retinas confirm this protein to be a promising candidate for treating glaucoma. |
autoamputation of an ovary is an extremely rare condition.18 torsion of an ovary or an ovarian lesion and the adnexa can lead to infarction and necrosis and subsequent amputation of the ovary.13 an amputated ovary gets calcified (dystrophic calcification) and may freely float in the peritoneal cavity.3 in most cases, a blunt ending fallopian tube is noted on the involved side with the free - floating calcified ovary during surgery or laparoscopy.3 confirmation of the diagnosis of an autoamputated wandering calcified ovary (awco) in most of the previously reported cases was made during surgery or laparoscopy, and all of these cases were evaluated by x - rays, ultrasound, and computed tomography (ct) scan alone or in combination.18 a magnetic resonance imaging (mri) study has not been conducted in any of these previously reported cases of awco.18 this is the first mri report of its kind in the literature of an awco in a pediatric patient.18 we describe the characteristic mri features of awco in this report, and review the literature about the autoamputation of ovaries or the adnexa. a 9-year - old asian indian girl presented to the emergency department with a complaint of right lower abdominal pain. she was born by normal vaginal delivery in a hospital, and the antenatal and perinatal period was uneventful. a 1.2 cm oval calcific opacity was noted in the left side of the pelvis on the abdominal plain x - ray (figure 1a), and an ultrasound of the abdomen was unremarkable. she was sent home after the pain subsided and called again for evaluation of the left pelvic opacity. another abdominal plain x - ray obtained after a week showed the same opacity in the pelvis in the midline (figure 1b). a ct scan was performed, suspecting the opacity to be a vesical calculus, which showed an oval calcified lesion in the right adnexa (figure 2). it showed an absent right ovary and a calcified lesion in the left adnexa adjacent to the left ovary (figures 35), suggesting that it was an autoamputated wandering calcified right ovary. an absent right adnexa and a blunt - ending right fallopian tube were very well visualized on mri, and they were best visualized on short ti inversion recovery images. suppressed t1-weighted images, the awco appeared as an oval hyperintense lesion with a central hypointense area. peripheral hyperintensity on t1-weighted images in awco can be due to methemoglobin or soft calcifications, and the central hypointense area can be due to thick or dense calcifications. only regular follow - up with ultrasound was advised ; no treatment was given, as it is a benign condition and generally does not require surgical intervention unless complicated. pain in the abdomen did not recur after the first episode and was considered as unrelated to the awco. the patient was followed up for 1 year until the writing of this report with an ultrasound study every 6 months, and no significant changes in the existing findings (or no new findings) were noted. the diagnosis by mri completely obviated the need for laparoscopy, saving the patient from an unnecessary surgical procedure. the autoamputation of an ovary is an extremely rare cause of calcification on an abdominal plain x - ray in the pediatric population.3 common causes of the pelvic calcification in young females include teratoma, ovarian neoplasm, chronic ovarian inflammation, appendicolith, urinary bladder calculus, lymph nodal calcification, calcification in a meckel s diverticulum, gallstone, or neoplasms of the pelvic bones.9 autoamputation of an ovary can be unilateral or bilateral, and it can occur during the prenatal or neonatal period.3 it is more common on the right side.13 the autoamputated ovary is mostly found incidentally while investigating symptoms not related to it, on prenatal ultrasound, or during surgery for different or related causes.18 in addition to our case, 96 cases of autoamputated ovaries were noted in the published literature, for a total of 97 cases.13 half (49/97) of these cases involved pediatric patients (< 18 years).13 most of these cases were diagnosed via antenatal ultrasonography, likely because it is a very commonly performed examination.3 a wandering cystic abdominal mass was demonstrated on antenatal ultrasound in almost all of these cases.13 in all cases, in older children, the diagnosis was made after laparoscopy or during surgery.13 only 14 cases of radiologically demonstrated wandering calcified ovary were identified in the literature, and mri findings have not yet been described in this group.3 in our case, mri clearly demonstrated the lack of an ovary / adnexa and a freely mobile oval calcified lesion (autoamputated ovary) in the pelvis, suggesting that it was an autoamputated wandering calcified right ovary. ultrasonography can show the absence of the adnexa, but mri is superior in delineating soft tissue morphology. also, ultrasonography may not demonstrate the displaced calcified ovary.10 ct scans can show calcifications very well, but they are limited in terms of resolving soft tissue abnormalities.9 radiation risk from ct scans can be a concern in young females.11 x - rays can only demonstrate mobile calcifications. therefore, mri is far better in conclusively demonstrating the absent adnexa and also in localizing the wandering calcified ovary, thus making it the investigation of choice in suspected cases of awco. the mri findings are characteristic in the diagnosis of an awco, and they can completely obviate the need for laparoscopy in this benign condition. an awco should be suspected in all cases of mobile calcific opacities on radiographs in females. we advise that mri be performed in all suspected cases of awco for accurate and noninvasive diagnosis, and that regular follow - up with ultrasound be performed. the findings in our case report have the potential to change the management of awco in suspected cases. | an autoamputated wandering calcified ovary (awco) is an extremely rare cause of abdominal calcification in the pediatric population. we present the magnetic resonance imaging (mri) features of awco in a child. to our knowledge, the mri features of awco have not been previously described in the published literature. our case report indicates that the mri findings are characteristic in the diagnosis of an awco and can completely obviate the need for invasive procedures in this mostly benign disease. an awco should be considered in all cases of mobile calcific opacities on radiographs in female patients. we advise that mri be conducted in all suspected cases of awco for accurate and noninvasive diagnosis, and regular follow - up should be performed with ultrasound. the findings in our case report have the potential to change the course of investigations and management in suspected cases. |
a semidominant locus in the vicinity of d14rat65 of chromosome 14 has been shown responsible for renal malformation. however, the renal lesion is assumed to occur in a polygenic trait. in the course of the genetic study on thymoma developments of buf / mna rats, we noticed that moderate substrain differences in the incidences of the renal malformations were found among congenic strains of control aci / mna rats with introgressed chromosomal segments from buf / mna rats. the rats of the inbred aci / mna (aci), buf / mna (buf) and wky / ncrj (wky) strains, and of congenic strains, in which genetic regions of rat nude (rnu), thymus enlargement-1 (ten1) and thymus enlargement-2 (ten2), thymoma susceptible gene of rat-1 (tsr1), atrophy of fast - twitch muscle-1 (aftm1) and proteinuria-1 (pur1) were transferred into aci, buf or wky strain, respectively, were used. the buf - rnu/+ rats were raised during the course of the establishment of the buf - rnu / rnu strain, as described in the previous study. they were housed with free access to food (cmf, oriental yeast, tokyo, japan) and tap water at the animal facility of fujita health university. all animal experiments were approved based on the approval of the guide for the care and use of laboratory animals of fujita health university school of medicine. rats of these strains, as surpluses in the course of the maintenance of the strains, were killed at the age of 6104 weeks, except 3 rats died of bilateral renal malformations 15 days after birth. 1) in 113 %, but buf and wky, and their congenic rats hardly developed. since there were no sex differences in the incidences in renal agenesis and hydronephrosis in these strains, the data for both sexes were accumulated (table 1). higher incidences of renal agenesis in the right side and hydronephrosis in the left side, respectively, were observed. three rats died 15 days after birth ; 1 developed no kidneys in bilateral sides and other 2 did bilateral hydronephrosis (table 1). statistically, lower incidences of these developmental abnormalities were found in rats of the aci - pur1 and aci - pur1-ten2 strains than aci, aci - tsr1, aci - ten1, and aci - aftm1 strains (table 1). incidences of renal agenesis and hydronephrosis in rats of both sexes of the aci, buf, and wky strains and their congenic strains the statistical analyses were carried out by the fisher s exact test. highly significant ; significant ; highly significant ; significant ; significant ; significant ; highly significant ; highly significant. the unilateral renal agenesis, hydronephrosis, and associated genitourinary anomalies in aci rats were thought to be a part of a mesonephric duct defect. the inheritance of the unilateral renal agenesis is believed to be polygenic and one of the genes for unilateral renal agenesis was mapped on chromosome 14. the present study revealed that the renal agenesis and hydronephrosis were significantly suppressed by the insertion of the genetic region of proteinuria in aci - pur1 and aci - pur1-ten2 rats originated from buf rats. conversely, it means that the pur1 region of aci rats contains a second gene for the induction of renal malformations. we previously showed that genetic pur1 region was located on the chromosome 13 and that the genetic pur1 region contained 38 genes, which should be analyzed by molecular methods. the present study also showed that aci rats developed unilateral hydronephrosis more in the left side. the exact mechanism why unilateral hydronephrosis occurs more in the left side is not known. | abstractthe aci rats developed hereditary renal malformations including agenesis and hydronephrosis at moderate penetrance. during construction of a variety of congenic strains based on aci / mna (aci), buf / mna (buf), and wky / ncrj (wky) rats, we found that the renal malformations were significantly suppressed by introgression of a segment of chromosome 13 of buf rats containing pur1 locus. it is plausible that this region contain a modifier locus influencing development of renal malformations. |
anteriorly directed decompression and arthrodesis can be achieved with a broad variety of techniques from simple discectomy and interspace replacement with autograft or allograft to corpectomy and anterior column reconstruction with internal fixation and grafting. advancements in instrumentation and interspace grafting have resulted in improved success and safety of these procedures. the broad indications for anterior cervical spine surgery vary across clinical presentations from degenerative disease, neoplasm, infection, trauma, and iatrogenic, but always include restoring stability to a structurally compromised spine, prevent progression of neurologic symptoms or deformity, and to alleviate pain. the evolution of interbody fusion techniques for arthrodesis is ongoing, and little data exist regarding the rare and potentially catastrophic complication of acute graft extrusion. in this article, we performed a multi - institutional retrospective case series of nearly 9000 cases to isolate instances of acute implant extrusion (ie). we hoped to elucidate any significant trends in these select instances, review technical considerations for avoidance, and highlight functional outcomes after these events. we conducted a retrospective multicenter case series study involving 21 high - volume surgical centers from the aospine north america clinical research network, selected for their excellence in spine care and clinical research infrastructure and experience. medical records for 17 625 patients who received anterior or posterior cervical spine surgery (levels from c2 to c7) between january 1, 2005, and december 31, 2011, were reviewed to identify occurrence of 21 predefined treatment complications occurring within 30 days from the index surgery. one hundred and thirty - nine rare complications were identified including re - intubation requiring evacuation, esophageal perforation, epidural hematoma, c5 palsy, recurrent laryngeal nerve palsy, superior laryngeal nerve palsy, hypoglossal or glossopharyngeal nerve palsy, dural tear, brachial plexopathy, blindness, implant extrusion, misplaced screws requiring re - operation, anterior cervical infection, carotid artery injury or cerebrovascular accident, vertebral artery injuries, horner s syndrome, thoracic duct injury, quadriplegia, intraoperative death, revision of arthroplasty, and pseudomeningocele. trained research staff at each site abstracted the data from medical records, surgical charts, radiology imaging, narratives, and other source documents for the patients who experienced one or more of the complications from the list. implant extrusion was defined as movement of the implant anteriorly or posteriorly on imaging and symptoms of intractable neck pain or new neurologic deficits after anterior cervical spine surgery. cases of isolated posterior cervical surgery were excluded from our data analysis, yielding 8887 patients to include in our study. copies of crf forms were transferred to the aospine north america clinical research network methodological core for processing, cleaning, and data entry. descriptive statistics were provided for baseline patient characteristics. paired t test, with statistical significance of p <.05, was used to analyze changes in clinical outcomes at follow - up compared to preoperative status. from 2005 to 2011, a total of 8887 patients underwent anterior cervical surgery at 21 institutions. eleven cases of acute ie in the first 30-day postoperative period were reported (table 1). eight patients presented with myelopathy, 4 for radiculopathy, and 2 patients had both (table 1). all cases were multilevel constructs with 10 including a corpectomy of at least at one vertebral body. three patients had single - level corpectomy at c5 with graft failure (figure 1), 3 involved multilevel corpectomies (figure 2), whereas the remainder had hybrid constructs with at least one adjacent discectomy (figure 3). of the 11 failures, 7/11 (64%) constructs ended with reconstruction or stabilization at c7. the second case involved a c5 - 6 discectomy and c7 corpectomy without a plate, but did have posterior supplement instrumentation. grafting was heterogeneous across cases with 3/11 (27%) using iliac crest, 2/11 (18%) allograft alone, and 5/11 (45%) using local mixed with allograft. (a) immediate postoperative film with good alignment of the construct. developed persistent neck pain postoperatively and (c) taken back to surgery for anterior revision and posterior instrumentation at c4-c6. (a) patient with progressive myelopathy, underwent a c5 and c6 corpectomy with fibular strut grafting and anterior plating c4-c7. on postoperative day 1, noted to have neck pain and dysphagia ; lateral x - ray revealed pistoning of graft and dislodgement of caudal screws. (b) taken back to surgery for repositioning of graft and posterior instrumentation from c4 to t2. patient with spondylotic cervical myelopathy, underwent c3 - 4, c4 - 5 diskectomies, c6 corpectomy with cage placement and allograft interbodies. (b) patient with neck pain postoperative day 1 ; lateral x - ray with retropulsion of c6 cage. (c) taken back to operative room for replacement of cage with a fibular strut graft, and posterior instrumentation from c3 to t3. eight patients had ie within 2 weeks and 3 were within 24 hours of surgery. after identification of ie, 2 patients were kept in cervical orthosis while 9 patients required surgery for repair and stabilization. revision surgery was performed at the discretion of each surgeon ; however, 7 patients reported intractable neck pain while 2 had new neurologic deficits prior to surgery. two patients were revised anteriorly or posteriorly alone, respectively, whereas 5 had anterior revision surgery with added posterior instrumentation. one patient had paresthesias and sensory loss whereas the other had residual weakness (4/5 strength in c5-c8 in bilateral upper extremities) at 30-day follow - up. preoperative mean neck disability index score, modified japanese orthopaedic association score, and short form-36 (sf-36) physical and mental sections were 53, 6, 24.972, and 54.879, respectively. at follow - up after revision surgery, neck disability index, modified japanese orthopaedic association, sf-36 physical, and sf-36 mental scored were 42, 9.5, 34.842, and 24.937, respectively. eight patients had nurick myelopathy grading pre- and postoperatively with mean scores of 1.875 and 0.467, respectively, with statistically significant improvement (p <.0379). these results suggest functional outcome can still be obtained if reoperation and revision is necessary. the risks to anterior cervical spine surgery are well documented, with morbidity rates ranging from 9% to 20%. well - known common complications are postoperative dysphagia, dural tear, and recurrent laryngeal nerve injury resulting in hoarseness. rare complications remain underreported in the literature. in this multi - institutional retrospective cohort, we identified 11 cases of acute ie in 8887 anterior cervical surgeries, with an incidence range of 0% to 0.8% across 21 academic institutions. this is similar to the incidence quoted in prior literature of 0.88% to 1.3% of ie following discectomy. early research showed very high reoperation rates of 10% to 18% among patients with nonplated multilevel anterior discectomy (adf) or anterior corpectomy (acf). after the popularity of plating began, caspar and colleagues observed 19/219 (8.6%) patients undergoing nonplated adf required reoperation whereas only 3/146 (2%) with plated constructs. connolly and colleagues studied addition of a plate in single and multilevel acf and adf. they found plating did not improve outcome ; however, plating multilevel surgery reduced ie and pseudoarthrosis. in our case series, all ies were in very complex constructs spanning at least 3 levels, and all but one involved a corpectomy (table 1). sasso and colleagues reviewed 40 cases of 2- and 3-level corpectomies and found 2/33 (6%) and 5/7 (71%) had plate or graft migration and failure. wang and colleagues reviewed 249 cases of acf over a 25-year period with autogenous bone grafting. they found migration in 16 patients with rates of 4/95 (4%), 4/76 (5%), 7/71 (10%), and 1/6 (16.7%) in cases of 1- to 4-level corpectomies, respectively. interestingly, they found 14/16 patients had ie after c6 corpectomy with fusion extending to the c7 vertebral body. biomechanically, the cervicothoracic junction poses a unique segment of the spine with an abrupt transition between kyphosis and lordosis in some patients. this transition zone can lead to large variations in the angle of the disc spaces of c5 - 6, c6 - 7, c7-t1, and t1-t2. this can create unique shear stresses not seen in the rostral subaxial spine. in our case series, 7/11 constructs involved reconstruction at c7 or t1. we hypothesize many of these failures were due to biomechanical failure during this transition zone where shear stresses on the construct may have been underestimated by the index surgeon. to lower the risk of ie, we recommend careful planning and consideration for supplemental posterior instrumentation when multilevel constructs will end at the cervicothoracic junction. biomechanical studies have also evaluated the strength of constructs in the subaxial cervical spine. in our study, 10/11 patients had a corpectomy incorporated in their anterior column reconstruction. a corpectomy has inherent advantages with fewer sites for fusion, but biomechanically may not be as stable due to the variations in axial loading during flexion and extension predisposing graft movement. plating for corpectomies has universally been accepted to improve fusion and stability. in our series, the 2 cases without plating were high - risk constructs as one was a multilevel discectomy and the other a corpectomy. plating may have decreased the risk for ie in these cases, and should be recommended in these difficult cases. in multilevel corpectomies with just anterior plating, the plate provides constraint only in flexion but in extension the load is placed on the graft. if the axial load is not perpendicular to the caudal end plate, erosion and even rupture can occur leading to settling or telescoping of the graft and construct failure. thus, supplement posterior instrumentation in cases of multilevel corpectomies should be considered to provide extra resistance against extension and offset loading of the graft leading to failure especially when reconstruction involves the cervicothoracic junction. in our series, 7/11 involved either multilevel corpectomies or hybrid constructs with at least one adjacent discectomy to a corpectomy, but posterior instrumentation was only utilized in 2/11 index surgeries. these data suggest inherent instability in these constructs may have been underappreciated at the initial time of surgery, and they were predisposed to failure. surgical technique is difficult to assess and the complexity of constructs involved in this case series may be understated in many instances on the crfs submitted. acute and subacute implant failure only were evaluated in this study and long - term follow - up would be needed to make stronger conclusions on the role of pseudoarthrosis, subsidence, and instrumentation failure on ie. moreover, graft and plate usage was not completely documented, and it is difficult to draw conclusions about trends in different plate or graft designs that also may have predisposed these constructs to fail. our case series highlights the importance of counseling patients on the possibility of hardware failure with complex anterior reconstruction, and most important, if the construct involves the cervicothoracic junction. posterior supplemental instrumentation is worth considering when complex anterior column reconstruction is going to be performed. prospective and biomechanical research is needed to further elucidate risks with different construct designs to minimize this rare complication and help guide treatment strategies when they occur. | study design : multi - institutional retrospective case series of 8887 patients who underwent anterior cervical spine surgery.objective:anterior decompression from discectomy or corpectomy is not without risk. surgical morbidity ranges from 9% to 20% and is likely underreported. little is known of the incidence and effects of rare complications on functional outcomes following anterior spinal surgery. in this retrospective review, we examined implant extrusions (ies) following anterior cervical fusion.methods:a retrospective multicenter case series study involving 21 high - volume surgical centers from the aospine north america clinical research network. medical records for 17 625 patients who received cervical spine surgery (levels from c2 to c7) between january 1, 2005, and december 31, 2011, were reviewed to identify occurrence of 21 predefined treatment complications.results:following anterior cervical fusion, the incidence of ie ranged from 0.0% to 0.8% across 21 institutions with 11 cases reported. all surgeries involved multiple levels, and 7/11 (64%) involved either multilevel corpectomies or hybrid constructs with at least one adjacent discectomy to a corpectomy. in 7/11 (64%) patients, constructs ended with reconstruction or stabilization at c7. nine patients required surgery for repair and stabilization following ie. average length of hospital stay after ie was 5.2 days. only 2 (18%) had residual deficits after reoperation.conclusions:ie is a very rare complication after anterior cervical spine surgery often requiring revision. constructs requiring multilevel reconstruction, especially at the cervicothoracic junction, have a higher risk for failure, and surgeons should proceed with caution in using an anterior - only approach in these demanding cases. surgeons can expect most patients to regain function after reoperation. |
tuberculosis (tb) has been one of the most significant infections causing human disease. in tropical countries poverty, overpopulation, inattention to tubercular services, and as a result of the human immunodeficiency virus (hiv)/ acquired immunodeficiency syndrome (hiv / aids) epidemic there are more cases of tb today than at any previous time in human history. following its advent hiv / aids relentlessly spread around the world with no signs of regression. in 1993, in our country, the overall prevalence of hiv is 0.05). the association of symptoms with seroprevalence in tb patients is shown in table 4 and association with signs shown in table 5. table 6 shows the association of chest x - ray with seroprevalence in tb patients. a total of 100 patients, 81 male and 19 female diagnosed with tb were included in the study. our study found that seroprevalence rates among men were 8.64%, women 5.26% and was highest in the age group between 31 and 40 years at 29.41% [tables 1 and 2 ] and had a significant association with seroprevalence (or = 11.11, p = 0.003). among the occupations [table 3 ], seroprevalence was highest among drivers at 25%. however, most of the seropositive patients were from the agricultural background accounting for half the cases. seroprevalence was found to be higher among the urban group of patients at 12.5% when compared to 5.88% among the rural group. patients with no previous history of tb had a seroprevalence of 8.86% whereas among patients with the previous history of the disease only 4.76% were seropositive (p > 0.05). patients presented with various symptoms [table 5 ] though 81% of patients complained of cough only 3.7% of those patients were seropositive (or = 0.11, p = 0.006). this can be explained by the fact that 75% of the seropositive cases had either extrapulmonary or disseminated tb (dtb) whereas only 25% had the pulmonary variety of the disease. seroprevalence was 12.5% among patients complaining of breathlessness (or = 2.03, p = 0.394). 6.59% of patients complaining of fever were seropositive (or = 0.25, p = 0.152). only 35% of patients complained of significant weight loss but again all the seropositive cases in our study had this complaint and seroprevalence was 22.86% (or = 19.25, p = 0.000). patients with symptoms of seizures, headache, meningeal irritation, and gastrointestinal disturbances did not have any significant association with seroprevalence. among patients who gave a history of contact with a commercial sex worker, there was a high seroprevalence of 70% (or = 207.67, p = 0.000). 26.08% of patients with lymphadenopathy were seropositive (or = 13.24, p = 0.002). oral candidiasis was seen in eight of our patients and 62.5% of them were seropositive (or = 49.44, p = 0.000). clinical findings on respiratory system examination were quite common and seroprevalence was 13.46% (or = 7.31, p = 0.061). seroprevalence was 36.36% among patients with signs on abdominal examination (or = 12.14, p = 0.005). pallor, jaundice, clubbing, edema, skin infections, and neurological signs did not have any statistically significant association with seropositivity. seropositive patients were significantly undernourished when compared to seronegative patients (bmi 18.01 1.91 vs. 20.57 2.66 kg / m, p = 0.009). the hb percentage was significantly lower in seropositive patients (8.64 1.07 g%) than in seronegative patients (9.89 1.73 g%, p = 0.047). total leukocyte count was significantly lower in seropositive patients (5512.50 1241.47 cells / ml) than in seronegative patients (1111.52 2252.18 cells / ml, p = 0.000). 41.17% of all patients with bilateral chest radiograph involvement were seropositive (or = 57.40, p = 0.000) [table 6 ]. 28.57% of patients with bilateral parenchymal infiltration or consolidation were found to be seropositive (or = 5.80, p = 0.096), however, there were none among those with unilateral parenchymal infiltration or consolidation. all the patients with a reticulonodular pattern were seropositive (or = 55.50, p = 0.000). seroprevalence was 25% among those with miliary mottling (or = 4.24, p = 0.287). about 52% of cases in our study were of ptb but only 3.85% were seropositive (or = 0.28, p = 0.149) [table 7 ]. 4.88% of extra - pulmonary tuberculosis (eptb) cases were seropositive (or = 0.44, p = 0.466). among the eptb cases 12.5% of abdominal tuberculosis (or = 4.24, p = 0.287) and 50% of tubercular meningitis (or = 0.63, p > 0.05) cases were seropositive. 37.5% of all the seropositive patients were diagnosed with dtb / milliary tb. among the sputum positive ptb patients seroprevalence was 2.22% (or = 0.16, p = 0.070) and among the sputum negative patients there were no seropositive patients. however among dtb / miliary tb patients seroprevalence was 66.67% (or = 30.33, p = 0.016) and 50% (or = 15.00, p = 0.031) among sputum positive and sputum negative patients, respectively. in tamil nadu, seroprevalence of hiv among tb was reported at 4.7% with the highest seropositivity rate among patients aged 3039 years at 10.6% during 20082009 92% of the cases were found in the age group between 20 and 49. in delhi seroprevalence increased from 0.4% in 19941999 to 8.4% in 20082009. sentinel surveillance done in pune showed that seropositivity has increased from 10% in 1995 to 20.75% in 2010. in thanjavur, seroprevalence was seen to increase from 0.59% in the year 1996 to 8.89% in 2008. seroprevalence in goa was reported to increase from 2.01% in 1995 to 6.9% in 2009. studies have shown that seroprevalence has increased from 2.6% in 19951996 to 11.7% in 20052006 in mumbai. our study suggests male tb patients aged between 21 and 40 years should be targeted as they account for the majority of the cases. on examination, severe anemia, undernourishment, lymphadenopathy, and presence of opportunistic infections like oral candidiasis are quite common. hence, taking all of this into consideration clinicians should maintain a high index of suspicion and is imperative to have a thorough understanding of the interactions between these two diseases. | background and objectivestuberculosis (tb) and the human immunodeficiency virus (hiv) infection have reached epidemic proportions in our country. this study was undertaken to know the seroprevalence of hiv infection among tb patients and to evaluate the various clinical features of tb in seropositive and seronegative patients. this study was undertaken in vijayanagara institute of medical sciences, bellary. it was cross - sectional comparative observational study conducted from december 2010 to may 2012.materials and methodsa total of 100 consecutive patients diagnosed with tb satisfying inclusion criteria were selected for the study. all patients went through a detailed evaluation along with testing for hiv seroprevalence. chi - square and student s t - tests used to find the significance between two groups.resultsthe overall hiv seroprevalence among tb patients was 8%. seroprevalence was highest in the age group between 31 and 40 years at 29.41% (odds ratio [or ] = 11.11, p = 0.003). it was found that seropositive tb patients were more likely to present with significant weight loss (or = 19.25, p= 0.000), and have lymphadenopathy or = 13.24, p = 0.002) and oral candidiasis (or = 49.44, p = 0.000) on examination. bilateral chest radiographic involvement (or = 57.40, p = 0.000) and the disseminated variety of the disease (or = 29.67, p = 0.001) are also more probable.conclusionshuman immunodeficiency virus seroprevalence is quite high among tb patients in bellary. during the evaluation of tb patients, the possibility of hiv co - infection should be kept in mind, and thus adequate knowledge of the likely clinical features is absolutely necessary. |
titanium and its alloys are currently used extensively in the field of dental implants because of its good mechanical properties and excellent biocompatibility. however, the native oxide layer of titanium can not directly bond with bone to promote new bone formation in the early stage of osseointegration. numerous studies have sought to optimize dental and orthopedic implants by modifying the implant surface chemistry and/or surface topography by methods such as blasting, plasma spraying of hydroxyapatite, sandblasting and etching, and anodic oxidation.17 tio2 nanotube arrays can be formed as columnar porous titania layers by anodic oxidation on pure titanium or titanium alloy surfaces, and are of great interest due to their highly ordered nanostructure.812 the results of recent studies suggest that formation of a titanium implant surface with a nanostructure could reinforce osseointegration because the surface area is markedly increased and the surface topography can be nanomodified to resemble native bone tissue.1214 recent studies have demonstrated that the fabrication of ordered tio2 nanotube arrays with controlled empty space diameters can be adjusted by controlling processing factors, such as voltage, current density, and electrolytes.8,15,16 tio2 nanotube surfaces with the optimal length scale for cell adhesion and differentiation can induce the migration of osteoblasts and mesenchymal stem cells, and hence reinforce interactions between implant surfaces and cells.9,10,13,14 recent advances in the fabrication, properties, and applications of tio2 nanotube arrays have provided new opportunities for research in relation to their use in clinical practice. the more recent studies attempted localized drug delivery via tio2 nanotubes.11,17 the empty space of tio2 nanotubes could be used as a drug reservoir. antibiotics, anti - inflammatory drugs, and growth factors can be prescribed to be taken orally, intravenously, or intramuscularly. moreover, systemic delivery of these drugs can produce adverse effects and organ toxicity associated with high concentrations. therefore, local drug therapy has become an accepted type of treatment.11 recombinant human bone morphogenetic protein-2 (rhbmp-2) has been shown to improve osteoblast differentiation and bone formation and remodeling.18,19 several studies showed that application of rhbmp-2 at appropriate doses induced bone formation, whereas higher doses were associated with undesirable effects.19,20 moreover, systemic delivery of rhbmp-2 can have adverse effects such as unwanted ectopic bone formation. therefore, it is believed that rhbmp-2 should be immobilized on the implant surface to allow sufficient time to promote osseointegration.11 in this study, tio2 nanotube arrays were formed on the surface of dental titanium implants by anodic oxidation. tio2 nanotube arrays provided empty spaces for drug loading and demonstrated better biocompatibility than a machined surface. we designed a dental implant with tio2 nanotube arrays as a suitable structure for inserting drugs such as antibiotics, anti - inflammatory agents, and growth factors. to improve bone - implant contact, the effects of tio2 nanotube arrays and rhbmp-2 on bone - implant contact in the dental implants were investigated in vitro and in an in vivo study in rabbits. dental implants with four different surface characteristics were used : a machined surface, a sandblasted large - grit and acid - etched sla) implant (ts iii, osstem implants, seoul, south korea) as a positive control group, tio2 nanotube arrays, and tio2 nanotube arrays with rhbmp-2 loading were called i1 group, i2 group, i3 group, and i4 group, respectively. tio2 nanotube arrays on the surface of the implants were fabricated by anodic oxidation in an electrolyte solution containing ethylene glycol with 0.5 wt% nh4f.21 figure 1 shows a schematic diagram of the anodic oxidation procedure. to obtain a proper microstructure of tio2 nanotube arrays, anodic oxidation voltages and the time provided by a dc power supply two - step anodic oxidation was conducted to obtain the clean surface and open windows of the tio2 nanotube arrays. tio2 nanotube arrays with clean and open windows were then fabricated by the second anodic oxidation. the voltage and duration of the second anodic oxidation were 60 v and 15 minutes, respectively. the thickness and open window size of the tio2 nanotube arrays were determined by field emission scanning electron microscopy (phillips / fei xl 30sfeg, eindhoven, the netherlands) at the korea basic science institute. for the rhbmp-2-loaded tio2 nanotube array implant, rhbmp-2 (cowellmedi co ltd, busan, south korea) was loaded into the inner space of the tio2 nanotube arrays on the surface of the dental implant by a dip - coating process in a vacuum chamber. the concentration of rhbmp-2 was 1.5 mg / ml, ie, the same concentration as that used by lee and wikesjo.20 each implant was immersed three times in rhbmp-2 solution for 5 seconds and dried at a maximum temperature of 20c. the elution of rhbmp-2 was observed by an interferometric biosensing method.22 figure 2 shows a schematic diagram of the interferometric biosensing method using tio2 nanotube arrays. tio2 nanotube arrays fabricated on a flat titanium surface were also used as a sensing porous layer. white light from a tungsten lamp (ocean optics, dunedin, fl, usa) was fed through one end of a bifurcated fiber optic cable and focused through a lens onto the surface of the tio2 nanotube arrays at normal incidence. reflected light was collected through the same optics, and the distal end of the bifurcated fiber optic cable was input to a s-4000 ccd spectrometer (ocean optics).23 optical thickness (nl) was determined from the fabry - perot relationship (m = 2 nl), where m is the fringe order, is the wavelength of maximum constructive interference for a spectral fringe of order m, n is the refractive index of the porous layer, and l is the thickness of the porous layer. this study was approved by the ethical committee on animal research at the institute of gangneung - wonju national university (gwnu-2013 - 3). three new zealand white rabbits (weighing 3,060167 g and aged 1314 weeks at the start of the experiment) were used in the study. the surgical procedures were performed aseptically under intramuscular anesthesia with a combination of 0.7 ml / kg of ketamine (yuhan corporation, seoul, south korea) and 0.2 ml / kg of xylazine (bayer, leverkusen, germany). prior to surgery, the operative sites were shaved and carefully washed with iodine solution and injected with 2% lidocaine containing 1:100,000 epinephrine (huons, seoul, south korea). a skin incision was made along the proximal one third of the tibia using sterile surgical technique. after full - thickness flap reflection, two holes were drilled about 7 mm apart with copious irrigation. two different types of implant were placed at each tibia in random circulating order into the left and right sides of the tibia to ensure unbiased comparisons. after surgery, all rabbits received antibiotic cover, ie, 0.15 ml / kg gentamicin sulfate (dongwha pharm co ltd, seoul, south korea) and analgesia, ie, 0.20 ml / kg sulpyrine (green cross veterinary products co ltd, yongin, south korea) by intramuscular injection. the animals were kept in separate cages and allowed full weight bearing after surgery. for fluorochrome labeling, subcutaneous injections with alizarin red (30 mg / kg ; sigma - aldrich, st louis, mo, usa) and calcein green (10 mg / kg ; sigma - aldrich) were performed 3 and 6 weeks, respectively, after the operation. the rabbits were euthanized in a co2 chamber 8 weeks after inserting the implants, and 1 cm 1 cm bone fragments with dental implants were collected. after euthanasia, the implant areas were scanned using a 1173 micro - computed tomography scanner (skyscan, kontich, belgium). the voltage and current of the x - ray tube were 130 kv and 60 a, respectively, with an exposure time of 500 msec. x - ray projections were obtained at 0.3 degree intervals with a scanning angular rotation of 360 degrees. the samples were fixed by immersion in a 10% neutral - buffered formalin solution (accustain, sigma - aldrich, steinheim, germany) for one day, then dehydrated in a graded series of ethanol solutions and embedded in methylmethacrylate resin (technovit 7200 vlc, kulzer co gmbh, friedrichsdorf, germany). after dehydration, the specimens were polymerized in a light - based polymerization unit (exakt apparatebau, norderstedt, germany). the implants were cut mid - axially in a mediolateral plane into 200 m thick sections using a band saw with a diamond blade (exakt cutting - grinding system, exakt apparatebau). the final section was ground to no thicker than about 20 m using an exakt microgrinder and polished to an optical finish utilizing the cutting - grinding technique described by donath and breuner.24 all the sections were first examined by immunofluorescence microscopy (leica microsystems, wetzlar, germany). images of the specimens were obtained by optical microscopy (bx-50, olympus america, melville, ny, usa). the bone - to - implant contact ratio (%) and bone volume ratio (%) was measured in the cortical bone area using image pro plus analysis software (media cybernetics inc, rockville, md, usa). the bone - to - implant contact ratio was defined as the percentage of bone contact measured along the entire surface length of two implant threads. the bone volume ratio was the percentage of total bone tissue within the area of two threads. dental implants with four different surface characteristics were used : a machined surface, a sandblasted large - grit and acid - etched sla) implant (ts iii, osstem implants, seoul, south korea) as a positive control group, tio2 nanotube arrays, and tio2 nanotube arrays with rhbmp-2 loading were called i1 group, i2 group, i3 group, and i4 group, respectively. tio2 nanotube arrays on the surface of the implants were fabricated by anodic oxidation in an electrolyte solution containing ethylene glycol with 0.5 wt% nh4f.21 figure 1 shows a schematic diagram of the anodic oxidation procedure. to obtain a proper microstructure of tio2 nanotube arrays, anodic oxidation voltages and the time provided by a dc power supply two - step anodic oxidation was conducted to obtain the clean surface and open windows of the tio2 nanotube arrays. tio2 nanotube arrays with clean and open windows were then fabricated by the second anodic oxidation. the voltage and duration of the second anodic oxidation were 60 v and 15 minutes, respectively. the thickness and open window size of the tio2 nanotube arrays were determined by field emission scanning electron microscopy (phillips / fei xl 30sfeg, eindhoven, the netherlands) at the korea basic science institute. for the rhbmp-2-loaded tio2 nanotube array implant, rhbmp-2 (cowellmedi co ltd, busan, south korea) was loaded into the inner space of the tio2 nanotube arrays on the surface of the dental implant by a dip - coating process in a vacuum chamber. the concentration of rhbmp-2 was 1.5 mg / ml, ie, the same concentration as that used by lee and wikesjo.20 each implant was immersed three times in rhbmp-2 solution for 5 seconds and dried at a maximum temperature of 20c. the elution of rhbmp-2 was observed by an interferometric biosensing method.22 figure 2 shows a schematic diagram of the interferometric biosensing method using tio2 nanotube arrays. tio2 nanotube arrays fabricated on a flat titanium surface were also used as a sensing porous layer. white light from a tungsten lamp (ocean optics, dunedin, fl, usa) was fed through one end of a bifurcated fiber optic cable and focused through a lens onto the surface of the tio2 nanotube arrays at normal incidence. reflected light was collected through the same optics, and the distal end of the bifurcated fiber optic cable was input to a s-4000 ccd spectrometer (ocean optics).23 optical thickness (nl) was determined from the fabry - perot relationship (m = 2 nl), where m is the fringe order, is the wavelength of maximum constructive interference for a spectral fringe of order m, n is the refractive index of the porous layer, and l is the thickness of the porous layer. this study was approved by the ethical committee on animal research at the institute of gangneung - wonju national university (gwnu-2013 - 3). three new zealand white rabbits (weighing 3,060167 g and aged 1314 weeks at the start of the experiment) were used in the study. the surgical procedures were performed aseptically under intramuscular anesthesia with a combination of 0.7 ml / kg of ketamine (yuhan corporation, seoul, south korea) and 0.2 ml / kg of xylazine (bayer, leverkusen, germany). prior to surgery, the operative sites were shaved and carefully washed with iodine solution and injected with 2% lidocaine containing 1:100,000 epinephrine (huons, seoul, south korea). a skin incision was made along the proximal one third of the tibia using sterile surgical technique. after full - thickness flap reflection, two holes were drilled about 7 mm apart with copious irrigation. two different types of implant were placed at each tibia in random circulating order into the left and right sides of the tibia to ensure unbiased comparisons. after surgery, all rabbits received antibiotic cover, ie, 0.15 ml / kg gentamicin sulfate (dongwha pharm co ltd, seoul, south korea) and analgesia, ie, 0.20 ml / kg sulpyrine (green cross veterinary products co ltd, yongin, south korea) by intramuscular injection. the animals were kept in separate cages and allowed full weight bearing after surgery. for fluorochrome labeling, subcutaneous injections with alizarin red (30 mg / kg ; sigma - aldrich, st louis, mo, usa) and calcein green (10 mg / kg ; sigma - aldrich) were performed 3 and 6 weeks, respectively, after the operation. the rabbits were euthanized in a co2 chamber 8 weeks after inserting the implants, and 1 cm 1 cm bone fragments with dental implants were collected. after euthanasia, the implant areas were scanned using a 1173 micro - computed tomography scanner (skyscan, kontich, belgium). the voltage and current of the x - ray tube were 130 kv and 60 a, respectively, with an exposure time of 500 msec. x - ray projections were obtained at 0.3 degree intervals with a scanning angular rotation of 360 degrees. the samples were fixed by immersion in a 10% neutral - buffered formalin solution (accustain, sigma - aldrich, steinheim, germany) for one day, then dehydrated in a graded series of ethanol solutions and embedded in methylmethacrylate resin (technovit 7200 vlc, kulzer co gmbh, friedrichsdorf, germany). after dehydration, the specimens were polymerized in a light - based polymerization unit (exakt apparatebau, norderstedt, germany). the implants were cut mid - axially in a mediolateral plane into 200 m thick sections using a band saw with a diamond blade (exakt cutting - grinding system, exakt apparatebau). the final section was ground to no thicker than about 20 m using an exakt microgrinder and polished to an optical finish utilizing the cutting - grinding technique described by donath and breuner.24 all the sections were first examined by immunofluorescence microscopy (leica microsystems, wetzlar, germany). images of the specimens were obtained by optical microscopy (bx-50, olympus america, melville, ny, usa). the bone - to - implant contact ratio (%) and bone volume ratio (%) was measured in the cortical bone area using image pro plus analysis software (media cybernetics inc, rockville, md, usa). the bone - to - implant contact ratio was defined as the percentage of bone contact measured along the entire surface length of two implant threads. the bone volume ratio was the percentage of total bone tissue within the area of two threads. figure 3 shows field emission scanning electron microscopic images of the implants with various surface treatments. it has mainly unidirectional machined grooves from the manufacturing instrument. the smooth surface by machining with a cnc lathe is also shown in figure 3b. the surfaces of the sla implant have very rough surfaces (figure 3c and d). figure 3e and f show the rough surface of tio2 nanotube arrays fabricated by anodic oxidation. however, the tio2 nanotube surface has nanosized holes for loading drugs such as bmp-2, pep7, and ibuprofen. figure 4 shows field emission scanning electron microscopic images of the tio2 nanotube arrays and rhbmp-2-loaded tio2 nanotube arrays on the surface of the implants. the tio2 nanotube arrays were fabricated by two - step anodic oxidation.25 there were traces of the tio2 nanotube arrays by first anodic oxidation on the surface of the newly grown tio2 nanotube arrays. the diameter of the tio2 nanotube window and tio2 nanotube were ~70 nm and ~110 nm, respectively. the windows of the tio2 nanotubes were clean and open, and these structures were appropriate for loading a drug. the thickness of the tio2 nanotube arrays was ~17 m, as shown in the inset in figure 4a. the window of the tio2 nanotube, as shown in figure 4d, was slightly clogged with rhbmp-2 loading. the surface - loaded rhbmp-2 was expected to improve the osseointegration. to observe the elution of rhbmp-2 from the tio2 nanotube arrays on the surface of the dental implant, an interferometric biosensing method with a flow cell was used.22,26 during this process, figure 5 shows the change in optical thickness of the dental implant with rhbmp-2-unloaded tio2 nanotube arrays (i3 group) and rhbmp-2-loaded tio2 nanotube arrays (i4 group) for 10 days. the solution was subsequently introduced by deionized water passed through the dental implant with tio2 nanotube arrays. however, in the i4 group, optical thickness was dramatically increased by elution of rhbmp-2 from the tio2 nanotube arrays and slowly increased for 9 days. a change in optical thickness of ~75 nm confirms the elution of rhbmp-2 from tio2 nanotube arrays. this study was designed to evaluate the possibility of using tio2 nanotube arrays as a drug reservoir, and rhbmp-2 was selected as a drug that might improve the induction of new bone formation and osseointegration around an implant surface. dental implants were classified into four groups : machined surface implants, sla surface implants, tio2 nanotube array surface implants, and tio2 nanotube array surface implant with rhbmp-2 (groups i1, i2, i3, and i4, respectively). clinical healing was uneventful, with no cases of implant exposure or loss in any of the rabbits. after 8 weeks, all the implants were histologically in direct contact with the surrounding bones along the threads. the highest mean bone - to - implant contact ratio was found in the i4 group (29.5%), followed by the i3 group, i2 group, and i1 group (16.3%, 14.7%, and 11.1%, respectively). the bone volume ratios were measured around the implant threads. the highest bone volume ratio (77.3%) was also found in the i4 group, with values of 67.2%, 53.7%, and 66.9% in the i3 group, i2 group, and i1 group, respectively. these results suggest that the tio2 nanotube array surface had more of an osseointegration effect than the machined surface or the sla surface implant, and that rhbmp-2 loaded into tio2 nanotube arrays had the biochemical effect of bone induction. our findings concerning the effect of tio2 nanotube arrays are similar to those of previous studies reporting an enhanced bone formation and cell adhesion effect with the tio2 nanotube array implant.9,12,14 bjursten reported that tio2 nanotubes significantly improved bone bonding strength, bone - implant contact, and new bone formation when compared with titanium grit - blasted surfaces. because tio2 nanotubes have a good oxide microstructure for growing new bone, tio2 nanotube arrays are able to influence protein interactions and components of bone for rapid and permanent bone bonding. a number of previous studies have reported the osteoinduction effect of the rhbmp-2-coated implant.1820,27 however, conventional rhbmp-2 coating methods can not provide a long - lasting osteoinduction effect by rhbmp-2. as suggested by alkan tio2 nanotube arrays enhance water wettability, and can therefore act as a drug reservoir. recently, a tio2 nanotube implant combined with rhbmp-2 was reported to improve bone formation.29 in this study, the i4 group in which rhbmp-2 was loaded into tio2 nanotube arrays showed the greatest bone - to - implant contact ratio and bone volume ratio 8 weeks after implantation. this can be taken as evidence of the long - lasting effect of rhbmp-2, because bone remodeling, bone formation, and bone reduction occurs very slowly. the slow elution of rhbmp-2 as shown in figure 5 indicates that rhbmp-2 has a long - lasting effect. vertical bone ingrowth in i4 group was increased, and the i3 and i4 groups showed more bone deposition around the implant threads than the i1 and i2 groups. figure 8 shows the fluorescence and histologic staining images for the four groups as observed by optical microscopy. the fluorescence and histologic staining images in figure 8a d are shown on the right and left sides, respectively. the red and green areas represent new bone formation at 3 weeks and 6 weeks after implant installation, respectively. bone formation and bone remodeling, as indicated by white arrows, were mainly observed near the periosteum in the i1, i2, and i3 groups. however, the bone formation and remodeling in the i4 group were observed not only near the periosteum but also all around the implant threads. the bone formation and bone remodeling in the i1, i2, and i3 groups can be explained by an osteoblast - rich periosteum. in the i4 group, the active bone formation and bone remodeling at the implant thread site are due to the osteogenic effect of rhbmp-2 eluted from the tio2 nanotube arrays. fluorochrome labeling near the periosteum indicates bone formation, whereas fluorochrome labeling around the implant thread is thought to indicate bone remodeling and improving osseointegration. the results suggest that tio2 nanotube arrays with rhbmp-2 can enhance bone formation and bone remodeling around an implant, and thus reinforce osseointegration on the surface of dental implants. the aim of the present study was to fabricate thicker tio2 nanotubes on the surface of dental implants for slower release of rhbmp-2 than that in a previous report.29 slower release of rhbmp-2 from the nanotubes was observed in our in vitro study, and a higher bone - to - implant contact ratio was observed in the i4 group in our in vivo study. however, a weak point in our study was the small number of samples which precluded a statistical analysis. further, the mechanical analysis like a removal torque and its evaluation on the different time points which could not be not performed due to same reason. a further study with a larger number of samples and various evaluation methods is necessary to clarify the effects of tio2 nanotube arrays on the surface of dental implants with rhbmp-2. figure 3 shows field emission scanning electron microscopic images of the implants with various surface treatments. it has mainly unidirectional machined grooves from the manufacturing instrument. the smooth surface by machining with a cnc lathe is also shown in figure 3b. the surfaces of the sla implant have very rough surfaces (figure 3c and d). figure 3e and f show the rough surface of tio2 nanotube arrays fabricated by anodic oxidation. however, the tio2 nanotube surface has nanosized holes for loading drugs such as bmp-2, pep7, and ibuprofen. figure 4 shows field emission scanning electron microscopic images of the tio2 nanotube arrays and rhbmp-2-loaded tio2 nanotube arrays on the surface of the implants. the tio2 nanotube arrays were fabricated by two - step anodic oxidation.25 there were traces of the tio2 nanotube arrays by first anodic oxidation on the surface of the newly grown tio2 nanotube arrays. the diameter of the tio2 nanotube window and tio2 nanotube were ~70 nm and ~110 nm, respectively. the windows of the tio2 nanotubes were clean and open, and these structures were appropriate for loading a drug. the thickness of the tio2 nanotube arrays was ~17 m, as shown in the inset in figure 4a. the window of the tio2 nanotube, as shown in figure 4d, was slightly clogged with rhbmp-2 loading. the surface - loaded rhbmp-2 was expected to improve the osseointegration. to observe the elution of rhbmp-2 from the tio2 nanotube arrays on the surface of the dental implant, an interferometric biosensing method with a flow cell was used.22,26 during this process, figure 5 shows the change in optical thickness of the dental implant with rhbmp-2-unloaded tio2 nanotube arrays (i3 group) and rhbmp-2-loaded tio2 nanotube arrays (i4 group) for 10 days. the solution was subsequently introduced by deionized water passed through the dental implant with tio2 nanotube arrays. however, in the i4 group, optical thickness was dramatically increased by elution of rhbmp-2 from the tio2 nanotube arrays and slowly increased for 9 days. a change in optical thickness of ~75 nm confirms the elution of rhbmp-2 from tio2 nanotube arrays. this study was designed to evaluate the possibility of using tio2 nanotube arrays as a drug reservoir, and rhbmp-2 was selected as a drug that might improve the induction of new bone formation and osseointegration around an implant surface. dental implants were classified into four groups : machined surface implants, sla surface implants, tio2 nanotube array surface implants, and tio2 nanotube array surface implant with rhbmp-2 (groups i1, i2, i3, and i4, respectively). clinical healing was uneventful, with no cases of implant exposure or loss in any of the rabbits. after 8 weeks, all the implants were histologically in direct contact with the surrounding bones along the threads. the highest mean bone - to - implant contact ratio was found in the i4 group (29.5%), followed by the i3 group, i2 group, and i1 group (16.3%, 14.7%, and 11.1%, respectively). the bone volume ratios were measured around the implant threads. the highest bone volume ratio (77.3%) was also found in the i4 group, with values of 67.2%, 53.7%, and 66.9% in the i3 group, i2 group, and i1 group, respectively. these results suggest that the tio2 nanotube array surface had more of an osseointegration effect than the machined surface or the sla surface implant, and that rhbmp-2 loaded into tio2 nanotube arrays had the biochemical effect of bone induction. our findings concerning the effect of tio2 nanotube arrays are similar to those of previous studies reporting an enhanced bone formation and cell adhesion effect with the tio2 nanotube array implant.9,12,14 bjursten reported that tio2 nanotubes significantly improved bone bonding strength, bone - implant contact, and new bone formation when compared with titanium grit - blasted surfaces. because tio2 nanotubes have a good oxide microstructure for growing new bone, tio2 nanotube arrays are able to influence protein interactions and components of bone for rapid and permanent bone bonding. a number of previous studies have reported the osteoinduction effect of the rhbmp-2-coated implant.1820,27 however, conventional rhbmp-2 coating methods can not provide a long - lasting osteoinduction effect by rhbmp-2. as suggested by alkan tio2 nanotube arrays enhance water wettability, and can therefore act as a drug reservoir. recently, a tio2 nanotube implant combined with rhbmp-2 was reported to improve bone formation.29 in this study, the i4 group in which rhbmp-2 was loaded into tio2 nanotube arrays showed the greatest bone - to - implant contact ratio and bone volume ratio 8 weeks after implantation. this can be taken as evidence of the long - lasting effect of rhbmp-2, because bone remodeling, bone formation, and bone reduction occurs very slowly. the slow elution of rhbmp-2 as shown in figure 5 indicates that rhbmp-2 has a long - lasting effect. vertical bone ingrowth in i4 group was increased, and the i3 and i4 groups showed more bone deposition around the implant threads than the i1 and i2 groups. figure 8 shows the fluorescence and histologic staining images for the four groups as observed by optical microscopy. the fluorescence and histologic staining images in figure 8a d are shown on the right and left sides, respectively. the red and green areas represent new bone formation at 3 weeks and 6 weeks after implant installation, respectively. bone formation and bone remodeling, as indicated by white arrows, were mainly observed near the periosteum in the i1, i2, and i3 groups. however, the bone formation and remodeling in the i4 group were observed not only near the periosteum but also all around the implant threads. the bone formation and bone remodeling in the i1, i2, and i3 groups can be explained by an osteoblast - rich periosteum. in the i4 group, the active bone formation and bone remodeling at the implant thread site fluorochrome labeling near the periosteum indicates bone formation, whereas fluorochrome labeling around the implant thread is thought to indicate bone remodeling and improving osseointegration. the results suggest that tio2 nanotube arrays with rhbmp-2 can enhance bone formation and bone remodeling around an implant, and thus reinforce osseointegration on the surface of dental implants. the aim of the present study was to fabricate thicker tio2 nanotubes on the surface of dental implants for slower release of rhbmp-2 than that in a previous report.29 slower release of rhbmp-2 from the nanotubes was observed in our in vitro study, and a higher bone - to - implant contact ratio was observed in the i4 group in our in vivo study. however, a weak point in our study was the small number of samples which precluded a statistical analysis. further, the mechanical analysis like a removal torque and its evaluation on the different time points which could not be not performed due to same reason. a further study with a larger number of samples and various evaluation methods is necessary to clarify the effects of tio2 nanotube arrays on the surface of dental implants with rhbmp-2. tio2 nanotube arrays on the surface of titanium dental implants were fabricated by anodic oxidation. to load rhbmp-2 into tio2 nanotube arrays, clean and open windows of tio2 nanotubes were obtained by two - step anodic oxidation. elution of rhbmp-2 from the tio2 nanotube arrays was measured by an interferometric biosensing method with a flow cell. implants with a tio2 nanotube array surface containing rhbmp-2 had the highest bone - implant contact and enhanced bone remodeling in the in vivo study. tio2 nanotube arrays on the surface of the implant demonstrated the feasibility of the drug reservoir and were helpful for bone formation and cell adhesion. this structure could be very useful as a drug reservoir for various treatments, such as bone growth factors, anti - inflammatory drugs, and antibacterial agents. | tio2 nanotube arrays on the surface of dental implants were fabricated by two - step anodic oxidation. their effects on bone - implant contact were researched by a pilot in vivo study. the implants were classified into four groups. an implant group with tio2 nanotube arrays and recombinant human bone morphogenetic protein-2 (rhbmp-2) was compared with various surface implants, including machined surface, sandblasted large - grit and acid - etched surface, and tio2 nanotube array surface groups. the diameter of the tio2 nanotube window and tio2 nanotube were ~70 nm and ~110 nm, respectively. the rhbmp-2 was loaded into tio2 nanotube arrays and elution was detected by an interferometric biosensing method. a change in optical thickness of ~75 nm was measured by flow cell testing for 9 days, indicating elution of rhbmp-2 from the tio2 nanotube arrays. for the in vivo study, the four groups of implants were placed into the proximal tibia of new zealand white rabbits. in the implant group with tio2 nanotube arrays and rhbmp-2, the bone - to - implant contact ratio was 29.5% and the bone volume ratio was 77.3%. bone remodeling was observed not only in the periosteum but also in the interface between the bone and implant threads. these values were higher than in the machined surface, sandblasted large - grit and acid - etched surface, and tio2 nanotube array surface groups. our results suggest that tio2 nanotube arrays could potentially be used as a reservoir for rhbmp-2 to reinforce osseointegration on the surface of dental implants. |
with increasing incidence and mortality, lung cancer has become the leading cause of cancer - related death and a challenging clinical problem worldwide. non - small cell lung cancer is a major type of lung cancer accounting for 80% of lung cancer cases. despite the development of early diagnostic modalities and tumor markers, it is often diagnosed at an advanced stage and the 5-year survival rate is less than 20%. despite increasing use of targeted agents including epidermal growth factor receptor (egfr) tyrosine kinase inhibitor and anaplastic lymphoma kinase (alk) inhibitor for treatment of lung cancer, platinum - based combination chemotherapy is still the standard first - line treatment for non - small cell lung cancer (nsclc), particularly for tumors without egfr mutation or alk translocation. the discovery and clinical application of biomarkers is critical not only for early detection of the disease but also for the identification of patients expected to show the best response to therapy. despite numerous studies, there is no biomarker with clinical significance for the prediction of outcomes after platinum - based chemotherapy. the kras mutation, despite its association with poor survival of nsclc patients in several studies, excision repair cross - complementation group 1 (ercc1) has been linked with resistance to platinum - based chemotherapy in nsclc. low ercc1 levels are related to increased recurrence in untreated patients after lung resection and correlated with prolonged survival of nsclc patients treated with platinum - based adjuvant and palliative chemotherapy [10 - 12 ]. however, ercc1-tailored chemotherapy failed to prove its utility in a prospective randomized trial. reactive oxygen species modulator 1 (romo1) is a novel protein first cloned from head and neck cancer tissue in 2006. it is located in the mitochondrial membrane and is a key modulator of intracellular reactive oxygen species. upregulation of romo1 was reported in a variety of cancer cells and romo1-induced reactive oxygen species (ros) production is essential for the proliferation of both normal and cancer cells. interestingly, romo1-derived ros production is related to chemoresistance in lung cancer cells. in a recent study, we demonstrated that romo1 expression is increased in lung tumor tissue compared to normal surrounding tissue. in addition, we found that serum romo1 levels are significantly increased in lung cancer patients as compared to a cancer - free population, and that romo1 overexpression was associated with poor clinical outcome in nsclc patients who underwent surgical resection. however, few studies regarding the clinical implications of romo1 in advanced nsclc have been reported. the aim of this study is to examine the question of whether romo1 protein expression is associated with responses to treatment and survival rates in nsclc patients who received platinum - based chemotherapy. patients with advanced nsclc who received platinum - based doublet as first - line chemotherapy at korea university anam hospital from may 2008 to march 2010 were recruited retrospectively. formalin - fixed paraffin - embedded tumor specimens acquired by percutaneous needle biopsy or endoscopic bronchial biopsy were used for evaluation of romo1 expression. patients who died within 1 month after diagnosis, those with a history of other cancers, and those who had received chemotherapy or radiation therapy were excluded. during the study period, of 123 patients who underwent first - line chemotherapy with platinum - based doublet for nsclc, six cases were excluded because the samples were unsuitable for immunohistochemical staining, five cases were excluded due to unavailable survival data, and three cases were excluded according to the exclusion criteria. all patients underwent chest computed tomography, brain magnetic resonance imaging, and f - fluorodeoxyglucose positron emission tomography for clinical staging determined according to the international association for the study of lung cancer tnm staging classification of nsclc. tumor response was examined by computed tomography every two cycles and evaluated according to the response evaluation criteria in solid tumors (recist) 1.1 as complete response (cr), partial response (pr), stable disease (sd), or progressive disease (pd). the study protocol was approved by the clinical research ethics committee of korea university anam hospital. four - micron - thick sections were prepared for each specimen and the staining was performed using a bond - max immunoautostainer (leica biosystems, newcastle upon tyne, uk). slides were heated at 98c for 20 minutes and cooled for 10 minutes in epitope retrieval solution 1 and 0.01 m citrate buffer (ph 6.0), respectively. slides were then washed in distilled water, followed by blocking of endogenous peroxidase activity using a bond polymer refine detection kit (leica biosystems) for 5 minutes. slides were washed and placed in tris - buffered saline, followed by incubation for 30 minutes with a romo1 monoclonal antibody (origene technologies, rockville, md) at a 1:200 dilution. sections were developed with 3,3-diaminobenzidine chromogen solution for 7 minutes, counterstained with hematoxylin, and dehydrated. human colon adenocarcinoma tissue was used as a positive control, and slides stained without the primary antibody were used as a negative control. histopathological assessment was performed separately by two investigators (s.h.l. and s.i.c.) and stained cells were interpreted as positive when cytoplasmic staining was identified. staining intensities of individual cells were graded as 0 (no staining), 1 (weak), 2 (distinct), or 3 (strong), and the percentages of cells with these staining intensities were calculated. finally, histological scores (h scores) were calculated by multiplying staining intensities by the percentages of cells with each staining intensity (possible range, 0 to 300). the cutoff h score for discriminating between low and high romo1 expression was defined as the point with the lowest p - value on the log - rank test for all possible h scores. clinical outcomes were assessed using response rate (rr), progression - free survival (pfs), and overall survival (os). rr was defined as the percentage of patients with cr and pr among the population. pfs was defined as the time from the first day of chemotherapy to disease progression or death from any cause. os was defined as the time from the first day of chemotherapy to death from any cause. chi - square test or fisher exact test was used as appropriate for analysis of the proportions of low and high h scores in the different patient groups. associations between clinical parameters and survival were first evaluated by univariate analysis using the log - rank test, and multivariate cox s proportional hazard regression was performed with adjustment for parameters with p - values of less than 0.3 in the univariate analysis. statistical analyses were performed using spss ver. 19.0 for windows (spss inc., chicago, il). patients with advanced nsclc who received platinum - based doublet as first - line chemotherapy at korea university anam hospital from may 2008 to march 2010 were recruited retrospectively. formalin - fixed paraffin - embedded tumor specimens acquired by percutaneous needle biopsy or endoscopic bronchial biopsy were used for evaluation of romo1 expression. patients who died within 1 month after diagnosis, those with a history of other cancers, and those who had received chemotherapy or radiation therapy were excluded. during the study period, of 123 patients who underwent first - line chemotherapy with platinum - based doublet for nsclc, six cases were excluded because the samples were unsuitable for immunohistochemical staining, five cases were excluded due to unavailable survival data, and three cases were excluded according to the exclusion criteria. all patients underwent chest computed tomography, brain magnetic resonance imaging, and f - fluorodeoxyglucose positron emission tomography for clinical staging determined according to the international association for the study of lung cancer tnm staging classification of nsclc. tumor response was examined by computed tomography every two cycles and evaluated according to the response evaluation criteria in solid tumors (recist) 1.1 as complete response (cr), partial response (pr), stable disease (sd), or progressive disease (pd). the study protocol was approved by the clinical research ethics committee of korea university anam hospital. four - micron - thick sections were prepared for each specimen and the staining was performed using a bond - max immunoautostainer (leica biosystems, newcastle upon tyne, uk). slides were heated at 98c for 20 minutes and cooled for 10 minutes in epitope retrieval solution 1 and 0.01 m citrate buffer (ph 6.0), respectively. slides were then washed in distilled water, followed by blocking of endogenous peroxidase activity using a bond polymer refine detection kit (leica biosystems) for 5 minutes. slides were washed and placed in tris - buffered saline, followed by incubation for 30 minutes with a romo1 monoclonal antibody (origene technologies, rockville, md) at a 1:200 dilution. sections were developed with 3,3-diaminobenzidine chromogen solution for 7 minutes, counterstained with hematoxylin, and dehydrated. human colon adenocarcinoma tissue was used as a positive control, and slides stained without the primary antibody were used as a negative control. stained cells were interpreted as positive when cytoplasmic staining was identified. staining intensities of individual cells were graded as 0 (no staining), 1 (weak), 2 (distinct), or 3 (strong), and the percentages of cells with these staining intensities were calculated. finally, histological scores (h scores) were calculated by multiplying staining intensities by the percentages of cells with each staining intensity (possible range, 0 to 300). the cutoff h score for discriminating between low and high romo1 expression was defined as the point with the lowest p - value on the log - rank test for all possible h scores. clinical outcomes were assessed using response rate (rr), progression - free survival (pfs), and overall survival (os). rr was defined as the percentage of patients with cr and pr among the population. pfs was defined as the time from the first day of chemotherapy to disease progression or death from any cause. os was defined as the time from the first day of chemotherapy to death from any cause. chi - square test or fisher exact test was used as appropriate for analysis of the proportions of low and high h scores in the different patient groups. associations between clinical parameters and survival were first evaluated by univariate analysis using the log - rank test, and multivariate cox s proportional hazard regression was performed with adjustment for parameters with p - values of less than 0.3 in the univariate analysis. statistical analyses were performed using spss ver. 19.0 for windows (spss inc., chicago, il). all subjects were korean and the median age was 69 years (range, 39 to 81 years). sixty - five patients (74%) were male, and 57 patients (65%) were over 65 years of age. fifty - nine patients (67%) had an eastern cooperative oncology group (ecog) performance status of 0 or 1, and 25 patients (28%) were stage iiib and 63 patients (72%) were stage iv. twenty - five patients (28%) had well - differentiated cancer and 63 patients (72%) had moderately - to poorly - differentiated cancer. fifty patients (57%) had adenocarcinoma and 38 patients (43%) had squamous cell carcinoma. egfr mutation analysis was performed in only 16 adenocarcinoma patients ; six patients (37%) were positive for the activating mutation while 10 patients (63%) were negative. the chemotherapy regimens used for first - line treatment were pemetrexed / platinum (n=30, 34%), gemcitabine / platinum (n=36, 40%), paclitaxel / platinum (n=14, 16%), and docetaxel / platinum (n=8, 9%). the median number of cycles of first - line chemotherapy was 4 (range, 1 to 9). of the 88 patients, 48 patients (54.0%) underwent second - line or later treatment during the follow - up period. second - line treatment regimens were gemcitabine / vinorelbine (n=11, 23%), pemetrexed (n=14, 29%), docetaxel (n=4, 8%), erlotinib (n=10, 21%), and gefitinib (n=9, 20%). twenty - one patients underwent third - line treatment with gemcitabine / vinorelbine (n=8, 38%), pemetrexed (n=3, 14%), docetaxel (n=2, 9%), or gefitinib (n=8, 38%). the romo1 h scores were normally distributed with a median of 180.7 (range, 17 to 295). the optimal cutoff h score determined for discriminating between low and high romo1 expression was 200. using this cutoff, 53 patients (60%) were allocated to the low romo1 group and 35 patients (40%) to the high romo1 group. to determine which clinical parameters are associated with the level of romo1 expression, we compared the proportion of low and high romo1 expression in the different patient groups. there was no difference in the proportion of patients with low and high romo1 expression in all patients groups (table 1). this result indicates that none of the clinical parameters including age, sex, smoking status, performance status, stage, tumor differentiation, or histological type were associated with romo1 expression. forty - one patients (46%) showed pr, 11 patients (12%) showed sd, and 36 patients (42%) showed pd.. in patients with low romo1 expression, 29 patients (55%) showed pr while 12 patients (36%) in the high romo1 group had pr. significantly higher rr was observed in the low romo1 group compared with that in the high romo1 group (p=0.017). clinical parameters including female sex, young age, never smoker, well - differentiated cancer, and better performance status showed a trend toward a good response to treatment but were not statistically significant. results of survival analyses according to the clinical parameters are summarized in table 2. the median pfs for the whole population was 6.7 months (95% confidence interval [ci ], 2.2 to 10.8). in the univariate analysis, poor performance, advanced t stage, advanced stage, and squamous histology showed association with poor pfs, and high romo1 expression showed association with poor pfs (4.5 months vs. 9.8 months, p < 0.001). in the multivariate analysis, advanced stage (hazard ratio [hr ], 1.78 ; 95% ci, 1.07 to 2.96) and high romo1 expression (hr, 2.75 ; 95% ci, 1.71 to 4.44) showed significant association with poor pfs. kaplan - meier survival curves showed that poor survival was likely in terms of pfs for patients with high romo1 expression (fig. the median os for all study subjects was 12.5 months (95% ci, 9.8 to 15.5). in univariate analysis, poor performance status and advanced stage showed significant association with poor os, and high romo1 expression also showed significant association with poor os (15.5 months vs. 8.4 months, p < 0.001). in multivariate analysis, male gender (hr, 2.58 ; 95% ci, 1.49 to 4.46), poor performance status (hr, 2.42 ; 95% ci, 1.47 to 3.99), advanced stage (hr, 1.84 ; 95% ci, 1.09 to 3.10), and high romo1 expression (hr, 3.99 ; 95% ci, 2.36 to 6.74) showed significant association with poor os. kaplan - meier survival curves showed that poor survival in terms of os was likely in patients with high romo1 expression (fig. the median pfs of patients with adenocarcinoma was 8.8 months (95% ci, 4.6 to 12.5). in univariate analysis patients with adenocarcinoma, male gender, smoking history, advanced stage, and high romo1 expression showed significant association with poor pfs and in multivariate analysis, high romo1 expression showed association with poor pfs (hr, 2.43 ; 95% ci, 1.42 to 3.67). in terms of os, in univariate analysis, old age, smoking history, poor performance, advanced stage, and high romo1 expression showed significant association with poor os. in multivariate analysis, poor performance (hr, 2.91 ; 95% ci, 1.46 to 5.79), advanced stage (hr, 1.87 ; 95% ci, 1.16 to 3.81), and high romo1 expression (hr, 2.08 ; 95% ci, 1.03 to 4.21) showed significant association with shorter os. in patients with squamous cell carcinoma, in univariate analysis high romo1 expression showed association with poor pfs, and in the multivariate analysis, high romo1 expression showed significant association with poor pfs (hr, 4.41 ; 95% ci, 2.94 to 8.69). in terms of os, in univariate analysis advanced stage and high romo1 expression showed association with poor os, and in the multivariate analysis, advanced stage (hr, 1.15 ; 95% ci, 1.07 to 2.38) and high romo1 expression (hr, 3.30 ; 95% ci, 2.65 to 9.10) showed significant association with poor os. the kaplan - meier survival curves showed that poor survival in terms of pfs and os in both cell types was likely for patients with high romo1 expression. all subjects were korean and the median age was 69 years (range, 39 to 81 years). sixty - five patients (74%) were male, and 57 patients (65%) were over 65 years of age. fifty - nine patients (67%) had an eastern cooperative oncology group (ecog) performance status of 0 or 1, and 25 patients (28%) were stage iiib and 63 patients (72%) were stage iv. twenty - five patients (28%) had well - differentiated cancer and 63 patients (72%) had moderately - to poorly - differentiated cancer. fifty patients (57%) had adenocarcinoma and 38 patients (43%) had squamous cell carcinoma. egfr mutation analysis was performed in only 16 adenocarcinoma patients ; six patients (37%) were positive for the activating mutation while 10 patients (63%) were negative. the chemotherapy regimens used for first - line treatment were pemetrexed / platinum (n=30, 34%), gemcitabine / platinum (n=36, 40%), paclitaxel / platinum (n=14, 16%), and docetaxel / platinum (n=8, 9%). the median number of cycles of first - line chemotherapy was 4 (range, 1 to 9). of the 88 patients, 48 patients (54.0%) underwent second - line or later treatment during the follow - up period. second - line treatment regimens were gemcitabine / vinorelbine (n=11, 23%), pemetrexed (n=14, 29%), docetaxel (n=4, 8%), erlotinib (n=10, 21%), and gefitinib (n=9, 20%). twenty - one patients underwent third - line treatment with gemcitabine / vinorelbine (n=8, 38%), pemetrexed (n=3, 14%), docetaxel (n=2, 9%), or gefitinib (n=8, 38%). the romo1 h scores were normally distributed with a median of 180.7 (range, 17 to 295). the optimal cutoff h score determined for discriminating between low and high romo1 expression was 200. using this cutoff, 53 patients (60%) were allocated to the low romo1 group and 35 patients (40%) to the high romo1 group. to determine which clinical parameters are associated with the level of romo1 expression, we compared the proportion of low and high romo1 expression in the different patient groups. there was no difference in the proportion of patients with low and high romo1 expression in all patients groups (table 1). this result indicates that none of the clinical parameters including age, sex, smoking status, performance status, stage, tumor differentiation, or histological type were associated with romo1 expression. forty - one patients (46%) showed pr, 11 patients (12%) showed sd, and 36 patients (42%) showed pd. thus, the overall rr was 46%. in patients with low romo1 expression, 29 patients (55%) showed pr while 12 patients (36%) in the high romo1 group had pr. significantly higher rr was observed in the low romo1 group compared with that in the high romo1 group (p=0.017). clinical parameters including female sex, young age, never smoker, well - differentiated cancer, and better performance status showed a trend toward a good response to treatment but were not statistically significant. the median pfs for the whole population was 6.7 months (95% confidence interval [ci ], 2.2 to 10.8). in the univariate analysis, poor performance, advanced t stage, advanced stage, and squamous histology showed association with poor pfs, and high romo1 expression showed association with poor pfs (4.5 months vs. 9.8 months, p < 0.001). in the multivariate analysis, advanced stage (hazard ratio [hr ], 1.78 ; 95% ci, 1.07 to 2.96) and high romo1 expression (hr, 2.75 ; 95% ci kaplan - meier survival curves showed that poor survival was likely in terms of pfs for patients with high romo1 expression (fig. the median os for all study subjects was 12.5 months (95% ci, 9.8 to 15.5). in univariate analysis, poor performance status and advanced stage showed significant association with poor os, and high romo1 expression also showed significant association with poor os (15.5 months vs. 8.4 months, p < 0.001). in multivariate analysis, male gender (hr, 2.58 ; 95% ci, 1.49 to 4.46), poor performance status (hr, 2.42 ; 95% ci, 1.47 to 3.99), advanced stage (hr, 1.84 ; 95% ci, 1.09 to 3.10), and high romo1 expression (hr, 3.99 ; 95% ci, 2.36 to 6.74) showed significant association with poor os. kaplan - meier survival curves showed that poor survival in terms of os was likely in patients with high romo1 expression (fig. the median pfs of patients with adenocarcinoma was 8.8 months (95% ci, 4.6 to 12.5). in univariate analysis patients with adenocarcinoma, male gender, smoking history, advanced stage, and high romo1 expression showed significant association with poor pfs and in multivariate analysis, high romo1 expression showed association with poor pfs (hr, 2.43 ; 95% ci, 1.42 to 3.67). in terms of os, in univariate analysis, old age, smoking history, poor performance, advanced stage, and high romo1 expression showed significant association with poor os. in multivariate analysis, poor performance (hr, 2.91 ; 95% ci, 1.46 to 5.79), advanced stage (hr, 1.87 ; 95% ci, 1.16 to 3.81), and high romo1 expression (hr, 2.08 ; 95% ci, 1.03 to 4.21) showed significant association with shorter os. in patients with squamous cell carcinoma, in univariate analysis high romo1 expression showed association with poor pfs, and in the multivariate analysis, high romo1 expression showed significant association with poor pfs (hr, 4.41 ; 95% ci, 2.94 to 8.69). in terms of os, in univariate analysis advanced stage and high romo1 expression showed association with poor os, and in the multivariate analysis, advanced stage (hr, 1.15 ; 95% ci, 1.07 to 2.38) and high romo1 expression (hr, 3.30 ; 95% ci, 2.65 to 9.10) showed significant association with poor os. the kaplan - meier survival curves showed that poor survival in terms of pfs and os in both cell types was likely for patients with high romo1 expression. in the current study, romo1 overexpression was significantly associated with poor pfs and os in advanced nsclc patients who received platinum - based chemotherapy as first line treatment. to the best of our knowledge, this is the first study demonstrating the relation of romo1 expression to clinical outcome as well as its potential as a predictive marker in advanced nsclc. although romo1 was discovered a decade ago, the clinical significance of this protein is not well known. several in vitro studies have suggested possible involvement of romo1 in many steps in carcinogenesis, including tumor progression and invasion. based on our previous findings the current study demonstrates the potential of romo1 in prediction of clinical outcomes not only in early stage lung cancer but also in advanced disease. in addition, the consistently positive findings of romo1 in lung cancers may provide a foundation for future studies examining the clinical usefulness of this protein in other malignancies. although the exact mechanism by which romo1 overexpression is related to poor response and shorter survival of patients who received platinum - based treatment is unclear, adaptation to oxidative stress could be a possible explanation. adaption involves regulation of the redox buffering system and upregulation of antioxidant enzymes required for survival of cancer cells from external stimulation or therapeutic drugs. the anticancer activity of platinum is mainly the result of crosslinking with dna and inhibition of dna synthesis ; however, induction and accumulation of ros is another important mechanism involved in its activity. romo1 is a key mediator that maintains intracellular ros production and is essential for survival in both normal and cancer cells. thus, we can hypothesize that romo1-induced ros production enhances expression of various antioxidants, resulting in chemoresistance to platinumrelated oxidative stress. although further in vitro studies are required to confirm our hypothesis, it is supported by a previous finding that romo1 is responsible for upregulation of antioxidant enzymes and the adaptive response to 5-fluorouracil treatment in lung cancer cells. in the current study, we found no difference in expression levels of romo1between adenocarcinoma and squamous cell carcinoma, and the association between romo1 expression and clinical outcome was similar regardless of tumor histology. this result is consistent with those of previous studies reporting romo1 overexpression in nsclc patients with both cell types. based on these findings, romo1 overexpression can be considered as a common phenomenon and romo1 has potential as a novel biomarker applicable to both cell types. however, considering the relatively closer relationship with cigarette smoking and the less frequent association of driving mutations in squamous cell carcinoma than in adenocarcinoma, further experiments are required to elucidate possible differences in the clinical implications of romo1 between different cell types. first, this study was conducted retrospectively at a single institution and included a relatively small sample size. second, immunohistochemical staining was performed for the quantification of romo1 protein expression, which may be less sensitive than other methods. however, a standard quantification method for romo1 expression has not been established and immunohistochemistry is a widely used method for measurement of protein expression. third, egfr mutation data were available in only a small proportion of the subjects ; therefore, analysis of the relationship between egfr status and romo1 expression was not possible. most of our study subjects were enrolled before the ipass trial ; since that trial egfr mutation analysis has become an essential test for newly - diagnosed nsclc patients. in summary, romo1 showed potential as an adverse predictive marker in nsclc patients treated with platinum - based chemotherapy. further large - scale investigations are required to determine the clinical implications of romo1 in different clinical settings involving patients treated with targeted agents and using different quantification methods. | purposereactive oxygen species modulator 1 (romo1) is a key mediator of intracellular reactive oxygen species production. however, examination of the clinical usefulness of romo1 in cancers has been limited. we evaluated the association of romo1 expression with clinical outcomes in advanced non - small cell lung cancer (nsclc) patients treated with platinum - based chemotherapy.materials and methodsromo1 expression in tumor tissue was examined by immunohistochemistry and evaluated by histological score. survival analyses were performed according to romo1 expression and the association between romo1 expression and clinical parameters was evaluated.resultsa total of 88 tumor specimens were analyzed. significantly shorter median progression - free survival (pfs) was observed in the high romo1 group compared with the low romo1 group (4.5 months vs. 9.8 months, p < 0.001), and the median overall survival (os) of the high romo1 group was also significantly shorter than that of the low romo1 group (8.4 months vs. 15.5 months, p < 0.001). results of multivariate analyses showed significant association of high romo1 expression with both poor pfs (hazard ratio [hr ], 2.75 ; 95% confidence interval [ci ], 1.71 to 4.44) and poor os (hr, 3.99 ; 95% ci, 2.36 to 6.74). results of the subgroup analysis showed a similar association regardless of tumor histology. romo1 expression showed no association with any clinical parameter including age, sex, smoking status, stage, differentiation, or tumor histology.conclusionromo1 overexpression was associated with poor response to treatment and shorter survival in advanced nsclc patients treated with platinum - based chemotherapy. romo1 could be a potential adverse predictive marker in this setting. |
stroke is the third leading cause of death and a major cause of disability in industrialized countries. ischemic stroke is the most common type of stroke, occurring in approximately 80% of all strokes. a less common type of stroke is hemorrhagic stroke, which occurs due to a subarachnoid hemorrhage and/or an intracerebral hemorrhage. hypertension, cardiovascular disease, arterial fibrillation, diabetes mellitus, obesity, smoking, and alcohol abuse are risk factors for stroke, even if there are slight differences in the influence of these factors between ischemic stroke and hemorrhagic stroke. however, some stroke patients do not have any of these risk factors, suggesting that other risk factors exist. for many years, clinical observations showed that plasma levels of inflammatory cytokines were increased after stroke onset, and immune cells, especially monocytes / macrophages and t - lymphocytes, existed in stroke lesions and related to exaggerate brain damage. in the clinical setting, elevated plasma levels of inflammatory cytokines, c - reactive protein (crp), and chemokines are associated with future cardiovascular risk. plasma levels of soluble intercellular adhesion molecule-1 (sicam-1) and se - selectin were observed to be increased both in large intracranial artery disease and small - artery disease, and plasma levels of icam-1 and monocyte chemoattractant protein-1 (mcp-1) were noted to be high in patients with ischemic stroke and myocardial infarction [5, 6 ]. epidemiological studies have shown that elevated leukocyte count was associated with the risk for first - time myocardial infarction and ischemic stroke [79 ] and the risk of recurrent myocardial infarction and ischemic stroke in a high - risk population. these observations indicate that inflammatory events occur in stroke patients and increase the risk of stroke recurrence. recently, both clinical and animal studies revealed that these inflammatory events occurred prior to stroke onset. plasma levels of soluble vascular cell adhesion molecule-1 (svcam-1), sicam-1, se - selectin, and mcp-1 were elevated in patients with essential hypertension in the absence of other diseases [1113 ]. anti - inflammatory strategies were shown to suppress the incidence of stroke in both human and animal models. we review the recent findings regarding the role of inflammation, especially monocytes / macrophages, in ischemic stroke which is predominant type of strokes. atherosclerosis is one of the major risk factors for stroke, and monocytes / macrophages affect the brain indirectly by inducing unstable plaques and plaque rupture in atherosclerotic lesions. it is well recognized that atherosclerosis is an inflammatory disease and macrophages play important roles in the initiation and the progression of atherosclerotic lesion. in addition to phagocytosis of oxidized low - density lipoproteins, macrophages secrete interleukin-1 (il-1), tumor necrosis factor- (tnf-), and transforming growth factor-1 (tgf-1). these inflammatory cytokines and growth factors induce endothelial dysfunction, smooth muscle cell migration and proliferation, and extracellular matrix production as fibrous plaques. during later disease stages, activated macrophages secrete several classes of neutral extracellular proteases, including serine proteases, cathepsins, and matrix metalloproteinases (mmps). blood monocytes already express low levels of a few mmps ; however, contact with matrix leads to rapid upregulation of a broad spectrum of mmps. cell biology experiments identify mechanisms by which excessive mmp production can cause plaque rupture, either directly by destruction of extracellular matrix or indirectly through actions that promote death of macrophages and vascular smooth muscle cells. microglial cells, the resident macrophages of the brain, and blood - derived monocytes / macrophages have morphologically and functionally similar roles in stroke [21, 22 ]. this activation occurs within minutes of ischemia onset and induces production of inflammatory cytokines, including il-1 and tnf-, which exacerbate tissue damage [2426 ]. following the rapid activation of resident microglial cells, blood - derived immune cells infiltrate into the brain tissue within hours to a few days [21, 22 ]. most current data from mice models and humans show that blood - derived macrophages are recruited into the ischemic brain tissue, most abundantly at days 3 to 7 after stroke [2729 ]. in contrast, resident microglial cells are already activated rapidly on day 1 after focal cerebral ischemia. these reports suggest that the resident microglial cell activation is induced immediately after brain injury and then blood - derived macrophage infiltration follows. on the other hand, it is reported that macrophages exist in the brain before onset of stroke in stroke - prone spontaneously hypertensive rats (shrsp) [30, 31 ]. these findings suggest that the alteration of the blood - brain barrier and macrophage activation occurs before the onset of stroke, and these changes might induce stroke onset. neutrophils and lymphocytes are also observed in stroke lesions. in ischemic stroke mice model, macrophages started to appear already at 12 hours after ischemia. on the other hand, lymphocytes (b- and t - lymphocytes) and neutrophils were significantly increased at 3 days after ischemia. according to this observation, it was reported that macrophages produce inflammatory cytokines and upregulate adhesion molecules in endothelial cells, thereby promoting neutrophil accumulation and migration into the brain. these data suggest that macrophage infiltration occurs prior to other immune cells and macrophage activation attracts other immune cells into stroke lesions. cd4 th1 cells may progress stroke through releasing proinflammatory cytokines, including il-2, il-12, ifn-, and tnf-, whereas cd4 th2 cells may play a protective role through releasing anti - inflammatory cytokines such as il-4, il-5, il-10, and il-13. hypertension is the principal risk factor for stroke and is a leading cause of cognitive decline and dementia. hypertension might induce endothelial cell dysfunction along with macrophage activation and infiltration into the brain. hypertension might induce endothelial cell dysfunction, vascular inflammation on the vascular lumen, and monocyte adhesion. it was reported that hypertension promoted or aggravated endothelial dysfunction, which induced the expression of icam-1, p - selectin, and monocyte adhesion in a rat model. high intraluminal pressure activated nfb in an organ culture model of mouse carotid arteries. in humans, the association of chronically or acutely elevated blood pressure with markers of inflammation has also been documented. circulating levels of sicam-1, svcam-1, se - selectin, and mcp-1 are increased in patients with essential hypertension [13, 42 ]. increasing levels of adhesion molecules and chemoattractant molecules could induce monocyte adhesion on the vascular surface and migration into subendothelial lesions in both aortae and the brain. hypertension might affect blood monocytes directly. the total number of blood monocytes and activated monocytes is greater in spontaneously hypertensive rats compared with wistar kyoto rats, which represent the normotensive control [43, 44 ]. on the other hand, reducing blood pressure with angiotensin converting enzyme inhibitors suppresses endothelial dysfunction and the number of subendothelial macrophages in the aorta. in humans, circulating monocytes from patients with essential hypertension are preactivated compared with those in normotensive healthy individuals. il-1 secretion of peripheral blood monocytes stimulated by angiotensin ii was shown to be significantly higher in patients with essential hypertension compared with normotensive healthy individuals. inflammatory cells accumulate in perivascular regions in the kidney, and in and around glomeruli in hypertensive rats [47, 48 ] and hypertensive subjects. there is extensive perivascular infiltration of leukocytes in the kidney of double transgenic rats harboring human renin and angiotensinogen genes. in a study that emphasized the role of inflammation in blood pressure elevation, pyrrolidine dithiocarbamate, an inhibitor of nfb, prevented monocyte / macrophage infiltration in animals, reduced expression of icam-1 and inducible nitric oxide synthase, and reduced blood pressure. there is also evidence of macrophage infiltration in the glomeruli of hypertensive animals and humans. monocytes / macrophages in the kidney modulate blood pressure via the production of inflammatory cytokines and modulation of renin - angiotensin - aldosterone system [51, 52 ]. on the other hand, drugs acting on the renin - angiotensin - aldosterone system prevent or modulate inflammation. monocytes / macrophages might play some important roles in the reciprocal influence between inflammation and hypertension. shrsps are unique genetic model that mimic both microvessel and parenchymal changes in spontaneous stroke [54, 55 ]. the microvascular changes and brain parenchymal damage may not simply be the result of hypertension, and endothelial cell dysfunction and inflammation may play a role in brain damage. this animal model has been used to examine the contributions of inflammation (macrophages) to stroke. in shrsp, fed a high - salt diet, rosuvastatin treatment significantly delayed the onset of stroke and attenuated the transcription of inflammatory biomarkers (mcp-1, tgf-1, il-1, and tnf-). pioglitazone, peroxisome proliferator - activated receptor- agonist, reduced the risk of recurrent stroke in patients with type 2 diabetes. in shrsp, pioglitazone delayed the onset of stroke by improving vascular endothelial dysfunction, inhibiting brain inflammation, and reducing oxidative stress. a low dose of acetylsalicylic acid (aspirin) delayed the onset of stroke in shrsp by suppressing inflammation. in addition to drug treatments, dietary restriction has been shown to delay the onset of stroke in shrsp via suppression of systemic and local inflammation including macrophage infiltration into the brain. permanent or transient middle cerebral artery occlusion is an established method for inducing focal ischemic stroke in mice or rats. middle cerebral artery occlusion produces highly reproducible lesions, and macrophages primarily infiltrate into the core of the ischemic lesion. the focal ischemic stroke model is a closer approximation to human stroke and produces a heterogeneous pathology that includes a necrotic core and salvageable penumbra. however, small differences in surgical technique may account for different effects on the infarct [63, 64 ]. furthermore, due to variances in cerebral vascular anatomy, different mouse strains show a different outcome [65, 66 ]. in addition, conditions of animals during surgery, such as blood pressure, blood gases, body temperature, and anesthesia influence outcome. thus, standardization and quality control are very important when using this animal model. there are a lot of hypertensive animal models ; however, surgical intervention is needed to induce stroke in these models. excessive salt intake induced frequent thoracic or abdominal cavity hemorrhage in tsukuba hypertensive mice, which are human renin and angiotensinogen transgenic mice. hemorrhaging occurred due to the development of aortic aneurysms and rupture at the aortic arch and aorta near the renal arteries. subsequently, a spontaneous stroke model using human renin and angiotensinogen transgenic hypertensive mice, but not tsukuba hypertensive mice, was reported. in this report, high - salt diet and l - name diet induced hemorrhage in the brain stem, cerebellum, and basal ganglia, which were reasonably similar to those observed in patients with hypertension. it is not clarified whether these mice models show ischemic stroke ; however, these hypertensive mice, especially renin and angiotensinogen transgenic mice, are useful for experimental stroke research. inflammatory cytokines, such as il-1, il-6, and tnf-, are secreted by activated microglial cells and macrophages in stroke lesions and induce the expression of chemokines, which recruit more circulating monocytes / macrophages into lesions and lead to further brain damage. chronic increases in il-1 expression in the brain led to leukocyte infiltration and increased mcp-1 and icam-1 expressions in a mouse model, which is a phenotype also seen in stroke lesions. in addition, a number of studies have demonstrated that inhibiting the release or action of il-1 markedly reduced ischemic cerebral damage in animal models. il-1 and il-1 double knockout mice exhibited dramatically reduced ischemic infarct volume compared with wild - type mice. in a meta - analysis of animal model studies, il-1 receptor antagonist (il-1ra), which represents the most advanced approach to modify il-1 action, reduced infarct volume in models of focal cerebral ischemia. in humans, a phase ii clinical trial of intravenous il-1ra compared with placebo in patients with acute stroke is currently underway. further, il-1ra gene polymorphism represents a risk factor for ischemic stroke [74, 75 ]. a prospective cohort study and systemic review revealed that plasma levels of il-6 were associated with poor outcome after both ischemic and hemorrhagic strokes ; however, it was not clear whether il-6 increased before or after stroke onset. il-6 could not induce adhesion molecules and mcp-1 mrna expressions in cerebrovascular endothelial cells derived from shrsp. mice deficient in il-6 showed similar stroke lesion volume and neurological function as control mice in an acute ischemic injury model. further studies are required to clarify the role of il-6 in stroke. increased serum and cerebrospinal fluid levels of tnf- have been found in patients 24 hours, 1 week, and 2 weeks after stroke, and these increases correlate with infarct volume and severity of neurological impairment. however, previous reports suggest that tnf- has a dual role in brain injury [80, 81 ]. blockade of tnf- actions reduced infarct volume after permanent middle cerebral artery occlusion in balb / c mice with the dimeric type i soluble tnf receptor, which binds to tnf- and antagonizes its action. in contrast, tnf- pretreatment was neuroprotective against permanent middle cerebral artery occlusion in balb / c mice with reduction of infarct size, macrophages, and cd11b - positive neutrophils. in addition to these observations, pentoxifylline, an anti - inflammatory agent, attenuated damage of stroke via the dual role of tnf-. pentoxifylline treatment increased serum levels of tnf-, but not il-1 and il-6, and dose dependently prevented the occurrence of spontaneous brain damage by reducing macrophage infiltration into lesion in shrsp, suggesting a protective role of tnf-. on the other hand, pentoxifylline reduced brain edema in a rat model of transient focal cerebral ischemia through a decline in tnf- production, suggesting an deleterious role of tnf-. although anti - tnf- strategies have proved beneficial in other clinical settings such as inflammatory bowel disease, there are no clinical trials of anti - tnf- agents in stroke. cc chemokine ligand (ccl2) is known as mcp-1 and is a potent mononuclear cell attractant. mcp-1 is synthesized by several cell types, such as monocytes / macrophages, t - lymphocytes, smooth muscle cells, endothelial cells, and even cerebrovascular endothelial cells. serum levels of mcp-1 are high in patients with ischemic stroke and myocardial infarction [5, 6 ], which might be interpreted as a stroke - induced increases in inflammatory events. on the other hand, there is one report that serum ccl2 levels in acute ischemic stroke patients did not differ from that in controls at 1 to 3 days after stroke onset. in this paper, details of controls were not shown, but one of the possibilities is that control subjects were hypertensive. it is reported that plasma levels of mcp-1 were elevated in patients with essential hypertension in the absence of other diseases. the mcp-1-deficient mice model is a unique model to elucidate the role of macrophages in stroke. compared with control mice, infarct volume was smaller in mcp-1-deficient mice 24 hours after middle cerebral artery occlusion, and a reduction of phagocytic macrophage accumulation within infarcts and the infarct border in mcp-1 deficient mice 2 weeks after middle cerebral artery occlusion. obesity is also recognized as the risk factor for stroke, because obesity is associated with hypertension and inflammation via secretion of adipokines, such as adiponectin, leptin, resistin, adipsin, plasminogen activator inhibitor-1, and inflammatory cytokines [8890 ]. it is well known that macrophage infiltration into adipose tissue induces inflammation in adipose tissue and influences these adipokine secretions [91, 92 ]. there are a lot of reports about the association of leptin and adiponectin with stroke, and leptin and adiponectin show differential association patterns with ischemic stroke. it is reported that higher leptin levels and lower adiponectin levels were found in stroke patients. on the other hand, there are controversial reports that adiponectin, but not leptin, levels are recognized as a predictor of the risk for stroke, or that leptin, but not adiponectin, levels are recognized as a predictor of the risk for stroke in men, but not women. it is not clear whether adiponectin and leptin are useful predictors of stroke in obese subjects ; however, adiponectin and leptin might directly influence stroke incidence. leptin increases the mrna and protein levels of il-1, il-6, il-12, tnf-, cyclooxygenase-2, and mcp-1 in macrophages and endothelial cells [97, 98 ]. adiponectin inhibits pro - inflammatory signaling in human macrophages and promotes macrophage polarization toward an anti - inflammatory phenotype. adiponectin also increases il-10, an anti - inflammatory cytokine, as well as mrna expression in human monocyte - derived macrophages. in addition, both adiponectin and leptin receptors are expressed in the brain, suggesting that these adipokines might be directly associated with stroke [102, 103 ]. there are several reports that treatment with drugs that have anti - inflammatory properties can prevent stroke not only in animal models, but also in humans. rosuvastatin treatment significantly delayed the onset of stroke and attenuated the transcription of inflammatory biomarkers. clinical studies using statins already use inflammatory events as endpoints for stroke prevention. in healthy persons without hyperlipidemia but with elevated high - sensitivity crp levels, rosuvastatin, which lowered high - sensitivity crp as well as cholesterol levels, reduced the incidence of stroke and myocardial infarction by 50% relative to placebo. a meta - analysis of statin trials showed that statins might reduce the incidence of all strokes by decreasing ldl - cholesterol without increasing the incidence of hemorrhagic stroke. in addition to cholesterol - dependent effects, cholesterol - independent effects of statins on stroke have also been recognized [106, 107 ]. however, statin treatment increases the risk of hemorrhagic stroke in patients with a history of cerebrovascular disease, even though it also clearly decreased the risk of ischemic stroke. therefore, patients undergoing statin treatment should be carefully monitored to avoid achieving very low level of cholesterols, which are known risk for hemorrhagic stroke. thiazolidinediones, including rosiglitazone and pioglitazone, are peroxisome proliferator - activated receptor- (ppar-) agonists used in the treatment of type 2 diabetes. a systemic review showed that rosiglitazone and pioglitazone were similarly effective in reducing infarct volume and protecting neurologic function in a rodent model of focal or global cerebral ischemia. pioglitazone delayed the onset of stroke by improving vascular endothelial dysfunction and brain inflammation in shrsp. rosiglitazone induced upregulation of cd36 in macrophages and enhanced the ability of microglia to phagocytose red blood cells, which helped to improve hematoma resolution, and improved functional deficits in an intracerebral hemorrhage mouse model. in humans, the prospective pioglitazone clinical trial in macrovascular events (proactive) showed that pioglitazone significantly reduced the risk of recurrent stroke in high - risk patients with type 2 diabetes. on the other hand, one report showed that compared with pioglitazone, rosiglitazone was associated with an increased risk of stroke, heart failure, and all - cause mortality and an increased risk of the composite of acute myocardial infarction, stroke, heart failure, or all - cause mortality in patients of 65 years or older. low - dose acetylsalicylic acid (aspirin) also delayed the onset of stroke in shrsp via suppression of inflammation. aspirin reduced salt - induced macrophage accumulation and mmp-9 activity at the stroke - negative area in the cerebral cortex of shrsp. frequent aspirin use might also confer a protective effect for risk of stroke in humans [114, 115 ]. terutroban, a specific thromboxane / prostaglandin endoperoxide receptor antagonist, decreased cerebral mrna expressions of il-1, transforming growth factor-, and mcp-1 and increased survival in shrsp. the prevention of cerebrovascular and cardiovascular events of ischemic origin with terutroban in patients with a history of ischemic stroke or transient ischemic attack (perform) study was started in february 2006. recently, it was reported that perform study did not meet the predefined criteria for noninferiority, but showed similar rates to terutroban and aspirin for the primary endpoint, such as a composite of fatal or nonfatal ischemic stroke, fatal or nonfatal myocardial infarction, or other vascular death. these reports indicate that antiplatelets agents, which also have anti - inflammatory properties, could suppress inflammation and prevent stroke onset. it is generally believed that the activated microglial cells in ischemic injury are neurotoxic, and results of several recent studies revealed that microglial cells might exert neuroprotective effects in certain conditions [119, 120 ]. in addition to the primary role of macrophages, which is the phagocytosis of cellular and fibrillar debris resulting from stroke, activated microglial cells and macrophages are involved in regulation of the regenerative state and remodeling of the brain by producing brain - derived neurotrophic factor [121, 122 ], insulin growth factor 1 [123, 124 ], several other growth factors, neuroprotective gene ym1, and nitric oxide which are known to regulate synaptic functions. as described previously, some cytokines secreted from microglial cells and macrophages, such as il-6 and tnf-, and attenuate brain damage. in addition to these mediators, intracranial transplantation of monocyte - derived multipotential cells enhances recovery after ischemic stroke. whether activated microglial cells and macrophages act as toxic or neuroprotective factors might depend on the time and severity of stroke lesions. microglial cells and monocytes / macrophages play important roles in the onset and aggravation of stroke via expression of several inflammatory cytokines at the brain, adipose tissue, and kidney (figure 1). however, it is also reported that these inflammatory events are important in the reduction of and recovery from brain damage. however, it is clear that suppression of inflammation is effective in the prevention of primary stroke, and macrophages might be therapeutic targets to prevent stroke. | stroke is an important issue in public health due to its high rates both of morbidity and mortality, and high rate of disability. hypertension, cardiovascular disease, arterial fibrillation, diabetes mellitus, smoking, and alcohol abuse are all risk factors for stroke. clinical observations suggest that inflammation is also a direct risk factor for stroke. patients with stroke have high levels of inflammatory cytokines in plasma, and immune cells, such as macrophages and t - lymphocytes, are noted within stroke lesions. these inflammatory events are considered as a result of stroke. however, recent studies show that plasma levels of inflammatory cytokines or soluble adhesion molecules are high in patients without stroke, and anti - inflammatory therapy is effective at reducing stroke incidence in not only animal models, but in humans as well. statins have been shown to decrease the stroke incidence via anti - inflammatory effects that are both dependent and independent of their cholesterol - lowering effects. these reports suggest that inflammation might directly affect the onset of stroke. microglial cells and blood - derived monocytes / macrophages play important roles in inflammation in both onset and aggravation of stroke lesions. we review the recent findings regarding the role of monocytes / macrophages in stroke. |
an outbreak case was defined as an illness clinically compatible with serogroup c meningococcal disease meeting the 2010 council of state and territorial epidemiologists case definition for a confirmed or probable case (6) with onset during january 2012february 2013 in nyc male residents self - identifying as gay or bisexual or reporting sexual contact with another man during the previous year. meningococcal disease case investigations include interviews with the patient (when possible), health care providers, family members, and close contacts and review of the patient s medical records. controls were selected from nyc male residents given a diagnosis of infection with giardia lamblia (giardiasis) or entamoeba histolytica (amebiasis) during january 2012february 2013, who had not been routinely interviewed by dohmh. three controls were matched to each case - patient for age at disease diagnosis (5 years) and diagnosis date (1 month). controls were ineligible if they were not nyc residents, were non - english speaking, had invasive meningococcal disease during the study, or were non - msm. during march april 2013, case - patients and controls were interviewed by telephone by using a 20-min questionnaire after informed consent was obtained. the questionnaire elicited information regarding demographic features and lifestyle (e.g., alcohol and drug use, smoking, bar and party attendance, and number and ways of meeting sexual contacts). case - patients and controls were asked about exposures during the 30 days before illness onset. questionnaires for deceased or unreachable case - patients were completed on the basis of information obtained during initial investigation. if drug use or sexual contact could not be determined, values for these patients were considered unknown and associated data were excluded from analysis. hiv and sexually transmitted infections (stis) (i.e., chlamydia, gonorrhea, and syphilis) for case - patients and controls were obtained from dohmh registries on june 5, 2013. all epidemiologic data were entered into a microsoft access 2010 database (microsoft, redmond, wa, usa). statistical analyses were conducted by using sas version 9.2 (sas institute, cary, ns, usa). matched odds ratios and 95% cis were calculated by using conditional logistic regression and the mid - p exact method (7). hiv infection, previously reported to be a risk factor for meningococcal disease (8), was controlled for in the analysis. seventeen outbreak cases occurred during 2012 (n = 13) and 2013 (n = 4). among 11 surviving serogroup c meningococcal disease case - patients, 10 were re - interviewed and 1 could not be reached. of 90 possible controls, 51 eligible controls completed interviews. of the remaining 39 possible controls, 6 were unreachable (after > 5 call attempts, including evenings or weekends) ; 11 refused ; 21 were ineligible (12 were non - msm, 6 were non - english speakers, 2 were non - nyc residents, and 1 had a false - positive report) ; and 1 did not complete the interview. most case - patients were brooklyn residents, black, and hiv infected, and most controls were manhattan residents, white, and non hiv infected. case - patients appeared to be of lower socioeconomic status, as indicated by income, education, and health insurance status. matched odds ratios (crude and adjusted) are shown in table 2. after we adjusted for hiv infection, exposures that remained independently associated with serogroup c meningococcal disease were black race, methamphetamine or cocaine use during the month before illness onset, and sti during the year before diagnosis. during the month before illness onset, tobacco smoking, sharing drinks, having sex with > 1 man, or meeting a sex partner online or at a bar or party, although more common among case - patients, were not major risk factors during this outbreak. denominators exclude unknown and refused answers. values in bold indicate mid - p exact p<0.05. one patient answered do n't know, but laboratory testing at hospital indicated methamphetamine use. other ways of meeting included work, school, through a friend, gym, sports group, sex party, or other. diagnosis date refers to the diagnosis date of serogroup c meningococcal disease for case - patients and diagnosis date of amebiasis or giardiasis for controls. we were unable to document vaccine receipt in controls, which limited our ability to examine the effect meningococcal vaccination may have had on the risk for meningococcal infection during this outbreak. although rates of methamphetamine and cocaine use are not known specifically among msm in nyc, during 20082009, a total of 3% of the general nyc population reported past - year cocaine use (9), which was much lower than the 29% reported use among case - patients. through inhalation, these drugs can damage respiratory mucosa and increase susceptibility to meningococcal disease (10). in addition, drug use can be a social activity involving equipment sharing among users, thus increasing respiratory secretion exposure. chlamydia, gonorrhea, or syphilis during the year before diagnosis was also a risk factor during this outbreak, despite controls having been selected on the basis of having a disease (giardiasis or amebiasis) that can be transmitted sexually (11,12). controls might have been overmatched for sexual behavior (i.e., number of sexual partners or high - risk sexual practices) to case - patients. whether the source of exposure during msm sexual contact is through oropharyngeal secretions or represents more research is needed to better understand the apparent overlap of stis and meningococcal disease among msm. this investigation highlights the usefulness for public health practice of collecting and recording information regarding sexual behavior among meningococcal patients, specifically cases among msm. although black race is not a risk factor for meningococcal disease (1), black race appeared to be a risk factor during this outbreak and was also common (75%) among patients during a 20052006 outbreak in brooklyn (13). race might be a proxy for a social network or an unidentified cofactor of this outbreak and not a biological risk factor for meningococcal disease. determining risk factors for infection to target prevention measures during an ongoing outbreak is challenging, and public health authorities often can not wait for results of epidemiologic studies before acting. previously identified risk factors (e.g., smoking, household crowding, or sharing drinks) (14,15) and behaviors used to target our vaccine recommendations (i.e., meeting men for sex at a bar, party, online, or through digital applications) were not associated with this outbreak but were more common among case - patients and might still be associated with meningococcal disease. this case control study, conducted in the context of a prolonged outbreak of serogroup c meningococcal disease among msm in nyc, identified 2 key risk factors : having an sti during the year before diagnosis and having used methamphetamine or cocaine during the month before illness onset. we hypothesize these factors might be associated with membership in a common social network in which carriage of serogroup c meningococci is increased (13). consideration can be given to collecting drug use and sexual identity data through routine meningococcal disease surveillance to recognize transmission clusters and to more fully understand if these risk factors are generalizable. | risk factors for illness during a serogroup c meningococcal disease outbreak among men who have sex with men in new york city, new york, usa, in 20122013 included methamphetamine and cocaine use and sexually transmitted infections. outbreak investigations should consider routinely capturing information regarding drug use and sex - related risk factors. |
