article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
imaging colorectal cancer has become a major indication for positron emission tomography (pet), following the transition of this technology from the research arena into clinical practice. colorectal cancer is the second commonest tumour to be evaluated at the wesley pet centre, reflecting the high prevalence of this disease. pet is a functional imaging technique that exploits the increased glucose metabolism that occurs in colorectal cancer, and many tumours, by depicting the distribution of the radio - labelled glucose analogue, fluorine-18 fluorodeoxyglucose (f - fdg). the high impact of pet results from its ability to detect tumour foci too small to be confidently diagnosed by ct or other structural imaging methods. this ability arises from the fact that lesion detection on pet is determined by the magnitude of metabolic change in the tumour, rather than tumour size. following a 6-hour fast to normalise serum glucose levels, patients receive 185370 mbq f - fdg intravenously, with imaging performed 4560 min later. whole - body images are acquired using attenuation correction to improve detection of deeply located lesions. iterative algorithms should be used for image reconstruction to improve image quality and prevent streak artefacts from areas of high activity, such as excreted activity within the bladder. combined pet / ct systems allow for more rapid attenuation correction and improved anatomical localisation of pet abnormalities in some cases. primary colorectal cancers occasionally present as an incidental finding on fdg - pet, and fdg uptake has been reported in adenomatous polyps, a precursor to colon cancer. however, the presence of physiological gut uptake of fdg combined with false - positive uptake in inflammatory disease, along with low sensitivity to lesions less than 1 cm, precludes a significant role for fdg - pet in primary diagnosis or screening. there is evidence that fdg - pet is more accurate than ct in the primary staging of colorectal cancer. however, fdg - pet in this setting appears to have little impact on clinical management, due to the need for most patients to undergo surgical resection of the primary tumour in order to prevent subsequent bowel obstruction and due to the importance that the results of pathological staging have in determining prognosis and post - operative management. recurrence rates after apparently curative resection of colorectal cancer remain high, up to 40% in some series. some patients will have a localised recurrence that is amenable to surgical resection and potential cure. the aim of imaging in such patients is to diagnose the local recurrence and confirm the absence of other disease sites that would preclude curative surgery. the performance of current imaging strategies in this setting has proved disappointing, with many patients thought suitable for surgery being found to have unresectable disease at operation. fdg - pet is proving to have a pivotal role in identifying those patients most likely to benefit from surgical intervention. differentiation between pelvic recurrence and postoperative fibrosis after excision of rectal tumour can be problematic for ct and mri (fig. 1). a meta - analysis of fdg - pet literature determined a 95% sensitivity and 97% specificity for pet in this setting, whilst a direct comparison of ct and fdg - pet reported sensitivity values of 52 and 91% for ct and pet respectively, along with enhanced specificity for pet (ct 80%, pet 100%). post - irradiation inflammatory change can result in falsely positive uptake with pet, particularly within 612 weeks of therapy. figure 1 pelvic recurrence of colorectal cancer on ct (top left) and fdg - pet : transaxial (bottom left) and sagittal (right) images. pelvic recurrence of colorectal cancer on ct (top left) and fdg - pet : transaxial (bottom left) and sagittal (right) images. fdg - pet can also be useful in characterising hepatic or pulmonary lesions in patients who have previously undergone resection of colon cancer. although fdg - pet often demonstrates hepatic metastases undetected by ct, the overall accuracy for pet is only marginally better than ct[58 ]. this finding is partly due to the background hepatic uptake of fdg, which creates difficulty in diagnosing hepatic metastases, particularly for lesions less than 2 cm in diameter. for this reason, an fdg - pet scan that is negative for hepatic metastases should not be considered to exclude this diagnosis. there has been little research to investigate the factors that determine background hepatic uptake of fdg, although our experience suggests background levels of fdg activity are lower in patients with advanced disease and poor survival. surgical resection of apparently isolated hepatic or pulmonary metastasis from colorectal cancer results in improved survival. accurate pre - operative staging of such patients is essential to avoid the morbidity of surgery for patients with otherwise unsuspected additional metastatic sites. there are now several reports indicating superiority of pet over ct in this clinical context[58 ], the greatest benefit arising from detection of additional extra - hepatic tumour foci (fig. comparative sensitivity values for extra - hepatic disease range