a 14-fr foley catheter was accidentally placed into the right ureter in a 38-yr - old woman. a 38-yr - old paraplegic woman was referred to a hospital emergency room due to lower abdominal pain following a urethral catheter change. five years before, she had developed neurogenic bladder as a result of a 10th thoracic spinal cord injury. a catheter change had been performed by the nursing staff, using 14-fr foley catheter without undue events. in order to determine the location of the tube and rule out bladder rupture, there was considerable leakage of contrast media around the midureter, and the foley catheter tip was observed to be located at the right lower ureter (fig. the bladder mucosa was intact and both ureteral orifices were in a typical position and normal shape. two weeks later, antegrade urography showed that the injured ureter had healed without leakage or obstruction (fig. urethral catheterization is commonly performed and is usually safe, although complications, such as infection, bleeding, injury to the urethra or bladder, or catheter malfunction can ensue (1). the two most common complications related to foley catheters, particularly in males, are urethral trauma and retention of the catheter balloon in the urethra (2). serious complications such as bladder perforation and/or peritonitis (3) and rectovesical fistula (4) have been reported. the authors can not explain the cause of the present complication. because the ureteral orifice was orthotopically located, direct insertion of a 14-fr catheter, a large device, into the ureter through the ureteral orifice without pretreatment or mechanical dilatation is completely unexpected. it is unclear whether the right ureteric orifice was patulous at the time of catheterization. urethral catheterization into the ureter is more common when the patient is catheterized on an empty bladder (5). the only way to avoid such injury would be adherence to the basic principles of catheterization, e.g., to confirm the location of the balloon before inflation, by the aspiration of urine. in conclusion, although the current case is an extremely rare example, we should perform urethral catheterization with particular care. | we report an unusual complication caused by urethral catheterization. during a routine urethral catheter change in a 38-yr - old woman, a 14-fr foley catheter was accidentally placed into the right ureter through the ureteral orifice. the position of the catheter was confirmed by retrograde urogram through urethral catheter. percutaneous nephrostomy was performed with subsequent proper replacement of a urethral catheter. two weeks later, the injured ureter had healed without leakage or obstruction. |
thiazolidinediones (tzds) are synthetic ligands for peroxisome proliferator - activated receptor - gamma (ppar-), which is expressed primarily in adipocytes and to a lesser extent in muscles. ppar- activation stimulates fatty acid storage in adipocytes, which decreases the availability of free fatty acids and adipocyte - derived signaling molecules and improves insulin sensitivity in skeletal muscle.1 lobeglitazone (ckd-501 ; chong kun dang pharmaceutical corp, seoul, korea) is a ppar- agonist with substituted pyrimidine derivatives containing tzd.2 lobeglitazone has been shown to have more potent activity than the prototypic tzds (ie, pioglitazone and rosiglitazone) in both in vitro and in vivo studies.2,3 in healthy volunteers, lobeglitazone has a favorable tolerability profile and exhibits linear pharmacokinetics (pk) over the dose range of 0.54.0 mg once daily.4 following oral administration, lobeglitazone is rapidly absorbed with a time to maximum plasma concentration (tmax) of 1.03.0 hours and is eliminated with a mean elimination half - life (t1/2) of 7.89.8 hours.1 on the basis of the favorable balance in the efficacy and safety profile, lobeglitazone was approved for the treatment of diabetes in 2013 by the ministry of food and drug safety, republic of korea.5 the use of warfarin, the mainstay of oral anticoagulant therapy, is often complicated by the narrow therapeutic index and wide interindividual variability. the dosage and administration of warfarin should be individualized for each patient according to the patient s international normalized ratio (inr) response to the drug. furthermore, small changes in its pk may lead to the need for dose adjustment. patients with diabetes are at increased risk of thromboembolic events.6 it has been estimated that higher blood glucose levels contribute to an additional 1.5 million deaths due to ischemic heart disease and 0.7 million deaths due to stroke every year.7 patients with type 2 diabetes mellitus at risk of thromboembolic events are likely to be prescribed anticoagulation therapy, and the vitamin k antagonist warfarin is commonly used for this purpose.8 hence, it is important to determine whether there are drug drug interactions between warfarin and antidiabetic drugs. in vitro studies have indicated that lobeglitazone and its metabolites are unlikely to interfere with the pk of warfarin. however, because of the narrow therapeutic index of warfarin, the current clinical study was conducted to confirm the preclinical results that suggested a lack of clinical drug drug interaction between lobeglitazone and warfarin. we believe that this information is needed because of the safety concerns associated with many tzds9,10 and because case reports have identified interactions with warfarin.11,12 to this end, the present study (clinicaltrials.gov registry number : nct02002611) assessed pk, pharmacodynamics (pd), and safety of warfarin and lobeglitazone when administered alone and concomitantly in healthy subjects. eligible subjects were healthy males aged between 19 years and 55 years who had a body mass index within the range of 1927 kg m. to be included, each subject had to have a clinically acceptable 12-lead electrocardiogram (ecg), vital signs, and physical examination results. key exclusion criteria for the study included the following : 1) a history of hemorrhagic disease or bleeding tendency ; 2) inr or activated partial thromboplastin time outside of the normal range ; 3) within 30 days before screening, use of any medication that could affect the results of the study ; 4) a history of hypersensitivity or allergic reaction to any of the study drugs ; 5) a history of hereditary problems, such as galactose intolerance, lapp lactase deficiency, or glucose galactose malabsorption. this was a single - center, open - label, randomized, two - sequence, two - period crossover study. one period (treatment ab) comprised treatment a, a once - daily oral dose of lobeglitazone (0.5 mg) for 4 days (days 14), and treatment b, a single oral dose of warfarin (25 mg) on day 5 and a single oral dose of lobeglitazone (0.5 mg) for 8 days (days 512). in the other period (treatment c), a single oral dose of warfarin (25 mg) was administered. subjects received one of two dosing schedules : ab, followed by c, or c, followed by ab with a 10-day washout interval. the doses for all treatment periods were administered with 240 ml of water in the morning following an overnight fast. blood samples were obtained for characterization of the pk and pd and were collected at the predose and selected time points. the study (clinical trial registration number : nct02002611) was conducted according to the ethical principles of the declaration of helsinki. the study protocol and any amendments were reviewed by the institutional review board of samsung medical center, seoul, republic of korea. lobeglitazone concentration was analyzed using a validated liquid chromatography procedure (shimadzu uflc ; shimadzu, kyoto, japan) and detected by tandem mass spectroscopy (5500 qtrap ; ab sciex, framingham, ma, usa) in the positive ionization mode. pioglitazone was used as the internal standard, and the lower limit of quantification for lobeglitazone was 0.05 g l. the coefficients of variation (cvs) for between - run and within - run variability were 6.88% and 8.29%, respectively, with mean deviations from the nominal concentration of no more than 4.93%. r- and s - warfarin concentrations were analyzed using a validated liquid chromatography method (shiseido nanospace si-2 ; shiseido, tokyo, japan) and detected by tandem mass spectroscopy (api 4000 ; ab sciex) in the negative ionization mode. the lower limit of quantification for r- and s - warfarin was 2.5 g l. the cvs for between - run variability were 3.14% for s - warfarin and 3.95% for r - warfarin. the between - run accuracy, expressed as mean deviation from the nominal concentration, was no more than 6.04% for s - warfarin and 4.48% for r - warfarin. a noncompartmental approach was used for pk analysis using phoenix winnonlin (version 6.3 ; pharsight, mountain view, ca, usa). the pk parameters determined for lobeglitazone included area under the plasma concentration time curve in one dosing interval at steady state (auc,ss), maximum observed plasma concentration at steady state (cmax, ss), time to reach maximum plasma concentration at steady state (tmax, ss), and t1/2. the pk parameters determined for r- and s - warfarin included area under the curve from time zero to the time of the last quantifiable concentration (auclast), area under the curve from time zero to infinity (aucinf), maximum observed plasma concentration (cmax), tmax, and t1/2. warfarin produces an anticoagulant effect by inhibiting hepatic vitamin k epoxide reductase, which is important for the activation of various coagulation factors including ii, vii, ix, and x. the inr is the most widely used measure to determine the clotting tendency of blood after warfarin administration. hence, the pd of warfarin was assessed by measuring the inr values and factor vii activity. the pd parameters for inr and factor vii activity determined included area under the effect time curve from time 0 to 168 hours (auec0168 h), baseline - corrected auec0168 h, maximum effect (emax) and time to reach maximum effect (temax). safety was assessed by physical examinations, vital signs, clinical laboratory evaluation (hematology, coagulation, blood chemistry, and urinalysis), ecg, and by monitoring of adverse events (aes). aes were monitored throughout the study and were evaluated in terms of seriousness (serious, not serious), duration, intensity (mild, moderate, severe), outcome, and relationship with the study drug. all subjects who took at least one dose of the study drug were included in the safety analysis. statistical analyses were performed using sas version 9.1.3 (sas institute, cary, nc, usa). a mixed - effect model was applied to the log - transformed pk and pd parameters. summary statistics and 90% confidence intervals (cis) of the auec0168 h and emax for inr and factor vii geometric mean ratios (gmrs) (warfarin + lobeglitazone : warfarin alone) were provided for the evaluation of the pd interaction. if the 90% cis of the cmax and auclast of the gmrs (warfarin + lobeglitazone vs warfarin or lobeglitazone alone) were within the range of 0.801.25, the absence of a pk interaction was concluded. eligible subjects were healthy males aged between 19 years and 55 years who had a body mass index within the range of 1927 kg m. to be included, each subject had to have a clinically acceptable 12-lead electrocardiogram (ecg), vital signs, and physical examination results. key exclusion criteria for the study included the following : 1) a history of hemorrhagic disease or bleeding tendency ; 2) inr or activated partial thromboplastin time outside of the normal range ; 3) within 30 days before screening, use of any medication that could affect the results of the study ; 4) a history of hypersensitivity or allergic reaction to any of the study drugs ; 5) a history of hereditary problems, such as galactose intolerance, lapp lactase deficiency, or glucose galactose malabsorption. this was a single - center, open - label, randomized, two - sequence, two - period crossover study. one period (treatment ab) comprised treatment a, a once - daily oral dose of lobeglitazone (0.5 mg) for 4 days (days 14), and treatment b, a single oral dose of warfarin (25 mg) on day 5 and a single oral dose of lobeglitazone (0.5 mg) for 8 days (days 512). in the other period (treatment c), a single oral dose of warfarin (25 mg) was administered. subjects received one of two dosing schedules : ab, followed by c, or c, followed by ab with a 10-day washout interval. the doses for all treatment periods were administered with 240 ml of water in the morning following an overnight fast. blood samples were obtained for characterization of the pk and pd and were collected at the predose and selected time points. the study (clinical trial registration number : nct02002611) was conducted according to the ethical principles of the declaration of helsinki. the study protocol and any amendments were reviewed by the institutional review board of samsung medical center, seoul, republic of korea. lobeglitazone concentration was analyzed using a validated liquid chromatography procedure (shimadzu uflc ; shimadzu, kyoto, japan) and detected by tandem mass spectroscopy (5500 qtrap ; ab sciex, framingham, ma, usa) in the positive ionization mode. pioglitazone was used as the internal standard, and the lower limit of quantification for lobeglitazone was 0.05 g l. the coefficients of variation (cvs) for between - run and within - run variability were 6.88% and 8.29%, respectively, with mean deviations from the nominal concentration of no more than 4.93%. r- and s - warfarin concentrations were analyzed using a validated liquid chromatography method (shiseido nanospace si-2 ; shiseido, tokyo, japan) and detected by tandem mass spectroscopy (api 4000 ; ab sciex) in the negative ionization mode. the lower limit of quantification for r- and s - warfarin was 2.5 g l. the cvs for between - run variability were 3.14% for s - warfarin and 3.95% for r - warfarin. the between - run accuracy, expressed as mean deviation from the nominal concentration, was no more than 6.04% for s - warfarin and 4.48% for r - warfarin. a noncompartmental approach was used for pk analysis using phoenix winnonlin (version 6.3 ; pharsight, mountain view, ca, usa). the pk parameters determined for lobeglitazone included area under the plasma concentration time curve in one dosing interval at steady state (auc,ss), maximum observed plasma concentration at steady state (cmax, ss), time to reach maximum plasma concentration at steady state (tmax, ss), and t1/2. the pk parameters determined for r- and s - warfarin included area under the curve from time zero to the time of the last quantifiable concentration (auclast), area under the curve from time zero to infinity (aucinf), maximum observed plasma concentration (cmax), tmax, and t1/2. warfarin produces an anticoagulant effect by inhibiting hepatic vitamin k epoxide reductase, which is important for the activation of various coagulation factors including ii, vii, ix, and x. the inr is the most widely used measure to determine the clotting tendency of blood after warfarin administration. hence, the pd of warfarin was assessed by measuring the inr values and factor vii activity. the pd parameters for inr and factor vii activity determined included area under the effect time curve from time 0 to 168 hours (auec0168 h), baseline - corrected auec0168 h, maximum effect (emax) and time to reach maximum effect (temax). safety was assessed by physical examinations, vital signs, clinical laboratory evaluation (hematology, coagulation, blood chemistry, and urinalysis), ecg, and by monitoring of adverse events (aes). aes were monitored throughout the study and were evaluated in terms of seriousness (serious, not serious), duration, intensity (mild, moderate, severe), outcome, and relationship with the study drug. all subjects who took at least one dose of the study drug were included in the safety analysis. statistical analyses were performed using sas version 9.1.3 (sas institute, cary, nc, usa). a mixed - effect model was applied to the log - transformed pk and pd parameters. summary statistics and 90% confidence intervals (cis) of the auec0168 h and emax for inr and factor vii geometric mean ratios (gmrs) (warfarin + lobeglitazone : warfarin alone) were provided for the evaluation of the pd interaction. if the 90% cis of the cmax and auclast of the gmrs (warfarin + lobeglitazone vs warfarin or lobeglitazone alone) were within the range of 0.801.25, the absence of a pk interaction was concluded. twenty - four subjects were randomized, and their mean (range) values for age and body mass index were 29.8 (range : 2147) years and 22.5 (range : 19.126.6) kg m, respectively. twenty - three subjects completed the study, and one subject withdrew for personal reasons during period 2. mean plasma concentration time curves for r- and s - warfarin following administration of warfarin alone and when combined with lobeglitazone are shown in figure 1. cmax, tmax, and t1/2 for r- and s - warfarin did not differ significantly between the two treatments (table 1). the 90% cis for the ratios of auclast and cmax of r - warfarin and s - warfarin for the coadministration of warfarin with lobeglitazone vs warfarin alone were within the predetermined no - interaction range (0.801.25). none of the pk parameters for lobeglitazone were affected by the coadministration of lobeglitazone and warfarin (figure 2). the gmrs and 90% cis for the ratios of auc,ss and cmax, ss of lobeglitazone for coadministration of warfarin with lobeglitazone vs lobeglitazone alone were 0.9728 (90% ci : 0.9248, 1.0233) and 1.0247 (90% ci : 0.9671, 1.0856), respectively. time profiles over time when warfarin (25 mg) was administered alone and coadministered with lobeglitazone (0.5 mg) are shown in figure 3. summary statistics for the inr and factor vii activity following the administration of warfarin with and without lobeglitazone are shown in table 2. median inr levels increased to a maximum at 23.93 hours and 24.00 hours after administration of warfarin with and without lobeglitazone. about 168 hours after dosing, these values returned to the baseline under both treatments. administration of warfarin with lobeglitazone did not affect the auec0168 h or emax of inr. the gmrs and 90% cis for auec0168 h and emax for the inr were 1.0091 (90% ci : 0.9872, 1.0314) and 1.0003 (90% ci : 0.9675, 1.0342), respectively. mean (standard deviation [sd ]) baseline factor vii activities were 100.91% (sd : 15.68) for warfarin + lobeglitazone and 108.33% (sd : 16.23) for warfarin alone (p=0.0198 ; wilcoxon rank sum test). factor vii activity decreased to 17.70% at 23.90 hours and to 15.92% at 24.00 hours following administration of warfarin with and without lobeglitazone. thereafter, factor vii activity reached the baseline level by 144 hours after dosing under both treatments. the observed gmrs and 90% cis of auec0168 h and emax for factor vii were 0.9355 (90% ci : 0.9028, 0.9695) and 1.0935 (90% ci : 0.9934, 1.2037), respectively. thirteen subjects (54%) reported a total of 28 treatment - emergent aes, all of which were mild or moderate in severity. among these aes, three events reported by two subjects were treatment related : headache in the lobeglitazone - alone group, and epistaxis and nausea in the coadministration group. epistaxis occurred 2 days after dosing in one subject whose inr value was < 2.0 and who recovered without any medication. twenty - four subjects were randomized, and their mean (range) values for age and body mass index were 29.8 (range : 2147) years and 22.5 (range : 19.126.6) kg m, respectively. twenty - three subjects completed the study, and one subject withdrew for personal reasons during period 2. mean plasma concentration time curves for r- and s - warfarin following administration of warfarin alone and when combined with lobeglitazone are shown in figure 1. cmax, tmax, and t1/2 for r- and s - warfarin did not differ significantly between the two treatments (table 1). the 90% cis for the ratios of auclast and cmax of r - warfarin and s - warfarin for the coadministration of warfarin with lobeglitazone vs warfarin alone were within the predetermined no - interaction range (0.801.25). none of the pk parameters for lobeglitazone were affected by the coadministration of lobeglitazone and warfarin (figure 2). the gmrs and 90% cis for the ratios of auc,ss and cmax, ss of lobeglitazone for coadministration of warfarin with lobeglitazone vs lobeglitazone alone were 0.9728 (90% ci : 0.9248, 1.0233) and 1.0247 (90% ci : 0.9671, 1.0856), respectively. time profiles over time when warfarin (25 mg) was administered alone and coadministered with lobeglitazone (0.5 mg) are shown in figure 3. summary statistics for the inr and factor vii activity following the administration of warfarin with and without lobeglitazone are shown in table 2. median inr levels increased to a maximum at 23.93 hours and 24.00 hours after administration of warfarin with and without lobeglitazone. about 168 hours after dosing, these values returned to the baseline under both treatments. administration of warfarin with lobeglitazone did not affect the auec0168 h or emax of inr. the gmrs and 90% cis for auec0168 h and emax for the inr were 1.0091 (90% ci : 0.9872, 1.0314) and 1.0003 (90% ci : 0.9675, 1.0342), respectively. mean (standard deviation [sd ]) baseline factor vii activities were 100.91% (sd : 15.68) for warfarin + lobeglitazone and 108.33% (sd : 16.23) for warfarin alone (p=0.0198 ; wilcoxon rank sum test). factor vii activity decreased to 17.70% at 23.90 hours and to 15.92% at 24.00 hours following administration of warfarin with and without lobeglitazone. thereafter, factor vii activity reached the baseline level by 144 hours after dosing under both treatments. the observed gmrs and 90% cis of auec0168 h and emax for factor vii were 0.9355 (90% ci : 0.9028, 0.9695) and 1.0935 (90% ci : 0.9934, 1.2037), respectively. thirteen subjects (54%) reported a total of 28 treatment - emergent aes, all of which were mild or moderate in severity. among these aes, three events reported by two subjects were treatment related : headache in the lobeglitazone - alone group, and epistaxis and nausea in the coadministration group. epistaxis occurred 2 days after dosing in one subject whose inr value was < 2.0 and who recovered without any medication. the prevalence of diabetes is increasing, and aging of the population is the main driving factor for this increase in prevalence.13 because older people with diabetes tend to have multiple comorbidities in addition to the traditional cardiovascular complications, it is likely that concomitant medications including warfarin may be used in these populations. drug interactions between warfarin and a wide variety of medications, including anticoagulants, antibiotics, and antidepressants, which are metabolized by hepatic microsomal enzymes. salicylates potentiated the anticoagulant effect of warfarin, possibly because of their warfarin - like activity.14 antibiotics such as trimethoprim and sulfamethoxazole potentiated the effect of warfarin by the inhibition of s - warfarin clearance.15 selective serotonin reuptake inhibitor antidepressants, such as fluoxetine and fluvoxamine, impaired platelet aggregation by the inhibition of cytochrome p450 (cyp) 2c9-, cyp2c19-, and cyp1a2-mediated warfarin metabolism.16 some tzds also have shown a drug drug interaction when used with warfarin. troglitazone increased the inr in patients on concurrent warfarin therapy, which was theorized to be due to displacement of warfarin from plasma proteins or inhibition of the cyp system by troglitazone.12 pioglitazone, a weak inducer of cyp3a4, significantly decreased patients inr.11 a case of inr increase was also reported on concurrent rosiglitazone therapy, which has no inhibitory effect on cyp2c9, 2c19, and 1a2 substrates.11 due to the possibility of lobeglitazone being used concomitantly with warfarin in patients with type 2 diabetes mellitus, this open - label, crossover study to investigate potential clinical drug drug interactions between lobeglitazone and warfarin was conducted. lobeglitazone was administered at the approved daily dose of 0.5 mg for 4 consecutive days to reach steady state. warfarin was administered during the steady state of lobeglitazone and, to maximize the interaction potential, the dosing of lobeglitazone continued until the effect of warfarin was maintained. in warfarin drug interaction studies, warfarin is usually administered as a single large dose (eg, 25 mg) because the higher single dose of warfarin provides more opportunities to detect an interaction and reduces the exposure of healthy volunteers to a prolonged period of anticoagulation.17 in vitro assessment indicates that lobeglitazone is metabolized mainly by cyp3a4 and that its major metabolite, m7 (o - demethylation), is metabolized by cyp3a4, cyp2c19, and cyp2d6. warfarin is eliminated almost entirely by metabolism ; s - warfarin is metabolized to s-7-hydroxywarfarin mainly by cyp2c9, whereas r - warfarin is primarily metabolized by cyp1a2 and cyp3a4, yielding 6-, 8- and 10-hydroxywarfarin.18 s - warfarin is about twice as active as r - warfarin but is eliminated more rapidly.19 the exposure to lobeglitazone in this study is similar to that in a published study using the same dose.4 the observed pk profiles of r- and s - warfarin in the absence of lobeglitazone are also consistent with those reported in previous studies.20,21 in this study, the 90% cis for the gmrs (warfarin + lobeglitazone vs warfarin) of cmax and auclast for r- and s - warfarin were within the bioequivalence guidelines - specified comparability bounds of 0.801.25. the 90% cis were also entirely within the tightened interval of 90.00%111.11% for narrow therapeutic index drugs.22,23 in line with the lack of an effect on warfarin pk, concomitant administration of lobeglitazone had no effect on the pd of single - dose warfarin, which was assessed through the measurement of inr and factor vii. the 90% cis for the gmrs (warfarin + lobeglitazone vs warfarin) of inr and factor vii were within the range of 0.801.25. because of the observed baseline differences in factor vii, baseline correction was also performed in the analysis. the 90% cis for the gmrs of baseline - corrected auec0168 h for factor vii were 0.90651.1088 (table 2). as a result, coadministration of lobeglitazone is unlikely to be associated with an increase in warfarin - associated bleeding risk. the results of this study imply that lobeglitazone does not inhibit cyp2c9 and cyp3a4, the main enzymes involved in the metabolism of r- and s - warfarin. these findings may be applicable to other drugs metabolized by these pathways, suggesting that the coadministration of lobeglitazone with other drugs that are cyp2c9 or cyp3a4 substrates is unlikely to cause a clinically significant pk drug interaction. all participants were healthy young males, which is not typical of cardiovascular patients seen in the clinical setting. there was no sex difference for systemic lobeglitazone exposure at a 2 mg dose, which is four times the approved maximum dose of 0.5 mg.24 because the anticoagulant response to warfarin is affected by several factors, the warfarin response must be monitored carefully even in the absence of drug interactions. in summary, concomitant administration of lobeglitazone and warfarin was generally well tolerated in healthy subjects. there were no significant changes in the pk or pd of warfarin when a single dose of warfarin was coadministered with repeated once - daily doses of lobeglitazone. therefore, dose adjustment of warfarin is not required when these two drugs are administered in clinics. | aimslobeglitazone has been developed for the treatment of type 2 diabetes mellitus. this study was conducted to evaluate potential drug drug interactions between lobeglitazone and warfarin, an anticoagulant with a narrow therapeutic index.methodsin this open - label, three - treatment, crossover study, 24 healthy male subjects were administered lobeglitazone (0.5 mg) for 112 days with warfarin (25 mg) on day 5 in one period. after a washout interval, subjects were administered warfarin (25 mg) alone in the other period. pharmacokinetics of r- and s - warfarin and lobeglitazone, as well as pharmacodynamics of warfarin, as measured by international normalized ratio (inr) and factor vii activity, were assessed.resultsthe geometric mean ratios (gmrs) and 90% confidence intervals (cis) for area under the curve from time zero to the time of the last quantifiable concentration (auclast) for warfarin + lobeglitazone : warfarin alone were 1.0076 (90% ci : 0.9771, 1.0391) for r - warfarin and 0.9880 (90% ci : 0.9537, 1.0235) for s - warfarin. the maximum observed plasma concentration (cmax) values were 1.0167 (90% ci : 0.9507, 1.0872) for r - warfarin and 1.0028 (90% ci : 0.9518, 1.0992) for s - warfarin, both of which were contained in the interval 0.801.25. lobeglitazone had no effect on the area under the effect time curve from time 0 to 168 hours (auec) of inr and factor vii activity, as demonstrated by the gmrs of 1.0091 (90% ci : 0.9872, 1.0314) and 0.9355 (90% ci : 0.9028, 0.9695), respectively. in addition, the pharmacokinetics of lobeglitazone was also unaffected by warfarin.conclusionconcomitant administration of lobeglitazone and warfarin was well tolerated. lobeglitazone had no meaningful effect on the pharmacokinetics or pharmacodynamics of warfarin. these findings indicate that lobeglitazone and warfarin can be coadministered without dosage adjustments for either drug. |
the prevalence of obesity in children and adults has increased dramatically, with 62% of adults and 30% of children in england being overweight or obese,. reducing this global epidemic through the prevention and management of obesity is therefore a public health priority. the consequences of obesity on physical and mental health have been well documented in both adults and children and include hypertension, type ii diabetes, increased social isolation, and reduced body image,. two cochrane systematic reviews, one looking at prevention of childhood obesity and the second at treatment, found limited evidence of effectiveness of interventions on weight ; the most effective interventions combined dietary, physical activity, and behavioural components along with parental involvement. although changes in diet and physical activity could enable short - term weight loss, a lifestyle approach mandates that these two activities are underpinned by behavioural change strategies which will help to sustain changes over time, that is, goal setting and/or involvement of parents. behavioural change strategies are generally based on behavioural theories such as social cognitive theory and make the assumption that all behaviour patterns are conditioned. altering these patterns is the key to changing and maintaining behavioural changes. successful interventions therefore include modeling to change behaviour with reinforcement (operant conditioning) [8, 9 ] to embed change. the involvement of the family, to ensure that the home environment is conducive to modeling and particularly reinforcement, is therefore important for change to occur and be sustained. having one or more obese parents is one of the best predictors of obesity in children. genetics aside, this demonstrates the influence of parents and the home environment in determining a child 's diet and physical activity levels. direct involvement by at least one parent as an active partner in the weight loss process has been found to improve a child 's short - term and long - term (1 year) weight regulation [13, 14 ]. this is particularly so for children aged 611 years where parents are the primary mediator of change. research has repeatedly demonstrated the importance of parental involvement. a recent study by watson. showed a strong positive association between adult bmi change and child bmi standard deviation scores (sds) change, particularly after intervention when therapeutic contact was minimal. it is important therefore that obesity interventions involve a parent in the process and hence a family - based programme is advocated. as berry., identifies, the management of obesity in families is difficult due to the number of variables that need to be taken into account when designing an intervention, for example, age, environment, and culture. the one body, one life (obol) programme has been designed with these principles in mind. this approach focuses on the client 's perception of the problem rather than objective facts. the theory emphasizes a client 's strengths and focuses primarily on solutions rather than the problem. it does not emphasise the past, except in relation to present and future solutions. hoyt and berg summarise the basic rules as (1) if it ai n't broke, do not fix it ; (2) once you know what works, do more of it ; and (3) if something does not work, do not do it again ; do something different. the main focus is on simple adaptive solutions, as small changes can lead to more substantial changes. the programme is also underpinned by goal setting theory and self - monitoring theory which have become the standard components of obesity interventions. the aim of goal setting states that under certain conditions, setting specific challenging goals leads to higher performance when compared with no goals or vague, nonquantifiable goals such as do your best,. the aim of self - monitoring is to raise awareness of the individual 's behavioural patterns so that they can assess changes over time. the sessions are designed to be fun and interactive with key messages for everyone. the 45-minute healthy eating workshop provides participants with foundation knowledge in healthy eating to enable them to make healthier choices. clients are encouraged to monitor their food intake, which is recognized as being more effective than food restriction,. the main objective of this is the development of core motor skills, confidence, and self - esteem alongside improving fitness. for the cohort included within this evaluation, the main recruitment strategy used was to raise awareness of the programme amongst the target population (the more deprived areas of coventry) by making the programme and team members visible within the local community. this was done through health promotions, taster sessions and briefings to neighbourhood groups in local venues (including schools), as well as through flyers, posters, the use of media, and a website. the teams strategy was to target prospective clients in their own environment and focus on those most at risk. this meant that our primary target for health promotions / taster sessions was schools in deprived areas. prior to an obol course being run, the team would liaise with headteachers, the healthy schools coordinator, and the school nurse to promote interest at the school. the main aim of the taster sessions was to give potential participants insight into what they could expect on the programme in a fun and interactive way. assemblies and classroom sessions were used, where possible, involving parents. for older children the sessions were often integrated into school curriculum, that is, destress session on following the health promotion / taster session, the schools were asked to distribute letters to the parents giving them details of the future - planned local obol programme. local fete 's and community groups were also used to promote uptake of the programme. again taster sessions were provided or on occasion health mot 's were given to prospective clients. the team used this opportunity to promote the benefits of healthy eating and physical activity, whilst at the same time signposting them to programmes available within the local area. the recruitment strategy also used newsletters and local newspapers to showcase successful case studies to highlight the benefits of the programme. flyers, posters, and leaflets were also distributed in deprived areas in locations that were highly visible as well as in venues linked to the health agenda, for example, pharmacies, gp surgeries, libraries, children 's centres, and schools. of those recruited onto the programme, approximately 90% reported that they attended because of this recruitment strategy. the remainder were recruited through word of mouth, referrals from healthcare professionals or other (unknown) sources. the obol programme recruits the whole family, where one or more member of the family is an unhealthy weight (underweight, overweight, or obese). this means that a participating child or adult may not be an unhealthy weight. the target age range for children is 716 years old, who must be accompanied by a parent although siblings outside this age range are included (especially where childcare facilities are an issue). physiological data and behaviour data was collected at the first and last sessions, using the same data collection instruments, as follows ; weight was measured to the nearest 0.1 kg ; fat percentage, total body water (tbw), and visceral fat were measured using bioimpedance on the medically approved tanita scales (bc420 ma). height was measured to the nearest 1 mm with leicester height measure ; child growth foundation, london. bmi (weight in kg/(height in m)) was used for adults. for children this healthy eating knowledge was estimated through a healthy eating quiz which looked at participants ' knowledge of the eat well plate, vitamins, hidden fats and sugars, and so on. participant 's eating behaviours were recorded using a 24 hour recall questionnaire focusing on fruit and vegetable portions and fast food / unhealthy snacks intake. clients self reported how many times they took part in activity for more than 30 minutes. during the programme, the measurement technique was altered from asking about activity in general to using specific activities (including household duties and walking up stairs) as prompts. the analysis described in this paper was a formative evaluation for the purpose of improving the service offered. the data analysed was routinely collected by the programme as part of the on - going monitoring arrangements and was used retrospectively for this evaluation. data quality issues were dealt with by excluding results where there was a clear data entry error (missing or decimal point error). where results were outliers of the distribution, the likelihood of the result being correct was considered, and if it was a physiological possible result, statistical analysis was carried out using paired t - tests to compare the before and after measurements of individual participants, where both start and end data was provided. subgroup analysis was carried out where relevant (e.g., bmi / bmi percentile reduction was only an objective in those who were overweight or obese at entry to the programme). outcome data at course completion was available for the cohort included in this evaluation ; longer term outcomes are now being captured where possible. the programme was attended by 272 children and 182 adults (parent / carer) via 30 different courses, run in different locations and times (january 2008 to may 2009), but following the same format. of these, physiological data was recorded at the start and end of the intervention for 186 children and 107 adults, and the evaluation results are obtained from this group. the reasons given for dropping out of the course were varied (including parent starting new employment and difficulties within families). the average age of the children was 8 years, but the range was as wide as 0 to 15 years since ; although the target range was 716 yrs, siblings were encouraged to participate. table 2 shows the characteristics of the participants who completed and those who failed to complete the programme. it demonstrates that the weight profile of children attending the program is broadly similar to that measured in year 6 through the ncmp programme in coventry and to the health survey for england data for 215 year olds. for adults, there are a higher proportion of obese participants (38%) than reflected in the current coventry population estimate of 25.6%. the programme attracted an ethnically diverse group, with a lower proportion of those of white british ethnicity than estimated from the 2001 census. the programme also attracted families from the more deprived areas in coventry, with 252 (77%) of the 326 attendees for whom postcode was available, coming from the two most deprived quintiles. a comparison of the characteristics of those who failed to complete the programme with those who completed it shows that boys were less likely to drop out than girls, and that those of mixed ethnicity were more likely to drop out (though this is based on small sample size). there was no significant difference by bmi category, deprivation, or healthy lifestyle behaviours. overall, the vast majority of participants (86%) were made aware of the programme through their child 's school (which may include the school nurse), and a further 8% had heard through advertising or word of mouth. table 3 shows the results for all measures of behaviour that were recorded for obol participants. there was a statistically significant improvement in knowledge of healthy eating and physical exercise both in adults and children, with an increased score of 11.5 points (out of 100) for children and 13.9 for adults (95% confidence intervals 8.614.5 and 10.916.9, resp.). both adults and children achieved a statistically significant increase in their weekly activity levels, of over 3 30 minutes (for adults) and 3 60 minutes (for children) per week. it is possible that this change is in part due to the activity element of the programme, however this would be a maximum of 45 minutes, considerably less than the increase seen. the number of participants consuming 5 or more portions of fruit and vegetables a day increased from 21% to 33%, with an increase of 0.57 portions (95% confidence interval of 0.310.83, p < 0.001) per day for children and 0.76 portions (95% confidence interval of 0.471.06, p < 0.001) per day for adults. there was also a significant reduction in the amount of chips, crisps, sweets, and fizzy drinks consumed per day. the reduction was of 0.32 portions per day (95% confidence interval of 0.11 to 0.52, p = 0.002) for children and 0.34 portions per day (95% confidence interval of 0.07 to 0.61, p = 0.01) for their parents. fast food consumption also decreased, but this was not statistically significant for children with a reduction of 0.21 portions per week, (95% confidence interval of 0.45 to + 0.03, p = 0.08), but was for their parents with a reduction of 0.34 portions per week (95% confidence interval of 0.16 to 0.51, p < 0.001). table 4 shows the physiological outc - omes, comparing baseline measures with those recorded at course end. this analysis was carried out for overweight and obese participants only, since this group might be expected to see changes due to their behaviour change. for overweight and obese parents and children, a number of measures including bmi (bmi percentile for children), body fat % and waist circumference showed a statistically significant difference at the end of the course compared to the initial measurement. each of the statistically significant changes reflected an improvement ; however, the scale of improvements was small and is unlikely to be clinically significant. although these changes are not expected to impact on the short - term health of the individuals, if this reported behaviour change is sustained, future health improvements should be anticipated. intention to treat analysis, which assumes no change for those who dropped out of the course, was also carried out ; compared to the data shown, the same measures were found to be statistically significant, but with a smaller size effect. a change in knowledge of healthy lifestyles and behaviour in terms of physical activity and healthy eating has been demonstrated during the course of the programme. if these changes in behaviour are sustained, this might be expected to lead to a reduction in health risk factors for adults [2426 ]. in addition, since parents are the primary mediators of change, parental eating and physical activity choices will inevitably impact on the home environment, making it more conducive to positive change in children. research supports this assumption by demonstrating that weight control interventions delivered within a family - based context have yielded very promising long - term results in the treatment of childhood obesity. this 10-year followup study demonstrated that 34% of obese children maintained a decrease in bmi percentile, and 30% were no longer overweight. this was only the case where at least one parent was involved in the intervention ; if neither parent had been involved the benefits only lasted 5 years. overweight and obese adults and children have also shown small but statistically significant changes in physiological parameters (bmi / bmi percentile, waist circumference, and body fat) in the short term. this highlights the possibility of utilizing the programme to both prevent and treat childhood obesity, since family - based lifestyle interventions with a behavioural program aimed at changing diet and physical activity together with thinking patterns have been shown to be effective at treating childhood obesity,. the effectiveness of the recruitment strategy in reaching higher deprivation groups, with a cross section of ethnicity, suggests that taking a high visibility approach in the local community is effective, even though it is labour and time intensive. importantly in the context of the prevention of childhood obesity, the proportion of obese adults (33%) was higher than estimates of the local population (26%). the recruitment strategy was inclusive and reached the target audience, as demonstrated through observation of the demographic profile of course participants shown in table 2. this was achieved through promotion of obol in the target communities rather than through applying exclusions. this type of inclusive approach to recruitment supports marmot 's philosophy on tackling health inequalities ; interventions that are universal but targeted at those most at need. another indirect benefit could also be that inclusivity reduces negative attitudes towards overweight / obese people. as faith. suggests obese and nonobese individuals working together on a common problem might be an effective means for reducing antiobese attitudes. one body, one life has a common goal of helping clients to lead a healthier life. clients often share experiences and work together to come up with strategies of how they can do this in their everyday life. a byproduct of the programme could be that non overweight / obese clients improve their attitudes toward overweight and obese people. at a societal level clearly this is an evaluation of a service and not a research programme, and there are limitations to the study. for example, there is no control group, and so spontaneous changes in behaviour of the whole population can not be ruled out. given the study design, a further limitation is that the findings only relate to short - term impact, during the 1012 weeks of the programme, and it is not known whether changes are sustained. efforts are underway to improve this ; as with other like services, collection of longer term outcome data is problematic. it should also be noted that the results were self - reported, and that participants may have overstated improvements in their healthy eating and physical activity. this could have been influenced by the demand characteristics of the setting and is known as the teaching test where clients report what they think the programme leader wants to hear. moreover, the data collection tools that were used for the courses described in this evaluation were developed specifically for this programme. however, to provide consistency, minimize the teaching test and allow better comparison with other programmes, validated questionnaires are recommended. since this evaluation research into the prevention and treatment of obesity is still emerging, and there are still many areas that are not fully understood. one area of interest that is highlighted within this research is the longer term impact of interventions. in relation to the following areas are changes maintained over a period of time. is it changes in eating habits, or changes in physical activity levels that are most effective at helping a client to maintain a healthy weight ? finally, more research is needed into understanding what type of programme best suits particular types of clients that is a treatment only programme needed just for obese clients, or in some circumstances can a more inclusive approach be more beneficial ? it should be noted that marsha towey is the manager of the team who deliver the one body one life programme. the pct commissioned the programme as part of coventry 's healthy weight strategy, the commissioning team was led by berni lee. | service evaluation of a community - based healthy lifestyle programme, designed for families aimed at preventing obesity. physiological and behaviour measures were recorded at the beginning and end of the programme. out of a total of 454 participants, 358 (79%) completed. from these completers 293 (64%) were analysed as there was sufficient data. the use of high visibility recruitment led to 77% of completers being from coventry 's two most deprived population quintiles. ethnic minorities were also well represented. there were statistically significant self - reported behaviour changes, with improvements in fruit and vegetables eaten and decrease in consumption of crisps, snacks, and take away foods. there were also significant increases in physical activity. there were small but statistically significant improvements in bmi / bmi percentile for adults and children who started the programme overweight / obese. these results demonstrate the programmes ' effectiveness in enabling behaviour change, and attracting participants from deprived communities. |
the earth hosts more than 10 microbial cells, a figure that exceeds the number of known stars in the universe by nine orders of magnitude. this richness of single - celled life, the first life to evolve on the planet, still accounts for the vast majority of functional drivers of our planet s ecosystems. yet the diversity and interdependencies of these microscopic organisms remain largely unknown. likewise, our understanding of the functional potential of most individual microbial taxa residing within any ecosystem is extremely limited and generally restricted to measurements of gross enzymatic processes of the community. moreover, sequenced metagenomic datasets have, to date, only played a limited role in biotechnological knowledge discovery, with the majority of novel developments occurring through heterologous expression of enzymes. our knowledge of microbial diversity on earth is poised to be revolutionized by the development of new technologies that will permit us to see the who, what, when, where, why, and how? of microbial communities. most recently, next - generation sequencing methods have begun to rapidly improve our understanding of the functional and evolutionary processes necessary to advance the field of microbial ecology. matching these technological strides are progress in scientific community cooperation, increases in interdisciplinary interaction, and the development of standards for experimental and sample contextual metadata acquisition, which are essential for downstream interpretation. here we discuss how advances in dna sequencing, the handling of contextual data and improvements in study design can unlock the potential of metagenomics. we discuss the need for robust experimental design (e.g., replication and improved ecosystem characterization) and highlight the need for an earth microbiome project that will rely on metagenomics to explore earth s microbial dark matter across temporal and spatial scales and simultaneously facilitate novel gene discovery. through standardized data generation approaches and metadata collection, we stand poised to make rapid progress toward advancing biotechnological goals. for more than 80 years, it has been recognized that the majority of microbial life can not be easily cultured in the laboratory. this has constrained understanding of microbial ecosystems and impeded our ability to discover and utilize new beneficial functions derived from microorganisms (e.g., enzymes to drive biotechnological reactions, processes to enhance bioremediation, and biomarkers for disease diagnosis and therapeutic targets). current biotechnology is still based on a small stable of domesticated species, yet technical improvements in molecular microbial ecology and synthetic biology offer the potential for novel enzyme discovery and exploitation from the previously inaccessible depths of the tree of life. however, in this age of exploration and discovery, as we test the capability and limits of these new tools, it is unsurprising that the majority of studies have failed to live up to expectations. this has created a paradox, in that funding agencies are not providing the resources required to undertake metagenomic sequencing and analysis of the large and sufficiently replicated sample sets needed to produce scientifically valid investigations. a genuine concern exists that such constraints have led some journals and reviewers to accept the argument that proper experimental design and true replication is logistically infeasible and therefore should not be required for publication of the observations made. yet, as discovery moves from the description of apparent diversity to the genuine description of complexity and function, this is no longer acceptable or desirable. is it possible that metagenomics has failed to deliver what it promised a fast, cheap, and comprehensive method to explore functional biochemistry in the natural world ? it is too early to reach this conclusion, but several factors led to this perception, including underestimation of the complexity of microbial diversity, limited data concerning the source of each sample and the identity of many genes, difficulties in integrating and comparing results obtained with different technologies in different labs, mismatched expectations between researchers who sought to generate understanding of ecological patterns, with those who were excited to test the limits of new technology, and the lack of agreed upon data standards. for the discovery of enzymes such as glycoside hydrolases (important for biomass breakdown), information on the type of biomass, biological or physicochemical pretreatment (e.g. grinding of biomass by wood feeding insects), redox conditions, ph and temperature are important parameters to record. if we continue to develop these environmental data checklists for other types of sample sets, it will be feasible to search for relevant genes in databases created by metagenomic endeavors, which will greatly assist in finding genes relevant to a target biotechnology application. to change perspectives, national and global cooperation is needed to adopt minimum standards in experimental design and to convince funding agencies to make the appropriate levels of investment. initial advances toward novel gene discovery using metagenomics relied on direct cloning and sequencing of dna fragments extracted from uncultured microbial communities. for example, metagenomic data generation for the first leg of the global ocean sampling expedition was estimated to cost > $ 10 million. although costly, the dataset is comparatively limited by today s standards. since the introduction of the first wave of next - generation highly parallel dna sequencers in 2006, there has been an explosion in gigabase- to terabase - scale metagenomic sequencing projects. an illustrative, though not exhaustive, list includes the continued global ocean survey (gos), international census of marine microbes, metahit, the human microbiome project (hmp), tara oceans, deepsoil, metasoil, genomic observatories, the jgi great prairie pilot study, and the national ecological observatory network (neon). pioneering metagenomic studies of microbial community composition and function in different environments (e.g., acid mine drainage, soil / permafrost, marine gos, hawaiian ocean time series, western channel observatory l4, termite hindgut, cow rumen, human gastrointestinal tract, and mouse gastrointestinal tract) provided a first glimpse into the potential of this approach to uncover previously unknown functional genes, phylogenetic types, and interactions among community members. indeed, comparative metagenomic analyses have yielded considerable insight into the distribution of gene families across different ecosystems, and the role of specific functional attributes in adaptation to physical and chemical conditions. however, these initial studies were limited by their status as pilot studies, often due to the need to develop and prove the technologies and the high cost of sequencing. therefore, most of these studies were observational and were not able to adopt the normal scientific methodological approach of well replicated coverage of the respective ecosystems for statistically relevant analyses of the biological variation. now that sequencing costs have declined as throughput has dramatically increased, we expect, without any reasonable exceptions, rigorous experimental design to be applied to future metagenomics experiments. further, we must take full advantage of this brave new world of rigorous metagenomic study design by thinking like cartographers, and creating a map that can be used to navigate the uncharted regions of the microbial universe. one example of this map could be a catalogue of all known proteins and the environments (including comprehensive metadata) in which they were found. to do this, it will be necessary to better characterize individual ecosystems with prolonged and in - depth investigations, comprehensive physical, chemical and biological contextual data, appropriate statistical design, and improved interpretation of functional and taxonomic characteristics (box 1). a metagenomic dataset is only as good as the contextual experimental and environmental data associated with it. just as maps require a standard format to enable comparability, in - depth investigations also must be comparable, and be able to be linked, to uncover what features are common to multiple systems, or specific to each system. standardization efforts enable further analyses, such as determining the distribution of these elements across time and space, thereby improving our understanding of microbial dynamics across planet earth. ultra - deep sequencing of taxonomic or functional marker genes such as the small subunit ribosomal rna gene (ssu - rrna) or nifh has enabled comprehensive cataloging of the inhabitants of a variety of microbial ecosystems. deep sequencing of a few samples can provide information about rare taxa and rare genes, but without analyzing larger numbers of samples, limitations arise : the statistical significance of observed patterns can not be determined, the patterns of co - occurrence between genes and taxa are difficult to assess, and the dominant biotic or abiotic factors structuring communities across time and space remain undetermined. as an analogy, if naturalists in the 19th century had only focused on plant and animal diversity in a few, isolated plots instead of exploring ecosystems across broad swaths of the globe, the fields of botany and zoology would have reached a standstill, and the global patterns of biogeography, which were crucial to forming our modern understanding of ecology and evolution, would have remained unknown. thus, for microbial biogeography, many samples from related or contrasting communities must be studied in parallel. we recognize the recent advances that have been made by the deep sequencing of a few samples (e.g. generating billions or trillions of base pairs from a single sample). indeed, broad, shallow sequencing from many thousands of samples can help to direct which samples should be analysed in more detail using deep sequencing, which enables additional data analyses that may lead to better interpretation of the biological information. for example, in order to obtain enough information to allow reliable assembly of specific genomic fragments (using currently available sequencing technologies), deep sequencing of random shotgun dna is essential. hess and colleagues were able to assemble 15 near - complete bacterial genomes from short - read length shotgun sequencing data. however, improved coverage is not the only answer, but can help to focus the question ; for example, using a rough calculation of 4 mbp (mega base pairs) per genome and a billion cells per gram, a single gram of soil could contain up to 3 pbp (peta base pairs) of genetic data. used deep sequencing to successfully assemble a draft genome of a novel methanogen from highly diverse permafrost soil. therefore, although soil is one of the most challenging ecosystems for metagenomics because of it s high diversity, advances in new assembly algorithms show great promise for genome reassembly from deep sequence studies. the question of whether to sequence deeply or shallowly across many samples is dependant on the question you want to answer. regardless of the habitat in question, rare members of the community can have key functional roles, such as nutrient cycling (e.g., methanogenesis, nitrogen fixation), pathogenesis, stimulation of the immune system, and metabolite production (e.g., butyrate in the gut, or antibiotics). for example, in the european meta - hit project, metagenome sequences from fecal samples were obtained from 124 individuals, and the human gut microbes identified as being shared between individuals varied 8- to 1500-fold among different hosts. shallow sequencing, in contrast, enables the exploration of microbial community structure dynamics, which is fundamental to building a predictive understanding of an ecosystem. recent evidence suggests that some ecosystems maintain a temporally persistent but vast microbial seed bank, suggesting that taxa identified by shallow surveys are merely indicative of the abundant taxa selected by the chemical, physical and biological processes leading up to and present at the time of sampling. however, one likely hypothesis states that the dominant microorganisms in a sample are those that play the most important functional roles under normal conditions. hence, if one is interested in the ecology of more abundant processes or taxa, ultra - deep metagenomic sequencing is not essential ; relatively small fractions of the genetic diversity contained within samples can reveal ecological patterns that help define ecosystem structure. the potential for reliance on shallow sequence data (either amplicon or shotgun) for some studies is supported by a study of gnotobiotic mice harbouring a defined consortium where the complete genome sequence of every community member was known. in that study it was possible to obtain accurate descriptions of the community s meta - transcriptome and meta - proteome based on short sequence reads. creating a highly detailed picture of an individual or environmental sample from one angle at one instant creates a static view of that sample that can be useful. however, it can not capture temporal dynamics, or variability among individuals or habitats. far more is gained from complementing such pictures with others, even if these others are taken at lower resolution, as it permits more accurate reconstruction of shape. likewise, low - resolution pictures taken successively over time can provide a sense of motion and dynamics and low - resolution pictures of many different samples can provide a view of diversity and variability that can not be obtained by a single sample. however, all these pictures or individual snap - shots must be well organized, as it is of little value to have them unsorted in a pile that prohibits retrieval of the series of the data sets, or images, necessary to reconstruct a view of a specific phenomenon under study. to determine dynamic processes, it is necessary to apply broad sampling (both in time and space) at an appropriate resolution to determine the frequency of the dynamics. with most studies, an increase in the number of samples analyzed has a significant impact on analytical power (table 1). gilbert and colleagues generated a 12-sample survey of the annual changes in the microbiota of surface waters in the english channel, and found evidence for seasonal succession driven by temperature and nutrient availability. however, when they augmented this with 60 more samples, making a contiguous 72 sample time series over six years, the patterns were significantly refined, with the seasonality being extremely robust, and day - length being identified as the key driver of richness in the community (figure 1 ; table 1). additionally, arumugam and colleagues used metagenomic sequencing from 22 individuals to show that human gut microbiota could be classified into 3 enterotypes, which showed no correlation to diet or ethnicity. however, wu. performed the same analysis on 98 individuals and demonstrated that the increase analytical power found distinct correlations with diet (table 1). other examples of the power of sampling breadth can be routinely found in the literature (table 1), and they demonstrate that using statistically relevant experimental design is vital to generating accurate analyses. defining the effect size and the power of a study is a particularly important challenge in the design of clinical microbiome - directed trials (e.g. probiotics, prebiotics, antibiotics and stool transplants) or the natural or man - made disturbance in any terrestrial or oceanic ecosystem. a recent attempt to define effect sizes in studies of the human microbiome foundered due to the lack of comparability of different datasets and methodologies for taxon detection and assignment. such effect sizes can only be determined with sufficiently large sample sizes of normal versus altered states, studied over sufficient temporal and spatial scales to reveal variation. the dilemma, especially for human studies, is that large samples are required to determine effect size, but such studies can not gain institutional review board approval because the effect size, and therefore the correct number of subjects required to achieve statistical power, is unknown. in recognition of the value of a multi - environmental survey of microbial diversity, we have instigated an initiative called the earth microbiome project (emp ; www.earthmicrobiome.org). the emp seeks to systematically characterize microbial taxonomic and functional biodiversity across global ecosystems, and to organize international environmental microbiology research by standardizing the protocols used to generate and analyze the data between studies. the earth microbiome project (emp) constitutes a restructuring and refocusing of microbial ecology. individual projects are grouped (by single pi, or by consortium) into overarching science questions that can be used to define the fundamental purpose of a single project, or individual hypothesis - driven studies can be grouped under a larger question. while this framework provides a way to influence and globally organize environmental microbiology research, the novelty lies in the sheer scale of the endeavor and the standardization of the protocols used to generate and analyze the data between studies. the emp standard operating procedures (sops) define a route to minimize bias between community analyses associated with different material extraction techniques, analytical methods and core data quality control and analysis. however, currently, the emp does not promote a standard physical sample acquisition protocol or preservation technique, but is working to explore the impact of these variables on ecological interpretation. the emp framework promotes open access research ; hence all data is being made public, including to industry, and comparable within an open access forum, which creates a data resource capable of answering and asking fundamental questions about the function of microbes in different environmental habitats. the scientists themselves also need to be more accessible through open science initiatives, ensuring that the right researchers are able to work on the most relevant topics, making the best use of reductionist expertise. additionally, the emp framework enables multidisciplinary cooperation across funding agencies and scientific research areas. stand - alone projects are mapped onto larger research themes, and these stack into overarching global questions, yielding multiple layers and scales of inquiry. this focus on multidisciplinary activity brings new dimensions to microbial investigation, through renewed interest in data processing, requirements for large - scale computational infrastructure, modeling community dynamics and functional capability, and linking the analyzed data and generated models to climate modeling informatics programs. it also merges aspects of biogeochemistry, microbiology, protein / enzyme interaction, and transcriptional feedback as we move from molecular scale processes to processes and dynamics on other scales. these range from cellular interaction, to community ecology, local, regional, national, continental and global scales. such a broad knowledgebase will be critical for developing a predictive understanding of genes and organisms of biotechnological interest. of course, for large scale sequencing efforts such as the emp to be focused and coordinated, the community must avoid the sequence everything approach, simply because we can. hypotheses must guide our selection of the most appropriate samples to sequence. to a large extent these will be sample sets that have rich metadata, and samples that have the potential to provide fundamental new knowledge. initiatives like the emp are saved from becoming simple natural history exercises in data collection by the requiring the acquisition and appropriate organization of the metadata that accompany every sequence dataset generated. these environmental and experimental metadata are the primary data of many multidisciplinary research groups, who already work together to generate a comprehensive understanding of a particular environment, e.g. a marine sampling field expedition, or a temporal exploration of soil and ecosystem dynamics in one location. such environmental parameters give context to the origin of the sequence data we rely upon to generate interpretative analyses about the microbial dynamics in that ecosystem. they include temperature, latitude and longitude, altitude, moisture content, nutrient concentrations, and standard ontologies for geolocators and ecosystem descriptors. but these must also be accompanied by experimental metadata that appropriately describe the methods used to create the sequence data, such as sample handling, nucleic acid extraction, pcr amplification method, sequence protocol, and bioinformatic analysis. acquisition of these metadata are essential to the emp, as they provide ecological grounding to analyses of the taxonomic and functional capacity of the sequenced microbial community. hence, this robust framework for routine collection of metadata and reliable standards will enable comparison between studies. a suite of such standard languages is provided by the minimum information about any (x) sequence checklists (mixs). mixs is an umbrella term to describe migs, mims and mimarks and contains standard formats for recording environmental and experimental data. the latest of these checklists, mimarks (minimum information about a marker sequence) builds on the foundation of the migs (the minimum information about a genome sequence) and mims (the minimum information about a metagenome sequence) checklists, by including an expansion of the rich contextual information about each environmental sample. for example, human samples can be annotated with fields such as the age, weight, and health status of the subject, whereas seawater samples can be annotated with fields such as ph, salinity, depth and temperature. additionally, detailed technical information such as the sequencing platform, and the genes and regions targeted are also required, making meta - analyses of many studies much easier to perform and interpret, because outliers can be traced back to technical differences or to biological differences automatically, rather than requiring the researcher to read scores of papers as is necessary for meta - analyses today. this integration is especially important for finding enzymes that participate in processes that are potentially industrially useful but where the origin is irrelevant to the industrial application except for improving the possibility that the enzyme will work under the necessary conditions. we believe that the mixs standard will play a key role for three reasons : first, it will enable large - scale projects to collect massive datasets according to standard protocols at multiple sites, and to share these data to facilitate global understanding. second, it will enable integration of each lab s individual projects into this universe of sequences, allowing community - level comparisons, unprecedented exploration of the diversity and distribution of life, easy detection and exclusion of contaminated samples, and the exploration of gene or taxon co - occurrence patterns. these features are especially crucial for accessing and integrating data from every clinic or every field site. third, it will provide a framework for large - scale integration of efforts, especially predictive modeling. the very best ones see analogies between analogies. by providing a method of integrating both the systematically collected results of large - scale projects such as the emp and the highly distributed efforts of smaller groups, standards such as mixs will help enable a future in which analogies across spatial scales, temporal scales, and even theories are not only possible but routine. as the cost of sequencing continues to decline, there has been a rapid adoption of the mixs standard, and of sound sampling principles. for example, tools such as qiime and mg - rast are already mixs - compliant and provide ways of viewing and analyzing mixs - compliant data. insdc has committed to incorporating a mixs keyword as a standard, and large projects such as the hmp (https://commonfund.nih.gov/hmp/), neon (http://www.neoninc.org/), the emp (www.earthmicrobiome.org), the bio weather map (http://bioweathermap.org/), and the personal genome project (http://www.personalgenomes.org) have already pledged to support the standard. arms race that spurs their mutual growth and progress, so too must data standards co - evolve. international activities such as the emp provide test beds to allow the community to agree on standards for exchange of data products that go well beyond the trading of consensus sequences and annotations (e.g., genbank). even given the expected advances in cloud computing and the predicted decrease in computation costs according to moore s law, one main driver of innovation will be the need to provide analyses of datasets that are orders of magnitude larger without the corresponding need for vast increases in the bioinformatics budget. however, it is easier to create standards than it is to successfully promote their use. the genomic standards consortium (gsc) has conducted pioneering work on minimum information checklists that have enabled provenance standards, and it is now taking on the much more complicated task of defining standards for computed data products. in this regard, journals can play a role by universally adopting such standards as a requirement for accepting and publishing manuscripts. the role of data generation in the discovery of novel enzymes and phylogenetic structure in microbial biodiversity must be complemented by improved functional and taxonomic databases that more appropriately represent the full breadth of microbial diversity. one critical aspect of this development will be mapping of metagenomic reads against reference genomes. the earth microbiome project is partnered with the genomic encyclopedia of bacteria and archaea and microbial earth initiatives that aim to improve the phylogenetic representation of sequenced genomes. these efforts combined with improved gene and protein database curation (e.g., img and img / m) will aid with metagenomic data interpretation, facilitating more efficient biodiscovery. as it occurred with many other technologies such as computing, telecommunications and photography (which, like sequencing, began with scientific applications but rapidly transformed consumers lives across the globe), metagenomics is in a time of transition. the community is moving from a situation in which technologies are first deployed centrally by large organizations, then by departments, by individual laboratories, and it is perhaps not unreasonable to speculate that sequencing devices will soon be owned by individuals, perhaps even in a handheld format. standard protocols are necessary to integrate the information and to allow easy communication across studies after all, the role played by the internet in today s world is only possible because computers everywhere can communicate with a set of standard, open protocols. while currently these initiatives are focused on dna sequencing (amplicon sequencing and metagenomics), it will be necessary to determine integration of metabolomics, proteomics and single - cell genomics into these efforts to improve community characterization, and enable more appropriate ecological inferences. the omics ratio (ratio of applied techniques, e.g. genomics : transcriptomics : proteomics : metabolomics) should always be determined by the hypothesis. we believe and hope that mixs and the emp will enable the same type of functionality for ecologists, allowing us to construct not just a catalog of organisms on earth but also to understand and exploit the critical processes they perform in the environment over a vast range of spatial and temporal scales. | metagenomics holds enormous promise for discovering novel enzymes and organisms that are biomarkers or causes of processes relevant to disease, industry and the environment. in the last two years we have seen a paradigm shift in metagenomics to the application of broad cross - sectional and longitudinal studies enabled by advances in dna sequencing and high - performance computing. these technologies now make it possible to broadly assess microbial diversity and function, allowing systematic investigation of the largely unexplored frontier of microbial life. to achieve this aim, the global scientific community must collaborate and agree upon common objectives and data standards to enable comparative research across the earth s microbiome. improvements in comparability of data will facilitate the study of biotechnologically relevant processes such as bioprospecting for new glycoside hydrolases or identifying novel energy sources. |
langerhans cell histiocytosis (lch) is characterized by a clonal proliferation of langerhans cells that occurs predominantly in children. lch is categorized as a single - system (ss) disease with single or multifocal lesions, and as a multi - system (ms) disease with or without involvement of risk organs (hematopoietic system, lung, liver or spleen). although the skin is not categorized as a risk organ, the precise diagnosis of skin lesions is necessary to determine the protocol for the treatment of lch. in this report, we present a case of lch mimicking prurigo chronica multiplex that carried the p. v600e mutation in the braf gene, successfully detected by immunohistochemical staining. a 28-year - old japanese man visited our outpatient clinic with a 1-year history of pruritic papules on his extremities. he had noticed a slow - growing subcutaneous nodule on his right chest 2 years before, and half a year before this nodule had been diagnosed as adult - onset lch and irradiated locally. on his initial visit, physical examination revealed multiple crusted papules on the trunk, lower legs and dorsal region of the foot (fig. a biopsy specimen showed atypical large lymphocytes infiltrated mainly in the perivascular region of the upper dermis with involvement of the overlying epidermis (fig. since the infiltrating cells were limited to the perivascular areas and it was difficult to diagnose these eruptions as cutaneous involvement of lch or dermadromes of lch, we employed immunohistochemical staining for braf mutation. we detected p.v600e - mutated cells in the perivascular region of the upper dermis (fig., we diagnosed this patient as having adult - onset braf - mutated lch with cutaneous involvement. he was treated for lch with a regimen of the japan lch study group protocol c (vinblastine, prednisolone, methotrexate, mercaptopurine) as described previously. one month after the administration of this regimen, in parallel with the induction of complete remission of lch, his pruritic eruption disappeared. lch can roughly be divided into two categories : a ss disease with single or multifocal lesions, and a ms disease with or without the risk of organ involvement (hematopoietic system, lung, liver or spleen). in adults, systemic chemotherapy is required for multifocal ss or ms lch lesions, whereas systemic chemotherapy is not recommended for those with localized ss disease. since cutaneous involvement of adult lch is frequent and its manifestation is variable, exact histological diagnosis of a skin lesion is necessary to determine the clinical type of lch. although lch is characterized by the proliferation of s100 protein, cd1a and langerin - positive cells, sometimes it is difficult to differentiate skin lesions of lch from other inflammatory skin diseases such as prurigo. recent reports suggested that the oncogenic braf mutation could be one of the markers for cutaneous lch. moreover, another report also suggested that braf mutation in circulating cd11c+/cd14 + cell fractions can even determine the prognosis of lch. notably, kobayashi and tojo reported that the braf mutation in circulating cell - free dna could be a biomarker of high - risk adult lch. these reports suggested that the expression of braf could be one of the diagnostic tools for the cutaneous involvement of lch with various presentations. although the skin is not categorized as a risk organ, the exact diagnosis of cutaneous involvement of lch is necessary to determine the protocol for the treatment of lch. since immunohistochemical staining and quantitative rt - pcr were useful for the detection of braf mutation [7, 8 ], in this report we selected immunohistochemical staining with 3,3-diaminobenzidine tetrahydrochloride and its enhancer. we could not detect p.v600e mutation in the braf gene by quantitative rt - pcr because of the lower cell densities in the skin lesion. our present report suggested that, in such cutaneous lesions, immunohistochemical staining is suitable for the detection of the gene mutation. | langerhans cell histiocytosis (lch) is characterized by the clonal proliferation of langerhans cells ; it is categorized as a single - system disease with single or multifocal lesions, and as a multi - system disease with or without the risk of organ involvement. although the skin is not categorized as a risk organ, the precise diagnosis of skin lesions is necessary to determine the protocol for the treatment of lch. in this report, we describe a 28-year - old japanese man with adult onset of brafv600e - mutated lch with cutaneous involvement successfully diagnosed by immunohistochemical staining. our report suggests that immunohistochemical staining for the brafv600e gene could be a diagnostic tool to determine the clinical type of lch. |
erysipelothrix rhusiopathiae is a gram - positive, non - sporeforming, slender and straight or slightly rod - shaped bacterium that causes erysipelas in swine and a wide spectrum of diseases in other animals, like sheep, birds, reptiles, amphibians, and some fishes. this bacterium is ubiquitous in environment and in reservoir of asymptomatic carriers among both domestic and wild animals. among the 23 serotypes of e. rhusiopathiae, serotypes 1a, 1b and 2 are the best known as the etiological agents affecting swine industry,,,. e. rhusiopathiaes vary widely in their morphology, host specificity and/or pathogenicity and little is known about the correlation of their proteins to virulence. e. rhusiopathiae gxby-1, isolated from acute swine erysipelas in binyang county, guangxi province, china, exhibits high pathogenic for mouse and swine. in order to elucidate the genetic background of this pathogenic strain and get deep insights into the virulence - associated proteins of this strain, we sequenced the complete genome of e. rhusiopathiae gxby-1. the genome of e. rhusiopathiae gxby-1 was sequenced at beijing genomics institute (bgi, shenzhen, china) using illumina hiseq 2000 system. a total of 300 million high - quality base pairs were produced with 62-fold coverage of the genome, and then were assembled into 11 contigs by using soap denovo software,, after which the contigs were joined into 2 scaffolds with paired - end information. gene predictions and annotations were performed using the glimmer software (version 3.02) and trna and rrna genes were identified by trnascan and rrnammer, respectively. all genes were further categorized according to swissprot, go (gene ontology) and kegg (kyoto ency - clopedia of genes and genomes). the complete genome of e. rhusiopathiae gxby-1 consists of one 1,876,490 bp circular chromosome with no plasmid. and its chromosome contains 1734 predicted open reading frames (orfs) and the total length of genes is 1,668,564 bp, which makes up 88.36% of the genome. the g + c content of the chromosome is 36.50% and encodes 57 trna and 27 rrna operons (table 1). the gxby-1 strain genome not only enriches the genome database of e. rhusiopathiae, but also supports and extends previous studies, and provides fundamental information for further studies. the genome sequence of e. rhusiopathiae gxby-1 has been deposited in ncbi genbank under accession number cp014861. the authors declare that there is no conflict of interests with respect to the work published in this paper. | erysipelothrix rhusiopathiae (e. rhusiopathiae) is an important pathogenic microorganism affecting swine industry. here, we report the finished annotated genome sequence of e. rhusiopathiae gxby-1, isolated from acute swine erysipelas in binyang county, guangxi, china. the gxby-1 strain, which exhibits high pathogenicity for swine, contains 1,876,490 bp with g + c content of 36.50%, and contains 1734 protein - coding genes, 57 trnas and 27 rrnas. the nucleotide sequence of this genome was deposited into genbank under the accession cp014861. |
the role played by protein motions in driving the chemical step of an enzyme - catalyzed reaction is the subject of vigorous debate. such promoting motions are distinct from motions associated with the physical steps during enzyme catalysis such as substrate binding, product release, or other conformational changes, which are well described in terms of millisecond second (ms s) time scale dynamics. it has been suggested that enzyme dynamics and flexibility are important not just for the physical events but also for the chemical step itself. the potential involvement of protein motions in driving the chemistry of enzyme catalyzed reactions is often studied for hydrogen transfer, where quantum mechanical tunnelling plays a role and the width of the reaction barrier is as important in determining the reaction rate as its height. an environmentally coupled tunnelling model has been proposed to explain unusual kinetic behavior of enzymatic h - transfer reactions. in this model, slower (s ms) protein motions such as large - scale loop or subdomain movements as well as active site remodelling promote the reaction by creating wavefunction degeneracy in a reaction ready conformation (rrc), while faster (fs ns) short - range motions can reduce the reaction barrier in the rrc. the temperature dependence of the primary hydrogen kinetic isotope effect has been used as the major indicator of the nature of the coupling of these motions to the reaction coordinate. therefore, changes to the coupling of protein motions to the reaction are expected to alter the kinetic isotope effects and their temperature dependences. however, several experimental observations and results based on computation have suggested inconsistencies with this model. changing the composition of the solvent will have a number of effects on the enzyme and its catalyzed reaction. increasing the viscosity will reduce the rate of diffusion through the medium and therefore slow ligand binding as well as motions within the protein itself. reducing the dielectric constant (i.e., reducing the polarity of the medium) will reduce the shielding effect of the medium on dipole this will strengthen electrostatic interactions in the transition state and so directly alter the reaction barrier, as well as altering the flexibility of the protein spanning hydrogen - bonding network. the coupling of protein motions to the reaction coordinate can therefore be tested experimentally through changes of the solvent composition. dihydrofolate reductase (dhfr) catalyzes the reduction of 7,8-dihydrofolate to 5,6,7,8-tetrahydrofolate using reduced nicotinamide adenine dinucleotide phosphate (nadph) as a cofactor. dhfrs from organisms living at high and moderate temperatures have been studied extensively with the goal of understanding the relationship between enzyme structure, protein dynamics, and chemical catalysis. the experimentally accessible temperature range has been extended in studies of the structural and kinetic adaptation of the dhfr from the hyperthermophile thermotoga maritima (tmdhfr) and more recently from the baro- and psychrophilic bacterium moritella profunda (mpdhfr), isolated from sediments 2.8 km below the surface of the atlantic ocean. the tertiary structure of mpdhfr is similar to that of dhfr from escherichia coli (ecdhfr) and no obvious structural indications of adaptation to high pressure and low temperature have been found. detailed structural and kinetic studies of a number of dhfrs from related moritella species and from other deep - sea bacteria did not reveal any specific evidence of pressure adaptation. we have previously reported the effect of temperature and ph in the steady state of the mpdhfr catalyzed reaction, where physical processes rather than the actual chemical step limit the reaction rate at physiological ph as is also the case for ecdhfr. here we provide insight into the role of protein motions in dhfr catalysis from measurements of the effects of temperature, ph, and solvent composition on the chemical step during mpdhfr catalysis and of hydrogen / deuterium exchange rates in mpdhfr and ecdhfr by nmr spectroscopy. hydrogen / deuterium exchange provides a measure of solvent accessibility and is therefore a measure of the flexibility of the protein on a slow (by nmr) time scale and of the shielding effects of secondary structural elements and ligands. our results indicate the importance of protein dynamics for the generation of the rrc on the free - energy landscape, but suggest that the chemical step itself is not promoted significantly by motions during catalysis by dhfr. 4-(s)-nadpd was prepared in the same way as 4-(r)-nadpd, except that glucose-1-d (cambridge isotope laboratories) was used as the deuterium source and glucose dehydrogenase from pseudomonas sp. the concentrations of nadph / nadpd and h2f were determined spectrophotometrically using extinction coefficients of 6200 cm m at 339 nm and 28 000 cm m at 282 nm, respectively. where applicable, solutions containing 17%, 33%, and 50% cosolvent (volume cosolvent per final solution volume) were used. circular dichroism (cd) experiments were performed on an applied photophysics chirascan spectrophotometer using 2.5 m protein in 5 mm potassium phosphate buffer (ph 7.0) containing the desired cosolvent where appropriate. spectra were measured between 195 and 400 nm in quartz cuvettes (0.1 cm path length, helma) under n2. mean residue ellipticities []mre were calculated using the equation []mre = /(10ncl), where is the measured ellipticity in mdeg, n is the number of backbone amide bonds, c is the concentration of protein in mol l, and l is the path length in cm. thermal denaturation experiments were performed using temperature steps of 1 c between 20 and 70 c, with 1 min equilibration at the desired temperature prior to measurement. turnover rates were measured spectrophotometrically on a jasco v-660 spectrophotometer by following the decrease in absorbance at 340 nm during the reaction (340 (nadph + h2f) = 11 800 m cm). rates were determined at ph 7 using 20 nm enzyme in 100 mm potassium phosphate containing 100 mm nacl and 10 mm -mercaptoethanol, and at ph 9 using 50 nm enzyme in mten buffer (50 mm morpholinoethanesulfonic acid, 25 mm tris, 25 mm ethanolamine, 100 mm nacl, and 10 mm -mercaptoethanol). the enzyme was preincubated at the desired temperature with nadph (0.1200 m) for 1 min to avoid hysteresis prior to addition of h2f (100 m). each data point is the result of three independent measurements. at low nadph concentrations in certain cosolvents, the errors on the measured rates hydride transfer rates were measured under single - turnover conditions on an applied photophysics stopped - flow spectrophotometer. the enzyme (20 m final concentration) was preincubated with nadph (8 m final concentration) for at least 5 min in 100 mm potassium phosphate (ph 7.0) containing 100 mm nacl and 10 mm -mercaptoethanol and the reaction started by rapidly mixing with h2f (200 m final concentration) in the same buffer. reduction of the fluorescence resonance energy transfer from the enzyme to nadph during the reaction was observed by exciting the sample at 292 nm and measuring the emission using a 400 nm cutoff output filter. varying the concentrations of the reagents showed that the measured rates were limiting rates for hydride transfer, regardless of solvent composition. rates of h / d exchange (hdx) at 20 c were determined by nmr on a varian inova 900 mhz (h) spectrometer equipped with a cryogenically cooled hcn probe. proteins for nmr experiments were purified by anion exchange on q - sepharose resin followed by gel filtration on a prep grade superdex 75 column. this ensures that no folate is present in the apoenzyme prior to nmr measurements, which would be the case using our usual purification method. ecdhfr and mpdhfr, as the apoenzyme and the nadp / folate complexes (6-fold excess of ligands), were prepared as 2 mm stocks in 50 mm potassium phosphate buffer, ph 7, containing 1 mm nacl, 10 mm -mercaptoethanol, and 10% d2o. as mpdhfr can not be freeze - dried without substantial loss of activity, hdx experiments were performed by dilution rather than resuspension. the concentrated stock was diluted 10-fold into h2o and d2o 24 h prior to measurement to create after samples, which were used to optimize the acquisition parameters and to obtain optimized shim maps for hdx experiments. hdx was then performed by diluting the concentrated stock 10-fold into d2o immediately prior to insertion into the magnet. sofast - hmqc spectra were recorded at regular intervals until no further exchange was seen, increasing the number of scans with time to maximize signal (see supporting information for full details). peak intensity (adjusted for changes to the number of scans by dividing by the square root of the ratio of number of scans) was plotted against exchange time (from sample mixing to the midpoint of the spectrum acquisition) and rate constants determined using sigmaplot 10. n crosspeaks for the ecdhfr / nadp / folate complex were assigned using published data, and connectivity was confirmed using a 3d h n noesy - hsqc spectrum acquired on a varian inova 600 mhz (h) spectrometer equipped with a hcn probe, using 2.4 mm ecdhfr with 15 mm ligands in 50 mm potassium phosphate buffer, ph 7, containing 1 mm nacl, 10 mm -mercaptoethanol, and 10% d2o. crosspeaks for apo - ecdhfr were assigned by titration to form the nadp / folate complex and using a 3d h n hsqc - noesy spectrum acquired on a bruker avance ii+ 700 mhz (h) spectrometer equipped with a cryogenically cooled hcn probe, using 2.2 mm apo - ecdhfr in the same buffer. crosspeaks for the mpdhfr / nadp / folate complex were assigned using standard triple - resonance methods. as all apo - mpdhfr crosspeaks exchanged fully within the dead time of the experiment, no assignment was performed. h n hsqc spectra were also acquired for the ecdhfr / nadp / folate complex in the presence of 17, 33, and 50% methanol and glycerol. spectra were acquired on a varian inova 600 mhz (h) spectrometer equipped with a hcn probe, using 240 m ecdhfr with 1.5 mm ligands in 50 mm potassium phosphate buffer, ph 7, containing 1 mm nacl, 10 mm -mercaptoethanol, and 10% d2o. the rate constants for hydride transfer (kh) during mpdhfr catalysis were determined under single turnover conditions that isolate the chemical step of the reaction cycle. at ph 7, kh was considerably greater than kcat at all temperatures, as expected from the earlier observation that the primary hydrogen kinetic isotope effect (kie) in the steady state is unity. at 25 c, kh for the mpdhfr - catalyzed reaction was over twice that of the ecdhfr - catalyzed reaction and more than 2 orders of magnitude greater than that of the tmdhfr - catalyzed reaction (figure 1 and table 1). the primary hydrogen kie on mpdhfr - catalyzed hydride transfer was temperature dependent with ea of 6.6 3.4 kj mol. the primary hydrogen kie was also determined under steady - state conditions at ph 9 (figure 1 and supporting information), where hydride transfer is rate limiting. here, the kie was almost temperature independent with ea of 1.5 1.1 kj mol. for ecdhfr at elevated ph, the kie falls below 15 c due to a partial change in the rate - limiting step. for mpdhfr, a similar fall in the kie was observed below 5 c, to 1.98 0.13 at 1 c (not shown). -secondary hydrogen kies on mpdhfr and ecdhfr catalysis were determined under single turnover conditions at ph 7 (supporting information). the -secondary kies for both enzymes were temperature independent with average observed values of 1.065 0.022 for ecdhfr and 1.044 0.011 for mpdhfr. arrhenius plots (a) for hydride (circles) and deuteride (triangles) transfer and the corresponding kies (b) plotted on a logarithmic scale against the inverse temperature for mpdhfr (blue), ecdhfr (green), and tmdhfr (red) catalysis, measured under single turnover conditions at ph 7 (left) and in the steady state at ph 9 (mpdhfr) or 9.5 (ecdhfr) (right). the hydride transfer rate constant for mpdhfr catalysis was dependent on ph with an apparent pka of 6.53 0.12 at 5 c (figure 2 and supporting information). at higher temperatures, the rate constant for the reaction below ph 6 was too high to determine accurately by stopped flow kinetic measurements. the sigmoidal curve observed for hydride transfer is in contrast to the steady state rate constant, which showed a bell shaped ph dependence demonstrating that the reduction in the steady - state rate constant for mpdhfr at low ph is not due to enzyme inactivation. the rate constants for mpdhfr - catalyzed hydride and deuteride transfer were also measured in d2o (supporting information). a considerable increase in both rate constants however, measurement of kh at varying values of pd in d2o demonstrated that this was the consequence of a d2o - induced shift of the apparent pka (to 7.13 0.13, a shift of 0.60 0.03 ph units) rather than any intrinsic effect on the reaction. plots of kh (blue ; left abscissa) and kcat (red ; right abscissa) against the ph value of the solution for the mpdhfr catalyzed reaction in mten buffer at 5 c. the effect of cosolvents on the secondary structure of mpdhfr was investigated by cd spectroscopy. some loss of structure was evident from the cd spectra in the presence of ethanol, isopropyl alcohol, and tetrahydrofuran, but little change of the global structure was observed in the presence of glycerol, ethylene glycol, sucrose, and methanol (supporting information). nmr spectroscopy in the presence of methanol or glycerol on the other hand revealed local solvent specific changes of the conformation of ecdhfr (vide infra). the addition of 50% glycerol and 30% sucrose increased the melting temperature of mpdhfr from 37.5 0.8 c to 51.5 0.5 and 47.2 0.9 c, respectively, while the melting temperature in 50% methanol (35.1 0.4 c) was similar to that in the absence of cosolvent (supporting information). interestingly, methanol appears to have a less pronounced effect on mpdhfr than it does on ecdhfr ; the melting temperature of ecdhfr was reduced from 51 to 26 c in 50% methanol. the steady - state rate constant (kcat) at ph 7 and ph 9 and the rate constant for hydride transfer (kh) at ph 7 were measured at 20 c for the mpdhfr catalyzed reaction in the presence of organic cosolvents and cosolutes (figure 3 and supporting information). increasing the concentration of cosolvent / cosolute led to a reduction of all three rate constants in a manner proportional to the dielectric constant but not the viscosity of the medium, as seen from the fact that the combined data for all cosolvents form a cluster when plotted against viscosity, whereas a clear overall trend against dielectric constant is visible. the use of multiple cosolvents is important here, as use of only a small number of solvent conditions might lead to the conclusion that a viscosity effect is visible (supporting information). however, simultaneous comparison of the data for all cosolvents used here shows that any apparent trend against viscosity with a single cosolvent is in fact due to the general trend against dielectric constant. this can be seen by comparing isoviscous solvent mixtures, which give large differences in rate constant, with isodielectric solvent mixtures, which give far smaller differences in rate constant. plots of kcat and kie on kcat at ph 9, kcat at ph 7, and kh and kie on kh at ph 7 for the mpdhfr - catalyzed reaction against solution viscosity (left) and dielectric constant (right). colors represent different cosolvents, where dark green denotes no cosolvent, light blue = methanol, dark blue = ethanol, purple = isopropyl alcohol, red = ethylene glycol, orange = glycerol, yellow = sucrose, and light green = tetrahydrofuran. the effect of dielectric constant on the reaction is consistent with electrostatic effects playing the major role in controlling the rate constant for hydride transfer. it is worthy of note that a low dielectric constant should be expected to favor catalysis through electrostatic effects by reducing the shielding of stabilizing electrostatic effects within the active site. this is in apparent contrast to our results, which show catalysis to be favored by a high dielectric constant. it is likely that reducing the dielectric constant of the solvent, which in effect reduces the difference between the dielectric constant within the active site and that of the surrounding medium, reduces the protection of the carefully aligned dipoles within the active site from more remote dipoles that may be deleterious to transition state stabilization. ansari extension of kramers theory was applied to further evaluate the effect of viscosity on the rate constant, revealing that neither kcat nor kh correlated with viscosity for any value of internal protein friction (supporting information). furthermore, plotting the normalized 1/kcat against the relative viscosity according to the method of kirsch gave poor fits (supporting information) strongly indicating that diffusion plays a minor role in limiting the reaction rate. the steady - state data did not indicate reversible inhibition and the values for kcat were unaffected by prolonged incubation of the enzyme with the solvents (data not shown), although the cd data (vide supra) suggest that in isopropyl alcohol and tetrahydrofuran the reduction of the rate constants is partly due to a degree of solvent - induced denaturation. the kie on kh at ph 7 was largely independent of the solvent composition (figure 3 and supporting information), whereas at ph 9, the kie on kcat decreased as the dielectric constant decreased. this suggests a change in rate - limiting step at ph 9 as the solvent composition is changed showing that solvent composition has a greater influence on the physical steps of the reaction than on the chemical step. km values could not be determined accurately in all cases due to high errors on the measured rate data at low cofactor concentrations in certain cosolvents, but in general, the presence of cosolvent reduced the km, leading to an initial increase in kcat / km followed by a decrease as the cosolvent concentration was increased further (supporting information). the effect of solvent composition on the temperature dependence of the kie on kh at ph 7 was also studied (figure 4 and supporting information). studies of solvent effects on the temperature dependence of the kie at ph 9 were not performed as the degree to which hydride transfer is rate limiting is changed by the solvent composition (vide supra), making meaningful analysis impossible. at ph 7, neither methanol nor glycerol had a significant effect on the temperature dependence of the primary kie of the reaction, although methanol caused a significant rise in the activation energy and a reduction in the kie itself (supporting information). the presence of sucrose led to temperature independent kies, as had been observed previously for ecdhfr and tmdhfr, although these were slightly depressed in 30% sucrose compared to 17% sucrose. it has also been observed that mutations in the dimer interface of tmdhfr can cause the kie to become entirely temperature independent, suggesting that relatively minor structural alterations remote from the active site may affect the temperature dependence of the kie. as the concentrations of methanol and glycerol had similar dielectric constants, while the concentrations of glycerol and sucrose used were isoviscous, it appears that bulk solvent properties have no effect on the temperature dependence of the kie on kh. arrhenius plots for mpdhfr - catalyzed hydride (circles) and deuteride (triangles) transfer (left) and the corresponding kies plotted on a logarithmic scale against the inverse temperature (right) at ph 7 in the presence of 0% (black), 17% (red), 33% (green ; 30% in the case of sucrose), and 50% (blue) methanol (a), glycerol (b), or sucrose (c). it is clear that the rate constant for hydride transfer by mpdhfr is greater than that of ecdhfr at all values of ph (kh for ecdhfr is 480.6 15.1 s at 10 c and ph 5, while kh of mpdhfr is 690.9 59.1 at 5 c and ph 5), and 2 orders of magnitude greater than that of tmdhfr (0.870 0.004 at 20 c, ph 5). however, at the typical operating temperatures of the three dhfrs (2 c for mpdhfr, 37 c for ecdhfr and 90 c for tmdhfr) at ph 7, the hydride transfer rate constants were estimated by linear extrapolation from the arrhenius plots as 255.0 6.4, 317.3 1.6, and 8.2 0.1 s, respectively. similarly, the steady - state rate constants under the same conditions are 5.0 1.5, 35.8 2.6, and 4.5 2.3 s. it therefore appears that mpdhfr is in fact a slightly poorer catalyst than ecdhfr at their respective physiological temperatures and is comparable to tmdhfr in the steady state. the activation energy (and enthalpy) for the hydride transfer reaction is most favorable for mpdhfr and least favorable for tmdhfr (table 1). this is offset by mpdhfr having the least favorable arrhenius prefactor (and activation entropy), which compensate for one another such that the gibbs free energies of activation for mpdhfr and ecdhfr are similar. this behavior is comparable to that observed for the activation parameters for the steady - state reactions of mpdhfr and ecdhfr. the behaviors of the rate constant for hydride transfer and its kie show a number of similarities between mpdhfr and ecdhfr. the apparent pka values of hydride transfer are approximately equal (6.53 0.12 at 5 c for mpdhfr ; 6.59 0.05 at 10 c for ecdhfr) and higher than that of tmdhfr (5.79 0.04 at 20 c). critically, the temperature dependence of the kie on hydride transfer is similar to that observed for ecdhfr, and quite different to that of tmdhfr (figure 1b). it has been shown recently that the kie on hydride transfer in ecdhfr is temperature dependent below ph 8 and temperature independent at or above this ph, demonstrating that the temperature dependent kies observed at ph 7 are indeed physiologically relevant, while the temperature independent kies observed at elevated ph are not. the lower value observed for the primary and -secondary hydrogen kies on hydride transfer in mpdhfr than in ecdhfr may suggest increased kinetic complexity on the measurements for mpdhfr. we have previously shown that kinetic complexity leads to an underestimate of the temperature dependence of the kie, which may also explain why the observed ea is lower for mpdhfr than for ecdhfr. from the data obtained here, it seems reasonable to conclude that monomeric dhfrs have similar kinetic behavior for the hydride transfer step, exemplified by temperature dependent kies under physiological conditions, whereas dimeric dhfrs (tmdhfr is the only dhfr shown to be dimeric so far, although it is likely that other dhfrs from the genus thermotoga are also dimeric) have different kinetic behavior exemplified by temperature independent kies at elevated temperatures. hdx was followed in nmr experiments to obtain a measure of protein flexibility (figure 5 and supporting information). hdx was performed for both the apoenzyme and the dhfr / nadp / folate ternary complex, which can serve as a model for the dhfr / nadph / dihydrofolate michaelis complex. the apoenzyme is not affected by shielding effects from the ligands and so yields a clearer picture of the intrinsic flexibility of the protein itself, while the complex more accurately represents the situation during catalysis. cartoon representations of ecdhfr (top) and mpdhfr (bottom) as the dhfr / nadp / folate complexes (left) and as apoenzymes (right) showing half - lives (t1/2) of h / d exchange. gray = no data, blue = no exchange after 24 h, cyan = t1/2 > 30 min, green = t1/2 1030 min, yellow = t1/2 210 min, orange = t1/2 < 2 min, and red = t1/2 too small to measure. the spectra of both apo - ecdhfr and apo - mpdhfr were of much lower quality than those of the complex with nadp and folate. spectra for the complexes could therefore be acquired considerably faster than for the apoenzyme (supporting information). assignment of the apo - ecdhfr resonances by standard triple - resonance techniques was not attempted due to this low spectral quality. titration of apo - ecdhfr with a 1:1 mixture of nadp and folate revealed that the free and bound states are in slow exchange on the nmr time scale, complicating assignment by that route, although the observed improvement to the spectrum demonstrated that the low spectral quality was intrinsic to the apoenzyme and not due to poor sample quality. n noesy - hsqc spectrum to confirm connectivity and residue type as well as by comparison to the assignments of the ecdhfr / nadp / folate complex. n hsqc of apo - ecdhfr as has been observed previously, demonstrating conformational heterogeneity. in general, hdx was much faster for the apoenzymes than for equivalent complexes (figure 5). the hdx results obtained by nmr are in good agreement with those obtained for apo - ecdhfr in mass spectrometric measurements. for apo - mpdhfr, in contrast, some crosspeaks for apo - ecdhfr showed no exchange after 24 h. these correspond to residues in the central -sheet of the adenosine - binding domain of the enzyme. mpdhfr is an intrinsically more flexible protein than ecdhfr in that all residues show similar or smaller half - lives of exchange in apo - mpdhfr (figure 6). the majority of residues that apparently show similar half - lives of exchange simply exchange too quickly for accurate measurement by nmr in both enzymes. cartoon representations of mpdhfr as the dhfr / nadp / folate complex (left) and the apoenzyme (right), comparing half - lives (t1/2) of h / d exchange with ecdhfr. gray = no data, blue = similar t1/2, green = t1/2 smaller in mpdhfr, red = t1/2 smaller in ecdhfr. secondary structural elements discussed in the text are indicated for the apoenzyme. the dhfr / nadp / folate complexes displayed considerably lower apparent flexibility. in mpdhfr and ecdhfr, significant portions of the secondary structural elements showed no h / d exchange even after 24 h (figure 5) and the half - lives of exchange were considerably longer in many other cases. this observation is in good agreement with results obtained for ecdhfr using mass spectrometric measurements and with nmr measurements for dhfr from lactobacillus casei. similarly, it has previously been reported that the melting temperatures of the two enzymes increase upon addition of ligands. interestingly, and perhaps surprisingly, some residues of the ecdhfr / nadp / folate complex displayed shorter half - lives of exchange than their counterparts in the mpdhfr / nadp / folate complex (figures 5 and 6) suggesting that these regions of ecdhfr may in fact have greater flexibility in the presence of ligands. notably, these include residues in the m20, fg, and gh loops, all of which are known to be important for the physical progression through the catalytic cycle. in general however, in ecdhfr, the m20 loop is known to adopt two conformations, closed and occluded, depending on the position within the catalytic cycle, and to fluctuate between these conformations even within the michaelis complex. on the other hand, ser 148 of ecdhfr, which is critical for the formation of the occluded conformation, is replaced by pro 150 in mpdhfr. replacement of ser 148 of ecdhfr with ala is known to prevent the formation of the occluded conformation. this may lead to reduced flexibility and the observed greater shielding of these loops from solvent despite equal exposure. faster h / d exchange in ecdhfr than in mpdhfr is also seen in helix e and nearby residues (figure 6), a region of ecdhfr thought to lose structure early in the thermal unfolding process, also suggesting high flexibility, although it should be noted that the residues that show no exchange after 24 h in apo - ecdhfr are also in this region. apo - dhfr from the thermophile geobacillus stearothermophilus (bsdhfr) has been found to have greater flexibility than ecdhfr at comparable temperatures demonstrating that the general tenet that thermophilic enzymes have reduced and psychrophilic enzymes greater flexibility does not necessarily always apply. it should be noted that binding of methotrexate causes a much larger increase in the melting temperature of mpdhfr than of ecdhfr, suggesting that ligand binding has a greater stabilizing effect on mpdhfr. other active - site regions of the enzyme, notably helices b and f, show decreased half - lives of exchange in mpdhfr relative to ecdhfr. these helices are involved in a network of hydrogen bonds and van der waals interactions that has been suggested to promote dhfr catalysis ; helix f has also been implicated in the temperature dependence of the kie in a recent study of bsdhfr. this study also implicates residues in strand a in the temperature dependence of the kie, although no exchange in this strand is seen here in either enzyme in the nadp / folate complex (probably due at least in part to shielding by the ligands) and very little exchange has been seen in a of bsdhfr below 50 c. in general, however, the hdx results for the dhfr / nadp / folate complexes suggest greater flexibility in mpdhfr than in ecdhfr ; where ecdhfr shows faster exchange, half - lives were within an order of magnitude of the equivalent mpdhfr values, whereas where mpdhfr showed faster exchange, half - lives were over 2 orders of magnitude smaller than the equivalent ecdhfr values in some cases (supporting information). in addition, shielding from the ligands is likely to cause many of the residues to show no exchange, meaning that the flexibility of these residues can not be determined from the hdx data. taken together, the hdx results presented here demonstrate greater flexibility of mpdhfr relative to ecdhfr, particularly in active site flanking helices thought to be important for the actual chemical step of catalysis. the effect of cosolvents on ecdhfr (as the dhfr / nadp / folate complex) was investigated by nmr spectroscopy. on addition of methanol and glycerol, large chemical shift perturbations are seen for certain amide groups, while others show little or no change (figure 7). the changes in methanol are different to those in glycerol, while the magnitudes and directions of the chemical shift perturbations are residue specific ; there is no general solvent effect on the amide chemical shifts. the chemical shift perturbations do not correlate with the surface exposure of the residue, ligand binding, or whether the residue shows chemical exchange (to the excited reactive state) on a microsecond millisecond time scale in the absence of cosolvent. most notably, the nonlinearity of some of the chemical shift perturbations with increasing solvent concentrations (see especially g51 and g121 in figure 7c) demonstrate that the conformational changes caused by the solvent involve a long - lived intermediate rather than simple two - state exchange. therefore, the presence of organic cosolvent clearly induces slow conformational transitions within the michaelis complex of ecdhfr. given that these conformational transitions will be much slower than the chemical step, these data strongly suggest differences in the conformational ensemble of the enzyme in the presence of cosolvents at the point of reaction. such changes of the conformational ensemble will alter the electrostatics of the enzyme s active site and lead to the observed changes in the rate constants for hydride transfer (vide supra). n hsqc spectra of ecdhfr / nadp / folate in the presence of methanol (a) and glycerol (b). insets (c) show expansions of certain regions of the spectra, demonstrating the different behavior of various peaks. colors represent 0% (teal), 17% (red / orange), 33% (green / light green), and 50% (navy / blue) meoh and glycerol. spectra were acquired on 240 m protein in 50 mm potassium phosphate buffer (ph 7.0) containing 1 mm nacl, 10 mm -mercaptoethanol, and 1.5 mm each nadp and folate, on a varian inova 600 mhz (h) spectrometer equipped with a 5 mm hcn probe. the kinetic results obtained here demonstrate that the effect of the addition of cosolvents on the chemical step is the same for mpdhfr, ecdhfr, and tmdhfr, while hdx experiments demonstrate greater flexibility of mpdhfr than ecdhfr. the kinetic results in the presence of cosolvents (vide supra) showed that dielectric constants, but not viscosity, affect the rate constant for hydride transfer ; neither parameter affects the primary kie on hydride transfer or its temperature dependence as has been observed for the ecdhfr and tmdhfr catalyzed reactions. most notably, the effect of dielectric constant on dhfr catalysis suggests a dominant role for electrostatic effects in controlling the rate constant for hydride transfer, while the absence of a viscosity effect rules out a direct coupling of large - scale motions to the actual hydride transfer step itself, as increased viscosity would be expected to dampen such motions, and is hence not consistent with any model that invokes such long - range coupling. computational studies including very recent work have highlighted the central role in ecdhfr catalysis of the electrostatic reorganization energy. large - scale motions may be of small amplitude, but span a significant proportion of the protein. in addition, they may not be pure vibrational motions but may also include activated, diffusive motions uncoupled to vibrational modes. our experimental results do not rule out shorter - range promoting motions that are uncoupled from the larger - scale motions of the protein but that could drive hydride transfer. since such local motions are not slaved to the solvent, the work described here does not address their role in dhfr catalysis. while local motions may be protected from the effect of the solvent, we consider it unlikely that a long - range motion could be protected in a similar way. localized motions have been proposed to be important for hydride transfer in lactate dehydrogenase, morphinone reductase, and aromatic amine dehydrogenase. for ecdhfr catalysis, it has been suggested that such promoting motions involve side chain rotation of ile 14 and ile 94, residues that are conserved in mpdhfr. however, if dhfr catalysis is dominated by electrostatic effects as our results and those of others suggest, then there is no need to invoke such motions in catalysis. the alternative explanation for our results, that large - scale protein motions do couple to the chemical step but that changes to these motions do not manifest in the isotope effects or their temperature dependences, is unlikely since the kie on hydride transfer is highly sensitive to changes to the donor acceptor distance. acceptor distance from 3 to 3.5 led to an increase of the kie by 60100% at all temperatures ; decreasing the temperature from 40 to 10 c led to an increase in the kie of only 10% when the donor acceptor distance was held at 3, or an increase of 40% when the donor acceptor distance as small as 0.05 would result in a change of 610% in the kie, larger than a typical experimental error of stopped - flow measurements. acceptor distance in the nadp / folate complex of ecdhfr, a model of the ground - state michaelis complex, is 3.3, requiring a decrease of 0.7 to meet the transition - state optimum. protein flexibility and motions may affect the rate constant for hydride transfer (kh in mpdhfr is greater than in ecdhfr) as changes within the conformational ensemble will affect the electrostatic environment of the active site and therefore alter the barrier to the reaction, but do not affect the nature of the chemistry, as demonstrated by the very similar temperature dependences of the kies and the similar behavior in organic cosolvents. at the same time, nmr experiments show clear changes to ecdhfr in the presence of methanol and glycerol, despite little effect on the kie. these results are in good agreement with our previous studies of ecdhfr, which suggest that conformational changes influence the reaction, but through a more indirect route rather than through direct coupling. the conformational state of the enzyme at the time of hydride transfer may affect its rate constant, but no conformational change occurs during the hydride transfer event itself. the fact that mutations in the dimer interface of tmdhfr also cause the kie to become entirely temperature independent across the whole temperature range (suggesting a long - range effect on a short - range motion, while long - range motions are excluded by the kinetic results for tmdhfr obtained in the presence of cosolvents) adds further support to the importance of prereaction conformational equilibria in dhfr catalysis. the -secondary hydrogen kies support an alternative view of the role of protein motions in dhfr catalysis. -secondary hydrogen kies at ph 7 have previously been reported for tmdhfr and the values obtained here are similar to those for the hyperthermophilic enzyme. the temperature independent -secondary kies observed for all three dhfrs, contrasting with the temperature dependent primary kies observed for mpdhfr and ecdhfr, support the suggestion that secondary kies report on events immediately prior to hydride transfer and/or are unaffected by the motions of the enzyme that affect the primary kie. alternatively, our results might suggest that the temperature dependence of the kie is in fact unaffected by protein motions altogether. it has recently been suggested that our results with cosolvents are not relevant to dynamics coupled to hydride transfer, as they relate to large - scale motions slaved to the solvent rather than internal protein motions slaved to the hydration shell. however, the proposed network of coupled motions in dhfr is assumed to be involved in conformational changes, that is, those motions that are slaved to solvent, rather than coupled directly to hydride transfer. indeed, we have always been clear that our results do not comment on short - range internal protein motions that could potentially couple directly to hydride transfer (vide supra), although changes to the solvent composition will most likely affect the hydration shell of the enzyme and hence the internal protein motions slaved to it. furthermore, others have suggested that the influence of viscosity on dynamics is felt even in the core of the protein. our results are fully consistent with a role for a network of coupled motions in dhfr that place the enzyme in an optimal conformation conducive to the reaction, the rrc, but not one directly coupled to hydride transfer itself. a recent nmr study connecting millisecond conformational fluctuations to hydride transfer is not inconsistent with our results either as no claim of direct causality is made in that work. it is not surprising that conformational fluctuations influence the chemical step, as we have shown previously. the central question is exactly how that influence is exerted, and how the chemistry is controlled within the rrc. in summary, the results presented here provide strong evidence against a direct coupling of large - scale protein motions to the chemical step of the dhfr catalyzed reaction. they are consistent with previous studies that suggest that dhfr catalysis consists of a conformational search uncoupled from the chemistry itself, followed by hydride transfer, which may or may not involve short - range protein motions. protein flexibility may affect the rate of the reaction, presumably by altering the rate at which the rrc, an optimal conformation with the correct electrostatics and geometry for the reaction to occur, can be attained, but long - range motions do not directly couple to the reaction coordinate to change the nature of the chemistry itself. dhfr, dihydrofolate reductase ; bsdhfr, dhfr from g. stearothermophilus ; ecdhfr, dhfr from e. coli ; mpdhfr, dhfr from m. profunda ; tmdhfr, dhfr from t. maritima ; nadp, nicotinamide adenine dinucleotide phosphate ; nadph, nicotinamide adenine dinucleotide phosphate (reduced form) ; kie, kinetic isotope effect ; cd, circular dichroism ; hdx, hydrogen / deuterium exchange ; hsqc, heteronuclear single quantum coherence ; sofast - hmqc, band - selective optimized flip angle short transient heteronuclear multiple quantum coherence. | dihydrofolate reductase has long been used as a model system to study the coupling of protein motions to enzymatic hydride transfer. by studying environmental effects on hydride transfer in dihydrofolate reductase (dhfr) from the cold - adapted bacterium moritella profunda (mpdhfr) and comparing the flexibility of this enzyme to that of dhfr from escherichia coli (ecdhfr), we demonstrate that factors that affect large - scale (i.e., long - range, but not necessarily large amplitude) protein motions have no effect on the kinetic isotope effect on hydride transfer or its temperature dependence, although the rates of the catalyzed reaction are affected. hydrogen / deuterium exchange studies by nmr - spectroscopy show that mpdhfr is a more flexible enzyme than ecdhfr. nmr experiments with ecdhfr in the presence of cosolvents suggest differences in the conformational ensemble of the enzyme. the fact that enzymes from different environmental niches and with different flexibilities display the same behavior of the kinetic isotope effect on hydride transfer strongly suggests that, while protein motions are important to generate the reaction ready conformation, an optimal conformation with the correct electrostatics and geometry for the reaction to occur, they do not influence the nature of the chemical step itself ; large - scale motions do not couple directly to hydride transfer proper in dhfr. |
inflammatory and pseudodiverticula are the most frequent. only one case of a true diverticulum of the transverse colon has been reported in the literature. we report a case of a 22-year - old woman presenting with constipation and meteorism from childhood. a plain abdominal x - ray showed a round radiolucent air - filled cyst. the postoperative course was uneventful, and she was discharged in 1 week without any complications. in july 2010, a 22-year - old woman was admitted with a history of constipation and meterorism that were longstanding from childhood. she had been previously diagnosed in other departments, and based on colonoscopy, dolichocolon had been suggested. physical examination revealed a large abdominal mass and cachexia (bmi = 15.5 kg / m). barium enema revealed a single, large diverticulum of the transverse colon (fig. 1). laparotomy showed a giant diverticulum originating from the proximal part of the transverse colon that was 40 cm long, 1015 cm wide at the bottom and 45 cm wide at the gate (fig. 2). histopathology revealed that the giant diverticulum contained all four layers of the normal bowel wall (fig. the postoperative course was uneventful, and she was discharged in 1 week without any complications. 3histopatological examination a giant diverticulum contains all four layers of the normal bowel wall barium enema showing a giant diverticulum of the transverse colon intraoperative image demonstrating a giant diverticulum of the transverse colon histopatological examination a giant diverticulum contains all four layers of the normal bowel wall a giant colonic diverticulum (gcd) is defined as a colonic diverticulum measuring 4 cm or larger.1,2 it is a very rare condition, and most frequently, it is associated with colonic diverticular disease. gcd was described first in 1953 by hughes and greene,3 primarily as a solitary air cyst. different names (giant air cyst or giant cyst) have been used to describe this condition. according to steenvoorde.,2 the term pathologically, gcd is divided into three types : type i (22%), pseudodiverticulum composed of granulation and fibrous tissue, with chronic inflammatory cells and remnants of muscularis mucosa ; type ii (66%), inflammatory diverticulum arising from local perforation and communicating with an abscess cavity and type iii (12%), true diverticulum that contains all the layers of normal bowel wall and being in continuity with the gut lumen.2,4 giant diverticulum located in the transverse colon is extremely rare.57 only one case of a true giant diverticulum of the transverse colon that was accompanied by a right inguinal hernia of the greater omentum has been reported in the literature.5 we present the unique case of an uncomplicated true giant diverticulum of the transverse colon. because symptoms have been remaining from patient s childhood, we believe that this pathology can be congenital due to an intestinal duplication. gcd may be asymptomatic or presents with nonspecific symptoms, such as vague abdominal pain, constipation, rectal bleeding, nausea and vomiting, abdominal distension, diarrhoea and abdominal mass.2 in 28% of patients, complications such as inflammation, perforation, intraabdominal abscess formation and wall infarction occur. 4 a plain supine abdominal x - ray is the radiological investigation of choice for gcd diagnosis.2 preoperative diagnosis may also include barium enema, ct scan or mri.5,8 diverticulectomy in selected cases or partial colectomy with the diverticulum is the preferred method of treatment in uncomplicated gcd. in complicated cases, | abstractgiant colonic diverticulum is an extremely rare condition in colonic diverticular disease. more than 90% of giant colonic diverticula are found in the sigmoid colon. inflammatory and pseudodiverticula are the most frequent. only one case of a true diverticulum of the transverse colon has been reported in the literature.case reportwe report a case of a 22-year - old woman presenting with constipation and meteorism from childhood. a plain abdominal x - ray showed a round radiolucent air - filled cyst. barium enema revealed a single, large diverticulum of the transverse colon. an extended right hemicolectomy with primary end - to - end anastomosis was performed. the postoperative course was uneventful, and she was discharged in 1 week without any complications. histopathology showed a true diverticulum containing all layers of the colon. |
endometriosis is a common gynecological condition that is associated with a variety of symptoms, most commonly chronic pelvic pain. endometriosis affects near seven million women in the united states, and more than 70 million worldwide. other reported estimates of the prevalence of endometriosis range from 1% to 52%, and the most frequently reported rate was 10%. women with endometriosis have social dysfunction, feelings of frustration and isolation due to pelvic pain, infertility problems and a delay in diagnosis. in recent years, studies have begun to assess the effects of endometriosis on health - related quality of life (hrql). health related quality of life is a multi - dimensional concept including physical, psychological, and social aspects associated with a particular disease or its treatment. health - related quality of life measurement has an important role as an outcome measure in investigations. using generic instrument to evaluate the quality of life in women with endometriosis has a great limitation that may not be sensitive enough to assess specific changes of the disease. it has been shown that disease - specific instruments contains items developed from typical patients could be more responsive to changes of health status. jones. recently reported a disease - specific questionnaire to measure the health status of women with endometriosis (endometriosis health profile-30). the evaluation of the original version of the 30-item endometriosis health profile-30 (ehp-30), performed in a gynecologic clinic at the john radcliff hospital, oxford, england, showed a high internal consistency for all domains (cronbach 's alpha ranged from 0.83 to 0.93). in order to use a reliable and valid instrument in another country with a different language, the objective of this study was to examine the reliability and validity of persian version of ehp-30 questionnaire employing patients with endometriosis in tehran, iran. the ehp-30, a disease - specific questionnaire to measure the hrql, was used in this study. the first part is a core questionnaire with 30 items applicable to all women with endometriosis covering five areas including pain, emotional well - being, control and powerlessness, social support and self imaging scales. the second part is a modular section containing six domains, which comprised of 23 questions covering areas such as work, relationship with children, sexual activity, infertility, medical profession and treatment, which are not necessarily relevant to all women with endometriosis. the score of each domain ranged from 0 (indicating the best health status) to 100 (indicating the worst health status). the score of each domain was calculated by dividing the total of the raw scores of each item in the domain by the maximum possible raw score of all items in the domain multiplied by 100. the questionnaire was translated to persian by a native iranian health professional translator fluent in both english and persian. the two versions of the questionnaire were compared by investigators and any differences were discussed and resolved. finally, the persian version of the questionnaire was tested on few women with endometriosis and their understandings of the items were assessed. afterwards, the final persian version of the questionnaire was developed and tested in this study. we used the questionnaire of short - form 36 (sf-36) health status survey in this study, which had previously been validated in persian. each dimension is reported on a scale of 0 to 100 with higher score reflecting a better quality of life. other variables measured in this study were demographic variables (age, marital status, education and occupation) and clinical variables including pelvic pain (unrelated to menstruation), feeling sick or nauseated, lack of energy and fatigue, painful urination, constipation or diarrhea, menstrual pain, irregular menstruation and also not having menstruation within previous four weeks. this cross - sectional study was conducted between may and november 2009 recruiting all women with endometriosis referring to outpatient gynecology clinics of three teaching hospitals affiliated to iran university of medical sciences. one hundred women who had been given a surgical confirmation of endometriosis during the preceding five years were recruited in this study. the inclusion criteria were an age of 20 to 50 years and a confirmed endometriosis. the exclusion criteria included evidence of another major physical or mental illness that had a great effect on quality of life. the aims of the study were described for subjects, and those who agreed to participate in the study were included. institutional review board of medical school or iran university of medical sciences approved the study. endometriosis health profile-30 was evaluated using descriptive statistics, internal reliability consistency, construct validity, factor evidence and item total correlation (corrected for overlap). internal consistency reliability was assessed by cronbach s. an alpha coefficient of 0.70 or more was considered acceptable. the item total correlation (linear relationship between an item and its scale total) evaluated and a correlation coefficient of 0.40 or more was considered acceptable for having a good item total consistency. to test the construct validity of the ehp-30, we hypothesized a significant correlation between the sf-36, and the ehp-30 and its subscales. factor analysis (principal component analysis and varimax rotation) was performed to verify the scales produced from the first analysis in the development of the questionnaire. items with a loading of 0.3 on a principle component analysis were used for factor analysis with varimax rotation. data analysis was performed using statistical package for social sciences (spss version 13.0). a p value of 0.05 non - menstrual pelvic pain (36%), menstrual pain (24%), constipation / diarrhea (18%), feeling sick / nauseated (14%), painful urination (9%) and irregular menstruation (7%) were the other symptoms respectively. table 1 shows descriptive statistics of the core and modular part of ehp-30. a factor analysis with a maximum five - factor solution developed (table 2). all items were loaded on their hypothesized factor except items 17 (felt aggressive or violent) and 18 (feeling unwell) which were loaded on other factors (pain : 0.524, and social support : 0.568 domains, respectively). descriptive statistics of eleven dimensions of the endometriosis health profile-30 core and modular questionnaires factor analysis : factor load for core domain of ehp-30 questionnaire cronbach s ranged between 0.80 - 0.93 for core domains and 0.78 - 0.90 for modular domains. table 3 and 4 shows corrected item to total correlation and scale internal reliability consistency (cronbach s) on the ehp-30 for core and modular domains, respectively. the ehp-30 item to total correlations exceeded the margin of 0.40 in all instances for core and modular parts. corrected item to total correlation and scale internal reliability consistency on the ehp-30 (core questionnaire) higher order factor analysis was undertaken on the five dimension of the ehp-30. the analysis produced a single component, which accounted for 65.67 % of the variance that indicated the dimensions can be summed up to create a single index (the ehp-30 summary index) score (table 5). corrected item to total correlation and scale internal reliability consistency on the ehp-30 (modular questionnaire) principal component matrix from a higher order factor analysis of the five dimensions of the ehp-30 we administered sf-36 to assess construct validity of the ehp-30. the most powerful correlation was between emotional scale of ehp-30 and emotional well - being of sf-36 (-0.63). endometriosis is a chronic gynecological disease caused by ectopic location of the endometrium outside the uterine cavity. because of pathological changes, and gynecological and psychiatric problems, the decline of quality of life of women with endometriosis endometriosis health profile-30 is a recently designed instrument to assess the quality of life in women with endometriosis. in this study the psychometric evaluation of persian version of ehp-30, as a disease - specific instrument, was assessed. internal consistency, descriptive statistics of data, factor analysis, item total correlation (corrected for overlap) and construct validity were the five criteria to assess psychometric properties of this questionnaire. the ehp-30 was evaluated and used in only a small number of countries around the world, including the united kingdom, united states, brazil, and more recently in australia. it has been found to be a reliable, valid (in terms of both content and construct validity), acceptable and suitable tool to be used in endometriosis - related research in these countries. correlations of endometriosis health profile-30 scales with short form-36 scales on the core questionnaire, emotional well - being and pain dimensions had the highest mean and ; therefore, the most negative impact on ill health (46.73 and 46.69). as in united states and australian reports the scales of self image had the lowest mean (36.2). in modular sections of our samples, infertility had the highest mean and the most negative impact upon ill health (mean scale score=50.55) that was similar to the united kingdom and australian results. in factor analysis, all items loaded on their hypothesized factor except two, which were loaded on other factors. it seems that pain accompanying endometriosis makes patient feel generally unwell and lack of enough social supports yields to be more violent or aggressive. the internal consistency reliability of the questionnaire was high with all scale exceeding the accepted value of 0.70. cronbach s ranged between 0.80 to 0.93 for core domain, and between 0.78 and 0.90 for modular domain, which are comparable to the united kingdom and american settings with cronbach s ranging from 0.83 to 0.93 and 0.84 to 0.91, respectively. item total correlation of questionnaire concluded in acceptable correlation in core and modular parts of questionnaire. higher order factor analysis suggests that single - factor solution, which was found in the united kingdom and united states, is also applicable in iranian version. construct validity of ehp-30 was measured using sf-6, a convenient and previously validated instrument for evaluating the quality of life in women with endometriosis in iran. the findings indicate that there was good correlations in several scales of the two questionnaires (table 6). the first limitation was the inability to assess the discriminate validity of the questionnaire using clinical variables, because these variables were not measured prospectively under investigators ' supervision. although our data was consistent with other psychometric evaluation of this instrument, we suggest the use of this questionnaire in future studies with samples of larger size in different clinics of the country. the questionnaire seems to be useful for evaluating the quality of life of women with endometriosis. | background : the endometriosis health profile-30 (ehp-30) is a disease - specific questionnaire to measure the health - related quality of life in patients with endometriosis. the aim of this study was to evaluate the validity and reliability of the persian version of endometriosis health profile (ehp-30) in women with endometriosis referring to three gynecology clinics in tehran, iran. methods : one hundred women (20 to 50 years old) with surgically confirmed endometriosis recruited from three outpatient gynecology clinics affiliated to the iran university of medical sciences. all 100 patients were asked to complete ehp-30 questionnaire while referring to the clinics. the findings were analyzed using descriptive statistics, internal reliability consistency, construct validity (using short form-36, which had already been validated in iran), factor analysis (with principle component analysis method), and item total correlation to assess the validity and reliability of the questionnaire. results : the internal consistency reliability of the questionnaire was high (cronbach s ranged between 0.80 and 0.93 for core, and 0.78 and 0.90 for modular parts). all items were loaded on their own factors except item 17 (feeling aggressive or violent) and item 18 (feeling unwell), which were loaded on pain and social support domains, respectively. construct validity of ehp-30, established by using sf-36, indicates good correlations in several similar scales of these two questionnaires. conclusion : the findings of the study demonstrate that persian version of ehp-30 is a valid and reliable measure to assess the quality of life in women with endometriosis. |
lung cancer ranks among the most commonly occurring malignancies and currently is the leading cause of cancer - related deaths worldwide (1). it is also the most common origin of brain metastases, accounting for 40 - 50% of such cases (2). patients with brain metastases who go untreated have a median survival of 1 month and this can be prolonged for about 1 month by treatment with corticosteroids. total excision of tumor combined with radiotherapy resulted in better survival compared with radiotherapy alone (6 - 8). recently, stereotactic radiosurgery became a widely used treatment modality, achieving effective local control of brain metastases (9). radiosurgery is a noninvasive alternative to surgical excision and very useful for multiple or deep - seated lesions which can not be managed with surgery. the survival of cancer patients with brain metastases who are treated with radiosurgery is mainly influenced by the progression of their primary site tumor or extracranial metastases, rather than by the brain lesions themselves (10). because clinical pattern of disease progression is different according to type of cancer, it is necessary to investigate the clinical outcome of metastatic brain tumors in each individual type of cancer. synchronous brain metastases accompany 7.4 - 10% of newly diagnosed non - small cell lung cancer (nsclc) (1112)and the probability of the concurrent brain lesion at initial diagnosis of nsclc is much higher than other solid organ cancers. optimal treatment strategy in this specific situation can be established based on the outcome data also specific in the situation. although there have been numerous reports demonstrating that stereotactic radiosurgery provides effective local control of metastatic brain lesions, little is known about the overall outcome of nsclc with synchronous cerebral metastases treated with radiosurgery. therefore, we carried out a retrospective study to determine the survival time and identify the prognostic factors for synchronous brain metastases from nsclc in which gamma knife radiosurgery (gks) was performed as an initial treatment. in the period between may 2001 and october 2004, 35 patients with synchronous metastatic cerebral lesions from nsclc underwent gks as a part of their initial treatment (table 1). there were 27 male (77.1%) and 8 female patients (22.9%), with a mean age of 55.3 yr (range 33 - 81). we included patients whose brain lesions were diagnosed before or within 2 months from the diagnosis of the primary tumors. the cytological or histological diagnosis of the primary site tumor was carried out by means of open biopsy and/or resection, fine needle aspiration biopsy, or bronchial lavage during bronchoscopy. the histologic subtypes were adenocarcinoma in 29 patients, large cell carcinoma in 2, and unclassified in 4. in terms of the extent of the disease excluding the brain lesions, as measured by the international staging system (12), there were 3 patients with stage i, 11 with stage ii, 14 with stage iii, and 7 with stage iv. the patients ' general condition was assessed using the karnofsky performance status (kps) score. thirty patients had a kps score of 70 or more and five patients had a kps score less than 70. all of the patients underwent gks as a part of their initial treatment using leksell model b and c gamma knife. a total of 166 brain lesions were treated initially and the numbers of brain lesions were one in 9 patients, 2 in 7 patients, 3 in 7 patients and more than 3 in 12 patients. the mean number of lesions per patient was 4.7 (range 1 - 27). the mean intracranial total tumor volume was 10.6 cm (0.2 - 50.9 cm). the mean marginal dose was 18.8 gy (11 - 25 gy) and the median marginal isodose was 50% (36 - 75%) of the maximal dose. gks was performed in the several cases with extraordinary large volume or number of lesions if they would have no available treatment options in case of progression after wbrt only and their performance status was favorable. although dose planning was compromised to acquire acceptable level of predictable complication, it was assumed that even low dose of boost would provide marginal benefit with acceptable risk and cost. gks was performed more than once in 11 patients with local recurrence or the occurrence of new lesions during the follow up period. twenty seven patients received whole - brain radiotherapy wbrt) (a total dose of 3,000 cgy in 10 fractions) with interval not longer than two weeks before or after gks. the mean 5 cycles of chemotherapy, consisting of taxotere / cisplatinum, were given and second - line chemotherapy protocol consisting of gemcitabine or gefitinib (iressa) was administered additionally in 5 patients among them. survival curves were obtained by the kaplan - meier method using a statistical software program (spss, inc., comparisons of survival from the univariate analysis were conducted using the log - rank test, while the multivariate analysis was conducted using the cox proportional hazards model. the mean follow up period was 12.5 months (0.75 - 43 months) and, at the conclusion of the study, 21 patients had died and 14 were still alive. the overall median survival time was 12 months (0.75 - 43 months) from the diagnosis of brain metastasis. the survival rates were 47.7% at 1 yr and 32.5% at 2 yr, as shown in fig. 1. the causes of death were progression of the brain lesions in 7 patients (33.3%), progression of extracranial disease in 12 patients (57.2%), and unknown origin in 2 patients (9.5%). local recurrence or development of new lesions in brain occurred in 6 (17.1%) and 11 (31.4%) patients, respectively. mean marginal dose and tumor volume in the patient with local recurrence were 18.8 gy and 7.5 cmeach respectively. the actuarial rates without development of new lesions in the brain were 86.9% at 6 months and 59.7% at 1 yr. therefore, the survival rates without any progression of brain lesions were 80.3% at 6 months and eleven patients (31.4%) needed second or more gks up to five times and the mean interval between the first and second gks was 8.3 months. adverse effects of radiosurgery, mostly radiation necrosis, developed in 5 patients (14.3%) who were treated with mean marginal doses of 18.8 gy for mean tumor volume of 6.0 cm. major permanent disability occurred in 1 patient (2.9%) who was treated with gks twice for the same lesion. statistically significant relationship between dose / volume and local control / toxicity could not be identified. the results of the univariate analysis for those factors that may influence survival are summarized in table 2. age, n stage, kps score, wbrt, and systemic chemotherapy were found to affect survival. age younger than 60 yr old, the absence of regional lymph node involvement (n0) (fig. 3), and kps score 70 or more were favorable factors for longer survival. meanwhile, survival was not significantly influenced by sex, extracranial metastasis, number of brain lesions (fig. the median survival time for patients with one to three lesions was 12.2 months from the diagnosis of brain metastasis, while that for patients with four or more lesions was 9.8 months. multivariate analysis, designed to clarify the independent role of those prognostic factors which were identified as having a significant influence in the univariate analysis, revealed that n stage, wbrt, and chemotherapy were significant predictors for survival (p<0.05) (table 2). the mean follow up period was 12.5 months (0.75 - 43 months) and, at the conclusion of the study, 21 patients had died and 14 were still alive. the overall median survival time was 12 months (0.75 - 43 months) from the diagnosis of brain metastasis. the survival rates were 47.7% at 1 yr and 32.5% at 2 yr, as shown in fig. 1. the causes of death were progression of the brain lesions in 7 patients (33.3%), progression of extracranial disease in 12 patients (57.2%), and unknown origin in 2 patients (9.5%). local recurrence or development of new lesions in brain occurred in 6 (17.1%) and 11 (31.4%) patients, respectively. mean marginal dose and tumor volume in the patient with local recurrence were 18.8 gy and 7.5 cmeach respectively. the actuarial rates without development of new lesions in the brain were 86.9% at 6 months and therefore, the survival rates without any progression of brain lesions were 80.3% at 6 months and eleven patients (31.4%) needed second or more gks up to five times and the mean interval between the first and second gks was 8.3 months. adverse effects of radiosurgery, mostly radiation necrosis, developed in 5 patients (14.3%) who were treated with mean marginal doses of 18.8 gy for mean tumor volume of 6.0 cm. major permanent disability occurred in 1 patient (2.9%) who was treated with gks twice for the same lesion. statistically significant relationship between dose / volume and local control / toxicity could not be identified. the results of the univariate analysis for those factors that may influence survival are summarized in table 2. age, n stage, kps score, wbrt, and systemic chemotherapy were found to affect survival. age younger than 60 yr old, the absence of regional lymph node involvement (n0) (fig. 3), and kps score 70 or more were favorable factors for longer survival. meanwhile, survival was not significantly influenced by sex, extracranial metastasis, number of brain lesions (fig. the median survival time for patients with one to three lesions was 12.2 months from the diagnosis of brain metastasis, while that for patients with four or more lesions was 9.8 months. multivariate analysis, designed to clarify the independent role of those prognostic factors which were identified as having a significant influence in the univariate analysis, revealed that n stage, wbrt, and chemotherapy were significant predictors for survival (p<0.05) (table 2). recently, stereotactic radiosurgery has become a widely used treatment modality for brain metastases. however, there is still some controversy surrounding the proper indications for radiosurgery, because improved local control of brain lesions does not guarantee the improved survival of patients with a short life expectancy, due to the progression of extracranial disease. the recently reported results of an randomized trial of wbrt vs. wbrt and radiosurgery revealed that radiosurgery provided a survival gain in recursive partitioning analysis (rpa) (14)class 1 patients of 25 months vs. 5 months (8,15). this study was limited to patients with a small number (1 to 3) of brain lesions, however, there have been several reports which insisted that radiosurgery in patients with larger numbers of metastases is beneficial (16 - 19), although they were not randomized trials. in this series, we did not limit the number of brain lesions in the radiosurgical treatment. predictably, those patients with one to three lesions had a longer survival time than those with four or more lesions (12.2 vs. 9.8 months), even if this difference was not statistically significant probably due to the small number of patients in this study. however, the survival of both groups in this series is still better than the comparable data in the literature in which median survival was 3.6 months with wbrt only (3,5). at the same time, our results show that the prognosis of patients with synchronous brain metastases is not worse than those with metachronous lesions. the major cause of death in this series was the progression of systemic disease (57.2%), regardless of the initial status of the brain lesions (e.g. multiplicity or volume), and it is suggested that effective local treatment modality for brain lesions could prevent death from neurologic causes resulting in survival gain. in this series, the prognostic factors identified by the multivariate analysis were n stage, wbrt, and chemotherapy. n stage is a well known prognostic factor of nsclc and our results show that it is still significant in the patients with metastatic bran lesions. most of the patients in this study underwent wbrt and survival was longer with gks and wbrt than gks only. recently there are several reports suggesting that radiosurgery only may produce survival outcome comparable to radiosurgery plus wbrt in selected patients particularly with small number of lesions with controlled primary tumor (15,19). somewhat contradictory result of our study may be caused by the different characteristics of the patients. one third of the cases included in this study had more than 3 brain lesions and all had the primary tumor that was not controlled at the time of gks. it is thought that wbrt is still an effective treatment option in the situation of synchronous brain metastases. those patients with a better general condition and a strong motivation to recover might be preferentially selected for chemotherapy, thereby resulting in their having a longer survival. the other, more optimistic interpretation is that the delayed progression of the disease resulted from the systemic chemotherapy. systemic chemotherapy might influence not only the extracranial disease, but also the brain lesions. however, it is not possible to draw conclusions, because this study is not a randomized trial and the number of patients included is too small. whatever the right interpretation is, it is clear that the adequate control of brain lesions can prolong the patient 's survival, until death occurs as a result of systemic disease. in other words, control of the primary tumor is the most important for the further prolongation of survival, if adequate local treatment (e.g. radiosurgery with wbrt) has already been administered for the brain lesions. quality of life is an issue as important as survival and only one randomized trial reported kps outcomes for wbrt alone vs. wbrt with radiosurgery boost (21). concerning the issue however, most of the patients died due to systemic causes rather than neurological ones and it seems that major disabling symptoms in these patients were not neurological problems. our results have some practical implications in making decision of treatment strategy when the patient was diagnosed as having lung cancer with simultaneous brain lesions. if the poor prognosis is expected due to the presence of brain lesions, it is reasonable to withhold aggressive local or systemic treatment to the primary site tumor or extracranial disease. several previous studies reported improved survival with surgical excision of both the primary tumor and intracranial lesions (survival rate 56 - 66.4% at 1 yr), mostly in case of a few metastases in brain and resectable lung lesion (10,22,23). it is thought that a similar principle may be applied when the use of radiosurgery and chemotherapy is considered for patients with multiple brain lesions and advanced extracranial disease. because the treatment of brain lesions with radiosurgery can afford a substantial period of freedom from disease progression in the brain, trial of aggressive treatment to extracranial disease may improve survival. currently, the response rate of advanced stage nsclc to chemotherapy is known to be in the range of 42 - 60%, depending on the regimen (24,25). it means that at least a subgroup of patients may benefit from the aggressive treatment of their brain lesions followed by systemic chemotherapy. recently it was reported that median survival was longer with wbrt and chemotherapy for nsclc with synchronous brain metastases (58.1 weeks) than wbrt and best supportive care only (19.0 weeks) (26). this data support benefit of chemotherapy. in this study, the main cause of chemotherapeutic failure was extracranial progression, however, still there was aggravation of neurologic status in 19.6%. this issue needs to be further investigated through randomized trial and quality of life as well as survival would be another important point of consideration. in conclusion, radiosurgery should be considered as a part of initial treatment in nsclc patients with metastatic brain lesions of synchronous onset. systemic treatment following the aggressive local treatment of brain lesions may provide further survival gain. | the clinical outcome and prognostic factors of patients with synchronous brain metastases from non - small cell lung cancer (nsclc) who were treated with gamma knife radiosurgery (gks) were analyzed. a total of 35 patients with nsclc underwent gks as an initial treatment for metastatic brain lesions of synchronous onset. the period of survival and various prognostic factors such as age, gender, performance status, multiplicity of the brain lesions, intracranial tumor volume, and extent of the primary tumor were analyzed. the overall median survival time for this series was 12 months (range 0.75 to 43 months) from the diagnosis. of the 21 patients who were no longer alive at the conclusion of this study, only 7 (33.3%) died of neurological causes. multivariate analysis of these data revealed that n stage, whole - brain radiotherapy (wbrt), and chemotherapy were significant predictors for survival (p<0.05). survival of patients with nsclc and synchronous brain metastases is mainly dependent upon the progression of the systemic disease, provided that the cerebral lesions are treated adequately with local treatment modalities including radiosurgery. application of radiosurgery as an initial treatment option and aggressive local and systemic modalities to control extracranial disease may improve survival. |
twenty - five patients with tle participated in the study at sheikh zayed hospital, rahim yar khan, mayo and services hospital, lahore, pakistan from march 2013 to october 2014. the inclusion criteria for patients was the presence of seizures with temporal origin as observed by electroencephalography and unilateral lesions in magnetic resonance imaging. exclusion criteria for patients were as follows : (i) extra temporal or generalized epilepsy (iii) below average intelligence quotient (iq) level (iii) history of oxygen deprivation, other neurological illness, head injury (iv) epilepsy surgery (v) history of psychiatric illness according to the criteria mentioned in diagnostic and statistical manual of mental disorders - iv.19 twenty - five healthy volunteers matched for demographic variables such as age, gender, socioeconomic class were included in the study from local community (table 1). exclusion criteria were the same for the control group except one additional factor (that is experience of seizure). wais - wechsler adult intelligence scale, dass - depression, anxiety and stress scale, ei - emotional intelligence, t (24)= 1.48, p=0.15, t (24)= 50.14, p<0.001 approval for the study was obtained from the board of studies of the islamia university of bahawalpur, bahawalpur, pakistan and was conducted according to the principles of helsinki declaration. intelligence quotient was measured using wechsler adult intelligence scale.20 the test is highly reliable with alpha ranged from 0.70 - 0.90 and inter - scorer coefficient high as 0.90. depression, anxiety, and stress were assessed using depression, anxiety, and stress scale.21 it is a 42-item scale that is used to measure depression, anxiety, and stress on a 4-point likert scale. scores on each subscales are categorized as : depression (normal=0 - 9, mild=10 - 13, moderate=14 - 20, severe=21 - 27), anxiety (normal=0 - 7, mild=8 - 9, moderate=10 - 14, severe=15 - 19), and stress (normal=0 - 14, mild=15 - 18, moderate=19 - 25, and severe=26 - 33). depression, anxiety, and stress scale are highly reliable with cronbach s alpha 0.96 for depression, 0.89 for anxiety, and 0.93 for stress.22 emotional quotient inventory (eq - i)23 was used as a measure of ei. it is a 133-item self - report inventory scale from 1=very seldom / not true of me to 5=very often / true of me. the ei scores were interpretation as 130 and above = atypically well developed emotional capacity, 120 - 129=extremely well developed emotional capacity, 110 - 119=well developed emotional capacity, 90 - 109=adequate emotional capacity, 80 - 89= underdeveloped emotional capacity, 70 - 79=extremely underdeveloped emotional capacity, under 70=atypically under developed emotional capacity. the reliability of eq - i is between alpha 0.60 - 0.70. in a pilot study, it was ensured that facial expression of emotions presented in photographs were recognizable by patients and healthy individuals (20 patients with tle and 20 healthy individuals). the experiment was designed in an alternating run paradigm of task- switching11 using e - prime software.24 participants were required to switch between emotion -age categorization of faces in 241 trials. the experiment was presented on computer screen and manual responses were made (key press young=1, old=2, happy=3, neutral=4). half trials of the experiment were switch (that is task changed) whereas other half were repeat trials (that is task repeated). statistical analysis was performed by the statistical package for social sciences system (version 12.0, chicago, il, usa). (a) a 2-factor analysis of variance (anova) was performed with quotient (iq and eq) as within subject and group (patients with tle versus healthy controls) as between subject factors to examine whether groups were different on iq and eq scores. (b) task - switching data : response times (rts) were removed meeting the following criteria : (i) standing above 2.5 standard deviation above the each participants mean (ii) for the first trial due to a no switch trial (iii) for incorrect trials. task switch costs were calculated by subtracting mean rts on repeat trials from mean rts on switch trials. the rt and error data were submitted to conduct separate repeated measures of anova with factors as trial (switch versus repeat trials : within subject) and group (patients with tle versus healthy controls : between group). t - test was performed to examine differences between groups on switch costs and rts on trials. errors for the first trial were also removed from 2 x 2 anova with trial (switch versus repeat trials : within subject) and group (patients with tle versus healthy controls : between group) (c) regression analysis was performed to assess the relationship between task switch costs and scores on ei. twenty - five patients with tle participated in the study at sheikh zayed hospital, rahim yar khan, mayo and services hospital, lahore, pakistan from march 2013 to october 2014. the inclusion criteria for patients was the presence of seizures with temporal origin as observed by electroencephalography and unilateral lesions in magnetic resonance imaging. exclusion criteria for patients were as follows : (i) extra temporal or generalized epilepsy (iii) below average intelligence quotient (iq) level (iii) history of oxygen deprivation, other neurological illness, head injury (iv) epilepsy surgery (v) history of psychiatric illness according to the criteria mentioned in diagnostic and statistical manual of mental disorders - iv.19 twenty - five healthy volunteers matched for demographic variables such as age, gender, socioeconomic class were included in the study from local community (table 1). exclusion criteria were the same for the control group except one additional factor (that is experience of seizure). wais - wechsler adult intelligence scale, dass - depression, anxiety and stress scale, ei - emotional intelligence, t (24)= 1.48, p=0.15, t (24)= 50.14, p<0.001 approval for the study was obtained from the board of studies of the islamia university of bahawalpur, bahawalpur, pakistan and was conducted according to the principles of helsinki declaration. intelligence quotient was measured using wechsler adult intelligence scale.20 the test is highly reliable with alpha ranged from 0.70 - 0.90 and inter - scorer coefficient high as 0.90. depression, anxiety, and stress were assessed using depression, anxiety, and stress scale.21 it is a 42-item scale that is used to measure depression, anxiety, and stress on a 4-point likert scale. scores on each subscales are categorized as : depression (normal=0 - 9, mild=10 - 13, moderate=14 - 20, severe=21 - 27), anxiety (normal=0 - 7, mild=8 - 9, moderate=10 - 14, severe=15 - 19), and stress (normal=0 - 14, mild=15 - 18, moderate=19 - 25, and severe=26 - 33). depression, anxiety, and stress scale are highly reliable with cronbach s alpha 0.96 for depression, 0.89 for anxiety, and 0.93 for stress.22 emotional quotient inventory (eq - i)23 was used as a measure of ei. it is a 133-item self - report inventory scale from 1=very seldom / not true of me to 5=very often / true of me. the ei scores were interpretation as 130 and above = atypically well developed emotional capacity, 120 - 129=extremely well developed emotional capacity, 110 - 119=well developed emotional capacity, 90 - 109=adequate emotional capacity, 80 - 89= underdeveloped emotional capacity, 70 - 79=extremely underdeveloped emotional capacity, under 70=atypically under developed emotional capacity. the reliability of eq - i is between alpha 0.60 - 0.70. in a pilot study, it was ensured that facial expression of emotions presented in photographs were recognizable by patients and healthy individuals (20 patients with tle and 20 healthy individuals). the experiment was designed in an alternating run paradigm of task- switching11 using e - prime software.24 participants were required to switch between emotion -age categorization of faces in 241 trials. the experiment was presented on computer screen and manual responses were made (key press young=1, old=2, happy=3, neutral=4). half trials of the experiment were switch (that is task changed) whereas other half were repeat trials (that is task repeated). statistical analysis was performed by the statistical package for social sciences system (version 12.0, chicago, il, usa). (a) a 2-factor analysis of variance (anova) was performed with quotient (iq and eq) as within subject and group (patients with tle versus healthy controls) as between subject factors to examine whether groups were different on iq and eq scores. (b) task - switching data : response times (rts) were removed meeting the following criteria : (i) standing above 2.5 standard deviation above the each participants mean (ii) for the first trial due to a no switch trial (iii) for incorrect trials. task switch costs were calculated by subtracting mean rts on repeat trials from mean rts on switch trials. the rt and error data were submitted to conduct separate repeated measures of anova with factors as trial (switch versus repeat trials : within subject) and group (patients with tle versus healthy controls : between group). t - test was performed to examine differences between groups on switch costs and rts on trials. errors for the first trial were also removed from 2 x 2 anova with trial (switch versus repeat trials : within subject) and group (patients with tle versus healthy controls : between group) (c) regression analysis was performed to assess the relationship between task switch costs and scores on ei. results showed a significant interaction between quotient and group f (1, 48)=784.82, p=0.001, hp2= 0.94, table 1. main effects of trial f (1, 48)=122.07, p=0.001, hp2=0.71 and group f (1, 48)=21.84, p=0.001, hp2=0.31 were significant. the rts were slower on switch trials as compared to repeat trials (m=2750.00 ms versus 1686.00 ms). patients with tle performed slower than healthy control subjects (m=2778.49 ms versus 1657.00 ms). the interaction between trial and group was also significant f (1, 48)=25.09, p=0.001, hp2=0.34. switch costs for patients with tle was larger than healthy controls t (24)=4.77, p=0.001, m= 773.39 ms versus 291.00 ms. patients with tle performed slower as compared to control group both on switch trials t (24)=5.95, p=0.001, m=3552.00 ms versus 1948.00 ms and on repeat trials t (24)=2.62, p=0.01, m=2005.10 ms versus 1366.16 ms. error data : main effects of trial f (1, 48)= 0.18, p=0.66, hp2=.00 was not significant (switch m=.02 ; repeat m=.02). the main effect of group was significant f (1, 48)= 5.87, p<0.01, hp2= 0.10 was significant. the interaction between trial, and group was significant f (1, 48)= 3.84, p=0.05, hp2=.07, patients with tle (switch m=.03, repeat m=.02) controls (switch m=.01, repeat m=.01). patients with tle showed lower ei scores as compared to healthy controls t (24)= 5.94, p=0.001, patients (m= 77.84, sd=15.17) controls (m= 101.00, sd=8.66). regression analysis was conducted with ei and laterality as independent and switch cost as dependent variable. the ei proved to be a significant predictor of task switch costs f (2, 49)= 11.91, p=0.001. coefficient of standard regression showed that ei scores had negative contribution towards switch costs, b= -0.57, t=2.25, p=0.02 whereas lateralization failed to reach the level of significance b= -0.00, t=0.02, p=0.97. results showed a significant interaction between quotient and group f (1, 48)=784.82, p=0.001, hp2= 0.94, table 1. main effects of trial f (1, 48)=122.07, p=0.001, hp2=0.71 and group f (1, 48)=21.84, p=0.001, hp2=0.31 were significant. the rts were slower on switch trials as compared to repeat trials (m=2750.00 ms versus 1686.00 ms). patients with tle performed slower than healthy control subjects (m=2778.49 ms versus 1657.00 ms). the interaction between trial and group was also significant f (1, 48)=25.09, p=0.001, hp2=0.34. switch costs for patients with tle was larger than healthy controls t (24)=4.77, p=0.001, m= 773.39 ms versus 291.00 ms. patients with tle performed slower as compared to control group both on switch trials t (24)=5.95, p=0.001, m=3552.00 ms versus 1948.00 ms and on repeat trials t (24)=2.62, p=0.01, m=2005.10 ms versus 1366.16 ms. error data : main effects of trial f (1, 48)= 0.18, p=0.66, hp2=.00 was not significant (switch m=.02 ; repeat m=.02). the main effect of group was significant f (1, 48)= 5.87, p<0.01, hp2= 0.10 was significant. the interaction between trial, and group was significant f (1, 48)= 3.84, p=0.05, hp2=.07, patients with tle (switch m=.03, repeat m=.02) controls (switch m=.01, repeat m=.01). patients with tle showed lower ei scores as compared to healthy controls t (24)= 5.94, p=0.001, patients (m= 77.84, sd=15.17) controls (m= 101.00, sd=8.66). regression analysis was conducted with ei and laterality as independent and switch cost as dependent variable. the ei proved to be a significant predictor of task switch costs f (2, 49)= 11.91, p=0.001. coefficient of standard regression showed that ei scores had negative contribution towards switch costs, b= -0.57, t=2.25, p=0.02 whereas lateralization failed to reach the level of significance b= -0.00, t=0.02, p=0.97. this study was designed to examine (i) the cognitive and emotional profile of patients with tle (ii) the contribution of ei in task - switching performance. across different studies, patients with tle demonstrate cognitive deficits but one aspect of cognitive functioning (that is task - switching) has not been examined. we sought to examine the status of switching between dual - tasks in patients with tle. in contrast to the traditional task - switching experiments which considered number - letter - word switching, we used faces as stimuli. we expected that task - switching, ei or a causal link between these 2 factors possibly could explain social difficulties in patients with tle. in contrast, to healthy individuals, patients with tle demonstrated a larger switch cost which reflected difficulties in task - set shifting. switching between tasks requires attentional control in case the task gets alternated and the previously relevant task becomes irrelevant. at this stage, task relevant - rule needs to be retrieved from working memory to make a correct response to the stimuli along with extra inhibitory processes to reduce interference from the irrelevant task - set. neuropsychological findings suggest that better task - switching and inhibition are correlated with greater integrity of white matter microstructures that support cortical - subcortical and cross - cortical connections of the prefrontal cortex.25 the performance on measures of set - shifting correlates with front temporal fiber tract integrity in healthy individuals that remains attenuated or absent in patients with tle.26 thus, there is a failure in formation of a typical bond between structure and function in patients with tle particularly atypical communication between mesial temporal and frontoparietal neural network. these abnormalities underlie cognitive morbidity in tle. as compared to healthy individuals, patients with tle demonstrate worse performance on 2 measures of set - shifting trail making test - b that measures visuomotor number - letter set - shifting and verbal fluency category switching test that examines verbal ability to alternate between selection of words from 2 different overlearned semantic categories quickly in 60 seconds.27 evidence from neuropsychological and neuroimaging studies suggests that set - shifting and working memory in relation to executive functions as measured by wisconsin card sorting test are compromised in patients with tle. various other executive functions such as theory of mind and decision - making are also vulnerable.28 patients with tle show marked deficits in attentional control during elevator counting with distraction and set - shifting as measured by odd - man - out test.29 our task - switching data also showed an overall slow processing speed of patients with tle than healthy individuals. this result can be attributed to disintegrated white matter in the prefrontal cortex and reduced cerebellar volume.30,31 patient with tle were impaired in ei. this result is consistent with previous studies that assessed ei in connection with tle.8,9 the important result here is that ei predicted task - switching performance. studies in the field of neuropsychology revealed overlapping neural system controlling cognitions and social interactions. frontal cortex has a significant role in task - switching and emotional concerns.15 patient studies further strengthened this idea for instance lesions of the prefrontal cortex impair emotion processing, empathy and cognitive flexibility.16 in frontotemporal dementia where degeneration of the prefrontal cortex occurs, a rapid decline in understanding of emotions and executive functioning has been observed.17 dysfunctions of the prefrontal cortex can be seen in autism spectrum disorder where patients show deficits in emotional attachments and cognitive performance.18 in conclusion, patients with tle exhibit marked changes in executive and emotional functioning including task - switching and ei. these changes are believed to be dependent on structural and functional abnormalities in frontal cortex and temporal lobe. the ei successfully predicts task - switching deficits. therapeutic interventions based on the development of ei must be formulated to decrease cognitive impairment related with tle. therapeutic interventions based on the development of ei must be formulated to decrease cognitive impairment related with tle. | objectives : to examine the role of emotional intelligence (ei) in task - switching performance of patients with temporal lobe epilepsy (tle).methods : an experimental research design conducted at sheikh zayed hospital, rahim yar khan, mayo and services hospital, lahore, pakistan from march 2013 to october 2014. twenty - five patients with tle and 25 healthy individuals from local community participated in the study. participants completed measures of intelligence, ei, depression, anxiety, stress, and task - switching experiment.results:patients and controls showed an average intelligence quotient, and normal levels of depression, anxiety, and stress. in contrast to controls, patients showed lower ei and impaired task - switching abilities. this result can be seen in the context of disintegrated white matter and cerebral connectivity in patients with tle. emotional intelligence was found to be a significant predictor of task - switching performance.conclusion:emotional intelligence is a potential marker of higher order cognitive functioning in patients with tle. |
the adaptive and maladaptive environmental responses of crops and humans to current environments reflect our evolutionary heritages. natural selection over millennia is unlikely to have missed simple, tradeoff - free improvements (denison. simple refers here to the sorts of mutations that arise frequently in any population of sufficient size, such as those leading to increases in expression of a given gene, or single amino acid substitutions in a given enzyme (obviously, some more - complex changes have never arisen in a given species and therefore never been tested by natural selection). tradeoff - free improvements are those that increase fitness under all conditions (wet and dry, for example), such as an increase in the efficiency of a key enzyme without, for example, a narrowing of its temperature range. my central hypothesis is that, for any given gene, there is at least one (often several) possible mutation that could increase its expression. mutation rates for plants and humans are about 2 10 per base per generation (koch. 2000 ; kondrashov 2002), so if there are five different mutations (somewhere in the genome) that would increase the expression of a given gene, one plant in 10 would have such a mutation. with 50 000 maize plants per hectare, each square kilometer would have a 50:50 chance of including such a mutant in a given year. measuring the frequency of rare mutations in the field would be difficult, but they are readily detected by response to selection, even over much shorter periods than the evolutionary histories of crops or humans, and even in much smaller populations than found in nature (moose. given that mutants increasing the expression of any given gene must have arisen repeatedly over evolutionary history, the failure of these mutants to persist must be the result of selection rather than random drift. given this past history of selection, opportunities for further tradeoff - free improvements (those hypothetical changes increasing fitness under all conditions) are now rare or nonexistent. therefore, crop geneticists who increase the expression of existing genes (e.g., for drought tolerance) are presumably recreating options already rejected by natural selection. similarly, drugs or dietary supplements that simply up- or down - regulate existing physiological mechanisms recreate phenotypes that reduced average fitness under past conditions. in both agriculture and medicine, however, some options rejected by natural selection may suit our purposes admirably. i will argue that discrepancies between natural selection and human goals represent low - hanging fruit : opportunities for relatively easy improvements. often, rejection of a trait by natural selection was based on tradeoffs that may also unacceptable by current human criteria (e.g., sacrificing growth under good conditions for better growth under drought). for example, a recent paper acknowledges that a drought - tolerant transgenic maize genotype had the same paper claims that a new transgenic line with greater expression of a particular transcription factor has higher yield at p < 0.1, relative to unspecified controls, when drought is imposed during flowering. if my central hypothesis is correct, then mutants with increased expression of that transcription factor must have arisen repeatedly in maize and its wild ancestors, but always died out because greater expression of this transcription factor decreased fitness more often than it increased fitness, at least under ancestral conditions. nelson. did not report yield comparisons under well - watered conditions, for example. if independent tests showed that the transgenic drought - tolerant genotype has greater fitness (in direct competition with its parental genotype) under all conditions, that would show that my central hypothesis is not universally true. tradeoffs or constraints that continue to limit our ability to improve our crops or our health include those based on conservation of matter for each chemical element, particularly nitrogen and carbon. this constraint limits the ability of either natural selection or crop geneticists to simultaneously increase seed yield and seed protein concentration with a given amount of nitrogen, for example, or to increase allocation to grain in perennials without sacrificing over - winter survival (denison and kiers 2005 ; denison 2009). a less - obvious example is the tradeoff between co2-specificity and turnover rate of rubisco (tcherkez. 2006), which may undermine molecular biologists longstanding fantasy (zelitch 1975 ; somerville and ogren 1982 ; mann 1999) of improving this key photosynthetic enzyme. principles of engineering suggest that the relationship between maximum short - term yield and sustainability will inevitably be negative. it does seem unlikely that the genotype / management combination that maximizes short - term yield would also maximize sustainability. on the other hand, simultaneous improvements in both (relative to current practices) breeding for disease resistance, for example, may increase both current yield and sustainability, by increasing production of both grain and root, with the latter contributing to soil organic matter and therefore sustainability. it is also worth noting that opportunities to improve the overall design of agricultural ecosystems (species composition, spatial and temporal patterns, etc.) may be more common than opportunities to improve the physiology of crops, as the latter has been more consistently improved already, by millennia of natural selection (denison. the arguments in this paper only apply to those genetic improvements or medical interventions simple enough that they (or their phenotypic equivalents) have been repeatedly tested by natural selection. prior to biotechnology, for example, plants making the bacterial bt toxin never competed against plants without that specific toxin, so we can not argue that this is an option rejected by past natural selection because it decreased fitness. however, many examples of herbivores evolving resistance to chemically diverse plant toxins do suggest that benefits will be short - lived. a more - creative example of a radical innovation is the re - engineering of arabidopsis thaliana to release photorespiratory co2 in chloroplasts rather than mitochondria, thereby increasing photosynthetic efficiency (kebeish. our ability to design and implement such innovations will presumably increase (denison 2007), but such examples are currently rare. so long as we are only tinkering with existing genes, we will be constrained by many of the same tradeoffs that constrained past natural selection. natural selection tends to increase geometric mean fitness (simons 2009), but we may choose a different balance between risk and potential reward. tradeoffs between adaptation to past versus present conditions are probably common, creating opportunities for improving crop adaptation to new conditions, while sacrificing some adaptation to the conditions under which they evolved. in some cases, those past conditions may no longer even exist anywhere on earth. comparing today 's plants with old herbarium specimens showed that stomatal numbers have decreased as atmospheric co2 has increased (woodward 1993), maintaining photosynthesis while reducing water loss (this could be the result of evolution or of developmental plasticity). such evolutionary trends may lag behind what would be optimal, leaving opportunities for humans to accelerate adaptation. this paper focuses on tradeoffs between human agricultural and health goals and the darwinian fitness of individuals, rather than tradeoffs between individual fitness in past versus present environments. the resulting opportunities are illustrated with three examples, based on tradeoffs between individual - plant fitness and the collective performance of a crop - plant community, between the fitness of symbiotic rhizobia and that of their legume hosts, and between human fertility and longevity in the context of growing or shrinking populations. as noted earlier, some proposed crop genetic improvements or medical interventions are so radical that we can not assume they have been already been rejected by natural selection. many such innovations will nonetheless involve tradeoffs, of course. beyond some threshold of innovational complexity, however, negative side - effects become only a possibility, rather than a high probability based on previous rejection by natural selection. to illustrate the sophistication of natural selection, relative to much of current biotechnology, i will first discuss the evolution of agricultural weeds, particularly echinochloa spp. then, i will briefly discuss the repeated evolution of a particular innovation that increases photosynthesis and water - use efficiency (wue), two traits that are the key to crop yield potential. natural selection had millions of years to improve photosynthetic efficiency and water use in the wild ancestors of our crops. evolution of herbicide resistance has a much shorter history. yet, by 1997, more than one hundred weed species in 42 countries had evolved resistance to various herbicides (heap 1997). evolution of resistance to glyphosate, in particular (vangessel 2001 ; yu. 2007), reinforces concerns about the useful life of glyphosate - resistant crops. by 2000, watergrass had evolved resistance to four different herbicides commonly used in california rice fields (fischer. evolving resistance need not require complex genetic changes, so mutants with this trait presumably arose repeatedly, only to be rejected by natural selection until herbicide use made the trait beneficial. but i argue that natural selection has also tested a variety of more - complex solutions to challenges that were faced by the ancestors of our crops. watergrass evolved from barnyard grass, echinochloa crus - galli, in asian rice fields within the last few thousand years. barnyard grass is killed by flooding, so it is rarely a problem in flooded rice fields. but watergrass evolved aerenchyma, air - filled channels that supply its roots with oxygen, so it can tolerate flooding. most of watergrass 's evolutionary history preceded the invention of herbicides, so weeds were controlled by hand cultivation. the resulting evolutionary changes were sufficient that watergrass was found to be more similar to rice in many [visual ] attributes than it is to its own close relative, barnyardgrass (barrett 1983). there are many other examples of crop mimicry by weeds and their seeds, with the latter helping weed seeds get harvested, stored, and replanted along with crops. these examples show the greater sophistication of natural selection, relative to most current biotechnology. but mimicking the appearance of a crop is not the sort of trait likely to be the key to crop productivity. so, how much progress has biotechnology made in improving traits like photosynthetic efficiency, or the ability to grow and reproduce under drought, relative to what natural selection has already achieved ? natural selection 's best - known photosynthetic innovation is c4 photosynthesis, which increases photosynthetic efficiency and greatly increases wue (kellogg 1999). co2 is pumped into bundle - sheath compartments, enhancing photosynthetic efficiency there while eliminating wasteful photorespiration. this transfer of co2 also increases wue, by reducing the co2 concentration at the inner end of stomatal pores, increasing the flux of co2 into the leaf relative to transpirational water loss through the stomata. this adaptation required major changes in both the structure and the biochemistry of leaves, dwarfing anything biotechnology has yet attempted. nonetheless, c4 photosynthesis has evolved independently at least 31 times (kellogg 1999). it therefore seems unlikely that natural selection has missed consistently beneficial changes to c3 photosynthesis simpler than (i.e., arising by mutation more frequently than) those that resulted in c4 photosynthesis. biotechnology, meanwhile, has repeatedly promised improvements in photosynthetic efficiency (mann 1999) and wue (marris 2008 ; pennisi 2008), without delivering either. some c4-related genes have been transferred to rice, but that actually reduced its photosynthesis (matsuoka. no transgenic crop has been shown, in independent and peer - reviewed field tests, to outperform the best varieties developed through conventional plant breeding, based on improvements in either of these traits. eventually, it will presumably be possible to design and implement genetic changes very different from anything that has arisen naturally, as in the arabidopsis photorespiration example above (kebeish. predicting all of the agronomic consequences of such changes will be difficult, but we can not assume that such changes would have been rejected by natural selection. so far, however, most of progress in improving crop performance under drought has come via conventional plant breeding and has implicitly or explicitly used the tradeoff - cognizant approach advocated in the next section. drysdale wheat (condon. 2004) clearly discusses some of the tradeoffs that affect crop growth and yield in dry environments. of several key variables that affect leaf wue (photosynthesis / transpiration) in a given environment, only one depends strongly on genotype : leaf - interior co2 concentration, or ci. leaf - tissue carbon - isotope ratios were used to select for lower average ci, which increases wue by increasing co2 flux into the leaf, relative to transpirational water loss (rebetzke. increasing leaf - protein concentration can increase co2 fixation and thereby reduce ci, increasing wue. for a plant with a given nitrogen supply, however, there is a tradeoff between leaf - protein concentration and total leaf area, by conservation of matter. with less leaf area, more sunlight will hit soil rather than leaves, evaporating water without contributing to photosynthesis and yield. another way to get lower ci and increased wue is to close stomata more tightly, perhaps especially at times when low humidity decreases wue. however, using soil water more efficiently makes it last longer, allowing photosynthesis to continue for more weeks. drysdale yields up to 40% more than older varieties, under the driest conditions, and about as much as older varieties under wetter conditions. so the tradeoffs just discussed apparently do not result in an agronomic tradeoff, over the range of conditions tested. probably because the water conserved in the soil when one plant closes its stomata can be used by a competing neighbor.. they all would benefit if they all used water mainly at those times (humid mornings) when wue is greatest. but a cheater that uses water all day will produce more seeds than the neighbors with which it shares the soil - water commons. natural selection works for the benefit of individual alleles (e.g., alleles for less restraint in resource use) and individuals, which can sometimes conflict with the common good of plant or animal communities (dawkins 1976). a few years before dawkins popularized this point, the australian agronomist colin donald hypothesized that there are often tradeoffs between the competitive ability of cultivars against other genotypes on the one hand, and their capacity for yield in pure culture on the other (donald 1968). natural selection will usually favor competitiveness in such cases, but plant breeders can reverse the effects of past natural selection and select for better crop - community performance. drysdale wheat and predict that careful tests would show that selection for wue came at some cost to competitiveness. stomatal opening is not the only basis for such tradeoffs ; natural selection can lead to wasteful over - investment in roots in dry environments, with each plant essentially stealing soil water from beneath its neighbors, with no overall benefit to the crop community (zhang. 1999). again, a clear demonstration that drysdale out - competes its parent under all conditions would undermine my central hypothesis. the best - known tradeoff between individual - plant competitiveness and crop - community performance is that linked to stem height. height was only one of the several traits discussed by donald (1968), but it proved to be the key to the yield increases of the green revolution. for example, short - stemmed rice has much higher grain yield, because it does not waste resources making taller stems. in competition with taller but lower yielding varieties, however, the high - yield variety disappeared within three years (jennings and de jesus 1968). the yield advantage of shorter rice and wheat, relative to taller varieties, does not depend on nitrogen fertilizer (austin. 1980 ; khush 1999), but good weed control is essential. i have discussed the potential for improving whole - crop performance at the expense of individual competitiveness in greater detail elsewhere (denison. 2010). to some extent, suppression of competitors of another species (e.g., weeds) is a public good, which may have net fitness costs for individuals that invest too much in shading weeds. a perennial plant like alfalfa may benefit from using solar tracking to shade its neighbors, even if it, thereby, reduces its own photosynthesis slightly by also shading its own lower leaves (denison. 2010). this is because those neighbors may produce seedlings that will compete with the same perennial plant in future years. but seeds produced by competitors this year have no direct effect on the fitness of an annual plant, like wheat. the resulting seedlings might compete with the plant 's own seedlings, but that is far from certain. so it is possible that natural selection has invested less in cooperative shading of weeds by annual crops than would be ideal in agriculture (weiner. 2010). to summarize, natural selection is unlikely to have missed simple improvements (e.g., changes in gene expression) that would consistently have increased the individual fitness of our crop plants or their wild ancestors in past environments. more - complex changes, such as importing novel genes from bacteria, have presumably not been tested in plants by natural selection, so their absence in extant crops is not evidence that their benefits will be limited by tradeoffs. but some of the greatest opportunities for improving crop performance may come from reversing past natural selection, in cases where there are tradeoffs between individual - plant fitness and the collective performance of communities of crop plants (donald 1968). even if neighboring plants are now all genetically identical, their evolutionary legacy of past competition may cause wasteful me first use of shared resources like soil water, or stem - growth arms races to capture a larger share of available sunlight, or under - investment in cooperative suppression of weeds. as a second example, consider crop interactions with other species, such as pollinators or pests. in particular, once rhizobia have colonized a legume root nodule, why should they invest scarce resources in supplying their host plant with nitrogen ? a plant with more nitrogen may photosynthesize more (bethlenfalvay. 1978) and share some of the photosynthate with its rhizobia. but each plant is typically colonized by several competing strains, creating a potentially tragic commons. if benefits from a healthier host are shared equally among strains, natural selection will favor those that divert resources from nitrogen fixation to their own reproduction (denison 2000 ; west.. the evolutionary persistence of symbiotic nitrogen fixation can be explained, however, because benefits are not always shared equally. in soybean and in wild lupine, rhizobia that fix less nitrogen (genetically, or because they were exposed to nitrogen - free air) reproduce less inside nodules. partner choice (simms. 2006), without any evidence for actual comparisons among partners, or 2003), which could have the unintended implication that a change in the behavior of individual rhizobia is expected. we assume, however, that the symbiotic behavior of rhizobia is programmed by their dna and that any improvement in rhizobial mutualism from sanctions results from host - imposed selection among strains, acting over generations. if this is true, then some of the benefits of sanctions accrue to future generations of legumes (oono. 2009), just as some of the benefits from shading of weeds by wheat go to future generations of wheat. to some extent, individual plants imposing sanctions may get an immediate benefit, wasting fewer resources on less - beneficial rhizobia (west. but, in evolution as in economics, individuals tend to invest less when benefits are shared with some larger group. for example, people are willing to pay for the individual benefit they get from vaccination, but not for herd immunity (althouse. similarly, natural selection might lead to legumes tolerating mediocre rhizobia the marginal benefit of receiving some nitrogen could still exceed the marginal cost, to the individual plant, of supplying those rhizobia with carbon rather than killing those rhizobia to protect future generations of legumes. we could perhaps breed legume crops and forages that help whichever rhizobia are providing them with the most nitrogen (ideally, relative to their carbon use) to reproduce copiously in their nodules, while killing less - efficient rhizobia. a possible selection scheme would be to grow different legume genotypes in pots with diverse rhizobia, then select among the seed saved from those plants, based on the performance of a subsequent set of test plants in the same pots. if the test plants were genetically identical to each other, then differences in their growth would partly depend on the effects of the first plants on the soil rhizobia population. other residual effects, e.g., on soil - borne pathogens, could also contribute, of course. but identifying genotypes that reduce the pathogen populations could be just as valuable as identifying genotypes that improve the rhizobial commons. differences among soybean cultivars in their response to mixtures of effective and ineffective rhizobia are consistent with the possibility of differences in sanctions among cultivars (kiers. 2007), so it may be possible to improve this trait, by agricultural criteria, beyond what natural selection has performed. my final example is based on tradeoffs between reproduction and longevity, as proposed by the antagonistic pleiotropy hypothesis (williams 1957), which is widely hypothesized to explain aging in humans and other species. humans, i suspect, might be willing to trade some fertility for longevity, in ways that natural selection has not. but how might we do this ? there is plenty of evidence for the tradeoffs that are central to the antagonistic pleiotropy hypothesis. risks associated with reproduction itself, with physiological and psychologic readiness to reproduce, and with care of offspring all reduce the chance of surviving to reproduce again. when food is scarce, the energy costs of pregnancy and lactation can reduce maternal health and survival in humans. lactation can be a major resource sink, transferring up to 200 kg of lactose and 30 kg protein over a lifetime (prentice 2005). even when food is plentiful, women with six or more pregnancies have a 70% higher risk of stroke, as well as higher risks of cardiovascular disease and obesity, although lower rates of breast cancer (jasienska 2009). high levels of testosterone tend to increase male reproductive success, but testosterone can also have negative effects on health, including risky behavior and greater susceptibility to infection (schmid - hempel 2003 ; reed. mutations in insulin - related genes in nematodes and fruit - flies extend lifespan, but delay reproduction (barbieri. similar mutations in mice extended female lifespan (and reproduction at ages beyond 9 months), but reduced reproduction at 7 months to about half that of wildtype mice (holzenberger. given these tradeoffs, will natural selection favor reproducing as soon as possible, or delaying reproduction ? that depends on whether the size of the gene pool (i.e., the local population) is increasing or decreasing (hamilton 1966). this is because each offspring has a larger evolutionary effect if it joins a smaller gene pool rather than a larger one. we recently showed that facultative delay of reproduction during population decreases can increase relative fitness, even if total lifetime fecundity is less (ratcliff. how might population decreases be detected, reliably enough to usefully trigger delays in reproduction ? over much of our evolutionary history, food shortages were a reliable cue that population was likely to decrease. this may be why starvation diets extend lifespan in so many species (partridge and brand 2005). for example, rhesus monkeys allowed to eat as much as they wanted lived an average of 25 years, whereas those getting less of the same food averaged 32 years (bodkin. our hypothesis predicts that physiological variables associated with reproduction would be different, in ways that could reduce fertility, in these long - lived monkeys. actual reproduction, if any, could depend on various factors other than innate fertility. if a starving individual smells food, then other members of the population may be eating. in that case, the population is less likely to decrease, so it is better to reproduce earlier, despite any resulting decrease in longevity. consistent with this hypothesis, food odors reduce the longevity benefit from dietary restriction, in both nematodes and fruit - flies (alcedo and kenyon 2004 ; libert. an association between metabolic syndrome and consumption of even sugar - free (diet) sodas (dhingra. 2007 ; lutsey. 2008) could have a similar explanation. under our hypothesis, we inherited our physiological responses to sweet - tasting food or drink from ancestors who consumed these preferred foods mostly when times were good and populations were increasing. under those conditions, reproducing as soon as possible would have increased fitness, whatever the long - term health consequences. but do the psychosomatic effects of sweets really tend to increase reproductive success ? this hypothesis makes the testable prediction that, in some cultures, candy may play a role in courtship. on the other hand, consumption of less - preferred famine foods would have been associated with past population declines, which favored longevity over immediate reproduction. many bitter or otherwise distasteful plant toxins have beneficial effects on health, in low doses (mattson and cheng 2006). the indirect health benefits from even a slight decrease in fertility could outweigh direct negative effects of low toxin doses (ratcliff. juvenile mortality was assumed to vary sinusoidally, because of changing availability of food. for adults, the risk of death in a given year three genotypes, assumed to be equally abundant at time zero, differed only in the age of reproductive maturity and in whether, once mature, they ever delayed reproduction. the genotype that always matured at age 2 out - competed the genotype that always matured at age 3. populations of all three genotypes decreased, but the slightly lower mortality of the facultative - delay genotype caused it to decrease less. even though only half of the individuals of this genotype were assumed to delay reproduction environmental cues like consumption of famine foods are unlikely to be 100% accurate this genotype doubled its proportional representation over the course of two famines. facultative delay of reproduction (only when consumption of famine foods predicts a population decrease) increased fitness, relative to always or never delaying reproduction. we conclude that past natural selection could indeed have linked fertility to environmental cues associated with past population decreases. this can explain why dietary restriction (partridge and brand 2005), stresses like increased temperature (maynard smith 1958 ; hercus. 2003), and perhaps consumption of traditional famine foods (ratcliff. 2009) extend lives, at the expense of fertility. it also explains why food odors (alcedo and kenyon 2004 ; libert. 2007) and consumption of even sugar - free soft drinks (dhingra. 2007 ; food quantity and quality, temperature stress, food odors, and sweet tastes all provide information that have often predicted changes in overall population size. humans and other species therefore evolved neurologic and physiological responses that reduce fertility when population size is likely to decrease, thereby increasing the chances of surviving to contribute offspring to a smaller future gene pool. the practical implications of our hypothesis, if correct, are that it may be possible to significantly extend human lives, if we are willing to accept some reduction in fertility. we just need to provide our bodies with cues that, over relevant parts of our evolutionary history, reliably predicted population declines. eating less, or eating plants that contain low doses of certain natural toxins, could help move the hypothetical reproduction - versus - longevity switch toward greater longevity. pharmaceutical approaches may also be possible, as we identify the signaling pathways that lead to this switch, although the risks of unexpected side - effects might be greater for novel compounds. some day, we may understand the inner workings of plants, beneficial microbes, or humans and their interactions with their environments well enough to design and implement wholesale genetic changes or medical interventions from first principles, confident in our ability to predict all of the effects. many of the improvements attempted today, however, involve relatively simple changes, such as increasing the expression of an existing gene. in predicting the overall consequences of such changes often, however, options rejected by natural selection may be quite acceptable, by human criteria. by sacrificing a little individual - plant fitness, we can develop crops that use shared resources more efficiently and improve soil microbial communities in ways that benefit subsequent crops. similarly, if we are willing to sacrifice teen pregnancy, we may be able to live longer and healthier lives. | the repeated evolution of complex adaptations crop mimicry by weeds, for example, or co2-concentrating c4 photosynthesis shows the power of natural selection to solve difficult problems that limited fitness in past environments. the sophistication of natural selection 's innovations contrasts with the relatively simple changes (e.g., increasing the expression of existing genes) readily achievable by today 's biotechnology. mutants with greater expression of these genes arose repeatedly over the course of evolution, so their present rarity indicates rejection by natural selection. similarly, medical interventions that simply up- or down - regulate existing physiological mechanisms presumably recreate phenotypes also rejected by past natural selection. some tradeoffs that constrained past natural selection still apply, such as those resulting from conservation of matter. but tradeoffs between present human goals and individual fitness in past environments may represent fairly easy opportunities to achieve our goals by reversing some effects of past selection. this point is illustrated with three examples, based on tradeoffs between (i) individual - plant fitness versus whole - crop performance, (ii) the fitness of symbionts (rhizobia) versus that of their legume hosts, and (iii) human fertility versus longevity in the context of environmental cues, such as consumption of famine foods, that predict trends in population size. |
vietnam is one of the countries most affected by highly pathogenic h5n1 influenza a viruses. to evaluate the potential pathogenicity in mammals of h5n1 viruses isolated from humans in vietnam, we determined the sequences of all eight genes of 22 human isolates collected between 2003 and 2008 and compared their virulence in mice. the isolates were classified into clade 1 and clade 2.3.4 and differed in pathogenicity for mice. whilst lysine at position 627 of pb2 (pb2 - 627k) is a critical virulence determinant for clade 2.3.4 viruses, asparagine at position 701 of pb2 and other unknown virulence determinants appear to be involved in the high pathogenicity of clade 1 viruses, warranting further studies to determine the factors responsible for the high virulence of h5n1 viruses in mammals. |
|
(cse) anaesthesia offers a safe and inexpensive technique with the advantage of both spinal and epidural anaesthesia. it provides faster onset of surgical anaesthesia and prolongs the duration of post - operative pain relief. the addition of opioids, which are the most commonly used adjuvants, to neuraxial anaesthesia is effective in prolonging the analgesic effect but has also been associated with adverse effects such as respiratory depression, nausea, urinary retention and pruritus, so various options including 2 agonists are extensively evaluated as an alternative. 2 agonists when used as adjuvant in central neuraxial blockade produce significantly lower post - operative pain scores without any of these opioid - related side effects. studies comparing effects of the two 2 agonists dexmedetomidine and clonidine on spinal and epidural anaesthesia have found that both produce a similar prolongation in the duration of the motor and sensory block with preserved haemodynamic stability and sedation. clonidine, as an adjuvant with local anaesthetics, increases the duration of pain relief after intrathecal or epidural administration but is associated with significant hypotension and bradycardia. literature search revealed very few studies using clonidine and local anaesthetics sequentially via different routes in cse to assess the influence of clonidine on characteristics of subarachnoid block (sab). an attempt was made by this study to determine whether administration of clonidine alone as epidural adjuvant in cse would provide prolonged analgesia without causing significant haemodynamic side effects. the study was undertaken in a tertiary teaching institute over a period of 7 months. keeping power of study at 80% and confidence interval at 95%, to detect 30% difference in duration of analgesia, the sample size required was 25 in each group. we enrolled a total of 60 patients for better validation of results. after obtaining the institutional ethical committee approval and written informed consent, 60 female patients undergoing elective gynaecological surgeries, aged 2560 years, belonging to american society of anesthesiologists physical status i and ii, were enrolled. gynaecological surgeries included in this study were total abdominal hysterectomy, vaginal hysterectomy, myomectomy, open ovarian cyst excision and tubal recanalisation. patients for whom central neuraxial block was contraindicated, those with neurological, cardiovascular, respiratory, endocrine disorders, psychiatric illness, antihypertensive therapy, with known allergy to study drugs and those who refused neuraxial block were excluded from the study. patients enroled were randomly allocated into group c (study) and group s (control) of thirty each using a computer - generated random number sequence. the drug solution for both groups was prepared by an anaesthesiologist not involved in the study. the allocation sequence and the drug received by the patients after intravenous (iv) access, the patients were preloaded with infusion of ringer lactate (20 ml / kg). the epidural space was identified at l2l3 interspace with 18 g tuohy needle using loss of resistance technique under strict asepsis, and a 20 g epidural catheter was then advanced into the epidural space. correct placement of epidural catheter was verified with a test dose of 3 ml of lignocaine (2%) with adrenaline (1 : 200,000). group c received injection clonidine 150 g, diluted to 5 ml in normal saline (ns) via epidural catheter 10 min before sab. hyperbaric bupivacaine 0.5%, 15 mg (3 ml) was given intrathecally to both groups at l3l4 interspace using 27 g quincke needle. sensory block was assessed bilaterally using loss of sensation to pinprick with a short hypodermic needle in midclavicular line. motor blockade was assessed using modified bromage scale (0 : no motor block ; 1 : inability to raise extended legs ; 2 : inability to flex knees ; 3 : inability to flex ankle joints). surgery was commenced after sensory block at t6 dermatome was attained. in this study, onset of sensory block was defined as time taken to achieve loss of sensation to pinprick at l1 dermatome level following sab. time taken to achieve bromage 3 following sab was defined as onset of motor block. time taken for two segment regression of sensory block was noted, and time taken for motor block to recede from bromage 3 to bromage 0 was recorded as the duration of motor block. basal heart rate (hr), respiratory rate, non - invasive arterial blood pressure and oxygen saturation were recorded before placement of epidural catheter and every 5 min till the end of surgery. intra- and post - operative sedation was assessed using ramsay sedation score (1 : anxious or restless or both, 2 : co - operative, oriented and tranquil, 3 : responding to commands, 4 : asleep, brisk response to light, glabellar tap or auditory stimuli, 5 : asleep, sluggish response, 6 : asleep, unarousable). post - operatively, pain was assessed using visual analogue scale (vas) (0 : no pain, 24 : mild pain, 57 : moderate pain, 810 : worst pain). duration of analgesia was the time from onset of sensory block at l1 till the patient complained of pain. rescue analgesic injection tramadol 2 mg / kg was given via epidural catheter when patient requested for analgesic or vas > 4. sedation score, vas and haemodynamic parameters were observed at 30 min, 60 min, 2, 3, 4, 5 and 6 h post - operatively. hypotension was defined as systolic blood pressure 30% decrease in baseline mean arterial pressure, treated with iv crystalloid 250 ml bolus and injection mephentermine 6 mg iv. bradycardia was defined as hr 600 g) of clonidine. in the present study, duration of analgesia was very much prolonged in clonidine group (299.00 43.38 min) as compared to saline group (152.50 21.04 min). a previous study found that epidural clonidine (150 g) prolonged anaesthesia duration along with significant sedation, similar to what was observed in our study. after neuraxial administration, clonidine affects arterial blood pressure in a complex manner because of opposing actions at multiple sites. the 2-adrenergic agonists produce sympatholysis and reduce arterial blood pressure through effects at specific brainstem nuclei and sympathetic preganglionic neurons in the spinal cord, effects that are counteracted by direct vasoconstriction resulting from the 2-adrenergic agonists on the peripheral vasculature. eisenach. showed that 160 g clonidine decreases arterial blood pressure by 18% and reduces hr by 520% and concluded that epidural clonidine does not induce haemodynamic instability. the current study showed relatively low incidence of hypotension and bradycardia with epidural clonidine at dose of 150 g. the 2 agonists when used in regional anaesthesia are shown to hasten onset of action of local anaesthetics with rapid establishment of both sensory and motor blockade, prolongation of analgesia into the post - operative period, with dose - sparing action of local anaesthetics and stable cardiovascular parameters. sedation after epidural clonidine is due to its systemic absorption and vascular redistribution to higher centres. in our study, we found that epidural clonidine produced arousable sedation in intra- and post - operative periods. patients rested quietly in beds with eyes closed but were able to respond to oral commands. epidural clonidine and neostigmine have been used as adjuvants following intrathecal labour analgesia with local anaesthetic and found to be associated with improved quality of analgesia, reduced the local anaesthetic requirement and higher patient satisfaction. in the current study, we administered epidural clonidine before sab in gynaecological surgery and found improved quality of analgesia, along with the early onset of sensory and motor blockade. epidural clonidine when administered 10 min prior to sab during cse, produces prolonged analgesia and arousable sedation. it increased the speed of onset and prolonged the duration of sensory and motor blockade of intrathecal bupivacaine without significant haemodynamic adverse effects. | background and aims : combined spinal epidural (cse) anaesthesia is being increasingly used for effective post - operative analgesia. this study was designed to evaluate the effect of epidural clonidine on characteristics of spinal anaesthesia for gynaecological surgeries.methods:this was a prospective randomised, double - blind, controlled study involving sixty patients belonging to american society of anesthesiologists physical status i and ii who underwent gynaecological surgeries were randomly divided into clonidine (c) group and saline (s) group of thirty each. all patients received cse anaesthesia. ten minutes before subarachnoid block (sab), group c received clonidine 150 g diluted to 5 ml in normal saline (ns) and group s received ns epidurally. hyperbaric bupivacaine (15 mg) was administered intrathecally for both groups after epidural injection. sensory and motor block characteristics, analgesia, sedation and haemodynamics were observed. statistical analysis was performed using appropriate tests.results:epidural clonidine produced faster onset (37.83 8.58 s in group c compared to 50.33 8.80 s in group s, p = 0.001) and prolonged duration of sensory block (241.1718.65 minutes in group c compared to 150.3319.16 minutes in group s, p = 0.001). time for two segment regression of sensory block was193.67 19.82 min in group c and 109.33 18.56 min group s (p < 0.001). the duration of analgesia was 299.00 43.38 min in group c and 152.50 21.04 min in group s (p < 0.001). haemodynamics and sedation scores were comparable between two groups.conclusion:administration of clonidine epidurally, 10 min before sab, caused early onset and prolonged duration of motor blockade and analgesia, without any significant post - operative complication. |
there have been few developments in the technical aspects of thyroid surgery since the surgical approach described by kocher greater than a century ago. given the significant vascularity of the thyroid gland and the relatively small operative field, meticulous hemostasis has and will always be an important prerequisite for a successful outcome in thyroid surgery. the mainstay for achieving hemostasis in thyroid surgery has been tying and/or clipping of blood vessels, both effective but time - consuming techniques. in the current climate of healthcare constraints and long surgical waiting lists, any methodology that can reduce operative times while maintaining acceptable complication rates warrants investigation. the harmonic scalpel (ethicon endosurgery, cincinnati, ohio) was introduced into the surgeon 's armamentarium almost two decades ago. using mechanical vibrations at 55.5 khz, this device is able to cut and coagulate tissue simultaneously. the proposed advantages of using this device over traditional electrocautery include less lateral thermal tissue injury, a lack of neuromuscular stimulation, and the avoidance of electrical energy transmission either to or through the patient. since the adoption of the harmonic scalpel (hs) into modern surgical practice, its utility for a wide variety of operations has been well documented. for example, a randomized prospective clinical trial demonstrated its ability to diminish blood loss as well as operative time for laparoscopic nissen fundoplication. over the last decade, many reports have evaluated the utility of the hs for thyroid surgery and the majority of these studies have been carried out at european centers. the investigators have shown similar results regarding reduced operative times with its utilization, but conflicting results regarding other postoperative outcomes such as transient postoperative hypocalcemia and recurrent laryngeal nerve dysfunction (rlnd). these complications are relatively uncommon and the number of cases reported in individual studies is limited. consolidating the data to date, no meta - analysis evaluating the utilization of hs in thyroid surgery has been reported. the purpose of this study was to determine whether conventional hemostasis (ch) or the hs results in shorter operative times for thyroidectomy and to evaluate the incidence of postoperative complications with each approach. we sought to identify prospective, randomized clinical trials comparing hs to ch methods (i.e., ties, clips, and/or electrocautery) for thyroidectomy utilizing a computerized literature search. we searched the cochrane central register of controlled trials, medline and embase (january 1, 1995 to september 30, 2008), using the following index terms : thyroidectomy, thyroid surgery, harmonic scalpel, harmonic shears, ultrasonic shears, ultrasonic scalpel, ultrasonic coagulator, ultrasonic dissector, ultrasonic dissection, ultrasonically activated scalpel, ultrasonic scissors, and coagulating shears. in addition, we reviewed the reference lists of retrieved articles, contacted experts in the field, and contacted the major manufacturer of the hs (ethicon endosurgery) to determine if they were funding or aware of any trials being conducted using their product. we also searched the proceedings of major endocrine surgery conferences for any reported trials that may not have been published. we restricted our study to adults older than 18 years of age. only studies comparing traditional studies where additional procedures were carried out at the time of thyroidectomy (e.g., lateral neck lymph node dissection) were also excluded, unless these additional procedures were accounted for by subtracting the time for the added procedure from the overall operative time. the principal outcome evaluated was the mean operative time, measured in minutes, for total or subtotal thyroidectomies carried out utilizing the two surgical techniques. although studies could include a combination of total and subtotal thyroidectomies and thyroid lobectomies, they were excluded if they did not report a mean operative time specifically for the total and subtotal thyroidectomies. one study defined rlnd as transient if vocal cord function recovered within twelve months of the operation. some studies did not provide an explanation for how transient rlnd was diagnosed [68 ]. in the majority of the papers, postoperative laryngoscopy was performed on every patient to assess vocal cord function [5, 913 ]. transient postoperative hypocalcemia was defined either by biochemical parameters or by clinical symptoms or both. although studies could report on a variety of secondary postoperative outcomes (e.g., amount and/or duration of wound drainage, postoperative hematoma formation, pain, analgesic requirements, time to hospital discharge, cost - effectiveness), they were excluded if they did not report these two specific outcomes. to be included, studies had to be prospective, randomized clinical trials and observational studies were not included in the analysis. clearly blinding is not feasible in studies evaluating two different surgical techniques, though it was noted if assessors of the postoperative outcomes were blinded to the intervention. regarding data collection and analysis, the two authors (am and smw) independently assessed the titles and abstracts of studies retrieved from the literature search and obtained full articles for all those that appeared to satisfy inclusion criteria, ultimately including those that met inclusion criteria after in depth review. the data from those studies were extracted independently by the authors, and any differences were resolved by discussion. the following information was abstracted for each study : year of publication, language of publication, country of origin, study design (including details on randomization, blinding, allocation concealment, intention - to - treat analysis, and losses to follow - up), provision of industrial support for the study, reason for ineligibility if the study was ultimately excluded, number of patients enrolled in each study arm, indication for thyroidectomy, type of thyroidectomy carried out (e.g., partial versus total versus subtotal), details regarding type of hs and ch utilized (ties versus clips versus electrocautery), mean operative time for total and subtotal thyroidectomies in each group, number of cases of transient and permanent postoperative hypocalcemia (either symptomatic or biochemical), number of cases of postoperative transient or permanent rlnd, and number of cases of postoperative hematoma formation. study validity is presented qualitatively though no formal validity score was assigned. for the primary outcome, the meta - analysis evaluated the weighted mean difference in operative times between thyroidectomy groups (hs versus ch) and the standard deviation of the difference from individual studies using the metan command in stata 9.2 (statacorp, college station, texas). in one study, the data regarding operative times was not reported as a mean with standard deviation, but after correspondence with the authors, the data was provided in such a format as to allow inclusion in the analysis. in 2 cases, attempts to contact the authors were unsuccessful and thus these papers could not be included in the analysis, though they had otherwise met inclusion criteria [14, 15 ]. significant heterogeneity across studies was noted ; thus a pooled estimate of the difference in operative time was generated using a random effects model. a sensitivity analysis excluding the two studies that disclosed financial support from the hs manufacturers was also carried out. for the secondary outcomes of postoperative rlnd and hypocalcemia, the fixed effects model was utilized to obtain the summary estimates of the logrr from the group of studies. we did not proceed to a random effects model once the fixed effects analysis did not reveal any significant heterogeneity (q statistic). publication bias was assessed with begg 's and egger tests and begg 's funnel plot [17, 18 ]. a p - value of <.05 was considered statistically significant. thirty - four studies that potentially met inclusion criteria were identified from the literature search. after abstract screening, 19 were excluded for variety of reasons. of the 15 that were reviewed in depth, 6 were excluded, leaving 9 studies that were incorporated into the meta - analysis. figure 1 depicts a flow diagram of the study selection process and table 1 summarizes the characteristics of the studies included in the meta - analysis. there were no incidents of author disagreement in either the study selection or data extraction phase regarding the primary outcome of mean operative time, the pooled estimate of the weighted mean difference (wmd) in operative time obtained from a random effects model was 23.1 minutes (95% ci = 13.8, 32.33). this was statistically significant, with a p - value of <.001 (figure 2). the test for heterogeneity was significant with a p - value of <.001. regarding secondary outcomes, the pooled estimate and 95% confidence interval of the relative risk of postoperative transient rlnd from a fixed effects model was 1.25 (p =.59 ; 95% ci = 0.56, 2.76). thus, there is a trend toward an increased risk of transient rlnd with the use of hs, but the overall number of cases of this was small and this was not a statistically significant finding (see figure 4). the test for heterogeneity was not significant (p - value =.51) ; thus we did not proceed to a random effects analysis. the pooled estimate and 95% confidence interval of the relative risk of postoperative transient hypocalcemia from a fixed effects model was 0.69 (p =.01 ; 95% ci = 0.51, 0.92). thus, there was a statistically significant reduced risk of transient postoperative hypocalcemia with the use of hs (see figure 5). the test for heterogeneity was not significant (p - value =.53) ; so a random effects analysis was not carried out. a sensitivity analysis excluding studies with industry support revealed an even greater reduction in operative time with use of the hs (25 minutes ; 95% ci = 16.3, 33.62). interestingly, there were a total of 3 cases of postoperative hematoma in the ch group and 1 in the hs group (table 1) suggesting a trend toward a lower incidence of this serious postoperative complication with the hs. the quality of the studies was assessed based on the following criteria : appropriateness of randomization, allocation concealment, blinding of patients, blinding of outcome assessors, utilization of intention - to - treat analysis, and a description of any patients that were lost to follow - up. in most cases, these parameters were not specified and thus the methodological quality of the included studies could only be deemed as fair. utilization of the hs for total and subtotal thyroidectomy significantly reduced operative time compared to ch techniques by greater than 23 minutes (p - value <.001). furthermore, there was a 31% decreased risk of transient postoperative hypocalcemia with hs utilization compared to ch techniques (pooled rr = 0.69, p - value =.01) and there was also no statistically significant difference in the risk of transient postoperative rlnd between the two groups (pooled rr = 1.25, p - value =.59). we conclude that not only is hs utilization for total thyroidectomy significantly faster than the conventional approach, with acceptable postoperative complication rates, but also it may even protect against the development of transient postoperative hypocalcemia. all of the studies uniformly report decreased operating time with the use of an hs. this is not a surprising observation, given that the same outcome has been reported repeatedly for a variety of other surgical procedures [1921 ]. with the exception of a single mexican study, all of the reports were from european centers. there is no reason to believe that the patients requiring thyroid surgery are any different in europe than in north america and thus we believe that our results are generalizable to other patient populations. from the literature search, two reports from u.s. centers evaluating hs use for thyroidectomy were identified but excluded because of their retrospective study design. both of these studies also found the hs to be safe and time - saving [22, 23 ]. all studies reported an increased risk of postoperative hypocalcemia with conventional hemostasis techniques, though only one report had a large enough cohort for the association to be statistically significant. though the mechanism is not fully understood, transient hypocalcemia observed after total thyroidectomy is believed to be related to traumatization of the parathyroid glands, which are anatomically intimately related to the thyroid gland and share its blood supply. we speculate that use of the hs may facilitate dissection of the parathyroid glands in a plane farther away from the parathyroid gland capsule, thus reducing the chance of damaging their blood supply, directly or indirectly, with either mechanical forces or electrical currents. thus, this finding of reduced transient postoperative hypocalcemia with hs utilization does seem biologically plausible and highlights an important rationale for conducting the meta - analysis. when an outcome is relatively uncommon, individual studies may all trend toward that same outcome though none may have the power to support statistical significance, but calculating a pooled estimate may allow for the determination of a statistically significant association. permanent hypoparathyroidism is a rare complication of thyroidectomy, and there were only three reported cases of this among the nine studies, two of which occurred in the ch group and one in the hs group (table 1). included studies had conflicting results in terms of the risks of rlnd with hs utilization compared to ch, and all reported either very few or no cases of this complication. in the current meta - analysis, there were only twenty - two incidents of transient rlnd out of 822 total thyroidectomies (.03%) or 1,644 nerves at risk (.01%). given that hs has been shown to cause less collateral thermal injury than conventional electrocautery unfortunately, the numbers in this analysis are too small to generate any meaningful conclusions. only one case of permanent rlnd occurred in a patient who underwent the ch technique. the time cutoff to differentiate between transient and permanent rlnd was not well defined in the studies, but most investigators did use postoperative laryngoscopy in all patients to document vocal cord paralysis. regarding the internal validity of included studies, one must accept that for studies evaluating surgical techniques, blinding of the surgeon is not possible. however, patients can be blinded to the procedure they have undergone to minimize reporting bias when evaluating postoperative outcomes such as symptomatic hypocalcemia or pain. furthermore, those individuals evaluating outcomes (operative time, rlnd, hypocalcemia) can also be blinded to the intervention to reduce observation bias, and this was only explicitly carried out in a single study. ideally, authors should also give a detailed description of their randomization procedures, allocation concealment, and use of intention - to - treat analysis, which was not consistently reported in the studies included in this meta - analysis. to assure internal validity, future randomized studies evaluating this question should include details addressing these issues. the quality of a meta - analysis is only as good as the reports from which it is derived, and so our study is inherently limited by the methodological limitations of the included reports. begg 's funnel plot for the pooled estimate of the wmd in operative time did exhibit some asymmetry, but this was not statistically significant. the asymmetry was likely a result of between - study heterogeneity (tau - squared = 175.88). when between - study heterogeneity is large and when the number of included studies is small, none of these tests to detect publication bias work well. though all studies found that thyroidectomy was faster with the hs, they were quite heterogeneous in terms of the baseline length of time required to carry out a conventional thyroidectomy (range from 46.7 to 168.8 minutes). this observed difference in time required to carry out the same operation is quite striking. the heterogeneity may have been due to the size of the gland that was being resected, which was not clearly defined in all studies. in addition, all of the thyoidectomies in the hallgrimsson study, which reported the longest mean operative time for conventional thyroidectomy, were carried out for graves ' thyrotoxicosis, wherein the vascularization of the thyroid gland can be very extensive. in contrast, the majority of thyroidectomies in the study reporting the fastest mean operative time excluded patients with graves ' disease or extensive goiters. one must consider whether or not benign versus malignant thyroid pathology affected our results. all of the studies incorporated in the meta - analysis excluded patients requiring either a central or lateral compartment lymph node dissection ; thus this could not have played a role in operative time or incidence of postoperative hypocalcemia. of the 9 studies, 4 excluded malignant disease (7, 10, 11, 13), 3 had no significant difference in the proportion of malignant cases between the hs and ch groups (5, 6, 9), 1 only included low - risk t1n0m0 papillary thyroid cancers (12), and 1 did not clearly outline the pathologies. given this, we do not feel that thyroid pathology is confounding our results for the primary or secondary outcomes. another consideration when interpreting the results of the current meta - analysis is that surgeons who conduct these trials may have significantly more experience with the hs than the average thyroid surgeon, and the timesaving effect of the hs might be exaggerated compared to what a less - familiar surgeon would experience when first adopting its use into their practice. future prospective, randomized trials of larger patient cohorts with more detailed and uniform definitions of postoperative complications, randomization procedures, intention - to - treat analyses, and blinding of outcome assessors are needed to draw more meaningful conclusions with regard to the influence of hs utilization on complications after total or subtotal thyroidectomy. in addition, cost - effectiveness analyses to determine whether the costs saved from the reduced time spent in the operating theater outweigh the added cost of the hs scalpel would also be important. several of the studies did report reduced overall cost associated with the hs [7, 8, 10 ] while another reported no difference in overall costs when comparing the two techniques. other benefits seen with hs demonstrated in these studies included less operative bleeding [6, 812 ], fewer cases of postoperative hematoma formation, fewer ties used [6, 8, 9, 13 ], less drain utilization, less postoperative pain or analgesic requirements [10, 12 ], and smaller incisions. the impact of a recently introduced, smaller handheld hs on thyroid surgery outcomes also warrants further study. reports of the use of another vessel sealing technology, the ligasure (covidien, boulder, colorado), for thyroid surgery have emerged in the recent literature, and comparisons between this device and the hs would also be of interest. from the current study, we are able to definitively conclude that not only does the use of the hs significantly decrease operative time compared to ch techniques with ties, clips, and/or electrocautery but it is also safer in terms of reducing the incidence of transient postoperative hypocalcemia. | background. the study 's aim was to determine whether conventional hemostasis (ch) or the harmonic scalpel (hs) results in shorter operative times for thyroidectomy and to evaluate the incidence of postoperative complications with each approach. methods. a literature search was conducted from study inception to september 30, 2008. included studies randomized thyroidectomy patients to either ch or hs and reported the incidence of postoperative transient recurrent laryngeal nerve dysfunction (rlnd) and hypocalcemia. results. nine rcts were included. use of the hs reduced operative time by 23.1 minutes (95% ci = 13.8, 32.33). there was no difference in the incidence of transient rlnd (rr = 1.25, 95% ci =.56, 2.76), but a lower rate of transient hypocalcemia with the use of the hs (rr =.69, 95% ci =.51,.92). conclusions. the use of hs in thyroidectomy significantly reduces operative time and is associated with a reduction in postoperative hypocalcemia compared to ch. |