from 58 to 74% for ct, vs. 90100% for fdg - pet, whilst specificity values are similar for the two modalities. exclusion of extra - hepatic metastases may also be useful prior to aggressive local treatments for hepatic metastases such as radiofrequency ablation or intra - arterial microsphere - based radiotherapy. figure 2 coronal fdg - pet image in a patient with an hepatic metastasis from colorectal cancer (straight arrow). a retro - peritoneal deposit undetected by ct coronal fdg - pet image in a patient with an hepatic metastasis from colorectal cancer (straight arrow). a retro - peritoneal deposit undetected by ct is also seen (curved arrow). the aim of imaging for patients with rising tumour markers is to identify a localised tumour recurrence that is potentially resectable with hope of a survival benefit. however, when conventional imaging is negative, the positive yield of fdg - pet ranges between 38 and 77%. although fdg - pet may reveal extensive inoperable disease in some cases, a localised tumour deposit potentially amenable to surgery is found in others. however, in a significant proportion of these patients (25% in one series), pet is found to have underestimated the extent of disease at surgery. also, false - positive diagnoses, most commonly inflammatory conditions, occasionally arise amongst patients investigated for a rising cea. differentiation between pelvic recurrence and postoperative fibrosis after excision of rectal tumour can be problematic for ct and mri (fig. 1). a meta - analysis of fdg - pet literature determined a 95% sensitivity and 97% specificity for pet in this setting, whilst a direct comparison of ct and fdg - pet reported sensitivity values of 52 and 91% for ct and pet respectively, along with enhanced specificity for pet (ct 80%, pet 100%). post - irradiation inflammatory change can result in falsely positive uptake with pet, particularly within 612 weeks of therapy. figure 1 pelvic recurrence of colorectal cancer on ct (top left) and fdg - pet : transaxial (bottom left) and sagittal (right) images. pelvic recurrence of colorectal cancer on ct (top left) and fdg - pet : transaxial (bottom left) and sagittal (right) images. fdg - pet can also be useful in characterising hepatic or pulmonary lesions in patients who have previously undergone resection of colon cancer. although fdg - pet often demonstrates hepatic metastases undetected by ct, the overall accuracy for pet is only marginally better than ct[58 ]. this finding is partly due to the background hepatic uptake of fdg, which creates difficulty in diagnosing hepatic metastases, particularly for lesions less than 2 cm in diameter. for this reason, an fdg - pet scan that is negative for hepatic metastases there has been little research to investigate the factors that determine background hepatic uptake of fdg, although our experience suggests background levels of fdg activity are lower in patients with advanced disease and poor survival. surgical resection of apparently isolated hepatic or pulmonary metastasis from colorectal cancer results in improved survival. accurate pre - operative staging of such patients is essential to avoid the morbidity of surgery for patients with otherwise unsuspected additional metastatic sites. there are now several reports indicating superiority of pet over ct in this clinical context[58 ], the greatest benefit arising from detection of additional extra - hepatic tumour foci (fig. comparative sensitivity values for extra - hepatic disease range from 58 to 74% for ct, vs. 90100% for fdg - pet, whilst specificity values are similar for the two modalities. exclusion of extra - hepatic metastases may also be useful prior to aggressive local treatments for hepatic metastases such as radiofrequency ablation or intra - arterial microsphere - based radiotherapy. figure 2 coronal fdg - pet image in a patient with an hepatic metastasis from colorectal cancer (straight arrow). a retro - peritoneal deposit undetected by ct coronal fdg - pet image in a patient with an hepatic metastasis from colorectal cancer (straight arrow). a retro - peritoneal deposit undetected by ct is also seen (curved arrow). the aim of imaging for patients with rising tumour markers is to identify a localised tumour recurrence that is potentially resectable with hope of a survival benefit. however, when conventional imaging is negative, the positive yield of fdg - pet ranges between 38 and 77%. although fdg - pet may reveal extensive inoperable disease in some cases, a localised tumour deposit potentially amenable to surgery is found in others. however, in a significant proportion of these patients (25% in one series), pet is found to have underestimated the extent of disease at surgery. also, false - positive diagnoses, most commonly inflammatory conditions, occasionally arise amongst patients investigated for a rising cea. demonstration of therapeutic impact and cost - effectiveness is becoming increasingly important in the evaluation of new diagnostic tests, and is often required before funding can be obtained from governments or health purchasers. a meta - analysis of pet literature in recurrent colorectal cancer concludes that management is altered in 29% (95% confidence interval 2534%). in most patients, fdg - pet results in