this database issue of nucleic acids research (nar) includes descriptions of 58 new data resources and updates to 73 previously published data resources. the online database collection that accompanies the issue holds 1230 data resources, a growth of 5% over last year (http://www.oxfordjournals.org/nar/database/a/). continuing a decade - long tradition, the database issue and database collection serve two functions : (i) to introduce molecular and cell biologists that make up the regular readership of nar to the databases that might be useful to them and (ii) to provide database developers a venue to publish articles to promote their resources and introduce their work to the community that might benefit from it. based on a number of measures (such as the numbers of downloads, literature citations and web links from outside sources), the nar database issue and database collection have been extremely successful. despite rather strict acceptance criteria (1), the number of submitted articles greatly exceeds the capacity of a single annual issue. in order to accommodate this, oxford university press, the publisher of nar, has recently launched the new journal database : the journal of biological databases and curation (http://database.oxfordjournals.org/). we hope that the availability of this new journal, as well as that of our other sister journal, bioinformatics, will provide a publication venue for databases that could not be accepted in the nar database issue because of their limited scope, absence of manual curation or orientation to a limited readership. the data resources of the database issue and the database collection make up an invaluable infrastructure upon which much of life science has come to rely. far more than a collection of distinct information sources, the resources form an extensive and evolving network of connected data, common concepts and shared technologies, driven forward by the collective efforts of developers, curators and database managers. while there is no moderator of this network and no overall controller of its growth, through peer review and editorial processes, the database issue and database collection provide a valuable quality assurance service to the reader. in this editorial, we first outline some of the new and updated databases that will be of interest to readers of the database issue. while individually these databases offer great utility, it is perhaps as part of the community of people, data and technology that the resources offer up some of their richest uses ; we complete our introduction to the database issue with a commentary on this community. in addition to the usual updates on the database services at the us national center for biotechnology information (ncbi) and the european bioinformatics institute (ebi), this issue includes a comprehensive listing of japanese databases provided by the japanese national bioresource project [http://www.nbrp.jp (2) ]. the geographic distribution of the featured databases continues to grow ; the phisite (http://www.phisite.org), a database of gene regulation in bacteriophages (3), is the first database in the list from slovakia. several articles in this issue feature updates on the status of databases that have been included in the database collection after being described first in other journals. these include the eukaryotic linear motif database [elm, http://elm.eu.org/ (4) ], the catalogue of somatic mutations in cancer [cosmic, http://www.sanger.ac.uk/genetics/cgp/cosmic/ (5) ], microbesonline [http://www.microbesonline.org (6) ], the immune epitope database [http://www.immuneepitope.org/ (7) ] and pdbselect [http://bioinfo.tg.fh-giessen.de/pdbselect/ (8) ]. several other articles describe updated features of such popular resources as the comprehensive microbial resource [cmr, http://cmr.jcvi.org/ (9) ], primerbank [http://pga.mgh.harvard.edu/primerbank/ (10) ] and the therapeutic target database [http://xin.cz3.nus.edu.sg/group/cjttd/ttd.asp (11) ], which have been last described in nar several years ago. in previous issues, update articles were permitted only brief descriptions of the latest changes in the respective resource. we felt that this limitation was unnecessary and that readers might benefit from more extensive and detailed descriptions of key database resources. for this issue, we have invited the authors responsible for several popular data resources to submit extended papers to provide a deeper insight into the organization and goals of their respective resources and would put the recent changes in these resources into a broader context. we are very happy with several excellent papers that resulted from this initiative, including comprehensive descriptions of the recent changes in pfam [http://pfam.sanger.ac.uk/ (12) ], metacyc [http://metacyc.org/ (13) ], uniprot [http://www.uniprot.org/ (14) ], intact [http://www.ebi.ac.uk/intact/ (15) ], the eukaryotic linear motif database [elm, http://elm.eu.org/ (4) ], the comprehensive microbial resource [cmr, http://cmr.jcvi.org/ (9) ] and the integrated microbial genomes system [img, http://img.jgi.doe.gov/ (16) ]. in addition, we have included extensive descriptions of three key databases recently unveiled by the ebi : the gene expression atlas [http://www.ebi.ac.uk/gxa, (17) ], ensembl genomes [http://www.ensemblgenomes.org, (18) ] and the protein data bank in europe [pdbe, http://www.ebi.ac.uk/pdbe/ (19) ]. we expect to continue this approach with longer articles next year ; database authors who would like to submit such descriptions of their resources are encouraged to contact michael galperin at [email protected] in advance. some of the greatest efforts that have brought connectivity between the records of distinct resources were conceived not to serve pre - defined sets of users, but rather as open - ended initiatives that would provide broad utility across multiple domains. perhaps the best known of these is the gene ontology (go) project [http://www.geneontology.org/ (20) ], which finds itself at the heart of the community of resources described in this database issue and database collection, with many of them providing go annotations. annotation of a common go term to data objects in distinct resources allows the user to infer a conceptual relationship between the objects that is described by the term ; by extension, more distant relationships can be inferred by using ontological relationships within go to reach terms common to distinct data objects. a shared approach to the development of data models is a theme in the database collection. for example, many model organism databases, such as flybase [http://flybase.org/ (21) ], beetlebase [http://beetlebase.org/ (22) ], parameciumdb [http://paramecium.cgm.cnrs-gif.fr/db/index (23) ] and wfleabase [http://wfleabase.org/ (24) ], have adopted the chado database schema as underlying data structure for their resources. chado, delivered and maintained by the gmod community, provides database and interface technology for a broad range of information typically required by users of a model organism database, including genomic data, expression data, phenotypic information and literature collections (25). centred on ontologies and controlled vocabularies, the schema is extensible through its system of domain - specific modules. model organism databases that adopt chado benefit from reduced development costs, as they are immediately able to use the substantial body of technologies (such as genome browsers, gene pages, search tools) that are freely available. in addition, users of these databases can apply their knowledge and experience of chado - based interfaces to all model organism databases that have adopted the schema. a key strategy for many resources in the database collection is partnering to exchange data, as a means of achieving comprehensive coverage and to reduce overall effort in data management. successful data exchange relies not least on agreement to structure information in compatible ways. in 1982, the databases of the international nucleotide sequence database collaboration (insdc, http://www.insdc.org) established the feature table definitions and continue to maintain the definitions to this day. the document defines a formalised text format in which biological features and their sequence coordinates can be described. insdc feature table format, as defined in the feature table definitions, remains the file format under which insdc annotation data are kept in daily global synchrony. an unsung hero, perhaps, in this community is the taxonomic backbone upon which almost all of its resources hang. the ncbi taxonomy project (http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=handbook&part=ch4) was established in 1991 and has been adopted as the de facto standard taxonomic classification of biomolecular data. while there are minor deviations and while for many resources with limited taxonomic range (such as the model organism databases), a model of taxonomy is not implicitly required, those resources that deal with multiple taxa all share this one system. the heaviest users are the large generalist resources [insdc, pdbe (19), uniprot (14) ], but even specialist resources adopt the system. the benefit to the user of the resource, of course, is the ability to approach, filter and link biomolecular information for any given taxon or set of taxa. finally, there are the direct relationships between items of information in the resources. these take many forms : perhaps molecular sequences are similar between objects, the same genes are described, a functional correspondence between objects exists or common technology for presenting data binds two resources together. some of these relationships are derived computationally, some manually curated from the literature and some exchanged between databases in reciprocal exchanges. the strengths of these relationships also vary ; some resources share data directly leading to exact mappings between their objects, others report common attributes of their objects. relationships can be asserted explicitly in cross - references, implied through common references to objects in tertiary resources or the user can be left to inject his / her own knowledge and creativity to bring a specific area of the network into sharper focus. for those generating and interpreting data to be fed into the resources of the database collection, shared technologies and concepts community standardisation initiatives, with their repertoire of minimal reporting standards and technology development initiatives to support the use of their standards, make their contribution here. seminal work in the microarray field under the microarray gene expression data (mged) consortium led to the development and adoption of miame minimal information about a microarray experiment a checklist of items of information required to render microarray data reusable beyond the initial analysis of those who generated the data (26). since this time, a whole host of minimal reporting standards have been developed to better the usability of data, across genomics and environmental sequencing [the migs, mims and miens standards of the genomics standards consortium and the emerging minseqe standard from mged (27), http://gensc.org/, http://www.mged.org/minseqe/ ], proteomics [the miape standard (28) ], cell - based assays (miaca ; http://miaca.sourceforge.net/), phylogenetics [miapa (29) ], systems biology [miriam (30) ] and many more. plenty of additional cases of such collective investment exist, but from the examples of vocabulary, taxonomic backbone, shared data models, common file formats and cross - references development initiatives alone, the value to the user is already clear. a continued attention to collective effort in such areas remains key to optimising the utility of our community of resources. as then, we prepare grant proposals to generate, interpret and present our latest and greatest data, we make reference to interoperability, shared effort to develop technologies and the need for cooperation and collaboration. the community of resources described in this database issue and database collection provides a compelling example of the many successes that can be won with investment in interoperability and shared effort. curators, developers, managers and users of life science databases know well the ongoing importance of developing and maintaining connectivity between our resources and cooperation between those involved. european molecular biology laboratory (to g.r.c.) ; intramural research program of the us national institutes of health (to m.y.g.). funding for open access charge : oxford university press. | the current issue of nucleic acids research includes descriptions of 58 new and 73 updated data resources. the accompanying online database collection, available at http://www.oxfordjournals.org/nar/database/a/, now lists 1230 carefully selected databases covering various aspects of molecular and cell biology. while most data resource descriptions remain very brief, the issue includes several longer papers that highlight recent significant developments in such databases as pfam, metacyc, uniprot, elm and pdbe. the databases described in the database issue and database collection, however, are far more than a distinct set of resources ; they form a network of connected data, concepts and shared technology. the full content of the database issue is available online at the nucleic acids research web site (http://nar.oxfordjournals.org/). |
thirty - three paraffin blocks generally containing multiple tissue samples (such as brain, liver, spleen, kidney, lung, heart, proventriculus, gizzard, intestine, pancreas, and skeletal muscle) were used for detection of usuv. most organ samples were from blackbirds, but some were from other bird species (table). tissue blocks were assigned to 4 groups : group 1 (7 blocks, blackbirds found dead or severely ill during august 28september 25, 1996) ; group 2 (6 blocks, blackbirds found during october 1november 19, 1996) ; group 3 (10 blocks, blackbirds, starlings [sturnus vulgaris ], and redwings [turdus iliacus ] found during august 3september 18, 1997) ; and group 4 (10 blocks, blackbirds and fieldfares [t. pilaris ] found during october 5december 20, 1997). ihc, immunohistochemical ; rt - pcr, reverse transcription pcr ; +, positive ;, negative ; i, inconclusive. blocks not assignable to individual bird species. recut samples from these blocks were placed on positively charged slides (superfrost plus ; menzel glser, braunschweig, germany) and processed for immunohistochemical staining by using a rabbit usuv - specific antibody at a dilution of 1:4,000. immunohistochemical analysis was performed by using an automated immunostainer (autostainer 3602d ; thermo - fisher, kalamazoo, mi, usa). from the same paraffin blocks, three 10 m viral rna was purified from paraffin - embedded tissue samples by using the qiaamp viral rna mini kit (qiagen, hilden, germany) after deparaffinization with xylene. because of the formaldehyde fixation, the paraffin wax embedding procedure, and the long storage time, a high degree of rna fragmentation was expected. therefore, the pcr - based nucleic acid detection methods were specific for short (5 years before usuv - associated bird deaths in vienna, austria (2), which has been generally assumed to have been the starting point of the spread of the virus to other countries in europe. partial sequencing of the 1996 strain confirmed its identity with the 2001 vienna strain and all its descendants. however, the assumed epicenter of virus spread being austria must be reconsidered because the source has been in italy much longer and may have given rise to subsequent local episodes of bird deaths in italy and other countries. usuv has an established stable mosquito - to - bird transmission cycle in europe, which can remain silent for many seasons. there are no reports of bird deaths during 19962001, which might have been caused by unfavorable climatic conditions or lack of larger numbers of susceptible birds. local herd immunity (8) prevented further bird deaths and supported silent spread of the virus. large - scale wild bird deaths, as later reported in austria, switzerland, and germany (2,3,5,7), had not been observed in italy, despite widespread viral activity (6,9). introduction of a potentially pathogenic vector - borne virus into a new area does not necessarily lead to immediate deaths, which has been repeatedly shown by seropositivity of sentinel birds or virus detection in vectors before epidemics (10,11). episodes of bird deaths tend to occur when virus spreads to areas without prior exposure, thus affecting virus - naive birds. also, specific climatic conditions, such as longer periods of hot and dry weather, seem to affect vector abundance and competence and efficient virus transmission to susceptible hosts (12). direct evidence exists for a strain so far found only in mosquitoes in spain, which is genetically different from the strain from central europe (13,14). this strain has never been associated with bird deaths, which might have resulted from its lower virulence, but low levels of bird deaths might have occurred unnoticed. thus, results of studies in the united kingdom that reported several usuv seroreactive resident birds without obvious bird deaths may be explained accordingly (15). | retrospective analysis of archived tissue samples from bird deaths in the tuscany region of italy in 1996 identified usutu virus. partial sequencing confirmed identity with the 2001 vienna strain and provided evidence for a much earlier introduction of this virus into europe than previously assumed. |
shilajit (l. asphaltum) also known as mineral pitch is a pale brown to blackish brown rock exudates found in many mountain ranges of the world, especially the himalayas and hindukush ranges of the indian subcontinent. shilajit is a complex mixture of organic humic substances as well as plant and microbial metabolites which occur in the rock rhizospheres. substances identified in shilajit include moisture, gums, albuminoids, resin, vegetable matter, benzoic acid, silica, minerals, vitamins, and many other substances. it is used for the last thousands of years as a rejuvenator and as an adaptogen in traditional medicinal systems of many countries and has been attributed with miraculous healing properties. recent reports have revealed that it has antioxidant, anti - inflammatory, and anxiolytic activity. although many herbomineral preparations aimed to treat hypertension and cardiac hypertrophy use shilajit studies related to its effect on blood pressure and cardiac hypertrophy have not been reported so far which prompted the present investigations. in this study, we used daphnia [figure 1 ] as a model due to several reasons such as their high responsiveness to pharmacological agents added to culture water, their transparent body enabling easy observations of heart beats, heart being myogenic with a myogenic pacemaker inhibited by extracardiac cholinergic nerves, similarity of the ultrastructural features to striated and cardiac muscles of other species. in addition, the genome of daphnia shows strong homology with the human genome which provides a provisional clinical relevance. thus, the organism is suitable to be used as a model for studying disease process, toxicological studies, and for biomedical research ; however, there are many species in the genus which are poorly described taxonomically at the species level. different concentrations were prepared in distilled water. due to lack of previously reported information on its lethal dose in daphnia and in humans, a starting concentration of 1 ppm the concentration of shilajit was logarithmically increased (1, 10, 100, and 1000 ppm). the stock and working solutions of shilajit were maintained under refrigeration at 48c during the course of this study [figure 2 ]. observed mean of means of heart rate of daphnia following exposure to shilajit at different concentrations daphnia were collected from the pond water from ahmednagar college campus without ascertaining the exact species. after the settling of debris, mud, and particulate matter, daphnia were transferred to cavity block containing filtered pond water. organism was maintained using pond culture method at ambient temperature in the laboratory till the completion of this study. after acclimatization for 10 minutes, an individual daphnia was carefully transferred, to a cavity slide containing filtered pond water. its heart beats were counted for 10 seconds, under the low power objective of olympus compound optical microscope using a countdown timer with audible signal. in all, 25 such observations were taken and their mean was taken as a control reading. the organism was then carefully transferred to another cavity block containing 1 ppm shilajit solution, acclimatized for 10 minutes, and 25 observations of heart beats for 10 second intervals were noted. the procedure was repeated for shilajit concentrations of 10, 100, and 1000 ppm using the same organism. data were obtained for 20 individuals of daphnia as described above. the mean value and standard error per organism per shilajit concentration similarly, the mean of means of heart beats per 10 seconds were calculated in each case and were converted to heart beats per minute with standard error. both the data were tested using students distribution (t - test) at 95% ci. mean of means of heart beats per minute of daphnia at different concentrations of shilajit with standard error at 95 % confidence interval different concentrations were prepared in distilled water. due to lack of previously reported information on its lethal dose in daphnia and in humans, a starting concentration of 1 ppm the concentration of shilajit was logarithmically increased (1, 10, 100, and 1000 ppm). the stock and working solutions of shilajit were maintained under refrigeration at 48c during the course of this study [figure 2 ]. observed mean of means of heart rate of daphnia following exposure to shilajit at different concentrations daphnia were collected from the pond water from ahmednagar college campus without ascertaining the exact species. after the settling of debris, mud, and particulate matter, daphnia were transferred to cavity block containing filtered pond water. organism was maintained using pond culture method at ambient temperature in the laboratory till the completion of this study. after acclimatization for 10 minutes, an individual daphnia was carefully transferred, to a cavity slide containing filtered pond water. its heart beats were counted for 10 seconds, under the low power objective of olympus compound optical microscope using a countdown timer with audible signal. in all, 25 such observations were taken and their mean was taken as a control reading. the organism was then carefully transferred to another cavity block containing 1 ppm shilajit solution, acclimatized for 10 minutes, and 25 observations of heart beats for 10 second intervals were noted. the procedure was repeated for shilajit concentrations of 10, 100, and 1000 ppm using the same organism. similarly, the mean of means of heart beats per 10 seconds were calculated in each case and were converted to heart beats per minute with standard error. both the data were tested using students distribution (t - test) at 95% ci. mean of means of heart beats per minute of daphnia at different concentrations of shilajit with standard error at 95 % confidence interval the individual variations in the rhythm observed may be a result of body size, sex, and physiological factors. however, the individual rhythm appears to be fairly constant during treatment with shilajit concentrations of 1, 10, and 100 ppm. a rapid increase in heart beat frequency was observed when the organism was treated with shilajit concentration above 1000 ppm. the data represented in table 1 are the mean of means of heart beats of daphnia per minute under control and test conditions with 95% ci. it was revealed that the frequency decreases by 7.65% at 1 ppm, 15% at 10 ppm, and 28.45% at 100 ppm treatments, respectively, indicating a negative chronotropic effect at low shilajit concentrations, whereas treatment with 1000 ppm showed a positive chronotropic effect. although the exact mechanism of action is not yet analyzed, it is possible that the negative chronotropic effect may result from a direct effect on muscle or stimulation of the cholinergic nerves to the pacemaker. the probable reason for the positive chronotropic effect may be due to mimicking of adrenaline- and noradrenaline - like effect or a change in ca levels which needs to be assessed during further studies. at increasing higher concentrations this condition is associated with abnormal heart rhythm (arrhythmia) leading to cardiac arrest. we feel that the accelerating action of this drug on daphnian heart is of less physiological significance because it occurs only with high concentrations (> 1000 ppm). this study being a preliminary investigation does not satisfactorily explain the related phenomena, but the results are still encouraging and of provisional clinical relevance prompting further in - depth studies for which authors intend to include echocardiographic analysis to strengthen their observations along with biochemical studies. | shilajit is a mineral - rich complex organic compound used in the traditional system of ayurvedic medicine for treating hypertension and improving the cardiac function with many herbomineral preparations. however, very little experimental evidence is available about its effect on the cardiac function. we used daphnia as a model organism for observing the effect of shilajit on its heart due to its myogenic properties and its response to number of cardioactive drugs that are known to affect human heart function. genome of daphnia shows the strongest homology with the human genome. these characteristics of daphnia make it an ideal organism for biomedical research. our results suggest that this complex organic compound lowers the heart beats as its concentration increases from 1.0 to 100 ppm. the beats come to near normal condition at 1000 ppm. above 1000 ppm, the beats are very fast and impossible to count. these results indicate a negative chronotropic effect on the daphnia heart at low concentrations and a positive chronotropic effect to arrhythmia and finally failure at increasing higher concentrations of shilajit. |
periodontal diseases usually refer to inflammatory disorders that are caused by pathogenic bacteria in the sub gingival biofilm in association with impaired host immune response and connective tissue breakdown. the bacterial challenge exacerbates the cytokine production by the gingival epithelium, resulting in an uncontrolled inflammation that leads to tooth loss in adults from different populations [1 - 3 ]. the prevalence of these diseases increases with aging, longer retention of teeth, and increased incidence of obesity and diabetes among the population. thus, it is relevant to develop new methods capable of detecting these diseases in early stages and following up their progression. increased cytokine levels in the saliva and gingival crevicular fluid of patients affected by periodontal diseases are a hallmark of the initiation and maintenance of these pathologies. salivary fluid is an exocrine secretion consisting of approximately 99% water containing electrolytes, for instance, sodium, potassium, calcium, chloride, magnesium, bicarbonate, phosphate and proteins, such as enzymes, immune globulins and other antimicrobial factors, mucosal glycoproteins, traces of albumin, and some polypeptides and oligopeptides of importance to the oral health. saliva is critical for the preservation and maintenance of the oral tissues, and it has been used as a source of non - invasive investigation of metabolism and for the elimination of many drugs. thus, it should contain biomarkers for the unique physiological aspects of periodontal diseases, which means that qualitative changes in the biomarkers composition might have diagnostic and therapeutic significance [6 - 7 ]. many contributing inflammatory mediators have been associated with the pathogenesis and progression of periodontal diseases, such as the inflammatory cytokines interleukin-1 beta (il-1) and tumour necrosis factor - alpha (tnf-), which seem to play an important role in the focal immunopathology of periodontal diseases. il-1 secretion pathway is complex, as it requires molecular signals to occur such as exposure to cellular danger or stress signals, culminating in an assembly of inammasomes, molecular platforms that mediate action of caspase-1 and are essential for the activation of il-1. furthermore, tnf- and il-1induce bone resorption and up - regulate prostaglandin e2 (pge2) and collagenases secretion and are produced by many cell types including macrophages, neutrophils, keratinocytes, broblasts, nk cells, t and b cells in the periodontium. these cytokines induce the up - regulation of adhesion molecules on leucocytes and endothelial cells, stimulating the production of chemokines that recruit circulating leucocytes to sites of inammation, and inducing expression of other inammatory mediators that potentiate inammatory responses. studies have indicated that their levels contribute to the pathogenesis of periodontitis since higher serum levels of il-1 and tnf- were detected in periodontitis patients [8 - 9 ]. thus, based on literature data available, we aim to provide a rationale for the use of il-1 and tnf- as biological markers of periodontal diseases. protocol and registration this review was conducted following the prisma (preferred reporting items for systematic reviews and meta - analyses) statement and it was registered on the international prospective register of systematic reviews prospero. the protocol can be accessed at : http://www.crd.york.ac.uk/prospero/display_record.asp?id=crd42016035729 the focus question of this review is whether or not the salivary levels of the inflammatory cytokines il-1 and tnf- could be associated with clinical evidence of periodontal tissue breakdown so that they could be used as biological markers of periodontal diseases. types of publications the review included studies on humans and animals published in the english language. the review included all human prospective follow - up studies and clinical trials, cohort studies, case - control studies, and animal studies published between january 2006 and december 2015, on the use of biological markers of periodontal tissue breakdown as diagnosis tool for periodontal diseases. the search strategy incorporated examinations of the electronic database pubmed (national library of medicine, ncbi) (http://www.ncbi.nlm.nih.gov/pubmed/). salivary biomarkers, periodontal diseases, tumour necrosis factor - alpha, interleukin-1 beta. the choice of keywords was intended to be broad, in order to collect as much relevant data as possible without relying on electronic means alone to refine the search results. the resulting articles were independently subjected to clear inclusion and exclusion criteria by two reviewers. they also compared decisions and resolved differences through discussion, consulting a third party, who was an experienced reviewer, when consensus was not reached. inclusion and exclusion criteria inclusion criteria for studies were : studies in animal models of marginal periodontitis and case - control, cohort and prospective studies in humans ; studies that screened and compared salivary levels of il-1 and/or tnf- in at least two different experimental pools - control and diseased groups ; assessment of clinical parameters such as depth and bleeding on probe, radiographic evidence of bone loss, and salivary levels of il-1 or tnf- measured by enzyme - linked immunosorbent assay (elisa). sequential search strategy following the initial literature search, all article titles were screened to eliminate irrelevant publications, review articles, and case reports. thereafter, the selected studies were excluded based on data obtained from screening the abstracts. the final stage of screening involved reading the full texts to confirm eligible studies based on the inclusion and exclusion criteria previously mentioned. data collection process and data items two different reviewers independently searched for studies on the aforementioned database adopting the described eligibility criteria., 225 potential articles were obtained at first instance which in turns had their titles and abstracts read and categorised according to the type of study- animal or clinical investigation. considering the inclusive dates, 144 studies remained for further review, which consisted of the investigation of the association of cytokines il-1 and tnf- with periodontal diseases onset, progression, and severity. this final step led to the total of 15 articles which are reviewed and discussed here (figure 1). risk of bias in individual studies and across studies the cochrane collaboration bias summary for potential bias was used to assess the quality of studies and identify papers with intrinsic flaws in method and design (table 1). relevant data of interest were collected and organised into tables 2 and 3. studies investigating interleukin-1 (il-1) expression and periodontal diseases studies investigating tumour necrosis factor - (tnf-) expression and periodontal diseases no meta - analyses could be performed due to the heterogeneity between the studies. this initial search yielded 225 non - doubled references from pubmed database. in the stage of screening in accordance with the study selection process prisma 2009 flow diagram as presented in figure 1, titles and abstracts of the studies were read and they were selected in according to the type of study and inclusive dates adopted. at this stage, irrelevant titles and abstracts were excluded (n = 81) and 144 potential articles were further evaluated in order to find studies that associated the periodontal diseases onset, severity, and progression with salivary levels of il-1 or tnf-. after checking articles for eligibility, a total of 15 studies full studies remained for further discussion whilst 129 ones were excluded due to no association of periodontal diseases activity with il-1 or tnf- levels. the reasons for excluding studies were irrelevant titles and abstracts were excluded (n = 81) and lack of association of periodontal diseases activity with il-1 or tnf- levels (n = 129). study characteristics the studies chosen in this review were published between january 2006 and december 2015 and they were designed to show association of periodontal disease activity with il-1 or tnf- salivary levels through assessment of clinical parameters such as depth and bleeding on probe, radiographic evidence of bone loss, and salivary levels of il-1 or tnf- measured by enzyme - linked immunosorbent assay (elisa). most studies selected were performed in humans through prospective studies, but also experimental models of periodontitis in animals were included as they were designed to determine the role of these two specific cytokines in the pathogenesis of periodontal diseases. tables 2 and 3 summarise the main characteristics of the selected studies in this review and they give more detail on specific aspects of each one individually. risk of bias within studies periodontal diseases heavily depend on the host immune response individually. in this scenario, it is predictable that salivary biomarkers could be expressed differently by a subject who over reacts to bacterial challenges, whereas the same levels of inflammatory cytokines could not be involved in the same extent of periodontal tissue loss in a different individual. thus, the association of salivary levels of il-1/tnf- and connective tissue breakdown has careful in order to validate the use of inflammatory biomarkers to diagnosis periodontal diseases as individual responses may change. interleukin-1 as a biological marker of periodontal diseases interleukin-1 is a resulting product of inflammatory and infectious stimuli, contributing to the development of an inflammatory condition. il-1 genes encode precursor molecules which are turned to mature forms via interleukin-1 convertase activity, cleaving the human 35-kda il-1 precursor between aspartic acid 116 and alanine 117 to generate the mature 17-kda cytokine. the il-1 active form shows immune potentiating effects, mediating inflammatory responses, bone resorption, leading to apoptosis, cell proliferation and differentiation in response to inflammatory stimuli such as bacterial lps, promoting recruitment of phagocytes, angiogenesis, epithelial cell repair, and regulation of cytokines and chemokine production by other immune cells at the site of infection or injury, being it an orchestrating cytokine during the immune response [13 - 15 ]. many clinical studies reported the use of il-1 present in saliva or gingival crevicular fluid as a potential biomarker of periodontal disease. mean levels of salivary il-1 were significantly higher in patients with periodontal disease than in controls, and they were correlated with individual clinical parameters indicative of periodontal disease. further, combined elevated salivary levels of il-1 and matrix metalloproteinase-8 increased the risk of experiencing periodontal disease 45-fold. in addition to this, salivary il-1 levels were found in greater abundance in samples of 110 diseased untreated dental patients as opposed to interleukin-6 and pge2. these results showed a greater degree of correlation between il-1 salivary levels and periodontal disease status than any of the other screened mediators. in 1,256-postmenopausal population, a 40-subject cohort with significant alveolar bone loss over a 5-year period il-1, osteonectin, and hepatocyte growth factor were quantified in saliva collected at baseline by immunoassay. positive association was observed between alveolar bone loss and il-1 salivary concentrations rather than between the other biomarkers screened in saliva. also, in regards to the il-1 potential to predict bone loss, increases in this cytokine levels during the first year of periodontal maintenance were associated with increased odds of subsequent (year 2) periodontal attachment loss. these obtained data support the hypothesis that elevated gingival crevicular fluid biomarkers of inflammation hold promise in identifying patients vulnerable to progressive periodontitis. in order to determine the profile response to periodontal therapy and the disease status, sexton. a 68-participant group with chronic periodontitis had il-1, il-8, mip-1, mmp-8, opg, and tnf- salivary cytokine levels screened. salivary levels of il-1 reflected disease severity and response to therapy suggesting its potential utility for monitoring periodontal disease status. in addition, a study carried out by oh. screened il-1 gingival crevicular fluid levels in 13 chronic periodontitis patients. the data obtained suggested that gingival crevicular fluid il-1 levels reflect disease severity and response to treatment in case of chronic periodontitis.. looked at the association between periodontal and coronary heart disease and how the inflammatory cytokine levels responded to this association. all the subjects assessed in this study were found to have a significant increase in the il-1 levels in gingival crevicular fluid (table 2). hence, high salivary levels of il-1 were associated with increased risk of periodontitis onset, progression, and severity given the role this cytokine plays in the periodontal disease pathogenesis, being it useful as a diagnosis biomarker. tumour necrosis factor- as a biological marker of periodontal diseases tnf- is a pleiotropic pro - inflammatory cytokine released by a variety of different cell types in response to various stimuli, including bacteria, parasites, viruses, cytokines and mitogens. it is involved in systemic and local inflammation via different signal pathways, inducing a broad range of genes. tnf- regulates a host response to infection and its deregulation is implicated in the pathogenesis of numerous complex diseases, including periodontitis. this cytokine was shown to drive several biological processes such as induction of inflammatory mediators, for instance, matrix metalloproteases, chemokines and prostaglandins, endothelial cell activation and endothelial - leukocyte interactions, monocyte adhesion, mediating bone remodelling, and oxidative processes [20 - 21 ]. since tnf- plays a role in the development and maintenance of inflammatory diseases, its mediating effects on the development, progress, and maintenance of periodontal diseases many clinical trials showed a correlation between high tnf- levels and periodontitis, results that would enable researchers and clinical practitioners to diagnose and monitor periodontal disease progression. salivary levels of tnf- were detected by frodge. in all subjects in a clinical trial aiming to determine its correlation with dental connective tissue breakdown. mean salivary levels of tnf- were signicantly higher in individuals with periodontal disease than in controls. subjects with salivary tnf- levels above a threshold of 5.75 pg / ml had signicantly more sites with bleeding on probing and attachment loss 2 mm (p 0.01). this study showed that the salivary levels of tnf- were elevated in patients who had clinical indicators of periodontitis, suggesting that this biomarker may serve in a panel of salivary biomarkers that could facilitate the screening, diagnosis, and management of periodontal diseases. additionally, it was performed a periodontitis experimental model to determine the expression of tnf- and pge2 in the occurrence and development of periodontitis. after a 6-week period of disease, they were then made into slices and histopathological changes were analysed as well as tnf- and pge2 levels changes. the two inflammatory mediators were statistically significantly expressed at higher levels than that in the control group. other investigation aiming to quantify the tnf- and other cytokines levels in the gingival tissues of patients with periodontitis, gingival tissues from 19 patients with periodontitis (male, n = 14 ; female, n = 5) were collected. these results are suggestive of a strong association of tnf- with the pathophysiology of periodontitis, and the measurement of this cytokine may be beneficial in the identification of patients with periodontitis. evaluating the effect of type 2 diabetes mellitus and smoking on salivary tnf- level in patients with chronic periodontitis compared to healthy individuals, subjects aged between 30 to 35 years old the results obtained suggested a strong correlation between tnf- and periodontal disease in the presence of predisposing factors such as smoking and diabetes, which means that not only does this cytokine play a role in the onset of periodontitis but also its response to external factors exacerbates the disease status (table 3). therefore, tnf- seems to show a high degree of correlation with the development of periodontal diseases and it can be a salivary biomarker used to search for the development and progression of periodontal diseases. the traditional diagnosis of periodontal diseases is based on clinical parameters such as bleeding on probing, probing pocket depths, and clinical attachment loss. albeit easy to use, cost - effective and relatively non - invasive, clinical attachment loss evaluation using the periodontal probe requires a 2 - 3 mm threshold change before a site with signicant breakdown can be identied. yet, this is the most used way to determine whether or not any subject is undergoing periodontal tissue destruction, leading to the irreversible dental loss. however, dental research has developed new technology to help dentists to identify patients who are undergoing pathological processes. in the field of inflammatory research, many studies have been carried out looking at the innovation of diagnosis methods whose advantages could be early detection, a non - invasive approach, high sensitivity and specificity. thus, this scenario boosts the search for a method capable of diagnosing periodontal diseases in an early fashion, bringing on an era of personalised medicine and individualised clinical decisions. in this regards, it emerges the use of salivary - based diagnosis to which much more attention is currently given. at present many researchers have made use of sialometry, which measures the saliva flow, and sialochemistry, which measures saliva composition, to diagnose systemic illnesses, monitoring general health, and as an indicator of risk for diseases creating a close relation between oral and systemic health. because serum components of saliva are derived primarily from the local vasculature that originates from the carotid arteries, saliva has a prodigious fluid source that provides many, if not most, of the same molecules found in the systemic circulation. thus, researchers involved in periodontal disease diagnostics are currently investigating the possible use of oral uids, such as saliva, for disease assessment. it could be used to monitor the general health and the onset of specic diseases. many analyses associated with periodontitis have been detected in saliva such as cytokines that are host - derived factors that can provide potentially important information regarding periodontal status. il-1 levels would be associated with periodontal disease onset, severity, and progress as this cytokine showed to have a strong correlation with the many clinical parameters evaluated and might be reliable to predict how an individual responds to periodontal diseases after a treatment. it can be a strong candidate biomarker of periodontal diseases, determining individuals likelihood to develop such malady, being it, therefore, traceable in human oral fluids. it would be clear to associate high il-1 salivary levels to periodontal diseases onset or progress as these diseases are inflammatory - mediated. consequently, progressing periodontal diseases would be directly correlated with high levels of il-1 in the whole saliva or in the gingival crevicular fluid. even more than a cause, il-1 levels concomitantly rise as the disease initiates and develops which permits cytokine quantification in the saliva of susceptible individuals. thus, the early detection of increasing il-1 levels would help anticipate the dental tissue breakdown and, therefore, it would make possible to provide those patients with the proper treatment before the irreversible dental loss. tnf- might be able to help us identify periodontitis susceptible patients such as those who suffer from diabetes mellitus or smokers. moreover, tnf- would be useful as a traceable salivary inflammatory mediator whose levels could be associated with the disease severity, showing its progression, being this possibility is a powerful tool to provide patients with the most suitable treatment according to their disease stage. nonetheless, being present in the oral fluids early, even before the periodontal clinical parameters being present, is a remarkable feature that makes possible the cytokine - based diagnosis of periodontal diseases. in regards to periodontal diseases, studies are needed to sample patients at regular intervals in order to capture biomarkers profiles seen during different phases of active disease. this information can then be used to identify useful key salivary biomarkers associated with the inflammatory patterns and the bone remodelling process through which a patient may undergo. obstacles to these approaches may appear in the clinical setting whilst the future of periodontal disease diagnosis using salivary screening looks promising. its emergent and novel status is prominent and many biomarkers have been investigated, albeit few research centres mainly through cross - sectional and animal studies have done the search for new salivary sensors of periodontal diseases. therefore, it is relevant that the use of salivary biomarkers applied to the diagnosis of periodontal disease could be even more investigated in order to consolidate the existing data related to this topic. inflammatory cytokines interleukin-1 beta and tumour necrosis factor - alpha are contributing mediators of periodontal diseases and they are present in the saliva in early stages as well as their levels increased with the disease progression. therefore, they might show reliability in regards the periodontal disease diagnosis, being useful as biomarkers and promising tools in the early diagnosis of periodontal diseases. this work was supported by fundao cearense de apoio ao desenvolvimento cientfico e tecnolgico (funcap), conselho nacional de pesquisa (cnpq), coordenao de aperfeioamento de pessoal de nvel superior (capes). | abstractobjectivesthe article aims to discuss the il-1 and tnf- potential use as salivary biomarkers of periodontal diseases pathogenesis and progression.material and methodsthis literature review has been registered in prospero database with following number : crd42016035729. data investigation was performed on pubmed database as the main source of studies. the following search terms were used : salivary biomarkers, periodontal diseases, tnf - alpha, interleukin-1 beta. clinical trials and animal experimental models of periodontal disease were included in the discussion. in regards to inclusive dates, published studies from january 2006 to december 2015 were considered in this review along with the mentioned inclusion criteria.resultsil-1 and tnf- salivary levels increased in diseased groups, they were associated with onset and disease severity, and their levels reduced in response to periodontal therapy. il-1 and tnf- could be promising biomarkers in the detection of periodontal diseases.conclusionsthe use of a salivary cytokine - based diagnosis appears to be a screening method capable of diagnosing periodontal diseases in an early fashion, establishing an era of individualized clinical decisions. |
variations in root canal morphology, especially in multirooted teeth, are a constant challenge for diagnosis and successful endodontic therapy. root canal treatment can be highly guaranteed when all root canals are identified, thoroughly cleaned and shaped, and obturated with an inert filling material. the clinician should be able to mentally visualize the pulp spaces from the coronal aspect to the apical foramen and should always be aware of the common internal root morphology and the possible variations which might be encountered. otherwise, these anatomical variations may complicate endodontic treatment and compromise therapy outcomes [2, 3 ]. mandibular first molars are the first permanent posterior teeth to erupt and are most prone to suffer from caries, leading to requirement of endodontic treatment. it is generally accepted that mandibular first molars have two roots, a mesial root and a distal root and three or four canals, two in the mesial root and one or two in the distal root. the most relevant variable related to the number of roots is the presence of a third distolingual root. this macrostructure, first mentioned by carabelli, was called radix entomolaris, which in general is smaller than mesial and distobuccal roots and can be separate from or partially fused with these other roots. when located at the mesiobuccal side, this additional root is called the radix paramolaris. anatomical variations in the number and location of canals have been reported by several studies. these include the presence of a third canal in the mesial root, three canals in the distal root, and mandibular first molar with five, six, or even seven canals [10, 11 ]. various techniques have been adopted to evaluate root canal morphology, and it has been reported that tooth demineralization and canal staining of extracted teeth are a very accurate method to detect root morphology. other techniques include access cavity preparation and radiographs with files placed in root canals, in vivo root canal treatment with radiographic evaluation, and macroscopic sectioning. however, these methods had serious limitations as the relationship between the external structure and the pulp might get lost during preparation of study samples. advancements in the field of radiology have drawn attention to the use of computed tomography (ct) for imaging teeth. technological advances have witnessed the invention of cone beam computerized tomography (cbct) which was introduced in the field of endodontics in 1990 by tachibana and matsumoto. cbct scans were recently shown to be a valuable tool in various stages of endodontic treatment as they deliver immediate and accurate three - dimensional radiographic images. preoperatively, these images offer superior diagnostic performance over conventional radiographic images and are used to improve the assessment of root canal systems as they provide information about the internal and external tooth anatomy including number and location of roots and canals, root and canal curvatures, size of the pulp chamber, and the degree of calcification. investigated the use of cbct scanning in identifying root canal systems and compared it with images obtained by using digital radiography. they concluded that cbct images always resulted in the identification of greater number of root canal systems than digital images. additionally, cbct technology aids in the diagnosis of endodontic and nonendodontic pathosis, assessing vertical root fractures, analysis of root resorption defects, and presurgical assessment of apicoectomy procedures [19, 20 ]. postoperatively, cbct scans can help in assessment of the technical quality of the root canal filling as well as healing of periapical lesions. many studies of root canal morphology in mandibular molars have been conducted because these teeth present a complex morphology that often complicates endodontic treatment. a review of the literature showed a lack of studies on root canal morphology of mandibular permanent first molar teeth in a palestinian population. the purpose of this study was to investigate canal number and internal morphologies of permanent mandibular first molar using a sample of cbct images obtained from extracted teeth of a palestinian population. a sample of 320 extracted double - rooted mandibular permanent first molars from palestinian population was collected from the tooth bank at the department of oral surgery. teeth included in this study were selected according to the following criteria : permanent mandibular first molars with intact roots and fully formed apices. teeth with broken roots, serious defects, and root canal fillings, posts, and crown restorations and teeth with signs of root resorption were excluded from the study. an ethical approval was obtained from the ethics committee of the university, and patients that were undergoing extraction signed an informed consent in regard to providing his / her tooth after being extracted for use in this study. teeth were stored in 10% formalin for disinfection and were cleaned of calculus and remaining soft tissue by using an ultrasonic scaler. was carried out on extracted teeth, gender and age of the patients were not recorded. to integrate the samples positions, the teeth were fixed in some molds made of silicone impression molding materials (zetaplus, zhermack, rovigo, italy) in 6-tooth groups. the mounted teeth were scanned with a cbct scanner (mct-1 [ex-2 f ], morita manufacturing corp, kyoto, japan) with image capture parameters set at 80 kv and 5.0 ma and an exposure time of 17.5 s. tomographic sections of 1 mm in 3 planes (axial, coronal, and sagittal) were created. the cbct images were analyzed using xorancat software version 3.1.62 (xoran technologies, ann arbor, usa) on a dell precision t5400 workstation (dell, round rock, tx), with a 32-inch dell lcd in a darkroom. the contrast and brightness of the images were adjusted using the image processing tool in the software to ensure optimal visualization. all mandibular first molars were thoroughly examined in the three planes (axial, sagittal, and coronal) at 1.0 mm intervals by continuously moving the toolbar from the floor of the pulp chamber to the apex. the following observations were registered : number of root canals per root and canal configuration in each root based on vertucci 's classification (figure 1). two endodontists evaluated the radiographic images simultaneously to reach a consensus. in cases where a consensus was not reached, a third professional oral radiologist with endodontic experience the number and type of root canals of mandibular first molars are summarized in table 1. all selected teeth had two separate roots. in total, 174 (54.4%) of the mandibular first molars had three canals (mesiobuccal, mesiolingual, and distal), 132 teeth (41.3%) had four canals (mesiobuccal, mesiolingual, distobuccal, and distolingual), and only four teeth had two canals (1.2%). analysis of the mesial root revealed one canal in 1.3%, two canals in 95.6%, and three canals in 3.1%. in the distal root, one canal was found in 57.5% and two canals were found in 42.5% of the examined roots (table 2). examples of canal distribution of examined teeth taken in an axial section are shown in figure 2. types of canal configuration for each root are summarized in table 3. of the examined teeth, the most common canal configuration in the mesial roots was vertucci type iv (53.8%) followed by type ii (38.8%) (figure 3). in the distal roots, the most prevalent canal configuration was vertucci type i (57.5%) followed by type ii (22.5%) and type iii (10.6%) (figure 4). morphologic variation in the anatomy of the root canal system should always be considered at the beginning of root canal treatment. each case, independent of which tooth is to be treated, should be examined clinically and radiographically in a thorough manner to detect possible anatomic variations. it is generally accepted that a major cause of root canal treatment failure is an inability to locate and adequately treat all canals of the root canal system. in a statistical analysis of retreatment cases, allen. analyzed a total of 1300 endodontic subjects for factors that may have contributed to the failure of the original treatment and reported that untreated canals were responsible for failure in 114 cases, with 8.8% prevalence. in another investigation, hoen and pink found that missed canals were the main cause of endodontic retreatment in 42% of cases studied. in our study, all evaluated teeth were two rooted. unfortunately, the tooth bank at our dental school from which the examined teeth have been selected did not contain any three - rooted mandibular first molars. no studies have been conducted on the incidence of radix entomolaris and radix paramolaris in palestine. radiographic examination is an essential part of endodontic management, from initial diagnosis to monitoring treatment results. a periapical radiograph is the most common method used to assess the configuration of root canal systems during root canal treatments. it provides much needed information about root canal morphology especially if taken from different horizontal angels. however, periapical radiographs produce a 2-dimensional image of 3-dimensional objects which prevents complete understanding of root morphology and canal anatomy. tooth clearing and canal staining had been considered for a long time the gold standard for studying root canal morphology where fine internal anatomic details can be visualized. in this study, we used cbct scanning to evaluate the number of canals and canal configuration of mandibular first molars. compared several methods used to evaluate root canal morphology and reported that cbct was as accurate in identifying root canal systems as the modified canal staining and tooth clearing technique. in fields of dentistry where 3-dimensional imaging is necessary, cbct is considered by some to be the standard of care with many advantages. cbct is an office - based imaging technique so can be conveniently used in vivo when required for diagnosis and preoperative assessment. additionally, cbct scanning has been shown to be more accurate than digital radiographs in determining root canal systems. when compared with 2-dimensional digital radiographs, cbct reduces or even eliminates the superimposition of the surrounding structures that normally overlap and enables clinicians to identify more canals in multicanal teeth that can then be instrumented and obturated, thereby increasing the likelihood of a successful outcome. moreover, cbct technology uses an extra - oral imaging scanner at a considerably lower radiation dose and higher resolution than conventional ct [18, 30 ]. the number of root canals and canal configuration of mandibular first permanent molars reported in the literature vary on the basis of the different ethnic populations and different methods used (table 4). our study showed that 54.4% of mandibular first molars had three canals and 41.3% had four. these results are in agreement with those of zhang. who reported an incidence of a fourth canal in 43% of a chinese population. chen. reported an incidence of 45.9% in a taiwanese population. in their study on mandibular molars in a jordanian population using clearing technique, al - qudah and awawdeh reported a fourth canal in 46% of the studied sample. the incidence of two canals in the mesial roots was found to be 95.6%. in their systematic review, de pablo. found a similar incidence (94.4%) in the 17 studies included accounting for 4535 mesial roots investigated. in the present study, ten mesial roots (3.1%) the clinical significance of an extra canal means that failing to locate and properly treat this canal could lead to treatment failure. the presence of the middle mesial canal was reported up to 14.8% incidence. in a study of 760 mandibular molars, fabra - campos found that 20 (2.6%) teeth had three canals in the mesial root. in 13 of these (65%) the third canal joined the mesiobuccal canal in the apical third of the root and in 6 (30%) they converged with the mesiolingual canal, also in the apical third ; the third canal ended as an independent canal in only 1 case. an overall same incidence (2.6%) in the mesial root, type iv configuration was most prevalent (53.8%) followed by type ii (38.8%) canal configuration. these results are consistent with the findings of most of the earlier studies [5, 12, 15, 17 ] in their systematic review, de pablo. reported a prevalence in mesial roots of 52.3% for type iv and 35% with type ii. an exception was reported by al - nazhan with type ii being the most prevalent followed by type iv. in the present study, ten mesial roots showed an additional configuration type (3 - 2) as described by gulabivala. and type (3 - 2 - 1) as described by al - qudah and awawdeh. identification, preparation, and obturation of type iv and type ii are relatively straightforward. however, the presence of additional types needs extra efforts, because failure to debride and disinfect this complex anatomy might have a direct effect on the treatment outcome. the most prevalent canal configuration in the distal roots was type i (57.5%) followed by type ii (22.5%), type iii (10.6%), and type iv (8.1%). the high prevalence of the vertucci type i canal configuration in the distal canals is consistent with the previous observations [12, 17, 27, 32 ]. in terms of type iv configuration, the incidence (8.1%) was lower than reported by previous studies [5, 12, 14, 17, 27 ]. in a korean population, kim. reported a higher incidence (76.9%) of mesial roots with type iv and (66.6%) of distal roots with type i configuration. these higher incidences were also reported by zhang. in a chinese population : 81% of mesial roots with type vi and 84% of distal roots with type i configuration. these differences may be related to study design (in vivo versus in vitro), study technique, sample size, and sample population. the present study indicates that cbct is helpful for the investigation of root canal morphology. when root canal assessment is possible from traditional periapical images or clinical procedures, the use of cbct may not be necessary. when there are abnormal findings on traditional periapical films or variations detected clinically, it may be impossible to evaluate the root canal system effectively. in such situations, it is necessary to adopt cbct for further diagnosis, whilst at the same time ensuring that the patients ' exposure to radiation is kept as low as reasonably possible. cbct scans allow the identification of anatomic features and variations of the root canal system. within the limitations of this study, it can be concluded that, in a palestinian population, cbct scans show that mandibular first permanent molars commonly have four canals with a lower incidence (41.3%) compared to previously reported data. therefore, to treat mandibular first permanent molars, dentists need to be aware of the possible existence of a separate distolingual root canal before they initiate endodontic treatment. | aim. the purpose of this study was to investigate the number of canals and variations in root canal configuration in the mandibular permanent first molar teeth of a palestinian population using cone - beam computed tomography (cbct). methods. a sample of 320 extracted double - rooted mandibular permanent first molars from palestinian population was collected for this study and scanned with cbct scanner. the following observations were made : number of root canals per root and canal configuration in each root based on vertucci 's classification. results. of the 320 mandibular first molars analyzed, 174 (54.4%) had three canals, 132 teeth (41.3%) had four canals, and only four teeth had two canals. the most common canal configuration in the mesial roots was vertucci type iv (53.8%) followed by type ii (38.8%). in the distal roots, the most prevalent canal configuration was vertucci type i (57.5%) followed by type ii (22.5%) and type iii (10.6%). conclusion. our results showed that the number of canals and canal configuration in palestinian population were consistent with previously reported data. the present study also indicates that cbct is helpful as a diagnostic tool for the investigation of root canal morphology. |
transposons are major structural elements of essentially all eukaryotic genomes, and mobilization of these elements can lead to genetic instability and cause deleterious mutations (mcclintock, 1953). mobile genetic elements also carry transcriptional enhancers and insulators, thus transposition can alter expression of nearby genes and potentially large chromatin domains, triggering coordinated changes in gene transcription that could disrupt development or drive evolution (feschotte, 2008). transposon silencing is particularly important in the germline, which maintains the genetic information that will be inherited by future generations. recent studies indicate that transposon silencing during germline development is imposed by piwi - interacting rnas (pirnas), which guide a small rna - based immune response related to rna interference (rnai ; malone and hannon, 2009). here we review pirna biogenesis and function during drosophila female germline development, where recent molecular and biochemical observations have provided significant insight into the mechanism of pirna production and transposon silencing, and where the developmental defects associated with pirna mutations can be evaluated within a well - established genetic, cellular, and developmental framework (spradling, 1993). gene silencing by micrornas (mirnas) and small interfering rnas (sirnas) is well established (filipowicz., 2005 ; ghildiyal and zamore, 2009), and studies on these small regulatory rnas have guided work on the more recently identified pirnas. the 21- and 22-nucleotide sirnas and mirnas are generated from double - stranded precursors by the rnase iii enzyme dicer and bind to argonaute proteins (ghildiyal and zamore, 2009). however, endogenous sirnas (endo - sirnas) direct chromatin assembly and transcriptional silencing in the fission yeast schizosaccharomyces pombe, and endo - sirnas have been implicated in repressing transposons and other repetitive sequences during somatic development in flies (volpe., 2002 ; verdel., 2004 ; czech., 2008 ; ghildiyal., 2008 ; kawamura., 2008 ; okamura. mirnas and sirnas, in complexes with argonautes, can therefore silence transcription, trigger target destruction, or inhibit translation. pirnas were first identified through studies on the drosophila stellate locus, which is composed of repeated copies of a gene encoding a casein kinase ii -subunit homologue (livak, 1990). the drosophila stellate protein has no known biological function, but mutations in the suppressor of stellate [su(ste) ] locus lead to stellate protein overexpression during spermatogenesis, which leads to stellate crystal formation and reduced fertility (livak, 1990). it is now clear that su(ste) encodes pirnas that are homologous to ste and silence this locus in trans (aravin., 2001). small rna cloning and sequencing studies subsequently showed that related 2230-nucleotide - long rnas, derived largely from retrotransposons and other repetitive sequence elements, are abundant in the male and female germline (aravin., 2003). these novel small rnas were therefore initially named repeat - associated sirnas (rasirnas ; aravin., 2003). in some other systems, however, the majority of small rnas in this class are not enriched in transposon sequences. in addition, these rnas bind a germline - enriched piwi clade of argonaute proteins that are distinct from the argonautes that bind mirnas and sirnas (aravin., 2006 ; girard., 2006 ; grivna., 2006a ; lau., 2006, this new small rna family was subsequently renamed piwi - interacting rnas (pirnas ; brennecke., 2007 ; yin and lin, 2007). many of the pirnas expressed in drosophila ovaries are derived from transposons and other repeats, and thus can not be assigned to specific chromosomal loci (brennecke., 2007 ; pirnas that map to unique sites, however, are clustered in large pericentromeric or subtelomeric domains of up to 240 kb that are rich in transposon fragments (brennecke., 2007). most of these clusters produce pirnas from both genomic strands, but a subset of clusters produce unique pirnas almost exclusively from one strand (aravin., 2006 ; girard., 2006 the drosophila flamenco locus falls into this second class, and genetic and molecular studies on flamenco have provided important insights into pirna function (brennecke. single p - element insertion mutations in the telomere - proximal side of flamenco disrupt pirna production and down - regulate expression of longer transcripts from across the entire 60-kb locus, suggesting that transposition has disrupted a transcriptional promoter for this cluster (brennecke., 2007). flamenco contains fragments of active transposons that are located throughout the genome ; therefore, mutations in this locus lead to overexpression of these dispersed elements (brennecke., 2007 ; mvel - ninio., 2007). the flamenco locus appears to function primarily in ovarian somatic cells, while the major pirna - producing dual - strand cluster at cytological position 42ab appears to be germline specific. mutations in 42ab and other dual - strand clusters have not been reported, but mutations in the rhino (rhi) locus lead to both dramatic reductions in pirnas from these clusters and to 10150-fold overexpression of 20% of transposon families (klattenhoff., 2009). pirnas derived from dual - strand clusters thus appear to act in the germline to silence target transposons in trans. pirna clusters represent 1% of the genome, and it is unclear how these limited chromatin domains are specified. most clusters are located in heterochromatin and contain complex arrays of transposon fragments, but only a subset of transposon - rich heterochromatic regions produce pirnas. these observations suggest that pirna clusters are epigenetically defined. however, single p - element insertions disrupt flamenco locus function, suggesting that, at a minimum, cluster promoters are hard - wired. the rhi locus is required for accumulation of putative pirna precursor rnas from the 42ab cluster, and the heterochromatin protein 1 (hp1) homologue encoded by this locus binds to this cluster (vermaak., 2005 ; klattenhoff. hp1a, the founding member of the hp1 family, binds to methylated lysine 9 on histone h3 (bannister. hp1 then recruits histone methyltransferase, which methylates neighboring h3 to extend an epigenetic structure that is generally associated with transcriptional silencing (nakayama., 2001) this calls for a selection for advantageous changes in host genes involved in transposon targeting. thus, the host and parasite are in a constant genetic conflict inside the cell and coevolve with each other. intriguingly, rhi is rapidly evolving and appears to be under strong positive selection, which is a hallmark of genes involved in host pathogen interactions (2005) to speculate that rhi evolution is driven by a germline - specific genomic conflict. the role for rhino in pirna biogenesis strongly suggests that the conflict between transposons and the host genome drives rhi evolution (klattenhoff., 2009). (2007) speculated that pirna clusters actively attract transposons, which would presumably lead to production of homologous pirnas capable of trans - silencing active elements throughout the genome. within this appealing model, rhino protein could interact directly with transposon - encoded integration proteins, and thus drive adaptive silencing by promoting transposition into clusters. deep sequencing and genetic studies suggest that two spatially and mechanistically distinct processes drive pirna biogenesis (for review see siomi., 2010). as noted above, the majority of unique pirnas are derived from transposon - rich heterochromatic clusters (brennecke., 2007 ; yin and lin, 2007). the most abundant pirnas are antisense to mrnas from active transposons, and these antisense rnas preferentially associate with piwi and aubergine (aub), two piwi clade argonautes (brennecke., 2007 ; sense - strand pirnas, in contrast, preferentially associate with argonaute 3 (ago3 ; brennecke. in vitro, all three drosophila piwi proteins, when programmed with pirnas, cleave target rnas between positions 10 and 11 of the guide strand (saito., 2006 ; gunawardane., 2007 ; nishida., 2007). significantly, drosophila pirnas from opposite strands tend to have a 10-nt 5-end overlap, and antisense pirnas bound to piwi and aub show a strong bias toward a uracil (u) at the 5 end, whereas sense - strand pirnas bound to ago3 tend to have an adenine (a) at position 10 (brennecke., 2007 ; these findings suggest that antisense pirnas derived from pirna clusters bind to aub and piwi and direct cleavage of sense - strand transcripts from active transposons, generating rna fragments with an a 10 nt from the 5 terminus (fig. these sense - strand cleavage products are proposed to associate with ago3, after 3 trimming by an undefined mechanism producing mature sense - strand pirnas. the resulting pirna ago3 complexes then cleave antisense pirna precursors from clusters to produce rna fragments that associate with aub and piwi (fig. 1 a). trimming generates mature antisense pirnas, completing the cycle. in this model, reciprocal cycles of piwi - mediated cleavage thus amplify the pool of sense and antisense pirnas. this ping - pong amplification cycle thus obviates the need for an rna - dependent rna polymerase (rdrp), which is needed to amplify sirna triggers in plants, nematodes, and yeast (verdel., the ping - pong model was developed from observations in drosophila, but a similar mechanism appears to function in other animal groups (aravin., 2007 ; houwing., 2007 ; grimson., 2008 ; palakodeti., 2008 ; lau., 2009a). transcripts from functional transposons (blue) and pirna clusters (blue and red) are exported from the nucleus. aub, preprogrammed with pirnas generated through the primary biogenesis pathway, cleaves complementary transposon and cluster transcripts (blue), yielding randomly sized rna fragments that bind ago3. 3-end trimming produces mature ago3-sense strand pirna complexes, which cleave anti - sense cluster transcripts (red). the resulting fragments bind to aub and 3-end processing generates anti - sense pirnas, completing the amplification cycle. anti - sense precursor transcripts (red) from flam and other uni - strand clusters are cleaved by zuc to produce intermediate species that bind to piwi. long - sense (blue) and anti - sense (red) precursor transcripts from pirna clusters are cleaved by sequence - independent nucleases, which could include zucchini (zuc) and/or squash (squ), producing intermediates that bind ago3 and aub. processing and modification of the 3 ends generates mature pirna complexes that drive that ping - pong amplification loop. (d) potential modes of pirna - mediated transposon silencing. (1) transcriptional silencing of target transposons. pirnas bound to piwi, which accumulates in the nucleus, direct heterochromatin assembly at target elements. the ping - pong model requires preexisting primary pirnas, presumably derived from clusters, to initiate the amplification cycle. how these primary pirnas are produced remains to be determined, but pirna production from the flamenco cluster has been proposed as a model for this process. pirnas from this locus appear to be expressed primarily in the somatic follicle cells, which express only one piwi argonaute, piwi. in addition, this locus produces unique pirnas from only one genomic strand and complementary pirnas drive biogenesis in the ping - pong model (brennecke., 2007). however, somatic follicle cells surround the germline cells in the ovary, and the mixture of germline and somatic tissue complicates interpretation of studies on intact tissue. recently, homogenous cell lines derived from the ovarian somatic sheets (osss) and ovarian somatic cells (oscs) have been used to circumvent this limitation (niki., 2006 ; these cells express piwi but do not express ago3 or aub, and produce pirnas from one strand of the flamenco cluster (lau. piwi thus appears to drive ping - pong independent pirna production in somatic cells. the putative nuclease encoded by the zucchini locus is also required for pirna production in the soma (malone., 2009 ; robine., 2009 ; saito., transcripts encoded by flamenco could be cleaved by zucchini, producing rna fragments that bind to piwi (fig. each of the piwi - clade proteins binds pirnas with a unique length distribution, suggesting that processing takes place after binding (brennecke. precursor rna fragments bound by piwi could be trimmed to produce mature primary pirnas (fig. however, the available data on primary pirna production are very limited and the proposed model is therefore highly speculative. in addition, several observations suggest that primary pirna production in the germline may be independent of piwi. for example, mutations that disrupt pirna production in the germline lead to severe defects in axis specification and oocyte nuclear organization (chen., 2007 ; klattenhoff., 2007, 2009 ; pane., 2007), but germline depletion of piwi does not disrupt egg chamber development or axial patterning (cox., 2000). in addition, piwi mutations reduce, but do not eliminate pirnas mapping to the major germline - specific 42ab cluster (malone., 2009). because a loss of primary pirnas should lead to a collapse of the entire pirna biogenesis cycle, these findings suggest that primary pirna production in the germline does not require piwi. the mechanism of primary pirna production in the germline thus remains to be explored, and could be distinct from pirna production in ovarian somatic tissue. the majority of germline pirnas appear to be produced by the ping - pong amplification cycle, and a simple modification of this cycle could explain primary pirna biogenesis during germline development (fig. primary pirnas are generated by ago3 or piwi - mediated cleavage of pirna precursor transcripts derived from clusters, which produces longer fragments that bind to aub and are subsequently trimmed to final length (fig., pirna cluster transcripts could be cleaved by sequence - independent endonuclease producing long rna fragments that enter the biogenesis cycle by binding to aub or ago3. subsequent processing by the same mechanisms employed using the ping - pong cycle could then generate the mature primary pirnas that initiate the amplification loop (fig. 1 a). mutations that eliminate primary pirnas are predicted to lead to a collapse of the ping - pong cycle. however, mutations that only reduce primary pirna production should allow reduced pirna production by the ping - pong cycle. intriguingly, mutations in squash and zucchini, which encode putative nucleases that localize to the perinuclear nuage, reduce pirna levels without blocking ping - pong bias (malone., 2009). as noted above, zucchini has been implicated in ping - pong independent pirna biogenesis in somatic cells (robine., 2009 ; saito., 2009). zucchini and/or squash could therefore cleave cluster transcripts to produce rnas that bind to piwi - clade proteins and generate the primary pirnas that initiate the germline amplification loop (fig. 1, b and c). like sirnas, the 3 ends of most mature pirnas are 2-o - methylated, whereas the 5 end carries a phosphate group (girard., 2006 ; horwich., 2007 ; houwing., 2007 ; saito., 2007). the 2-o - methylation is performed by dmpimet (pirna methyltransferase)/dmhen1, the drosophila homologue of arabidopsis hen1 (horwich. dmhen1 mutants eliminate 2-o - methylation and reduce average pirna size and abundance, suggesting that this modification protects mature pirna from degradation (horwich., 2007 ; saito., 2007). these mutations also lead to a modest loss of transposon silencing, although mutants are viable and fertile (horwich., 2007 ; these findings suggest that 3-end modification is not essential to pirna function, but existing dmhen1 alleles may not be null. the piwi proteins aub and ago3 have recently been shown to be modified by the methyltransferase prmt5, which generates symmetrical dimethyl arginines (sdmas), which creates a binding site for tudor domains (kirino., 2009). there are 23 tudor domain proteins in drosophila, including the founding member of the family, tudor (tud), which is required for assembly of germ plasm and aub localization in the germline (boswell and mahowald, 1985 ; nishida., 2009). in addition, the tudor domain proteins krimper, spindle - e, and tejas have been implicated in piwi localization, pirna production, and transposon silencing (vagin., 2004 ; lim and kai, 2007 ; malone., these findings suggest that piwi family protein dimethylation leads to assembly of higher order complexes that promote pirna biogenesis and transposon silencing. the majority of drosophila pirnas map to transposons and other repetitive elements, and pirna mutations lead to massive transposon overexpression. pirnas bound to piwi proteins direct homology - dependent target cleavage in vitro, suggesting that transposons are silenced through post - transcriptional transcript destruction (saito., 2006 ; gunawardane., 2007 ; nishida., 2007). intriguingly, a number of the pirna pathway components, including aub and ago3, localize to nuage, an evolutionarily conserved perinuclear structure associated with germline rna processing (eddy, 1974 ; ikenishi, 1998 ; saito. in addition, protein - coding genes with transposon insertions within introns escape silencing by the pirna pathway. these observations suggest that pirnas bound to aub and ago3 direct homology - dependent cleavage of mature transposon transcripts after export from the nucleus (fig. protein - coding genes containing intronic transposon insertions are not silenced because pirna homology is removed by splicing. however, several lines of evidence raise the possibility that pirnas act at several levels. piwi, the founding member of the piwi clade, localizes to the nucleus, binds hp1a, and has been implicated in heterochromatin assembly in the soma (pal - bhadra., 2004 ; in addition, mutations in spn - e, which encodes a putative helicase required for pirna production, reduce hp1a binding to the telomere - specific transposon tart (klenov., 2007). these findings suggest that pirna bound to piwi guide heterochromatin assembly, and thus impose transcriptional silencing. however, pirnas have also been found in polysome fractions (grivna., 2006b) and the mouse piwi protein mili associates with translation initiation factors and may positively regulate translation (unhavaithaya., 2009). in many organisms, including poriferans, cnidarians, caenorhabditis elegans, and mouse, the majority of pirnas map to the unannotated regions of the genome and only a limited set match transposons and other repeats (aravin., 2006 ; girard., 2006 ; ruby., 2006 ; batista., 2008 drosophila also express pirnas derived from the 3-utrs of a subset of mrnas (aravin. the most abundant genic pirnas in drosophila somatic cells are linked to the 3-utr of a transcription factor, traffic jam (tj) (robine., 2009 ; saito., 2009). in cultured somatic cells, tj pirnas coimmunoprecipitate with piwi protein, and in ovaries their levels are reduced in zucchini mutants, but not in ovaries mutant for several other genes implicated in secondary pirna amplification (saito., 2009). mutations in tj appear to reduce piwi protein levels in somatic follicle cells, suggesting that this locus controls piwi expression and is the source of pirnas that bind to it. mutations in tj and piwi produce similar defects in oogenesis and lead to two- to fourfold overexpression of fasiii, a cell adhesion molecule necessary for oogenesis. these changes are modest compared with the 100200-fold increases in transposon expression observed in several pirna pathway mutants. nonetheless, these findings suggest that pirnas from the tj locus down - regulate fasiii in the somatic follicle cells (saito.,, the vasa and stellate (ste) genes also appear to be targeted by the pirna pathway (aravin., 2001 ; vagin., 2006 ; nishida., 2007). the vasa gene encodes a germline - specific dead box protein required for pirna production (schpbach and wieschaus, 1991 ; malone., 2009), pirnas derived from the at - chx-1 and at - chx-2 loci are homologous to the vasa gene, and mutations in aub and ago3 that disrupt production of these pirnas lead to vasa overexpression (nishida., 2007 ; li., 2009) during early embryogenesis, maternally deposited mrnas are destroyed as transcription is activated, leading to a switch from maternal to zygotic control of development. recent studies suggest that the pirna pathway may have a role in this developmental switch (rouget., 2010). however, genome - wide tiling array analyses show that mutations in the pirna pathway genes aub, ago3, rhi, and armi do not significantly alter expression of protein - coding genes during oogenesis (klattenhoff., 2009 ; li., 2009) pirna control of gene expression may therefore be restricted to specific tissues or developmental stages. in every system studied to date, mutations in pirna pathway genes disrupt germline development, often producing complex and poorly understood phenotypes that are difficult to directly associate with transposon targets of the pathway. analyses of the ovarian phenotypes in drosophila pirna mutants, however, have helped link transposon mobilization to germline development and may provide a paradigm for phenotypic analysis of pirna mutants in other systems. drosophila oogenesis is initiated by the division of a germline stem cell within a somatic cell niche at the tip of the germarium (fig. 2 ; spradling, 1993). signaling between the niche and the stem cell controls stem cell division and is likely to orient division plane (deng and lin, 1997 ; lin and spradling, 1997). the latter process is critical to asymmetric cleavage, which regenerates the stem cell and produces the cystoblast precursor of the oocyte and nurse cells (deng and lin, 1997). mutations in piwi, which encodes a founding member of the piwi clade of argonaute proteins, lead to a near complete loss of germline stem cells (cox., genetic mosaic studies indicate that piwi protein is required in both the somatic cells of the niche and in the germline (cox., disrupts stem cell maintenance, but does not alter the viability of the eggs that are produced (cox., 2000). in contrast, germline clones of piwi mutations slow stem cell division and the eggs that are produced do not hatch (cox., 2000). unlike mutations in many other pirna pathway genes, however, piwi germline clones do not disrupt oocyte patterning, which appears to be a downstream consequence of transposon overexpression (see below). the function for piwi and pirnas in stem cell maintenance and divisions are not well understood, and may be distinct from latter functions in transposon control. a pair of germline stem cells (red) in region 1 of the germarium divide to produce cystoblasts (light green), which undergo four divisions with incomplete cytokinesis to generate inter - connected 16-cell cysts. meiosis is restricted to a single pro - oocyte in the center of the cyst in region 2b (dark green). a microtubule - organizing center (mtoc) forms in the oocyte where microtubules direct osk mrna (yellow) to the posterior pole. in pirna mutants, dsbs persist in region 3, activating chk2 signaling, which blocks mtoc formation and grk mrna localization. bottom panel shows early and late stage 8 oocytes in wt (a) and pirna mutants (b). the oocyte cortex nucleates microtubules (green, arrowheads indicate plus end). kinesin moves osk mrna (red) to the interior. in the wild type, posterior follicle cells (yellow) signal to the oocyte (blue arrow), triggering depolymerization of cortical microtubules. osk mrna moves to the posterior by kinesin - dependent random walk. in pirna mutants (b, bottom panel), osk mrna moves to the interior, but posterior follicle cell signaling fails, posterior microtubules persist, and osk mrna is trapped in the interior. in the majority of pirna pathway mutations, the earliest phenotype is an increase in dna damage in germline cells of the germarium (klattenhoff. after stem cell division, the cystoblast proceeds through four incomplete divisions to produce a cyst of 16 interconnected cells that will differentiate into a single oocyte and the nurse cells (spradling, 1993). region 2a of the germarium contains early 16 cell cysts, and all 16 cells begin to accumulate double - strand breaks and initiate synaptonemal complex (sc) assembly (carpenter, 1975, 1979). the sc is progressively restricted to a single oocyte, located at the posterior pole, as cysts progress to region 3, where they are surrounded by a monolayer of somatic follicle cells and bud from the germarium to form stage 2 egg chambers (spradling., 1997). during the progression, meiotic dna breaks are first restricted to the pro - oocyte and then repaired in the oocyte (jang., however, a single microtubule - organizing center (mtoc), focused on the pro - oocyte, begins to dominate as cysts progress through region 2b and into region 3. this polarized microtubule scaffold is required for asymmetric localization of a tgf- homologue encoded by the grk gene, which signals to posterior follicle cells that are in contact with the pro - oocyte. this initiates a reciprocal germline - to - soma signaling cascade that patterns the oocyte and the surrounding egg shell (schpbach, 1987 ; neuman - silberberg and schpbach, 1993). in pirna mutants, double - strand breaks form normally in region 2a cysts, but the breaks persist and appear to increase as egg chambers mature (klattenhoff., 2007). in addition, the microtubule network is not polarized, which disrupts grk signaling and initiation of oocyte patterning (chen. the first clear oocyte patterning defects associated with pirna mutations are observed in late stage 8 and early stage 9 (chen., 2007 ; klattenhoff. by early stage 8, most of the oocyte cortex appears to nucleate microtubules, and the microtubule network shows no clear polarity. at this stage, osk mrna, which specifies the posterior pole, is localized to the anterior and lateral cortex (kim - ha., 1991). by stage 9, however, osk mrna is tightly localized to the posterior cortex. both fluorescence in situ hybridization and time - lapse studies using molecular beacons show that osk mrna transiently accumulates in the center of the oocyte before moving to the posterior pole (cha. the second step in osk mrna localization temporally correlates with loss of cortical microtubules specifically at the posterior pole, and mutations in grk, pka, and par1 trap osk mrna in the interior of the oocyte and block depolymerization of microtubules at the posterior cortex (lane and kalderon, 1993 ; roth. in addition, osk mrna remains uniformly at the cortex in oocytes mutant for khc, which encodes the plus end these findings support a two - step model in which microtubules nucleated at the cortex and randomly projecting into the oocyte support kinesin - dependent movement of osk mrna toward the interior. depolymerization of posterior microtubules, induced by a signal from the posterior follicle cells and mediated by par-1 and camp - dependent protein kinase in the oocyte, eliminates the cortical exclusion force specifically at the posterior pole (fig. the remaining oocyte microtubules then support a biased random walk toward the posterior (serbus., 2005 ; zimyanin., assembly of a single mtoc in the oocyte during early oogenesis thus leads to polarized grk signaling to follicle cells (fig. 2, bottom), which differentiate and signal back to the oocyte during mid - oogenesis, inducing a second microtubule reorganization that allows osk mrna movement to the posterior cortex (fig., grk mrna localizes to the anterior dorsal cortex of the oocyte, leading to grk / tgf- signaling to the dorsal follicle cells. it is unclear how grk mrna moves to the dorsal cortex, but this process requires microtubules and the minus - end motor, dynein. mutations that disrupt osk mrna localization generally disrupt grk mrna localization, suggesting that both processes may be initiated by grk signaling from the oocyte to the follicle cells during early oogenesis. in pirna pathway mutants, osk mrna fails to localize to the posterior pole and grk mrna fails to localize to the dorsal cortex during late stage 9 and early stage 10, and this correlates with persistence of cortical microtubules at the posterior pole (fig. these patterning defects during mid - oogenesis lead to production of elongated eggs with reduced or missing dorsal appendages, which are egg shell structures induced by grk signaling. these findings suggest that pirna mutations disrupt assembly of the mtoc early in oogenesis, disrupting an early step in oocyte patterning that ultimately leads to production of spindle - shaped eggs. insight into the link between pirna function in transposon silencing and these polarity defects came from studies by ghabrial. (1998), who showed that a subset of spindle class genes encodes meiotic dna break repair enzymes, and that these mutations lead to persistent dna breaks during early oogenesis. they speculated that these breaks activate damage signaling, which in turn disrupts oocyte patterning. supporting this hypothesis, they showed that mutations in mei-41 and mnk, which encode atr and chk2 kinases that function in dna damage signaling, suppress the axis specification defects associated with meiotic dna repair mutations (ghabrial and schpbach, 1999 ; abdu., 2002). transposon mobilization, and particularly the excision of dna elements, can lead to dna breaks (belgnaoui., 2006 ; gasior., significantly, mutations in mnk and mei-41 dramatically suppress the patterning defects associated with these mutations (fig. 3 a ; chen., 2007 ; klattenhoff., 2007, 2009 ; pane., 2007). these observations support a model in which loss of silencing leads to transposon mobilization and dna break accumulation, which in turn triggers chk2-dependent defects in axis specification (klattenhoff and theurkauf, 2008). (a) osk protein (green) localizes to the posterior of wild - type stage 9 oocytes (wt), but is dispersed in armi mutants (armi). posterior localization of osk protein is restored in oocytes mutant for both armi and mnk, which encodes the dna damage signaling kinase chk2 (mnk;armi). (b) during early oogenesis in wild - type females (wt), a prominent microtubule - organizing center (mtoc) forms in the pro - oocyte. the resulting microtubule scaffold mediates asymmetric grk mrna localization and grk signaling to the follicle cells, initiating axis specification. the mtoc fails to form in armi mutants. in contrast, a prominent mtoc forms in female mutants for both armi and mnk. as noted above, posterior patterning of the oocyte appears to require assembly of a single mtoc in the pro - oocyte during oogenesis. this leads to oocyte - specific localization of grk mrna and grk / tgf- signaling to the posterior follicle cells. mutations in the pirna genes armi and aub disrupt this mtoc, and the subsequent depolymerization of microtubules at the posterior cortex of stage 9 oocytes (cook., 2004). significantly, the mutations in mnk and mei-41 that suppress defects in patterning also restore mtoc formation during early oogenesis (fig. 3 b ; klattenhoff., 2007). in early drosophila embryos, chk2 activation triggers -tubulin ring complex dissociation from centrosomes, disrupting mitotic mtoc formation (takada., 2003). taken together, these finding suggest that pirna pathway mutations lead to transposon overexpression and mobilization, which triggers chk2-dependent defects in mtoc formation early in oogenesis, thus preventing an early step in the oocyte patterning cascade (fig. although this model is appealing, dna damage in the pirna pathway mutations has not been directly linked to transposon mobilization, and the mechanism of chk2-dependent disruption of the oocyte mtoc remains to be determined. in addition, mutations in mnk and mei-41 do not suppress the maternal - effect embryonic lethality associated with pirna pathway mutation, and the essential embryonic functions for this pathway remain to be explored. nonetheless, the available data suggest that the axis specification defects produced by many drosophila pirna mutations are an indirect consequence of transposon overexpression and dna damage signaling. mutations that disrupt the pirna pathway in mouse and fish lead to germline - specific cell death and sterility, and are also associated with increased transposon expression (aravin., 2007 ; studies in drosophila suggest that transposon mobilization represents the primary biological trigger for these phenotypes, and that mobile elements are the primary targets for the pirna pathway. however, the vast majority of pirnas in the mouse germline map to unique sequences in unannotated regions of the genome, a subset of drosophila pirnas is derived from protein - coding genes, and pirnas appear to control at least one gene target in drosophila ovarian somatic cells. there is also intriguing data implicating the pirna pathway in learning and memory and chromatin assembly in the soma (pal - bhadra., 2004 ;, 2006 ; brower - toland., 2007), and we have recently found that a subset of pirna pathway mutations disrupt telomere protection and lead to chromosome fusion segregation during meiosis and mitosis (khurana., 2010). the biological function for this novel class of small rnas may therefore extend well beyond transposons and germline development. | transposons are prominent features of most eukaryotic genomes and mobilization of these elements triggers genetic instability. transposon silencing is particularly critical in the germline, which maintains the heritable genetic complement. piwi - interacting rnas (pirnas) have emerged as central players in transposon silencing and genome maintenance during germline development. in particular, research on drosophila oogenesis has provided critical insights into pirna biogenesis and transposon silencing. in this system, the ability to place pirna mutant phenotypes within a well - defined developmental framework has been instrumental in elucidating the molecular mechanisms underlying the connection between pirnas and transposon control. |
parkinson 's disease (pd) is a common neurodegenerative disorder which affects about 1.7% of the population over the age of 65 in china. although the pathological character and clinical features of pd have been clarified, the pathogenesis of idiopathic pd which accounts for 90% of pd is currently unclear. in the past two decades it has been shown in animal models that initially, 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine, an inhibitor of complex i, could give rise to parkinsonism. in subsequent studies, dysfunction of complex i was found in platelets and substantia nigra of pd patients. the reduction of complex i activity was also detected in cybrids derived from pd patients, pointing to a mitochondrial dna (mtdna) impairment. interestingly, increasing evidence indicates that a combination of mitochondrial single nucleotide polymorphisms (mtsnps) might confer susceptibility to pd. the increased risk of a phenotype could be attributable to a combination of polymorphisms rather than a single polymorphism. according to the available research, the classic mtdna haplogroups includes h, i, j, k, t, u, v, w, x in europeans, while major mtdna haplogroups involve a, b, c, d, e, f, g, p, q, y, z in asians. mtdna haplogroups j and k, which both share a10398 g, appeared as a protective effect against pd among european population ; inconsistent results were found in the english, italian population ; while even a new work denied the association between european mtdna haplogroups and pd in spanish. besides, the reduced risk of pd with haplogroups j, k, and t was mirrored by an increased risk of pd in super - haplogroup hv in caucasian. to the best of our knowledge, investigations concerning the role of asian mtdna haplogroups in the risk of pd for han chinese are few. the association of asian mtdna haplogroups and pd is not clear yet. in this study, we employed nine snps representing the major asian mtdna haplogroups (a, b, c, d, f, g) to explore the relationships between these six haplogroups and the risk of pd in han chinese. totally, 279 nonconsanguineous patients were recruited in our study from the neurology department in the first affiliated hospital of fujian medical university and quanzhou first hospital from 2007 to 2011. the diagnosis of pd was based on the clinical diagnostic criteria of the uk pd society brain bank and the chinese pd criteria. the exclusion criteria included : (1) cases with a family history of pd or other neurodegenerative disorders ; (2) cases with secondary parkinsonism due to trauma, cerebrovascular accident or non - pd neurodegenerative syndromes. the enrolled affected individuals consisted of 174 males and 105 females, with a mean age at onset (aao) of 58.02 10.73 years (1983 years), and a mean age at examination (aae) of 62.18 10.40 years (3185 years). on the basis of aao, patients were divided into two groups : early - onset pd (eopd) with aao 50 years (63 cases, aae 48.41 8.14 years, 60.3% males) and late - onset pd (lopd) with aao > 50 years (216 cases, aae 66.19 7.00 years, 63.0% males). aae was defined as the age at which the participant was clinically examined and enrolled in the study. aao was defined as the age at which the patient first noticed the manifestation of pd. matched with age and gender, 510 unaffected individuals were randomly selected from the local people. evaluated by a consultant neurologist, controls had no signs or family history of cognitive or neurological disorders. the healthy group composed 304 males and 206 females, and the mean aae was 61.97 11.14 years (3086 years). for a case control study, controls were also divided into two groups : control team 1 (ct1) (118 subjects, aae 47.27 8.97 years, 53.4% males) and control team 2 (ct2) (392 subjects, aae 66.39 7.25 years, 61.5% males), matched with eopd and lopd, respectively. all the participants were with the same nationality - han chinese, the purpose of which was to minimize a race - mixture and avoid a bias of results. our investigation was approved by the medical ethics committee, and all participants offered informed consents. nine snps were employed in our study to identify the major asian mtdna haplogroups. according to mitomap (human mitochondrial genome database ; http://www.mitomap.org) and previous research, the diagnostic snps and corresponding haplogroups are listed in figure 1. for all subjects, genomic dna was extracted from peripheral blood sample using a qiaamp dna kit. nine mtdna snps classifying different haplogroups were analyzed by polymerase chain reaction - restriction fragment length polymorphism [table 1 ]. briefly, eight pairs of primers were designed based on a revised version of the cambridge reference sequences in order to amplify specific fragments. digested by relevant restriction enzymes, the products were electrophoresed through a 2.5% agarose gel. in particular, the snp 82808290 = a[delccccctcta ] g, which is surveyed to determine the haplogroup b, was detected by 8% denaturing polyacrylamide gel electrophoresis without restriction enzyme digestion [figures 24 ]. primers and restriction enzymes for defining major asian mtdna haplogroups the restriction site was detected using a mismatched oligonucleotide. polymerase chain reaction - restriction fragment length polymorphism products of mitochondrial dna single nucleotide polymorphism a10398 g and c10400 t analyzed with agarose gel electrophoresis. lane m : d2000 marker ; lane 1 : 10398 g and 10400 t ; lane 2 : 10398a and10400c. polymerase chain reaction - restriction fragment length polymorphism analysis of mitochondrial dna single nucleotide polymorphism a663 g, c5178a, a13263 g, a4833 g, c12705 t, t6392c, and 82808290 = a[delccccctcta ] g. (a) lane m : d2000 marker ; lane 1 : 663 g ; lane 2 : 663a ; lane 3 : 5178a ; lane 4 : 5178c ; lane 5 : 13263 g ; lane 6 : 13263a ; lane 7 : 4833 g ; lane 8 : 4833a ; (b) lane m : d2000 marker ; lane 1 : 12705c ; lane 2 : 12705 t ; (c) lane m : d2000 marker ; lane 1 : 6392c ; lane 2 : 6392 t ; (d) lane m : marker-20-bp ladder ; lane 1 : 9-bp del (+) ; lane 2 : 9-bp del (). direct sequencing of the mitochondrial dna fragments to confirm the alleles of each single nucleotide polymorphism. forward sequencing for all of the polymerase chain reaction - amplified fragments except the one encompassing c12705 t which was detected by reverse sequencing. all statistical analyses were performed using spss software, version 13.0 (spss inc, chicago, usa). statistical significance was established at p 50 years (216 cases, aae 66.19 7.00 years, 63.0% males). aae was defined as the age at which the participant was clinically examined and enrolled in the study. aao was defined as the age at which the patient first noticed the manifestation of pd. matched with age and gender, 510 unaffected individuals were randomly selected from the local people. evaluated by a consultant neurologist, controls had no signs or family history of cognitive or neurological disorders. the healthy group composed 304 males and 206 females, and the mean aae was 61.97 11.14 years (3086 years). for a case control study, controls were also divided into two groups : control team 1 (ct1) (118 subjects, aae 47.27 8.97 years, 53.4% males) and control team 2 (ct2) (392 subjects, aae 66.39 7.25 years, 61.5% males), matched with eopd and lopd, respectively. all the participants were with the same nationality - han chinese, the purpose of which was to minimize a race - mixture and avoid a bias of results. our investigation was approved by the medical ethics committee, and all participants offered informed consents. nine snps were employed in our study to identify the major asian mtdna haplogroups. according to mitomap (human mitochondrial genome database ; http://www.mitomap.org) and previous research, the diagnostic snps and corresponding haplogroups are listed in figure 1. for all subjects, genomic dna was extracted from peripheral blood sample using a qiaamp dna kit. nine mtdna snps classifying different haplogroups were analyzed by polymerase chain reaction - restriction fragment length polymorphism [table 1 ]. briefly, eight pairs of primers were designed based on a revised version of the cambridge reference sequences in order to amplify specific fragments. digested by relevant restriction enzymes, the products were electrophoresed through a 2.5% agarose gel. in particular, the snp 82808290 = a[delccccctcta ] g, which is surveyed to determine the haplogroup b, was detected by 8% denaturing polyacrylamide gel electrophoresis without restriction enzyme digestion [figures 24 ]. primers and restriction enzymes for defining major asian mtdna haplogroups the restriction site was detected using a mismatched oligonucleotide. polymerase chain reaction - restriction fragment length polymorphism products of mitochondrial dna single nucleotide polymorphism a10398 g and c10400 t analyzed with agarose gel electrophoresis. lane m : d2000 marker ; lane 1 : 10398 g and 10400 t ; lane 2 : 10398a and10400c. polymerase chain reaction - restriction fragment length polymorphism analysis of mitochondrial dna single nucleotide polymorphism a663 g, c5178a, a13263 g, a4833 g, c12705 t, t6392c, and 82808290 = a[delccccctcta ] g. (a) lane m : d2000 marker ; lane 1 : 663 g ; lane 2 : 663a ; lane 3 : 5178a ; lane 4 : 5178c ; lane 5 : 13263 g ; lane 6 : 13263a ; lane 7 : 4833 g ; lane 8 : 4833a ; (b) lane m : d2000 marker ; lane 1 : 12705c ; lane 2 : 12705 t ; (c) lane m : d2000 marker ; lane 1 : 6392c ; lane 2 : 6392 t ; (d) lane m : marker-20-bp ladder ; lane 1 : 9-bp del (+) ; lane 2 : 9-bp del (). direct sequencing of the mitochondrial dna fragments to confirm the alleles of each single nucleotide polymorphism. forward sequencing for all of the polymerase chain reaction - amplified fragments except the one encompassing c12705 t which was detected by reverse sequencing. all statistical analyses were performed using spss software, version 13.0 (spss inc, chicago, usa). statistical significance was established at p < 0.05 and based on two - tailed 5% level. to compare the aae and gender between the two groups, we adopted an independent - samples t - test and chi - square test, respectively. as appropriate, we used two - tailed fisher 's exact test or test with yates correction to assess the differences in frequency of each haplogroup between pd cases and unaffected subjects, while each haplogroup was compared to all other haplogroups pooled into one group. to evaluate the risk of pd for each haplogroup or mtsnps, we calculated odds ratios (ors) and associated 95% confidence intervals (cis) by binary logistic regression analysis. meanwhile, to adjust for potential confounding, aae and gender no significant differences were found in aae (t = 0.255, p = 0.798) or gender (= 0.574, p = 0.449) between patients and healthy controls. furthermore, each case - control group was statistically comparable in both aae and gender (eopd vs. ct1 : t = 0.842, p = 0.401 ; = 0.799, p = 0.371. lopd vs. ct2 : t = 0.335, p = 0.738 ; = 0.130, p = 0.718). the distribution of the six major asian mtdna haplogroups is listed in table 2. in the healthy controls, the distribution of haplogroup a, b, c, d, f, and g accounted for 4.3%, 21.2%, 3.7%, 13.9%, 15.7%, and 2.9%, respectively, which echoes similar results with mitomap and previous reports. in addition, 39.1% of patients and 38.2% of healthy controls were assigned to the others group, which could not be classified to any of the six representative asian haplogroups. however, no significant difference in the distribution of mtdna haplogroups was found between the pd patients and controls (= 3.872, p = 0.694). similarly, we did not find any difference after stratification by gender (males : = 2.927, p = 0.818 ; females : fisher 's exact test, p = 0.669) [table 3 ]. distribution of mtdna haplogroups between pd patients and controls, n (%) chi - square test for the overall haplogroup distribution : = 3.872, p = 0.694. distribution of mtdna haplogroups after stratification by gender chi - square test : = 2.927, p = 0.818 ; fisher s exact test : p = 0.669. after stratification by aao, a significant difference was found in the distribution of haplogroups between the eopd and ct1 groups (fisher 's exact test : p = 0.023). this was especially true for the frequency of haplogroup b, which was significantly lower in patients with eopd compared to ct1 (= 8.665, p = 0.003 ; or = 0.225, 95% ci : 0.0820.619, p = 0.004) [table 4 ]. interestingly, between lopd and ct2, this difference disappeared (= 0.998, p = 0.986) [table 5 ]. stratified by aae, haplogroup b also showed a lower frequency in pd cases who are younger than 50 years (= 5.066, p = 0.024 ; or = 0.146, 95% ci : 0.0300.715, p = 0.018), while haplogroup d contained a higher proportion of these cases (= 5.522, p = 0.019 ; or = 3.579, 95% ci : 1.11211.523, p = 0.033) [table 6 ]. distribution of mtdna haplogroups after stratification by aao (eopd vs. ct1) fisher s exact test for the overall haplogroup distribution : p = 0.023 ; p values for 2 2 tables ; p < 0.05. mtdna : mitochondrial dna ; aao : age at onset ; eopd : early - onset parkinson s disease ; ct1 : control team 1 ; or : odds ratio ; ci : confidence interval. distribution of mtdna haplogroups after stratification by aao (lopd vs. ct2) chi - square test for the overall haplogroup distribution : = 0.998, p = 0.986. mtdna : mitochondrial dna ; aao : age at onset ; lopd : late- onset parkinson s disease ; ct2 : control team 2. distribution of mtdna haplogroups after stratification by aae < 50 fisher s exact test for the overall haplogroup distribution : p = 0.032 ; p values for 2 2 tables ; p < 0.05 ; p < 0.05 ; na : not applicable ; mtdna : mitochondrial dna ; aae : age at examination ; or : odds ratio ; ci : confidence interval ; pd : parkinson s disease. according to previous studies, mtdna 10398 g seems to be a protecting factor for pd patients, and is usually closely linked to mtdna 10400 t. we detected the polymorphisms of 10398 g and 10400 t, but no significant difference was found between groups (46.2% vs. 44.7%, = 0.171, p = 0.680 ; data not shown). no significant differences were found in aae (t = 0.255, p = 0.798) or gender (= 0.574, p = 0.449) between patients and healthy controls. furthermore, each case - control group was statistically comparable in both aae and gender (eopd vs. ct1 : t = 0.842, p = 0.401 ; = 0.799, p = 0.371. lopd vs. ct2 : t = 0.335, p = 0.738 ; = 0.130, p = 0.718). the distribution of the six major asian mtdna haplogroups is listed in table 2. in the healthy controls, the distribution of haplogroup a, b, c, d, f, and g accounted for 4.3%, 21.2%, 3.7%, 13.9%, 15.7%, and 2.9%, respectively, which echoes similar results with mitomap and previous reports. in addition, 39.1% of patients and 38.2% of healthy controls were assigned to the others group, which could not be classified to any of the six representative asian haplogroups. however, no significant difference in the distribution of mtdna haplogroups was found between the pd patients and controls (= 3.872, p = 0.694). similarly, we did not find any difference after stratification by gender (males : = 2.927, p = 0.818 ; females : fisher 's exact test, p = 0.669) [table 3 ]. distribution of mtdna haplogroups between pd patients and controls, n (%) chi - square test for the overall haplogroup distribution : = 3.872, p = 0.694. distribution of mtdna haplogroups after stratification by gender chi - square test : = 2.927, p = 0.818 ; fisher s exact test : p = 0.669. after stratification by aao, a significant difference was found in the distribution of haplogroups between the eopd and ct1 groups (fisher 's exact test : p = 0.023). this was especially true for the frequency of haplogroup b, which was significantly lower in patients with eopd compared to ct1 (= 8.665, p = 0.003 ; or = 0.225, 95% ci : 0.0820.619, p = 0.004) [table 4 ]. interestingly, between lopd and ct2, this difference disappeared (= 0.998, p = 0.986) [table 5 ]. stratified by aae, haplogroup b also showed a lower frequency in pd cases who are younger than 50 years (= 5.066, p = 0.024 ; or = 0.146, 95% ci : 0.0300.715, p = 0.018), while haplogroup d contained a higher proportion of these cases (= 5.522, p = 0.019 ; or = 3.579, 95% ci : 1.11211.523, p = 0.033) [table 6 ]. distribution of mtdna haplogroups after stratification by aao (eopd vs. ct1) fisher s exact test for the overall haplogroup distribution : p = 0.023 ; p values for 2 2 tables ; p < 0.05. mtdna : mitochondrial dna ; aao : age at onset ; eopd : early - onset parkinson s disease ; ct1 : control team 1 ; or : odds ratio ; ci : confidence interval. distribution of mtdna haplogroups after stratification by aao (lopd vs. ct2) chi - square test for the overall haplogroup distribution : = 0.998, p = 0.986. mtdna : mitochondrial dna ; aao : age at onset ; lopd : late- onset parkinson s disease ; ct2 : control team 2. distribution of mtdna haplogroups after stratification by aae < 50 fisher s exact test for the overall haplogroup distribution : p = 0.032 ; p values for 2 2 tables ; p < 0.05 ; p < 0.05 ; na : not applicable ; mtdna : mitochondrial dna ; aae : age at examination ; or : odds ratio ; ci : confidence interval ; pd : parkinson s disease. according to previous studies, mtdna 10398 g seems to be a protecting factor for pd patients, and is usually closely linked to mtdna 10400 t. we detected the polymorphisms of 10398 g and 10400 t, but no significant difference was found between groups (46.2% vs. 44.7%, = 0.171, p = 0.680 ; data not shown). to date, the relationship between asian mtdna haplogroups and the risk of pd remains unsubstantiated. according to mitomap and previous reports, carriers of mtdna haplogroup a, b, c, d, f, g are in the majority in the asian population. here, we focused on these six haplogroups in a population from southern china, with the proportions of each haplogroup in our control group being similar to those listed in mitomap. consonant with prior research, the frequency of haplogroup b and f shows a tendency to decrease from southern to northern chinese population while those of a and d increase, which also corresponds to our data. in other words, the control group can be considered representative of the general population in southern china. for each pd patient, aao and aae were significant, with the former indicating the occurrence of first pd symptoms and the latter meaning early diagnosis and therapy. in southern han chinese, haplogroup b seems to be a protective factor for whose aao or aae are under 50 years while haplogroup d leads a susceptibility to pd for whose aae is under 50 years. in addition, mtdna snps 10398 g and 10400 t do not confer any protective effect upon our patients. mitochondrial dna haplogroup b has been established for east asian population as one of the distinctive mitochondrial lineages, which derives from r, a sub - haplogroup under n. one of the most characteristics of haplogroup b is a 9-bp deletion 82808290 = a[delccccctcta ] g, which is in a noncoding (nc) region of 25-bp lengths between cytochrome c oxidase subunit ii and trna. as reported, the haplogroup b is associated with a risk of exacerbating acute mountain sickness in southwestern han chinese. in taiwanese people, the intergenic 9-bp deletion can be seen in high prevalence in melas or merrf patients. recently, it has been reported that even mtdna synonymous polymorphisms, which do not result in the substitution of amino acids, experience selection pressure, and indicate functional relevance. these findings suggest the possibility that the 9-bp deletion in nc region might be subtly functional. we propose that the 9-bp deletion located in the small region between two functional genes may affect the intergenic structure, leading to an abnormal molecular conformation which could cause a protective function against eopd. on the other hand, as haplogroup b subordinates to r, individuals with haplogroup b also carry the 12705c that encodes for ile in the nadh dehydrogenase 5, which is a mitochondrial subunit of complex i. since the effect of single causal variation is possibly enhanced or subdued by combining with a particular mtdna polymorphism. the 9-bp deletion possibly cooperates with other mtsnp, such as 12705c, to reduce the risk of developing eopd. mitochondrial dna haplogroup d, a sub - cluster of haplogroup m, is one of the prevalent lineages in east asian population and is defined by c5178a. the snp changes amino acids from leu to met in nd2, which is also a mitochondrial subunit of complex i. several studies have nominated mt5178a as a candidate genetic marker of longevity, as well as a protector against certain adult - onset diseases in the japanese population. nevertheless, the relationship between c5178a and pd still lacks clarification among the same population. it is the case that certain mtdna variations are representative for specific races or geographical regions. in han chinese, the protective effect against some adult - onset diseases has not been detected in 5178a, and on the contrary, our research suggests that 5178a is a predisposition to pd in people younger than 50 years of age. specifically, it proved the probable relationship between the haplogroups d and pd in the han population. in addition, as a sub - cluster of haplogroup m, haplogroup d possesses 10398 g and 5178a, makes a possible influence on the function of complex i with an integrative effect for different age brackets. the potential role of haplogroup d in younger patients may be based on several elements : such as oxidative stress, cell apoptosis, and respiratory chain complex activities. by the way, in aao we believe that the difference between the two results come from the different methods of stratification (aae / aao). certainly, a larger sample and age - matched study will be necessary to explore this influence in the future. in our study, 10398 g and 10400 t seem to not be associated with the risk of pd. although the function of these snps remains unclear, some investigations have found that 10398 g shows a protective effect on pd in certain population, a conclusion not arrived at in other studies. mtdna 10398 g and 10400 t are located in the nd3 gene, which encodes one of the seven subunits constituting complex i. a10398 g leads a substitution of thr with ala, while c10400 t causes a synonymous mutation with thr. as described in several studies, the 10398 g and 10400 t are usually tightly linked. since the effect of a single variation can possibly be modified by other existing mtdna or a nuclear gene polymorphism, we decided to analyze the coexistent a10398 g and c10400 t together in order to avoid bias. from our data, we failed to find any significant association between the snps and pd in han chinese, which is consistent with the results of similar studies carried out in other population. in a previous report, single common variation did not seem to be pd - deterministic because of the overall modifying effect by other snps. as the typical snps for super - haplogroup m and found at a large frequency in our samples, the 10398 g and 10400 t may just be a marker for mtdna haplogroup but not a genetic factor involved in pd among han chinese. a strength of our study is that the control group is representative of the general population in southern china, and the ethnic backgrounds of the subjects are consistent. as for limitations, a similar percentage of patients and controls could not be classified to any of the six major asian haplogroups. the samples pooled in the others category might be derived from some particular haplogroups which have not been incorporated to our research, such as m7-m10, or other rare haplogroups, such as y or p. in summary, we speculate that mtdna haplogroup b might confer a lower risk for eopd and people younger than 50 years in han chinese, while haplogroup d probably lead a higher risk of pd in people younger than 50 years of age. our research reveals that particular asian mtdna haplogroups likely play a part in the pathogenesis of pd among han chinese. certainly, a case control study with larger samples and further biochemical analysis will be warranted to clarify the exact function of mtdna haplogroups in pd among han chinese. | background : mitochondrial dysfunction is linked to the pathogenesis of parkinson 's disease (pd). however, the precise role of mitochondrial dna (mtdna) variations is obscure. on the other hand, mtdna haplogroups have been inconsistently reported to modify the risk of pd among different population. here, we try to explore the relationship between mtdna haplogroups and sporadic pd in a han chinese population.methods:nine single - nucleotide polymorphisms, which define the major asian mtdna haplogroups (a, b, c, d, f, g), were detected via polymerase chain reaction - restriction fragment length polymorphism or denaturing polyacrylamide gel electrophoresis in 279 sporadic pd patients and 510 matched controls of han population.results:overall, the distribution of mtdna haplogroups did not show any significant differences between patients and controls. however, after stratification by age at onset, the frequency of haplogroup b was significantly lower in patients with early - onset pd (eopd) compared to the controls (odds ratio [or ] = 0.225, 95% confidence interval [ci ] : 0.0820.619, p = 0.004), while other haplogroups did not show significant differences. after stratification by age at examination, among subjects younger than 50 years of age : haplogroup b also showed a lower frequency in pd cases (or = 0.146, 95% ci : 0.0300.715, p = 0.018) while haplogroup d presented a higher risk of pd (or = 3.579, 95% ci : 1.11211.523, p = 0.033), other haplogroups also did not show significant differences in the group.conclusions:our study indicates that haplogroup b might confer a lower risk for eopd and people younger than 50 years in han chinese, while haplogroup d probably lead a higher risk of pd in people younger than 50 years of age. in brief, particular asian mtdna haplogroups likely play a role in the pathogenesis of pd among han chinese. |
however, vitamin d deficiency is not only a risk factor for osteoporosis ; there is also evidence that it is responsible for decreased muscle functions and falls1,2,3,4,5. recently, there has been a growing field of research concerned with the association between vitamin d deficiency and a wide range of diseases other than osteoporosis in the elderly. it has been found that the capacity for synthesizing vitamin d decreases with age due to the changes in the skin seen with aging2. decreases in oral intake and absorption of vitamin d in the intestines as well as low 1 alpha hydroxylase enzyme activity in the kidneys, frequently lead to the development of vitamin d deficiency in the elderly2. considering the theory that vitamin d regulates skeletal muscle physiology, as suggested by various clinical observations and experimental studies, the muscular weakness seen in older patients with low - serum 25-oh - vitamin d (25(oh)d) concentrations may lead to falls6, 7. indeed, cholecalciferol - calcium supplementation reduces falls by 46% to 65% in community - dwelling older women5. on the other hand, there are many factors affecting fall - risk in the older population. in an overview of the literature by annweiler.8, it was asserted that age - related changes in postural reactions may be related to vitamin d status, mediated through either central nervous system integration or antigravity muscles as the effectors in postural responses. some studies showed that people with vision and balance disorders had lower levels of vitamin d compared to those without. although no evidence has reported that lower levels of vitamin d result in neurobehavioral impairment, it seems that vitamin d plays an important role in neurobehavioral functions9. this suggests that muscular weakness can not be considered as the only mechanism of fall - risk related to vitamin d deficiency. on the other hand, there is no clear consensus regarding the relationship between falls and vitamin d. karlsson.10 in their review reported that vitamin d supplementation, with or without calcium, in the community - living elderly did not reduce the number of falls or number of fallers. in that study, the authors recommended the administration of vitamin d supplements in those with low levels of vitamin d. there has been confusion about which form of vitamin d is effective in reducing the risk of falls. no fall - reductive effect in community - dwellers has been reported with alfacalcidol, whereas those with calcitriol had a 36% reduction in the number of falls11. according to previous data showing that impaired balance is an established risk factor for falls in older persons12, 13 although clinical studies indicated a significant impairment of postural balance in vitamin d deficiency, there are few studies in which the effect of vitamin d on falls and balance were assessed by the posturographic method14,15,16. for this reason, our study intends to explore whether there is an association between vitamin d and risk of falling, balance, and lower extremity neuromuscular function in women aged 60 and above by using tetrax posturography. a total 200 women aged 60 and above who applied to our outpatient clinic were enrolled into the study between december 2010 and june 2012. a history of intake of medications that affect the central nervous system and/or bone metabolism ; the presence of a disease that affects postural stability and gait such as parkinson s disease, stroke, dementia and vitamin b12 deficiency ; the presence of any neurological motor deficit such as paresis or orthopedic problems such as previous arthroplasty, amputation or severe osteoarthritis in the lower extremities, were exclusion criteria. in addition, patients who had severe liver disease, cardiac failure, other severe metabolic diseases, and mental disorders were also excluded. the patients cognitive status was measured by the mini mental state test (mmst)17. if the patient had had a score 12 schooling years29 (14.5)6 (7.8)23 (18.7)vitamin d supplementation (n, %) 63 (31.5)13 (16.9)50 (40.7)history of falls (n, %) 1 fall36 (18.0)14 (18.2)22 (11.5) > 1 fall18 (9.0)9 (11.7)9 (9.6)season of blood collectionwinter (n, %) 123 (61.5)48 (62.5)75 (61.0)summer (n, %) 77 (38.5)29 (37.7)48 (39.0)using of loop and/or thiazide diuretics (n, %) 38 (19.0)14 (18.2)24 (19.5)using of psychotropic medications (n, %) 34 (17)9 (11.7)25 (20.3)number of births (meansd)3.31.93.52.03.11.8ocular problems (n, %) 179 (89.5)68 (88.3)111 (90.2)25-oh - vitamin d (nmol / l, meansd)68.738.734.09.490.433.9student t test, test. p<0.05. there was no significant difference between the groups except vitamin d supplementation (13 subjects-16.9% vs. 50 subjects- 40.7%, p<0.05). p<0.05 a comparison of the serum 25(oh)d level groups (hypo - vitaminosis group and normal group) for the clinical assessment parameters is presented in table 2table 2.comparison of the groups for clinical testshypo - vitaminosis group(<50.0 nmol / l)n=77normal group(50.0 nmol / l)n=123standing balance, median (min / max)3 (04)4 (14)gait, median (min / max)3 (14)3 (14)chair stand performance, median (min / max)2 (04)3 (04)sppb total, median (min / max)8 (112)10 (212)ipaqsedentary (n, %) 59 (76.6)78 (63.4)low physical activity (n, %) 18 (23.4)45 (36.6)hand grip, jamar (kg, meansd)18.3 4.9 19.5 4.6tetrax- falling risk, (meansd)55.725.841.125.0tetrax- si, median (min / max)no19.6 (7.748.5)15.8 (6.454.0)nc21.2 (8.397.5)18.3 (7.865.8)po20.2 (8.778.6)19.6 (8.856.2)pc28.3 (12.776.3)21.1 (8.990.4)hr23.3 (13.298.2)22.3 (8.387.7)hl24.5 (10.289.3)22.0 (7.888.4)hb24.9 (12.271.4)20.2 (8.3124.6)hf22.5 (10.5113.6)21.18 (9.1389.33)total 190.9 (115.0607.0)167.7 (80.3614.2)tetrax- wdi. median (min - max)no5.9 (1.020.0)6.0 (1.2518.9)nc5.6 (019.1)5.5 (0.-19.1)po8.4 (2.020.9)9.1 (0.929.1)pc9.1 (1.821.3)9.0 (2.027.8)hr7.2 (1.321.3)5.9 (1.618.1)hl7.3 (0.717.8)6.2 (0.619.5)hb7.3 (1.019.1)7.0 (1.018.4)hf6.5 (0.618.2)5.0 (0.516.9)total57.0 (17.3156.0)52.7 (22.4146.8)sppb : short physical performance battery, ipaq : international physical activity questionnaire, si : stability index, wdi : weight distribution index, no : neutral position with eyes open, nc : neutral position with eyes closed, po : eyes open on pillows, pc : eyes closed on pillows, hr : head turned right and eyes closed, hl : head turned left and eyes closed, hb : eyes closed raising head backward 30, hf : eyes closed with head forward approximately 30. mann whitney u test. test. sppb scores, si and wdi results on posturography were given as median values because normal distribution could not be obtained. standing balance, gait, and chair stand performance scores were significantly better in patients with serum 25(oh)d levels higher than 50.0 nmol / l (p<0.05). total sppb scores were also different between the groups, indicating that the group with serum 25(oh)d levels higher than 50.0 nmol / l had significantly better lower extremity functions (p<0.05). similarly, falling risk and si values in the most of the postures were significantly higher in the hypovitaminosis group (p<0.05). sppb : short physical performance battery, ipaq : international physical activity questionnaire, si : stability index, wdi : weight distribution index, no : neutral position with eyes open, nc : neutral position with eyes closed, po : eyes open on pillows, pc : eyes closed on pillows, hr : head turned right and eyes closed, hl : head turned left and eyes closed, hb : eyes closed raising head backward 30, hf : eyes closed with head forward approximately 30. mann whitney u test. this study showed that serum 25(oh)d levels were significantly associated with clinical balance test results, falling risk and si values on tetrax posturography. this finding was confirmed with comparison analyses showing better balance control, lower extremity function, and less falling risk in the patients with serum 25(oh)d levels higher than 50.0 falling is a significant concern in elderly individuals, resulting in complex problems related to the personal and societal impact of aging. recently, there has been a growing field of research concerned with reducing the risk of falls and increasing muscle strength in at - risk subjects. for this purpose, major institutions such as the international osteoporosis foundation, endocrine society and us preventive services task force recommend giving vitamin d to elderly people in order to reduce the risk of falling. muscle weakness, muscle pain (especially in the proximal muscles), and gait disorders are commonly seen in vitamin d deficiency3,4,5,6. from previous data, it has been demonstrated that the lower extremity functions were better with higher 25(oh)d levels in older people21,22,23,24. our findings, in accordance with these reports, support the importance of vitamin d in lower extremity functions. an accurate evaluation of balance control in elderly patients is necessary before effective treatment can be recommended or developed. sppb, which is comprised of standing balance, usual gait, and chair stand performance, is a widely - used test for this purpose18. although such clinical tests may allow for interference of subjective factors, it is easy to use and is reported to have high validity and reliability. in our study, we found significant differences between the two groups for all subtests, and the total score of sppb indicated better performance in the patients with serum 25(oh)d levels higher than 50.0 posturography is a balance - status measurement that is used to quantitatively assess human postural stability and postural responses25. it is based on computerized elaboration of electronic signals emitted by four footplates, one for each heel and toe25. in this way, it provides the investigation of visual, somatosensory, motor and central nervous processes and their effect on stability. st, which quantitatively measures the postural sway according to changes in the pivoting center with high values indicating worse postural performance, was higher in most of the postures of hypovitaminosis group compared to those of the other group. on tetrax posturography, falling risk is a comprehensive result based on all results in all positions, with higher values indicating that the patient is at risk of falling. falling risk was significantly higher in the hypovitaminosis group in our study. in the regression analysis, serum 25(oh)d concentrations were also associated with falling risk, supporting this result, even with adjustment for confounding variables and potential mediators of fall risk. on the other hand, wdi was not different between the groups. wdi is a discrepancy from equal weight distribution (25% of weight on each plate). considering its role on balance, with high values indicating orthopedic problems, this result may be explained. according to our findings, the anti - fall effect of vitamin d is supported by the results of the clinical balance test and tetrax posturography are inconsistent with previous observations. in many studies on elderly people, a clear relation between vitamin d deficiency and postural instability has been demonstrated5, 14, 26. however, most of these studies used sppb as a balance test in evaluating this relationship. among the studies which used posturography, a similar study investigating the effects of vitamin d on postural balance was conducted by boersma d. in that study, it was concluded that posture was impaired in vitamin d deficiency (< 30 nmol / l) in comparison to patients with vitamin d levels between 30 to 50 nmol / l and higher than 50 nmol / l. when compared with our study, it seems that their results are of a similar nature, but are not completely comparable due to the variability in vitamin d boundaries, parameters, and method used. indeed, the absence of standardization of method particularly regarding the range of vitamin d levels- in such studies leads to incompatible results. there is no clear consensus on what is the optimal range of vitamin d in the prevention of deterioration of balance and neuromuscular functions. the american endocrine society defines levels of 50 nmol / l or below as deficiency20. thus, we grouped our patients according to serum 25(oh)d levels below or above 50 nmol / l. recent research has provided an increasing number of arguments in favor of an action of vitamin d on muscles and the central nervous system. it is well known that 1.25-dihydroxy vitamin d, the active vitamin d metabolite, binds to a vitamin - d - specific nuclear receptor (vdr) in muscle tissue27,28,29, leading to de novo protein synthesis30 and muscle cell growth29. vitamin d may improve muscle strength and function, as well as balance due to the improved strength. on the other hand, vdrs have been demonstrated in some parts of the brain, especially in the cortical, subcortical and spinal motor zones31, 32. according to this evidence, it seems that vitamin d plays a role in the cerebral processes of postural balance. since only women aged 60 and above were enrolled into the study, we can not apply our results to all older people in this age population. secondly, since tetrax usually evaluates stability in the static condition, it is difficult to assess the problems of balance control in the dynamic state. another limitation could be addressed through a pilot study to investigate whether the tetrax balance control index is confounded by age, weight, or height, which is currently lacking. because a difference regarding these parameters could not be found between the two groups in our study, any confounding effects of age, weight, or height may be limited. in summary, this study showed better balance control, better lower extremity function, and less falling risk in patients with serum 25(oh)d levels higher than 50.0 this finding was supported using both clinical tests of postural balance and tetrax posturography. nevertheless, our results should be confirmed by further studies on wider populations to establish definitive effectiveness. | [purpose ] to evaluate the association between vitamin d and risk of falling, balance, and lower extremity neuromuscular function in women aged 60 and above by using tetrax posturography. [subjects and methods ] a total 200 women were classified based on their 25-oh - vitamin d (25(oh)d) values : hypo - vitaminosis group (less than 50.0 nmol / l) and normal group (50.0 more). balance was measured using a tetrax posturography device (sunlight medical ltd, israel). falling risk, stability index (si), and weight distribution index (wdi) were calculated. short physical performance battery (sppb) and international physical activity questionnaire (ipaq) were used as the clinical tests. [results ] standing balance, gait, chair stand performance and total sppb scores were significantly better in the patients with serum 25(oh)d levels higher than 50.0 nmol / l. similarly, falling risk and si values in the most of the postures were significantly higher in the hypovitaminosis group. there were significant associations between serum 25(oh)d levels with sppb total score and tetrax - measured falling risk. [conclusion ] this study showed better balance control, lower extremity function, and reduced falling risk in patients with serum 25(oh)d levels higher than 50.0 nmol / l in women aged 60 and above. |
preliminary estimates show that 11% of the global burden of disease is manageable by surgery (1). even with conservative estimates, each year 7 million people suffer from complications caused by surgery, while probably half of them are preventable. studies have also shown that the rate of major complications caused by surgery for hospitalized patients in developed countries is 3 - 6%, accounting for 0.4 - 0.8% of total mortality, as opposed to 5 - 10% in developing countries (2). what is more, the performance of organizations providing surgical care in low- and middle - income countries (lmics) is not satisfactory (3). only 3.5% of major surgical procedures are performed in low - income countries, while they account for 1.3% of the world s population (4). in addition to the quality of surgical procedures, the cost - effectiveness of surgeries is a very important issue which is different between countries. available evidence suggests that the cost - effectiveness of essential surgical care in lmics is not appropriate (1). it seems that although surgery is an integral component of health care, it is generally neglected in these countries (5, 6). to tackle the above problems and reduce inequity in the quality and quantity of surgical care in the world, especially in lmics, in december 2005, the world health organization (who) launched a global initiative on emergency and essential surgical care. this initiative includes educational materials, designing a tool for data collection regarding the quantity and quality of surgical care and emergency care (standard tool for situational analysis), and preparing and completing a global atlas for essential surgical care (5). the first level comprises primary health care, the second level delivers both inpatient and outpatient specialized health services by hospitals and health centers, and the third level provides subspecialty services as inpatient and outpatient services. the medical universities based on their educational, research, and medical facilities, and also on the indictors of provincial health are divided into three types. type i universities have more facilities and better health indicators than the other two types (7). based on this grouping, 31% of hospitals are managed by type i universities, 52% by type ii, and 17% by type iii universities. this study, originally presented as a phd thesis, aims to address the current dearth of information on the status of surgical care in iran and also to introduce and implement strategies suggested by the who for the universal and effective management of essential surgical care in iran. this research was a descriptive and cross - sectional study performed at 42 first - referral district hospitals in iran in 2013 selected via the randomized sampling method. in june 2012, the study protocol was approved by the ethics committee of iran university of medical sciences (project # 344). general, governmental and non - educational hospitals which had active operating rooms were included in this study. general private or charity hospitals as well as those in provincial capitals were excluded from the study. first, the hospitals that met the inclusion criteria were determined. as is shown in table 1, there were 68 hospitals in type i universities, 113 in type ii, and 37 in type iii. then, due to the large number of the qualified hospitals, according to the proportion of each type of university hospitals, it was decided to choose 3 hospitals for each type i university, 2 hospitals for each type ii university, and one hospital for each type iii university. consequently, via random sampling, the present study included 73 hospitals, 42 of which responded with completely answered questionnaires and they were eligible to be included in the final data analysis. the study tool was a questionnaire developed by the who in 2003 for the situational analysis of emergency and essential surgical care (8, 9). this tool is used to assess surgical needs in many developing countries and has been translated into farsi and validated and employed in iran by mouseli (2009) (10 - 12). however, the researcher improved and completed the translation of the tool before it was utilized. the questionnaire consisted of 138 questions in four parts, encompassing general information about the hospital, surgical and anesthetic infrastructure, human resources for surgery, surgical interventions and services, and equipment for surgery and resuscitation. the reliability of the questionnaire was evaluated by calculating cronbach s for 7 filled questionnaires, which yielded 77.7% internal co - efficiency. thereafter, the questionnaire was filled after obtaining the consent of the directors of the studied hospitals and ensuring the confidentiality of the information. the data were analyzed via descriptive statistics (i.e. frequency, percentage, and ratio) using the spss software (version 16). among the studied hospitals, there were 16 (38.1%) type i, 19 (45.2%) type ii, and 7 (16.7%) type iii university hospitals. the total population covered by these 42 hospitals was 5637688, and the mean of the population covered by each hospital was 134230.67 67496.22. the average number of the active hospital beds was 94.55 44.74, and the mean number of the operating rooms was 3.36 1.62. the mean distance to the next health center in the next level was 120.57 88.66 km. as the data presented in table 2 show, the highest numbers of approved beds and active beds were 200 and 220, respectively. the highest number of the operating rooms was 8, with a mean number of 3.36. additionally, the mean number of the admitted patients was 15186.10, the mean number of the patients that underwent surgery was 3249.73, the mean number of the operated children younger than 15 years old was 279, and the mean number of the patients that were referred to more equipped centers for surgery was 233.89. regarding infrastructure, our results showed that all the hospitals had oxygen cylinders, running water, electricity, functioning anesthesia machines, emergency departments, archives of medical records, and functioning x - ray machines. the least available facilities were central oxygen (27 [64.3% ] hospitals) and blood banks (28 [66.71% ] hospitals). in all the hospitals, regardless of their types, specialists in surgery, anesthesia, and obstetrics and gynecology were available full time. to complete expert staff, in addition, none of the general practitioners or nurses that were qualified or had performed surgery or anesthesia was reported as hospital staff. number of the paramedics and nurses is related to all the wards of the hospital and not just surgery. as is shown in table 5, cricothyroidotomy was offered only in 85.7% of the hospitals and foreign body removal in 85.7%. among urgent procedures, neonatal surgeries were conducted in 14.3% of the hospitals, open treatment of fractures in 71.4%, and amputation in 66.7%. from non - urgent procedures, acute burn management was conducted in 38.1% of the hospitals, urethral stricture dilatation in 64.3%, cleft - lip repair in 31%, and release of contracture tissue in 52.4%. the present study showed that the most common shortage was in arm and leg splints, reported by 47.6% of the hospitals. cricothyroidotomy sets and artery forceps were available in 57.1% and 78.5% of the hospitals, correspondingly. the other required supplies were always available in most of the hospitals (over 85%). among the studied hospitals, there were 16 (38.1%) type i, 19 (45.2%) type ii, and 7 (16.7%) type iii university hospitals. the total population covered by these 42 hospitals was 5637688, and the mean of the population covered by each hospital was 134230.67 67496.22. the average number of the active hospital beds was 94.55 44.74, and the mean number of the operating rooms was 3.36 1.62. the mean distance to the next health center in the next level was 120.57 88.66 km. as the data presented in table 2 show, the highest numbers of approved beds and active beds were 200 and 220, respectively. the highest number of the operating rooms was 8, with a mean number of 3.36. additionally, the mean number of the admitted patients was 15186.10, the mean number of the patients that underwent surgery was 3249.73, the mean number of the operated children younger than 15 years old was 279, and the mean number of the patients that were referred to more equipped centers for surgery was 233.89. regarding infrastructure, our results showed that all the hospitals had oxygen cylinders, running water, electricity, functioning anesthesia machines, emergency departments, archives of medical records, and functioning x - ray machines. the least available facilities were central oxygen (27 [64.3% ] hospitals) and blood banks (28 [66.71% ] hospitals). in all the hospitals, regardless of their types, specialists in surgery, anesthesia, and obstetrics and gynecology were available full time. to complete expert staff, in addition, none of the general practitioners or nurses that were qualified or had performed surgery or anesthesia was reported as hospital staff. number of the paramedics and nurses is related to all the wards of the hospital and not just surgery. as is shown in table 5, cricothyroidotomy was offered only in 85.7% of the hospitals and foreign body removal in 85.7%. among urgent procedures, neonatal surgeries were conducted in 14.3% of the hospitals, open treatment of fractures in 71.4%, and amputation in 66.7%. from non - urgent procedures, acute burn management was conducted in 38.1% of the hospitals, urethral stricture dilatation in 64.3%, cleft - lip repair in 31%, and release of contracture tissue in 52.4%. the present study showed that the most common shortage was in arm and leg splints, reported by 47.6% of the hospitals. cricothyroidotomy sets and artery forceps were available in 57.1% and 78.5% of the hospitals, correspondingly. the other required supplies were always available in most of the hospitals (over 85%). the present study provides a general view of the current status of surgical and anesthesia services in first - level hospitals in the referral system in iran, based on the who tool. our findings identified the gaps in the infrastructure, human resources, surgical interventions, and essential equipment and indicated that suitable facilities and equipment, human resources, and infrastructure are available in the district hospitals in iran at a standard higher than that in many of the lmics which have evaluated and published the status of their own essential surgical care (11 - 17). our results also showed a significant improvement in status by comparison with the situation 5 years ago in iran. this is the second study in iran to have evaluated surgical care in the district hospitals using the who tool. the results of the present study, conducted 5 years after the previous one, showed that iran has made significant progress in the different aspects of surgical care over the recent years (10). in the infrastructure domain, despite its wide geographical expanse, iran has endeavored to provide its population with access to essential surgical care. our results revealed that the mean number of the hospital beds in the 42 evaluated hospitals was 97.24, which shows a good increase compared with the figure (69 beds) reported in the previous study. more than 92% of the studied hospitals had management guidelines for surgery, anesthesia, pain relief, and emergency conditions. the reasons for the availability of these guidelines were the implementation of clinical governance and safe surgery services in the hospitals, as well as the requirement for accreditation programs for the hospitals (18). in comparison with 5 years ago, the surgical services have made headway in all aspects of the infrastructure domain (10). this indicates the good status of iran s general hospitals in terms of infrastructure, which also suggests that more surgical services can be defined for the hospitals in this level. our findings also demonstrated that the status of surgical care in iran compared with that in many developing and even some developed countries is good. in regard to infrastructure, the situation of iran compared with that of other developing countries, which were studied using the similar assessment tool, was significantly better, such that it places iran in the range of developed countries. in mongolia, only 45% of the hospitals had power generators and 23% had blood banks (13). in afghanistan, 41% of the hospitals had anesthesia machines and 40% had access to running water (14). in gambia, oxygen sources, running water, and electricity were available in 77.8%, 50%, and 44.4% of the hospitals, correspondingly. furthermore, most of the studied hospitals in these countries did not have management guidelines (15). in terms of human resources, the iranian ministry of health has made great strides in promoting surgical care by training more surgeons. presently, 52 medical universities and medical faculties are active in iran, which yearly accept 150 residents in general surgery in 27 universities, 181 anesthesia residents in 26 universities, and 224 obstetrics and gynecology residents in 27 universities (19). there is no shortage of human resources in iran, but their distribution is far from equitable (20, 21) insofar as the expert human resources are less likely to work full time in disadvantaged provinces. it is notable that surgical services were provided only by surgeons, anesthesiologists, and obstetrics in the studied hospitals. performing surgery and anesthesia by general physicians is illegal ; therefore, none of the surveyed hospitals permitted general practitioners or other health care personnel to perform any surgery or anesthesia. considering human resources, iran also has a very good condition compared to many developing countries. for example in afghanistan, a study reported that only 64.7% of the hospitals had surgeons and 29.4% had anesthesiologists. in addition, 30% of afghanistan s hospitals did not have gynecologists, which was one of the main reasons for the referral of patients to the next health level (14). in mongolia, the presence of surgeons and anesthesiologists was not reported even as part time and only in limited hospitals did general physicians have the permission to perform anesthesia and surgery (13). in some studies, for example in sierra leone, likewise, in the east region of africa, there were 400 surgeons for more than 200 million people (17, 22). in the surgical intervention domain, life - saving services such as resuscitation and chest tube insertion were offered by 100% of the hospitals. cricothyroidotomy and foreign body removal were offered in 85.7% of the hospitals, and the other hospitals referred their patients to a higher level. for emergency surgeries like neonatal operations, most of the hospitals (85.7%) also referred their patients to a higher level. services for acute burn, dilatation of urethral strictures, and cleft lip were provided in 38.1%, 64.3%, and 31% of the hospitals under study, respectively. the main reason for not offering these services as stated by the other hospitals was a lack of specialists, followed by a paucity of equipment. mouseli in his study reported neonatal surgery and cleft - lip repair in 40% and acute burn treatment and dilatation of urethral stricture in 45% of the hospitals ; these figures are not very different from our results (10). in the present study, all the studied hospitals provided anesthesia services, and only 26.2% of them did not offer anesthesia with ketamine. the principal reason for this shortcoming was a lack of experts and equipment. in this domain, iran s status is far more desirable than that in many developing countries. in tanzania, equipment shortages precluded the provision of many life - saving procedures such as oxygen tubing, pulse oximetry, and pediatric intubation (11). in gambia due to the inadequacy of human resources, cesarean section and appendectomy were performed only in 58.8% of the hospitals (15). with respect to equipment, the iranian ministry of health has tried to improve surgical care by equipping hospitals and paying special attention to operating rooms. equipment and supplies, renewable items, and supplementary equipment were always available in all the hospitals in the current study. only items like arm and leg splints (47.6%) and cricothyroidotomy sets (57.1%) were not always available in the studied hospitals. the availability of equipment showed that there has been a good improvement in this area since the last study in iran (10). in this regard, iran s situation was superior to that in many other developing countries. in mongolia, the availability of arm and leg splints and cricothyroidotomy sets was reported in 14% and 18% of the hospitals, correspondingly. in addition, oxygen sources, suction pumps, and resuscitator bag valves and masks (for adults) were only supplied in 9% of the hospitals in mongolia (13). in contrast, our findings showed that the same pieces of equipment were, respectively, available in 100%, 97.6%, and 95.2% of the hospitals evaluated. the limited number of the studied hospitals compared with the total district hospitals (42 vs. 218) may limit the generalizability of our results to all surgical care in all districts and is, as such, one of the limitations of the present study. another drawback of note is that the quality of the provided surgical services was not assessed in this study. furthermore, it is possible that because of the weaknesses in the hospital information system (his) in some hospitals, the accurate number of the patients referred to next levels was not reported. considering the defined level of services for these hospitals on the basis of the findings of the current study, it is advisable that a revision be made to these services with a view to expanding the spectrum of the provision of care. by encouraging health care personnel, especially surgeons and anesthesiologists, to render their services in small towns, it will be possible to provide better quality services at higher levels and reduce referral rates. moreover, the attainment of this goal requires a more equitable distribution of specialists to reflect the acceptable status of equipment distribution in iran. it is deserving of note that very few studies have hitherto been conducted on the performance of district hospitals, not least in the field of surgical services. the present study, thus, sought to present a general view of the current status of surgical services at iranian district hospitals. | background : surgery is an essential component of health care, yet it has usually been overlooked in public health across the world.objectives:this study aimed to perform a situational analysis of essential surgical care management at district hospitals in iran.materials and methods : this research was a descriptive and cross - sectional study performed at 42 first - referral district hospitals of iran in 2013. the world health organization (who) tool for the situational analysis of emergency and essential care was used for data collection in four domains of facilities and equipment, human resources, surgical interventions, and infrastructure. data analysis was conducted using simple descriptive statistical methods.results:in this study, 100% of the studied hospitals had oxygen cylinders, running water, electricity, anesthesia machines, emergency departments, archives of medical records, and x - ray machines. in 100% of the surveyed hospitals, specialists in surgery, anesthesia, and obstetrics and gynecology were available as full - time staff. life - saving procedures were performed in the majority of the hospitals. among urgent procedures, neonatal surgeries were conducted in 14.3% of the hospitals. regarding non - urgent procedures, acute burn management was conducted in 38.1% of the hospitals. also, a few other procedures such as cricothyrotomy and foreign body removal were performed in 85.7% of the hospitals.conclusions:the results indicated that suitable facilities and equipment, human resources, and infrastructure were available in the district hospitals in iran. these findings showed that there is potential for the district hospitals to provide care in a wider spectrum. |
the approval rate for drugs to treat central nervous system (cns) disorders is significantly lower than that for other therapeutic classes. despite aggressive efforts, many new compounds targeting the cns are not effective in delivering a safe and efficacious dose to the brain. one challenging aspect of cns drug development is the requirement of the compound to cross the blood the bbb consists of a continuous layer of endothelial cells, surrounded by astrocyte foot - processes, and scattered pericytes. an intact bbb presents a formidable obstacle for the entry of drugs into the brain. the brain microvessel endothelial cells that form the bbb have complex tight junctions, low endocytic activity, and an absence of fenestrations that prevent the passage of most polar and hydrophilic solutes from the blood into the brain. furthermore, numerous efflux transporters including breast cancer resistance protein (bcrp), p - glycoprotein (p - gp), and multidrug resistance protein (mrp) are expressed within the brain microvessel endothelial cells collectively, these efflux transporters move a wide variety of compounds including phospholipids, ions, peptides, steroids, polysaccharides, amino acids, organic anions, bile acids, drugs, and other xenobiotic from the brain to the blood. one such method is to chemically modify the drug molecules to reduce their interactions with efflux transporter proteins and, thus, enhance their permeation through the transcellular route. this method had been tested with some chemotherapeutic drugs including paclitaxel. while chemical modification of functional groups has proven beneficial in improving bbb permeability through limiting drug interaction with efflux transporters, there are clearly structural limitations to this approach. another strategy to enhance drug delivery to the brain involves the direct bypassing of the bbb altogether. two common techniques that utilize this approach include intraventricular infusion of the drug and intracerebral implants containing drug. these techniques have great potential in delivering a high dose of drug locally into the brain without causing systemic side effects ; however, when used in clinical settings, the results to date have been disappointing. this may be due to the relatively small surface area of the brain that is in contact with the ventricular compartment and the limited diffusion of the drugs into the brain parenchyma from the infusion site in humans compared to preclinical animal models. the most clinically proven approach to increase drug penetration into the cns thus far is to reversibly disrupt the junctions formed by the endothelial cells to enhance their permeation through intercellular junctions. this can be accomplished through the use of osmotic agents or pharmacologically through the targeting of membrane receptors that alter bbb permeability. while osmotic agents like mannitol have been used to modulate bbb permeability in both preclinical and clinical setting, the major drawback with osmotic disruption is the long recovery period required for re - establishment of bbb integrity. with several hours required for the return of normal bbb function, pharmacological agents such as cereport, a bradykinin receptor agonist, have been shown to transiently disrupt the bbb in various animal models. however these agents have failed to produce the desired response in clinical trials due to nonuniform disruption of the bbb. the limitations in clinical studies clearly highlight the need for an alternative method that can provide a homogeneous disruption of the bbb within a desired therapeutic window to maximize the therapeutic response of drugs in the brain. an important component of the bbb is the adheren junction which is primarily composed of cadherin proteins. the binding of cadherin proteins on adjacent brain microvessel endothelial cells forms a homolytic dimer within the cell junction that limits the paracellular passage of solutes with diameter greater than 11 or approximately 500 da. the cadherin protein has an extracellular (ec) domain which consists of five tandem repeated units (ec-1 to ec-5). site directed mutagenesis studies have shown that the highly conserved region of his - ala - val (hav) is involved in the formation of the dimer. synthetic peptides based on the hav region sequence have also been shown to inhibit the interactions between the e - cadherin molecules and prevent the aggregation of bovine brain microvessel endothelial cells in a concentration dependent manner. furthermore, pretreatment of madin darby canine kidney (mdck) with a hav based peptide having the amino acid sequence of ac - shavss - nh2 resulted in an increased paracellular diffusion of radiolabeled mannitol and decreased transepithelial electrical resistance (teer). based on these in vitro studies, the flanking of hav residue can directly interfere with the interactions between the cadherin proteins. furthermore, hav peptide has been shown to enhance the brain delivery of c - mannitol and h - daunomycin in an in situ rat brain perfusion model. however, the extent of bbb disruption produced by hav peptides has not been fully elucidated in vivo. the present studies set out to examine the effects of hav peptide on bbb permeability in vivo with special emphasis on the time to onset, and duration of action for hav peptide - induced changes in cerebral vascular permeability in the mouse. furthermore, using both magnetic resonance imaging (mri) and near - infrared fluorescence (nirf) contrast agents, alterations in bbb permeability to small and large molecular weight compounds as well as a p - glycoprotein substrate were evaluated. modulation of bbb permeability was rapid, occurring within minutes following systemic administration of hav peptide. equally important, bbb integrity was restored within 1 h. the modulation of bbb permeability with hav peptide was observed for both small and large molecular weight permeability agents and, to a lesser extent, with p - gp dependent permeability agents. together these studies suggest cadherin peptides can be used to transiently modulate bbb permeability for enhanced drug delivery to the brain. the hav peptide (ac - shavss - nh2) was synthesized using solid phase method with fmoc - chemistry in pioneer peptide synthesizer. after removal from the resin, the peptide was purified using a semipreparative c18 column in hplc. the purity of the peptide is higher than 96% as determined by c18 analytical hplc. the nirf imaging agents, irdye 800cw peg and rhodamine 800 (r800), were obtained from licor (lincoln, ne) and exciton (dayton, oh), respectively. gadolinium diethylenetriaminepentaacetate (gd - dtpa) contrast agent used for mri of bbb permeability was obtained from berlex (lachine, qc, canada). ketamine hydrochloride and xylazine adult female balb / c mice were used to characterize the bbb - disruption profile produced by hav peptide. mice were obtained from the university of manitoba breeding colony and maintained in the central animal care facility under temperature - controlled environment with 12 h dark / light cycle and unlimited access to food and water. all animal experiments followed the canadian council on animal care (ccac) guidelines and were approved by the university of manitoba animal care committee (protocol number 09 - 049). quantitative determination of bbb permeability was performed using three different imaging agents and magnetic resonance (mri) and near - infrared fluorescence (nirf) imaging modalities described below. the onset and duration of hav peptide - induced alterations in bbb permeability were initially assessed using magnetic resonance imaging (mri) with gd - dtpa contrast agent as described previously by on. mice were anesthetized and secured in a bruker biospect mr (7 t/21 cm spectrometer with 2.5 2.5 cm field of view). a series of t1-weighted images (rare factor = 8, echo time = 11.56 ms, effective echo time = 11.56 ms, repetition time = 852 ms, averages = 6, total image time = 2.40 min) and t2-weighted images (rare factor = 8, echo time = 20 ms, effective echo time = 80 ms, repetition time = 1640 ms, averages = 12, total image time = 10.50 min) of the mouse brain were obtained prior to administration of gd - dtpa contrast agent to acquire background images of the mouse brain. the onset of hav induced bbb disruption in mice was determined by administration of gd - dtpa contrast agent (0.4 mmol / kg) together with hav (0.0010.032 mmol / kg) or vehicle (pbs) via tail vein injection. a series of t1-weighted images were obtained immediately following gd - dtpa administration and at 3 min intervals throughout a 21 min imaging session. after 21 min, a second dose of gd - dtpa was administered and t1-weighted images were obtained at 3 min intervals for an additional 21 minute imaging session. to confirm the bbb disruption period for hav peptide, a separate group of mice were administered hav peptide (0.01 mmol / kg) or vehicle 1 h prior to the first gd - dtpa (0.4 mmol / kg) injection. immediately following administration of gd - dtpa contrast agent, a series of t1-weighted scans were taken at an interval of 3 min for a period of 21 min. after the first 21 min of scanning, the mice received a second dose of gd - dtpa and were imaged for an additional 21 min as described above. quantitative assessment of gd - dtpa enhancement in the brain was accomplished by manually outlining regions of interest (roi) within the coronal brain slices using marevisi 7.2 software (institute for biodiagnostics, national research council, canada). changes in gd - dtpa intensity in the brain were determined using a percent difference analysis of brain slice images within the paravision 3.0 software package according to the following formulas : the resulting data were graphed as the fold - enhancement in gd - dtpa at the various time intervals. in a separate study, the effects of hav on cerebral blood flow were also examined using perfusion - weighted mri with a bruker biospec 7 t/21 cm spectrometer (bruker biospin, karlsruhe, germany) equipped with a 2.5 cm diameter quadrature volume coil (national research council, winnipeg, mb, canada). mice were anesthetized with 1.5 to 2% isoflurane in 30% oxygen and 70% nitrous oxide and were secured in the magnet and maintained at a core temperature constant at 37 c. the relative cbf was measured using an adiabatic spin labeling sequence with a 36-echo haste readout following a 400 ms post tagging delay at 1 mm slice thickness with a resolution of 234 m. coronal slices images of the brain were obtained at 3.4 mm below the bregma for cbf measurement. analysis of mri cbf was performed using marivisi 7.2 analysis software (national research council, winnipeg, mb, canada). the relative blood flow was measured throughout the brain region and was expressed as the percent difference in intensity. the effects of hav peptide on the bbb permeability of a large molecular weight compound as well as a p - glycoprotein (p - gp) sensitive agent was also examined as previously described using nirf imaging agents. for these studies, mice received both irdye 800cw peg (0.01 mol / kg), a pegylated dye of approximately 25 kda molecular weight used for assessing macromolecule vascular leakage, and r800 (0.032 mol / kg), a nirf dye with p - gp substrate properties. the nirf probes were administered to mice under four different treatment regimes. in treatment regime a, the mice received only vehicle injection ; treatment regime b received only 0.01 mmol / kg hav ; treatment regime c received (9 mg / kg) gf120918, an inhibitor of p - gp ; while treatment regime d received a combination of both 0.01 mmol / kg hav and 9 mg / kg gf120918. the dosage 9 mg / kg of gf120918 was selected based on previous in vivo studies showing significant inhibition of p - gp activities without adverse effects on the animals. the mice were sacrificed at various times (1560 min) following treatment via cardiac perfusion with 10% formaldehyde solution. the brain and other tissues were removed, and the accumulation of nirf dyes was examined ex vivo using an odyssey near - infrared imaging system (licor, lincoln, ne). quantitative assessment of fluorescence was performed on roi in 2 mm thick coronal tissue slices and normalized to fluorescence from blood samples taken at the time of tissue collection. resulting values were presented as relative fluorescence units per mm of tissue divided by relative fluorescence units per microliter of blood. student t tests were used to analyze the changes in permeability of gd - dtpa in different brain regions as well as the changes in permeability of irdye 800cw peg in various tissues following the systemic administration of either vehicle or hav (figure 1 and figure 6 respectively). the dose dependent effects of hav on gd - dtpa accumulations as well as the ex vivo accumulations of r800 and irdye 800cw peg in the brain were analyzed using anova with student newman keul post hoc comparison of the means. statistical significance was set at p < 0.05 unless otherwise stated. modulation of bbb permeability with hav peptide was initially assessed using gd - dtpa contrast enhanced mri. figure 1 shows a representative series of t1-weighted mr images taken from the posterior brain region of vehicle (pbs) or 0.01 mmol / kg hav peptide - treated mice. mice receiving vehicle had no change in bbb permeability as shown by the similar gd - dtpa contrast enhanced images of coronal brain slice at time 0 (prior to the injection of vehicle solution) and at 9 min (time 9) following vehicle injection (figure 1a and figure 1b, respectively). in contrast, administration of 0.01 mmol / kg of hav peptide resulted in an increased accumulation of the gd - dtpa contrast agent in the brain (represented by white - gray appearance indicated by red arrows) when compared to images obtained in the same mouse prior to hav peptide injection at time 0 (figure 1). this increase in bbb integrity in response to hav peptide was observed in all regions of the brain examined (figure 1c e). quantitative assessment of gd - dtpa contrast enhancement in the various brain regions indicated an approximately 24-fold increase in gd - dtpa intensity in the hav treatment group compared to control mice in all regions of the brain examined (figure 2a). furthermore, the disruption of bbb integrity mediated by hav peptide was dose dependent with the lowest dose (0.001 mmol / kg) having no effects on gd - dtpa accumulation in the brain and the highest dose (0.032 mmol / kg) producing a 4-fold higher enhancement of the gd - dtpa signal in the brain compared to control mice (figure 2b). assessment of hav peptide - mediated effects on bbb permeability using gd - dtpa contrast - enhanced mri. representative t1-weighted posterior coronal slice images of mouse at time 0 (a) and 9 min (b) after an iv injection of either vehicle (pbs) or (0.01 mmol / kg) hav peptide. quantitative analysis of pixel intensity of gd - dtpa in (c) posterior brain region, (d) midbrain region, and (e) anterior brain region following an administration of either vehicle (pbs) or (0.01 mmol / kg) hav peptide solution. data is expressed as the fold - enhancement of whole brain pixel intensity (outlined in yellow) at a particular time point compared to the whole brain (outlined in yellow) pixel intensity at the time 0. area under the curve for % gd - dtpa enhancement over the combined 39 min imaging session in control and various dosages (0.0010.032 mmol / kg) of hav peptide treated mice within different brain regions. the time frame for bbb disruption with the hav peptide was also determined using mri techniques. the increase in gd - dtpa accumulation in the brain was rapid, with significant increases observed within 36 min following systemic administration of hav peptide (figure 1). this transient nature of the bbb disruption was confirmed as administration of gd - dtpa contrast agent at 1 h following administration of hav peptide (0.01 mmol / kg) resulted in no significant increases in gd - dtpa accumulation in the brain (figure 3). to confirm that the bbb permeability enhancing affects mediated by hav were independent of cerebral blood flow, a separate group of mice were selected for cerebral blood flow assessment using mri. as shown in figure 4, hav treatment did not alter the blood flow to the brain as indicated by similar image intensity compared to both preinjection in the same mouse and control mice receiving vehicle alone. quantitative analysis of pixel intensity for gd - dtpa enhancement normalized to the pixel intensity at time 0 following a 60 min pretreatment with either vehicle (pbs) or 0.01 mmol / kg hav peptide. assessment of cerebral blood flow mediated by 0.01 mmol / kg hav using mri. representive of perfusion weighted mr images obtained before and after an injection of either vehicle (pbs) or 0.01 mmol / kg of hav via tail vein (a) as well as the quantitative data for cbf obtained from the images (b). two - way anova was used with treatment and imaging time as the independent variables. there was no statistically significant difference between treatment groups or imaging time, and there was no interaction between the two. the range of solutes that could be delivered to the brain by hav peptide modulation of bbb permeability was examined using a large macromolecule paracellular marker (irdye 800cw peg) as well as small molecule, p - gp substrate (r800). both probes were examined at different time points (1560 min) following hav peptide exposure using near - infrared fluorescent imaging techniques. under control conditions, there was little accumulation of either irdye 800cw peg or r800 in the brain (figure 5). indeed most of the fluorescence appeared to be associated with the cerebral vasculature (figure 5a and figure 5b) with nonvascular brain regions showing minimal fluorescence (figure 5a). similarly, r800 fluorescence activity in the brain under control conditions was comparable to that observed in mice receiving no r800 injections (figure 5a and figure 5b). in contrast, mice receiving hav peptide showed a significant increase in fluorescence of both irdye 800cw peg and r800 in the brain tissue (figure 5). in the case of r800 there was an approximately 2-fold increase in r800 accumulation in the brain following hav peptide exposure (figure 5c). this was comparable to the increases in brain accumulation of r800 observed following treatment with the p - gp inhibitor, gf120918 (figuer 5c). for irdye 800cw peg, an approximately 6-fold increase in brain accumulation was observed following hav peptide treatment (figure 5d). in contrast, gf120918 had no effect on irdye 800cw peg accumulation in the brain (figure 5d). the effect of the hav peptide on bbb permeability was transient with maximal increases in both r800 and irdye 800cw peg observed within 15 min of hav peptide exposure and no significant increases over that of control observed following 60 min pretreatment with the hav peptide (figure 5b). examination of fluorescence accumulation in other tissues indicated that systemic exposure to hav peptide altered permeability of irdye 800cw peg in other tissues besides the brain. those tissues displaying increased permeability of irdye 800cw peg permeability marker following hav treatment included the kidneys, intestines, and lungs (figure 6). effects of hav peptide and gf120918 on the permeability of a p - gp substrate, r800, as well as the permeability of a large macromolecule, irdye800 cw peg in the bbb at 15 min (a) and 60 min (b) pretreatment of either vehicle (pbs) and 0.01 mmol / kg hav peptide. quantitative assessment of r800 (c) and irdye 800cw peg (d) in the brain at various time points under the different treatment groups including vehicle (pbs), gf120918, hav peptide, and hav peptide in combination with gf120918. quantitative assessment of irdye 800cw peg in various tissues at 20 min following an injection of the dye normalized to the intensity of irdye 800cw peg in the blood. one of the most significant obstacles in the development of agents to treat cns diseases is achieving therapeutically relevant concentrations of drug in the brain due to the presence of the blood brain barrier (bbb) and the blood cerebral spinal fluid barrier (bcsfb). these barriers are composed of epithelial (bcsfb) or endothelial (bbb) cells with tight junctions and active efflux transporters that together restrict both the paracellular and transcellular passage of solutes into the brain. however, there are several ways to circumvent these barriers including the use of high concentration of osmotic agents or bradykinin analogues to reversibly disrupt the tight junction proteins allowing more drugs to penetrate. one major drawback with the use of high concentration of mannitol to transiently disrupt bbb integrity is the long recovery period associated with the disruption, which can last up to several hours, resulting in neurotoxicity and inflammation. although disruption of bbb integrity with bradykinin analogues occurs over a more condensed time frame, the lack of effectiveness in clinical trials has been attributed in part to the nonuniform distribution of their receptors in the brain, which ultimately resulted in nonuniform distribution of the drugs. clearly the failure of these compounds highlights the need for a new agent with a better bbb disruption profile that is able to uniformly enhance bbb permeability to improve drug delivery to the brain. synthetic hav peptide had been shown to inhibit the homolytic interaction between e - cadherin protein, an essential protein that forms the adherens junctions of the bbb. indeed the binding of these peptides to the extracellular domain of the proteins has been shown to reduce the teer reading and enhance the permeability of mannitol across the mdck cell monolayer. the ability of the hav peptide to alter bbb has also been demonstrated using a rat in situ brain perfusion model. however, the ability of the hav peptide to alter bbb permeability in the in vivo setting has not been demonstrated. the present studies describe a series of experiments detailing the effects of hav on bbb permeability in vivo, specifically focusing on the time to onset, and duration of action for hav - induced changes in cerebral vascular permeability in the mouse. in the present study, administration of hav peptide resulted in significant dose - dependent increases in the accumulation of gd - dtpa in the brain. the hav peptide effects on bbb permeability were not attributable to alterations in cerebral blood flow as the perfusion - weighted images from mri were similar in both hav peptide treated and control mice. the increased bbb permeability to gd - dtpa observed following hav administration was consistent with previous in situ perfusion study using radiolabeled mannitol, another small molecular weight paracellular marker. the studies by kiptoo and colleagues demonstrated a significant increase in the accumulation of intravenously infused c - mannitol following treatment with 1 mm hav peptide compared to either a vehicle solution or amino acid sequence scrambled control peptide. furthermore, when the dose of hav peptide was decreased to 0.5 mm, the amount of c - mannitol that accumulated in the brain was reduced by 40%. this is consistence with the dose - dependent effects of hav peptide observed with gd - dtpa in the present study. the gd - dtpa contrast agent has been widely used in clinical settings to identify localized cerebral microvascular leakage resulting from brain tumors or stroke. however, the present study employed gd - dtpa contrast enhanced mri to quantitatively characterize both the time course and magnitude of bbb disruption following hav peptide exposure throughout the entire brain. this approach has been used recently to characterize transient bbb alterations produced by lysophosphatidic acid (on.). an advantage in using mr imaging technology is the fast acquisition time, which allowed the monitoring of rapid changes in bbb permeability in response to hav - peptide exposure within the same animal. based on these studies, another advantage to this approach is the ability to monitor bbb alterations in various brain regions (i.e., posterior, midbrain, and anterior regions). consistent with previous studies, regional differences in bbb permeability were apparent with anterior regions of the brain having reduced gd - dtpa contrast enhancement compared to posterior regions. however, despite the regional differences in baseline bbb permeability, hav peptide produced similar magnitudes of bbb disruption. the gd - dtpa contrast enhanced mri also provided a means for determining the time frame of bbb disruption mediated by hav peptide. indeed, this is the first study that examines the disruption time frame of hav in vivo. the observation that gd - dtpa enhancement is completely abolished when the mice were given hav peptide at 1 h prior to the injection of the contrast agent indicates that bbb integrity was completely restored within one hour of hav peptide exposure. the one hour time frame for bbb disruption with the hav peptide is considerably less than in vitro studies reporting the return of barrier properties after 6 h incubation with hav peptide. furthermore, in vitro hav peptide stability studies reported a rat plasma half - life of 4.7 h. while various peptidases present in the blood and tissue can influence peptide activity, hepatic uptake and biliary excretion is the major route of elimination of a variety of small linear and cyclic peptide therapeutics. consequently, the shorter period of disruption observed in the present study likely reflects the importance of hepatic clearance mechanisms in determining the circulation time of the hav peptide. it should be noted that, from a clinical application perspective, the relatively short duration of disruption observed in vivo is a desired characteristic for cns drug delivery applications, as prolonged periods of bbb disruption in the clinical setting can lead to increased incidence of brain inflammation and edema. the impact of hav peptide on the pore - size opening of the tight junction of the bbb was also determined by utilizing the near - infrared imaging technology and the dyes rhodamine 800 and irdye 800cw peg. given its lipophilic nature, r800 would normally penetrate the bbb via transcellular diffusion ; however, as the dye is also a substrate for p - glycoprotein, one of the main efflux transporter in the bbb, the brain accumulation of r800 is limited. it was previously shown that when p - gp was inhibited by gf120918, the accumulation of r800 in the brain and the choroid plexus was significantly enhanced by 4- and 2-fold respectively. in the present study, treatment with gf120918 the effect of gf120918 on bbb permeability was selective for r800 as the brain penetration of the large molecular weight paracellular marker, irdye 800cw peg, was unaffected. it is important to note that treatment with the hav peptide resulted in similar increases in the accumulation of r800 in the brain as were observed with the p - gp inhibitor, gf120918. the one - hour window for hav peptide - mediated enhancement of the brain accumulation of r800 was similar to that observed with gd - dtpa. the ability to increase the brain penetration of r800 suggest that hav peptide based modulation of bbb permeability could be effective for therapeutics that have reduced bbb permeability due to active cellular efflux transport mechanisms. these findings support the previous studies in the in situ brain perfusion model reporting an effect of hav peptide on the bbb permeability of daunomycin, a p - gp transport substrate. it is postulated that hav peptide interferes with the intercellular junctions of the cells allowing for increased r800 permeability in the bbb via the paracellular route rather than the transcellular route. in the present study, the combination of gf120918 and hav peptide did not produce an additive affect in the amount of r800 accumulation in the brain. as the hav peptide and p - gp inhibitor are influencing different permeability pathways an additive effect of hav peptide and p - gp inhibition on radiolabeled daunomycin permeability was observed in the in situ brain perfusion studies. the results in the present study may be due to a maximal enhancement of r800 in the brain through either increased paracellular diffusion (hav peptide treatment) or increased transcellular diffusion (p - gp inhibition). if the hav peptide and gf120918 treatments resulted in maximal increases in r800 accumulation in the brain, then combining the two treatments would have no additional effects. in addition to increasing the permeability of r800, the disruption of the bbb via hav also enhanced the diffusion of a large paracellular compound irdye 800cw peg. the irdye 800cw peg is a large molecular weight near - infrared fluorescence imaging agent that has traditionally been used to examine vascular leakage and lymphatic drainage. with a molecular weight of 25 kda, little amount of dye was expected to penetrate the brain following a systemic injection under normal conditions. however, when the dye was administered in the presence of hav, a substantial enhancement of irdye 800cw peg leakage was observed in the brain. in addition to the brain, the permeability of irdye 800cw peg in other organs including the kidney, the lungs, and the small intestine was also increased in the presence of hav. in clinical applications, potential off - target site enhancement of vascular permeability would be minimized by carotid artery injections of the hav peptide that primarily target the cerebral vasculature. as expected, the presence of gf120918 had no impact on the diffusion of this paracellular marker. the results from this study suggested that hav - induced bbb disruption was not limited to small molecular weight compounds but was also present for larger macromolecules. as the magnitude of increase in small molecule gd - dtpa penetration was greater than that observed with the large molecule irdye probe, these findings further support the targeted alteration of paracellular diffusion with hav peptides. in summary, using both mri and nirf, the present studies showed that hav peptide was able to increase bbb permeability. consistent with the binding of cadherin and disruption of tight junction complexes produced by the hav peptide, increases in bbb permeability were most apparent for the small hydrophilic permeability marker, gd - dtpa. however, significant increases in bbb permeability were observed following hav exposure for both the large hydrophilic permeability marker, irdye 800cw peg, and the p - glycoprotein dependent permeability marker, r800. the hav peptide - induced enhancement of bbb permeability was transient with complete restoration of bbb integrity observed within a 60 min time period. the rapid onset and transient nature of the bbb modulation produced with the hav peptide is well - suited for cns drug delivery applications. | the present work characterizes the effects of synthetic e - cadherin peptide (hav) on blood brain barrier (bbb) integrity using various techniques including magnetic resonance imaging (mri) and near - infrared fluorescent imaging (nirf). the permeability of small molecular weight permeability marker gadolinium diethylenetriaminepentaacetate (gd - dtpa) contrast agent, the large molecular weight permeability marker, irdye 800cw peg, and the p - glycoprotein (p - gp) efflux transporter contrast agent, rhodamine 800 (r800), were examined in the presence and absence of hav peptide. the results consistently demonstrated that systemic iv administration of hav peptide resulted in a reversible disruption of bbb integrity and enhanced the accumulation of all the dyes examined. the magnitude of increase ranged from 2-fold to 5-fold depending on the size and the properties of the permeability markers. the time frame for bbb disruption with hav peptide was rapid, occurring within 36 min following injection of the peptide. furthermore, modulation of bbb permeability was reversible with the barrier integrity being restored within 60 min of the injection. the increased bbb permeability observed following hav peptide administration was not attributable to changes in cerebral blood flow. these studies support the potential use of cadherin peptides to rapidly and reversibly modulate bbb permeability of a variety of therapeutic agents. |
myositis ossificans [mo ] is a benign heterotropic bone forming (often- self resolving) pathology of bone and soft tissue. here we are reporting the first time in literature for osteomyelitis of myositis ossificans in arm of a male due to trauma as a perusal of rare entity. it is a case report of a 25 years old male presented to us in out - patient department with chief complaint of discharging wounds over mid part of left arm since six months. clinically provisional diagnosis of chronic osteomylitis of left humerus made and his x - ray sought. x- ray showed geographic appearance of myositis ossificans around the upper two third of left arm. sinuses curetted and infected bone (part of myositis ossificans) removed and sent for biopsy. osteomyleitis of myositis ossificans should be recognized as a possible differential diagnosis chronic discharging sinus. myositis ossificans [mo ] is a benign heterotropic bone forming (often- self resolving) pathology of bone and soft tissue. here we are reporting the first time in literature for osteomyelitis of myositis ossificans in the arm of a male due to trauma as a perusal of a rare entity. it is a case report of a 25 years old male presented to us in outpatient departments with chief complaint of discharging wounds over mid part of his left arm since six months. on the complete history taking he revealed that he had an episode of trauma one year back over his left arm due to fall on the ground and swelling develops at that time. for it he did not take any medical advice and he took few pain killers and repeated massage over his left arm. after six months of this incident he felt that now mid of his arm is pain full and after 2 to 3 episodes of fever pus discharge came out. since then, on and off the pus (sometimes with chunk of bone) is coming out. on physical examination there were multiple discharging sinuses (with the protruding bony chunk) over his lateral aspect of his mid part of the left arm with puckered and hyper pigmented skin [fig 1 ]. clinical provisional diagnosis of chronic osteomyelitis of left humerus made and his hematological examination and x - ray sought. his hematological study was near normal except the erythrocyte sedimentation rate (esr) which was raised (westergren s method=35 mm / hour). x- ray was astonishing, entire humerus bone was normal, and there was no any osteomyelitic change in the humerus. there was a geographic appearance of myositis ossificans around the upper two third of left arm [fig 2 ]. anteroposterior and lateral x - ray of left arm showing oseomyelitis ossificans. after consent taking, sinuses curetted out and sequestrum (infected part of myositis mass, because it was not feasible to remove the all myositis mass) removed and sent for biopsy and culture sensitivity. now after the one year of follow - up, there is no recurrence of the myositis ossificans. the exact pathogenesis of mo is not clear but one theory stated that due to injury there are fibroblastic proliferation or osteoblastic migration (from injured periosteum) into haematoma, have been blamed for causing the pathology of myositis ossificans. neither is it found exclusively in skeletal muscle nor there is muscle inflammation so its name is misnomer, even the name myositis ossificans is most commonly used clinical term. so the term heterotrophic ossification seems clinically worth. myositis ossificans have three variants, myositis ossificans circumscripta (moc), neurogenic myositis ossificans and fibrodysplasia (myositis) ossificans progressiva. myositis ossificans circumscripta (or traumatica) is a pseudosarcomatous pathology with restricted growth tendency. if its excision is done in matured phase (well demarcated from surrounding tissue) and if repeated injury is avoided then it may prevent the recurrence of it. neurogenic form of myositis involves the large joints of the body (hip, knee) if they have been immobilized due to traumatic neurological damage, burn or arthroplasty. but on the contrary to circumscripta, it involves the connective tissue between the muscle plane and around the joint rather than skeletal muscle [6, 7 ]. fibrodysplasia (myositis) ossificans progressiva (fop) have the preponderance for young age while the other two forms do so rarely. fop is an autosomal dominating inherited disabling disease (a disorder of bone morphogenic protein 4) have a predilection to paraspinal, scalp and temporomandibular joints (but never involves facial muscles, tongue, diaphragm and viscera). fop has the characteristic feature of (potentially recognizable at birth) short big toe, hallux valgus (also thumb and cervical spine sometimes involved) and broad femoral neck. there is spontaneous (also by trauma) endochondral ectopic ossification in tendons, ligaments, joint capsule and progressively in a specific manner and give a feature of second skeleton moc has peculiar clinico - radiological and cytological feature and clinically present as painful soft tissue swelling with restricted range of movement in a joint following a trauma. in the early stage it appears as irregular, hazy, flocculent structure, but after 3 weeks zonal calcified area is evident. so for the early diagnosis of moc, sonography and three phase bone scan is needed [11, 12 ]. this characteristic radiological feature of zoning, is due to distinct mature ossification at the periphery and centrally situated radiolucent (which is due to immature osteoid and primitive mesenchymal tissue) nidus. this characteristic feature of zoning differentiate it from extra skeletal osteosarcoma in which there is centrally situated radio opaque matured osteoid cell. zonal architecture is obvious after 6 weeks of trauma and computer tomography is needed to demonstrate this zonal mineralization pattern. for the management of moc initially conservative management (i.e. - rest, immobilization and physiotherapy) should be given and surgical excision can be used as a last resort for the matured stage (6 - 12 months of trauma) to avoid the recurrence. even after the diligent search we did not get any article on osteomyelitis in mo. etiopathogenesis of osteomyelitis in myositis mass can be conceded same, as it occurs in other bone (i.e. direct inoculation due to trauma or hematogenous spread). our case had the feature of chronic osteomyelitis (chronic discharging sinuses and protruded sequestrum) so the treatment protocol was the same as usual of the chronic osteomyelitis of normal bone. in summary, as a rare case in literature we are presenting the case of osteomyelitis of moc due to trauma. in this case mo was in matured stage and infected so the surgical excision done. as a perusal of rare presentation, clinicians should be aware of this unusual presentation of mo. osteomyelitis of myositis ossificans can be conceded as a possible differential diagnosis of chronic discharging sinus in a few feasible conditions (following trauma around joints). this type of presentation of myositis ossificans is rare, and we are reporting to it as a first time in literature. so we are bringing it to horizon of knowledge to disclose the unusual presentation of myositis ossificans. | introduction : myositis ossificans [mo ] is a benign heterotropic bone forming (often- self resolving) pathology of bone and soft tissue. here we are reporting the first time in literature for osteomyelitis of myositis ossificans in arm of a male due to trauma as a perusal of rare entity.case report : it is a case report of a 25 years old male presented to us in out - patient department with chief complaint of discharging wounds over mid part of left arm since six months. clinically provisional diagnosis of chronic osteomylitis of left humerus made and his x - ray sought. x- ray showed geographic appearance of myositis ossificans around the upper two third of left arm. sinuses curetted and infected bone (part of myositis ossificans) removed and sent for biopsy. now the patient is discharge and sinus free, and has resumed his work.conclusion:osteomyleitis of myositis ossificans should be recognized as a possible differential diagnosis chronic discharging sinus. this type of presentation of myositis ossificans is rarest. |
childhood mental disorders are known for their associated comorbidities ; childhood bipolar affective disorder and obsessive compulsive disorder are no different. they are marked with multiple comorbid anxiety disorders, mood disorders, and disruptive behavior disorders. it was once considered that bipolar comorbidity in obsessive compulsive disorder was rare and a systematic investigation in this area was not done until recently. even today, there is a dearth of literature in this area, when childhood population is considered. we report the case of a child presenting with obsessive compulsive disorder and bipolar disorder at a very young age. a review of the relevant literature has been undertaken, to compile the information on comorbidity of bipolar disorder and obsessive compulsive disorder in childhood. adolescent, obsessive compulsive disorder, bipolar disorder, antidepressant - induced mania / hypomania, and relevant articles were retrieved supplemented with a manual search of cross - references. the index patient, a four - year - old male, from a rural background of eastern india, presented with irritability for 18 months. (local dialect of hindi, meaning : there 's filth on my clothes and body) whenever someone would touch him and would be irritated. in the seven months prior to presentation he used to urge his family members to wash his dresses with detergent repeatedly. after being touched by someone he would insist on getting bathed, using an unusually excessive amount of water, and taking a long time before he would let the attendant take him out of the bathroom. he would also repeatedly touch the private parts of the female members of the family. another noted feature was his habit of repeatedly hitting himself or biting his body parts. on asking about these he would not provide any explanation, but however, the birth, prenatal, postnatal, and developmental history was unremarkable. when admitted in hospital he would often demand that the bed sheets and linens be washed several times a day, as they were not satisfactorily clean. he was started on escitalopram 5 mg per day and behavioral intervention was done for the self - injurious behaviors. he showed improvement in his overall condition and was discharged on that regime. at follow - up after four months, he showed increased goal - directed behaviors, an unusual cheerful mood, and the parents reported increased socialization. the diagnosis of obsessive compulsive disorder with mania was made ; he was re - admitted, escitalopram was stopped and tablet lithium 600 mg per day was started, and was increased to 750 mg (serum level 0.92 mmol / l) along with tablet risperidone 1 mg per day. on this regime the manic symptoms improved significantly. childhood bipolar affective disorder is different from the adult counterpart for its different clinical presentation (protracted irritability with frequent violent outbursts, confusing the picture with disruptive behavior disorder) and course (chronic and continuous rather than acute and episodic). it is also marked with frequent comorbidities and anxiety disorders, it often shows a bidirectional overlap. there have been few studies investigating the comorbidities of anxiety disorder in childhood and adolescent bipolar disorder, which are summarized in table 1.[138 ] these studies show that the prevalence of obsessive compulsive disorder in bipolar affective disorder cohorts, range from 0 to 54%. among other comorbidities, separation anxiety disorder, generalized anxiety disorder, and attention deficit / hyperactivity disorder figure, prominently. however, most of the studies were flawed by the selection and referral bias and the recall bias of patients and their guardians. also, there have been studies in pediatric obsessive compulsive disorder patients, where comorbid bipolar disorder has been assessed, which are summarized in table 2.[914 ] among the primary obsessive compulsive disorder cases, bipolarity has been seen in 1.85 36% of the patients, and in those patients, the overall severity is higher, they respond poorly to medications, and in them, the age of onset of obsessive compulsive disorder is earlier than in the cases of pure obsessive compulsive disorder patients. summary of studies assessing comorbid obsessive compulsive disorder in childhood and adolescent bipolar affective disorders summary of studies assessing bipolar affective disorder comorbidity in childhood and adolescent obsessive compulsive disorder antidepressant - induced manic / hypomanic switches in primary obsessive compulsive disorder cases have been very rare, especially in the pediatric population. the selective serotonin reuptake inhibitors (ssris) impose a lower risk in inducing a manic / hypomanic switch, compared to other antidepressants. cyclothymic and episodic variants of obsessive compulsive disorder have been described in adults, which are pointers toward latent bipolarity.[1821 ] however, there has been no study addressing these issues in children or in the adolescent population. in our case the age of onset of obsessive compulsive disorder was two - and - a - half years. to the best of the authors knowledge this is one of the youngest patients with obsessive compulsive disorder ever reported. a positive family history of bipolar disorder has been seen in our case, which might have paved the way for the onset of bipolarity in this case of a child who initially presented with obsessive compulsive disorder. bipolar affective disorder and obsessive compulsive disorder comorbidity is not uncommon in children or the adolescent population, although studies addressing this issue have been scarce. in our opinion, an index of suspicion for bipolarity is always required in childhood obsessive compulsive disorder cases with a family history of bipolar disorder, and the use of antidepressants in these cases has to be judicious. | obsessive compulsive disorder and bipolar affective disorder in the pediatric population show a bidirectional overlap. few studies that have addressed this issue show that the prevalence of obsessive compulsive disorder in bipolar affective disorder patients ranges from 0 to 54%, and 1.85 to 36% of the obsessive compulsive disorder patients have a comorbid bipolar affective disorder. we report a case of a patient with an onset of obsessive compulsive disorder at two - and - a - half years of age, who developed mania after exposure to escitalopram. we suggest that in pediatric obsessive compulsive disorder cases, antidepressants be used with caution, especially in cases with a positive family history of bipolar affective disorder. |
gemcitabine is a nucleoside analogue of cytarabine, first approved by the us food and drug administration in 1996. currently, in combination with other chemotherapeutic agents, gemcitabine is included among first - line treatments in some adjuvant and palliative settings for non small cell lung, ovarian, breast, and pancreatic cancers. in urothelial tumors, gemcitabine with cisplatin showed equal efficacy and less toxicity in elderly patients and currently, is a first - line regimen in advanced stages. mild proteinuria, microscopic hematuria, and elevated levels of blood urea nitrogen (bun) and creatinine (cr) can occur after gemcitabine treatment but are rarely of clinical significance. nevertheless, gemcitabine - induced thrombotic microangiopathy (tma) has been reported in a few cases and it can lead to persistent kidney failure with poor prognosis. the first case was reported in 1994 ; the currently known incidence of gemcitabine - induced tma is 0.0151.4%,. the combination therapies with other chemotherapeutic agents including carboplatin, cisplatin, vinorelbine, tegafur, and docetaxel may increase the risk of tma as discussed in previous studies,. there have been reports that gemcitabine - induced tma occurred in patients with urothelial cancer, but none of these included a nephrectomy case,,. we report the case of gemcitabine - induced tma in a patient with a single - kidney urothelial cancer, who eventually needed kidney biopsy for diagnosis. a 55-year - old man, who had undergone palliative chemotherapy for urothelial carcinoma, was referred to nephrology for dyspnea and generalized edema for a month. one year previously, he was diagnosed with urothelial carcinoma when he visited a clinic on account of right flank pain. he received one cycle of neoadjuvant chemotherapy with gemcitabine / cisplatin but did not continue because of elevation of the liver enzyme level. after the neoadjuvant chemotherapy, thrombocytopenia developed (92,000/mm), but the thrombocyte count returned to a normal level within 1 week. pathologic findings of the non tumor - involved kidney tissue showed a normal glomerulus without significant tubular damage. at the time of surgery, bun and serum cr (scr) levels were 15 mg / dl and 1.2 mg / dl, respectively. three months after surgery, multiple lymph node metastases were found on positron emission tomography, after completion of four cycles of palliative gemcitabine / cisplatin over 3 months. in each cycle, 35 mg / m of cisplatin and 1,500 mg / m of gemcitabine were injected. cumulative doses of cisplatin and gemcitabine were 294 mg and 18,354 mg, respectively, including neoadjuvant and palliative chemotherapy. the patient was hospitalized with dyspnea on exertion and generalized edema, developing during the final month of chemotherapy. he did not have a history of hypertension, but his blood pressure was elevated up to 164/110 mmhg. daily urine output had decreased to less than 500 ml / day, and lower extremity pitting edema was prominent. the white blood cell count was 4,303/mm, the hemoglobin level was 9.1 g / dl, and the platelet count was 133,000/mm. bun and scr levels were elevated to 42 mg / dl and 3.4 mg / dl, respectively. serologic test results were within the normal range, except for fluorescent antinuclear antibody titer positive at 1:40. the spot urine protein - to - cr ratio (g / g) was 15.32, and the albumin - to - cr ratio (g / g) was 9.375. shifting bilateral pleural effusions were found on chest radiography. on renal ultrasonography and abdominal computed tomography, interval decrease of multiple lymph node metastases was seen. on hospital day 3, hemodialysis was started because of worsening dyspnea and progressive azotemia. to differentiate the cause of rapidly progressive renal failure after the biopsy, anemia and thrombocytopenia worsened, with a hemoglobin level of 7.9 mg / dl and a platelet count of 98,000/mm. additional laboratory results were compatible with microangiopathic hemolytic anemia (maha), including decreased haptoglobin (8 mg / dl) and elevated plasma hemoglobin (10.5 mg / dl) levels, increased lactic acid dehydrogenase (533 iu / l) levels, and schistocytes on peripheral blood smears (fig. 1). ultimately, we demonstrated chronic tma involvement of the kidney with endothelial hypercellularity and a tram - track appearance, combined with acute tubulitis from the kidney biopsy (fig. 2). the patient underwent steroid and rituximab therapy, with 16 sessions of plasmapheresis ; however, his kidney failure did not recover, and he progressed to a dialysis - dependent state. bone marrow biopsy was performed to check for an occult cause of refractory tma, even after the intensive treatments, but did not show any abnormality. after 5 weeks of the treatments, thrombocytopenia began to recover, but urothelial carcinoma metastases progressed, and the patient is currently on second - line palliative chemotherapy with weekly taxol. tma is a spectrum of diseases that includes thrombotic thrombocytopenic purpura and hemolytic uremic syndrome, characterized by glomerular microvascular endothelial injury. anemia and thrombocytopenia occur as a result of maha, and other organs are often injured. in the kidney, tma appears as endocapillary cell swelling, fibrin thrombi, platelet plugs, arterial intimal fibrosis, and membranoproliferation. many chemotherapeutic agents, including mitomycin, bleomycin, cisplatin, and 5-fluorouracil, can induce tma, but the precise pathophysiology is unknown. since its initial use, a few cases of gemcitabine - induced tma have been reported. the incidence of gemcitabine - induced tma varies between 0.015% (based on clinical trials) and 0.41% (from a single - center study),. gemcitabine - induced tma can occur at a cumulative dose of 2,450 mg / m and within 3 months after the first chemotherapy cycle, but the risk of occurrence seems to increase when the cumulative dose approaches 20,000 mg / m and more than 18 doses are administered. although kidney biopsy is necessary for confirmation, clinical manifestations, such as maha and thrombocytopenia with acute kidney injury (aki), are sufficient for diagnosis in most cases discontinuation of gemcitabine and plasmapheresis with steroids is the primary therapy for tma. in some patients, recently, rituximab treatment showed benefit in cases refractory to plasmapheresis and steroid therapy,. for diagnosis of chemotherapy - induced tma, various factors need to be considered when thrombocytopenia with aki occurs during palliative treatment. thrombocytopenia and anemia can occur with myelosuppression, and chemotherapy - induced tubulopathy and microangiopathy caused by disseminated cancer can induce aki. early diagnosis and proper management are important to improve prognosis and enable further cancer treatment, but differential diagnosis is often difficult based on clinical manifestations. in addition, the variable time course of gemcitabine - induced tma presentation makes diagnosis more complicated. in our case, gemcitabine - induced tma presented acutely on a chronic course. from the patients history, foamy urine with dyspnea and generalized edema appeared at least 1 month before admission, which was 7 months after the initial gemcitabine dose, and 3 months after the start of palliative therapy. although aki was overt, with oliguria at the time of the admission, thrombocytopenia and maha were not evident. for correct diagnosis and management, kidney pathology showed chronic tma features. in this patient, thrombocytopenia and anemia recovered slowly, eventually requiring maintenance dialysis, even after active treatments including plasmapheresis and steroids. during the treatment of tma this case highlights the importance of following blood pressure and urinalysis for new - onset hypertension and proteinuria for early diagnosis, when treating with gemcitabine. in patients with urothelial cancer, urinalysis with cr testing should be performed routinely, with the caveat that various conditions can affect the result, including postoperative changes, tumor progression, and chemotherapy complications, as in this case. a high index of suspicion is required for early diagnosis, and biochemical tests associated with hemolysis should be considered. in conclusion, we report a case of chronic tma induced by gemcitabine that required kidney biopsy for diagnosis in a patient with a single kidney. usually, tma can be differentially diagnosed from maha features, thrombocytopenia, and other clinical manifestations, but sometimes, kidney biopsy is eventually needed to differentiate other causes. we should be aware of the importance of careful monitoring in renal function and be suspicious about tma in patients with urothelial cancer with palliative gemcitabine treatments as in this case. | thrombotic microangiopathy (tma) is a rare complication of gemcitabine treatment. a 55-year - old man with a history of urothelial cancer underwent right ureteronephrectomy and palliative chemotherapy. the patient presented with dyspnea, generalized edema with foamy urine, and new - onset hypertension with acute kidney injury (aki). although aki with oliguria was evident, thrombocytopenia and hemolytic anemia were not overt. to determine the cause of rapidly progressive azotemia, kidney biopsy was performed despite a single kidney and revealed chronic tma. microangiopathic hemolytic anemia and thrombocytopenia developed after renal biopsy. diagnosed as gemcitabine - induced tma, gemcitabine cessation and active treatment including steroids, plasmapheresis, and rituximab were carried out, but the patients condition progressed to a dialysis - dependent state. gemcitabine - induced tma is often difficult to diagnose because of its variable clinical course. therefore, heightened awareness of this potentially lethal complication of gemcitabine is essential ; renal biopsy may be helpful. |
the st george hospital specialises in peritonectomy and hyperthermic intraperitoneal chemotherapy (hipec) for treatment of intra - abdominal malignancies. despite performing around 800 peritonectomy and hipec procedures, we have rarely encountered desmoplastic small round cell tumours (dsrct). we present our experience with dsrct and hipec in a series of three cases, and propose peritonectomy and hipec as a treatment option for dsrct. a 26-year - old gentleman presented with localised right iliac fossa pain after having a colicky lower abdominal pain, which lasted 24 h associated with anorexia, and nausea but no vomiting. his bowel motions were regular, and he did not notice any blood, diarrhoea or tenesmus. he did not notice any weight loss and had been well prior to this episode. on examination he was afebrile, tachycardic, had a soft non distended abdomen with no palpable hernias or masses. he was tender over the right iliac fossa, hypogastrium and umbilical regions with guarding, rebound tenderness, and positive rovsing 's sign. given the high clinical likelihood of appendicitis, the patient was taken for laparoscopic appendicectomy without imaging. intraoperatively the appendix was found to be normal, however, a large mass was found on the right hepatic flexure with intra - abdominal pus noted. given this finding, the procedure was converted to an open appendicectomy and right hemicolectomy with the mass sent off for histological assessment. a 60 mm mass was resected from the colon with margins of 30 mm distally and 140 mm proximally. the tumour involved the full thickness of the colon wall invading through the serosal fat, just reaching the serosal surface. the diagnosis of dsrct was made on the basis of the tumour morphology showing nests of tumour cells with hyperchromic nuclei and scant cytoplasm surrounded by desmoplastic stroma, and positive immunohistochemistry staining for desmin and cytokeratin (fig. furthermore, fluorescence in situ hybridisation (fish) techniques revealed positive ewsr1 arrangements, which further supported our diagnosis. interestingly, the tumour did not stain positive with the wt1 antibody which is present in the majority of dsrct. staging workup with chest and abdomen ct, hepatic angiogram ct and pet scans revealed a stage 1 dsrct. given the aggressive nature of dsrct, the patient was treated with a potentially curative peritonectomy two weeks later with the aim of removing microscopic intraperitoneal disease and improving long term survival. the intraoperative assessment revealed a peritoneal cancer index (pci) of 4, with a small volume of disease in the pelvis. a revision of the ileocolic anastamosis, omentectomy, pelvic peritonectomy, excision of the umbilicus and intraoperative ultrasound for hepatic lesions was subsequently performed. the procedure achieved a complete cytoreduction of the tumour with a completeness of cytoreduction (cc) score of 0. postoperatively, urine output was maintained at 100 ml / h for 24 h given the nephrotoxicity of cisplatin. the repeat histopathology showed peritoneal deposits of dsrct in the ileocolic anastamosis, and pelvic peritoneum. the patient 's recovery was complicated by a pulmonary embolus on postoperative day 10, for which heparin infusion was initiated and subsequently switched to therapeutic enoxaparin. the patient was discharged from hospital on postoperative day 19 and commenced on systemic chemotherapy using cyclophosphamide, doxorubicin and vincristine. the patient had one episode of febrile neutropenia after his first cycle of chemotherapy and was admitted to hospital for intravenous antibiotics. he has since tolerated his cycles well and was on his fourth of nine cycles at the time of submission and would continue with ongoing oncologist follow up. the patient had repeat colonoscopies and pet scans with no evidence of recurrence at 6 months post peritonectomy. he remained asymptomatic with ecog performance status grade 0, and was continuing with gym training. a 14-year - old male was referred to our unit with stage 2 dsrct after being treated with 11 weeks of vincristine, doxorubicin, ifosfamide, and etoposide. he originally presented with a large pelvic mass which was compressing against his right ureter, bladder and prostate. he was referred to our centre after his initial chemotherapy and had an intraoperative pci of 12. we performed a laparotomy for right diaphragm strip, cholecystectomy, right hemicolectomy, anterior resection of the rectum, urinary bladder strip, and lymph node dissections, to remove all visible tumours. the histopathology confirmed dsrct with a ki-67 of 2030%, with clear resection margins but metastatic disease in the right common iliac vein lymph nodes. post operative recovery was complicated by haemorrhage from the right psoas, for which we performed a laparotomy for haemostasis and evacuation of the blood clot. despite ongoing chemotherapy with irinotecan / temozomide and external beam radiation therapy, the patient developed recurrence in the liver and right iliac lymph node chain at 15 months after our procedure, as evident on pet scans, and he would continue with ongoing oncologist follow up. the patient was asymptomatic, ecog grade 0 and competing in go kart racing at 20 months after initial diagnosis. a 21-year - old male was referred to our unit for recurrence of stage 1 dsrct. he initially presented 17 months prior with 3 months of increasing left inguinal lymphadenopathy associated with pain, but otherwise asymptomatic. his biopsy was positive for dsrct and he was subsequently treated with vincristine, doxyrubicin, cyclophosphamide, alphosphomide and etoposide, followed by surgical resection of the mass. this recurred in the pelvis 6 months later and he was referred to our centre. had an intraoperative pci of 5 and we performed a laparotomy for removal of all visible tumour from the rectum, iliac vessels, obturator nerve, pelvic peritoneum, and performed aortic node dissection. the histopathology confirmed dsrct with a ki-67 of 520%, with clear resection margins and metastatic disease in 6/6 lymph nodes. his post operative stay was complicated by bowel obstruction which was treated conservatively. despite ongoing chemotherapy with irinotecan / temozomide, the patient developed recurrence in the left external iliac and para - aortic lymph nodes 6 months after our procedure, as evident on pet scans, and he would continue with ongoing oncologist follow up. the patient remained energetic, asymptomatic, ecog grade 0 and was working on a ranch at 25 months after initial diagnosis. a 26-year - old gentleman presented with localised right iliac fossa pain after having a colicky lower abdominal pain, which lasted 24 h associated with anorexia, and nausea but no vomiting. his bowel motions were regular, and he did not notice any blood, diarrhoea or tenesmus. he did not notice any weight loss and had been well prior to this episode. apart from a previous cholecystectomy, his past medical and family history were unremarkable. on examination he was afebrile, tachycardic, had a soft non distended abdomen with no palpable hernias or masses. he was tender over the right iliac fossa, hypogastrium and umbilical regions with guarding, rebound tenderness, and positive rovsing 's sign. given the high clinical likelihood of appendicitis, the patient was taken for laparoscopic appendicectomy without imaging. intraoperatively the appendix was found to be normal, however, a large mass was found on the right hepatic flexure with intra - abdominal pus noted. given this finding, the procedure was converted to an open appendicectomy and right hemicolectomy with the mass sent off for histological assessment. a 60 mm mass was resected from the colon with margins of 30 mm distally and 140 mm proximally. the tumour involved the full thickness of the colon wall invading through the serosal fat, just reaching the serosal surface. the diagnosis of dsrct was made on the basis of the tumour morphology showing nests of tumour cells with hyperchromic nuclei and scant cytoplasm surrounded by desmoplastic stroma, and positive immunohistochemistry staining for desmin and cytokeratin (fig. fluorescence in situ hybridisation (fish) techniques revealed positive ewsr1 arrangements, which further supported our diagnosis. interestingly, the tumour did not stain positive with the wt1 antibody which is present in the majority of dsrct. staging workup with chest and abdomen ct, hepatic angiogram ct and pet scans revealed a stage 1 dsrct. given the aggressive nature of dsrct, the patient was treated with a potentially curative peritonectomy two weeks later with the aim of removing microscopic intraperitoneal disease and improving long term survival. the intraoperative assessment revealed a peritoneal cancer index (pci) of 4, with a small volume of disease in the pelvis. a revision of the ileocolic anastamosis, omentectomy, pelvic peritonectomy, excision of the umbilicus and intraoperative ultrasound for hepatic lesions was subsequently performed. the procedure achieved a complete cytoreduction of the tumour with a completeness of cytoreduction (cc) score of 0. postoperatively, urine output was maintained at 100 ml / h for 24 h given the nephrotoxicity of cisplatin. the repeat histopathology showed peritoneal deposits of dsrct in the ileocolic anastamosis, and pelvic peritoneum. the patient 's recovery was complicated by a pulmonary embolus on postoperative day 10, for which heparin infusion was initiated and subsequently switched to therapeutic enoxaparin. the patient was discharged from hospital on postoperative day 19 and commenced on systemic chemotherapy using cyclophosphamide, doxorubicin and vincristine. the patient had one episode of febrile neutropenia after his first cycle of chemotherapy and was admitted to hospital for intravenous antibiotics. he has since tolerated his cycles well and was on his fourth of nine cycles at the time of submission and would continue with ongoing oncologist follow up. the patient had repeat colonoscopies and pet scans with no evidence of recurrence at 6 months post peritonectomy. he remained asymptomatic with ecog performance status grade 0, and was continuing with gym training. a 14-year - old male was referred to our unit with stage 2 dsrct after being treated with 11 weeks of vincristine, doxorubicin, ifosfamide, and etoposide. he originally presented with a large pelvic mass which was compressing against his right ureter, bladder and prostate. he was referred to our centre after his initial chemotherapy and had an intraoperative pci of 12. we performed a laparotomy for right diaphragm strip, cholecystectomy, right hemicolectomy, anterior resection of the rectum, urinary bladder strip, and lymph node dissections, to remove all visible tumours. the histopathology confirmed dsrct with a ki-67 of 2030%, with clear resection margins but metastatic disease in the right common iliac vein lymph nodes. post operative recovery was complicated by haemorrhage from the right psoas, for which we performed a laparotomy for haemostasis and evacuation of the blood clot. despite ongoing chemotherapy with irinotecan / temozomide and external beam radiation therapy, the patient developed recurrence in the liver and right iliac lymph node chain at 15 months after our procedure, as evident on pet scans, and the patient was asymptomatic, ecog grade 0 and competing in go kart racing at 20 months after initial diagnosis. a 21-year - old male was referred to our unit for recurrence of stage 1 dsrct. he initially presented 17 months prior with 3 months of increasing left inguinal lymphadenopathy associated with pain, but otherwise asymptomatic. his biopsy was positive for dsrct and he was subsequently treated with vincristine, doxyrubicin, cyclophosphamide, alphosphomide and etoposide, followed by surgical resection of the mass. this recurred in the pelvis 6 months later and he was referred to our centre. had an intraoperative pci of 5 and we performed a laparotomy for removal of all visible tumour from the rectum, iliac vessels, obturator nerve, pelvic peritoneum, and performed aortic node dissection. the histopathology confirmed dsrct with a ki-67 of 520%, with clear resection margins and metastatic disease in 6/6 lymph nodes. his post operative stay was complicated by bowel obstruction which was treated conservatively. despite ongoing chemotherapy with irinotecan / temozomide, the patient developed recurrence in the left external iliac and para - aortic lymph nodes 6 months after our procedure, as evident on pet scans, and the patient remained energetic, asymptomatic, ecog grade 0 and was working on a ranch at 25 months after initial diagnosis. dsrct is a rare sarcoma with fewer than 200 cases reported between 1989 and 2010. it involves translocation t(11 ; 22) (p13 ; q12), which fuses the n - terminus of the ewing sarcoma (ews) gene to the c - terminus of the wilms tumour (wt1) gene, resulting in a ewsr1/wt1 fusion product and activation of the pi3k / akt / mtor pathway., dsrct has a nesting pattern of growth with focal rhabdoid features and intense desmoplastic reaction. a distinctive feature of dsrct is its divergent differentiation that immunohistochemically stain positive for epithelial (keratin, epithelial membrane antigen), mesenchymal (vimentin), neural (neuron - specific enolase, cd56), and myogenic (desmin) markers. interestingly, dsrct almost always stain positive with wt1 antibodies, which detects the wt1 component of the ewsr1/wt1 fusion product. even though our first case did not stain positive with wt1 antibodies, the diagnosis of dsrct was made based on morphology, positive cytokeratin and desmin staining showing divergent differentiation, and positive fish for the ewsr component of the mutation. dsrcts are located almost exclusively in intra - abdominal locations and classically involve a large intra - abdominal mass in the retroperitoneum, pelvis, omentum or mesentery, with diffuse peritoneal deposits that spread along peritoneal and mesothelial surfaces. dsrct directly spreads to various organs including liver, pancreas, spleen, and testes, with no consistent pattern of organ involvements, and can metastases to lung, and lymph nodes of the groin, neck and mediastinum. in rare cases, primary dsrct have been reported outside of the abdominal cavity to affect thorax, and head and neck regions. diagnostic investigations include abdominal imaging, either with computed tomography (ct), or magnetic resonance imaging (mri) to assess peritoneal and extra abdominal lesions, followed by a histological diagnosis with tissue samples from laparoscopy. the current proposed staging system based on comparison of outcomes involves stage 1 : pci < 12, without liver metastases ; stage 2 : pci 12 without liver metastases ; stage 3 : liver metastases ; and stage 4 : extra abdominal metastases. traditional treatments include induction chemotherapy using agents such as cyclophosphamide, doxorubicin, vincristine, ifosfamide and etoposide, followed by aggressive debulking and external beam radiotherapy. despite treatment, survival prognosis remains poor (table 1), with most patients experiencing resistant and recurrent disease before end of life. the data on use of hipec in dsrct is scarce, however, hayes - jordan. showed that hipec has improve survival outcomes with patients receiving neoadjuvant chemotherapy followed by cytoreductive surgery and hipec having a 3 year survival of 71% compared to 26% (p = 0.021) in patients who did not receive surgery or hipec. our follow up has been shorter and hence we were unable to make a direct comparison in terms of survival. our recurrences at 6 months and 15 months are comparable to the mean of 8.85 months reported by hayes - jordan. our remaining patient had no disease recurrence after 6 months and we hope for better outcomes given that he had no nodal disease, which is associated with better outcomes. our patients all had favourable prognostic factors including, young age at diagnosis, and high functional status at time of diagnosis, and all three patients have survived with good function and quality of life. survival prognosis remains poor in dsrct despite conventional treatment with surgery, chemotherapy and radiotherapy ; however, hipec has offered promising survival results. in our experience, patients with dsrct who present with nodal involvement or recurrent disease tend to recur early despite treatment with peritonectomy and hipec. despite this recurrence longer term follow up of our patients and future studies involving peritonectomy and hipec in dsrct would be useful in assessing long - term clinical outcomes and survival. written informed consent was obtained from the patients for publication of this case series and accompanying images. a copy of the written consent is available for review by the editor - in - chief of this journal on request. | introductionthe st george hospital specialises in peritonectomy and hyperthermic intraperitoneal chemotherapy (hipec) for treatment of intra - abdominal malignancies. despite performing around 800 peritonectomy and hipec procedures, we have rarely encountered desmoplastic small round cell tumours (dsrct). we present our experiences with dsrct, and propose peritonectomy and hipec as a treatment option for dsrct.presentation of casethis is a case series of 3 cases. the first case was a 26-year - old male who presented with appendicitis which we diagnosed as dsrct and treated with peritonectomy and hipec. the second case was a 14-year - old male referred to our centre for peritonectomy and hipec after initial presentation with a pelvic mass and treatment with chemotherapy. the third case was a 21-year - old male referred to our centre for peritonectomy and hipec for recurrent dsrct after previously being treated with neoadjuvant chemotherapy and surgery without hipec.discussiondsrct is a rare, almost exclusively intra - abdominal malignancy, which predominantly affects young males. survival prognosis remains poor in dsrct despite conventional treatment with surgery, chemotherapy and radiotherapy ; however, hipec has offered promising survival results. our recurrences with peritonectomy and hipec at 6 months and 15 months are comparable with the literature of 8.85 months.conclusionin our experience, patients with dsrct who present with nodal involvement or recurrent disease tend to recur early despite treatment with peritonectomy and hipec. longer term follow up of our patients and future studies involving hipec in dsrct would be useful in assessing long - term clinical outcomes and survival. |
khat (catha edulis forsk.) is a flowering perennial shrub cultivated for its neurostimulant properties resulting mainly from the occurrence of (s)-cathinone in young leaves. the biosynthesis of (s)-cathinone and the related phenylpropylamino alkaloids (1s,2s)-cathine and (1r,2s)-norephedrine is not well characterized in plants. we prepared a cdna library from young khat leaves and sequenced 4,896 random clones, generating an expressed sequence tag (est) library of 3,293 unigenes. putative functions were assigned to > 98% of the ests, providing a key resource for gene discovery. candidates potentially involved at various stages of phenylpropylamino alkaloid biosynthesis from l - phenylalanine to (1s,2s)-cathine were identified. |
|
ameloblastomas are the most common neoplasms of the jaws, and they arise from the odontogenic epithelium. they begin as an asymptomatic swelling of the jaws and gradually cause the mobility, displacement, and root resorption of the involved teeth. the most common histopathological types of ameloblastomas are the follicular and plexiform types, followed by the acanthomatous and granular cell types. waldron and el - mofty discovered a unique variant of the ameloblastoma in 1987, displaying a combined histology of desmoplastic and conventional ameloblastomas as a hybrid variant. only a few cases have been reported worldwide, accounting for about 1.1 to 4.3% of ameloblastomas. our search of the existingliterature demonstrated that the present case is the first of its kind inasmuch as it has a unique combination of follicular, cystic, acanthomatous, and desmoplastic variants of the ameloblastoma and involves a very unusual site (i.e., the maxilla). sudha and nageswara rao siddhartha institute of dental sciences, gannavaram, india, in may 2014, with a chief complaint of a swelling over the left side of his face of 4 years duration. the patient revealed a history of trauma sustained at the same site 11 years previously, followed by an asymptomatic period of 4 years. he then noticed a painless swelling in the anterior region of the maxilla, for which he underwent extraction of 21 and 22. the swelling recurred after 3 years at the same site with associated dull pain on wide opening of the mouth. on extraoral examination, a well - defined swelling was seen on the left side of the face measuring 54 cm in size. the obliteration of the nasolabial fold on the left side and a deviated nasal septum to the right side were noted. on palpation of the swelling, no local rise in temperature was noted and the swelling was non - tender and firm in consistency (figure 1a). on intraoral examination, a well - defined swelling was noted involving the left maxilla and measuring 65 cm. on palpation, the swelling was non - tender and revealed cystic consistency in the vestibular region, although it was firm in the palatal region (figure 1b). fine - needle aspiration was performed, which was nonproductive, and hematological investigations were within the normal limits. panoramic radiography showed a large, irregular, osteolytic lesion demonstrating a multilocular radiolucency in the left maxilla. wispy bone trabeculae were seen extending from 21 to 27 regions with an irregular soap - bubble appearance. the margins of the radiolucency were well - corticated and separated by thick bony septae (figure 2a). a) multilocular radiolucency involves the left maxilla and the adjoining sinus, exhibiting a soap - bubble pattern. b) axial computed tomography image shows a multilocular expansile lesion encroaching into the sinuses and the nasal cavity. axial computed tomography images demonstrated a large, well - defined, multilocular, expansile lesion with thin, corticated, bony walls. the internal structure of the lesion revealed multiple thin septae in the left maxilla extending superiorly from the infraorbital margin and inferiorly involving the alveolar ridge. the lesion extended medially to the lateral border of the nasal septum and the palatal process of the maxilla as far as the mid palatine raphe, encroaching the entire left maxillary sinus and laterally expanding into the buccal cortical plate (figure 2b). the lesion showed a bulge into the oral cavity involving the maxillary sinus and roots of all the teeth on the affected side with a deviated nasal septum to the right side. after a complete examination of the patient, the surgical resection of the tumor and hemimaxillectomy were performed under general anesthesia. the excision was done with a wide surgical margin, preserving the orbital floor (figure 3a). a split thickness graft was placed to close the surgical defect, and an immediate obturator was placed over the graft (figure 3b). the excised specimen was sent for histopathological examination (h & e 20x), which revealed islands of cells in which the peripheral cells were tall and columnar with subnuclear vacuolations and a peripheral prominent palisading appearance of basal cell nuclei with a reverse polarization (black and green arrow). the central cells appeared to be stellate reticulum - like cells with a few islands showing central necrosis, and there were large areas of cystic degeneration between the cells (red arrow). the tumor showed foci of squamous metaplasia (blue arrow) infiltrating the soft tissues and areas of dense hyalinization with focal desmoplasia of the connective tissue (yellow arrow), suggestive of an ameloblastoma with mixed subtypes consisting of follicular, cystic, acanthomatous, and desmoplastic variants (figures 4a, b, and c). written informed consent was obtained from the patient regarding the publication of the current case report along with the accompanying images. a) h & e 20x section shows follicles (black arrow) and peripheral hyperchromatic palisading ameloblast - like cells (green arrow) with stellate reticulum - like cells (red arrow) in the center intervening with a dense hyalinized desmoplasia connective tissue (yellow arrow). b) h & e 20x section presents follicles with peripheral hyperchromatic palisading - like cells (black arrow) with squamous metaplasia (blue arrow) and a few cells undergoing cystic degeneration (red arrow) with dense hyalinized desmoplasia (green arrow) like connective tissue stroma. the average age at the occurrence of hybrid ameloblastomas is similar to that of conventional ameloblastomas and it varies between the first and the seventh decades of life with a mean in the fourth decade, showing a male predilection. our patient was male and was in the fourth decade of his life. according to the literature, the most common site of involvement for hybrid ameloblastomas is the mandible at a ratio of 5:3 when compared with the maxilla. when the tumor occurs in the maxilla, the posterior region is the most affected, which may often compromise the maxillary sinus and the orbit. in the present case, the maxilla was involved, which is a very rare anatomical location for the occurrence of an ameloblastoma. maxillary tumors spread very quickly compared to mandibular neoplasms due to the thin cortical bone that forms the weak barrier for the spread of the tumor. in addition invasive maxillary ameloblastomas have grave prognoses owing to their extension into the orbit, frontal sinus, skull base, middle cranial fossa, and petrous apex. philipsen and coworkers proposed that a hybrid variant was a transitional form of the desmoplastic type, comprising the microscopic features of both desmoplastic and classic follicular or plexiform variants. the hybrid variant demonstrates varied radiographical appearances such as mixed radiolucent and radiopaque lesions with irregular borders similar to the common radiological pattern observed in the desmoplastic variant (with osteoplasia) or fibro - osseous lesions or malignant tumors owing to its high infiltrative nature, while few cases of hybrid ameloblastomas exhibited a multilocular radiolucent pattern, which is similar to that of conventional ameloblastomas, as was seen in our patient. the clinicopathological and radiographical features of a few reported cases of hybrid ameloblastomas are illustrated in table 1. however when the ameloblastoma shows a typical expansile multilocular aspect, the differential diagnosis can include a variety of odontogenic or non - odontogenic lesions with similar characteristics like odontogenic keratocysts, aneurysmal bone cysts, adenomatoid odontogenic tumors, odontogenic myxomas, and giant cell central lesions. clinicopathological and radiographical features of a few reported cases of hybrid ameloblastomas follicular and plexiform ameloblastomas are the most common histological variants and account for 32.5% and 28.2%, respectively, followed by the acanthomatous subtype with 12.1%. however, the desmoplastic variant is extremely rare, with an incidence ranging from 4 to 13%. the synchronized occurrence of the desmoplastic variant with another variant in the hybrid lesion is mysterious. it is considered a puzzling pathology in that it is doubtful whether a part of the primary desmoplastic variant transforms into the conventional variant, whether the desmoplastic change occurs secondarily in the stroma of a pre - existing solid multicystic ameloblastoma, or whether it is a collision tumor. two or more tumors that arise from independent topographic sites are regarded as collision tumors. the desmoplastic and conventional variants of hybrid ameloblastomas may develop simultaneously, which supports the collision concept. histopathologically, hybrid ameloblastomas show areas of extensive stromal collagenization or desmoplasia surrounding compressed islands of the odontogenic epithelium. the present case was diagnosed as a hybrid ameloblastoma according to the diagnostic criteria established by waldron and el - mofty as it showed histopathological features of the desmoplastic variant along with other variants like follicular, cystic, and acanthomatous ameloblastomas. this finding confirmed a unique hybrid variant, which we herewith report as the first of its kind to the best of our knowledge. various attributable facts could be a)their potential to grow to a large sizeb)likelihood of maxillary lesions to produce early invasion to the adjacent structuresc)the diffuse radiographical appearance and the histological findings of bone invasion their potential to grow to a large size likelihood of maxillary lesions to produce early invasion to the adjacent structures the diffuse radiographical appearance and the histological findings of bone invasion finally, it is difficult to treat these ameloblastomas surgically because it is unfeasible to find the exact interface of the lesion with the normal bone. smaller lesions can be managed with a conservative approach, whereas radical tumor ablation is preferred for larger lesions. for the unicystic type, this is usually enucleation, whereas for the solid and multicystic variants, it is marginal or segmental surgical excision. because there are vital structures adjacent to the maxilla, a significant recurrence rate after local curettage has been reported. recurrences usually present even decades after surgery ; therefore, following surgery, close follow - up is recommended during the first 5 years with an interval of once in a year and then once every 2 years with regular radiological investigations for the early detection of recurrence. concerning the present case, following the surgical management of the tumor, the patient is under regular follow - ups with no evidence of recurrence. we herein presented a unique case of a hybrid variant of the ameloblastoma involving the maxilla with clinical, radiographical, and histopathological features that render it the first of its kind to have ever been reported. this report is to alert practitioners regarding the clinical behavior of such lesions, necessitating a prompt diagnosis and treatment for a better prognosis and prevention of recurrence. | ameloblastomas are slow growing, locally invasive, benign odontogenic tumors of an epithelial origin, accounting for approximately 1% of all oral tumors. a 40-year - old man presented with a chief complaint of a swelling over the left side of his face of 4 years duration. on examination, gross facial asymmetry was detected, and a well - defined swelling was noted intraorally involving the left maxilla medially from the mid palatal raphe and obliterating the buccal vestibule laterally. the swelling was non - tender and exhibited dual consistencies : firm in the palate and cystic in the vestibular region. computed tomography revealed a multilocular radiolucency, which involved the left maxilla, encroached into the left maxillary sinus and the nasal complex, and caused bony erosion. early diagnosis and treatment are the key tools in managing ameloblastomas, failure of which may lead to a significant deterioration of the prognosis and an increased recurrence rate. uncommon variants of ameloblastomas have been gaining interest recently. to date, 25 cases of hybrid ameloblastomas have been documented in the scientific literature. we present an extremely rare hybrid type of the ameloblastoma with combined follicular, cystic, acanthomatous, and desmoplastic variants, which render it the first of its kind to have ever been reported. |
spontaneous cavernous carotid fistula (ccfs) are less common than traumatic ccfs and are quite a rare entity in children. their presentation widely varies, and diagnosis is commonly delayed due to late presentation to the hospital. most ccfs are not life threatening ; however, it is essential that ccfs be not overlooked in the paediatric population especially when dilated scleral veins, persistent headaches, proptosis and dysdiadochokinesis are present (fig. 1). figure 1:initial brain mri at presentation. initial brain mri at presentation. a 12-year - old girl presented with a 7-month history of frontal headaches and intermittent left - sided proptosis. on examination, she had dilated and engorged scleral veins on the left eye (evident on inspection), mild dysdiadochokinesia and past pointing on the left side. a brain computed tomography (ct) with contrast showed an enlarged left superior ophthalmic vein and a prominent left cavernous sinus. an interventional radiography (ir) cerebral angiogram under general anaesthesia was performed, which revealed evidence of an indirect ccf fed by ophthalmic branches of the left internal carotid artery and filling from multiple ethmodial branches of the distal internal maxillary artery. from the fistula, the ophthalmic vein was markedly hypertrophied and drained the cavernous sinus anteriorly. the fistula was also feeding from the right side through ethmodial branches into the right cavernous sinus and across to the left cavernous sinus (fig. 2). figure 2:(a) and (b) evidence of a ccf. (a) and (b) evidence of a ccf. after a discussion that involved the neuroradiology team, neurosurgical team, the patient and her family, a decision was made to proceed with endovascular treatment of the fistula. following informed consent from the patient 's parents, the procedure was performed under general anaesthesia. a headway microcatheter was advanced into the cavernous sinus trough the petrosal sinus into the cavernous sinus and subsequently into the dilated ophthalmic vein. multiple coils were then placed into the ophthalmic vein throughout its course in the orbit back as far as the anterior section of the cavernous sinus. no immediate complications occurred, and the patient woke without any new neurological deficit in recovery (fig. figure 3:(a) and (b) post - procedural digital subtraction angiogram under general anaesthesia shows no evidence of a residual ccf following coil embolization. (a) and (b) post - procedural digital subtraction angiogram under general anaesthesia shows no evidence of a residual ccf following coil embolization. the patient was discharged 3 days later and a follow - up brain magnetic resonance imaging (mri) was conducted 4 months afterward, which showed some residual proptosis. the superior ophthalmic vein was prominent but clearly less prominent than previous imaging. on a routine outpatient follow - up, her proptosis had significantly improved with reduction of the corneal injection, she reported no headaches and normal vision. a follow - up ir cerebral angiogram was conducted 4 months later that revealed no evidence of a residual ccf. a ccf is an abnormal communication between the internal or external carotid arteries and the cavernous sinus. these lesions may be classified based on aetiology (traumatic vs. spontaneous), velocity of blood flow (high vs. low) and anatomy (direct vs. dural, or internal carotid vs. external carotid). barrow (1985) proposed a classification of ccfs into four subtypes based on their communication. type a ccf are direct high - flow shunts between the internal carotid artery and the cavernous sinus. indirect fistulas are also referred to as dural cavernous sinus fistulas (dcsfs) because they are supplied by dural branches of both, external carotid artery (eca) and internal carotid artery (ica). type b ccfs, dcsf, are dural shunts between meningeal branches of the internal carotid artery and the cavernous sinus. type c ccfs, dcsf, are dural shunts between meningeal branches of the external carotid artery and cavernous sinus. type d ccfs, dcsf, are dural shunts between meningeal branches of both the icas and ecas and the cavernous sinus. type d is the most frequent type often supplied by numerous branches from both territories, sometimes bilaterally. the barrow classification does not, however, take into account cortical drainage nor does it differentiate between uniateral and bilateral supplies or fistulas [25 ]. spontaneous ccfs are less common than traumatic ccfs and are a rare entity in children. they are usually found in postmenopausal women and patients with collagen vascular diseases and connective tissue diseases like ehlers - danlos syndrome and osteogenesis imperfecta. ophthalmic manifestations range from proptosis, chemosis, orbital bruit, ptosis, vascular tortuosity, opthalmoplegia, glaucoma, chemosis, increased intraocular pressure and anterior segment ischaemia [1, 610 ]. in our case, the child presented with classic symptoms for a ccf ; however, a delayed presentation ensured worsening complaints and symptoms. it is essential that ccfs be not overlooked in this clinical presentation even in the paediatric population. most ccfs are not life threatening ; however, the involved eye is at considerable risk. imaging studies, ct, mri and ir cerebral angiography, may reveal an enlarged superior ophthalmic vein, thick ocular muscles and evidence of an enlarged cavernous sinus with convexity of the lateral wall. treatment (surgical and endovascular) includes ligation of the external and/or internal carotid arteries and fistula embolization with glue, detachable ballons, microcoils and stents. follow - up is essential for improved outcome as demonstrated in this case. in conclusion, ccf is rare in the paediatric population ; however, it is very important to keep a high degree of suspicion in the clinical setting of dilated scleral veins, proptosis and dysdiadokinesis. | we present a very rare case of indirect cavernous carotid fistula (ccf) in a 12-year - old girl. indirect ccf is extremely rare in the paediatric population. a 12-year - old girl presented with a 7-month history of frontal headaches and intermittent left - sided proptosis. on examination, she had dilated and engorged scleral veins on the left eye, mild dysdiadochokinesia and past pointing on the left side. a brain computer tomography with contrast, brain magnetic resonance imaging (mri) and interventional radiography (ir) cerebral angiogram confirmed the diagnosis of ccf. the ccf was embolized and a follow - up brain mri and an ir cerebral angiogram were conducted over the course of 8 months that revealed no evidence of residual ccf. ccf, though rare in the paediatric population, should be highly considered in the differential diagnosis when dilated scleral veins, proptosis and dysdiadokinesis are present in the clinical setting. prompt treatment has good prognostic results. |
isolated hypogonadotropic hypogonadism (ihh) is characterized by impairment of gonadal function secondary to deficient gonadotropin secretion. it can result from a variety of congenital, acquired, and functional defects related to gonadotropin releasing hormone (gnrh) deficiency. in general, ihh is caused by genetic mutation or acquired anatomical abnormalities including infiltrative disorders or space - occupying tumors involving the hypothalamic - pituitary axis, subsequently promoting deficiency of sex hormones. sex steroid hormones are important factors in bone mineral dynamics and play an essential role in the pathogenesis of osteoporosis. there have been many investigations of the links between sex hormone status and bone mineral density (bmd) for various clinical conditions. in renal transplant recipients, serum levels of estradiol estrogens also play a pivotal role in the regulation of bone loss and metabolism in elderly men. maintenance of proper bmd requires not only sex steroid hormones but also thyroid hormones and vitamin d. moreover, abnormal status of thyroid hormone or lower levels of vitamin d can promote pathologic or non - trauma induced fractures. although abnormal thyroid hormonal status is rare in patients with ihh, ihh accompanied by primary or secondary hypothyroidism including bradycardia and heart failure was recently reported. however, to our best knowledge, there has been no report of ihh associated with graves ' disease. therefore, we herein report a rare case of ihh accompanied by multiple fractures due to thyrotoxicosis and sex steroid hormone deficiency. a 35-year - old asian woman, born from non - consanguineous parents, was referred to the department of endocrinology for evaluation of a patient with multiple fragility fractures, and severe osteoporosis accompanied by diffuse goiter. she was 1.71 m tall and weighed 51.2 kg with a body mass index (bmi) of 17.5 kg / m. the diagnosis of ihh was established by suggestive clinical findings with primary amenorrhea and absence of growth and development of secondary sexual characteristics and laboratory findings at 16 years. no familial history of anosmia, delayed puberty or hypogonadism was reported by the patient. the karyotype was 46xx and genetic screening for mutations in the hypogonadotropic hypogonadism genes was not performed. at that time, the patient has been treated with estrogen replacement since she was 16 years old, but she was taken off estrogen by herself several years ago. sella magnetic resonance imaging scan revealed a small sized pituitary gland without mass - like lesion and thinning of the lower half of the pituitary stalk (fig. iu / l and peak follicle stimulating hormone (fsh) was 1.50 iu / l, suggesting hypogonadotropic hypogonadism (table 1). in the recent visit, the patient 's blood pressure was 130/82 mmhg and her heart rate was 98 beats / min. on laboratory examination, complete blood count revealed hemoglobin : 12.3 g / dl ; leukocyte count : 4.910/l ; and platelet : 31310/l. serum levels of total cholesterol (207 mg / dl), triglyceride (85 mg / dl), albumin (5.0 g / dl), aspartate transaminase (ast ; 22 iu / l), and alanine aminotransferase (alt ; 20 the levels of basal lh, fsh and estradiol were 0.25 iu / l (range, follicular 0.6 - 6.2 ; mid - cycle 12 - 51 ; luteal 0.0 - 6.0), 0.23 iu / l (range, follicular 3.3 - 8.8 ; mid - cycle 5.4 - 20 ; luteal 1.6 - 8.7), and 10 pg / ml (range, follicular 21 - 251 ; mid - cycle 38 - 649 ; luteal 21 - 312), respectively. symptoms and sign of thyrotoxicosis including tachycardia, smooth skin, and goiter were also developed in the patient. a technetium-99 m (tc-99 m) pertechnetate scintigraphy revealed diffuse enlargement of both lobes of the thyroid gland with markedly increased uptake (fig. a thyroid function test showed newly developed primary hyperthyroidism in the patient (table 2). moreover, the level of thyrotropin binding inhibiting immunoglobulin was also increased (table 2). neck ultrasonography showed an enlarged heterogeneous echogenic thyroid gland with increased vascularity determined by the color doppler method (fig. the antero - posterior pelvic x - ray showed left proximal femoral fracture (fig. 1d) and shoulder x - ray revealed a non - displaced proximal humeral fracture (fig. bmd was measured at the lumbar spine and femoral neck of the patient using dual energy x - ray absorptiometry. the patient had significantly lower bmd at both lumbar spine and femur neck (table 3). she was treated with conservative management for humeral fracture and received surgical fixation with screws for the left femoral fracture. the patient was also treated with methimazole, estrogen replacement, calcium, and vitamin d for two years, thereby leading to 2.34% and 6.97% increase in bmd of lumbar spine and femur neck, respectively (table 3). she was maintained in an euthyroid state with 2.5 to 5.0 mg of methimazole per day and has been recovering fairly well with estrogen replacement and treatment of calcium and vitamin d 2,000 iu per day for six months (table 2). in general, ihh presents as decreased ovarian function leading to menstrual defect, diminished vaginal secretion, infertility, and impaired breast development in premenopausal woman. in this case report, we presented ihh accompanied by graves ' disease and multiple fractures. to our best knowledge, this case report is the first paper describing severe osteoporosis - induced bone fracture in a patient with ihh accompanied by graves ' disease. people with ihh are also prone to develop osteoporosis or fragile bones leading to higher risk of fractures induced by otherwise minor injuries. although the mechanisms underlying the relationship between central hypogonadism and bmd have not yet been determined, unreplaced sex steroid deficiency is associated with lower bmd in adults with growth hormone deficiency. therefore, cyclical replacement of estrogen and progesterone is recommended to prevent premature osteoporosis and to promote sexual characteristics in premenopausal women. in addition, testosterone treatment was also effective for increasing lumbar spine bmd in hypogonadal middle - aged men. ihh is rarely accompanied by central hypothyroidism due to structural abnormalities of the hypothalamic - pituitary axis. thyroid - stimulating hormone (tsh) is critical for regulating expression of sodium - iodide symporter which is important for the production of thyroid hormone in the thyroid gland. in the pre - specified subgroup of premenopausal - aged women, tsh deficiency however, graves ' disease or excessive replacements of thyroid hormone are also known as risk factors of osteoporosis. graves ' disease promotes bone loss by increased bone turnover, leading to decreased bmd and osteoporosis. on the other hand, vitamin d deficiency is also an important risk factor for osteoporosis and increased risk of pathologic fractures in adults. therefore, we thought that low levels of vitamin d as well as inappropriate estrogen replacement with graves ' disease might be contributing to aggravation of the osteoporosis and development of fractures in the patient. although the co - occurrence of hypopituitarism and graves ' disease are rare, several reports have been described in the literature (table 4). a patient with hyperthyroidism in the presence of panhypopituitarism developed a radioiodine - induced thyroid storm. graves ' disease developed eight years after the diagnosis of hypopituitarism in this case. in another case, a 24-year - old male patient presented with hypopituitarism accompanied by hyperthyroidism and diabetes insipidus was described in 1999. a more recent report described that a subject with known panhypopitutarism developed thyrotoxicosis that contributed to acute glucocorticoid deficiency. another report showed that it was possible for hyperthyroidism secondary to toxic thyroid nodule, to occur with hypopituitarism. however, our case is ihh rather than panhypopituitarism, and the patient presented with multiple osteoporosis - induced fractures associated with graves ' disease. in conclusion, herein we report a case of ihh with graves ' disease and multiple fractures. sex hormone, calcium, and vitamin d replacement are essential for prevention of osteoporosis in patients with ihh. secondary osteoporosis - inducible factors including hyperthyroidism should also be considered in patients with fragility fracture accompanied by ihh. | isolated hypogonadotropic hypogonadism (ihh) is known to decrease bone mineral density due to deficiency of sex steroid hormone. graves ' disease is also an important cause of secondary osteoporosis. however, ihh does not preclude the development of primary hyperthyroidism caused by graves ' disease, leading to more severe osteoporosis rapidly. here, we describe the first case of 35-year - old asian female patient with ihh accompanied by graves ' disease and osteoporosis - induced multiple fractures. endocrine laboratory findings revealed preserved anterior pituitary functions except for secretion of gonadotropins and showed primary hyperthyroidism with positive autoantibodies. sella magnetic resonance imaging showed slightly small sized pituitary gland without mass lesion. dual energy x - ray absorptiometry revealed severe osteoporosis in lumbar spine and femur neck of the patient. plain film radiography of the pelvis and shoulder revealed a displaced and nondisplaced fracture, respectively. after surgical fixation with screws for the femoral fracture, the patient was treated with antithyroid medication, calcium, and vitamin d until now and has been recovering fairly well. we report a patient of ihh with graves ' disease and multiple fractures that is a first case in korea. |
the incidence of invasive fungal infections (ifi) has been on the rise due to increasing numbers of immunocompromised or severely ill patients. this rise in incidence the subject of this report had a solitary pulmonary nodule, which was initially suspected to be of malignant origin but eventually was confirmed to be of fungal origin. to our knowledge, this is the first report of an ifi caused by talaromyces species (sp.) that is successfully treated with voriconazole. a 61-year - old male was admitted to our clinic (day 0) with complaints of right pleuritic chest pain and dyspnea on exertion during the past two weeks. he had been diagnosed with rheumatoid arthritis (ra) and chronic obstructive pulmonary disease (copd) five years ago. his ra was under control with leflunamide 20 mg per day and methylprednisolone 4 mg per day., his rheumatologist had ordered a computerized chest tomography (ct) scan, which revealed a 12-mm nodule with spicular borders in the left lower lobe (fig. as the patient did not have any symptoms compatible with an infectious process at that time, samples were sent for histopathological examination only. malignancy was ruled out, but the pathology report described a suppurative, granulomatous inflammation around fungal hyphal elements with the presumptive diagnosis of a candida infection (fig. his body temperature was 38 c, his pulse rate was 90 beats per minute, respiratory rate was 20 per minute and blood pressure was 130/70 mmhg. a repeat thoracic ct taken on day 0 revealed persistence of the nodule in left lower lobe, while there was a new loculated pleural collection adjacent to medial right lower lobe (fig. once daily) was started with the presumptive diagnosis of candida pneumonia, based on histopathological report. on day samples sent from this collection were negative for any microbiological growth, but microscopic examination showed abundant polymorphonuclear leucocyte (pmnl) infiltration with a negative gram stain suggesting abscess formation. four times a day) was added to treatment. on day + 14, right pleural collection was drained for a second time by thoracic surgery. samples sent from this collection were again negative for any microbiologic growth, but still showed abundant pmnl infiltration. a thoracic ct taken on day + 17 revealed partial regression of right pleural collection, while left lower lobe nodule progressed into a focal nodular consolidation (fig. maintenance once daily) based on the assumptions of fluconazole unresponsive candida pneumonia or possibility of a mold infection. on day + 26, antifungal treatment was switched to voriconazole (400 mg i.v. twice daily loading and 200 mg i.v. twice daily maintenance), since an oral agent would be preferable during the prolonged treatment period. a control thoracic ct taken on day + 31 revealed 50% regression in size of nodule and the patient was discharged with voriconazole 200 mg per oral twice daily. another control ct taken on day + 82 revealed almost complete regression of lesion (fig. patient was given a biological agent, abatacept for ra on day + 177 and completed a total of nine monthly injections without any infectious complications. later for identification of the fungus, genomic sequencing from paraffin blocks this involved deparaffinization of tissue sample performed as per the protocol described by bialek., and genomic dna extraction using the ctab method as described by fraczek.. the fungal its region was amplified by pcr using primers its1 and its4 and sequenced in both directions by dideoxy chain termination/ cycle sequencing on an abi 3730xl sequencing machine (eurofins mwg operon ebersberg, germany). sequences were compared to those available in the cbs - knaw fungal biodiversity centre database (http://www.cbs.knaw.nl) using the pairwise sequence alignment tool. jx315670, base pair match 478/478) genus. although the top species identity was talaromyces stollii (genbank accession no. jx965246.1, base pair match 478/478), the its region is inadequate to definitively distinguish to this level. our case highlights the need for microbiological examination of solitary pulmonary nodules detected in immunosuppressed patients. although the major differential diagnosis is malignancy for such nodules, fungal organisms may well be the etiological agent, particularly in immunosuppressed patients. biopsy is usually performed to rule out malignancy ; however, once the specimen is placed in formalin, the opportunity for culture is lost, which is the gold standard in identification of fungal element. as in our case, when culture opportunity is lost or there is no growth in culture, a molecular approach may be quite useful in identification of fungal species. histopathological examination is crucial to demonstrate invasiveness of infection, but morphological identification of fungal species should be avoided as it may misidentify the fungal element. it has been reported that in at least 20% of cases, misclassifications of fungal organisms occur in histopathological examination. yeast - mold differentiation is important for empirical and definitive treatment of fungal infections as it affects the choice of antifungal agent. in our case, based on the presumptive histopathological diagnosis of candida infection, a therapeutic trial with fluconazole was carried out as it has both parenteral and oral formulations, is much cheaper than the other antifungal drugs and has fewer side effects. however, patient s condition did not improve which necessitated switching to an extended - spectrum antifungal agent. an echinocandin or voriconazole are possible alternatives in this case, although the latter has an oral formulation making it ideal for prolonged outpatient therapy. in our case, voriconazole was well - tolerated by the patient and led to total cure of mold infection after two and a half months of treatment. using dna sequencing, fungal element this finding also explained the unresponsiveness to fluconazole that we initially observed. to the best of our knowledge, this is the first report of an ifi caused by talaromyces sp. our case shows that talaromyces sp. is the latest addition to a growing list of rare light - colored (hyaline) molds causing serious infection. although it carries a labeled warning regarding the risk of pulmonary infections, in clinical trials the incidence of serious infection appeared lower than that encountered with other biological agents. in our case, although secondary prophylaxis was not administered, there was no recurrence of ifi with abatacept. more studies are needed to determine whether abatacept can safely be given without secondary prophylaxis in patients with proven ifi. clinicians taking care of immunocompromised patients should carry the suspicion that a fungal agent might play a role in a variety of disease settings, thus remember to request for microbiological as well as histopathological examination. | invasive fungal infections (ifi) are on the rise due to increasing numbers of immunosuppressed and critically ill patients. a malignant - looking pulmonary nodule in an immunosuppressed patient may indeed be caused by a fungal organism. we report a patient, who was eventually diagnosed with an ifi caused by an agent of hyalohyphomycosis, talaromyces sp. determined via molecular methods and succesfully treated with voriconazole. |
este estudo avaliou o uso do plasma, superfcie ssea e osso total como biomarcadores da exposio crnica ao flor em ratos. quarenta ratos wistar machos foram divididos em 4 grupos (n=10/gr) que diferiram de acordo com a concentrao de flor presente na gua de beber. os grupos 1, 2, 3 e 4 receberam gua contendo 0, 5, 15 e 50 mg f / l, respectivamente. o plasma e os fmures foram coletados e a concentrao de flor foi analisada com um eletrodo especfico pelo mtodo direto para a superfcie do fmur e aps difuso facilitada por hmds para o osso total e o plasma. a mdia (ep) da concentrao de flor no plasma variou de 0,0300,006 a 0,1870,040 (mg / ml). a concentrao de flor na superfcie e no osso total variou de 610103 a 4693703 e 64769 a 3439423 (mg / g), respectivamente. a proporo entre a concentrao de flor na superfcie ssea e osso total foi de 0,941, 1,414, 1,173 e 1,377, para os grupos 1, 2, 3 e 4 respectivamente. para o plasma e osso total, a diferena entre todos os grupos foi estatisticamente significante, exceto para o grupo 2 quando comparado com o grupo 1. para a superfcie ssea s no houve diferena entre o grupo 2 quando comparado com o grupo 3. houve correlao positiva significante entre a concentrao de flor presente na superfcie ssea e no osso total (r=0,94), to bem como entre o plasma e a superfcie ssea (r=0,71) e o plasma e o osso total (r=0,74). os dados sugerem que tanto a superfcie ssea quanto o osso total so bons indicadores da exposio crnica ao flor em ratos e o plasma pode ser utilizado como um indicador dos nveis de flor. the metabolism of fluoride in laboratory animals and humans is characterized by rapid and extensive absorption from the gastrointestinal tract, distribution to all soft tissues in which the intracellular - to - extracellular concentration ratios vary according to the magnitude of the ph gradients across cell membranes, extensive but not irreversible uptake by calcified tissues which contain 99% of the fluoride in the body, and rapid excretion in the urine12. from the pharmacokinetic point of view, plasma is regarded as the central compartment because it is this fluid into which and from which fluoride must pass for distribution and excretion. thus, plasma fluoride concentrations reflect the concentrations elsewhere in the body including those in bone6,8,10,12. at a 1999 dental workshop in bethesda, maryland, usa one of the topics was the identification of f biomarkers that are easy to collect and analyze, in order to determine the body burden and to measure acute and chronic f exposure in relation to bone f levels and fluoride in plasma, ductal saliva, dentin and fingernails4. the uptake of f from the extracellular fluids by bone in the short - term occurs largely on the periosteal and endosteal surfaces where it is firmly but not irreversibly bound. thus, the analysis of bone surface f has the potential of being a more reliable biomarker for acute f exposure than whole bone1,2,3. in the case of chronic exposure to fluoride, however, it would be expected that both bone surface and whole bone fluoride concentrations would have the same potential as biomarkers of exposure to fluoride and would be similarly related to plasma fluoride levels. forty male wistar rats were obtained from the central aninal laboratory of bauru dental school and received as weanlings. they were assigned to 4 groups (n = 10/gr) that differed according to the f concentration they received in the drinking water. groups 1, 2, 3 and 4 received water containing 0 (control), 5, 15 and 50 mg f / l (as naf), respectively. a blood sample was drawn by cardiac puncture when the rats were 120 days old and while under general anesthesia. the right femur was removed from each rat, cleaned of soft tissue with gauze and dried for 24 h at 90c. the mid - diaphysis of the femur was sectioned transversely to obtain a specimen with 1.0 cm in length. the cut edges were sealed with dental wax. a circular hole (2.4 mm diameter) was punched in adhesive tape, which was applied firmly to the center of the bone specimen. the remaining surfaces of the bone were painted with acid - resistant nail varnish so that only a 4.52 mm surface area was exposed. the bone was then placed in a plastic test tube containing 0.50 ml of 0.50 m hcl and, after 15 s of being constantly agitated, the acid was buffered to ph 5 by the addition of 0.50 ml of total ionic strength adjustment buffer (tisab)1 and the bone was removed from the solution. this solution was analyzed along with standards containing from 0.8 to 6.4 g f / ml using the ion - specific electrode (orion model 9609). the mv readings were converted to g f using a standard curve with a coefficient correlation of r 0.99. the weight of bone mineral removed was obtained by the colorimetric analysis of inorganic phosphorus7 in the acid assuming that its concentration in dry bone is 13.5%. the fluoride concentration on the bone surface is expressed as g f / g bone (ppm). the remaining bone was ashed at 600 c overnight, after removing the nail varnish. f concentrations were determined after overnight hexamethyldisiloxane (hmds)-facilitated diffusion (taves9) as modified by whitford12 using the ion - specific electrode (orion research, model 9409) and a miniature calomel electrode (accumet, # 13 - 620 - 79) both coupled to a potentiometer (orion research, model ea 940). deionized water (2.0 ml) was placed in the bottom of a non - wettable diffusion dish (falcon, 1007) along with the bone ash (5 mg) and plasma. the trapping solution, 50 l of 0.05 m naoh, was placed in three drops on the inside of the lid of the dish. the periphery of the lid was ringed with vaseline and sealed to the bottom of the dish. n h2so4 saturated with hmds were added to the bottom through a small hole previously burned into the lid with a soldering iron. the hole was immediately sealed with vaseline. during the diffusion process, which continued overnight at room temperature, the lid was removed and inverted and the trapping solution was buffered to ph 5 with 25 l of 0.20 m acetic acid. the final volume was then adjusted to 75 l by the addition of deionized water using a fixed volume pipettor. the f and reference electrodes were placed in contact with the solution with gentle agitation until a stable mv reading was obtained. f standards (containing 1.9, 3.8, 19 and 38 mg f for bone ash and 0.5 1.0, 5.0 and 10.0 nm f for plasma) were prepared in triplicate and diffused in the same manner as the bone ash and plasma samples. in addition, non - diffused standards were prepared with the same reagents and in the same proportions as those used to prepare the diffused standards and samples. the non - diffused standards were made to have exactly the same f concentrations as the diffused standards. comparison of the mv readings demonstrated that the f in the diffused standards had been completely trapped and analyzed (recovery > 99%). the mv potentials were converted to g f using a standard curve with a correlation coefficient of r 0.99. the mid - diaphysis of the femur was sectioned transversely to obtain a specimen with 1.0 cm in length. a circular hole (2.4 mm diameter) was punched in adhesive tape, which was applied firmly to the center of the bone specimen. the remaining surfaces of the bone were painted with acid - resistant nail varnish so that only a 4.52 mm surface area was exposed. the bone was then placed in a plastic test tube containing 0.50 ml of 0.50 m hcl and, after 15 s of being constantly agitated, the acid was buffered to ph 5 by the addition of 0.50 ml of total ionic strength adjustment buffer (tisab)1 and the bone was removed from the solution. this solution was analyzed along with standards containing from 0.8 to 6.4 g f / ml using the ion - specific electrode (orion model 9609). the mv readings were converted to g f using a standard curve with a coefficient correlation of r 0.99. the weight of bone mineral removed was obtained by the colorimetric analysis of inorganic phosphorus7 in the acid assuming that its concentration in dry bone is 13.5%. the fluoride concentration on the bone surface is expressed as g f / g bone (ppm). the remaining bone was ashed at 600 c overnight, after removing the nail varnish. f concentrations were determined after overnight hexamethyldisiloxane (hmds)-facilitated diffusion (taves9) as modified by whitford12 using the ion - specific electrode (orion research, model 9409) and a miniature calomel electrode (accumet, # 13 - 620 - 79) both coupled to a potentiometer (orion research, model ea 940). deionized water (2.0 ml) was placed in the bottom of a non - wettable diffusion dish (falcon, 1007) along with the bone ash (5 mg) and plasma. the trapping solution, 50 l of 0.05 m naoh, was placed in three drops on the inside of the lid of the dish. the periphery of the lid was ringed with vaseline and sealed to the bottom of the dish. n h2so4 saturated with hmds were added to the bottom through a small hole previously burned into the lid with a soldering iron. the hole was immediately sealed with vaseline. during the diffusion process, which continued overnight at room temperature, the lid was removed and inverted and the trapping solution was buffered to ph 5 with 25 l of 0.20 m acetic acid. the final volume was then adjusted to 75 l by the addition of deionized water using a fixed volume pipettor. the f and reference electrodes were placed in contact with the solution with gentle agitation until a stable mv reading was obtained. f standards (containing 1.9, 3.8, 19 and 38 mg f for bone ash and 0.5 1.0, 5.0 and 10.0 nm f for plasma) were prepared in triplicate and diffused in the same manner as the bone ash and plasma samples. in addition, non - diffused standards were prepared with the same reagents and in the same proportions as those used to prepare the diffused standards and samples. the non - diffused standards were made to have exactly the same f concentrations as the diffused standards. comparison of the mv readings demonstrated that the f in the diffused standards had been completely trapped and analyzed (recovery > 99%). the mv potentials were converted to g f using a standard curve with a correlation coefficient of r 0.99. plasma, bone f concentrations, the acid etch depth and the ratios between surface and whole bone f concentrations as a function of the f doses administered were tested for statistically significant differences by anova and tukey 's post hoc test for individual comparisons. the correlation between bone surface and whole bone f concentrations, as well as plasma and bone surface and plasma and whole bone f concentrations table 1 shows mean f concentrations (se) found in the plasma g / ml), bone surface g / g) and whole bone g / g), the ratio between bone surface and whole bone f concentration, as well as the acid etch depth when bone surface was analyzed. the f concentration ranged between 0.0300.006 and 0.1870.040 for the plasma, 610103 and 4,693703 for the bone surface and 64769 and 3,439423 for the whole bone. the ratios surface / whole bone f concentrations were 0.9410.111, 1.4140.282, 1.1730.274 and 1.3770.181, for groups 1, 2, 3 and 4 respectively. the f concentrations in plasma and whole bone showed a significant difference among all the groups, except for group 2 compared to group 1. for bone surface, all groups differed from each other except for group 2 compared to group 3. the acid etch depth in control group was significantly higher than in the other groups. although a decrease in acid etch depth was seen with increasing f concentrations in the drinking water, this difference was not statistically significant among the test groups. a significant positive correlation was found between bone surface and whole bone f (figure 1, r=0.94, p<0.0001), as well as between plasma and bone surface f (figure 2, r=0.71, p<0.0001) and plasma and whole bone f (figure 3, r=0.74, p<0.0001). values in the same column with the same superscript letters are not statistically significant (p<0.05). f is widely used in dentistry as a therapeutic agent for the control of dental caries. due to this, when new fluoridated agents have to be tested, it is common that the volunteers are subjected to a washout period, when fluoridated products are avoided, in order to decrease plasma and salivary f levels. however, it is known that a steady - state distribution exists between the extracellular fluid and the hydration shell of bone crystallites12. the ion - rich aqueous shells are continuous with, or at least accessible to, the extracellular fluids. presumably, f in this pool is rapidly exchangeable so that it can undergo net migration in either direction, depending on the relative concentrations in extracellular fluid and the hydration shells. when plasma levels fall, a net flux of f from the hydration shell to the extracellular fluid occurs. when plasma levels increase, a net flux of f from extracellular fluid to the hydration shells occurs. the results of the present study corroborate this hypothesis of steady - state distribution, since a significant correlation was found between plasma and bone surface f in rats exposed chronically to different f concentrations in the drinking water. the determination of the time needed for removal of f incorporated in bone is subject of an ongoing study in our laboratory. to the extent to which this steady - state relationship exists, plasma fluoride concentrations would be influenced by the fluoride concentrations in the exchangeable pool of bone., the body fluids or tissues that may be used to estimate bone f concentrations11 12. in a recent study, corra rodrigues,.5 (2004) using nails as biomarkers of subchronic exposure to f from fluoridated dentifrice could not see a reduction in nail f concentration when a f - free dentifrice was used, which could have been due to the fact that f was being released from bone after the f - free dentifrice started being used, thus preventing plasma and in turn fingernails f levels from declining. the results of the present study show a direct relationship between the f concentrations in the rapidly exchangeable bone compartment (surface) and the non - exchangeable inner compartment (whole). the correlation between bone surface and whole bone f concentrations was strong, as well as between plasma and whole bone f. this result was expected, since the animals had been exposed chronically to different fluoride doses. thus, plasma f seems to be a reliable indicator of bone surface and whole bone f levels in rats subjected to chronic f exposure. obtaining normative values for bone f levels in persons with different histories of exposure to f is necessary and is under determination in our laboratory. bezerra de menezes,.1 (2003) have suggested that the ratios between bone surface and whole bone f concentrations are more reliable biomarkers of acute lethal f exposure than is the analysis of whole bone solely. in this chronic study, the ratios were increased in the experimental groups when compared to control, indicating a faster f incorporation in bone surface when f is administered in drinking water, although group 3 (15 ppm) did not differ from control. in addition, the whole bone analyzed included a lot of surface as well as subsurface bone and the f ratios probably would have been different if we had analyzed only subsurface bone. in the present study, when the bone surface was analyzed for fluoride, the acid etch depth was significantly reduced when f was added to the drinking water. however, increasing fluoride concentrations in the drinking water (from 5 to 50 ppm) did not show a significant dose - response effect on the acid etch depth. these results indicate that the presence of f in the drinking water made the bone surface more resistant to acid etch, since a thinner bone layer was removed under acid attack. the same could be expected when the whole bone is considered, since there was a very strong correlation between bone surface and whole bone f concentrations. significant correlations were also found between plasma and bone surface, as well as between plasma and whole bone fluoride concentrations. thus, the results suggest that both bone surface and whole bone are suitable biomarkers of chronic f exposure in rats and plasma may be used as indicator of bone fluoride levels. | objective : this study evaluated the use of plasma, bone surface (periosteal) and whole bone as biomarkers of chronic fluoride (f) exposure.methods:forty male wistar rats were assigned to 4 groups (n=10/gr) that differed according to the f concentration they received in the drinking water. groups 1, 2, 3 and 4 received water containing 0 (control), 5, 15, and 50 mg f / l, respectively. the rats were killed at 120 days of age. plasma and femur were collected and analyzed for fluoride with the ion specific electrode by the direct method or after hexamethyldisiloxane - facilitated diffusion. data were tested for statistically significant differences by anova and linear regression (p<0.05).results : mean (se) plasma f concentrations ranged from 0.030 0.002 to 0.187 0.013 (mg / ml). the concentrations in surface and whole bone ranged from 610 32 to 4,693 222 ; and 647 22 to 3,439 134 g / g, respectively. the surface / whole f concentration ratios were 0.941, 1.414, 1.173 and 1.377, for groups 1, 2, 3 and 4 respectively. for plasma and whole bone, the difference among all groups was statistically significant, except for group 2 compared to group 1. for bone surface, all groups differed from each other except for group 2 compared to group 3. a significant positive correlation was found between bone surface and whole bone f (r2=0.94), as well as between plasma and bone surface (r2=0.71) and plasma and whole bone (r2=0.74).conclusions : data suggest that both bone surface and whole bone are suitable biomarkers of chronic f exposure in rats and plasma may be used as indicator of bone fluoride levels. |
deafferentation pain is an unfavorable outcome in orthopedic patients who have experienced injury to the nervous system. such patients experience severe spontaneous pain in body parts distal to the injury despite reduced or no sensitivity to external noxious stimuli to that body part (hypoalgesia or analgesia). deafferentation pain can follow spinal cord injuries, peripheral nerve injuries, brachial plexus avulsions, and limb amputations. it is widely accepted that the loss of pain - related afferent information to the brain (deafferentation) is responsible for this pain syndrome. in particular, deafferentation pain is considered to result from destruction of the spinothalamic tract, which transmits somatosensory information about pain, itch, and rough touch. nonetheless, the mechanisms of how deafferentation - related changes produce spontaneous pain are not well understood. pain syndrome after limb amputation, known as phantom limb pain, is an extreme example of deafferentation pain. in patients with phantom limb pain the prevalence of phantom pain after amputation is quite high (6080 %) [13 ]. phantom limb pain may be described as burning or tingling at the time of onset and may eventually evolve into severe crushing, pinching, or shooting pain that can become extremely intense (e.g., as if a knife is twisting in the flesh). the onset of phantom limb pain may be immediate, but it also may not become evident until years after the injury responsible for the pain. hence, it is possible that plastic changes after deafferentation events play a role, at least in part, in the pathogenesis of phantom limb pain. however, progress in neuroimaging and brain stimulation techniques has begun to cast light on the neural mechanisms underlying neuroplastic changes after limb amputation. transcranial magnetic stimulation (tms) is a noninvasive brain stimulation technique that can temporarily modulate brain functions. in brief, a coil placed onto the scalp surface produces rapidly changing magnetic fields, which transcranially induce eddy currents in the brain. when applied to the primary motor cortex (m1), suprathreshold tms stimulation can evoke muscle twitching that is measurable by electromyography (emg) ; this activity is known as motor - evoked potentials (mep). by changing the coil position over the m1 in the precentral gyrus, tms can induce mep in a somatotopical fashion. karl and colleagues used tms to map motor representations in the m1 in people with amputated forearms. the m1 contralateral to the amputation had expanded representations of the body parts (i.e., lip or upper arm) adjacent to the now missing forearm, as if the surrounding motor representations invaded the previous forearm motor representation. however, evidence indicates that the motor cortical representation of the missing limb is not completely gone in amputees. tms applied over the m1 can elicit motor perception of the missing limb, providing an explanation for phantom limb perception. how, then, does the m1 retain representation of the phantom limb for a long period without linkage between motor efferents and somatosensory afferents ? this finding suggests that motor commands from the part of the m1, which previously controlled the now - missing limb, are retargeted to the stump muscles and that a new linkage between motor efferents and somatosensory afferents is formed. however, the brain possibly interprets stump muscle contraction and the resultant sensory information as phantom limb movement. functional magnetic resonance imaging (fmri) noninvasively allows measurement of oxygenation / blood - flow - related (hemodynamic) changes in mri signals as a surrogate marker of neural activity. because of its high spatial localization, fmri has remained the most reliable noninvasive brain mapping method for more than a decade. using fmri, brain activity during a sensory stimulation task was mapped in people with spinal cord injury (sci). the study showed that activity during sensory stimulation to the little finger was expanded into the parts of the primary somatosensory cortex (s1) that would normally receive afferent information from the lower limbs. namely, it appeared that the s1 was reorganized after sci in such a way that representations of the remaining body parts invaded areas that had lost somatosensory afferents. intriguingly, the degree of s1 reorganization was greater in sci patients with deafferentation pain than in those without it. to summarize, converging evidence suggests that motor and somatosensory representations undergo complex reorganization (table 1) after deafferentation, including amputation, and that this reorganization may be associated with deafferentation pain.table 1brain regions possibly involved in the pathogenesis of deafferentation painregionsreorganizationpain matrixsomatosensory stimulationm1 stimulationprimary motor cortex (m1)+++ (nonthermal)++primary somatosensory cortex (s1)+++ (nonthermal)++++supplementary motor / premotor areas?+ (nonthermal)++++cingulate cortex?++++++insula - parietal operculum (s2)?++++++thalamus+++++++basal ganglia?+++++ frequently reported, + occasionally reported, ? not clear brain regions possibly involved in the pathogenesis of deafferentation pain + + frequently reported, + occasionally reported, ? not clear the international association for the study of pain (http://www.iasp-pain.org) has defined pain as an unpleasant sensory and emotional experience arising from actual or potential tissue damage or described in terms of such damage. this implies that pain may be ascribed to the perception of tissue damage or to a perceptual experience interpreted as tissue damage. in any case, the above definition of pain signifies the importance of clarifying how the brain handles sensory afferents associated with tissue damage. furthermore, it is important to understand how psychological and emotional factors influence the brain to interpret pain - related sensory signals. in fact, the neural substrates of pain perception have been intensively explored with neuroimaging techniques, such as fmri and positron emission tomography (pet). many imaging studies have consistently revealed a set of brain regions as substrates of pain perception. these regions include the anterior cingulate cortex, the insula, the parietal operculum including the second somatosensory cortex (s2), and the thalamus, which are collectively called the pain matrix. activity in the s1 is reported only during nonthermal stimulation (table 1 ; fig. the anterior cingulate cortex (acc), posterior insula, parietal operculum (po) including the second somatosensory cortex (s2) and thalamus (tha.) are considered to be the key structures for pain perception. the primary motor and somatosensory areas may be involved in the perception of nonthermal (deep) pain pain matrix. the anterior cingulate cortex (acc), posterior insula, parietal operculum (po) including the second somatosensory cortex (s2) and thalamus (tha.) the primary motor and somatosensory areas may be involved in the perception of nonthermal (deep) pain activity in parts of the pain matrix is modulated by psychological and/or emotional factors. sawamoto and colleagues showed that the anterior cingulate cortex and parietal operculum / insula area are activated during both painful (stimulus intensity above the pain threshold) and nonpainful (below the threshold) thermal stimuli. moreover, uncertainty about the forthcoming stimulus enhances the unpleasantness of the stimulus and brain responses in the anterior cingulate cortex and parietal operculum / insula. by contrast, in a yoga master who claimed not to feel pain during meditation, brain activity in the pain matrix in response to painful thermal stimuli was reduced during meditation. these lines of evidence suggest that activity in the pain matrix is influenced by psychological factors and that the degree of pain matrix activity could reflect the subjective experience of pain. deafferentation pain appears to involve both superficial and deep pain sensations. although most previous neuroimaging studies of pain used stimuli affecting superficial pain sensations, a few studies investigated brain responses during the experience of muscular pain. such studies used injection of hypertonic saline into muscles [12, 13 ] or electric stimulation of a myofascial trigger point to evoke deep pain sensations. the results of these studies suggest that deep pain perception induces brain activity in motor - related areas, including the m1, as well as in the pain matrix. therefore, it is possible that motor - related brain areas are involved in addition to the pain matrix in the development of deafferentation pain involving both superficial and deep pain sensations. therapeutic interventions to deafferentation pain also indicate a link between the pathophysiology of deafferentation pain and functions of the motor - related brain areas. motor cortex stimulation using surgically implanted electrodes can control poststroke pain after thalamic infarction, although its effects on phantom limb pain require further investigation. moreover, noninvasive stimulation to the m1 with high - frequency repetitive tms relieves deafferentation pain, whereas low - frequency stimulation or stimulation to other brain areas does not [17, 18 ]. the mechanisms by which m1 stimulation reduces deafferentation pain are poorly understood. it has been suggested that abnormal processing of nociceptive information develops at the level of deafferentation and spreads to higher levels. together with evidence discussed in the deafferentation pain section above, it seems plausible to hypothesize that reorganization of the nervous system upstream to the deafferentation level is responsible for deafferentation pain. reorganization appears to occur in the motor and somatosensory areas after deafferentation, but the connection between those areas and the pain matrix has not been well documented. to clarify the pathophysiology of deafferentation pain, we need to know how the motor / somatosensory areas and the pain matrix interact through neural networks. advances in multidimensional neuroimaging techniques allow us to conduct tms with emg monitoring in the fmri environment [19, 20 ]. this experimental setup may provide a novel approach with which to explore the neural mechanisms underlying deafferentation pain. when single - pulse tms was delivered to the hand representation of the left m1 at various intensities, it evoked meps in the right - hand muscles in a dose - dependent manner. suprathreshold tms induced brain activity not only in the stimulated m1 but also in remote motor and somatosensory areas, such as the anterior cingulate cortex, supplementary motor areas, premotor cortex, s1, insula / parietal operculum (s2), thalamus, basal ganglia, and cerebellum (table 1 ; fig. 2). counterintuitively, a detailed analysis of the relationship between tms intensities and fmri responses showed that activity in the remote motor / somatosensory areas was induced at lower intensities than those that were required to evoke m1 activity. these findings indicate that brain activity is evoked through the network comprising the m1 and other motor / somatosensory areas by means of combined tms and fmri. it should be noted that because brain stimulation to the m1 can relieve deafferentation pain, the neural substrates responsible for deafferentation pain are likely included in the brain network activated by m1 stimulation.fig. 2brain activities induced by deep somatosensory stimulation (blue) and transcranial magnetic stimulation to the primary motor cortex (red) in healthy volunteers. the overlapping activity partially corresponds to the pain matrix, which is composed of the cingulate cortex, the insula / parietal operculum including the second somatosensory cortex, and the thalamus. overlap is also observed in nonpain matrix areas, such as the primary motor cortex, the primary somatosensory cortex, the supplementary motor cortex, and the basal ganglia. brain activities induced by deep somatosensory stimulation (blue) and transcranial magnetic stimulation to the primary motor cortex (red) in healthy volunteers. the overlapping activity partially corresponds to the pain matrix, which is composed of the cingulate cortex, the insula / parietal operculum including the second somatosensory cortex, and the thalamus. overlap is also observed in nonpain matrix areas, such as the primary motor cortex, the primary somatosensory cortex, the supplementary motor cortex, and the basal ganglia. another possibility is that the regions responsible for deafferentation pain receive somatosensory afferent information from the body. shitara and colleagues investigated brain activity evoked by superficial and deep somatosensory stimulation of a limb, along with brain activity evoked by m1 stimulation. as superficial and deep somatosensory stimuli, electrical stimulation was delivered to the median nerve at the right wrist above the sensory threshold (below the motor threshold) and above the motor threshold, respectively. median nerve stimulation above the motor threshold induced brain activity in the m1, s1, s2, anterior cingulate cortex, insula, basal ganglia, and thalamus. these regions partially overlapped with the zones activated by m1 stimulation (figs. 2, 3 ; table 1).fig. deafferentation pain may result from an interaction between reorganization processes after deafferentation and their influences on the pain matrix (core mechanisms). these processes and perception of deafferentation pain are likely to be influenced by many factors, including plasticity, the reward system, and psychological / emotional factors. we need to look for therapeutic interventions (e.g., brain stimulation, neurofeedback) that can effectively modulate the activity of these core mechanisms, most likely represented in the form of a neural network hypothetical mechanisms of deafferentation pain. deafferentation pain may result from an interaction between reorganization processes after deafferentation and their influences on the pain matrix (core mechanisms). these processes and perception of deafferentation pain are likely to be influenced by many factors, including plasticity, the reward system, and psychological / emotional factors. we need to look for therapeutic interventions (e.g., brain stimulation, neurofeedback) that can effectively modulate the activity of these core mechanisms, most likely represented in the form of a neural network deafferentation pain could be represented in parts of the pain matrix. considering the intersection of the pain matrix, somatosensory - stimulation - induced brain activity, and m1-stimulation - induced brain activity, the candidate regions responsible for deafferentation pain are s2, the cingulate cortex, and the thalamus (table 1). it is appealing to examine brain responses during m1 stimulation in patients with deafferentation pain to prove the essential roles of these areas in the pathophysiology of deafferentation pain. as discussed, accumulating evidence suggests that the complex interaction between reorganization of the nervous system after deafferentation and its influences on the pain perception system (pain matrix) underlies the pathophysiology of deafferentation pain. moreover, it is critical to examine the mechanisms of neuroplasticity operating after nerve injury and their relationship to deafferentation pain. recent anatomical imaging studies show brain reorganization in the motor / somatosensory areas and thalamus at the structural level (i.e., reduced gray matter volume) after sci and amputation. the meaning of these structural changes should be clarified in relation to functional changes in those regions. to understand the plasticity associated with deafferentation pain geha and colleagues found that activity in the basal ganglia was related to tactile allodynia after nerve injury, although the basal ganglia are not regarded as a part of the pain matrix. intriguingly, the basal ganglia are activated during both deep somatosensory stimulation and m1 stimulation. because the basal ganglia are implicated in plastic brain changes that occur in association with reward and punishment, it is possible that the basal ganglia exert modulation effects on s2, anterior cingulate cortex, and thalamus in the course of the development of deafferentation pain. this hypothesis should be investigated in future studies. finally, the effects of m1 stimulation on the relief of deafferentation pain suggest that the abnormal activity responsible for such pain can be functionally modulated. a recent study shows that training with fmri - based neurofeedback of pain - induced activity can relieve pain. these exciting findings will direct researchers toward the development of a variety of neurofeedback techniques to relive deafferentation pain. in conclusion, neuroimaging studies are providing, and will continue to provide, indispensible knowledge that will aid our understanding of the pathophysiology of deafferentation pain and lead to the development of new treatment strategies for such pain. | deafferentation pain following nerve injury annoys patients, and its management is a challenge in clinical practice. although the mechanisms underlying deafferentation pain remain poorly understood, progress in the development of multidimensional neuroimaging techniques is casting some light on these issues. deafferentation pain likely results from reorganization of the nervous system after nerve injury via processes that interact with the substrates for pain perception (the pain matrix). therapeutic effects of motor cortex stimulation on deafferentation pain suggest that the core mechanisms underlying deafferentation pain also interact with the motor system. therefore, simultaneous neuroimaging and brain stimulation, an emerging neuroimaging technique, was developed to investigate complicated interactions among motor, somatosensory, and pain systems. in healthy participants, parts of the pain matrix (the anterior cingulate cortex, parietal operculum, and thalamus) show activity during both somatosensory stimulation and brain stimulation to the motor cortex. this finding indicates that motor, somatosensory, and pain systems communicate among each other via the neural network. a better understanding of the plastic mechanisms influencing such cross - talk among these systems will help develop therapeutic interventions using brain stimulation and neurofeedback. |
hepatocellular carcinoma (hcc) is one of the most common cancers and its incidence is increasing worldwide.1 as the treatment of hcc has remarkably improved, the survival of patients with hcc has been prolonged. consequently, extrahepatic metastasis of hcc is now diagnosed more frequently and the incidence of bone metastasis from hcc is also increasing.2,3 however, cases of extrahepatic hcc without a detectable primary liver tumor have rarely been reported ; in fact, bone metastasis from hcc, single or multiple, without the presence of a primary tumor has been reported in only six cases worldwide.4 - 9 because of insufficient experience with these cases, diagnostic and treatment approaches for these patients are challenging. here, we present a case of metastatic hcc arising from the pelvic bone without a primary focus. a 73-year - old man was admitted to our hospital for evaluation of severe back pain and right leg pain for 1 month. the medical history of patient revealed that he was diagnosed as a hepatitis b virus (hbv) carrier about 20 years earlier, but was lost to follow up. initial laboratory findings were as follows : white blood cell count 4,830/l, hemoglobin 15.2 g / dl, platelets 138,000/l, total protein 7.8 g / dl, albumin 4.4 g / dl, aspartate aminotransferase (ast) 31 iu / l, alanine aminotransferase (alt) 35 iu / l, total bilirubin 1.0 mg / dl, alkaline phosphate 98 iu / l, prothrombin time 14 second (inr 1.21), alpha - fetoprotein (afp) 15.01 ng / ml, and protein induced by vitamin k absence or antagonist - ii (pivka - ii) 864 mau / ml. hepatitis b virus surface antigen (hbsag) and hepatitis b e antigen (hbeag) were positive. hepatitis b e antibody (hbeab), hbv - dna with polymerase chain reaction, and serological markers of hepatitis c were negative. he belonged to child - turcotte - pugh class a. for evaluation of the pelvic mass, computed tomography (ct) and magnetic resonance imaging (mri) scans were performed. they demonstrated a 1310 cm expansile mass that involved the right iliac bone (fig. 1). the patient underwent an incisional biopsy with the impression of a malignant bone tumor. however, on pathological examination, the tumor was composed of polygonal cells with ample cytoplasm and trabecular pattern. in immunohistochemical stains, these tumor cells were positive for cytokeratin (ae1/ae3), hepatocyte paraffin 1 (heppar1), and glypican-3, which confirmed the diagnosis of hcc (fig. tumor cells were negative for cd56, chromogranin a and synaptophysin, which are the markers of neuroendocrine differentiation. to find the primary focus, abdominal ct, mri, positron emission tomography (pet) we diagnosed this case as an isolated metastatic hcc of the pelvic bone without the presence of a primary cancer in the liver. surgical resection of the tumor was recommended, but the patient refused an operation because of old age and the large size of the tumor. he started radiotherapy in the pelvic area with a total dose of 5,100 cgy in 17 fractions. one week after the end of radiotherapy, transarterial chemoembolization (tace) was performed in the metastatic hcc of the pelvic bone via the right internal iliac artery (adriamycin 50 mg and 20 ml of lipiodol). then, the patient was treated with five cycles of systemic chemotherapy based on 5-fluorouracil (5-fu, 1,000 mg / m on days 1, 2, and 3) and cisplatin (90 mg / m on day 2 every 4 weeks). after the completion of chemotherapy, the tumor became almost necrotic. the afp and pivka - ii levels decreased to the normal ranges (2.85 ng / ml and 28 mau / ml, respectively). as the treatment resulted in near complete regression of the tumor, the patient underwent close follow - up without chemotherapy. however, 12 months after chemotherapy, a ct scan revealed multiple lung metastases in both lungs with increasing afp and pivka - ii levels (182 ng / ml and 38 mau / ml, respectively). he was treated with two cycles of systemic chemotherapy with the same regimen (5-fu 1000 mg / m on days 1, 2 and 3 and cisplatin 90 mg / m on day 2). after two cycles of chemotherapy, the patient refused additional chemotherapy and we provided him with supportive care thereafter. even though the lung metastases were newly developed, primary hcc had not been detected in the sequential radiological examinations, including abdominal ct and pet ct scans. in this case, the final diagnosis was an isolated pelvic bone metastasis from hcc with unknown primary origin. extrahepatic metastases from unknown primary hcc are exceptionally rare and only a few case reports of bone metastasis have been documented.4 - 9 the hypothesis for explaining this unusual phenomenon is that the metastases are from a microhepatocellular carcinoma, which regressed spontaneously or was destroyed by the activated immune system.6,7,10 however, the carcinogenesis mechanism as well as the natural history of this rare phenomenon is not well - known yet.7 thus, the diagnostic approach and treatment have been performed on an individual basis. although the nature of tumor cell could be confirmed by histological examination including immunohistochemical stains, we had to make a differential diagnosis with hepatoid adenocarcinoma and hcc development from ectopic liver.11 - 13 indeed, as there is no specific pathologic finding that could distinguish metastatic hcc from hepatoid adenocarcinoma or hcc arising from ectopic liver, information about involved organ, the presence of chronic liver disease and the degree of liver disease have been used as additional basis for differential diagnosis in previous studies.4 - 9 for example, reporting on a case of hcc in chest wall without unknown origin, asselah made a final diagnosis of hcc arising in ectopic liver tissue, considering that the patient was not at high risk factors of hcc development and that the tumor developed in only parietal muscular tissue, which is an uncommon site for an hcc metastasis. in our case, we also had to make a diagnosis considering not only the pathological examination but also the clinical features of our case, even though we made a different diagnosis comparing from previous case. at first, in our case, neither hepatoid cells with large eosinophilic cytoplasm nor normal liver tissue was observed at microscopic histological examination, which could be shown in hepatoid adenocarcinoma or hcc arising from ectopic liver.9,14 second, 1 year after treatment, new metastases developed in lung, which is the most common metastatic site of hcc.3,15 in previous studies, lung metastases from hepatoid adenocarcinoma or hcc arising from ectopic liver have rarely been reported.16,17 moreover, to our knowledge, there is no report that hepatoid adenocarcinoma or ectopic liver developed from pelvic bone, even though they can originate from various organs.14,16,18 for these reasons, we made a final diagnosis of metastatic hcc with unknown primary hcc. however, we admit that our diagnosis may not be definitely confirmed in that histological was insufficient, as the specimen obtained from an incisional biopsy did not have non - cancerous tissue. it can also be argued that a liver biopsy would be necessary for evaluating primary hcc in the liver. coban reported a patient who presented an isolated extrahepatic hcc of the chest wall without a primary focus. the patient had hbv - related liver cirrhosis, and a diffusely nodular and heterogeneous echogenic pattern was shown in ultrasonography, but there was no evidence of hcc in the liver. however, a liver biopsy was performed, and histological examination confirmed a diffuse type of hcc. but, we thought that the benefit of a biopsy was uncertain in our case because the patient had no clinical evidence of liver cirrhosis, and the liver parenchyma was smooth without a mass or infiltrating lesion. moreover, we performed ct, mri, pet scans, and angiography to find primary hcc, but no evidence of a primary liver tumor was found. however, even though a primary tumor was not found in our case, an intensive search for primary hcc should be carried out when extrahepatic metastasis is observed as the initial presentation. although there is no standard treatment for extrahepatic metastasis without a primary focus, aggressive treatment including surgical resection results in good prognosis if a solitary lesion exists.4,6,8,9 iosca reported a case that presented with an isolated left iliac bone metastasis from a primary unknown hcc. instead, we treated him with combined modalities including radiotherapy, tace and systemic chemotherapy. although chemotherapy and radiotherapy have not been demonstrated to increase the survival rate of hcc patients with bone metastasis, their ability to reduce pain and to increase quality of life has been reported in previous studies.15,20 in our case, back and leg pain were relieved after treatment. moreover, tace was performed without complications to the pelvic bone metastasis in our case. indeed, tace was successfully performed for bone metastasis of hcc in previous studies,6,21 and these results suggest that tace could be considered as a treatment option for a bone metastasis from hcc. even though multiple lung metastases developed, the tumor was well controlled for 12 months after the treatment. in conclusion, we think that individualized and multimodality treatment would be beneficial in such cases. in summary, we reported a rare case of metastatic hcc of the pelvic bone without a known primary origin. in such cases, tissue biopsy and radiological examination should be performed and diagnosis should be made based on both pathological examination and clinical features. | reports of metastatic hepatocellular carcinoma (hcc) without a primary liver tumor are rare. here we present a case of isolated hcc that had metastasized to the pelvic bone without a primary focus. a 73-year - old man presented with severe back and right - leg pain. radiological examinations, including computed tomography (ct) and magnetic resonance imaging (mri), revealed a huge mass on the pelvic bone (1310 cm). he underwent an incisional biopsy, and the results of the subsequent histological examination were consistent with metastatic hepatocellular carcinoma. the tumor cells were positive for cytokeratin (ae1/ae3), hepatocyte paraffin 1, and glypican-3, and negative for cd56, chromogranin a, and synaptophysin on immunohistochemical staining. examination of the liver by ct, mri, positron - emission tomography scan, and angiography produced no evidence of a primary tumor. radiotherapy and transarterial chemoembolization were performed on the pelvic bone, followed by systemic chemotherapy. these combination treatments resulted in tumor regression with necrotic changes. however, multiple lung metastases developed 1 year after the treatment, and the patient was treated with additional systemic chemotherapy. |
atazanavir has been licensed for the treatment of hiv infection in nonpregnant adults in the uk since 2004. off - license antenatal use is increasing ; however, safety and efficacy data in this setting are lacking. atazanavir is a protease inhibitor (pi), a drug class which has been associated in some reports with increased risk of preterm delivery (ptd) and gestational diabetes [16 ]. inhibition of uridine diphosphate - glucuronosyl transferase (ugt) 1a1 enzyme by atazanavir results in an unconjugated hyperbilirubinemia often presenting as jaundice ; some have questioned whether this can result in increased neonatal hyperbilirubinemia [7, 8 ]. the standard atazanavir - containing regimen consists of atazanavir 300 mg given with ritonavir 100 mg once daily (qd) in combination with two nucleos(t)ide reverse transcriptase inhibitors (nrtis) ; ritonavir boosts plasma atazanavir concentrations through cytochrome p450 inhibition. atazanavir can be administered without ritonavir at an increased dose ; however this is not recommended in pregnancy. some authors advise increasing the atazanavir dose to 400 mg qd as both coadministration of tenofovir [9, 10 ] and antenatal physiological changes are associated with reduced total plasma atazanavir concentrations. safety concerns prevent the inclusion of pregnant women in clinical trials ; therefore, observational data are required to assess the safety and efficacy of novel agents antenatally. the aim of this study is to report maternal and neonatal outcomes following antenatal atazanavir exposure in the routine clinical setting. this was a retrospective medical records review of pregnancies exposed to atazanavir and completing 12 weeks ' gestation across 12 participating london hiv specialist centres between march 1, 2004, and december 1, 2010. data were abstracted from medical records on demographics ; medical history ; symptoms ; cd4 + t - lymphocyte counts (cd4 counts) ; hiv viral load (vl) ; treatment ; adherence ; maternal biochemistry ; pregnancy and infant outcomes ; neonatal bilirubin ; and infant hiv infection status. the indication for atazanavir prescription was categorised for each pregnancy as preconception, if they were already taking an atazanavir - containing regimen at the time of last menstrual period (lmp) ; switch, if atazanavir was commenced during this pregnancy in a woman already taking combination antiretroviral therapy (cart) ; first - line, if a first - line atazanavir - based regimen was initiated after the lmp. group included women conceiving on, or initiating during this pregnancy, a non - atazanavir - based cart regimen. women were classified as discontinuing atazanavir if a clinical decision was made to discontinue atazanavir prescription prior to the end of pregnancy. in the uk, maternal hiv infection is diagnosed in accordance with national guidelines, by detection of hiv - specific antibodies using a commercial enzyme - linked immunoassay (eia). the initial reactive assay is confirmed by a further, different, and type - specific eia. the diagnosis of hiv infection is reconfirmed on a separate sample taken at a different time point. hepatitis b virus (hbv) or hepatitis c virus (hcv) coinfection was diagnosed by the detection of antigen (hbv) or the respective nucleic acids at any point during the pregnancy. hepatotoxicity was defined according to the aids clinical trial group (actg) grading of grade 14 transaminitis. mode of delivery was classified as vaginal delivery (vd), planned prelabour prerupture of membranes caesarean section (plcs), or emergency caesarean section (ecs), the latter including all unplanned caesarean sections. analysis of birth weight and gestational age at delivery included data only from singleton deliveries. deliveries at 3 months of life, as per the british hiv association guidelines. congenital (birth) defects as defined by the european surveillance of congenital abnormalities (eurocat) were reported if identified antenatally through screening programmes or during the neonatal examination. quantitative data with normal distribution are presented as means with 95% confidence intervals (ci) while non normal data are presented as medians with interquartile range (iqr). for the purpose of analysis a logistic regression model was used to assess the strength of associations between different exposures and hiv - vl < 50 copies / ml at delivery both in a univariate analysis and after adjustment for hiv - vl at the first antenatal visit and whether atazanavir had been prescribed preconception, first - line, or switch. the following methods were used to account for the correlation caused by multiple pregnancies occurring in the same woman : robust standard errors and generalised estimating equations (gee) with an exchangeable correlation matrix to model clustered data. all p values presented are two - sided and generated by wald - type testing. the use of anonymised clinical data collected as part of routine care for this evaluation was conducted in accordance with the uk national research ethics service (nres) guidance. median age at the first antenatal appointment was 32 years (iqr 2837 years). recorded ethnicities were black - african, 110 (75.9%) ; black - caribbean, 10 (6.9%) ; and white, 8 (5.5%). hiv transmission risks were heterosexual intercourse, 136 (93.8%) ; injecting drug use, 5 (3.4%) ; mother - to - child - transmission, 3 (2.1%) ; and blood transfusion, 1 (0.7%). seven pregnancies (4.8%) occurred in women who were hbv - coinfected and two (1.4%) in women who were hcv - coinfected. median maternal cd4 count at first antenatal appointment was 407 (range : 151161) cells / mm. categories of atazanavir exposure were as follows : preconception, 89 (61.4%) ; switch, 29 (20%) ; first - line, 27 (18.6%). there was no significant difference in the demographic composition of the different atazanavir exposure groups. data on prevalence of nausea and vomiting, new - onset transaminitis, vl at delivery, ptd, birth weight, neonatal jaundice, and events of mother - to - child - transmission are summarised by exposure group in table 1. of the 89 women who received preconception atazanavir, five discontinued atazanavir prior to delivery : two due to teratogenicity concerns, two due to nausea, and one due to virological failure. there was one case of actg grade 2 transaminitis in a woman coinfected with hcv ; atazanavir was continued in this case and the transaminitis resolved spontaneously prior to delivery. there were two intrauterine deaths : one at 14 weeks ' gestation associated with trisomy 21 (maternal age 39) and one stillbirth at 27 weeks ' gestation, the cause of which is unclear and no autopsy results are available. there were 82 live births amongst women who conceived on atazanavir (80 singleton and 2 twin deliveries), amongst which there were two reported congenital abnormalities : one case of trisomy 21 with an associated atrial septal defect (maternal age 44) and one severe congenital cardiac abnormality incompatible with life (maternal age 38). phototherapy was used in one twin with haemolytic disease of the newborn (neonatal bilirubin 194 mol / litre). one infant, delivered by ecs, was infected in utero, with hiv proviral dna detected at delivery and at age three months. maternal adherence to antiretroviral therapy during pregnancy had been poor and hiv - vl at delivery was 1103 copies / ml. no other hiv transmissions were reported. a negative hiv proviral dna result was available at delivery and at 3 months for 73 and 67 infants, respectively. of the 27 women receiving first - line atazanavir, three discontinued atazanavir prior to delivery : two for nausea and vomiting and one for abdominal pain and gallstones. all 27 women commencing first - line atazanavir did so with normal baseline transaminase levels. spontaneously resolving transaminitis developed in 3 (11%) cases (actg grade 2 in 2 cases who were not hbv / hcv - coinfected and actg grade 4 in 1 case with hbv coinfection). these infants had been diagnosed with polycythaemia neonatorum (neonatal bilirubin 258 mol / litre) and infant haemolytic anaemia (neonatal bilirubin 109 mol / litre), respectively. the median duration of antiretroviral treatment prior to delivery was 16.8 weeks (range : 2.730.4 weeks). overall, an undetectable vl at delivery was achieved in 13/23 women who were prescribed first - line atazanavir (56.5%, 95% ci 34.876.0%). when categorised by the duration of art exposure prior to delivery, an undetectable viral load was achieved in 4/10 women who received < 16 weeks cart (40.0%, 95% ci 10.263.5%) compared to 9/13 who received 16 weeks cart (69.2%, 95% ci 36.589.8%). hiv proviral dna results were available for all 24 infants at delivery and for 19 singletons at three months, with no reported cases of mother - to - child - transmission. of the 29 women who switched to atazanavir, 13 had conceived on an alternative regimen and 16 had commenced an alternative regimen during the course of this pregnancy. three women discontinued atazanavir prior to delivery : one due to intolerance and two due to transaminitis. the commonest reason for switching to atazanavir was symptomatic intolerance of the discontinued regimen : 21/29 switched because of gastrointestinal symptoms attributed to antiretroviral therapy. of the 20 who switched from another pi, symptoms improved in 19 (95.0%, 95% ci 69.698.8%). ten of the 29 women (34.5% ; 95% ci 16.152.9%) had new or worsening of gastrointestinal side effects after switching to atazanavir which was also discontinued in one pregnancy. transaminase levels were normal at the time of atazanavir switch in 24/29 cases ; none of these developed new - onset transaminitis (table 1). in five cases atazanavir was commenced in women with elevated baseline transaminases. in two of these five cases, atazanavir was discontinued due to persistent transaminitis ; in both cases women had switched to an atazanavir - based regimen from a lopinavir - based regimen with grade 2 transaminitis, following which atazanavir was switched to raltegravir with subsequent resolution of transaminitis. atazanavir was continued with resolution of transaminitis in three of these five cases, of which two, who were both hbv - coinfected, had switched from lopinavir - containing therapy because of nausea and grade 3 transaminitis and one had switched from nevirapine - containing therapy because of hypersensitivity and grade 1 transaminitis. no intrauterine deaths or congenital abnormalities were reported in this group. excluding the three cases in which atazanavir was discontinued, one infant with no recorded comorbidities required phototherapy (neonatal bilirubin 194 mol / litre). hiv proviral dna results were available for 24 infants at delivery and 22 infants at 3 months, with no reported cases of mother - to - child transmission. data on hiv - vl at delivery amongst women prescribed different atazanavir dosing regimens are displayed in table 2. women who remained on atazanavir 300 mg / ritonavir 100 mg throughout pregnancy were most likely to achieve an undetectable hiv - vl at delivery ; however there was no good evidence of an association between undetectable vl at delivery and the atazanavir dosing regimen in the univariate (p = 0.1) or multivariate analysis (p = 0.1) after adjusting for atazanavir treatment group and hiv - vl at the first antenatal visit. we present data on outcomes seen amongst women who have been prescribed atazanavir in a routine clinical environment. overall atazanavir was well tolerated, with hepatotoxicity necessitating treatment switch occurring only when atazanavir was commenced on a background of existing transaminitis. neonatal hyperbilirubinemia requiring phototherapy was uncommon and the only mother - to - child transmission event was attributed to poor adherence. large hiv cohort studies such as the antiretroviral pregnancy register and the national study of hiv in pregnancy and childhood continue to report on many antenatal outcomes including antiretroviral teratogenicity, virological efficacy, mother - to - child transmission, and trends in antenatal antiretroviral use. however, these studies do not capture data on some clinically relevant queries such as drug tolerability, toxicity, or optimum drug dosing. intolerance was the most common indication for switching to atazanavir following which symptoms resolved in the majority. in the absence of a control group we can not conclude that symptom resolution was attributable to switching. our findings do suggest, however, that atazanavir may be a useful option to consider amongst women intolerant of other regimens. this is in line with the findings of a recently published observational analysis which suggests that atazanavir - based therapy is comparable to lopinavir - based therapy in terms of safety and efficacy. these data do not support routine atazanavir dose escalation in pregnancy, in keeping with another recent report. despite most women remaining on atazanavir 300 mg / ritonavir 100 mg during the third trimester, the overall rate of complete hiv viral load suppression at delivery and the rate of mother - to - child transmission amongst those who conceived on atazanavir were comparable to those reported in other cohorts [2024 ]. a low percentage of women who commenced first - line atazanavir achieved an undetectable hiv viral load at delivery (56.5%) ; however 10/23 of this group had received less than 16 weeks of cart prior to delivery, a shorter treatment duration than that recommended by the british hiv association. the risk of ptd compares favourably to rates reported with other cart- and specifically pi - exposed cohorts [2, 2527 ]. the need for phototherapy (4/120) was much lower than that reported in another observational cohort where 5/23 neonates required phototherapy. however, our findings are in keeping with other published data which support the theory that in utero exposure to atazanavir does not exacerbate physiological jaundice the main limitations to this study are selection bias and information bias : due to the limited experience of atazanavir in pregnancy, the women in our study partly represent a cohort that was intolerant of other more established regimens (the switch cohort), whilst the indications for commencing first - line atazanavir were not recorded. as with all medical records reviews, this has resulted in large amount of missing data which could introduce bias into the analysis, especially affecting infant outcomes. the follow - up of in utero exposed infants is limited to neonatal examination and postnatal hiv testing ; we therefore can not comment on whether in utero atazanavir exposure is associated with longer - term risks to the infant. in addition, despite the size of the overall cohort, the small sample size of subgroups limits the precision of estimates in subgroup analysis. this is, to our knowledge, the largest case series to date of atazanavir use in pregnancy. in summary we found that atazanavir as part of antenatal cart appears safe and well tolerated. data on hiv viral load at delivery and transmission have not raised any concerns regarding efficacy for women conceiving on or switching to atazanavir - based cart. the overall risk of mother - to - child transmission is similar to that reported in other cohorts. further data are required to assess whether initiation of atazanavir - based cart as a first line regimen during pregnancy has a similar efficacy in achieving virological suppression by the time of delivery in comparison with other antiretroviral regimens. | introduction. there are few data regarding the tolerability, safety, or efficacy of antenatal atazanavir. we report our clinical experience of atazanavir use in pregnancy. methods. a retrospective medical records review of atazanavir - exposed pregnancies in 12 london centres between 2004 and 2010. results. there were 145 pregnancies in 135 women : 89 conceived whilst taking atazanavir - based combination antiretroviral therapy (cart), preconception atazanavir exposure ; 27 started atazanavir - based cart as first - line during the pregnancy ; and 29 switched to an atazanavir - based regimen from another cart regimen during pregnancy. gastrointestinal intolerance requiring atazanavir cessation occurred in five pregnancies. self - limiting, new - onset transaminitis was most common in first - line use, occurring in 11.0%. atazanavir was commenced in five switch pregnancies in the presence of transaminitis, two of which discontinued atazanavir with persistent transaminitis. hiv - vl < 50 copies / ml was achieved in 89.3% preconception, 56.5% first - line, and 72.0% switch exposures. singleton preterm delivery (< 37 weeks) occurred in 11.7% preconception, 9.1% first - line, and 7.7% switch exposures. four infants required phototherapy. there was one mother - to - child transmission in a poorly adherent woman. conclusions. these data suggest that atazanavir is well tolerated and can be safely prescribed as a component of combination antiretroviral therapy in pregnancy. |
case : this study included a total of 119 tissue samples from 110 female dogs that were diagnosed as cmgt and underwent surgical resection at the veterinary medical center, the university of tokyo, between april 1996 and december 2009. tumor tissues were classified into adenoma (n=10), complex adenoma (n=22), benign mixed tumor (n=39), adenocarcinoma (n=42) and complex adenocarcinoma (n=6) according to the international histological classification of tumors of domestic animals of the world health organization. when the patient had both benign and malignant cmgts, malignant cmgt tissue was used in the study. the medical records of applicable cases were reviewed, and clinical data including age, breed, body weight, spay history, anamnestic history, other concurrent disease, experience of lumpectomy, the who clinical staging at the time of surgery, operation procedure (unilateral or regional mastectomy), chemotherapy and survival time were collected. regional lymph node involvement was confirmed by cytopathology, and lung metastasis was confirmed by thoracic radiography. antibody : the primary antibodies used for epithelial markers were rabbit polyclonal anti - zo-1 (santa cruz biotechnology, ca, u.s.a.) and mouse monoclonal anti - e - cadherin (bd transduction laboratories, lexington, ky, u.s.a.), and those for mesenchymal markers were mouse monoclonal anti - vimentin (dako japan, kyoto, japan), mouse monoclonal anti - n - cadherin (dako japan) and rabbit polyclonal anti - fibronectin (dako japan). immunohistochemistry : the summary of the procedure is shown in table 1table 1.protocol for immunohistochemistryantigen - retrievalprimary antibodydabzo-1121c, 5 min in cb1:100, 4c, over - nightrt, 3 mine - cadherin121c, 5 min in cb1:150, 4c, over - nightrt, 3 minvimentin121c, 5 min in cb1:50, 37c, 1 hrrt, 1 minn - cadherin121c, 15 min in tb1:50, 37c, 50 minrt, 50 secfibronectrinrt, 5 min, in proteinase k1:1,000, 37c, 50 minrt, 50 seca) cb, 10 mm citrate buffer, ph6.0, b) tb, 10 mm tris buffer, ph9.0 with 1 mm edta, c) rt, room temperature, d) dab, 3, 3-diaminobenzidin / hydrogen peroxide solution.. briefly, formalin - fixed paraffin - embedded sections were deparaffinized, followed by antigen epitope retrieval using appropriate methods. then, they were blocked in 0.1% tween-20 in pbs (pbs - t) containing 5% normal goat serum and probed with the primary antibody. after incubation, samples were treated with polymer solution containing hrp - conjugated antibody against mouse immunoglobulin for e - cadherin, vimentin and n - cadherin, and rabbit immunoglobulin for zo-1 and fibronectin, respectively. visualizations were done with liquid 3, 3-diaminobenzidine (dab)/ hydrogen peroxide solution (dako japan) and counterstained with hematoxylin. a normal canine skin tissue was used as positive and negative controls for epithelial and mesenchymal markers, except for n - cadherin. for n - cadherin a) cb, 10 mm citrate buffer, ph6.0, b) tb, 10 mm tris buffer, ph9.0 with 1 mm edta, c) rt, room temperature, d) dab, 3, 3-diaminobenzidin / hydrogen peroxide solution. evaluation of the emt markers : the evaluation of epithelial and mesenchymal markers was done by one researcher in a blind fashion without clinical information. for each sample, 3 fields of 200 magnification were randomly selected from intra - tumoral area. only stained epithelial tumor cells other than myoepithelium were counted, and the percentage of weak stained and negative cells was calculated for epithelial markers, and the percentage of positive cells was calculated for mesenchymal markers. regarding mesenchymal markers, samples with less than 1% positive of expression were defined as negative to avoid the influence of non - specific false positive. statistical analysis : statistical analysis was performed using excel 2010 or statview - j 5.0 software, and p value<0.05 was considered statistically significant. a chi - square test was used to evaluate the associations between expression of emt markers and clinicopathological factors. spearman s rank - correlation coefficient was performed to determine the relationship between two markers. a multiple logistic regression model yielding adjusted odds ratios was used to clarify the availability as prognostic factors. we selected factors showing the association with one - year survival by univariate analysis (p<0.1). a variance inflation factor indicates degree of multicollinearity, and values greater than 4 may be a cause of concern. clinical features : the 119 cmgts tissues (110 dogs) enrolled in this study are summarized in table 2table 2.canine mammary gland tumors clinical samples used in this studytumor typen (%) benignsimple adenoma10 (8.4)complex adenoma22 (18.5)benign mixed tumor39 (32.8)total71 (59.7)malignantsimple carcinoma42 (35.3)complex carcinoma6 (5.0)total48 (40.3). this study included following breeds ; 20 mongrel, 17 yorkshire terrier, 14 maltese, 12 toy poodle, 8 shih tzu, 5 miniature dachshund, 5 shetland sheepdog and 38 other breeds. expression of epithelial markers : expressions of zo-1 and e - cadherin were observed on the cell membrane and/or cytoplasm (fig. 1.representative findings of immunohistochemistry with antibodies against epithelial markers zo-1 and e - cadherin. (d) e - cadherin was weakly expressed in tumor cells (arrows). the number of samples in which weak or negative expression of zo-1 was observed was significantly larger in dogs 10 years (21 of 68) than in dogs < 10 years (3 of 51). the number of samples in which weak or negative expression of zo-1 was observed was significantly larger in dogs with malignant cmgt (21 of 48) than in dogs with benign cmgt (3 of 71). the number of samples in which weak or negative expression of e - cadherin was observed was significantly larger in dogs with stages iv and v cmgt (7 of 13) than in dogs with i, ii and iii grade cmgt (14 of 106). the number of samples in which weak or negative expression of e - cadherin was observed was significantly larger in dogs with malignant cmgt (14 of 48) than in dogs with benign cmgt (7 of 71). representative findings of immunohistochemistry with antibodies against epithelial markers zo-1 and e - cadherin. (d) e - cadherin was weakly expressed in tumor cells (arrows). expression of mesenchymal markers : mesenchymal markers were observed in the cytoplasm (fig. 2.representative findings of immunohistochemistry with antibodies against mesenchymal markers, vimentin, n - cadherin and fibronectin. (d) positive expression of n - cadherin was observed in tumor cells (arrowheads). the number of samples in which1% positive expression of vimentin was observed was significantly larger in dogs 10 years (17 of 68) than in dogs < 10 years (4 of 51). the number of samples in which 1% positive expression of vimentin was observed was significantly larger in dogs with malignant cmgt (19 of 48) than in dogs with benign cmgt (2 of 71). the number of samples in which 1% positive expression of n - cadherin was observed was significantly larger in dogs with malignant cmgt (10 of 48) than in dogs with benign cmgt (1 of 71). there is no significant relationship between expression of fibronectin and clinicopathological characteristics (table 3table 3.correlations between change of epithelial and mesenchymal markers and clinicopathological variablesloss ofgain ofoverallzo-1e - cadherinvimentinn - cadherinfibronectinage (year)<10354429511021161774568p0.0020.090.030.890.3body weight (kg)<10161413949821087822537p0.990.990.610.530.42ovarian statusspayed64511116intact1817161063103p0.130.630.240.980.76experience of mastectomyfirst14151265588experienced1069519103p0.090.990.10.240.9tumor size (cm)<3987236603871422537p0.230.320.140.0540.62clinical stagei iii201417864106iv and v47431013p0.520.0010.350.190.39histopathological typebenign37214671malignant211419102848p<0.0010.014<0.0010.0010.48a) p<0.05, b) p<0.01.). representative findings of immunohistochemistry with antibodies against mesenchymal markers, vimentin, n - cadherin and fibronectin. (d) positive expression of n - cadherin was observed in tumor cells (arrowheads). the correlation between each marker : to evaluate whether expression levels of used markers relate to each other, spearman s rank - correlation coefficient between two markers was calculated. there is no strong positive correlation between used markers (table 4table 4.correlations between epithelial and mesenchymal markersspearman s rank - correlation coefficient ()loss ofgain ofzo-1e - cadherinvimentinn - cadherinfibronectinloss of zo-10.340.340.210.03loss of e - cadherin0.150.110.07gain of vimentin0.190.20gain of n - cadherin0.26gain of fibronectin a) p<0.05, b) p<0.01.). the relationship between change of emt markers and one - year survival : thirteen dogs died of cmgt within a year after surgery. although necropsy was not allowed in any cases, we judged these dogs died of cmgt because they showed progression of distant metastasis and associated clinical signs. on the other hand table 5table 5.relationship between various parameters and one - year survivalvariablespor (95% ci)age0.272.6 (0.514.5)body weight0.691.3 (0.35.4)ovarian status0.630.7 (0.13.6)previous mastectomy0.940.9 (0.24.0)tumor size0.084.3 (0.823.7)metastasis0.093.4 (0.814.9)chemotherapy0.14naoperative procedure0.093.4 (0.814.9)loss of zo-10.561.5 (0.45.7)loss of e - cadherin0.0039.0 (1.941.7)gain of vimentin0.083.4 (0.813.8)gain of n - cadherin0.831.2 (0.26.1)gain of fibronectin0.202.6 (0.611.9)a) or, odds ratio, b) ci, confidence interval, c) n.a., not available, d) p<0.1. shows the relationship between independent variables including changes in emt markers and clinicopathological factors and one - year survival. independent variables which had associations (p<0.1) with one - year survival were then taken forward to multivariate models. between these variables, the evidence for multicollinearity was absent, because the variance inflation factor for independent variables was less than 4.0 (data not shown). as shown in table 6table 6.the effect of the expression of epithelial and mesenchymal markers on one - year survivalvariablespadjusted or (95% ci)loss of e - cadherin0.022.3 (1.370.8)gain of vimentin0.171.4 (0.530.8)a) or, odds ratio, b) ci, confidence interval, c) p<0.05., multiple analysis showed that only loss of e - cadherin was maintained as their independent predictive values (adjusted odds ratio 2.3 ; p=0.02). a) or, odds ratio, b) ci, confidence interval, c) n.a., not available, d) p<0.1. a) or, odds ratio, b) ci, confidence interval, c) p<0.05. the loss of epithelial markers and gain of mesenchymal markers were observed in some cmgts tissues in this study. these results indicate that emt - like phenomenon occurs in canine tissues as with human breast cancer [6, 21 ]. however, these two changes were not always observed simultaneously in the same tissue, rather, weak correlation was observed between the loss of epithelial markers and gain of mesenchymal markers (table 4). these results indicate that the mechanisms of loss of epithelial markers and gain of mesenchymal markers may work independently. in the past study, a cmgt cell line stimulated by transforming growth factor- acquired vimentin, whereas did not acquire other markers including e - cadherin, -catenin and n - cadherin. the loss of zo-1 and e - cadherin, and the acquisition of vimentin and n - cadherin were observed in much more malignant cmgt tissues as compared with benign tumor tissues (table 3). in human tumors, it is understood that emt is assumed to be a phenomenon that occurs in accordance with the acquisition of a malignancy, such as cell motility, invasive capacity, apoptotic resistance and drug resistance [10, 22 ]. the changes of markers observed in this study were similar to emt in human tumors in that the phenomena mainly occur in carcinoma. therefore, the investigation of various features associated with emt given above is important to understanding of tumor malignancy and progression in canine tumors. on the other side, no significant difference of fibronectin between malignant and benign cmgts tissues was observed. positive expression of fibronectin was observed in 64.8% of benign tissues and 58.3% of malignant tissues, and no expression in peritumoral normal mammary gland (data not shown). a previous study examined the expression of fibronectin in cmgts and normal mammary gland. in this study, cytoplasmic staining of fibronectin was observed in epithelial tumor cells in cmgts, while no staining in normal mammary tissue. staining characteristics of fibronectin in fibronectin may be correlated with tumor genesis rather than acquisition of malignancy. in the comparison with clinicopathological variables, age was related to loss of zo-1 (p=0.002) and acquisition of vimentin (0.03). the median age of benign and malignant groups was 9.5 (range : 5.316) and 11.7 (range : 5.311.7), respectively. these markers might have correlated with age, because the sensitivity for malignant tissues of zo-1 and vimentin was higher than that of benign tissues. this might occur, because the specificity of fibronectin for the malignancy was low. multivariate analysis for one - year survival indicated that loss of e - cadherin was associated with poor prognosis. this result was in accord with the previous studies which suggested the importance of adhesion factors in metastasis and advocated the hypothesis that the acquisition of mesenchymal feature related to tumor malignancy. first, we counted only cells that could be recognized as epithelial tumor cells morphologically, however, the tumor cells undergone complete emt were thought to change their morphology. second, we selected 3 fields across the tumoral area to evaluate the expression of each marker. because the tumor tissue is heterogeneity, it is debatable issue whether 3 fields are enough or not. furthermore, several studies suggested that the emt occurred frequently at invasive front, but less at intra - tumoral. it has been suggested that a local emt at invasive front takes place owing to exposition to a different microenvironment, such as stromal fibroblast and increase of emt regulatory transcription factors via stimulations of various cytokines [1, 18 ]. the further investigation including invasive front with enough fields may be necessary to evaluate emt with more precision. | abstractit is known that epithelial mesenchymal transition (emt) contributes to the acquisition of malignant property in human cancers. however, the role of emt in canine tumors remains to be elucidated. to evaluate the correlation between expression levels of protein markers involved in emt and clinicopathological characteristics in canine mammary gland tumors, immunohistochemistry using antibodies against zo-1, e - cadherin, vimentin, n - cadherin and fibronectin was performed on 119 clinical tissue samples. consequently, loss of zo-1 and e - cadherin, and gain of vimentin and n - cadherin were more frequently observed in malignant tumors than in benign tumors. however, there was no correlation among expression of these molecules. univariate and multivariate analysis identified that loss of e - cadherin independently had a low one - year survival rate (adjusted odds ratio : 2.3, p=0.02). these results suggested that emt might relate to acquisition of malignancy, and additionally, e - cadherin was strongly correlated with malignant behavior in canine mammary gland tumors. |
patients with congenital cleft lip are susceptible to a variety of deformities. among them, the most common type is cleft lip with cleft palate 46%, cleft palate alone 33%, and cleft lip alone 21%. both environmental agents and genetic factors are important in the presence of cleft lip. despite recent advances in surgical techniques in primary correction of the cleft lip deformity, secondary lip deformities usually present as a defect in the free border of the upper lip, which consists of the orbicularis oris muscle, subcutaneous tissue, vermilion, and center of the lip. popular techniques are z plasty, advancement of lateral vermilion, v y advancement, mucosal transposition flaps, or the kapetansky double pendulum flaps. the use of dermis grafts, a strip of skin that has been detached from the subcutaneous tissue, for facial contouring, correction of saddle nose deformity, and lip augmentation has been presented previously. we aimed to assess dermis fat graft (dfg) to correct the tissue deficit in the free border of the upper lip in the secondary cleft lip deformities. this study was performed as a cross - sectional and observational assessment on the outcomes of the dfg technique in patients with lip deformity, secondary to the previous surgery to repair the congenital cleft lip conducted at 20132014 and approved by the isfahan university of medical sciences (research project number : 194109). thirty - five individuals who referred to the center of cleft lip and palate due to lip deformity, following previous cleft lip and palate repair with standard technique underwent cleft repair surgery using dfg. all patients had undergone cleft reconstructive surgery at least once and for maximum of three times. patient 's information including age, gender, and type of primary cleft lip comprising unilateral or bilateral and complete or partial was recorded. the shape of the upper lip by means of preoperative and postoperative photographs in standardized projections was compared. the recipient site of dfg was prepared by creating a submucosal the vermilion or by a surgical incision. the amount of dfg required was estimated based on the length of the lip and extent of deformity. after primary preparation, the proper amount of graft was introduced into the created tunnel through a small incision 12 mm away from labial commissure. the graft was manipulated to sit facing outward and make the site of secondary lip defect bulge. after insertion, two small incisions were sutured with the edge of graft to fix it. from site of the surgery incision, proper and required bed for dfg was prepared and the graft was placed in the site and further stages were the same. thirty - five consecutive patients with lip deformities following primary cleft lip repair surgery who had referred to cleft lip and palate clinic participated in this study. participants included 21 males and 14 females. the results were as follows after 4 months by satisfactory of surgeon and patients : 18 (51.42%) patients were excellent, 10 (28.57%) good, and 7 (20%) intermediate. evaluation was based on the photographs of the patients and motion of the upper lip. length and width of the upper lip, red line and white line of lip, and volume of vermilion were considered while evaluating the results. the result of 35 patients with cleft lip deformity and deficit showed that using this novel method, autograft, instead of allograft, can be efficient for these patients. after 4-month follow - up, we called patients and asked about satisfaction after surgery. presence of a notch in vermilion is a common outcome in cleft lip repair surgery [figure 1 ]. this deformity might be the result of technical problems in the primary corrective operation, or the tissues of this area may have a defect primarily. however, some patients have severe tissue deficit and making a beautiful appearance by readjustment techniques is impossible and other volume enhancers should be performed. before and after cleft reconstructive surgery various materials have been suggested for volume enhancement of free vermilion of upper lip such as fat, dermofat, dermis, and labial minor grafts. regarding the facts that dfg is a rife and accessible reserve in the body, the technique is relatively easy to perform, and harvesting it from donor site does not bring any serious morbidity and also has a more appropriate volume and less resorption and it is an appropriate volume enhancer with long - term clinical results. in the study of patel and hall, dfg technique was used usually in combination with a z plasty of the dry vermilion. in their study, a few number of patients were included compared with our study and they studied a different age group from our study patients. staebel and verheyden also used dfg for the correction of secondary cleft lip deformities, but their method features a precisely dissected pocket to define the deficit to be augmented. another study suggested fat grafts a safe and effective way to improve symmetry and enhance facial proportions in patients with cleft lip. as suggested by niechajev, there are lots of advantages in using dfg for lip augmentation. the use of the autologous material is biologically correct and thus easily accepted by patients and surgeons alike. however, dermofat and autologous fat graft methods used are less reliable because it is difficult to predict the degree of absorption and patients are at increased risk of developing an infection. however, none of these complications were reported in our study. among other methods used for correction of secondary lip deformities, the whistle flap procedure, which was studied by grewal., provided a versatile and reliable option for the correction of vermilion defects from secondary cleft lip deformities. another method is the use of tongue flap for the reconstruction of the upper lip as studied by guerrero - santos. however, this method causes the discomfort to the patient of spending approximately 3 weeks with the tongue flap retained between the lips. as described above, there are various surgical methods depending on the size of defects and the clinical characteristics of patients, each of which has its own benefits and drawbacks. regarding the results, ease of harvesting of dermograft, its abundance, minimal morbidity of donor - site and surgery complications, and high degree of patient satisfaction, we suggest this method as an admissible method with 80% good to excellent results. ha, aak, and rm conceived and designed the study and interpreted the data. | background : this study aimed to assess dermis fat graft (dfg) as a choice to correct the tissue deficit in the free border of the upper lip in cleft lip repair surgery.materials and methods : thirty - five individuals who referred to alzahra hospital at 20132014, with lip deformity following the primary repair surgery of cleft lip underwent surgery by dfg technique. outcomes were assessed 4 months after the surgery based on comparison of preoperative and postoperative photographs.results:the results in 18 (51.42%) patients were excellent, 10 (28.57%) good, and 7 (20%) intermediate according to the satisfaction of patients and investigators in terms of filling of lip deficit and motion of the upper lip. moreover, complications and pain were minimal after 4-month follow-up.conclusion:this method introduces an admissible method with 80% good to excellent results based on satisfactory of patients and surgeon. |
fascioliasis in livestock and humans is caused by two of the most socioeconomically important trematodes : f. hepatica linnaeus, 1758 and f. gigantica cobbold, 1855, respectively (1). humans and animals are infected by eating aquatic vegetables or drinking water contaminated with the infective meta - cercariae (2). human fascioliasis is a foodborne disease, included in the who list of neglected tropical diseases (ntd) (3). more than 180 million people are at risk of fascioliasis with 2.417 million individuals infected (2). fasciola hepatica appears mainly in europe, the americas and oceania, and f. gigantica occurs mainly in africa and asia (1). the distributions of both species overlap in many countries of africa and asia and leads to many problems as for identification (4). the differentiation of fasciola species is essential because their intermediate host, epidemiological characteristics, control strategies, host specificity, drug susceptibility and virulence is different (5). although fasciolid species can generally be distinguished by morphological characters, but both fasciolid species are polymorphic with many factors affecting the morphology and leading to considerable taxonomic confusion (6). nowadays morphological methods are incomplete and imperfect and various molecular and genetic techniques based on dna analyses have been employed for distinguish species confirmation and genetic structuring of parasitic populations (6, 7). reaction - restriction fragment length polymorphisms (pcr - rflp) assay is very rapid, simple, inexpensive, easy to perform and appropriate method for distinguish of f. hepatica from f. gigantica (810). however, for more detailed and complete interpretation of the results consequent sequence analysis of target dna is recommended. in iran, ectopic infection with fascioliasis in non - hepatic sites such as the thyroid, eye or skin, have been reported from iran (12, 13). this province is divided into three distinct portions : warm, moderate and cold climates and suitable pastures for traditional rearing of domestic animals. f. hepatica and f. gigantica have been reported from a range of mammals including buffalo, cattle, sheep and goat based on morphological features in this province. a small outbreak of 17 cases of human fascioliasis happened in the province in 1998 and verified a new emerging focus of human fascioliasis in western part of the country (14, 15). the aim of this study was to identify and differentiate fasciola flukes by pcr - rflp of its1 analysis for epidemiological applications especially in regions where the two species overlap in kermanshah province. adults of f. hepatica and f. gigantic were collected from the bile ducts of different livestock at slaughterhouses in kermanshah, iran from september 2014 to september 2015. flukes were washed in saline solution and subsequently stored in 70% ethanol until required for pcr and sequencing. genomic dna was extracted from the adult flukes using dngtm - plus kit (cinnagen, iran) following manufacturer s recommendations. the its1 region was amplified using two primers forward (5- ttgcgctgattacgtccctg -3) and reverse (5- ttggctgcgctcttcatcgac -3). pcr amplifications were performed in 15 l reactions containing of 7.5 l master mix (amplicon), 0.5 l of each primers (5 pmol) (forward and reverse), 1.5 l genomic dna, and 5 l distilled water. the reactions were performed as follows : pre - denaturation at 95 c for 5 min, 30 cycles of denaturation at 94 c for 30 sec, annealing at 50 c for 30 sec, elongation at 72 c for 30 s, followed by a final extension at 72 c for 5 min. the pcr products were separated in 1.5 % agarose gel using simply safe (eurx, poland). a pcr - rflp method was used to distinguish specifically f. hepatica from f. gigantica in its1with rsai enzyme (9). to confirm results pcr - rflp, sequences were performed using bioedit sequence alignment editor, version 5.0.9 (hall, 1999). then resulted sequences aligned against nr database using blast 2.0 to find the closest entries. multiple sequence alignment was carried out using the clustalw with default parameters ; alignments were visualized using jalview software. phylogenetic analysis was performed using mega 6 package with neighbor joining method and default parameters. adults of f. hepatica and f. gigantic were collected from the bile ducts of different livestock at slaughterhouses in kermanshah, iran from september 2014 to september 2015. flukes were washed in saline solution and subsequently stored in 70% ethanol until required for pcr and sequencing. genomic dna was extracted from the adult flukes using dngtm - plus kit (cinnagen, iran) following manufacturer s recommendations. the its1 region was amplified using two primers forward (5- ttgcgctgattacgtccctg -3) and reverse (5- ttggctgcgctcttcatcgac -3). pcr amplifications were performed in 15 l reactions containing of 7.5 l master mix (amplicon), 0.5 l of each primers (5 pmol) (forward and reverse), 1.5 l genomic dna, and 5 l distilled water. the reactions were performed as follows : pre - denaturation at 95 c for 5 min, 30 cycles of denaturation at 94 c for 30 sec, annealing at 50 c for 30 sec, elongation at 72 c for 30 s, followed by a final extension at 72 c for 5 min. the pcr products were separated in 1.5 % agarose gel using simply safe (eurx, poland). a pcr - rflp method was used to distinguish specifically f. hepatica from f. gigantica in its1with rsai enzyme (9). to confirm results pcr - rflp, sequences were performed using bioedit sequence alignment editor, version 5.0.9 (hall, 1999). then resulted sequences aligned against nr database using blast 2.0 to find the closest entries. multiple sequence alignment was carried out using the clustalw with default parameters ; alignments were visualized using jalview software. phylogenetic analysis was performed using mega 6 package with neighbor joining method and default parameters. overall, 48 adult flukes were collected from 28 cattle, 16 sheep, and 4 goats from the abattoirs of kermanshah province. this approach yielded the identification of two genetically distinct banding patterns belonging to the genus fasciola : the hepatica genotype displays five bands of about 367, 104, 68, 59, 54, and 28 bp, the gigantica genotype shows five bands of about 367, 172, 59, 54, and 28 bp. based on rflp pattern, from 48 fasciola isolates, 4 isolates (100%) from goat had a rflp pattern corresponding to f. hepatica, 27 (96%) and 1 (4%) isolates from cattle had an rflp pattern corresponding f. hepatica and f. gigantica, respectively. fifteen isolates (94%) and 1 isolates (6%) from sheep had rflp pattern corresponding to f. hepatica and f. gigantica, respectively (fig. 1). pcr - rflp pattern of fasciola after digestion with rsa i restriction enzyme. lane 7 : 50bp dna ladder, lane 1 : f. gigantica from cattle, lane 2 : f. hepatica from cattle, lane 3 : f. hepatica from sheep, lanes 4 : f. gigantica from sheep after digestion with rsa i restriction enzyme. lane 5 : f. hepatica from cattle before digestion with rsa i restriction enzyme, lane 6 : f. gigantica from sheep before digestion with rsa i restriction enzyme the sequences of 700 bp its 1 of the flukes were analyzed and aligned with those of available sequences in genbank using multalin (http://multalin.toulose.inra.fr/multalin) software in comparison (fig. 2). there was no nucleotide variation in the its-1 rdna sequences among the f. hepatica and f. gigantica samples examined. some sequences of f. hepatica and f. gigantica were analyzed and deposited in genbank (table 1). one - hundred percent similarities were obtained in comparison of these sequences with all available data of fasciola spp. in genbank. phylogenetic trees were obtained by using mega 6.0 (tamura 3- parameter model) with bootstrap values of 1000 replicates set for neighbor - joining. sequences from specimens isolated in different hosts from our study sequencing profile of fasciola spp. phylogenetic analysis of fasciola samples based on the its1 region revealed 2 haplotypes (1 f. gigantica and 1 f. hepatica) (figure 2). therefore suggesting that two species of fasciola are able to infect domesticated animals and probably human in west of iran. some sequences of f. hepatica and f. gigantica in our study were analyzed and deposited in gen - bank (table 1). overall, 48 adult flukes were collected from 28 cattle, 16 sheep, and 4 goats from the abattoirs of kermanshah province. this approach yielded the identification of two genetically distinct banding patterns belonging to the genus fasciola : the hepatica genotype displays five bands of about 367, 104, 68, 59, 54, and 28 bp, the gigantica genotype shows five bands of about 367, 172, 59, 54, and 28 bp. based on rflp pattern, from 48 fasciola isolates, 4 isolates (100%) from goat had a rflp pattern corresponding to f. hepatica, 27 (96%) and 1 (4%) isolates from cattle had an rflp pattern corresponding f. hepatica and f. gigantica, respectively. fifteen isolates (94%) and 1 isolates (6%) from sheep had rflp pattern corresponding to f. hepatica and f. gigantica, respectively (fig. 1). pcr - rflp pattern of fasciola after digestion with rsa i restriction enzyme. lane 7 : 50bp dna ladder, lane 1 : f. gigantica from cattle, lane 2 : f. hepatica from cattle, lane 3 : f. hepatica from sheep, lanes 4 : f. gigantica from sheep after digestion with rsa i restriction enzyme. lane 5 : f. hepatica from cattle before digestion with rsa i restriction enzyme, lane 6 : f. gigantica from sheep before digestion with rsa i restriction enzyme the sequences of 700 bp its 1 of the flukes were analyzed and aligned with those of available sequences in genbank using multalin (http://multalin.toulose.inra.fr/multalin) software in comparison (fig. 2). there was no nucleotide variation in the its-1 rdna sequences among the f. hepatica and f. gigantica samples examined. some sequences of f. hepatica and f. gigantica were analyzed and deposited in genbank (table 1). one - hundred percent similarities were obtained in comparison of these sequences with all available data of fasciola spp. in genbank. phylogenetic trees were obtained by using mega 6.0 (tamura 3- parameter model) with bootstrap values of 1000 replicates set for neighbor - joining. sequences from specimens isolated in different hosts from our study sequencing profile of fasciola spp. phylogenetic analysis of fasciola samples based on the its1 region revealed 2 haplotypes (1 f. gigantica and 1 f. hepatica) (figure 2). therefore suggesting that two species of fasciola are able to infect domesticated animals and probably human in west of iran. some sequences of f. hepatica and f. gigantica in our study were analyzed and deposited in gen - bank (table 1). the present paper provides additional information on the molecular epidemiology of fascioliasis in kermanshah regions. characterization of the population genetic variability of fasciola species is useful as it can help disease surveillance, diagnosis and control of the parasite. the prevalence of fasciolosis in kermanshah has been reported to be 0.25% in livestock (16). molecular characterization using a pcr - rflp approach on a nuclear marker has revealed that f. hepatica was more prevalent than f. gigantica in kermanshah, confirming previous studies that f. hepatica is found in temperate areas while f. gigantica mainly in tropical zones (9). in tropical regions when both species are present, f. gigantica is commonly endemic in lower areas and f. hepatica is endemic in the highlands (17, 18). the distribution of the two species overlaps in some countries and the presence of hybrid form of fasciola has been reported from livestock or human in asian countries, such as iran (19), thailand (20), vietnam (21), and pakistan (22). phenotypic differences of the liver fluke have been recognized, suggesting hybridization of the two species. this indicates that intermediate forms may exist within our study region, although none has been found in this study. analyses based on the nuclear markers such as its 1 and 2 are useful for species confirmation, whereas mitochondrial markers such as cytoch - rome c oxidase (co1) and nicotinamide dinucleotide dehydrogenase subunit-1 (nd1) are more variable because its mutation rate is often fast and can be used to distinguish closely related species and populations of fasciola. our findings showed that all isolates belonging to f. hepatica and f. gigantica were of common h1 and g1 haplotype, respectively but the comparisons with its1 sequences of f. hepatica and f. gigantica from other localities showed nucleotide differences at least in one position. haplotype g1 of f. hepatica has been reported already from ardabil (9) and guilan (23) from iran, as well as from uruguay (24), egypt (25) and saudi arabia (26) as well. besides, haplotype g1 of f. gigantica has been reported from zambia (24), egypt (27), thailand (28), plus ardabil from iran (9). two species fasciola require a particular snail as an intermediate host in order to complete their life cycle. the main intermediate host of f. hepatica in iran is lymnaea truncatula while the main intermediate host of f. gigantica is l. gedrosiana (11). the distribution of fasciola species is determined by the ecological characteristics such as population dynamics, anthropophylic characteristics, type of water bodies the availability of the snail intermediate hosts (29). lack of data on the susceptibility of potential intermediate hosts to fasciola infection in the present study makes it difficult to determine the role of these snails in the transmission of parasite. complementary studies are needed to determine the prevalence of fasciola species and to determine the presence of the parasite in its snail hosts risk area. we can not forget that the correct identification of lymnaeidae is a key element to detect possible transmission foci and to estimate the infection risk. ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors. | background : we evaluated the genetic diversity of samples identified morphologically as fasciola spp. from sheep, cattle and goat from kermanshah province, western iran using pcr - rflp method.methods:we used pcr - rflp analysis of ribosomal its1 fragment using rsai restriction enzyme to investigate the genetic characteristics of fasciola species obtained from different hosts (16 sheep, 28 cattle, 4 goats). the species of fasciola were confirmed by sequencing the 700 bp region of ribosomal its1 gene.results:in kermanshah, f. hepatica was present in 96% of the samples, f. gigantica was found only in two cattle sample. no hybrid forms were detected in the present study.conclusion:our results contribute to clarify the dark spots of fasciola genotyping in different parts of iran. |
over the past 2 decades, numerous clinical reports have noted an increased incidence of both papillary thyroid carcinoma (ptc) and papillary thyroid microcarcinoma (ptmc) [1, 2 ]. although most ptc patients show a good prognosis on initial followup, the mortality rate for ptc after long - term followup is 510%. multifocal ptc has higher recurrence than that of unifocal ptc [3, 4 ] and mainly results from radiation exposure, genetic mutation, and/or intrathyroid spread. differences in therapeutic intervention and long - term followup between patients with multifocal ptc and ptmc have generated considerable controversy ; however, these alternative approaches are necessary in order to provide appropriate treatment. the purpose of the present study is to investigate the clinical features, therapeutic outcomes, and percentage of multifocal ptc in both ptmc and non - ptmc tumors in areas unexposed to radiation. additionally, the percentages of ptmc and multifocal ptc found during recent decades were retrospectively analyzed. for our retrospective analysis, we collected the records of 2,418 ptc patients who had undergone thyroidectomy at the chang gung medical center (cgmc) (linkou, taiwan) between 1977 and 2010. all of the patients were followedup until the end of 2011 and were staged in accordance with the tumor - node - metastasis (tnm) staging criteria proposed by the union for international cancer control (6th edition). patients who were not followedup for at least 1 year, as well as those who underwent an initial thyroid surgery at a different hospital, were excluded from the study. preoperative thyroid ultrasonography and fine needle aspiration cytology (fnac) examinations were performed for 1,908 of 2,418 patients with thyroid nodules. of these multifocal ptc patients, 454 (94.0%) underwent total thyroidectomy. following total thyroidectomy, 1,809 patients received postoperative thyroid remnant ablation, radioactive iodine (i) therapy, and long - term followup at cgmc, with the exception of the low - risk t1a without metastasis group. ablation of thyroid remnant was performed 4 to 6 weeks after surgery, with an i ablation dose of 1.13.7 gbq (30100 mci). cases in which foci of i uptake, cytological findings, or histological findings indicated extension beyond the thyroid bed were classified as postoperative progressive disease. in these cases, patients were given higher i therapeutic doses (3.77.4 gbq (100200 mci)) that were repeated at 6- to 12-month intervals. permission was obtained from the institutional review board (irb) and ethics committee of cgmc for a retrospective review of the medical records of study subjects. confidentiality of the research subjects was maintained in accordance with the requirements of the irb of cgmc. patients were categorized as ptmc if the largest tumor diameter was 1 cm ; otherwise, patients were categorized as non - ptmc. as per our previous study, multifocal ptmc was defined as two or more tumor sites with a diameter 1 cm. noninvasive radiologic and nuclear medical studies were selected based on clinical indications for each patient and included the following : chest radiography, computed tomography, magnetic resonance imaging, bone scan, thallium-201 scan, and fluoro-18-deoxyglucose positron - emission tomography. postoperative persistent disease status was defined as a persistent local regional tumor or distant metastases as detected by noninvasive methods during the first postoperative year. at the end of 2011, patients were categorized as progression free (pf) on the basis of negative results on i whole - body scan (wbs), absence of visible tumor outside the neck area, and absence of local or distant metastases in noninvasive examinations. clinical postoperative progression of ptc was defined as the presence of cytologically or pathologically confirmed lesions or detectable stimulated thyroglobulin (tg) levels (> 1.2 ng / ml). admission records were reviewed for the following data : age, gender, primary tumor size, ultrasonographic findings, fnac results, thyroid function before surgery, surgical methods, histopathological findings, tnm stage, serum tg levels 4 to 6 weeks after surgery, tg antibody titers, therapeutic i scanning results, i accumulated dose, postoperative chest radiography findings, clinical status for the analysis of distant metastases vianoninvasive radiologic and nuclear medical studies, treatment outcomes, cause of death, and survival status. univariate statistical analysis was performed to determine the significance of various factors according to the kaplan - meier method and the log - rank test. survival rates were calculated according to the kaplan - meier method and compared with the breslow and mantel - cox tests. for all 2,418 ptc patients, the number of total ptc, ptmc, and multifocal ptc cases in different periods is illustrated in figure 1. the percentage of multifocal ptc and ptmc increased 6.1-fold during the period before 1990 and 1.9-fold during the period between 2006 and 2010. among the 483 multifocal ptc patients, 108 presented with multifocal ptmc (22.4%) (table 1). a significantly higher percentage of non - ptmc patients underwent total or complete thyroidectomy (96.8% non - ptmc versus 84.3% ptmc). the incidence of tnm stage i was higher for ptmc tumors than for non - ptmc tumors ; in addition, the non - ptmc group had a higher rate of postoperative disease progression (table 1). otherwise, there were no statistical differences with regard to thyroid cancer disease - specific and total mortality between the 2 groups after a follow - up period of 6.1 years. to identify risk factors for postoperative progression, clinical and demographic information for multifocal ptc cases the results indicated that male gender, larger tumor size, advanced tnm stage, and high postoperative tg level were significant factors for postoperative progression. cancer - specific survival and postoperative progression analysis were performed to compare multifocal ptmc with other types of ptc. the thyroid cancer - specific survival rates for unifocal ptmc and multifocal ptmc were 99.7% and 97.8% at 5 years ; 99.7% and 86.8% at 10 years ; and 99.7% and 86.8% at 20 years, respectively (figure 2(a), left). thyroid cancer - specific survival rates for multifocal ptmc and multifocal non - ptmc groups were 97.8% and 96.4% at 5 years ; 86.8% and 95.3% at 10 years ; and 86.8% and 90.3% at 20 years, respectively (figure 2(a), right). survival rate for multifocal ptmc was statistically lower than that for unifocal ptmc (p < 0.0001) ; in contrast, no difference was observed between multifocal ptmc and non - ptmc (p = 0.3749). the pf rates for unifocal and multifocal ptmc were 96.8% and 83.7% at 5 years ; 96.2 and 83.7% at 10 years ; and 96.2 and 83.7% at 20 years, respectively (figure 2(b), left). in addition, the pf rates for multifocal ptmc and multifocal non - ptmc tumors were 83.7% and 76.5% at 5 years ; 83.7% and 71.9% at 10 years ; and 83.7% and 65.6% at 20 years, respectively (figure 2(b), right). the pf rate for multifocal ptmc was statistically lower than that for unifocal ptmc (p < 0.0001) ; in contrast, no significant difference in pf rate was observed between patients with multifocal ptmc and non - ptmc (p = 0.0843). although the incidence rates of ptc and ptmc have increased in the last decade [2, 11, 12 ], the growing use of preoperative diagnostic modalities can not explain this trend. we have only recently gained sufficient information about the incidence of multifocal ptc in thyroid cancer patients to identify predictive factors. in this study, the incidence rates of both ptmc and multifocal ptc were found to have increased during the last 20 years. these increases highlight the need for further investigation of the clinical features, therapeutic outcomes, and long - term follow - up results of multifocal ptc in patients with microcarcinoma and larger tumors. more aggressive surgical procedures have been mentioned in recent papers [13, 14 ]. however, before reaching conclusions about alternative surgical treatments and postoperative i therapy, it is important to first obtain more information about the long - term follow - up results of multifocal ptc patients. although our study data were collected from a single medical center, members of the thyroid cancer team, including those responsible for diagnoses, surgical approaches, and long - term followup, did not change during the last 20 years. ptmcs that are incidentally diagnosed after surgery was performed to treat benign nodular lesions or graves ' disease usually have good prognosis, even in the absence of further postoperative treatment [1518 ]. the epidemiology and end results cancer database identified 18,445 cases with ptmc during the period from 1988 to 2007 and concluded that the presence of 2 or more risk factors is strongly associated with cancer - related mortality. however, multifocal lesions were not included in that analysis. in our study, patients with multifocal ptc had higher rates of lymph node metastases, soft tissue invasion, and distant metastases at the time of thyroidectomy. additionally, the effects of prophylactic central lymph node dissection for multifocal ptc must be investigated further. to avoid transient or permanent hypoparathyroidism associated with total thyroidectomy this approach may also improve the recurrence - free rate. for cases with lymph node metastasis of bilateral multifocal ptc, concomitant contralateral paratracheal lymph node dissection may be indicated. in our study, compared to unifocal ptc, multifocal ptc or ptmc was expected to correlate with higher recurrence rates or poorer prognosis. among 483 multifocal ptc patients, there were 23 (4.8%) presented as distant metastases at the time of thyroidectomy. in addition, 23 of 98 (23.5%) postoperative progressive patients were presented with distant metastases. additionally, total and disease - specific mortality rates were not increased in patients with multifocal ptc. more data and a longer follow - up period are needed to draw firm conclusions. diverse mechanisms such as multiple independent tumors or intrathyroid spread originating from a single tumor mass were suggested for occurrences of multifocal ptc [5, 21 ]. in our study, the incidence of multifocal ptmc was not lower than that of multifocal non - ptmc. this finding indicates that the pattern of multifocal ptc manifests in early - stage thyroid cancer. there is some controversy regarding the use of i ablation after total thyroidectomy to prevent recurrence of low- and intermediate - risk ptmc [2224 ]. in our multivariate statistical analysis, we identified extrathyroid invasion, solid pattern, tumor multifocality, and absence of a tumor capsule as significant and independent risk factors for ptmc recurrence, although less information was available about postoperative i therapy for multifocal ptc. in our study, the i doses used to treat multifocal and unifocal ptc patients were not statistically different, and a higher rate of postoperative progression was noted in the multifocal group. additional prospectively designed studies are required to determine the effect of higher i doses on preventing recurrence in patients with multifocal ptc. along with the study limitations described above, 17.3% of our patients did not undergo total thyroidectomy, and the thyroid remnant might have contained incidental microcarcinomas. differences between ptmc and non - ptmc groups treated with total thyroidectomy may also represent a bias. additionally, postoperative disease progression and cancer mortality rates were higher in multifocal ptc than in unifocal ptc in both the ptmc and larger tumor groups. furthermore, total thyroidectomy successfully reduced the postoperative disease progression rate in multifocal ptc patients with larger tumors. | this study was to investigate the clinical features and therapeutic outcomes of multifocal papillary thyroid microcarcinoma (ptmc). a total of 2,418 papillary thyroid carcinoma (ptc) patients had undergone thyroidectomy in one medical center between 1977 and 2010. there were 483 (20.0%) diagnosed with multifocal ptc. the percentage of multifocal ptc was higher in ptmc patients (22.0%) than in non - ptmc patients (19.5%). demographic and clinical characteristics of ptmc and multifocal ptc in ptc patients were traced. multifocal ptc patients presented with smaller tumors at an older age, and a higher percentage underwent total or complete thyroidectomy. these patients also showed a higher incidence of postoperative disease progression than did unifocal ptc patients. comparison of 483 patients with multifocal ptmc and non - ptmc tumors showed a higher incidence of postoperative disease progression in patients with non - ptmc ; otherwise, there was no statistical difference in disease - specific and total mortality between these two groups. in conclusion, the incidence of multifocal ptmc was not lower than that of non - ptmc, and postoperative therapies were necessary for both multifocal ptmc and non - ptmc patients. |
mechanical axis derangement arising out of either a varus or valgus deformity in the lower limb will subject the knee to accelerated degeneration and further deformity1,2,3). correction of these deformities is, therefore, essential and proximal tibial osteotomy (pto) is advocated for young adults4,5). in the recent literature, many reports increasingly favor medial open wedge osteotomy over lateral close wedge osteotomy for correction of the varus knee6,7). the level of osteotomy for those two techniques is usually above tibial tuberosity because this level of osteotomy has many advantages, including a high healing rate and the ability to correct the deformity closer to the joint8,9,10). however, it has also several disadvantages, such as iatrogenic patella alta or baja, limited degree of correction, intraarticular fracture and limited proximal bone stock for rigid fixation8,11). there is no consensus in the literature on the optimal fixation device12) or a surgical technique for an open wedge osteotomy13). although plates12) are commonly used for fixation of open wedge osteotomy, their biomechanical stability is still under investigation and longer and thicker plates are recommended14). but relatively bigger plates need a larger incision and can cause irritation of thin overlying medial soft - tissue cover15). there is a need, therefore, for a surgical technique characterized by less invasive surgical methods, biological osteotomy techniques, more rigid fixation, accelerated rehabilitation, and lower surgical risk of complications13,15). the purpose of this prospective study was to document results of pto below the tibial tuberosity using an intramedullary nail in a consecutive series of young adults treated in our institute for varus deformity of the knee. we tried to incorporate the benefits of a conventional osteotomy with less invasive surgical method, less distortion of the anatomy of the proximal tibia, rigid fixation, and less morbidity. the first hypothesis was that open wedge pto performed with a less invasive surgical approach and fixed with an intramedullary tibial nail in young adults with varus deformity would result in desired angular correction and facilitate union. the second hypothesis was that this technique would not affect proximal tibial anatomy, the patellofemoral joint, and basic knee biomechanics as measured by changes in posterior tibial slope angle (ptsa) and patellar height. this is a prospective study consisting of a cohort of 24 consecutive cases in 16 patients treated for varus deformity of the knee by open wedge pto fixed with an intramedullary tibial nail in our institute. all the patients got informed consent to participate in the study, and the study was approved by the institutional review board. young adults who visited our institute for concerns regarding bow knee deformity with associated symptoms, such as minor discomfort due to overloading of the medial compartment, with no or mild early degenerative changes on radiographs were included. our indication for pto using an intramedullary nail were 1) varus malalignment on long - standing radiographs16) in young active individuals under 40 years of age, 2) patients with a normal knee range of motion, 3) the mechanical axis passing through a point located at 30% or less on the articular surface where medial edge of articular surface is 0% and lateral edge is 100%17,18), and 4) stable knee. the exclusion criteria were 1) patients older than 40 years of age, 2) patients with advanced arthritic changes19), 3) patellofemoral pain, and 4) indications for simultaneous ligament repair. for the open wedge pto, a conventional intramedullary tibial nail was used (ctn - cannulated tibia nail [synthes, oberdorf, switzerland ] in 14 cases, etn - expert tibia nail [synthes ] in 4 cases and targon t - universal tibia nail [b. braun, melsungen, germany ] in 6 cases). the underlying cause of deformity was idiopathic genu varum in 13 patients, and the other diagnoses were, multiple epiphyseal dysplasia, hemophilic knee arthropathy, and post - traumatic deformity in one patient each (table 1). the mean age of patients at the time of operation was 25.86.5 years (range, 18 to 40 years). the average follow - up period was 54 months (range, 36 to 107 months). with regard to grading according to the radiographic appearance, 20 knees were grade 0 and 4 knees were grade 1 by kellgren - lawrence classification. one patient underwent bilateral periacetabular rotational osteotomy for dysplastic hip, another patient underwent bilateral supracondylar femoral osteotomy for varus bowing of femurs, and the third patient underwent lengthening with a ring fixator for post - traumatic shortening and deformity in the other leg. the weight bearing line was drawn on long leg weight bearing radiographs, connecting centers of the hip and ankle9). if the medial edge of articular surface is 0% and lateral edge is 100%4,17,18), the weight bearing line in present series always passed medial to a point denoting 50%. the average position of weight bearing line was at 10.7% (range, -26.5% to 29.5%). to determine the mechanical alignment (ma) of the limb, hip - knee - ankle (hka) angle20) of the lower extremity was calculated as the angle between the femoral and tibial mechanical axis9). limb deformity was expressed as degrees of deviation of hka from 180, hence forth referred to as ma, with varus deviations as negative (-) and valgus deviations as positive (+). in the preoperative planning, a corrected mechanical axis was drawn passing through the center of the hip and the center of the knee on long leg radiographs (fig. as all of the patients were active and young adults with few symptoms associated with deformity and minimal degenerative changes, we aimed to correct the mechanical axis of the lower extremity from varus to neutral or slight valgus position of 3 rather than over correction9,21). when this line was extended over the tibia, it passed from the medial side of the tibial plateau to the lateral side of the proximal tibial metaphysis. the path of this line on the proximal tibia was used for nail entry and direction of the nail path. therefore, the nail entry point was located medially compared to conventional intramedullary nailing for tibial fracture. usually, the level of osteotomy was just above where the line contacts the lateral tibial cortex. furthermore, the level of osteotomy was influenced by the location of the most distal screw hole for proximal interlocking present on the nail ; it was usually at a point 1 to 2 cm below the most distal screw hole for proximal interlocking on the nail. the mid - diaphyseal line of the distal fragment of the tibia was marked on a paper tracing and aligned with the proximal nail path to achieve desired correction such that the mid - diaphyseal line of the divided distal tibia coincided with the corrected mechanical axis (fig. the level of osteotomy and direction of the nail were marked on the leg under fluoroscopic guidance according to the preoperative drawing. the entry point of the tibial intramedullary nail was made through a less than 3 cm skin incision medial to the patellar tendon. only the proximal tibia above the planned osteotomy line was reamed under fluoroscopic guidance along the desired trajectory of the entry of nail in the proximal fragment. then osteotomy was performed percutaneously22) through a small stab incision (0.05). the osteotomy level in this series was quite lower than the usual level4,11) at the metaphysio - diaphyseal junction or very proximal diaphysis. this made the osteotomy less vulnerable to an increase in ptsa that can be caused by muscular forces or natural increases after conventional opening or closed wedge osteotomies. recent studies have demonstrated that a decrease in patellar height associated with medial open wedge pto is due to distalization of the tibial tuberosity and shortening of the patella tendon by scarring4,18). these results can cause high incidence of patella baja following pto, which may have deleterious effects on the patellofemoral biomechanics or complicate subsequent tka11). in our series, therefore, we believe that the amount of change in the patella height is smaller for pto below the level of the patella tendon. there are some limitations of our technique and study. first, the number of patients was relatively small and it was not a comparative study. consequently, we can not state that our technique produces better result than other pto techniques for genu varum. second, no clinical or pain scores were assessed since most of our young patients showed only minor discomfort or even no pain. third, this method is technically demanding and has a steep learning curve because the rate of outlier was relatively high. the degree of correction of the varus deformity at the metaphyseal / diaphyseal junction is critically determined by the precise identification of the nail entry portal, the nail path, and the adequacy of locking screws. therefore, preoperative planning is extremely important to determine exact degree of correction, entry point, and the trajectory of the nail in the proximal fragment. radiographic evaluation indicated that pto using an intramedullary tibial nail leads to significant improvement in radiographic parameters without changes in the posterior tibial slope or patellar height. we found that this technique could be a less invasive and effective alternative for correction of the varus knee in young adults. | purposethe purpose of this study was to document results of a less invasive technique of open wedge proximal tibial osteotomy (pto) for the varus knee in young adults using an intramedullary tibial nail.materials and methodswe prospectively studied 24 knees in 16 young patients with varus knee deformity. the mean follow - up was 54 months (range, 36 to 107 months) and the mean age of patients at the time of operation was 25.8 years (range, 18 to 40 years). the open wedge pto was performed below tibial tuberosity using a percutaneous multiple drill - hole technique. conventional intramedullary tibial nail was used for fixation without bone graft. radiographic evaluations were made using mechanical alignment (ma), posterior tibial slope angle, and insall - salvati ratio. union time, loss of correction, implant failure, and associated complications were also investigated.resultsthe mean ma was significantly changed from -9.7 preoperatively to 1.1 at the final follow - up (p<0.001). there was no significant change in the proximal tibial anatomy and patellar height. all patients achieved radiographic bony union at an average of 3.1 months without loss of correction. the only complication was knee pain due to nail prominence in 3 patients.conclusionsradiographic evaluation indicated that pto using an intramedullary tibial nail leads to significant improvement in radiographic parameters without changes in posterior tibial slope or patellar height. we found that this technique could be a less invasive and effective alternative for correction of the varus knee in young adults. |
lithium is the most effective therapeutic modality for the prevention of manic and depressive recurrences in bipolar disorder. since its introduction for such purpose in 1963, considerable concerns have been aroused about a possible negative effect of lithium on kidney function. such evidence has been substantiated with increasing experience with lithium - treated patients receiving lithium for 10 years or more. in recent years, most clinicians treating patients with lithium longitudinally have been of the opinion that in such patients, a systematic monitoring of kidney function is required and, in case of major disturbances, collaboration with nephrologists is needed. the most frequent renal lithium effect is a decrease of urinary concentration ability, which clinically manifests itself by polyuria and polydipsia of various intensities. in lithium - treated patients, urinary concentrating capacity is diminished by about 1030%, which results in the increase of urine volume by about 1060%. extreme impairment of the lithium - induced urinary concentrating ability may lead to nephrogenic diabetes insipidus. a case of this complication occurred in our department and, chronic interstitial nephropathy may develop, first described in renal biopsy specimens 35 years ago. the nephropathy results in increased serum creatinine and a reduction of glomerular filtration rate (gfr). duration of lithium treatment is the main predisposing factor for nephropathy, which, in a small proportion of patients can result in end - stage renal disease. the results of studies performed in the last decade have confirmed that a substantial proportion of lithium - treated patients have a reduced gfr [810 ]. this is connected with the duration of lithium treatment, and is significantly more frequent in lithium - treated than in age - matched, non - lithium - treated subjects. the most recent review of lithium toxicity profile, including 30 studies of renal effects in long - term lithium patients, revealed a reduction in maximum urinary concentrating ability by about 15%, a mean reduction of gfr of 05ml / min per year of lithium treatment, and a significantly lower gfr in lithium patients than that of age - matched controls. the risk of end - stage renal disease in lithium - treated patients was approximately 0.5%. the aim of the study was to screen for some markers of kidney damage in a large group of men and women treated with lithium preparation, and to evaluate the sex - associated differences. the study comprised 80 patients with bipolar mood disorder, aged 3682 (6011) years. there were 26 men, aged 3878 years ; and 54 women, aged 3882 years. consensus diagnosis by at least 2 psychiatrists was made for each patient, according to dsm - iv criteria (scid). the patients had been treated with lithium carbonate for 538 (169) years. in 20 patients (25%), lithium had been used as monotherapy, and in the remaining 60 it was administered with other psychotropic medications. serum concentration of lithium had been maintained in the range of 0.50.8 mmol / l. throughout the period of lithium treatment, the patients had been followed by the same outpatient clinic, the department of psychiatry, university of medical sciences in poznan. if they needed hospitalization, they were hospitalized in the same institution (inpatient clinic, department of adult psychiatry, university of medical sciences in poznan). a semi - structured questionnaire was used for registering patient clinical data, including concomitant medications and somatic conditions. twenty - three patients had hypertension, 16 had thyroid dysfunction, and 6 had type 2 diabetes. table 1 presents clinical characteristics of all patients, divided into 2 subgroups by sex. there were no differences between male and female lithium - treated patients in age, duration of illness, duration of lithium therapy, or mean serum lithium level. the concentration of creatinine was measured in serum and urine by enzymatic method with creatininase. the concentration of albumin in serum was measured by colorimetric method, and the concentration of microalbumin in urine was measured by the immuno - turbidimetric method. urinary excretion rate of microalbumin was calculated in mg / g creatinine (uaer). the results are presented as the mean sd or median and range of the values, as appropriate. for comparative purposes, student s t test and chi - square test after complete description of the study to the subjects, written informed consent was obtained from all of them. the study comprised 80 patients with bipolar mood disorder, aged 3682 (6011) years. there were 26 men, aged 3878 years ; and 54 women, aged 3882 years. consensus diagnosis by at least 2 psychiatrists was made for each patient, according to dsm - iv criteria (scid). the patients had been treated with lithium carbonate for 538 (169) years. in 20 patients (25%), lithium had been used as monotherapy, and in the remaining 60 it was administered with other psychotropic medications. serum concentration of lithium had been maintained in the range of 0.50.8 mmol / l. throughout the period of lithium treatment, the patients had been followed by the same outpatient clinic, the department of psychiatry, university of medical sciences in poznan. if they needed hospitalization, they were hospitalized in the same institution (inpatient clinic, department of adult psychiatry, university of medical sciences in poznan). a semi - structured questionnaire was used for registering patient clinical data, including concomitant medications and somatic conditions. twenty - three patients had hypertension, 16 had thyroid dysfunction, and 6 had type 2 diabetes. table 1 presents clinical characteristics of all patients, divided into 2 subgroups by sex. there were no differences between male and female lithium - treated patients in age, duration of illness, duration of lithium therapy, or mean serum lithium level. the concentration of creatinine was measured in serum and urine by enzymatic method with creatininase. estimated glomerular filtration rate (egfr) the concentration of albumin in serum was measured by colorimetric method, and the concentration of microalbumin in urine was measured by the immuno - turbidimetric method. urinary excretion rate of microalbumin was calculated in mg / g creatinine (uaer). the results are presented as the mean sd or median and range of the values, as appropriate. for comparative purposes, student s t test and chi - square test after complete description of the study to the subjects, written informed consent was obtained from all of them. the mean sd serum concentration of creatinine (scr) in all patients was 1.00.2 mg / dl ; in 29% of them the values exceeding the upper normal limit (1.2 mg / dl) were detected. scr values were higher in men than in women (1.20.3 and 0.80.1 mg / dl, respectively), but did not differ markedly. however, men had 46% elevated scr values, significantly higher than 21% in women (p=0.027). the mean sd and range of values of egfr in all patients and in the subgroups of men and women are shown in table 2. the mean of egfr for all patients averaged 70 ml / min/1.73 m. egfr values 52 hyperalbuminemia is mainly associated with dehydration, but our patients did not show other signs of dehydration. it may be speculated that in lithium - treated patients demonstrating hyperalbuminemia, an impaired urine concentrating ability caused polyuria, which was not adequately corrected by increased fluid intake, and resulted in hemo - concentration. in 16% of our patients the specific gravity of the random urine sample was < 1.005, suggesting polyuria, but serum albumin concentration did not correlate with the specific gravity of the random urine sample (r=0.09, ns). the tendency to hyperalbuminemia in long - term lithium - treated patients has not yet been reported and needs further observation. there have been few studies on the markers of kidney damage during long - term lithium administration in relation to sex. the results of the present study indicate that male patients may be more vulnerable to a possible renal impairment connected with long - term lithium therapy. therefore, while systematic monitoring of lithium function in all patients taking lithium for 10 years should be mandatory, male patients should be the subject of special attention in this respect. the results confirm that screening for markers of kidney damage should be performed in long - term lithium - treated patients for identification of persons with impaired kidney function. male sex seems to be a risk factor for the development of kidney damage during long - term lithium treatment. | summarybackgroundlithium is the most effective therapeutic modality for the prevention of recurrences in bipolar disorder. an important adverse effect of lithium, especially with long - term treatment, is a possibility of a toxic effect on kidney function. therefore, the aim of the study was to assess kidney function in a group of long - term lithium - treated patients.material/methodsthe study comprised 80 patients with bipolar mood disorder (26 male, 54 female), aged 6011 years. they had been receiving lithium for 538 (169) years. random urine sample was examined for albumin and creatinine excretion, and urinary albumin to creatinine ratio (uacr) was calculated. specific gravity of the urine sample was recorded. serum concentration of creatinine was measured and estimated glomerular filtration rate (egfr) was calculated. serum concentration of albumin was also measured.resultsdecreased egfr values 30 mg / g) were found in 25% of men and 12% of women, respectively. serum albumin concentration > 52 g / l was detected in 19% of patients (17% of men and 20% of women). specific gravity of the urine, equal to or below 1.005, was recorded in 21% of men and 14% of women.conclusionsthe results confirm the opinion that screening for the markers of kidney damage should be performed in long - term lithium - treated patients for identification of persons with impaired kidney function. male sex seems to be the risk factor for the development of kidney damage during long - term lithium treatment. |
multiple sclerosis (ms), a chronic disorder, is the most common neurological disease among young people (1). the estimated average global prevalence rate of this disease is 30 per 100,000 individuals with an even higher average rate in europe (80 per 100,000 individuals) (2). the prevalence of ms has been estimated to be 51.9 from 20022008 in tehran (3), 43.8 during 20032006 (4), and 73.3 per 100,000 individuals during 20032010 in isfahan (5). the common symptoms of the disease include fatigue, intestinal and urinary disorders, visual problems, spasticity, swallowing, sexual, cognitive, and motor problems, depression, and pain (6). the quality of life of afflicted individuals is often reduced following the appearance of the above symptoms (7 - 9). drug and non - drug treatments are used for the management and prevention of disease progression and for controlling illness - related disorders (10). in ms, managing the disease requires the help of different personnel with varying healthcare expertise to meet the needs of patients during their lifetime (1, 11). since ms often occurs at a young age, the patients need long - term care. with the progression of the disease, patient capacity to take care of themselves therefore, the burden of responsibility for patient care is transferred to the family (13). the economic effects of the disease arise from a loss of patient ability to work, hospitalization, the requirements to be helped to perform routine daily activities, and the direct costs resulting from the consumption of expensive drugs (14, 15). considering the multiple effects of ms on the patients, their families, and society, it is necessary that the healthcare services offered to patients and families be effective and based on need (16). however, there is evidence that the needs of patients have not been met and that they are not satisfied with the services provided (17, 18). studies employing quantitative methods were performed to assess the needs and available services for patients with neurological disorders, through the use of questionnaires (16, 19 - 21) or qualitative methods of interviewing patients (22, 23). the present study was conducted with the aim of identifying the expectations of ms patients and their families for healthcare services, with a qualitative method. this study is of importance, given the expectations of ms patients regarding social, psychological, and cultural factors, of identifying the needs and expectations of these service users to provide proper healthcare services and the lack of previous research on the needs of ms patients in iran. this article is a part of a qualitative case study that served as a phd dissertation. the study focused on the disease experience, expectations, and health services delivered to ms patients and their families. this study was conducted at the ms association and two hospitals in isfahan, iran, which have ms clinics and neurology wards. the general eligibility criteria for the participants were as follows : a willingness to participate in the study, the ability to take part in the interview and communicate experiences, and a confirmed diagnosis of ms by the neurologist. the participants meeting the eligibility criteria were selected using a purposive sampling method with maximum variation from ms clinics and neurology units of teaching hospitals of isfahan university of medical sciences and isfahan ms association. participants who represent a maximum variation based on gender, age, marital, educational, employment, and income status were invited. semi - structured, face - to - face interviews with the participants were conducted at the ms clinic, participant homes, and isfahan ms association as per the participant s choice. at the beginning of the interview, the participants were requested to explain their illness and then their expectations. to provide a sample of the questions, they were asked to explain their illness, what their opinion of available services was, and what their expectations from the services for them and their families were. the average duration of the interviews was 58 min, with a range of 20120 min. the approval to conduct the study was granted by the ethics committee of the isfahan university of medical sciences (code of ethical approval was 3904050). the research investigator introduced herself to the participants and explained the objectives of the study. the participants were assured that confidentiality, anonymity will be maintained, and they were free to not participate at any step of the study. the researcher also collected documents related to the objective of the study, including weblogs of ms patients, materials from news agencies, and special conservation issues of site members of the ms center and bimonthly ms magazine. the data obtained from these interviews and documents was analyzed by conventional qualitative content analysis, which is a systematic approach for data coding and categorizing (24). this approach helps in avoiding the use of preconceived categories and allows the categories to emerge from the data (25). the interviews were transcribed word by word, read accurately several times, and open - coded. for open coding, the interviews were divided into semantic units that were summarized in the next step and converted into codes. codes were compared based on their differences and similarities, and similar codes were grouped into subcategories. in the next step, subcategories were compared with each other, and similar categories were combined in a manner that the main categories finally emerged. criteria such as credibility, transferability, confirmation, and dependability were used by the researcher to verify trustworthiness. long - term engagement, feedback from participants, and peer verification were employed to increase the credibility of the study. the researcher conducted interviews and repetitive meetings with the participants for an in - depth understanding of each participant could be achieved. moreover, feedback was obtained from each participant to verify the codes and interpretations made based on each interview. the codes resulting from the data were also verified by the researcher s colleagues to survey peer understanding. the researcher s colleagues were presented with the data to investigate the accuracy of its analysis process. all crude data such as recorded tapes and documentations were maintained by the researcher. to increase transferability, the researcher proceeded to describe the study process and conducted activities in a precise and objective - oriented manner. twenty - eight individuals participated in this study, including 20 individuals with ms and 8 family members. the age of the participants ranged between 22 and 63 years, 21% were male and 17% were single. the data obtained from this study was categorized into 5 main categories as follows : being cured, need for comfort, promoting knowledge, economic welfare, and social security (table 3). abbreviation : p, patient. abbreviation : f, family member. after experiencing different symptoms and several periods of relapse some of the participants were tired of long - term treatments and wanted to be rid of them by any means to be able to resume a normal life. due to tiredness because of treatments, some patients had interrupted their drug treatments in the hope of improvement. instead, they had followed treatments such as bee or herbal therapies with the expectation that a treatment intervention would result in a complete cure. i think that if a very effective drug is presented, even if its price is high but it cures the patients, it is very good (p5). some of the participants expected swift elimination of the symptoms, which were of annoyance to them ; otherwise, they referred back to their physician or even changed their physician to obtain the intended result. he expects to be cured very soon, he expects a drug that, if taken tonight, will cure him by tomorrow (f2). some of the participants of this study expected that the patient and family would receive comfort because of the psychological burden associated with illness. some participants even decided to change their physician due to the lack of attention to their needs, and instead, choose a physician who is sympathetic to their needs. i still had not finished talking, when he / she gave me his / her prescription. i expected the physician to listen to me and get to know my problems ; when he / she wrote down the prescription, i thought, what is its use ? individuals with ms expected healthcare personnel to consider their human spirit and not behave with them or their families in a way that made them feel weak. the participants also expected consideration of the psychological aspects of their illness from diagnosis to progression, and recognized that they needed psychological support not only during diagnosis but also throughout the course of their illness. in addition, the families of bedridden ms patients with advanced illness expected healthcare providers to appease the patient and not be left alone. they also expected personnel to follow - up on the condition of the patient and their families. we expected them to call in, because that would make the patient happy ; if the patient would like to go on vacation, they must know, as it is important to ask the patient to go with them the families of ms patients who were experiencing the psychological burden associated with the patients illness also expected psychological support. they expected that they would be offered an opportunity to relieve their emotions, which could reduce their psychological pressure, helping them care better for the patients. now i am very comfortable, my morale has improved (by speaking with the researcher). you spoke with me because i was very unhappy ; such consultation is good for those of us (f4). in addition to tolerating the psychological burden associated with the illness, some of family members were confused regarding the manner of dealing with the patient and expected guidance from a knowledgeable person. the participants noted that they had to be instructed to obtain more information about the illness and comply better with it. additionally, enhancing the knowledge and awareness of people around the ms patient was also expected to improve familial relationships. one of the problems faced by some ms patients was that the diagnosis was concealed from them by the attending physician. for others, the diagnosis was raised in an ambiguous manner such that the patient experienced fear and worry because of the lack of proper knowledge. the participants expected their physicians to tell them the diagnosis and provide them with suitable information regarding the course of ms and treatment trends during all steps of the illness to prevent the patient from developing an erroneous expectation of rapid recovery. " unfortunately, this explanation is such that nobody understands it. we do not know anything ; we are confused about what it is, what my situation is. if i know that it would last for 10 days, i will tolerate it for 10 days the participants also placed emphasis on the importance of educating their families about the illness and its effects on the patient. they felt that this resulted in better compliance of the family with the patients problems as well as proportional expectations based on the patients condition. if the male and female family members are educated separately with regard to the method of dealing with the patient, then they would understand the problems faced by individuals with ms some of the participants expected financial support because of their need for continuous treatment, various services, and certain expensive drugs, the financial effects of their illness on their job and income, and problems in meeting treatment costs. in addition, they expected some of the services to be provided free of charge, and expressed satisfaction with some of these. however, they expected the other services also to be provided free of charge or at least with reduced costs. the participants expected that they would be supported financially, because they experienced the psychological burden following economic problems. i need this money very much ; it is very difficult for us to provide the money (p3). moreover, they did not like being helped in a way that hurt their self - respect. the families of individuals with progressive illness who faced monetary issues expected help from indirect sources, including relevant organizations, so that they could be supported in a manner that maintained their self - respect. i expect the ms association and state welfare organization to help me, because the patient is under their supervision this support included strategies for coping with stigma, job support, and urban optimization. individuals with ms wanted the establishment of cultural awareness of ms because they experienced social stigma resulting from improper awareness of this illness among people and from their misbehavior. ms patients expected that people should be educated about ms, so that they understood the patients condition instead of pitying them. the participants believed that the problems they faced with married life were also due to the misconceptions about ms in society. why are people still without any information about ms are very pessimistic, sufficient information about ms must be provided to the people " (a patient s weblog). individuals with ms expected that they would receive support for acquiring jobs and that their employment would be prioritized because of their concerns about their careers. " he / she can work ; if there is any job, they should give priority to ms patients " (p7). thus, most of them had concealed their diagnosis in their working environment due to anxiety. the participants expected support in their working environments, understanding of their condition by the employers, and co - operation for receiving treatment during periods of illness relapse so that ms patients do not experience concern about losing their job. if i want to be absent for three days, they should temporarily assign another person " (p13). the individuals with progressive ms and motor problems expected such civic amenities and facilities, which would enable their presence in society in a comfortable manner, without confronting problems in performing their personal affairs. " i 'm riding the bus or subway a lot, and when i ride if there is no place to sit, get in the middle, i do not have the strength to hold my hand tight, so now i am fall several times. (ms center website). after experiencing different symptoms and several periods of relapse, some of the participants expected the illness symptoms to be eliminated. some of the participants were tired of long - term treatments and wanted to be rid of them by any means to be able to resume a normal life. due to tiredness because of treatments, some patients had interrupted their drug treatments in the hope of improvement. instead, they had followed treatments such as bee or herbal therapies with the expectation that a treatment intervention would result in a complete cure. i think that if a very effective drug is presented, even if its price is high but it cures the patients, it is very good (p5). some of the participants expected swift elimination of the symptoms, which were of annoyance to them ; otherwise, they referred back to their physician or even changed their physician to obtain the intended result. he expects to be cured very soon, he expects a drug that, if taken tonight, will cure him by tomorrow (f2). some of the participants of this study expected that the patient and family would receive comfort because of the psychological burden associated with illness. some participants even decided to change their physician due to the lack of attention to their needs, and instead, choose a physician who is sympathetic to their needs. i still had not finished talking, when he / she gave me his / her prescription. i expected the physician to listen to me and get to know my problems ; when he / she wrote down the prescription, i thought, what is its use ? individuals with ms expected healthcare personnel to consider their human spirit and not behave with them or their families in a way that made them feel weak. the participants also expected consideration of the psychological aspects of their illness from diagnosis to progression, and recognized that they needed psychological support not only during diagnosis but also throughout the course of their illness. in addition, the families of bedridden ms patients with advanced illness expected healthcare providers to appease the patient and not be left alone. they also expected personnel to follow - up on the condition of the patient and their families. we expected them to call in, because that would make the patient happy ; if the patient would like to go on vacation, they must know, as it is important to ask the patient to go with them the families of ms patients who were experiencing the psychological burden associated with the patients illness also expected psychological support. they expected that they would be offered an opportunity to relieve their emotions, which could reduce their psychological pressure, helping them care better for the patients. now i am very comfortable, my morale has improved (by speaking with the researcher). you spoke with me because i was very unhappy ; such consultation is good for those of us (f4). in addition to tolerating the psychological burden associated with the illness, some of family members were confused regarding the manner of dealing with the patient and expected guidance from a knowledgeable person. the participants noted that they had to be instructed to obtain more information about the illness and comply better with it. additionally, enhancing the knowledge and awareness of people around the ms patient was also expected to improve familial relationships. one of the problems faced by some ms patients was that the diagnosis was concealed from them by the attending physician. for others, the diagnosis was raised in an ambiguous manner such that the patient experienced fear and worry because of the lack of proper knowledge. the participants expected their physicians to tell them the diagnosis and provide them with suitable information regarding the course of ms and treatment trends during all steps of the illness to prevent the patient from developing an erroneous expectation of rapid recovery. " unfortunately, this explanation is such that nobody understands it. we do not know anything ; we are confused about what it is, what my situation is. if i know that it would last for 10 days, i will tolerate it for 10 days the participants also placed emphasis on the importance of educating their families about the illness and its effects on the patient. they felt that this resulted in better compliance of the family with the patients problems as well as proportional expectations based on the patients condition. if the male and female family members are educated separately with regard to the method of dealing with the patient, then they would understand the problems faced by individuals with ms some of the participants expected financial support because of their need for continuous treatment, various services, and certain expensive drugs, the financial effects of their illness on their job and income, and problems in meeting treatment costs. in addition, they expected some of the services to be provided free of charge, and expressed satisfaction with some of these. however, they expected the other services also to be provided free of charge or at least with reduced costs. the participants expected that they would be supported financially, because they experienced the psychological burden following economic problems. i need this money very much ; it is very difficult for us to provide the money (p3). moreover, they did not like being helped in a way that hurt their self - respect. the families of individuals with progressive illness who faced monetary issues expected help from indirect sources, including relevant organizations, so that they could be supported in a manner that maintained their self - respect. i expect the ms association and state welfare organization to help me, because the patient is under their supervision individuals with ms and their families expected social support because they experienced social burden. this support included strategies for coping with stigma, job support, and urban optimization. individuals with ms wanted the establishment of cultural awareness of ms because they experienced social stigma resulting from improper awareness of this illness among people and from their misbehavior. ms patients expected that people should be educated about ms, so that they understood the patients condition instead of pitying them. the participants believed that the problems they faced with married life were also due to the misconceptions about ms in society. why are people still without any information about ms are very pessimistic, sufficient information about ms must be provided to the people " (a patient s weblog). individuals with ms expected that they would receive support for acquiring jobs and that their employment would be prioritized because of their concerns about their careers. " he / she can work ; if there is any job, they should give priority to ms patients " (p7). thus, most of them had concealed their diagnosis in their working environment due to anxiety. the participants expected support in their working environments, understanding of their condition by the employers, and co - operation for receiving treatment during periods of illness relapse so that ms patients do not experience concern about losing their job. if i want to be absent for three days, they should temporarily assign another person " (p13). the individuals with progressive ms and motor problems expected such civic amenities and facilities, which would enable their presence in society in a comfortable manner, without confronting problems in performing their personal affairs. " i 'm riding the bus or subway a lot, and when i ride if there is no place to sit, get in the middle, i do not have the strength to hold my hand tight, so now i am fall several times. (ms center website). being cured was one of the expectations of the participants. given the progression of the illness despite therapy and occurrence of periods of relapse, they expected that a complete treatment would be found. similarly, daugherty indicated the reasons for interrupting interferon therapy included progression of the illness and the patients understanding of the ineffectiveness of the drug (26). some of the participants in the current study expected very rapid elimination of the annoying symptoms of the illness and changed their physician because of the ineffectiveness of the therapy. in another study, forbes showed that patients expected treatment of the illness and control of its symptoms and progression (21). another expectation of the participants pertained to the comfort of individuals with ms and their families. the participants expected others to sympathize with them and continuously offer psychological support throughout the course of their illness. vazirinejad showed that the psychological dimension was the most important one governing the quality of life for patients with mild to severe ms (27). moreover, the ms patients examined by gottberg expected that they would be offered consultation services (19). the participants in the current study also experienced psychological problems and expected healthcare providers to pay attention to their psychological needs. in addition to the individuals with ms, their families also expected psychological support to reduce their psychological burden and help them care better for the patients. the family members expected that they would be consulted regarding the manner of dealing with the patient. egger indicated that 30% of family caregivers noted the need for receiving consultation to help them manage their feelings related to illness burden better (28). moreover, koopman indicated that the psychological needs of caregivers were considered their most important needs and they needed to be heard and have access to appropriate support (29). another expectation of the participants was that the patients and their families should be instructed about the illness, treatment trends, and illness - related problems. in forbes (21) and courts (30), the participants raised the need for providing information about ms to the family members for amending the family members understanding of ms and the influence of the illness on the patient. economic support was another of the expectations of the participants in the current study. because they experienced financial burden due to illness, they expected a reduction in the cost of treatment or the provision of services free of charge. this is similar to forbes, where the issues of funding the interferon treatment and financial help were raised by the patients (20). koopman revealed that financial security was raised as an important requirement by the patients (29). along these lines, the participants in the current study expected charity organizations to help them, so that their self - respect was maintained. the experience of stigma by the participants led to their expectation that the strategies to cope with stigma would also be offered by society. they expected that the attitudes of people in society regarding ms would be changed by providing proper information. the participants believed that the mass media must portray different layers of the lives of ms patients and that the producers of programs should consult with experts to provide suitable information about ms. in zoller, the individuals with ms expected a true picture of ms is conveyed to the people (31). because the participants faced problems related to occupation, they requested that hiring of ms patients should be prioritized. sweetland indicated that patients required support in their working environment, and accordingly, had expectations from their employers (20). moreover, dyck showed that although the disease symptoms influence the career situation of patients, non - medical factors such as understanding of the patients condition by the employer and change in work conditions could prove effective (32). the participants of the current study also expected that suitable facilities for their transportation and other necessities should be provided. this is consistent with studies by gottberg (19), forbes (21), and mccabe where individuals with ms and progressive neurologic disorders expected that suitable transportation services would be provided for them, enabling their presence in society. the strength of the current study is the collection of data from different sources to obtain deeper insight about the study subject. another strength of the study is the emergence of potential suggests how to intervene to promote a more positive outcome for people with ms. this study examined a small sample of patients with ms and their families living in iran. individuals with ms and their families have different needs and expect the healthcare providers to attend to their needs. therefore, healthcare providers are required to make holistic assessment of all the needs of the patients and their family members as well as try to meet them. the absence of such holistic assessment while offering healthcare to ms patients and their families could possibly enhance the psychological burden of the patient or his / her family. therefore, it is the responsibility of the healthcare service providers, policy makers, and social institutions to try to meet the needs of individuals with ms and their families. | background : multiple sclerosis (ms) is a neurological disease that is most commonly observed among young people. drug and non - drug treatments are used to prevent the progression of the disease and to control illness - related disorders. patients with ms often have multiple and complicated needs that require a broad spectrum of health services.objectives:this study was conducted to identify the expectations of individuals with ms and their families for healthcare services.patients and methods : this article is part of a qualitative case study. the participants were selected by a purposive sampling method. in this study, semi - structured interviews of 20 individuals with ms and 8 family members were conducted to identify the expectations of ms patients and their families. in addition to the interviews, the documents related to the aim of the study, including weblogs, ms magazines, special websites of individuals with ms, and news agencies were gathered. analysis of data was performed by a conventional content analysis method.results:the age of the participants ranged from 2263 years. the data obtained from this study was classified into 5 main categories as follows : being cured, need for comfort, promoting knowledge, economic welfare, and social security.conclusions:individuals with ms and their families had different expectations pertaining to all dimensions of life, such that not meeting the needs related to any dimension could have affect the other dimensions. therefore, it is necessary for healthcare providers to have a holistic assessment as well as try to needs and expectations. |
small - scale industries (ssis) play a crucial role in the development of the national economy and generation of employment and self - employment of a country. according to an international labour organization (ilo) report, ssis account for the majority of the world 's labor force, accounting for, on average, nearly 40% of the workforce in the industrialized countries and up to 60% of the workforce in developing and newly industrialized countries. there is a great deal of evidence indicating that workers employed in ssis are provided with insufficient and poor - quality occupational health and safety services and perform their duties under suboptimal working conditions. ssis are not organized to provide workers with safety regulations and education. the lack of safety controls in ssis along with a poor knowledge of safe practices and safety behaviors of workers has led to a wide range of accidents and disabling injuries in ssis. the findings of a nationwide survey in japan showed that 72% of all occupational injury cases requiring sick leave for 4 days or more were related to the ssi sector. furthermore, in a study conducted by park. among 5,080 factories in korea, the morbidity rate due to occupational accidents and diseases in small - scale enterprises was higher than the national rate. similarly, okuga. found that 92% of ugandan welders employed in ssis reported injuries or illnesses that they suspected were caused by their work. in iran, industries employing fewer than 10 employees are considered as micro - scale enterprises (mses), which constitute more than 98% of all enterprises, and their employees account for more than 80% of the total workforce. according to iran 's labor law and social security regulations, employers with more than 25 employees are obliged to a) prepare the means and resources necessary to secure the safety, well - being, and health of the workers in their work environment and to teach them how to use them, b) perform annual health check - ups for employees and provide the results to the iran ministry of health and medical education, and c) monitor and measure occupational harmful agents in workplaces. there are some private occupational health companies registered with the iran ministry of health and medical education that provide occupational health services to these enterprises. however, these services are very limited for mses, and these enterprises are not forced legally to provide occupational health and safety services. on the other hand, employees in mses use poor, outdated machinery and equipment and poorly designed work tools, lack suitable and adequate personal protective equipment, and perform their duties in poor working environments that include high levels of noise, poor lighting, inadequate ventilation, poor housekeeping, and inadequate working space. so far, a few studies have addressed some of the health and safety problems in iranian mses. in a cross - sectional study performed among small hand - woven carpet enterprises, nazari. found that more than half of the carpet weavers were not satisfied with some of the health and safety aspects of their workshops, such as thermal conditions, cleanliness of the air, lighting conditions, noise level, and work station and tool design. however, there is no study in iran that presents a clear picture of the extent of implementation of health and safety standards in mses, particularly taking into account the wide range of occupations. this information would be helpful to focus on occupations needing attention and planning effective programs for improving health and safety measures in iranian mses. therefore, the aims of the current study were to assess (1) the current status of health and safety measures in mses and (2) the prevalence of occupational injuries and accidents and its relationship with health and safety conditions of the mses. this cross - sectional study was conducted among micro - scale enterprises (those with less than 10 employees) in shiraz, a city in one of the largest provinces of iran, fars province. a stratified random sampling method was used to ensure a representative sample of all enterprises. from a list of 3257 micro - scale enterprises, the distribution of enterprises was as follows : 1422, 153, 852, 403, 119, 135, and 173 enterprises in the automobile repairs, electrical, metal, wood, construction, chemical, and food industries, respectively. selected enterprises were visited and after informing the employers / employees about the aims of the research, the numbers of enterprises ultimately surveyed in the current study was 595 (84.63%), including 302, 13, 148, 67, 55, 8, and 2 enterprises in the automobile repair, electrical, metal, wood, construction, chemical, and food industries, respectively. required data on occupational safety and health measures in each mse were collected using an audit checklist constructed based on national safety and health regulations. the checklist covered 7 dimensions (appendix a) including fire safety (7 items), electrical safety (7 items), building safety (6 items), machinery safety (9 items), chemical safety (3 items), occupational health measures (15 items), and use of personal protective equipment (3 items). in order to create an index to calculate the percentage of provided occupational safety and health measures, items of the checklist were rated by a judging panel consisting of 10 occupational health and safety (ohs) experts from shiraz university of medical sciences using the following three - point scale : 0 (fully provided occupational safety and health measures), 1 (partly provided occupational safety and health measures), and 2 (did not provide occupational safety and health measures). in the next stage, to weight the importance of each item in the checklist, a coefficient scored from 1 (minimum importance) to 3 (maximum importance) was allocated to each item by the judging panel mentioned above. for this purpose, the average score of the panellists for each item was considered for determination of the importance coefficient (ic) as follows : 1 - 1.5 (ic of 1), 1.6 - 2.5 (ic of 2), and 2.6 - 3 (ic of 3). finally, an index called the safety and health requirement index (shri) was created to calculate the percentage of provided occupational safety and health measures in the mses as follows : where n is the ic and x is the score of each item. the shri was then graded with the following scale : 25%, very poor ; 26 - 50%, poor ; 51 - 75%, moderate, and > 75%, good. these categories were applied for judging the level of provided occupational safety and health measures in the studied mses. the shri was also used successfully in a recent study to determine the percentage of provided occupational safety and health measures in an iranian hospital. in order to check the reliability of the checklist, the internal consistency of the dimensions was measured with the cronbach 's alpha test. the study protocol was approved by the shiraz university of medical sciences ethics committee, and all the participating enterprises were informed about the objectives of the study and asked to provide written consent prior to start of the study. the relationship between the shri and each dependent variable was investigated using the t - test and analysis of variance (anova). this cross - sectional study was conducted among micro - scale enterprises (those with less than 10 employees) in shiraz, a city in one of the largest provinces of iran, fars province. a stratified random sampling method was used to ensure a representative sample of all enterprises. from a list of 3257 micro - scale enterprises, the distribution of enterprises was as follows : 1422, 153, 852, 403, 119, 135, and 173 enterprises in the automobile repairs, electrical, metal, wood, construction, chemical, and food industries, respectively. selected enterprises were visited and after informing the employers / employees about the aims of the research, the numbers of enterprises ultimately surveyed in the current study was 595 (84.63%), including 302, 13, 148, 67, 55, 8, and 2 enterprises in the automobile repair, electrical, metal, wood, construction, chemical, and food industries, respectively. required data on occupational safety and health measures in each mse were collected using an audit checklist constructed based on national safety and health regulations. the checklist covered 7 dimensions (appendix a) including fire safety (7 items), electrical safety (7 items), building safety (6 items), machinery safety (9 items), chemical safety (3 items), occupational health measures (15 items), and use of personal protective equipment (3 items). in order to create an index to calculate the percentage of provided occupational safety and health measures, items of the checklist were rated by a judging panel consisting of 10 occupational health and safety (ohs) experts from shiraz university of medical sciences using the following three - point scale : 0 (fully provided occupational safety and health measures), 1 (partly provided occupational safety and health measures), and 2 (did not provide occupational safety and health measures). in the next stage, to weight the importance of each item in the checklist, a coefficient scored from 1 (minimum importance) to 3 (maximum importance) was allocated to each item by the judging panel mentioned above. for this purpose, the average score of the panellists for each item was considered for determination of the importance coefficient (ic) as follows : 1 - 1.5 (ic of 1), 1.6 - 2.5 (ic of 2), and 2.6 - 3 (ic of 3). finally, an index called the safety and health requirement index (shri) was created to calculate the percentage of provided occupational safety and health measures in the mses as follows : where n is the ic and x is the score of each item. the shri was then graded with the following scale : 25%, very poor ; 26 - 50%, poor ; 51 - 75%, moderate, and > 75%, good. these categories were applied for judging the level of provided occupational safety and health measures in the studied mses. the shri was also used successfully in a recent study to determine the percentage of provided occupational safety and health measures in an iranian hospital. in order to check the reliability of the checklist, the internal consistency of the dimensions was measured with the cronbach 's alpha test. the study protocol was approved by the shiraz university of medical sciences ethics committee, and all the participating enterprises were informed about the objectives of the study and asked to provide written consent prior to start of the study. descriptive statistics were used to describe the characteristics of the study population. the relationship between the shri and each dependent variable was investigated using the t - test and analysis of variance (anova). the cronbach 's alpha coefficients for dimensions 1 - 7 of the checklist were within the range of 0.60 - 0.90, meeting the minimum acceptable value for cronbach 's alpha. the cronbach 's alpha coefficients for the fire safety, electrical safety, building safety, machinery safety, chemical safety, occupational health measures and use of personal protective equipment dimensions were 0.829, 0.855, 0.648, 0.918, 0.857, 0.631, and 0.859, respectively. the distributions of mses and other dependent variables of the studied sample are presented in table 1. the industry with the highest number of enterprises was the automobile repair industry (50.8%), followed by the metal (24.9%) and wood (11.2%) industries. among the surveyed mses, 82.8% had 1 to 2 workers, the majority of employers / employees (71.3%) were covered by insurance regulations. of the 30.9% of enterprises that had experienced accidents and injuries, the most common types of injuries were musculoskeletal disorders and cuts, and the least common types were pulmonary and hearing problems. a high level of occupational safety and health requirements may have an important role in decreasing the occurrence of accidents and injuries. statistically significant relationships were found between the mean shri score and industrial branch, enterprise size, and type of accident and injury. the overall shri calculated for the studied mses in the current research was 60.43% (sd=20.03), which represented a moderate level. classification of the enterprises by shri category revealed that 24.9%, 42.9%, 24.9%, and 5.4% of the enterprises were in the good, moderate, poor, and very poor categories, respectively (fig. 1). table 3 shows the mean and standard deviation values for the shri and the distribution of shri categories for the different dimensions of health and safety measures. according to table 3, the lowest shri score was related to dimensions of chemical safety (shri=36.42%), followed by use of personal protective equipment (shri=40.22%) and machinery safety (shri=47.37%), respectively. in this research, the implementation of various dimensions of health and safety measures in mses and its relationship with the prevalence of occupational accidents and injuries was studied. the overall shri for the studied mses was categorized into the moderate level (shri= 60.43%). according to our findings, the occurrence of occupational accidents and injuries was not significantly influenced by health and safety measures provided in mses. although the mean shri score was categorized into the moderate level in the current research, considering the categorizations, 30.3% of the studied mses were at the very poor to poor level. this result is more than twofold the value reported by dryson, who found that 15% of new zealand workers in small industries considered their worksite occupational health services to be poor. in this study, a statistically significant difference was found between the mean shri scores in enterprises with different number of employees. in the current research, the mean shri score was lower in enterprises with 5 to 10 employees than in enterprises with 1 to 2 or 3 to 5 employees. this result is in contrast with findings of a national study conducted among danish industries, which showed a lower level of systematic occupational health and safety management in enterprises with 1 to 4 and 5 to 19 employees than larger enterprises. furthermore, fabiano. analyzed the relationship between safety performance and number of employees in italian industries during a period of 5 years using the frequency index (fi) of accidents, i.e., the number of total injuries per million hours of working the results of their study indicated a reduction in the frequency index of accidents with an increase in enterprise size, with small enterprises recording an fi higher by 47% than the fi in large enterprises. a possible reason for the difference in findings between the current study and the other studies mentioned above could be related to an unequal distribution in terms of the number of the studied enterprises. in the current study, while enterprises with 1 to 2 and 3 to 5 employees constituted 96.7% of the sample, only 3.2% of the sample was in the category of enterprises with 5 to 10 employees, which does not allow for actual causative conclusions to be made. according to the study results, 30.9% of enterprises reported that they had experienced occupational accidents and injuries during the previous 12 months. some of the previous studies also reported a high prevalence of occupational accidents and injuries among smes. in a study conducted by nakata. it was found that 35.6% of japanese small - scale manufacturing enterprises had experienced an occupational injury during the previous year. furthermore, in the study of. conducted among small - scale enterprises in korea, the accident rate was 26.0 per 1,000 workers. also, small companies with fewer than 10 employees had nonfatal and death rates that were two and three times those of companies with over 1,000 employees in the korean construction industry. the results of the present study highlighted that musculoskeletal disorders were the commonest work - related injury, which is consistent with other studies. for instance, the prevalence of musculoskeletal disorders was 78.5% among indian workers in the small - scale garment industry and 81.17% among carpet weavers engaged in iranian small - scale enterprises. small enterprises are not organized to fulfill the legal requirements for control of occupational health and safety hazards. in the current study, the shri scores for dimensions of chemical safety, use of personal protective equipment (ppe), and machinery safety were between 25 to 50%, all of which were at the poor level. this finding is in line with a previous study reporting a poor chemical and physical work environment in mses. according to the results of the current research, only17.89% of enterprises labelled chemicals based on their safety hazards, 31.05% of enterprises kept chemicals in a safe way, and 26.84% of employees were aware of the safety of chemicals (data not shown). in addition, ppe was available in 51.05% of enterprises, but only 15.26% of them used ppe when performing jobs that required its use. similarly, kwame. reported that a significant number of ghanaian workers in small - scale sawmilling industries did not use ppe when operating machines or performing jobs that required their use. they concluded that insufficient supply and non - use of personal protective equipment were the cause of 45% of injuries that occurred among workers. first, the cross - sectional nature of the research does not allow further explanation of the casual relationship between provided safety and health measures in the studied mses and the occurrence of accidents and injuries. second, the records for accidents and occupational injuries were self - reported, and it is possible that respondents would not provide correct information to the researcher via this method for a variety of reasons. third, the distribution of samples in the three categories of enterprises was unequal, which does not allow for interpretation of real differences in shri scores between the enterprises of different sizes. finally, the participation rates for enterprises in the chemical (8 out of 135) and food (2 out of 173) industries were very low. it is suggested that future studies should consider more complete samples for these two industries. well - established occupational safety and health requirements have an important role in decreasing the occurrence of accidents and injuries. based on the study findings, the overall shri score was categorized into the moderate level. hence, feasible strategies such as providing basic training on job safety and occupational health aimed at the promotion of knowledge and awareness of employees about health and safety hazards in the working environment and taking appropriate protective actions such as establishment of regional occupational health agencies to render occupational safety and health services such as regular workplace inspections, periodic health check - ups, counselling, and suggestions about eliminating or minimizing work environment health and safety hazards may decrease the risk of accidents and injuries and promote occupational health and safety in the studied mses. acknowledgments : this study was financially supported by shiraz university of medical science grant no.92 - 01 - 21 - 6507. | objectives : this study aimed to determine the extent of implementation of occupational safety and health measures in micro - scale enterprises (mses) and to assess the prevalence of occupational injuries and accidents and its relationship with occupational safety and health measures provided in the mses. method : a cross - sectional study was conducted among 595 of mses. an index called the safety and health requirement index (shri) was created and used to calculate the percentage of provided occupational safety and health measures. the relationship between the shri and the occurrence of occupational accidents and injuries was investigated with the independent samples t - test and one - way anova. results : the mean shri score was 60.43%, which was categorized into moderate level. of the 30.9% of enterprises that had experienced accidents and injuries, the most common types of injuries were musculoskeletal disorders and cuts, and the least common types were pulmonary and hearing problems. results of one - way anova revealed a statistically significant relationship between the mean shri score and industrial branch, enterprise size, and type of accident and injury. the independent samples t - test showed that the occurrence of occupational accidents and injuries was not significantly influenced by provided health and safety measures in mses. conclusion : given the high percentage of enterprises with very poor to poor levels for the shri and the high prevalence of occupational accidents and injuries among the studied mses, feasible protective strategies and job safety training programs are required to promote occupational health and safety in the studied mses. |
a 23-year - old male presented with dull ache, redness, diffuse swelling in superolateral quadrant of the right orbit and proptosis for 4 months [fig. he had no history of trauma, sinusitis, steroid intake, diabetes, and no other significant medical history. on examination, his best - corrected visual acuity of the right eye (re) was 20/15, n6 and left eye (le) was 20/20, n6. hertel 's exophthalmometry showed 2 mm proptosis of the re with 1 mm inferior displacement. slit lamp examination of re revealed conjunctival congestion with discharge and rest of the anterior segment examination was within normal limit. computed tomography (ct) scan showed a 17 mm 19 mm 20 mm well - defined, homogenous, enhancing lacrimal gland (lg) mass with no indentation of the globe [fig. acute dacryoadenitis was suspected and was given a course of systemic and topical antibiotics (tablet amoxicillin and clavulanate potassium, 500 mg/125 mg and topical moxifloxacin eye drops). the specimen was sent for histopathological examination (hpe) in formalin and in saline for koh preparation. hpe report showed lobules of benign lg acini surrounded by dense lymphoplasmacytic inflammation [figs. 3 and 4 ]. occasional necrotizing granulomas and pigmented island of narrow, septate, branching fungal hyphae along with few nonbudding spores suggestive of aspergillus infection. we started patient on systemic antifungals, i.e., tablet itraconazole 200 mg tds for first 3 days followed by maintenance dose twice day for 3 months. the patient was kept under follow - up of 1, 2, 6 weeks. (a) clinical photograph of the patient with right eye proptosis inward and downward. (b - d) well - defined, homogenous, enhancing lacrimal gland mass with no indentation of the globe and without calcification intraoperative photographs showing exposure and excision of the lacrimal gland and black material within the lacrimal gland mass lacrimal gland acini with dense inflammation and fungal colonies (h and e) infiltration of nerve by fungal hyphae and filamentous branching septate fungi (gram - stain) infectious causes are viruses, bacteria, fungi, and parasites. though infectious causes include fungi, isolated fungal dacryoadenitis has never been reported. there are four main types of aspergillus, i.e. aspergillus fumigatus, aspergillus flavus, aspergillus lentulus, and aspergillus nidulans. of which aspergillus fumigates and a. flavus are the most common fungal contaminants of the sinuses, and thus have the potential to infect the orbit. cases of invasive sino - orbital aspergillosis in healthy individuals have often been reported from sudan, india, and other tropical areas. since these areas share a hot and humid climate favorable for fungal growth and possibly a larger number of fungal spores in the environment, even healthy individuals are exposed to fungal spores resulting in increased risk of sino - orbital aspergillosis. risk factors for aspergillosis the spectrum of aspergillus infection is complex and may present in four fundamental patterns : allergic, noninvasive, invasive, and fulminant. in nonimmunocompromised individuals, two modes (allergic, noninvasive) of presentation of aspergillus allergic aspergillus sinusitis is a cause of chronic sinusitis seen in atopic but otherwise normal individuals and is thought to be a combination of type i and type iii immunological reactions to aspergillus antigens via granulomatous inflammation. noninvasive disease results in the formation of an aspergilloma (a fungus ball) and behaves like chronic sinusitis. in contrast, immunocompromised patients typically demonstrate either invasive aspergillosis, which is associated with granulomatous inflammation and fibrosis, or fulminant aspergillosis, which is characterized by diffuse vascular invasion, thrombosis, and ultimately tissue necrosis. showers of aspergillus emboli from an infected valve or other source may infarct small vessels, while larger vessels may become thrombosed in situ. we need to put other causes of lg inflammatory diseases and neoplasms as differential diagnosis. the presence of dense intraluminal calcifications on ct scan is highly indicative of aspergillosis, but their absence does not rule it out since the calcifications may be present in only 50% of infected patients. when present, calcifications with a density > 2000 hu are particularly suggestive of aspergillosis. fine - needle aspiration is one of the procedures to be indicated, especially in patients too ill to undergo more definitive biopsy or when an orbitotomy is not acceptable to the patient. hence, one should suspect fungal infection in a case presenting as dacryoadenitis and not responding or improving with empiric antibiotic therapy. the authors certify that they have obtained all appropriate patient consent forms. in the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal. the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity can not be guaranteed. the authors certify that they have obtained all appropriate patient consent forms. in the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal. the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity can not be guaranteed. | we report a case of isolated aspergillus dacryoadenitis. a 23-year - old male presented with dull ache, diffuse swelling in superolateral quadrant of the right orbit and proptosis for 4 months. ocular examination showed conjunctival congestion, discharge in the fornix and palpable lacrimal gland (lg) mass. routine hematological investigations followed by computed tomography scan of orbits were done. he did not respond to a course of systemic and topical antibiotics. lateral orbitotomy with extended lid crease incision was performed with excision biopsy of lg. abundant blackish material was found in the lg intraoperatively. the specimen was sent for histopathological examination (hpe). hpe report showed aspergillus. thorough ent and systemic evaluation ruled out any other site with the fungus. to the best of our knowledge, this is the first case report of aspergillus infection in lg. |
the annual worldwide incidence of gastric cancer is approximately one million and is ranked the fourth most common cancer worldwide. there are estimated 7,700 new diagnoses and 5,200 deaths from the disease in the uk annually. in the last two decades, more gastric cancer has been diagnosed in the proximal stomach and around the gastrooesophageal junction (goj). increased levels of gastrooesophageal reflux disease and obesity both gastric and gastrooesophageal junction (goj) cancers are associated with poor five - year survival rates [68 ]. potentially curative treatments involve surgical resection and both neoadjuvant and adjuvant chemotherapies, sometimes combined with radiotherapy. the aim of neoadjuvant treatment is to decrease tumour bulk, improve rates of surgical tumour clearance, and treat occult micrometastatic tumour. several trials have used a combination of neoadjuvant and adjuvant chemoradiotherapies to improve outcome with varied success. the use of adjuvant chemoradiation in gastric and goj adenocarcinomas (acc) has achieved mixed results [10, 11 ]. however, use of neoadjuvant chemoradiotherapy has been shown to improve outcome in goj acc. in gastric cancer, neoadjuvant and adjuvant chemotherapies have been shown to improve overall survival [13, 14 ]. the landmark magic chemotherapy trial conducted by the mrc (uk) has established guidelines for the administration of perioperative chemotherapy (cisplatin, 5-fluorouracil (5-fu), and epirubicin) in the surgical management of gastric and goj acc. the study recruited patients with gastric, gastrooesophageal junction, and lower third of oesophageal tumours. 45 centres in the uk, europe, and asia participated in this randomised control trial (rct). between 1994 and 2002, 503 patients were randomised to receive perioperative chemotherapy and surgery (n = 250) or surgery alone (n = 253). 65% (n = 137) of patients started adjuvant chemotherapy but only 42% (n = 104) completed all six cycles of perioperative chemotherapy. the results showed overall improved survival of 36% in the chemotherapy groups versus 23% in surgery - only group on an intention to treat basis. the study mentioned a problem of lack of clarity and information regarding chemotherapy, whether it was neoadjuvant or adjuvant chemotherapy or a combination of both responsible for improved overall survival and progression - free survival. the study did not publish the survival comparison for patients receiving both neoadjuvant and adjuvant cycles versus patients who only received neoadjuvant chemotherapy. presently, in the uk it is standard practice to offer perioperative chemotherapy for gastric and goj acc for appropriate patients. the aim of this study was to review the outcome for patients who have received magic chemotherapy for gastric and goj acc at our institute. specifically we aimed to assess survival differences in patients completing perioperative chemotherapy compared with patients who did not complete neoadjuvant chemotherapy. a total of 272 patients underwent surgical resection for gastric (n = 115) and goj (n = 157) acc between 1996 and 2010 at the university hospital of south manchester. 66 of these patients received neoadjuvant chemotherapy for gastric and goj acc according to magic chemotherapy protocol and subsequently underwent surgical resection. inclusion criteria were histological diagnosis of acc, locally advanced disease (t1 to t4, n0 to n2, and m(0)), and fit for both surgical resection and perioperative chemotherapy. all patients underwent a standard staging ct scan (chest, abdomen, and pelvis). the positron emission tomography (pet ct scan) all patients underwent cardiopulmonary exercise testing as part of preoperative assessment for fitness for general anaesthesia. all cases were discussed in a multidisciplinary team. a consensus decision to offer neoadjuvant chemotherapy was made, and patients were counselled accordingly. each cycle consisted of epirubicin (50 mg / m) by intravenous bolus and cisplatin (60 mg / m) intravenously with hydration on day one and 5-fu (200 mg / m) daily for 21 days by continuous intravenous infusion. a full blood count, serum electrolyte profile, serum creatinine, coagulation, and liver function test monitoring were performed during each cycle. patients were closely monitored for development of side effects of chemotherapy. in patients with a history of ischaemic heart disease the dose of chemotherapeutic agents was modified in patients with myelodepression, thrombocytopenia, and compromised renal function. the absence of further disease progression patients underwent total or subtotal gastrectomy and d2 lymphadenectomy depending upon the tumour site. postoperatively patients were managed by a multi - disciplinary team on the high dependency unit and then on a surgical ward. the demographic details of patients survival status, disease recurrence, and followup were recorded. the postoperative survival was analysed from the date of surgery to last followup or death. the time to recurrence was calculated from the date of surgery to the radiological and clinically proven evidence of disease recurrence. a data set was developed to collect histological information for patients who underwent surgical resection. this included site of tumour, local stage (t), nodal status (n), metastases (m) according to tnm 5 classification, differentiation, and status of longitudinal resection margins. spps version 16 (spss, chicago, il, usa) was used for statistical analyses. the histological characteristics including yptnm, histological grade, and resection margins status were compared against the survival. data was collected for the 66 patients who received neoadjuvant chemotherapy according to magic protocol. the median number of neoadjuvant and adjuvant cycles completed was 2 (range 1 to 3). thirty - one (47%) patients received both neoadjuvant and adjuvant courses of chemotherapy (table 2). in 11 (17%) patients, who completed full course of chemotherapy (neoadjuvant and adjuvant) the median postoperative survival was 14 months (95% confidence interval (ci), 1228) and time to recurrence was 12 months (95% ci, 1228). in patients who completed only the neoadjuvant chemotherapy the median adjuvant survival was 8 months (95% ci 1125) and time to recurrence was 7 months (95% ci, 919). in our study 35 (53%) this was because of postoperative complications, patient refusal, or time lapse between surgery and initiation of adjuvant chemotherapy. there was no significant difference in the rate of recurrence between the two groups. only three (5%) patients showed complete histological response to neoadjuvant treatment as defined by histological analysis of resected specimens (two patients completed full three cycles and one patient received only two cycles). the univariate and multivariate analyses identified completion of both neoadjuvant and adjuvant chemotherapy courses (hr (hazard ratio) 0.26, p = 0.008), nodal status (hr 1.20, p = 0.014), and longitudinal resection margin status (hr 1.35, p = 0.015) as independent markers of prognosis. the kaplan - meier plot showed significant survival difference between patients completing the neoadjuvant and adjuvant chemotherapies compared with patients receiving only neoadjuvant chemotherapy (p = 0.02) (figure 1). the involvement of the nodes (p = 0.004) and longitudinal resection margins (p = 0.03) by the tumour were associated with poor outcome. this is the first study to investigate the survival outcome difference among patients receiving chemotherapy according to magic protocol (figure 1). there was no statistical difference in the rate of incidence of recurrence between the patients completing both neoadjuvant and adjuvant courses of chemotherapy and patients only receiving neoadjuvant chemotherapy (table 1). however, recurrence occurred sooner in patients who received only neoadjuvant chemotherapy, although only 11 (17%) patients completed all six courses of perioperative chemotherapy. also in these two groups of patients no significant difference was observed in terms of neoadjuvant staging and medical fitness before the initiation of chemotherapy. the difference in postoperative survival may signify the oncological importance of completing the full course of perioperative chemotherapy in the absence of prolonged morbidity following surgery. though the number of patients included in this study was limited to the experience at a single centre. in the future, a study involving multiple centres with a larger cohort can help to explain if the difference in survival is related to one adjuvant cycle or the completion of all three cycles. in the management of gastric and goj acc several interventions including neoadjuvant chemotherapy alone, perioperative chemotherapy, and adjuvant chemotherapy alone have been suggested. specialist centres around the world adopt management strategy which best suits the local practice and guidelines based on the best available evidence. in 1970s the first phase i trial of neoadjuvant infusion of chemotherapeutic agents was carried out in japan [16, 17 ]. famtx trial (5-fu, doxorubicin, and methotrexate) was the first study to randomise patients into neoadjuvant and surgery alone. this trial did not show any clinical benefit but laid the foundations for further research in neoadjuvant settings for management of gastric cancer. the magic trial has widely been recognised as the first landmark study to report the prognostic benefit of perioperative chemotherapy in a large cohort of patients. a second well - reported trial conducted by fdration francophone de la cancrlogie digestive (ffcd) group showed significant increase in disease - free survival (34% versus 21%) and overall survival (38% versus 24%) over 5 years following perioperative administration of 5-fu and cisplatin in gastric and distal oesophageal acc. a meta - analysis of 14 neoadjuvant chemotherapy trials in gastric and goj acc concluded improved overall survival (or = 1.27, 95% ci : 1.262.33) and r0 resection rate (or = 1.51, 95% ci : 1.191.91) in patients treated with perioperative chemotherapy. in japan following the publication of acts - gs trial adjuvant chemotherapy has become the standard of care. the chemotherapy consists of adjuvant administration of cycles of s-1 (orally active fluoropyrimidine). the study showed overall survival rates of 80.1% in the chemotherapy group and 70.1% in the surgery - only group. furthermore patients who received chemotherapy had less incidence of recurrence. a recently published meta - analysis by gastric group of 17 trials of adjuvant chemotherapy identified improved overall survival (hazard ration (hr) 0.82, 95% ci 0.760.90, p < 0.001) and disease - free survival (hr 0.82, 95% ci 0.750.90, p < 0.001) in gastric cancer patients who were administered fluorouracil - based regimen as compared to surgery - only group. on the literature search five randomised control trails (rct) were identified which have compared one adjuvant chemotherapy regimen against the other [2125 ]. three trials failed to demonstrate an actual difference in overall and disease - free survival [21, 23, 25 ]. however one trial showed significant improvement in overall and disease - free survival when administering cisplatin, epirubicin, leucovorin and folinic acid versus etoposide, leucovorin, and folinic acid. similarly another rct reported improvement in disease - free survival following administration of 5-fu, folinic acid, irinotecan, docetaxel, and cisplatin versus mitomycin - c. in japan, an ongoing samit study is evaluating the use of paclitaxel and s-1 versus oral tegafur - uracil (uf) for gastric cancer in the adjuvant settings. the recently published results of classic trial in patients with stages ii and iii gastric cancers have identified improved disease - free survival 74% (95% ci, 6979) in patients administered adjuvant capecitabine and oxaliplatin versus surgery - only group 59% (95% ci, 5364). adjuvant chemoradiotherapy (crt) has also been employed in the management of gastric cancer. the int 0116 trial of gastric and goj tumours identified improved three - year survival (50%) and disease - free survival (48%) following administration of adjuvant 5-fu, leucovorin, and radiation (45-gy for 5 weeks). the group recently published 10-year follow - up results which showed benefit for the crt group both in terms of overall survival (hr 0.76, p = 0.004) and disease - free survival (hr 0.66, p < 0.001). a large rct critics study is being conducted by a dutch group. the study aims to evaluate the role of neoadjuvant chemotherapy, surgery and adjuvant crt versus neoadjuvant chemotherapy, surgery, and adjuvant chemotherapy. a recently concluded rct of adjuvant chemotherapy versus adjuvant crt in gastric cancer failed to show any survival difference and clinical benefits between the two groups. fiorica. published a meta - analysis of nine rct : four trials of neoadjuvant radiotherapy and five of adjuvant crt. the study reported that reduced mortality in neoadjuvant radiotherapy to surgery alone over 5 years (or 0.62, 95% ci 0.320.64, p < no trials in the literature were identified which have only compared surgery versus adjuvant radiotherapy. there is a general consensus that neoadjuvant chemotherapy is well tolerated and tolerance to adjuvant chemotherapy is limited by general morbidity following surgery. currently sto3 trial conducted by mrc (uk) is employing bevacizumab, a monoclonal antibody targeting vascular endothelial growth factor - a in combination with epirubicin, cisplatin, and capecitabine (ecx) chemotherapy in gastric, goj, and lower oesophageal tumours. our study showed considerable prognostic benefit achieved following completion of both neoadjuvant and adjuvant chemotherapy courses. it does not include patients who received neoadjuvant chemotherapy but did not progress for surgery or patients who received chemotherapy and were found to have unresectable disease. our study is limited by the total number of patients and it will be difficult to draw a firm conclusion. however, this study highlights the importance of completing the perioperative chemotherapy. this will further lead to a discussion of whether the neoadjuvant or adjuvant chemotherapy is the best option or a combination of chemotherapy actually improves prognosis. | aims. magic chemotherapy has become the standard of treatment for patients undergoing curative resection for gastric and gastrooesophageal junction (goj) cancers. the importance of postoperative component of this regimen is uncertain. the aim of this study was to compare survival and cancer recurrence in patients who have received neoadjuvant and adjuvant chemotherapies according to magic protocol with those patients completing only neoadjuvant chemotherapy. methods. 66 patients with gastric and goj adenocarcinomas treated with neoadjuvant and adjuvant chemotherapies according to the magic protocol were studied. all patients underwent potentially curative surgical resection. the histological, demographic, and survival data were collected for all patients. results. the median number of neoadjuvant chemotherapy cycles received was 2 (range 13). thirty - one (47%) patients underwent adjuvant chemotherapy with a median of 2 cycles (range 13). patients who have completed both cycles of chemotherapy had significantly improved survival (p = 0.04). patients with involved lymph nodes and positive longitudinal resection margins had increased incidence of recurrence (p = 0.02) and poor five - year survival (p = 0.03). conclusions. patients who received both neoadjuvant and adjuvant chemotherapies for gastric and gastro - oesophageal junction tumours have improved outcomes compared to patients who only received neoadjuvant chemotherapy. |
balancing ecological and social outcomes of conservation actions is recognized in global conservation policy development. social scientists studying natural disaster recovery frequently call on the term fragile to describe human systems that are vulnerable to and compromised after natural disasters. for example, people with physical or mental disabilities or individuals who are culturally different from the mainstream population within a disaster zone may be extremely fragile components of the population. the antonym antifragile is arguably a highly relevant term for biologists to use for describing recovery potential of ecosystems that claim a history of frequent tc disturbance. a resilient system is one that absorbs a disturbance and has the ability to stay the same. species in any given ecosystem are adapted to the local environmental stressors, and continued exposure to those stressors offers opportunities for those species to reveal their evolved optima. indeed, paleoecological research indicates localities with a history of tcs exhibit greater tc resilience than localities with less frequent tcs. if we use a nave ecosystem that has not experienced recent tcs as the benchmark, and an experienced ecosystem recovers more quickly and to a greater degree than a resilient nave system, then the response of the experienced ecosystem is better than resilient. antifragile would be an appropriate term for biologists to begin using to describe the recovery of experienced ecosystems following tc disturbance. accumulated cyclone energy (ace) is founded on the square of the wind speed recorded every 6 h during the life of tcs, and is useful for integrating cumulative destructive potential of a single tc, a season of tcs, or the collective tcs that impact a specified locality. a comparison of 40 y of ace reveals the value of the western pacific region for studying tcs, in that the annual ace of the western pacific greatly exceeded that of the atlantic. the annual ace mean was 276 knots 10,000 in the western pacific tc basin, and only 99 knots 10,000 in the atlantic tc basin. the pacific ace was greater than the atlantic ace even in 1992 when hurricane andrew and in 2005 when hurricane katrina impacted the atlantic coastal regions. furthermore, in 6 of the 40 years, the pacific ace was more than 10-fold greater than the atlantic ace. most non - economists can grasp the bottom line on a spreadsheet even if they do n't understand the models and data used to get to that bottom line. the ace emerges as a parallel, in that within a single number one can integrate the complex factors that integrate to quantify damage potential. for example, a tc that persists for many days but never reaches catastrophic wind speeds may exhibit a relevant and accurate low ace despite its longevity. alternatively, a tc that is short - lived but powerful may exhibit a relatively high ace despite its short life. biologists may aid in cross - referencing their tc research with meteorology and climatology research if ace were more frequently used as a metric in ecology research. how humans use the natural environment and how much they do so without threatening its sustainable integrity is a fundamental issue in environmental conservation. within this context, ecosystem services are defined as the benefits people obtain from ecosystems on earth. for coastal regions where tcs exert their greatest damage, owners and managers of land are both producers and consumers of many of these services. although the total value of the ecosystem services provided by the coastline is great, land owners may perceive their only direct benefit is from saleable products. in western pacific islands, this is partly causal of the ongoing large - scale alteration of coastal zones to aquaculture. thus, incentives from government and the larger community are needed to interest land owners in adopting practices that benefit society as a whole. toward that end, the political and socio - economic relevance of ecosystem services has fostered growing knowledge on the subject. the future integrity of coastal ecosystems will be determined by complex interactions among various effects of climate change and globalization. some of the mediating factors will be state and regional governance, global and regional environmentalism, economic policies, availability of financial resources, technological advances, and cultural values. in cases where land owners do not perceive a direct benefit from maintaining the full range of environmental services obtained from natural coastal ecosystems, these land owners may require compensation for revenues foregone from the decision to maintain natural areas. in countries like the philippines this may be further complicated by highly diverse groups of indigenous peoples, because the fate of indigenous peoples and maintenance of indigenous rights is typically tightly linked to local biodiversity. the convention on biological diversity was the first global agreement aimed at conservation and sustainable use of biological diversity. in recent years a strong focus on biodiversity governance has generated standardized biodiversity assessment, monitoring, and conservation using market - based instruments. however, biodiversity is not the only facet of coastal ecosystem services that would benefit from an integrated global approach. innovative market - based instruments targeting all facets of what the ecosystem has to offer mankind would benefit various countries which seek to offer incentives to local communities. the european environment agency (eea) has recently summarized the economic importance of coasts and the immense pressure to which they are subjected. while the term ecosystem services has a long history in ecology research, the eea is introducing the term ecosystem capital as a means of quantifying the changes to coastal habitats over time. integrating ecosystem capital metrics in coastal planning generates more relevant knowledge and improves collaboration of diverse actors. indeed, if discussions can shift from ecosystem services to ecosystem capital, perhaps policy makers from the countries such as the united states that carry the most blame for historical emissions involved in global climate change will more fully embrace their responsibilities to the most vulnerable countries like the philippines. this will involve moving more resources from affluent perpetrators to the vulnerable countries in order to help them address their own mitigation actions that sustain their ecosystem capital. enforcement mechanisms of a multilateral treaty are arguably required and these mechanisms may take on more strength if the growing knowledge of ecosystems services is employed to quantify an ecosystem capital framework. efforts to mainstream concepts from various disciplines into tc ecology research may improve contributions of biologists to understanding aspects of global climate change. embracing the concepts of fragility and antifragility may help integrate key ecological concepts with humanitarian efforts and social sciences. employing ace metrics in ecosystem and biodiversity response to tcs may foster better cross - referencing between ecology and climatology literature. contributions by biologists to the quantification of ecosystem capital may better position those biologists as moral actors in climate justice efforts to alleviate unequal burdens created during climate change. increased use of these concepts by biologists may cultivate conceptual confluence among disciplines and help reconcile deficiencies in coordination between anthropo- and ecocentric motivations. | contributions of biologists to tropical cyclone research may improve by integrating concepts from other disciplines. employing accumulated cyclone energy into protocols may foster greater integration of ecology and meteorology research. considering experienced ecosystems as antifragile instead of just resilient may improve cross - referencing among ecological and social scientists. quantifying ecosystem capital as distinct from ecosystem services may improve integration of tropical cyclone ecology research into the expansive global climate change research community. |
carrot is among the top ten most economically important vegetable crops in the world, in terms of both area of production and market value ; it is generally believed to be rich in vitamins and minerals. meanwhile yacon (smallanthus sonchifolius) is a perennial herbaceous feverfew, which is native to southern peru and the andean plateau of western bolivia. in china yacon fruit, which is rich in flavonoids, phenolic acids, esters, lipids, and polysaccharides, has stomach - cleansing, detoxification, hypolipidemic, and bactericidal properties. however, carrot and yacon have easily encountered some same plant diseases and pests at southwest area in china, all of which have grown locally ; therefore, phosphorothioate agrochemicals have been often used in the two root crops. among the pesticides, organophosphate species are the most used due to their high insecticidal activity and relatively low persistence. furthermore, the application of organophosphate pesticides (opps) during crop cycles could contaminate surface and ground soil and can be toxic to aquatic microorganisms, humans, root crops, and other plants. therefore, a rapid, convenient, accurate, and sensitive method is required to be developed to monitor the concentration of organophosphorous pesticides in carrot and yacon samples. it is especially more important to monitor phosphorothioate pesticides in time since they are the major organophosphate pesticides in carrot and yacon samples. in the past decades, a large number of screening methods have been used for the determination of organophosphorus pesticides, such as thin layer chromatography, gas chromatography, biosensor, and chromatography - mass spectrometry. among them, gas chromatography (gc) is one of the most classical and universal techniques at present due to the very low limits of detection, but gc determination is insufficient for the analysis of trace pesticide residues. consequently, an effective sample preparation procedure before gc analysis is very significant and valuable. sample extraction, purification, and enrichment of pretreatment procedure are very crucial steps in an analytical process when the target compounds are detected. currently, there have been a great number of the traditional pretreatment methods in pesticide residue analysis, such as soxhlet extraction, liquid - liquid extraction (lle), solid - phase extraction (spe), and ultrasonic extraction. these methods not only require lots of organic solvents, but also need plenty of time ; moreover, they might cause environmental pollutions. compared with the traditional pretreatment methods, a promising technique named matrix solid - phase dispersion (mspd) has been developed and extensively applied in recent years, which enables extraction and cleanup to be performed in one single step. application of mspd in sample analysis can greatly reduce the analysis time and solvent because no elution of the spe column is needed, which can evidently decrease the cost of analysis. however, because of the lack of selectivity and ideal purification efficiency, the common dispersants in matrix solid - phase dispersion (c18, n - ethylenediamine propyl silane, silica, florisil, etc.) therefore, further improving the adsorption and selectivity of matrix solid - phase dispersion is still very crucial and significant. the molecularly imprinted polymers (mips) are very ideal matrix solid - phase dispersant, which can be successfully applied in pretreatment process of samples. molecularly imprinted polymers (mips) are artificially synthesized macromolecular materials, which are highly cross - linked polymers and are able to recognize the target molecules by imprinting the molecules during polymer synthesis through covalent or noncovalent interactions. so far, mip has been researched and utilized extensively in such fields as biochemical separation, chiral resolution [14, 15 ], enzyme catalysis [16, 17 ], chromatographic analysis, biosensors, drug delivery, and so on. in recent years, mips have been extensively used for the selective enrichment and pretreatment of target compounds which exist in a complex matrix sample. it is a new trend that mips are used as selective mspd sorbents to achieve simultaneous extraction and purification of analytes, which can significantly reduce the labor and cost of the analysis. in addition, mips technology has also been gradually applied to the field of environmental analysis with the rapid development of analytical methods. however, the conventional techniques used to prepare mips most often result in a poor site accessibility of the mips to the target molecules. mips especially prepared by the method of traditional bulk polymerization can only selectively recognize the template molecules, but their adsorption capacities toward other analytes are low and weak. furthermore, a template leakage of mip is always observed in its actual applications [22, 23 ]. therefore, their applications in the multiresidue analysis of pesticides are limited to a great extent. technique has been developed to overcome this drawback. in this technique, the initiating mip groups are immobilized on the surface of a solid support, and the grafted mips were propagated from the surface of the solid supports during the course of polymerization. meanwhile, mip thin layers with high graft density and nanometer thickness can be prepared on the surface of a solid support by using the grafting from special materials technique. the aim of this study is to employ tolclofos - methyl molecularly imprinted nanomicrospheres as a dispersant of mspd based on supporting materials of nanosilica microspheres, which was used for the rapid screening and adsorbing of four phosphorothioate pesticides from the extracted solution of carrot and yacon. the nanomicrospheric imprinted polymers of tolclofos - methyl were synthesized via a method of grafting technique on the surface of nanosilica. the obtained mips were used as the adsorbent of matrix solid - phase dispersion to extract and preconcentrate the four phosphorothioate pesticides from the extracted solution of the carrot and yacon samples. it especially was very significant and novel in process of separation of the sample that magnesium chloride was used for improving adsorbance of mip nanomicrospheres towards pesticides in a process of pretreatment of the carrot and yacon samples. then the factors affecting the preconcentration and separation of the analytes were discussed in detail and the applicability of this method was evaluated. the pure product of tolclofos - methyl with purity of 99.7 0.5% and the single standard solution of four phosphorothioate pesticides (1000 gml) (phoxim, tolclofos - methyl, chlorpyrifos, and parathion - methyl) were purchased from aladin reagent (beijing, china). ethyl acetate, acetonitrile, methylene chloride, methanol, and ethyl alcohol were also purchased from aladin reagent which all were of chromatographic grade. n - ethylenediamine propyl silane, nanosize silica (50100 nm), magnesium sulfate, magnesium chloride, acetic acid, and trifluoroacetic acid were purchased from sigma company which all were of analytical grade. ethylene glycol dimethacrylate (egdma, 98% purity), -methacrylic acid (maa, 99% purity), gamma-(methacryloyloxy) propyl trimethoxy silane, and 2,2-azobisisobutyronitrile were also purchased from sigma company, all of which were of analytical grade. 10% magnesium chloride (mgcl2) was prepared with pure water. for the standard curve, the standard solution was diluted to 5.0, 2.5, 1.0, 0.25, and 0.05 gml. analysis of four phosphorothioate pesticides was performed using an agilent 7890 gas chromatograph (agilent, ca, usa) equipped with a nitrogen phosphorus detector (npd). the separation was performed on an agilent db-35ms column (30 m 320 m, 0.25 m). nitrogen was used as the carrier gas at a constant flow rate of 1.0 ml / min. meanwhile, hydrogen was used as the burning gas at a constant flow rate of 3 ml / min and the auxiliary burning gas was air at 60 ml / min. the injection volume was 1.0 l, and the injection port temperature was held at 200c at the splitless mode. the oven temperature was programmed as follows : 150c held for 1.0 min, and then the temperature was increased to 280c at a rate of 10c / min and held for 5 min. the morphological features of the imprinted polymer grain were examined under a jeol jsm-5610lv scanning electron microscope (jeol, tokyo, japan). infrared analyses between 400 and 4000 cm of the mip- and nip - imprinted polymer grains were performed in a vertex 70-ir spectrometer (bruke, germany) where kbr was used to prepare the samples. nanosilica was pretreated in order to eliminate any surface contaminants and to activate the surface silanol groups for silanization. in a typical experiment, 15 g silica gel was pretreated by soaking in 10% hcl solution for 8 h and was rinsed thrice by deionized water. active nanosilica was prepared as follows : 10 g of pretreated nanosilica, 300 ml of acetic acid, and 35 ml of ammonia water were added to 140 ml of pure water ; then the mixture was carried out under nitrogen atmosphere at 45c for 1 h with magnetic stirring. after centrifugation at 8000 rpm for 10 min at 4c, the sediment of active nanosilica was obtained and washed thrice with absolute ethyl alcohol, rinsed by deionized water, and then dried in vacuum at 60c before use. dried active nanosilica (5 g), gamma-(methacryloyloxy) propyl trimethoxy silane (20 mmol), and 10 ml absolutely dry toluene were introduced into a conical flask under the atmosphere of nitrogen. at a constant temperature of 90c and with continuous stirring, the reaction was allowed to proceed for 20 h. the particles were then separated from the mixture via centrifugation. the product was washed with toluene for five times and then washed with methanol for five times in order to remove the excessive gamma-(methacryloyloxy) propyl trimethoxy silane. at the end, the obtained gamma-(methacryloyloxy) 1.0 mmol of tolclofos - methyl was dissolved into 40 ml acetonitrile, followed by the addition of 15 mmol of ethylene glycol dimethacrylate (egdma) and 3 mmol g of -methacrylic acid (maa). the mixture was sonicated for 10 min and then degassed for 20 min using nitrogen, and the sealed system was heated in a water bath shaker at 40c for 22 h under nitrogen protection to produce prepolymerization mixture. preparation of initiator solution was carried out by adding 0.09 g of 2,2-azobisisobutyronitrile into 1.5 ml of acetonitrile. molecularly imprinted polymer nanomicrospheres were prepared by synthesis of tolclofos - methyl imprinted polymers on the surface of gamma-(methacryloyloxy) propyl trimethoxy silane nanosilica. 5.0 g of activated gamma-(methacryloyloxy) propyl trimethoxy silane nanosilica was mixed fully with prepolymerization mixture and then 0.5 ml initiator solution was added into this prepolymerization mixture. after the system was degassed for 20 min using nitrogen, the sealed system was heated in a water bath shaker at 60c for 18 h under nitrogen protection to produce polymerized mixture. the obtained polymer nanomicrospheres were washed with methanol - acetic acid (v / v, 9 : 1), methanol, and acetonitrile solution till no template could be detected. and then the solid was dried in vacuum at 40c, resulting in a complex of tolclofos - methyl imprinted polymers with nanosilica. synthesis of nonimprinted polymer microspheres on the surface of nanosilica was carried out in a similar manner but without the addition of template. finally, a small part of the particles of sediment was scanned by jeol jsm-5610lv electron microscope. meanwhile, the added amounts of tolclofos - methyl, maa, and activated nanosilica gel were, respectively, 1.0 mmol, 3.0 mmol, and 5 g among them. but the added amount of crosslinking agent egdma on preparation of mips was set to different adding quantity (3, 6, 9, 12, 15, 18, and 21 mmol). after the seven species of different mips were synthesized, 50 mg microsphere particles of mips were, respectively, weighed in 5 ml test tube, and 1 ml methanol was added to each tube. then, 400 l single standard solutions (25.0 gml) of tolclofos - methyl and 0.2 ml 10% magnesium chloride (mgcl2) were, respectively, added to each test tube. and then this group 's solutions were, respectively, metered volume to 10 ml using methanol and vibrated for 3 h. the liquid was centrifuged at 10000 10 ml acetonitrile- trifluoroacetic acid (99 : 1, v / v) was added to extract sediments by vibrating for 30 min and then the acetonitrile phase was separately filtered and the filtered acetonitrile solution was evaporated to dryness and dissolved in 1.0 ml dichloromethane of chromatographic grade again. the dichloromethane solution was filtered through a 0.22 m membrane and analyzed by gc. 50.0 mg of the mips and nips was placed in vial containing 5 ml of 5.0 gml of four phosphorothioate pesticides in methanol and shaken for 16 h, respectively. then the mips or nips were rapidly removed by a filter with 0.45 m pore size, and the remaining pesticides in obtained solutions were analyzed by gc to get the information about the adsorption kinetics of mips and nips. the adsorption amount (q) of analyte was calculated according to q = (w0 w1)/w, where w0 and w1 (g) are the initial amount and the residual amount of the analyte at different time, respectively, and w (g) is the amount of the polymers. 50 mg microsphere particles of mip were, respectively, weighed in two - group 5 ml test tube (group a and group b), and 1 ml methanol was added to each tube. then, 400 l mixed standard solutions (1.0, 5.0, 10.0, 25.0, 50.0, and 100.0 gml) of four phosphorothioate pesticides and 0.2 ml 10% magnesium chloride (mgcl2) were, respectively, added to each test tube of group a. by contrast, only 400 l mixed standard solutions (1.0, 5.0, 10.0, 25.0, 50.0, and 100.0 gml) of four phosphorothioate pesticides were, respectively, added to each test tube of group b. meanwhile, the procedure same as group a was performed for the nips, which was designated as group c. and then this three - group solution was, respectively, metered volume to 10 ml using methanol and vibrated for 3 h. the liquid was centrifuged at 10000 10 ml acetonitrile- trifluoroacetic acid (99 : 1, v / v) was added to extract the three groups of sediments by vibrating for 30 min ; then the acetonitrile phase was separately filtered and the filtered acetonitrile solution was evaporated to dryness and dissolved in 1.0 ml dichloromethane of chromatographic grade again. the dichloromethane solution was filtered through a 0.22-m membrane and analyzed by gc, and an adsorption curve of the group was drawn. the recognition studies of adsorption capacity were performed with iprobenfos which is the structurally similar compound of the four pesticides. the mixed standard solution of the four pesticides (phoxim, tolclofos - methyl, chlorpyrifos, and parathion - methyl) and iprobenfos, each of 5 mgl, were prepared in 10 ml of the methanol. after the solutions had been centrifuged, the concentrations of the four pesticides and iprobenfos in the supernatants were determined by gc. the same procedure was performed for the nips. in this experiment, after fresh carrot and yacon samples were homogenated through tissue homogenizer, which were collected from supermarket of huazhong agricultural university in wuhan city. an aliquot of 0.2 g of samples was placed in an agate mortar and grounded firmly with the pestle. then, 0.3 g of mips and 0.05 ml 10% magnesium chloride (mgcl2) prepared with pure water were added to the agate mortar. intimate contact between the sorbent and the sample was obtained by pounding with the pestle for some minutes to produce a homogenous packing material for mspd. the homogenized mixture was then added into a 6 ml solid - phase extraction (spe) column, which contained a polyethylene frit at the bottom and compacted by another frit on the top. after being packed for 5 min, 0.3 ml of methanol - water (1 : 2, v / v) and 0.1 ml of 10% magnesium chloride (mgcl2) were added into column ; the column was shelved and incubated for a period of 3 h at room temperature. then, the column was rinsed with 5.0 ml of methanol - water (1 : 9, v / v) and eluted with 6.0 ml of acetonitrile - trifluoroacetic acid (99 : 1, v / v). the eluent was then evaporated to dryness under nitrogen and dissolved in 1.0 ml dichloromethane of for further gc analysis. to test the accuracy of the mip - gc method, the samples of blank carrot and yacon were, respectively, spiked with standard substance of four phosphorothioate pesticides, which all were collected from farmland of huazhong agricultural university. prior to spiking, the blank carrot and yacon were ensured to be free of the four phosphorothioate pesticides. briefly, 0.01 ml of mixed standard solution (0.01 and 0.05 mgl) containing 0.1 and 0.5 ng of phosphorothioate pesticides in acetonitrile were added into 0.2 g of homogenated blank carrot and yacon sample, respectively. after being incubated for a period of 1.0 h, the spiked samples were extracted and cleaned according to the above sample preparation procedure. in addition, as a comparison with mips, 100 mg commercial n - ethylenediamine propyl silane was also used as dispersant of mspd to clean and enrich the above four pesticides in blank carrot and yacon samples by above same spiked sample procedure. an adequate molar ratio of template to functional monomer is essential to successful imprinting. in most cases, the molar ratio of template to functional monomer could be approximately set from 1 : 3 to 1 : 5 (the molar ratio was at 1 : 3 in this experiment). -methacrylic acid was selected as the functional monomer because it is favorable for hydrogen bond or ionic bond interaction in the porogen prior to polymerization. a stable complex between the template and functional monomer was formed in the imprinting process. the effect of added amount of crosslinking agent egdma on adsorption amount of mips towards template molecule tolclofos - methyl was investigated with different adding quantity. and the added amounts of tolclofos - methyl, maa, and activated nanosilica gel were, respectively, 1.0 mmol, 3.0 mmol, and 5 g among them. as is shown in figure 1, the adsorption capacity reached maximum value at 15 mmol of the amount of crosslinking agent (egdma) ; furthermore, the adsorption capacity increased at the start with the growth in the amount of crosslinking agent and decreased after maximum value. the phenomenon might be attributed to following reason ; mip formed at start had been only poor mechanical strength and chemical stability due to the dosage of cross - linking agent. at the same time, too little dosage of cross - linking agent might cause deficiency of quantity of the three - dimensional cavity structure, but too much dosage of cross - linking agent might lead to too tight mips network structure. it might make its accessibility of recognized site to get weak ; therefore, it might make mip nanomicrospheres not easily to spread and to result in the decrease of the adsorption capacity of imprinting molecule. under the optimized synthesis conditions, this method is simple and fast, yielding polymers that can be used as extracted sorbents in matrix solid - phase dispersion. figure 2 shows the environment and morphology of the synthesized polymers, which have a lacunose structure. the morphology and size were characterized by scanning electronic microscopy (sem) with a jeol jsm-5610lv scanning electronic microscope. the picture shows that the number of cavities of nip nanomicrospheres (figure 2(a)) seems to be far less than that of mip nanomicrospheres (figure 2(b)). furthermore, the surface of nip microspheres also seems to be smoother than that of mip nanomicrospheres. figure 2(c) indicates that the resulting imprinted polymer nanomicrospheres were monodisperse and showed a uniform spherical morphology with a diameter of about 200 nm. ir spectra (figure 3(b)) and spectra (figure 3(c)), respectively, represent nip microspheres and gamma-(methacryloyloxy) propyl trimethoxy silane - silicon dioxide (sio2) microspheres. the mip and nip molecularly imprinted polymers were washed with methanol / acetic acid (90 : 10, v / v), methanol, and acetonitrile solution. as shown in figure 3, for the ft - ir spectra of the imprinted and nonimprinted polymers in figure 3(a) (mip) and figure 3(b) (nip), the features around 3595 cm indicate a oh vibration. this shift can be attributed to the reaction of the oh group of -methacrylic acid. for the imprinted polymers in figure 3(a), furthermore, for the ft - ir spectra of imprinted polymers in figure 3(a) (mip), the strong features around 1713 cm indicate the presence of a p = s bond, and the shift in the position of this stretch can be attributed to the hydrophobic interaction between the p = s group of tolclofos - methyl and the oh group of -methacrylic acid. these results demonstrate that tolclofos - methyl had been reacted with -methacrylic acid and that nanomicrosphere polymers had been synthesized. the ft - ir spectra of the imprinted and nonimprinted polymers after extraction are similar, indicating that the template molecule was completely removed from the imprinted polymers. in figures 3(b) and 3(c), the features around 1100 cm and 476 cm were evidently observed in the ft - ir spectra of the nonimprinted polymers and gamma-(methacryloyloxy) propyl trimethoxy silane - silicon dioxide (sio2) microspheres, indicating a si o vibration, while these features were almost unobservable in imprinted polymers (figure 3(a)), suggesting that tolclofos - methyl had been successfully imprinted in polymeric nanomicrospheres. furthermore, the two characteristic peaks in 1713 cm and 2436 cm of figure 3(a) are all evidently stronger than those of figures 3(b) and 3(c), suggesting that tolclofos - methyl was successfully imprinted into the surface of nanosilica. therefore, the two characteristic peaks of nanosilica were observably weakened and decreased in figures 3(b) and 3(c). to investigate the adsorption kinetics of mips and nips, equilibrium time it can be seen from figure 4 that the amount of four pesticides adsorbed onto mips increased with longer hours and nearly reached saturation state within 3.0 h, as well as the nips. the high adsorption rate within 3.0 h might result from the prior and efficient adsorption of recognition sites at the surface of mips, and the adsorption equilibrium of the polymers towards pesticides could be achieved in 3.0 h. thus, the adsorption time was set for 3.0 h in the following adsorption capacity and selectivity experiments. the isothermal adsorptions of the imprinted and no - imprinted polymer nanomicrospheres are plotted in figure 5. the data show that the adsorption capacity of molecularly imprinted or nonimprinted polymer nanomicrospheres increased together with the raise of the initial concentrations of the four phosphorothioate pesticides. however, the imprinted polymer nanomicrospheres exhibited a stronger memory function and a higher adsorption capacity for the four phosphorothioate pesticides than the nonimprinted polymers. the adsorption capacity of the imprinted polymer (173.2 gg) was about 3.4-fold that of the nonimprinted polymer (51.3 gg) at a 4 mgl concentration of template tolclofos - methyl (figures 5(a) and 5(h) ; table 1). the adsorption capacity of the imprinted polymer (143.5 gg) was about 2.5-fold that of the nonimprinted polymer (57.7 gg) at a 4 mgl concentration of chlorpyrifos (figures 5(c) and 5(e) ; table 1). the static adsorption capacity of molecularly imprinted nanomicrospheres toward the four phosphorothioate pesticides was approximately twice to triple that of the nonimprinted polymers. furthermore, the adsorption capacity of the molecularly imprinted nanomicrospheres towards tolclofos - methyl was maximal in the four phosphorothioate pesticides because tolclofos - methyl was used as the template. in addition, the adsorption capacity of the molecularly imprinted nanomicrospheres towards chlorpyrifos was the minimum in the four phosphorothioate pesticides owing to the maximal relative molecular mass of chlorpyrifos compared with other three pesticides. the results reveal that molecularly imprinted nanomicrospheres of tolclofos - methyl have a higher adsorption capacity and selectivity for the four kinds of phosphorothioate pesticides than nonimprinted polymers. furthermore, as shown in figure 5, the diversity of adsorbance of the mips for the four pesticides (a, b, c, and d) was more evident than that of nips for the four pesticides (e, f, g, and h), implying that the selectivity of mips is evidently better than that of nips for the four pesticides. in addition, magnesium chloride was used in determination of the adsorbance of mips and nips for the four pesticides at group a and group c. by contrast, magnesium chloride was not added at group b. then, the adsorbance of three groups was shown in table 1. it was very evident contrast that adsorbance of a group seems to be consistently one - third higher than that of group b because of the effect of magnesium chloride. the results suggest that magnesium chloride can improve the adsorbance of imprinted polymer nanomicrospheres remarkably in pretreatment program of samples. that magnesium chloride can facilitate the extraction (adsorption) of the analytes may be due to that magnesium chloride can decrease the solubility of phosphorothioate pesticides in the solvent and increase the activity of mips. the structurally similar compound iprobenfos was used as a typical species that compared with representational four pesticides (phoxim, tolclofos - methyl, chlorpyrifos, and parathion - methyl) in a recognition study. the distribution coefficient (kd), the selectivity coefficient of the sorbent (k), and the relative selectivity coefficient (k) were obtained in these comparative experiments (table 2). kd indicates the affinity of the sorbent for a particular substance ; k indicates how selective the sorbent is for one of the substances when it is exposed to several substances ; k indicates how selective a sorbent is for a particular substance when compared with the selectivity of a different sorbent and q means the adsorbance value of specific binding sites of the imprinted polymers. these factors were calculated using (1)kd = cicfvscfmp, k = kd (each one of four pesticides)kd (iprobenfos),k=kimprintedknonimprinted, q=cvsmp (c = cf - nonimprintedcf - imprinted),where ci and cf represent the initial and final concentrations of the each pesticide adsorbed ; vs represents volume of solution. mp represents mass of polymer ; c represent the different value of each pesticide 's final concentrations of the mips and nips. the tolclofos - methyl imprinted polymer adsorbed twice to fourfold as much four pesticides as iprobenfos. the k (every one of four pesticides / iprobenfos) values of the imprinted polymer sorbent were between 0.8 and 2.2 in 5 mgl, which were evidently larger than that of the nip sorbent (0.5~1.1). the results show that the imprinted polymer sorbents of tolclofos - methyl have a higher selectivity and q value for four pesticides than for iprobenfos, which is structurally very similar to the four pesticides. the k value was greater than 1, which showed that the mip sorbent had a higher selectivity than the nip sorbent. as expected, iprobenfos was retained to some extent in the active centers of mips, but not in a quantitative way and the repeatability was poor. there were specific and nonspecific binding sites in the mips, but in the nips there were only nonspecific binding sites. it is also obvious that the specific recognition sites are mainly complementary to the template in terms of size and shape. furthermore, the kd, k, k, and q values of tolclofos - methyl were highest among the four pesticides due to being used as template molecule ; at the same time, the kd, k, k, and q values of chlorpyrifos were lowest among the four pesticides owing to being maximal relative molecular mass. the analytical figures presented in this method for the simultaneous determination of four phosphorothioate pesticides were estimated under optimal conditions. this study defined the lowest concentration used in the calibration curve, 10 ngg, to be the limit of detection (lod) for each pesticide. detection limits were verified by injection of the samples prepared at 10 ngg to ensure that discernible peaks had a signal - to - noise ratio 3. the results indicated that the limit of detection (lod) (s / n = 3) of this method for the four phosphorothioate pesticides was in the range of 0.012~0.026 ngg (table 3). as shown in figure 6(a), the four target compounds were entirely separated by agilent db-35ms column (30 m 320 m, 0.25 m). furthermore, the linear ranges of the calibration graph were all between 0.05 and 17.0 ngg (r > 0.9971). at present, only several relevant literatures have been reported [30, 31 ]. for instance, some scholars such as wang. made use of homemade fiber and gas chromatography to develop a method for the determination of five organophosphorous pesticides in pakchoi samples in 2008, which indicated that the lod of methyl parathion was 0.05 ngg. this lod value is observably higher than that (0.012 ngg) of parathion - methyl in this paper. and linearity range of this literature was also more narrow than that of this paper, which showed that the linearity range of parathion - methyl was 0.6~60 ngg. this range is observably higher and narrower than that (0.05~10 ngg) of parathion - methyl in this paper. employed capillary gas chromatography - mass spectrometry and flame photometric detection to build a method for the determination of organophosphorus pesticides in ginseng root in 2007. by contrast, the lod of pesticides in their study was 5~500 ngg, which is also obviously higher than the lod of pesticides in this experiment. therefore, the method of using gc technique and condition can evidently cut down the lod value of the determinand, which obviously improves the sensitivity of the method and decreases the cost of determination. and linearity range of the method was also obviously broadened owing to novel sample pretreatment and gc technique. to evaluate the applicability of the this method, the selectivity and enrichment of mip matrix solid - phase dispersion and n - ethylenediamine propyl silane matrix solid - phase dispersion were compared by the spiking of four phosphorothioate pesticides at the levels of 0.5 and 2.5 ngg in the food samples ; and then the spiked samples were extracted and analyzed (figures 6(b) and 6(c)). the results show that the traditional method of n - ethylenediamine propyl silane matrix solid - phase dispersion has good concentration effect but poor selectivity for the four phosphorothioate pesticides (figure 6(b)). therefore, the enrichments of phoxim, tolclofos - methyl, chlorpyrifos, and parathion - methyl were almost the same when the traditional adsorbent was used (figure 6(b)). by contrast, the imprinted matrix solid - phase dispersion (figure 6(c)) shows a better concentration effect and selectivity for the four phosphorothioate pesticides than the traditional n - ethylenediamine propyl silane matrix solid - phase dispersion. these results clearly indicate that imprinted polymers are more suitable to be used as matrix solid - phase dispersants for the scientific separation and extraction of pesticides. for each concentration, five replicate measurements were performed, and good recovery rates between 85.4 and 105.6% were obtained by mips when mips were used for extracting pesticides in carrot and yacon (tables 4~5). the recovery precision (rsd) for five replicate extractions of the spiked samples was less than 9.6%. by contrast, low recovery rates between 63.0 and 87.6% were obtained when n - ethylenediamine propyl silane was used for extracting pesticides in carrot. the obtained results suggest that mip is better than n - ethylenediamine propyl silane for extracting pesticides in carrot and yacon sample. furthermore, there was an interference peak to be glued to target peak 2 (figure 6(b)), which already affected results of accurate calculation of the target peak 2 (parathion - methyl). the developed method was then applied for the extraction and determination of four pesticide residues in actual carrot and yacon samples (figures 6(d), 6(e) and tables 4, 5). parathion - methyl was not found in the carrot and yacon samples, indicating that this pesticide may not be widely applied in crop cultivation. chlorpyrifos in yacon was quantitatively detected at a level of 1.26 ngg due to its wide application in planting, and phoxim in carrot was quantitatively detected at a level of 0.83 ngg. moreover, tolclofos - methyl was also, respectively, detected at two levels of 0.69 ngg in the carrot samples and 0.47 ngg in the yacon samples (tables 4 and 5 ; figures 6(d) and 6(e)). and all these detected values have not exceeded maximum residue limit (mrl) of the food of japan and korea. furthermore, compared with the published methods for the determination of organophosphorous pesticides in food, this developed method has easier popularization, less time consumption, lower lod value, better linearity range, and easier peak identification. thus, this method can facilitate the effective and efficient analysis of the phosphorothioate pesticides in food such as carrot and yacon samples. an efficient method with high sensitivity, namely, molecularly imprinted matrix solid - phase dispersion coupled with gc, was developed for the rapid extraction and determination of four phosphorothioate organophosphorus pesticides in carrot and yacon. under the optimized conditions, a high extraction efficiency was obtained for the four pesticides with low lods (0.012~0.026 ngg). meanwhile, a good linearity of phosphorothioate pesticides was observed in a range of 0.05~17.0 ngg, and the spiked recovery rates at two spiked levels were in a range of 85.4105.6%. this method will provide a new tool for the rapid determination of multipesticide residues in the complicated food samples, which will facilitate the studies of food safety concerning carrot and yacon. | an efficient, rapid, and selective method for sample pretreatment, namely, molecularly imprinted matrix solid - phase dispersion (mi - mspd) coupled with gas chromatography (gc), was developed for the rapid isolation of four phosphorothioate organophosphorus pesticides (tolclofos - methyl, phoxim, chlorpyrifos, and parathion - methyl) from carrot and yacon samples. new molecularly imprinted polymer nanomicrospheres were synthesized by using typical structural analogue tolclofos - methyl as a dummy template via surface grafting polymerization on nanosilica. then, these four pesticides in carrot and yacon were extracted and adsorbed using the imprinted nanomicrospheres and further determined by gas chromatography. under the optimized conditions, a good linearity of four pesticides was obtained in a range of 0.0517.0 ngg1 with r varying from 0.9971 to 0.9996, and the detection limit of the method was 0.012~0.026 ngg1 in carrot and yacon samples. the recovery rates at two spiked levels were in the range of 85.4105.6% with rsd 9.6%. the presented mi - mspd method combined the advantages of mspd for allowing the extraction, dispersion, and homogenization in two steps and the advantages of mips for high affinity and selectivity towards four phosphorothioate pesticides, which could be applied to the determination of pesticide residues in complicated vegetal samples. |
the complex mechanism of pathogenesis for chronic subdural hematoma (csdh) involves repetitive microhemorrhages from the neomembranes, inflammatory processes in the neomembranes, local hyperfibrinolysis, and cerebrospinal fluid (csf) leakage into the subdural space6,9,15,17,22,27,30,33). as a result, many coagulofibrinolytic factors, inflammatory cytokines, angiogenic growth factors, and highly specific proteins for csf [beta - trace protein (tp) ] have been associated with csdhs5,10,12,17,25,34), and some studies have suggested that various types of csdhs, as observed on ct, are associated with coagulofibrinolytic factors, inflammatory cytokines, and angiogenic growth factors5,12,19,23,24,25,26). mri of csdhs provides more precise information about the localization, extent, and mass effect of a hematoma on adjacent structures. and, mri findings of csdhs are attributed to many factors including the age of the hematoma, the presences of rehemorrhage, and the hematocrit status in csdhs11). however, there have been no reports to date on correlations between mri findings and biomolecules in the csdh. the purpose of this study was to measure the levels of interleukin-6 (il-6) and interleukin-8 (il-8), as typical inflammatory cytokines in patients with a csdh and correlate these markers with mri signal intensity. in addition, we measured the concentration of tp in the subdural hematoma and investigated whether csf admixture to the csdhs influenced mri findings. between january and december 2013, 48 consecutive patients had been admitted to our institute for surgical management of csdh. of these, 17 patients with the following risk factors were excluded from this study : long - term use of thrombolytics, anticoagulants, or anti - inflammatroy therapy or hemodialysis (n=12) ; concomitant infection, inflammatory, hematological or neoplastic disorders, liver dysfunction, dementia, coagulopathy, or diabetes mellitus (n=2) ; presence of a ventriculoperitoneal shunt for hydrocephalus (n=3). the remaining 31 patients were enrolled in this prospective study and provided written informed consent to participate in the study. imaging was performed on high spiral ct systems and on 1.5 tesla mr scanners before burr hole drainage. on the basis of ct scanning, the csdhs were classified into 2 groups, a homogenous group and a heterogenous group, according to the classification system suggested by park.25) (fig. 1). mri of the csdhs was classified into 4 groups, according to signal intensity suggested by senturk.29) : low, iso, high signal, and mixed intensity. then we subdivided the four groups into two different groups : a hyperintense group and a non - hyperintense group (fig. the subdural hematoma sample was obtained through the dura mater with a disposable plastic syringe via a burr hole before the dural incision. all samples were collected into siliconized vaccum tubes containing protamine sulfate and ethylenediamine tetraacetic acid and were immediately centrifuged at 2500 to 3000 rpm for 10 minutes. concentrations of il-6 and il-8 in the subdural fluid and venous blood were measured with an elisa kit (r&d system co, minneapolis, mn, usa ; dilution 1 : 100) using monoclonal antibodies. the tp is a marker highly specific for csf, and more than 99% of the tp is produced by the choroid plexus in the central nervous system, and is obtained in the csf. the tp concentration in csf is 32 to 35 times higher than the tp concentration in the serum (tpser)1,28). samples of subdural fluid with a tp concentration in the subdural fluid (tpsf) at least twice as high as the tpser (tpsf/tpser>2, corresponding to a rate of at least 5% csf in the subdural fluid) were considered indicative of the presence of csf in the subdural fluid. if the ratio of tpsf/tpser in the subdural fluid was 2, corresponding to a rate of at least 5% csf in the subdural fluid) were considered indicative of the presence of csf in the subdural fluid. if the ratio of tpsf/tpser in the subdural fluid was 2 in 100% of the patients with a csdh. we compared the concentrations and ratio between the groups for ct and mri, respectively (table 3). in the t1-wi mri, the mean concentrations of il-6 and il-8 for the hyperintense group (n=18) were 3975.11040.8 pg / ml and 6873.26365.4 pg / ml, respectively, whereas those for the non - hyperintense group (n=13) were 2173.51042.1 pg / ml and 2851.26267.5 pg / ml. for t1-wi mri, the mean concentrations of il-6 and il-8 for the hyperintense group were significantly higher than the non - hyperintense group, respectively (p 2 in 100% of the patients with a csdh. we compared the concentrations and ratio between the groups for ct and mri, respectively (table 3). in the t1-wi mri, the mean concentrations of il-6 and il-8 for the hyperintense group (n=18) were 3975.11040.8 pg / ml and 6873.26365.4 pg / ml, respectively, whereas those for the non - hyperintense group (n=13) were 2173.51042.1 pg / ml and 2851.26267.5 pg / ml. for t1-wi mri, the mean concentrations of il-6 and il-8 for the hyperintense group were significantly higher than the non - hyperintense group, respectively (p2 corresponded to a rate of at least 5% csf in the subdural fluid, and that this was considered indicative of the presence of csf in the subdural fluid. and, they reported that csf was present in the subdural fluid in the vast majority (62 of 67 patients ; 93%) of patients with csdh, and that the concentration of tp reflected the amount of csf present. although the mechanism of csf leakage (and its component tp) into the subdural space in csdhs remains unknown, two hypotheses were suggested in the literature : 1) csf (and its component tp) enters the subdural space of csdh through the arachnoid tear that acts as a valve2,18,31,32) and 2) csf (and its component tp) crosses the inner membrane of the csdh into the subdural space by diffusion / exudation6,20). in the majority of cases, a csdh appears hyperintense on t2-wi because blood degradation products, especially methemoglobin, appear hyperintense on such images16). however, our study demonstrated that the mean concentration of tpsf and the ratio of tpsf/tpser in the t2-wi mri hyperintense group were significantly higher than in the non - hyperintense group, and indicated more csf admixture to the csdhs in the t2-wi mri hyperintense group. therefore, the higher subdural concentrations of tp and the higher ratio of tpsf/tpser may provide good markers for csdhs for the hyperintense group on t2-wi mri, and csf admixture to the csdhs may provide another possibility for the t2-wi mri hyperintensity for csdhs. in the present study, we did not conduct a comparative study between patients with and without a recurrence, because the recurrent cases (9.7%) were fairly low. in future, a prospective study is needed to evaluate the relationship between prognostic markers and the recurrence rate based on the mri findings. in this paper, the subdural concentrations of il-6 and il-8 in csdhs were relatively higher in the t1-wi mri hyperintense group compared to the non - hyperintense group, and we suggested that the subdural concentrations of il-6 and il-8 in csdhs may be a marker for the hyperintense group on t1-wi mri, corresponding to a likely probability of recent rebleeding. additionally, the subdural concentration of tpsf and the ratio of tpsf/tpser in csdhs were relatively higher in the t2-wi mri hyperintense group compared to the non - hyperintense group, and reflected more csf admixture to the csdh. therefore, csf admixture to the csdhs may provide another possibility for the t2-wi mri hyperintensity for csdhs. | objectivemagnetic resonance imaging (mri) of chronic subdural hematoma (csdh) detects various patterns, which can be attributed to many factors. the purpose of this study was to measure the level of interleukin-6 (il-6), interleukin-8 (il-8), and highly specific protein [beta - trace protein (tp) ] for cerebrospinal fluid (csf) in csdhs, and correlate the levels of these markers with the mri findings.methodsthirty one patients, treated surgically for csdh, were divided on the basis of mri findings into hyperintense and non - hyperintense groups. the concentrations of il-6, il-8, and tp in the subdural fluid and serum were measured. the tp was considered to indicate an admixture of csf to the subdural fluid if tp in the subdural fluid (tpsf)/tp in the serum (tpser)>2.resultsthe mean concentrations of il-6 and il-8 of the hyperintense group (n=17) of t1-wi mri were 3975.11040.8 pg / ml and 6873.26365.4 pg / ml, whereas them of the non - hyperintense group (n=14) were 2173.51042.1 pg / ml and 2851.26267.5 pg / ml (p<0.001 and p=0.004). the mean concentrations of tpsf and the ratio of tpsf/tpser of the hyperintense group (n=13) of t2-wi mri were 7.32.9 mg / l and 12.65.4, whereas them of the non - hyperintense group (n=18) were 4.32.3 mg / l and 7.53.9 (p=0.011 and p=0.011).conclusionthe hyperintense group on t1-wi mri of csdhs exhibited higher concentrations of il-6 and il-8 than non - hyperintense group. and, the hyperintese group on t2-wi mri exhibited higher concentrations of tpsf and the ratio of tpsf/tpser than non - hyperintense group. these findings appear to be associated with rebleeding and csf admixture in the csdhs. |
understanding caries etiology and its progression has been made easy with concomitant advances in science and technology. however, although most of the population in developing countries live in indigence, it is must for the clinician to develop rapid, inexpensive and yet effective methods for caries control and progress. this article provides an insight of how a simple oral rinse test can be used for detection of caries activity. in a period marked by brilliant achievements in the prevention and treatment of disease, dental caries still remains one of the most widely spread afflictions in human populations. dental caries is one of the most prevalent infectious diseases and for practical purposes it can be considered ubiquitous in civilized population. the dental caries prevalence in the child population is increasing at an alarming rate, the prevalence varying from 33.7% to 90%. furthermore, the inequalities in the distribution of dental care in rural and urban areas correlate well with the difference found in caries prevalence for the respective populations. given the harsh realities of the maldistribution of resources and variations in individual susceptibility, dental caries is not about to become another extinct disease. dental caries gets established in the mouth long before it becomes clinically manifested in the form of visible lesions. this means it should be possible to assess the seriousness of the caries in a patient or in a population. particularly, during the past 10 - 15 years, there has been a surge of interest in this issue. this appears to reflect recent advances in our knowledge of the etiology of dental caries, the potential promise of certain risk factors or combinations thereof for caries prediction. there should be incessant desire to prevent rather than to treat dental caries, but at the same time the increasing need of cost containment should be understood. even though, dental caries is known to be a multifactorial disease process, the vast number of caries susceptibility tests developed so far is based on the microbiological aspects of dental caries. caries activity can generally be defined as the occurrence and the rate at which, teeth are destroyed by acid produced by the plaque bacteria. a good caries activity test should possess at least three characteristics, i.e. validity, reliability and feasibility. it is very difficult to measure all the factors responsible for caries using one caries activity test. hence until date, the ideal method to evaluate caries activity in terms of sensitivity, specificity and reliability has not been found. currently, there are many caries activity test kits available in the market, e.g. dentocult sm, mucount, gc saliva buffer check etc., unfortunately, many of these caries activity tests require extensive work - up time and special equipments. in developing countries simple, inexpensive and quick techniques, which do not demand sophisticated skills or consume a substantial amount of chair - side time, are required for the caries activity tests. however, very few studies have been reported regarding their sensitivity and specificity to assess caries risk. in this study, an attempt has been made to explore the co - relation of simple oral rinse technique (oratest) with the other caries activity tests in children. this study was carried out in the department of pedodontics and preventive dentistry in association with the college of microbiology. a total of 120 healthy school going children of both sexes falling in the age group of 6 - 8 years were selected by randomized sample technique. out of 120 children, 30 caries free children were randomly selected through a survey carried out in a public school, pimpri. an informed consent was obtained from the child 's parents / guardians for the subjects who were fulfilling the inclusion criteria. care was taken to ensure ethical protection of human subjects at all stages of the study. all the necessary ethical guidelines were followed as prescribed by the institutional ethical committee in accordance with the central ethics committee on human research, india. age group = 6 - 8 yearsgingival (le and sillness) index = 0plaque index = 0 (for the control group)abstaining from intake of any food / drink (except water) 90 min prior to the tests. age group = 6 - 8 years gingival (le and sillness) index = 0 plaque index = 0 (for the control group) abstaining from intake of any food / drink (except water) 90 min prior to the tests. all the participating subjects received a thorough oral examination using a mouth mirror and world health organization (who) probe in adequate illumination. the decayed, missing and filled teeth (dmft / dmft) were recorded as per who criteria. all the subjects were divided into two groups according to their dmft / dmft scores. group i : control group (dmft / dmft = 0) : 30 subjects. group ii : test group (dmft / dmft > 0) : 90 subjects. the test group was further subdivided into 3 subgroups : sub - group a : (dmft / dmft = 1 - 5) : 30 subjects sub - group b : (dmft / dmft = 6 - 10) : 30 subjects sub - group c : (dmft / dmft = 11 - 18) : 30 subjects. all the subjects were taken for the study only after a gap of 90 min after the last intake of food or drink. prepared snyder 's test medium was melted in the microcentrifuge tubes, which were then kept in hot water bath at 50c. the child was made to sit comfortably on the dental chair in an erect position. after swallowing the pre - existing saliva in the oral cavity, a standardized piece of gum base (1 g) was given to the child. the stimulated saliva secreted in the subsequent 3 min was collected while the child chewed on the same block of gum base. the child was made to spit and drool in a disposable sterile cup held near the mouth. by means of a sterile disposable syringe, 1 ml aliquot of collected saliva was removed from the measuring cup and injected in a previously labeled sterile test tube containing 4 ml of transport medium. after the addition of saliva into the medium, tube was rotated for proper mixing of saliva and the medium. the observations for color change were made every 24 h for a period of 72 h. the rate of color change of snyder 's medium from green to yellow is indicative of caries activity. the interpretation of snyder 's test observation was made according to following : oratest was carried out in the same patients after the collection of salivary sample for the microbiological method [figure 1 ]. materials for oratest each patient was given 10 ml of ultra - high temperature sterilized cow milk in a beaker and asked to rinse the mouth vigorously for 30 s. the expectorate was collected in the same beaker and 3 ml of this was aspirated with the help of a disposable syringe. 0.12 ml of 0.1% methylene blue was added to a sterile screw cap test tube the expectorate was transferred to the test tube and thoroughly mixed. it was placed on a stand in a well - illuminated area over a mirror at room temperature. test tubes were observed every 10 min for color change at the bottom, which would easily be discernible in the mirror. time taken for initial color change within a 6 mm diameter circle on the bottom of the test tube was recorded [figure 2 ]. color change at bottom of test tubes a total volume of 10 l of the vortexed sample was streaked in duplicate on msb agar selective for mutans streptococci. age group = 6 - 8 yearsgingival (le and sillness) index = 0plaque index = 0 (for the control group)abstaining from intake of any food / drink (except water) 90 min prior to the tests. age group = 6 - 8 years gingival (le and sillness) index = 0 plaque index = 0 (for the control group) abstaining from intake of any food / drink (except water) 90 min prior to the tests. all the participating subjects received a thorough oral examination using a mouth mirror and world health organization (who) probe in adequate illumination. the decayed, missing and filled teeth (dmft / dmft) were recorded as per who criteria. all the subjects were divided into two groups according to their dmft / dmft scores. group i : control group (dmft / dmft = 0) : 30 subjects. group ii : test group (dmft / dmft > 0) : 90 subjects. the test group was further subdivided into 3 subgroups : sub - group a : (dmft / dmft = 1 - 5) : 30 subjects sub - group b : (dmft / dmft = 6 - 10) : 30 subjects sub - group c : (dmft / dmft = 11 - 18) : 30 subjects. all the subjects were taken for the study only after a gap of 90 min after the last intake of food or drink. prepared snyder 's test medium was melted in the microcentrifuge tubes, which were then kept in hot water bath at 50c. the child was made to sit comfortably on the dental chair in an erect position. after swallowing the pre - existing saliva in the oral cavity, a standardized piece of gum base (1 g) was given to the child. the stimulated saliva secreted in the subsequent 3 min was collected while the child chewed on the same block of gum base. the child was made to spit and drool in a disposable sterile cup held near the mouth. by means of a sterile disposable syringe, 1 ml aliquot of collected saliva was removed from the measuring cup and injected in a previously labeled sterile test tube containing 4 ml of transport medium. after the addition of saliva into the medium, tube was rotated for proper mixing of saliva and the medium. the observations for color change were made every 24 h for a period of 72 h. the rate of color change of snyder 's medium from green to yellow is indicative of caries activity. oratest was carried out in the same patients after the collection of salivary sample for the microbiological method [figure 1 ]. materials for oratest each patient was given 10 ml of ultra - high temperature sterilized cow milk in a beaker and asked to rinse the mouth vigorously for 30 s. the expectorate was collected in the same beaker and 3 ml of this was aspirated with the help of a disposable syringe. 0.12 ml of 0.1% methylene blue was added to a sterile screw cap test tube the expectorate was transferred to the test tube and thoroughly mixed. it was placed on a stand in a well - illuminated area over a mirror at room temperature. test tubes were observed every 10 min for color change at the bottom, which would easily be discernible in the mirror. time taken for initial color change within a 6 mm diameter circle on the bottom of the test tube was recorded [figure 2 ]. a total volume of 10 l of the vortexed sample was streaked in duplicate on msb agar selective for mutans streptococci. the oratest time in the control group had shown a range of 200 - 305 min and in test groups shown a range of 24 - 200 min. a statistically significant difference revealed with the mean oratest scores revealed a statistically significant difference (p < 0.001) between the control and individual test groups. the oratest time observed in the control group was significantly higher than the individual test groups [table 1 ]. mean values of oratest and s. mutans count for control and test groups a statistically significant difference obtained with the mean of salivary s. mutans count between control and individual tests groups [table 1 ]. the modal values of snyder 's caries activity test for the control group, sub - group a, sub - group b and sub - group c was found to be negative, slight, moderate and moderate respectively [graph 1 ]. results for snyder 's caries activity tests chi - square test results showed a statistically high significant difference (p < 0.001) between the snyder 's test results of control and individual test groups. pearson 's correlation analysis revealed, the s. mutans count in a statistically significant negative linear relationship with oratest time [table 2 ]. pearson 's correlation analysis of s. mutans count and oratest time for control and test groups all test groups computed together the oratest time (min) was found to be in a statistically highly significant negative linear relationship with existing caries status. thus, oratest time was found to have a significant negative linear relationship with salivary s. mutans colony count and deft / dmft of the individual [graph 2 ]. an overview of changes in dental caries confers a global decline in dmft levels of individuals. thanks to the 20 century which has given tremendous knowledge in the understanding of oral diseases and possibilities for preventing and treating these diseases. however, this knowledge can not be put into action in a developing country like india due to financial constraints and lack of man power. in a country where 70% population inhabits the villages (consensus 2001), the dentist : population ratio is 1:35,000 and only one out of five dentists return back to the rural area to serve, prevention of caries will be a more viable option than rendering restorative treatment. in the existing situation in india, the cost involved in assessing the high risk group by s. mutans test and other methods in indian situation is so high that it can not become a routine procedure in the near future. western methods for caries prevention as such will not be successful here and they need to be modified to suit the local needs and habits. there is an acute need for simple, robust, inexpensive equipments for use in rural surroundings. hence, this study was designed to evaluate the caries susceptibility of children using a non - invasive, simple and inexpensive oratest and to compare it with two other caries activity tests. in comparison with the sole use of any one caries activity test, the combination of the information of different parameters has been shown to increase the power in caries prediction. in this study both the subjective and objective evaluation has been carried out for each subject and then compared with each other. the caries process is initiated by activity within the biofilm and manifested in the underlying enamel or dentin. in the present study, the mean although in test groups, it ranged from 1.4 10 cfu / ml to 1.76 10 cfu / ml of saliva. similar results were also been observed by loesche. and by straetemans. lactobacilli being acidogenic as well as aciduric possesses a strong potential to demineralize enamel surfaces. significant relation between lactobacilli and caries experience was shown by crossner, holbrook, kingman. and zickert. a simple colorimetric test, i.e. snyder 's test was developed for practicing dentist to serve as a valuable aid in detection of lactobacilli. the snyder 's test measures the rapidity of acid formation when a sample of stimulated saliva is inoculated into glucose agar adjusted to ph 4.7 - 5 and with bromocresol green as color indicator. overall distribution of snyder 's test results in the present study [graph 1 ] correlated well with the existing caries status of individual. such relation had also been supported by ali ya. in a study carried out by ramesh. sensitivity of snyder 's test was found to be 87.5% along with positive predictive value of 18.9%. specificity of 18.9% was obtained with negative predictive value of 87.5% in caries free individuals. however, 100% sensitivity was shown in children with caries. there have been two main schools of thoughts on the role of plaque bacteria in the etiology of caries and periodontal disease. the specific plaque hypothesis proposed that, out of the diverse collection of organisms comprising the resident plaque microflora, only a few species are actively involved in disease. in contrast, the non - specific plaque hypothesis considered that disease is the outcome of the overall activity of the total plaque microflora. in this way more recently, an alternative hypothesis ecological plaque hypothesis has been proposed, which stated that plaque - mediated diseases are as a consequence of imbalances in the resident microflora. oratest, a whole mouth rinse test in this regard provides a pooled sample of microbiota of oral cavity. thus, the principle of oratest is congruent with philip marsh 's ecological plaque hypothesis proposed in early 1990s. in young plaques, streptococci usually predominate, but other organisms such as neisseria and actinomyces species may also play a role in the initial development of plaque. as the plaque matures during 7 - 14 days, the rods and filaments increase proportionally. the changes in the morphological forms of the plaque flora have been attributed to changing metabolic and environmental conditions within the plaque over time. the degree of anaerobiosis of plaque is reflected in its redox potential (eh). the eh of early developing plaque is about + 200 mv, which is similar to aerobically metabolizing tissue. oxygen depletion by aerobic plaque micro - organisms is a prerequisite for the development and progression of anaerobic growth conditions. oratest is based on the rate of oxygen depletion by the microorganisms in expectorated milk samples. once oxygen gets utilized by aerobic micro - organisms, methylene blue acts as electron acceptor and gets reduced to leucomethylene blue reflecting the metabolic activity of the aerobic organisms. in some of the previous studies strong correlations, saxsena. have suggested that oratest can be used as chair - side caries activity test. but the literature about its comparative evaluation with other caries activity tests seems to be lacking. hence, in the present study for the 1 time oratest has been compared with qualitative and quantitative characteristics of cariogenic bacteria. milk is used in this study because it acts as a suitable liquid for dislodging micro - organisms and provides an excellent medium for subsequent metabolism. moreover, milk being white in color, make it easier to detect the earliest color change from blue to white at the base of test tube, i.e. methylene blue to leucomethylene blue. nearly 1% of methylene blue was used in the present study as suggested by desai. and since, there is no oxygen in the methylene blue molecule ; the reduction of this dye involves transference of hydrogen. the corresponding metabolism, which occurs will be a reaction which supplies energy for the growth of the organisms. sensitivity is defined as the ability of a test to detect the presence of a disease in patients with the disease, while specificity is the ability of a test to detect the absence of a disease in patients without the disease. the oratest by virtue of its simplicity and high degree of sensitivity could be used to screen patients for dental caries. however, the lack of specificity of the oratest can mean that a high number of false positive readings occurred. some of the false positive results for the oratest and s. mutans count could be explained by the presence of interproximal caries that was not diagnosed clinically. in both cases, the number of false positive results would be reduced if radiographs were exposed to detect interproximal caries. since, larger sample size and proposed use of oratest at community level, however, dmft / dmft score was used as useful predictor of caries. higher levels of cariogenic organisms and higher plaque values in high risk group may have resulted into shortest oratest time. thus, in context to the observations of the present study and of earlier studies it is supported that oratest can be used as one of the tool to estimate caries activity and oral microbial level. simple, inexpensive, non - invasive, less time consuming, reproducible and required no trained personnelcan be used to monitor mouth - rinse programs, denture hygiene and gingival inflammation and plaque levelscan be used as good educational and motivational tool for patients, school and community dental health programsvehicle of the test (milk) is non - toxic and readily accepted by young patientscan be used to identify high risk population groupsresults can provide the dentist to command the patients to reinforce motivation, plaque control and behavior. simple, inexpensive, non - invasive, less time consuming, reproducible and required no trained personnel can be used to monitor mouth - rinse programs, denture hygiene and gingival inflammation and plaque levels can be used as good educational and motivational tool for patients, school and community dental health programs vehicle of the test (milk) is non - toxic and readily accepted by young patients can be used to identify high risk population groups results can provide the dentist to command the patients to reinforce motivation, plaque control and behavior. it does not identify a specific group of organism in a specific diseaseit can not accurately differentiate between the healthy state and carrier state and also between initial and progressive carious lesionit does not approach dental caries in a holistic manner like other caries activity testslack of specificity gives false positive results as positive observations can be obtained in patients with gingival disease and other oral ailments. it does not identify a specific group of organism in a specific disease it can not accurately differentiate between the healthy state and carrier state and also between initial and progressive carious lesion it does not approach dental caries in a holistic manner like other caries activity tests lack of specificity gives false positive results as positive observations can be obtained in patients with gingival disease and other oral ailments. simple, inexpensive, non - invasive, less time consuming, reproducible and required no trained personnelcan be used to monitor mouth - rinse programs, denture hygiene and gingival inflammation and plaque levelscan be used as good educational and motivational tool for patients, school and community dental health programsvehicle of the test (milk) is non - toxic and readily accepted by young patientscan be used to identify high risk population groupsresults can provide the dentist to command the patients to reinforce motivation, plaque control and behavior. simple, inexpensive, non - invasive, less time consuming, reproducible and required no trained personnel can be used to monitor mouth - rinse programs, denture hygiene and gingival inflammation and plaque levels can be used as good educational and motivational tool for patients, school and community dental health programs vehicle of the test (milk) is non - toxic and readily accepted by young patients can be used to identify high risk population groups results can provide the dentist to command the patients to reinforce motivation, plaque control and behavior. it does not identify a specific group of organism in a specific diseaseit can not accurately differentiate between the healthy state and carrier state and also between initial and progressive carious lesionit does not approach dental caries in a holistic manner like other caries activity testslack of specificity gives false positive results as positive observations can be obtained in patients with gingival disease and other oral ailments. it does not identify a specific group of organism in a specific disease it can not accurately differentiate between the healthy state and carrier state and also between initial and progressive carious lesion it does not approach dental caries in a holistic manner like other caries activity tests lack of specificity gives false positive results as positive observations can be obtained in patients with gingival disease and other oral ailments. oratest is proven to be a simple, inexpensive and a rapid technique for assessment of caries activity according to present study. we believe that this method will be useful, both at the individual level and community level, in an attempt to identify groups of persons with an increased risk to develop caries. in the earlier study carried out by cardash., patients were supplied with denture hygiene kits consisting of plastic test tubes containing 0.12 ml of methylene blue and plastic pipettes. if such oral hygiene kits made available to children, then it might be possible for parents to monitor oral hygiene. performance of the test prior to the treatment session not only makes the waiting period interesting for the child, but also test results can provide the dentist with something to comment upon either to reinforce motivation and plaque control or to reinforce a positive behavior. | aim : evaluation and co - relation of the caries susceptibility using oratest, colorimetric snyder 's test and salivary streptococcus mutans count amongst children in the age group of 6 - 8 years.materials and methods : a total of 120 healthy children were grouped into control and test groups according to their dmft / dmft scores. snyder 's test, salivary s. mutans count and oratest were performed for each individual.results:the relationship of three caries activity tests with each other and with existing caries status was found out.conclusion and clinical implications : the present study has shown that oratest has a definite clinical relationship with caries status and microbiological relationship with s. mutans count of the individual. |
chronic kidney disease (ckd) blunts erythropoietin production, a proanemic effect that is compounded by other factors such as accelerated erythrocyte destruction and widespread use of concomitant medication such as ace inhibitors and arbs. following transplantation, the prevalence of anemia declines sharply as renal function is restored but low hemoglobin (hb) levels persist in a worryingly large proportion of cases due to multiple factors such as suboptimal renal function, cardiovascular medication, and certain immunosuppressive therapies [4, 5 ]. in the largest series to date, an analysis of 5,834 kidney transplant recipients at 10 european outpatient transplant clinics detected anemia in 42% of patients based on the american society of transplantation anemia guidelines (hb 13.0 g / dl in males and 12.0 g / dl in females). using the same thresholds, large single - center cohort studies have found that 3035% of kidney transplant patients have anemia [79 ]. in nontransplant ckd populations, anemia is predictive of cardiovascular events, mortality [11, 12 ], and diminished quality of life. posttransplant anemia is significantly associated with increased death - censored [14, 15 ] and all - cause [9, 16, 17 ] graft loss, probably cardiovascular events and possibly mortality [1619 ], although causative relationships are not certain and anemia may be a marker for other pathologic processes. posttransplant anemia remains undertreated. in 2003, the transplant european survey on anemia management (tresam) analyzed a cohort of 4,263 patients from 72 centers in 17 countries and found that only 18% of patients with hb 2 g / dl, any occurrence of pure red cell aplasia or production of anti - epoetin antibodies was to be handled as serious adverse drug reactions of special interest. data were recorded by study investigators on printed forms and checked at the participating center for completeness, and then entered independently to a database by an independent research organization (m.a.r.c.o. gmbh & co kg, 40227 dsseldorf, germany) which was also responsible for clarifying discrepancies on the submitted forms. the main efficacy variable was the proportion of patients (responders) achieving an hb concentration of 11 - 12 g / dl at each of visits 7, 8, and 9, that is, after a 79 month period for c.e.r.a., the proportion of patients within each of these two hb ranges was also calculated for the periods covering months 7 to 12 and months 7 to 15. in additional prespecified analyses, the proportion of patients within the hb ranges 1012, 1013 g / dl and 1113 g / dl were also calculated for each of these time periods. the sample size calculation showed that a total of 300 patients were required, based on a maximum responder rate of 85%, a mean accuracy (mean confidence interval width) of 5%, a drop - out rate of approximately 30%, and a significance level of 5%. efficacy analyses were performed in the efficacy population, defined as all patients who provided at least one measurement of hb concentration and received at least one dose of c.e.r.a. during months 79 of the study, did not receive any esa therapy other than c.e.r.a. during the study, met the inclusion / exclusion criteria as confirmed in writing by the investigator, and did not have other major protocol violations. safety analyses were performed on all patients who received at least one dose of c.e.r.a. for patients therapy was terminated before the end of the observation period, data were analyzed to the point of discontinuation. the efficacy population included 193 patients, with exclusion most frequently due to absence of c.e.r.a. dosing and/or a missing hb concentration during months 79. in total, 186 patients in the efficacy population completed month 9 and 138 completed month 15. ninety - four patients discontinued the study prematurely (figure 1) and 49 stopped c.e.r.a. other frequent reasons were the requirement to start dialysis (n = 22) and administration of another esa (n = 17) (figure 1). the mean age was approximately 51 years, and approximately half the patients were male (table 1). the mean (sd) egfr was 35.3 (16.6) ml / min/1.73 m. data on immunosuppressive therapy was available for only 43/279 patients (15.4%), including mycophenolic acid (n = 24), an mtor inhibitor (n = 18), and a calcineurin inhibitor (n = 22). iron deficiency, defined as serum ferritin 13 g / dl. at months 7, 9, and 15, respectively, 9.9% (14/142), 10.6% (15/142), and 8.6% (9/105) had an hb level 13 g / dl. at all times points during the study, no more than 15% of patients had an hb level 13 g / dl. during the prespecified evaluation period (visits 79), 20.7% of patients (40/193) had all hb values within the range 11 - 12 g / dl, increasing to 64.8% for the wider range of 1013 g / dl (table 3). as would be expected, the proportion of patients with all hb within target ranges declined as the period was extended to months 712 and 715 (table 3). the mean (sd) deviation in hb values from the intraindividual mean was 0.50 (0.6) g / dl during the evaluation period (visit 79), 1.0 (0.6) g / dl for the period visits 712, and 1.2 (0.6) g / dl for the period visits 715. during the evaluation period, the majority of patients (87.0%) showed a mean deviation of 1 g / dl in hb values from the intraindividual mean (table 4). in total, 55 patients (19.7%) reported a total of 178 adverse events during the study. these included headache in two patients (0.7%) and hypertension in three patients (1.1%) (see supplementary table 1 in supplementary material available online at http://dx.doi.org/10.1155/2014/179705). ten adverse events in seven patients (2.5%) were considered by the investigator to be possibly, probably, or definitely related to c.e.r.a. these were hemolytic anemia, pancytopenia, thrombocytopenia, angina pectoris, unstable angina, deep vein thrombosis, hypertension (three patients), and injection site pain. serious adverse events were reported in 32 patients (11.5%), with four out of 59 events having at least a possible relation with c.e.r.a. (angina pectoris, unstable angina, deep vein thrombosis, and hypertension in one patient each). treatment was discontinued in three patients due to adverse events (hypertension ; bone marrow depression ; pancytopenia with hemolytic anemia) and in four patients due to serious adverse events (dialysis ; sepsis with pneumonia, hemodialysis and renal failure ; hypertension with angina pectoris ; decreased hemoglobin with increased crp). there were four deaths during the study, none of which had a suspected relation with c.e.r.a. mean (sd) egfr remained unchanged during the study (study entry, 35.3 [16.6 ] ml / min/1.73 m ; month 15, 34.4 [19.8 ] ml / min/1.73 m). no consistent pattern of change in serum ferritin concentration or tsat was observed over the study period. abnormal erythrocyte counts, as identified by the physician as a clinical deviation from the normal, were reported in 46.7% of patients at the prestudy visit, 24.4% at visit 9, and 23.8% at visit 15. no difference in the rates of clinically significant abnormalities for leukocyte or thrombocyte counts was observed during the study versus prestudy. other laboratory values including crp, vitamin b12, and liver enzymes showed no clinically relevant changes during the study. mean blood pressure remained unchanged from baseline (132/77 mmhg) to month 15 (130/77 mmhg). in this observational study of maintenance kidney transplant patients with stable graft function, c.e.r.a. administered once a month according to local practice achieved a high degree of hb stability. the main efficacy variable, hb concentration of 11 - 12 g / dl at each of the visits at months 7, 8, and 9, was achieved by 20.7% of patients. during the evaluation period, the intrapatient hb level varied by no more than 1 g / dl in 87% of patients. applications of 34 days and with patients self - administering at least some injections in 90% of cases. moreover, initiation in the subgroup of patients who were esa - nave at study entry, mean hb remained stable throughout the 15-month observation period. the finding that one in five patients maintained an hb concentration in the range 11 - 12 g / dl at months 7, 8, and 9 was consistent with the results of observational studies of c.e.r.a. these have reported hb levels within the 11 - 12 g / dl window at all three evaluation visits in 15.6% and 18.4% of patients, respectively. these findings should be interpreted against the background of a naturally high degree of hb variability in patients with ckd [39, 40 ]. indeed, it has been shown that the mean within - patient variability is greater than 1 g / dl in ckd patients receiving esa therapy [40, 41 ]. comparisons of hb stability between the current results and randomized trials of esa therapies are not clinically relevant since this observational study applied no exclusion criteria for hb cycling prior to inclusion, in contrast to controlled trials which have typically excluded patients with hb fluctuation > 1 g / dl during screening [34, 4244 ]. one previous study, anemiatrans, has examined the use of c.e.r.a. in kidney transplant recipients. anemiatrans was a retrospective, multicenter study which included both de novo patients (n = 32) and maintenance patients (n = 286). as in the current study, the majority of maintenance patients were converted from another esa therapy to c.e.r.a. hb levels were monitored for six months from the time of conversion, and consistent with our results, the proportion of patients within the target hb range of 1113 g / dl was similar at baseline and at month 6. in the majority of converted patients (52.5%), hb level fluctuated by less than 1 g / dl between baseline and month 6. dose at month 6 (93 g) was remarkably similar to that used in our population (95.1 g). the kidney disease : improving global outcomes (kdigo) guidelines for the care of kidney transplant recipients recommend that anemia in kidney transplant patients should be monitored and treated in the same way as patients with ckd. regular monitoring of hb levels is mandatory for all recipients, but certain subpopulations are at particular risk of anemia. as in the nontransplant population, poor renal function is the strongest predictor [1, 4, 6 ], but low iron stores [1, 4, 6 ], probably female gender [4, 6, 47 ], increasing recipient age [4, 6, 33 ], donor age, poor nutrition, and chronic inflammation also appear to contribute, exacerbated by frequent use of renin - angiotensin - aldosterone system inhibitors [3, 46 ]. the risk of anemia following transplantation is compounded by immunosuppression with mtor inhibitors [46, 4951 ] or mycophenolic acid [46, 52, 53 ], although this effect is less marked in the presence of higher gfr. modification of the immunosuppressive regimen to ameliorate anemia should be considered but may be difficult, so management focuses on esa and iron therapy after exclusion of other causes. a more cautious approach to excess esa dosing has been adopted since randomized trials in ckd populations indicated an increased risk of stroke and venous thromboembolism when esa therapy is used to target high hb levels [2224 ], especially in relatively unresponsive patients [55, 56 ]. in kidney transplantation, a large retrospective study has demonstrated that reaching an hb level of 14.0 g / dl during esa therapy is associated with increased mortality compared to 12.5 g / dl. in the current study, fewer than 15% of patients had an hb level > 13 g / dl at any time point during c.e.r.a. the recent kdigo clinical practice guideline for anemia in chronic kidney disease advises that iron deficiency should be addressed prior to initiation of esa therapy. in our cohort of patients, the documented use of iron supplementation was low (21.5%), but unfortunately medication reporting and the assessment of iron status seem unlikely to have been comprehensive or fell outside the prespecified windows for study visits. for example, immunosuppressive agents were listed by investigators in only 15% of patients, another clear limitation of the study. serum ferritin levels, however, indicated the presence of low iron stores in many patients with available data, with median values consistently below the lower recommended limit of 100 ng / ml. additionally, approximately 25% of patients were below the recommended minimum tsat level of 20%, a level frequently considered to represent functional iron deficiency. while data are incomplete, it appears that iron indices are not routinely monitored or managed at all centers. thus, our observational study has identified some marked areas of concern where there is room for improvement in patient management, upon which future studies should focus. adverse events and serious events judged by the investigator to have at least a possible relation to c.e.r.a. were reported in 2.5% and 1.4% of patients, respectively. taking into account the comorbidities and multiple concomitant medications given to kidney transplant patients, it is difficult to accurately assign causality to a specific drug. of the expected adverse events listed in the summary of product characteristics for c.e.r.a., only headache (0.70%) and hypertension (1.10%) were observed, with hypertension contributing to discontinuation in two cases. there were no hematological or biochemical concerns. an observational study design was chosen to document real - world outcomes when patients were selected for c.e.r.a. therapy and managed according to local center practice at a large number of transplant centers. randomized trials in dialysis - dependent and nondialysis ckd populations have previously shown hb control to be similar with once - month c.e.r.a. versus more frequent dosing with epoetin or darbepoetin [43, 58, 59 ], therefore a control arm was not included. it is important to point out that it was neither the aim of this study to demonstrate the efficacy of c.e.r.a., which is already well documented, nor was the goal to compare efficacy between different esa therapies. use in transplanted patients in a real - life setting, which could be used for the development of future interventional trials in this population. our observational study results provide a basis for future interventional trials of esa therapy in this population. given the presence of inadequate iron stores in a substantial proportion of patients future observational studies could benefit from a protocol - stipulated iron supplementation. this observational study provides an insight into the use of c.e.r.a. therapy to treat anemia under real - life conditions in a population of stable kidney transplant patients with minimal selection criteria. once - monthly administration, largely self - administered, achieved stable hb levels with few dose medications and good tolerability. a once - monthly regimen for esa therapy may be particularly attractive to transplant recipients who no longer have to attend frequent hemodialysis sessions and are keen to return to a normal lifestyle. | in a multicenter, prospective, observational study of 279 kidney transplant recipients with anemia, the efficacy and safety of once - monthly continuous erythropoietin receptor activator (c.e.r.a.) were assessed to a maximum of 15 months. the main efficacy variable was the proportion of patients achieving a hemoglobin level of 11 - 12 g / dl at each of visits between months 7 and 9. at study entry, 224 patients (80.3%) were receiving erythropoiesis stimulating agent (esa) therapy including darbepoetin alfa (98), epoetin beta (61), and c.e.r.a. (45). the mean (sd) time between c.e.r.a. applications was 34.0 (11.9) days. among 193 patients for whom efficacy data were available, mean (sd) hemoglobin was 11.1 (0.99) g / dl at study entry, 11.5 (1.1) g / dl at month 7, 11.6 (1.3) g / dl at month 9, and 11.4 (1.1) g / dl at month 15. during months 79, 20.7% of patients had all hemoglobin values within the range 11 - 12 g / dl and 64.8% were within 1013 g / dl. seven patients (2.5%) discontinued c.e.r.a. due to adverse events or serious adverse events. in this observational trial under real - life conditions, once - monthly c.e.r.a. therapy achieved stable hemoglobin levels in stable kidney transplant recipients with good tolerability, and with no requirement for any dose change in 43% of patients. |
identifikacija, kvantifikacija i tipizacija m - proteina (mp) imaju vanu ulogu u dijagnostikovanju, klasifikovanju i praenju monoklonskih gamapatija kako malignog (npr. prethodni do - kazi pokazuju da monoklonska gamapatija neodrelenog znaaja (mgnz) koja se otkriva elektroforezom na agaroznom gelu i m a prevalenciju od 3,2% u optoj populaciji. kapilarna elektroforeza je izvrena da bi se utvrdila prevalencija m - proteina (mp) kod 44.474 uzastopnih klinikih pacijenata svih uzrasta kod kojih je u toku dve godine (2008. kod ispitanika starijih od 50 godina (23.408, tj. 52,6% ukupnog broja) mp 30 g / l (mgnz) identifikovan je u 6,0% sluajeva, sa gotovo dva puta veom uestalou nego to je prethodno procenjeno. populacija je zatim podeljena na starosne grupe raspona po deset godina : grupa 7180 imala je najveci procenat mp (29%), a slede grupe 6170 (27%), 5160 (18%), 8190 (12%), 4150 (8%), 3140 (3%), > 90 (2%) i 3.5 (3, 4). early identification and typing of mgus is therefore of utmost clinical importance, because no definite proof of whether or not it will evolve towards myeloma has been provided so far. recent studies showed that the three predisposing conditions can efficiently predict the risk of progression. twenty years after a diagnosis of mgus the risk of malignancy is 58% in patients with all three risk factors, 37% in patients with two risk factors, 21% in patients with a single risk factor and 5% in patients with no risk factors, respectively. therefore, this classification is an effective approach to identify patients with the highest progression risk towards multiple myeloma or a related malignant disease, who would benefit from tailored treatments. moreover, 20 years after the first identification of mgus, patients with mp > 25 g / l have a progression risk 4.6-fold higher compared to those with mp lower than 5 patients with igm mp, and to a greater extent those with iga mp have a higher progression risk towards multiple myeloma than those with igg mp. the estimation of flcr has been successfully used in the past few years to assess progression risk, wherein patients with an abnormal flcr carry a significantly higher risk than those with a normal ratio (2). therefore, in the absence of tests for differential diagnosis between mgus and the malignant forms, the most effective strategy is to monitor the evolution of the monoclonal gammopathy over time, along with the above - mentioned factors and the crab criteria. previous evidence attests that mgus detected by agarose gel electrophoresis has an overall prevalence of 3.2% in the general population (2). therefore, this study aimed to verify these data by means of capillary zone electrophoresis (cze). cze technique was used to estimate the prevalence of monoclonal components in all consecutive outpatients referred to the department of laboratory medicine of the treviglio hospital (bg - italy) over a 2-year period (i.e., between january 2008 and december 2009) with a prescription for serum protein electrophoresis. the analysis of data was carried out in the year 2012, after obtaining approval from the hospital ethics committee, in accord with the declaration of helsinki and under the terms of relevant local legislation. the analysis was arbitrarily limited to the outpatient population since the prevalence of mp is greater in hospitalised patients (i.e., the percentage of mgus can be as high as 6.1% in hospitalised patients aged over 50) (2). moreover, the presence of mp in hospitalised patients is frequently associated with a variety of disorders. blood samples were collected according to standard laboratory procedures (iso 9001:2008 certified and accredited according to the international joint commission standards) from fasting patients. specifically, blood was drawn in primary blood tubes with no separator gel or additives, centrifuged and processed within 4 hours from collection. all the mps were typed by immunofixation electrophoresis on agarose gel (ife) using the hydrasys instrument (sebia). a database was created for each subject, containing blood sampling date, date of birth, sex, barcode identification, total protein concentration, electrophoresis performed by using the cze technique, comment on the electrophoretic pattern, mp concentration, mp type, ife scan, along with values of igg, iga and igm, presence or absence of bence jones protein in urine (ife urine, sebia), presence of cryoglobulinemia or rheumatoid factors. overall, the population cohort consisted of 44,474 outpatients of all ages examined during the 2-year period of the study, 1,606 of whom with the presence of an mp (3.6% ; 1.85% males and 1.76% females ; median age 69 years). g / l (i.e., mgus) was detected in 6.0% (95% confidence interval, 5.76.3%) of subjects aged over 50 years (23,408/44,474, i.e., 52.6% of the total study population) while the frequency of mp < 30 g / l was much lower (i.e., 0.8%) in those aged 50 or younger (21,066, i.e., 47.4% of the total study population). in all subjects in whom mp was detected, the frequency of mgus was 98.4%, with a median concentration of 4 the presence of mgus was identified in 733/10,304 men and 677/13,104 women (7.1% vs. 5.2% ; p<0.001) (table i). after stratification of the entire population into 10-year age groups, the highest frequency of mp was found in the 7180 age group (29%), followed by the 6170 group (27%), the 5160 group (18%), the 8190 group (12%), the 4150 group (8%), the 3140 group (3%), those aged 91 or older (2%) and, finally, those aged 30 or younger (1%). interestingly, the frequency of mp in each age group was found to be higher in males than in females until the age of 80. after this age, the male to female ratio was inverted, with a greater prevalence in women (figure 1). the frequency of mp types (ife) was virtually overlapping in each age group, with igg kappa being the most frequent class (i.e., igg kappa 40.8%, igg lambda 25.3%, igm kappa 12.9%, iga kappa 8.1%, iga lambda 7.4%, igm lambda 4.5%, kappa free 0.5%, lambda free 0.5%) (figure 2). the values of mp were found to be similar in each group, but exhibited an incremental trend in parallel with ageing. the bence jones protein was measured in 710/1,410 outpatients with mgus aged 50 or older, and was found to be positive in 228 cases (32%), 153 of whom were positive for kappa free (67.1%) and 75 for lambda free (32.9%), respectively. mgus prevalence (6.0%) according to age group and sex among outpatients referred to the department of laboratory medicine of the treviglio hospital (bg - italy). the percentage was calculated as the number of patients with mgus divided by the number of those who were tested. mgus prevalence in outpatients population aged over 50 (6.0%).the outpatients have been divided into decades and gender [(males (m) and females (f) ] and compared to all the outpatients aged over 50. the mps have been divided into decades (others include the percentage of kappa and lambda free). the identification of mps is very frequent around the globe, and it is now considered as one of the most prevalent conditions in people aged 50 years or older. the available data on the prevalence of mp in the general population were almost solely based on the agarose gel technique, whereas little information has been obtained using more sensitive techniques, such as cze. in the present study, the frequency of mp in a general population of subjects aged 50 years or older was as high as 6.0%, thus being almost twice that reported by kyle., this data is probably attributable to the greater sensitivity of the cze used in our study compared to the agarose gel technique previously employed by kyle. we have also observed that the prevalence of mgus in all subjects in whom mp could be identified was as high as 98.4%, thus confirming by means of a highly sensitive technique such as cze that the incidence of this condition considerably increases with ageing (i.e., the median age of mgus patients was 69 years in our study population). it is also noteworthy, however, that mgus could also be identified at earlier ages, since the youngest patient with mgus was 25 years old. due to the importance of identifying and monitoring mgus patients, the results of our population study seemingly attest that the advantage of the higher sensitivity compared to conventional agarose gel electrophoresis would make it the preferable mean to detect and quantify mp, notwithstanding some methodological problems that remain, including an ameliorable analytical variability in total protein measurement and the still unmet accuracy of the peak boundaries positioning (1). indeed, the laboratory should also provide interpretative comments in the laboratory report, to assist the specialist in patient management. the primary clinical objective is to establish whether or not the serum protein pattern is suggestive of a mp, and then to assess its concentration and biochemical characteristics. it is hence noteworthy that the patient should be followed using an identical method and, preferably, by the same laboratory. the laboratory report should also be informative about the progress of disease, thus including data about complete, almost complete, partial, ongoing or stable remission. in conclusion, the results of this population study support the concept that routine identification of mp should be carried out in all patients aged 50 years or older by using an analytically sensitive technique, such as the cze was proven to be (8). in particular, the high prevalence of mgus found in our investigation provides valuable information to general practitioners, because the identification of even small mp allowed by cze (i.e., analytical sensitivity as low as 0.5 g / l) may be effective for achieving an early and accurate diagnosis, as well as in the follow - up and clinical management of patients (910). | summarybackgroundidentification, quantification and typing of m - proteins (mp) play an important role in the diagnosis, classification and monitoring of monoclonal gammopathies both of malignant origin (eg. multiple myeloma) and of unknown origin. previous evidence attests that mgus (monoclonal gammopathy of undetermined significance) detected by agarose gel electrophoresis has a prevalence of 3.2% in the general population. therefore, our study aimed to verify this data by means of capillary zone electrophoresis (cze).methodscze was performed to evaluate the prevalence of m - protein (mp) in 44.474 consecutive outpatients of all ages with a prescription for serum protein electrophoresis over a 2-year period (2008 and 2009). all mps that were identified were then typed by immunofixation electrophoresis on agarose gel (ife).resultsin subjects aged over 50 (23.408, i.e., 52.6% of the whole cohort) mp 30 g / l (mgus) was identified in 6.0% of cases, with a frequency nearly double than that previously reported. the population was then divided into ten - year age groups : the 7180 age group had the highest percentage of mp (29%), followed by 6170 (27%), 5160 (18%), 8190 (12%), 4150 (8%), 3140 (3%), > 90 (2%) and < 30 (1%). the frequency of mp types (ife) was the same in each age group, with igg kappa being the most represented class.conclusionsaccording to the high mgus prevalence observed in this study, these results may be useful especially for general practitioners, because the identification even of small mp (analytical sensitivity : 0.5 g / l) may help optimize clinical management. |
in the distant past due to the absence of adhesive restorative materials, it was necessary to remove sound tooth structure just to make room for the restoration. now - a - days the main aim of restoring a decayed tooth is to reinforce by preserving as much tooth structure as possible by limiting the extent of cavity preparation by removing only affected dentin. due to better understanding of caries process and improved knowledge of the function of fluoride, it is possible to retain some of the demineralized enamel and dentin and allowing it to heal through remineralization. even though the rotary method of caries removal is widely accepted and quick technique, it is often associated with excessive cutting of uninfected dentin, pain, discomfort, noise, and fear. hence, the quest for removal of caries with minimal pain and more tissue preservation has given rise to various alternative caries removal techniques. this includes air abrasion, atraumatic restorative therapy, chemo - mechanical system, and lasers.[14 ] chemo mechanical caries removal (cmcr) method is a non - invasive technique which eliminates infected tissues, preserving healthy structures, avoiding pulp irritation and patient discomfort. papacrie introduced in 2003 has claimed to preserve healthy dental tissue with benefits of minimal discomfort, antibacterial, and anti - inflammatory effects. this study was carried out to compare the clinical efficacy of a cmcr product in reducing cariogenic flora, duration of caries removal, the amount of tooth loss, child 's behavioral assessment before, during and after procedure, pain perception, and preference of treatment in comparison with the conventional method. the study sample consisted of 60 primary molars from 30 children, 2 teeth in each, between 4 and 9 years of age with broad cavitated occlusal lesions not involving the pulp. all patients were treated in the department of pediatric dentistry, sdm school of dentistry, dharwad, india. the study was approved by the institutional review board and informed consent was obtained from the parents. the study samples were divided into group a and b having 30 teeth in each. carious teeth in group a were treated by the conventional airotor method and group b were treated by papacrie. after this, the patient was allowed to settle down for some time before starting the caries excavation to minimize its effect on change in the behavior of child during procedure. the administration of local anesthesia was not done as it would alter the pain perception of the patient. caries excavation in group a was done with help of airotor using a round bur (no., caries excavation was done according to the manufacturer 's instruction using papacrie gel (formulae acao, sao paulo, brazil). after completion of caries removal in each method, healthy dentin samples were collected using a sharp spoon excavator and immediately transferred to thyoglycolate broth for microbiological investigations. the diluted samples were plated on two different agar plates, i.e., rogosa agar plates and chocolate agar plates to determine the lactobacilli counts (lbc) and total bacterial counts (tbc), respectively. the border of the lesion was marked and the greatest diameter of the lesion entrance was measured with a sterile divider (ceto diamond, mumbai, india) and recorded before and after the caries removal in both methods. to minimize bias, inter - examination of the cavities on both occasions was done and the mean was calculated. all the sample teeth were finally restored with miracle mix restorative material (gc corporation tokyo, japan). time taken was recorded for both the procedure with the help of a digital stop watch. the degree of cooperation by the child before, during and after caries removal was evaluated and recorded according to wright 's modified frankl 's behavior rating scale. after completion of the caries removal procedure by each method, the child was interviewed regarding pain or discomfort and the preferred caries removal method. microbial growth was observed in 36.7% of group a samples and 56.7% of group b samples [figure 1 ]. the mean tbc were 0.9 10, 1.15 10 and lbc were 0.35 10, 0.41 10, respectively, for group a and b [figure 2 ]. although the mean tbc and lbc in the conventional method was less than the papacrie method the results were not statistically significant (p = 0.36). gp - growth present, ga - growth absent mean total bacterial count and lactobacilli count in both the groups. tbc - total bacterial count, lbc - lactobacilli count the mean cavity entrance size [figure 3 ] with group a was 0.98133 mm, and group b was 0.26083 mm (p < 0.001). the mean preparation time [figure 4 ] for group a was 280.89 s and group b was 1077.60 s (p < 0.001). mean difference in cavity entrance size in both the groups mean preparation time for both the groups majority of kids of both group a and b scored 3 [figure 5 ] before and after the treatment showing no statistical difference in their behavioral score (p = 1). in group a, 50% of children had no pain, 46.7% had slight, and 3.3% had unspecified pain. in group b, 86.7% of children had no pain, 10% had slight, and 3.3% had unspecified pain [figure 6 ]. there was statistical significance in the number of children who had no pain among the two groups (p = 0.01). considering the preference 36.7% of children preferred conventional method, 60% preferred papacrie, and 3.3% preferred both the methods [figure 7 ]. there was no statistical difference in the preference of treatment (p = 0.12). percentage of children scoring the various behavioral scores before, during and after the treatment in both the groups. 1 - definitely negative, 2 - negative, 3 - positive, 4 - definitely positive percentage of children with different pain perception in both the groups percentage of children preferring each method of treatment new methods of caries removal have always been a major objective for dental researchers seeking possible alternative to existing conventional methods in the field of pediatric dentistry. factors, including speed, pain - free preparation, cost - effectiveness, clinical application, safety and proper conservative cavity preparation for the placement of advanced chemically adhesive restorative material has encouraged research in this field thus inventing new devices for this purpose. among most caries removal methods, the cmcr system has found to be easy, simple and economic, as well as being effective in removing caries. researchers claim the use of this technique for children who are basically anxious for dental treatment is interesting based on its simplicity. in this study, all the cavities were found to be clinically caries - free in both conventional and papacrie methods when observed by the tactile and visual method. the one used by kidd., wherein they reported satisfactory results in assessing the caries - free status of lesion. bussadori., found that after 1 year of clinical and radiographic follow - up ; caries - free teeth with good retention of restoration were found with papacrie method. kidd., used a procedure for taking samples from residual dentin, by round bur of a defined size. in this study, an excavator was chosen to reduce the risk of accidental pulpal exposure, especially when sampling hard dentin, similar to the study done by azrak. and subramaniam. several investigations have shown that often a low number of residual microorganisms (10 - 10 cfu) remains behind in clinically sound hard dentin in spite of a significant reduction in the bacterial count. however, this low level of bacteria is considered to be clinically acceptable by several authors. residual bacteria can not be held solely responsible for occurrence of secondary caries, since individual factors like oral hygiene and dietary habits of the patients also have a profound influence on caries progression. bacterial values were below 10 cfu 's for the streptococci and lbc in hard dentin. according to the chart reasons attributed for increased time taken in papacrie method could be multiple applications needed for complete caries removal, differences in type and size of the cavities, type of teeth and age of the patient. bussadori., observed through scanning electron microscope that in papacrie method, there was more preservation of dentin structure., in this study, the papacrie method was beneficial in preserving more amounts of healthy tooth tissue being minimally invasive., have revealed that the most feared events in dental treatment as ranked by the patients are cavity cutting, induction of anesthesia, and tooth extraction. wright 's modification of frankl 's behavior rating scale in this study were simple, sufficiently sensitive, and easy to record and widely accepted. according to hosey and blinkhorn, frankl 's behavior rating scale showed a significant correlation with the newer scales. in this study, there was deterioration of the behavior from positive to negative during the treatment with the conventional method and after the treatment, there was an improvement in the behavior. however, in papacrie method there was no change in the behavior of children before, during and after the treatment. the study results are in correlation with many others ; wherein they had concluded that cmcr is well suited for dental treatment of anxious patients. but, contradicting to these studies inglehart., found that the subject 's fear of the dentists increased in the cmcr method, while it is slightly decreased in the conventional method. they have attributed this finding to the longer treatment time required for cmcr method. according to ansari., the cmcr method not only prevents anxious patients losing their teeth at an early age, it can also be used successfully when the alternative treatment is under general anesthesia. silva., demonstrated that caries removal using papacarie method is significantly less painful compared to the conventional method. it reduces the risk of pulpal exposure and thereby reduces the damage to healthy tissues, silva., and bussadori.,. anusavice and kincheloe demonstrated that cutting sound dentin often results in some level of pain. in this study, the age of participants limited the possibilities of obtaining a more complete description of the kind of pain felt during the caries excavation. however, the gel itself may have a thermal insulating function as it covers the cavity during the procedure. in addition the method is expected not to open so many dentinal tubules as in drilling. regarding preference, around 60% of the children preferred papacrie method [figure 7 ]. similar studies on carisolv reported that most of the patients prefered cmcr method over the conventional method. contrasting results were reported by maragakis., who claimed that only 31% of pediatric patients preferred cmcr method. it was quicker, it tasted better, and they finished sooner. another study by zinck. the reasons given were that they felt it decreased drilling time, did not cause pain and provided a general feeling of comfort and relaxation. in this study, the children who did not prefer papacrie method gave the reason that it took a longer time than conventional method. thus, the time factor may be crucial for the acceptance of the treatment by some patients, especially children, since it constitutes an important source of discouragement for them. the results from this study indicate that the cmcr method is a safe and effective method for excavation of dentinal caries. as the efficacy of the active gel compared to traditional hand excavation has been documented in vitro, this study showed that the chemo - mechanical method may reduce patient discomfort and decrease unnecessary removal of sound dental tissue. it can be successfully employed to treat medically compromised, bed - ridden patients and in school dental camps. thus, this method seems to be a promising alternative for conventional method of cavity cutting in pediatric dental use. | aims : this study was aimed to determine the effectiveness of papacrie for caries removal as compared to the conventional method with respect to microbial flora, time, the amount of tissue removal, child 's behavior, pain perception, and preference of treatment.materials and methods : sixty primary molars of 30 children of age 4 - 9 years were selected randomly and divided into two groups of 30 teeth each : group a treated by conventional method and group b with papacrie method.results:comparatively, no statistical difference was seen in microbial growth, total bacterial count, and lactobacilli count in both the groups (p = 0.36). the mean cavity entrance size with group a was 0.98133 mm and group b was 0.26083 mm (p < 0.001). the mean preparation time for group a was 4.7 mins (minutes) and group b was 17.96 min s (p < 0.001). majority of kids of both group a and b scored 3 (frankl behavior rating scale) before and after the treatment showing no statistical difference in their behavioral score (p = 1). in group a 50% of children experienced no pain as compared to 86.7% in group b (p = 0.01). there was no statistical difference in the preference of treatment (p = 0.12).conclusion : thus, the chemo mechanical caries removal method can be considered as an effective method to control pain and preserve sound tooth structure during caries excavation. |
knee extension is conducted as a therapeutic exercise for dysfunction of the knee joint and includes passive exercise, active assistive exercise, active exercise, and active resistive exercise1. passive exercise is generally conducted when the results of manual muscle testing of the quadriceps femoris muscles are extremely poor ; active assistive exercise is conducted when the results of the testing are poor ; active exercise is conducted when the results are fair ; and active resistive exercise, in which loads such as weights are applied, is conducted when the results are better than fair. passive exercise involves passively having the lower leg moved against the femur with the knee joint as a fulcrum. on the other hand, active assistive exercise, active exercise, and active resistive exercise are based on the third class lever of the quadriceps femoris muscle as the force, the knee as a fulcrum, and the weight load of the lower leg and foot as the load1. because each type of exercise involves mechanical load being applied to the knee joint, which serves as a fulcrum, it is essential that knee joint motion should be kinematically proper during exercise. the knee joint possesses two degrees freedom : flexion and extension, and the resulting leg rotation. leg rotation is found in the full range of motion of flexion and extension, with leg rotation in the direction of internal rotation accompanying flexion, and leg rotation in the direction of external rotation accompanying extension2,3,4. leg rotation increases in the direction of external rotation in the range from 30 flexion to final extension which is the final phase of extension : this is called the screw - home movement5. the screw - home movement is caused by differences in size between the medial and lateral condyles of the femur, strain in the anterior cruciate ligament, and external traction exerted by the quadriceps femoris muscle against the tibia, and it is important for gaining dynamic stability in the knee joint2. sugawara.6 reported failure of leg rotation in knee osteoarthritis patients, indicating the importance of establishing a method for restoring leg rotation. their findings indicate the importance of leg rotation in knee joint extension as a therapeutic exercise for dysfunction of the knee joint. when leg rotation does not arise from knee joint extension, we must investigate the factors limiting it. we may then conduct knee extension after restoring proper leg rotation by implementing a therapeutic approach for the limiting factors. however, while there have been many reports which have analyzed leg rotation7,8,9,10,11,12,13, there have been few on the causes of the failure of leg rotation and how it might be restored. the hamstring, the antagonist of knee extension, is made up of the semitendinosus muscle, the semimembranosus muscle, and the biceps femoris muscle. the semitendinous muscle and the semimembraneous muscle form the medial hamstring, while the biceps femoris muscle forms the lateral hamstring. both originate in the ischial tuberosity. the medial hamstring muscle fibers attach themselves to the anterior of the medial condyle of the tibia forming the pes anserinus, while the lateral hamstring muscle fibers attach themselves to the posterior surface of the head of the fibula2. as these are bi - articular muscles, knee extension occurs by bringing the origin and insertion of the hamstring together, by reducing the flexion angle of the hip joint with retroversion of the pelvis when the knee is extended in the sitting position. when the flexion angle of the hip joint does not change, the knee is extended while stress is applied to the joint play region within the knee joint, lowering the tibia which is the origin of the hamstring. if the hamstring is stretched from resting length by knee extension when there is reduced extensibility of the hamstring, defensive contraction induced by stretch reflex occurs, inhibiting the knee antagonizing extensors and reducing their activity. this indicates that when hamstring extensibility is reduced during knee extension, the resultant leg rotation may be limited. however, it is not clear whether changes in hamstring extensibility affect leg rotation during knee extension. accordingly, this study was conducted to clarify the effects of hamstring stretching on leg rotation during knee extension. the mean age of the subjects was 20.9 1.4 years, their mean weight was 54.7 10.3 kg and their mean height was 158.3 6.4 cm. subjects consent was obtained after sufficient explanation was given regarding the aim of the study, management of personal information obtained in the study, and the right of the subjects to withdraw from the study at any time if they wished to do so. the study was conducted after obtaining approval from the research ethics committee of meiji university of integrative medicine (authorization number 21 - 88). the muscle hardnesses of the bilateral medial and lateral hamstrings of the subjects were measured. leg rotation with active knee extension was measured using a 3-dimensional motion analysis system, and muscle activities of the knee extensors were measured by the surface electromyograph. for the leg with greater muscle hardness in the medial hamstring, direct stretching was conducted through intervention for the medial and lateral hamstrings (the stretching group). meanwhile the other leg was considered to be at rest (the control group). after the intervention, the same measurements as prior to the intervention were performed, and the results were compared with those of prior to the intervention. we also examined the correlation between changes in muscle hardness of the medial and lateral hamstrings and leg rotation, and muscle hardness of the medial and lateral hamstrings and muscle activities of the knee extensors. muscle hardness was measured by a muscle durometer (axiom biosensor venustron ii, axiom, fukushima, japan). the indenter was placed perpendicularly above the skin at the measurement site using a special arm (fig. the indenter was depressed to a depth of 8 mm, then returned to the starting position. the speed of the indenter was set at 3 mm / sec. the pressure on the indenter at the depth of 8 mm the muscle is hard when the pressure is high, and the muscle is soft when the pressure is low. measurements were taken with 5 degrees of ankle dorsiflexion, 20 degrees of knee flexion, and the hip in the neutral position. a plastic ankle foot orthosis was affixed to both ankles, and a pillow was placed at the distal point of the legs to standardize the positions measured. measurement sites of the medial hamstring were the muscle belly at the midpoint of the ischial tuberosity and medial condyle of the tibia. measurement sites of the lateral hamstring were the muscle belly at the midpoint of the ischial tuberosity and the head of fibula. the measurement sites were marked to ensure the same site was measured before and after the intervention. measurement was done three times at the same site and the mean value was used as the representative value. for measurement of leg rotation at the knee, the subjects wore on tight - fitting leggings and 10 reflective markers were bilaterally placed, 5 on each leg, at the mid - thigh, medial knee joint gap, lateral knee joint gap, medial malleolus, and lateral malleolus. subjects lay supine on a bed with their lower legs hanging down and the femur fixed to the bed by a belt. the tester checked to make sure the subjects soles were not touching the floor. active knee extension with the ankle joint at maximal dorsiflexion was conducted from a starting position of 90 degrees knee flexion to full extension of the knee. subjects movements were recorded after explaining the task orally and confirming it was understood. the positions of the reflective markers were measured using a 3-dimensional motion analysis system (vicon512, oxford metrics, oxford, uk), and knee joint extension angle and leg rotation angle were calculated by software (body builder3.6, oxford metrics, oxford, uk). to ascertain angular variation of the leg rotation angle from the initial position of 90 degree knee flexion, the initial angle was adjusted to 0 degrees internal / external rotation, with displacement in the direction of external rotation shown as positive and displacement in the direction of internal rotation shown as negative. the first phase of extension was defined as going from 90 degrees of knee flexion to 60 degrees of knee flexion, the middle phase from 60 degrees of knee flexion to 30 degrees of knee flexion and the final phase from 30 degrees of knee flexion to full extension. the mean leg rotation angle in each phase was calculated as the representative value of each phase. the difference of the minimum and maximum leg rotation angles generated by knee extension from 90 degrees of flexion to full extension were calculated as the variation in leg rotation angle. the maximum leg rotation angle in the direction of external rotation was calculated as the variation in leg external rotation angle while the maximum leg rotation angle in the direction of internal rotation was calculated as the variation in leg internal rotation angle. before measurement of the muscle activities of the knee extensors, the measurement site was cleaned with an alcohol wipe. then, disposable surface electrodes were attached and muscle activities were measured using surface electromyography (myosystem1200, noraxon u.s.a. inc. the measurement sites of each muscle were as follows : the midpoint between the patellar superior border and anterosuperior iliac spine on the anterior surface of the thigh for the rectus femoris, the lateral surface of the thigh in a five - finger - wide area from the patellar superior border for the vastus lateralis, and a four - finger - wide area from the patellar superior margin for the vastus medialis14. using the measurement results, average rectified value (arv) per second were calculated using an analog - to - digital converter (trias system, dkh, tokyo, japan). at the end of the experiment, the maximal voluntary contraction(mvc) of each muscle was measured. subjects lay supine on a bed with their legs hanging down, and the mvc of each muscle was measured for 5 seconds. arv during active knee extension was divided by arv of mvc to calculate % mvc for each muscle. hamstrings were stretched by direct stretching in which pressure was applied in the direction transverse to the axis of the medial and lateral hamstring per the matsumoto method15, so as not to induce articular movement of the knee. direct stretching was conducted in the prone position, with the hip in the neutral position and the knees extended. the muscles were stretched for 30 seconds in 3 places ; the proximal and distal muscle - tendon junctions of the muscles, and the centers of their muscle bellies. we compared hamstring muscle hardness, leg rotation angle, variation in leg rotation angle, variation in leg external rotation angle, variation in leg internal rotation angle, and % mvc of the rectus femoris, vastus lateralis and vastus medialis between before and after the intervention. the paired t - test was used when normality was established by the kolmogorov - smirnov test. the wilcoxon rank sum test was used when normality was not established. for comparison between the stretching and control groups, the independent t - test was used when the kolmogorov - smirnov test established normality, while the mann - whitney u - test was used when normality was not established. pearson correlation coefficients were calculated to investigate the correlations between muscle hardness variation and variation in leg rotation angle, variation in leg external rotation angle and variation in leg internal rotation angle, and between muscle hardness and variations in the muscle activities of the knee extensors. the data were analyzed using spss 11.0 j for windows and values of p<0.05 were considered statistically significant. p<0.01, significant difference between groups meansd, p<0.05, significant difference between pre- and post - intervention table 1 shows the results for muscle hardness. the hardness values of the medial hamstring in the stretching group were 110.9 24.7 g prior to the intervention, and 83.2 15.8 g after the intervention, a significantly lower value after the intervention (p < 0.01). in the control group, the values were 92.0 19.8 g prior to the intervention, and 95.2 17.5 g after the intervention. the comparison of the groups revealed that the stretching group had a significantly higher mean value than the control group prior to the intervention (p < 0.01), and a significantly lower value than the control group after the intervention (p < 0.01). for the lateral hamstring, in the stretching group, the hardness values were 107.7 25.6 g prior to the intervention and 85.8 14.9 g after the intervention, a significantly lower value after the intervention (p < 0.01). in the control group, the values were 97.3 24.1 g prior to the intervention and 96.6 19.7 g after the intervention. the comparison of the groups revealed the stretching group had a significantly higher mean value than the control group prior to the intervention (p < 0.05), and a significantly lower value than the control group after the intervention (p < 0.01). p<0.05, significant difference between groups table 2 shows the results for leg rotation angle. mean values and standard deviation of leg rotation angle are shown. in the stretching group prior to the intervention, the values were 0.97 1.82 in the first phase, 0.21 4.94 in the middle phase, and 1.99 6.74 in the final phase. after intervention, the values were 1.30 3.31 in the first phase, 1.01 6.34 in the middle phase, and 3.58 7.24 in the final phase. there was a significant increase in external rotation in the final phase following the intervention (p < 0.05). in the control group prior to intervention, the values were 1.53 2.36 in the first phase, 2.12 5.57 in the middle phase, and 4.33 7.12 in the final phase. after the intervention, the values were 1.29 2.16 in the first phase, 1.23 4.83 in the middle phase and 3.93 6.00 in the final phase. p<0.05, significant difference between groups table 3 shows the results for variation in leg rotation angle. mean values and standard deviation of variation in leg rotation angle are shown. in the stretching group, the values were 9.38 4.19 prior to the intervention and 10.72 4.57 after the intervention, a significantly higher value after the intervention (p < 0.05). in the control group, the values were 10.85 4.13 prior to the intervention and 10.01 3.67 after the intervention. the comparison of the groups revealed the stretching group had a significantly lower value than the control group prior to the intervention (p < 0.05), but no significant difference was found after the intervention. mean values and standard deviation of variation in leg external rotation angle are shown. in the stretching group, the values were 5.59 4.57 prior to the intervention and 7.08 5.25 after the intervention, a significantly value for the direction of external rotation after the intervention (p < 0.05). in the control group, the values were 7.94 5.73 prior to the intervention and 7.02 4.66 after the intervention. the comparison of the groups revealed the stretching group had a significantly lower value than the control group prior to the intervention (p < 0.05), no significant difference was found after the intervention. meansd, p<0.01, significant difference between pre- and post - intervention table 5 shows the results for variation in leg internal rotation angle. mean values and standard deviation of variation in leg internal rotation angle are shown. in the stretching group, the values were 3.79 4.16 prior to the intervention and 3.63 4.15 after the intervention. in the control group, the values were 2.91 3.28 prior to the intervention and 2.99 3.59 after the intervention. no significant difference was found between the groups, before or after the intervention. muscle activities of the rectus femoris in the stretching group were 20.6 10.6% prior to the intervention and 25.0 9.5% after the intervention, a significantly higher value after the intervention compared to prior to the intervention (p < 0.01). in the control group, the values were 24.0 12.4% prior to the intervention and 24.7 10.5% after the intervention. muscle activities of the vastus lateralis in the stretching group were 24.8 12.7% prior to the intervention and 30.6 17.7% after the intervention, a significantly higher value after the intervention compared to prior to the intervention (p < 0.01). in the control group, the values were 25.4 12.8% prior to the intervention and 28.1 12.6% after the intervention. muscle activities of the vastus medialis in the stretching group were 24.0 12.4% prior to the intervention and 25.9 13.2% after the intervention. in the control group, the values were 25.8 12.8% prior to the intervention and 25.7 12.8% after the intervention. correlations between variation in muscle hardness and variation in leg rotation angle, variation in leg external rotation angle and variation in leg internal rotation angle are shown in table 7. a moderate positive correlation was found between variation in leg rotation angle and muscle hardness of the lateral hamstring. a moderate positive correlation was found between the variations in leg external rotation angle and muscle hardness of the medial hamstring. correlations between variation in muscle hardness and variations in muscle activities of the knee extensors are shown in table 8. no significant correlations were found between variations in muscle hardness of the medial and lateral hamstrings, and variations in the muscle activities of the rectus femoris, vastus lateralis and vastus medialis. knee extension is often conducted as a therapeutic exercise for knee joint dysfunction, and depending on the remaining muscular strength of the quadriceps femoris muscles active resistive exercise, active exercise, active assistive exercise, or passive exercise is selected1. since each type of motion involves mechanical load being applied to the knee joint, which serves as a fulcrum, it is important that the joint motion of the knee be kinematically proper when knee extension is conducted. in knee thus, in knee extension as a therapeutic exercise for knee joint dysfunction, it is necessary that knee joint motion should be kinematically proper during exercise. however, many studies have analyzed leg rotation7,8,9,10,11,12,13, there have been few studies of the causes of the failure of leg rotation. focusing on the hamstrings, the antagonists of knee extension, whether the extensibility of the hamstring was a limiting factor of leg rotation was investigated by examining the effect of change in the extensibility of the hamstring on leg rotation during knee extension. to do this, leg rotation was measured during knee extension before and after stretching of the hamstring and factors correlating with this, including muscle activities of the knee extensors, were investigated. one method for checking extensibility of the hamstring is the straight leg raise angle. however, as this is a measurement that involves joint motion, it includes changes in the flexibility of the joint in addition to changes in the extensibility of the muscles. since the subject of evaluation in this study was the joint itself, we used a muscle durometer which examines just the hardness of the muscles. the results of the muscle hardness measurements show that the muscle hardness of the stretching group was significantly higher than that of the control group before the intervention, and this is thought to because the selected subjects had higher muscular hardness of the medial hamstring in the initial measurement. muscle hardness of the lateral hamstring on the same side was also significantly higher than that of the control group. muscle hardness can be observed in the body motion in daily activities and in a range of sports. laterality of center of gravity during motion arises since there is laterality and non - laterality in bodily movements, such as bilaterally simultaneous actions like standing - up and squatting, or alternate movement as in walking. thus, laterality arises in muscular activity during motion, and laterality in muscle hardness may also arise without the subject s awareness. from this we can infer that muscle hardness may also have been high in the lateral hamstring of the stretching group which exhibited significantly high muscle hardness of the medial hamstring. straight leg raises are normally used as a method for stretching the hamstring, but the stretching force applied to the hamstring passes through the hip and knee joints in this case and this stretching force may change the flexibility of these joints. in this study we conducted direct stretching, the effects of which have been reported to be measurable by the finger - floor distance16, since it was important that the hamstrings were stretched without affectiong the joints, which were the target of evaluation. as a result of this intervention, muscle hardness was significantly reduced in the medial and lateral hamstrings of the stretching group in which pre - intervention muscle hardness was significantly high. this indicates that the extensibility of the hamstring had increased, with post - intervention active knee extension probably conducted in a state of high extensibility of the hamstring. the causes of leg rotation in the direction of external rotation during knee extension exercises are divided into passive and active factors. in passive exercise, differences in the size of the medial and lateral condyles of the femur and strain in the anterior cruciate ligament act as passive factors. when there is extension from a state of knee flexion, the articular surface of the tibia shifts to the anterior, following the medial and lateral condyle of the femur. however, since the articular facet of the medial condyle of the femur is larger than the articular facet of the lateral condyle of the femur, the anterior migration length of the contact point with the articular surface of the tibia becomes longer in the medial condyle of the femur than in the lateral condyle of the femur. at 90 degrees of flexion, the contact point with the medial condyle of the femur is situated in a more posterior position. subsequently, while these anterior shifts of contact points occur in parallel, leg rotation occurs in the direction of external rotation since the contact point with the medial condyle of the femur shifts more to the anterior than the lateral condyle of the femur from 30 degrees of flexion to full extension. also strain in the anterior cruciate ligament increases with extension, inducing anterior shift of the tibia. this strain reaches its maximum point at full extension, causing traction in the direction of external rotation. in active assistive exercise and active exercise, in addition to the passive factors, external traction against the tibia induced by the muscular strength of the quadriceps femoris muscle when quadriceps femoris knee extension exercises are conducted, the vastus muscle group provides 80% of the work, and the other 20% is provided by the rectus femoris muscle2. the vastus lateralis muscle has the widest cross - sectional area in the vastus muscle group. thus, the traction direction in relation to the patella of the quadriceps femoris muscle generally tends to be in the external direction, causing traction in the direction of external rotation in leg rotation. limiting factors in leg external rotation may include deformation of the medial and lateral condyles of the tibia, dysfunction and damage of the anterior cruciate ligament, and decreased strength of the quadriceps femoris muscle. however, all of the subjects in this study were young, healthy individuals without a history of articular disease. therefore, factors such as bone deformation, dysfunction and damage of the anterior cruciate ligament, and decreased strength of the quadriceps femoris muscle should have been absent in this group. ishii.17 reported multiple patterns of leg rotation in healthy individuals, which they explained were due to general joint laxity. it is possible that decreased extensibility of the hamstrings might be one factor of general joint laxity. when extensibility of the hamstring decreases, active knee extension is conducted with the force from the head of the fibula being pulled in the posterior direction. this is due to the head of the fibula being in close contact with the tibia and proximal tibia which is the insertion point for the semitendinous, semimembraneous and biceps femoris muscles, which form the hamstring. thus, the anterior shifts of the medial and lateral condyles of the tibia are limited, the proximal tibia in the region of full knee extension falls in the posterior direction, and the proximal end of the tibia can not reach a sufficiently anterior position. as the articular surface of the tibia shifting anteriorly to follow the medial and lateral condyle of the femur becomes insufficient, strain in the anterior cruciate ligament does not increase in the region of full knee extension. hence, prior to the intervention when the extensibility of the hamstring was comparatively low, the angle of leg rotation, variation in leg external rotation angle, and variation in leg internal rotation angle exhibited low values. however the restriction of the anterior shift of the contact point of the medial condyle of the tibia with the medial condyle of the femur in the region of full knee extension disappeared as extensibility of the hamstring increased following the intervention. because natural leg rotation in the direction of external rotation becomes possible at this point, the angle of leg rotation, variation in leg external rotation angle, and variation in leg internal rotation in the final phase of extension significantly increased. the increase in the angle of leg rotation as extensibility of the hamstring increased is supported by the moderately positive correlation that was found between the variation in muscle hardness of the lateral hamstring and the variation in leg rotation angle, and between the variation in muscle hardness of the medial hamstring and the variation in leg external rotation angle. these findings indicate that reduction in extensibility of the hamstring may be a limiting factor for leg rotation. in terms of activity of the quadriceps femoris muscle during active knee extension, no correlation was found between change in muscle hardness of the hamstring due to the intervention and change in the activity of the quadriceps femoris muscle. however, the activity of the quadriceps femoris muscle increased despite the subject being in the supine position, in which active knee extension is not as easily affected by the hamstring. nakajima.18 reported that stretching of the hamstring increased knee extension torque during uniform motion at an angular velocity of 180/sec. their research did not use electromyography, however their results mirror ours in that the increased extension torque resulting from increased muscle activity suggests the activity of the quadriceps femoris muscle increased due to hamstring stretching. a possible explanation for this is that, generally when a muscle elongates, a response to the tensile stimulation occurs in the intramuscular muscle spindle. when this surpasses optimal strength, a stretch reflex is produced in the same muscle, and the antagonist is suppressed. when there is gamma motor neuron activity, the receptor site in the intrafusal muscle fiber expands due to this activity19. thus, stretch reflex increases on account of the increased frequency of responses generated from the muscle spindle. therefore, when the hamstring elongates from resting length due to knee extension, prior to intervention when extensibility of the hamstring wsa reduced, the muscle elongates in a way that triggers the gamma motor neuron activity which regulates the length of the intrafusal muscle fiber in response to muscle extensibility. thus, the response frequency of the muscle spindle increases, increasing the stretch reflex, triggering a suppressive effect on the quadriceps femoris muscle which has an antagonistic relationship, thus reducing that activity. this in turn reduced gamma motor neuron activity, which regulates the length of the intrafusal muscle fiber, reducing the response frequency of the muscle spindle, and decreasing the stretch reflex. accordingly, there was a decrease in the suppressive effect acting on the quadriceps femoris muscle, which increased the activity of that muscle. as an active factor causing leg rotation during knee extension, the quadriceps femoris muscle exerts traction against the tibia in the external direction2. thus, the angle of leg rotation, variation in leg external rotation angle, and variation in leg internal rotation increased in the final phase of the extension due to this increased activity. the present results indicate that reduced extensibility due to stretching of the hamstring affects the anterior shift of the tibia along with the femoral shape, which is a passive factor in leg rotation. in addition, it affects the activity of the quadriceps femoris muscle, which is an active factor. the present findings indicate that when conducting knee extension as a therapeutic exercise for dysfunction of the knee, extensibility of the hamstring and leg rotation should be evaluated. when proper leg rotation is not found, extensibility should be increased by hamstring stretching, to restore the proper leg rotation associated with active knee extension. this would not affect patients with abnormal structural factors, including athletes who have suffered anterior cruciate ligament injury or knee osteoarthritis patients with clear bone deformity. increasing extensibility of the hamstring by stretching would also be effective as a pretreatment for restoring proper leg rotation when knee extension is conducted as a therapeutic exercise for athletes who have not suffered anterior cruciate ligament injury and knee osteoarthritis patients initially lacking clear bone deformity. | [purpose ] this study investigated the effects of hamstring stretching on leg rotation during active knee extension. [subjects ] subjects were 100 bilateral legs of 50 healthy women without articular disease. [methods ] hamstring hardness, leg rotation and muscle activities of the knee extensors during active knee extension were measured before and after hamstring stretching. [results ] hamstring hardness was significantly decreased after hamstring stretching. the leg rotation angle, variation in leg rotation angle, variation in leg external rotation angle, and muscle activities of the vastus lateralis and rectus femoris were significantly increased after hamstring stretching. a moderate positive correlation was found between variation in leg rotation and variation in muscle hardness in hamstring. [conclusion ] leg rotation during active knee extension was increased by hamstring stretching. hamstring stretching would be effective as a pretreatment for restoring proper leg rotation when knee extension is conducted as a therapeutic exercise. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.