upstaging of disease with deferment of surgery. reported experience and modelling approaches, such as decision - tree sensitivity analysis, 3). figure 3 results from a decision - tree sensitivity analysis for the use of fdg - pet to detect extra - hepatic metastases prior to resection of an apparently isolated hepatic metastasis. using australian medical costs, the graph plots the incremental cost - accuracy ratio (icar : i.e. the additional cost per additional correctly managed patient) against the prevalence of extra - hepatic disease for ct- and pet - based management strategies. results from a decision - tree sensitivity analysis for the use of fdg - pet to detect extra - hepatic metastases prior to resection of an apparently isolated hepatic metastasis. using australian medical costs, the graph plots the incremental cost - accuracy ratio (icar : i.e. the additional cost per additional correctly managed patient) against the prevalence of extra - hepatic disease for ct- and pet - based management strategies. this diagnostic performance leads to changes in clinical management for a significant proportion of patients, resulting in improved cost - effectiveness. fdg - pet is fast becoming the standard of clinical care for patients with known or suspected recurrence of colorectal cancer. | imaging colorectal cancer has become a major indication for positron emission tomography using fluorodeoxyglucose (fdg - pet). in primary diagnosis and staging, the role for this technique is limited but fdg - pet has proved highly accurate in the detection of recurrent tumour. the three main indications are (i) characterisation of a residual structural lesion after definitive therapy, (ii) pre - operative staging prior to resection of apparently isolated metastasis, and (iii) investigation of rising carcinoembryonic antigen (cea) in a patient with normal structural imaging. the diagnostic accuracy of fdg - pet translates to changes in management in a large number of patients, resulting in improved cost - effectiveness. fdg - pet is fast becoming the standard of clinical care for patients with recurrent colorectal cancer. |
idiopathic hypertrophic spinal pachymeningitis (ihsp) is a rare clinical disorder characterized by diffuse or localized fibrous thickening of the spinal dura matter with chronic and progressive process13,14,16,25). several etiologies are related with hypertrophic spinal pachymeningitis, including infection, autoimmune reaction, sarcoidosis and neoplastic process. clinical manifestation of ihsp is usually related with compression of the nervous system or vascular structure caused by thickened dura mater. as a result, ihsp might induce various neurologic symptoms depending on the location of the lesion. typical magnetic resonance imaging (mri) finding of the ihsp is linear t2 low signal mass involving dura extending over multiple levels with peripheral or nodular enhancement. a 58-year - old female visited our institution with progressive weakness of both lower extremities and clumsiness of both hands. the patient received a hysterectomy 10 years ago because of benign myoma and total thyroidectomy 2 years ago because of follicular thyroid carcinoma. there was neither noticeable history of trauma nor contributable family medical history. on physical examination, there was slight motor power weakness (grade 4+/5) in both lower extremities. however, the erythrocyte sedimentation rate (esr) was slightly elevated to 38 mm / hr (reference range : 0 - 27 mm / hr). initial computed tomography (ct) scan showed an osteolytic mass - like lesion involving base of the c6 spinous process, which caused spinal canal stenosis. radiologic report suggested neoplastic disease such as giant cell tumor, which has the characteristics of an osteolytic neoplasm (fig. mri was carried out after ct scan and revealed an epidural mass involving the dorsal aspect of cervical spinal canal from c5 to c7 level, with low signal intensity on t1 and t2 weighted images and non - enhancement on t1 weighted - enhanced images. there was abnormally high signal intensity of the spinal cord on t2 weighted image at c6 level, suggesting myelopathy (fig. the patient underwent surgical exploration, with a complete hemilamiectomy of c5, c6, and c7 with left side approach. five days after surgery, patient discharged without complications related with surgery and the symptoms were improved but not completely recovered. pathologic examination revealed fibrotic pachymeninges with no significant inflammation, and these findings were compatible with diagnosis of ihsp (fig. six months after operation, the patients visited an out - patient clinic, and the symptoms were stationary compared with at discharge. a follow - up mri was conducted and revealed no recurrence of dura mater thickening. ihsp is a rare condition, but possibly under - recognized because of its indolent nature and non - specific symptoms. since accessibility of the diagnostic imaging technique including spinal mri has improved recently, ihsp has been diagnosed and reported more frequently. according to etiology of the disease some infectious diseases including syphilis, and diseases caused by htlv-1, mycobacterium, and fungi are reportedly associated with hypertrophic pachymeningitis2,10,18,27,29). various autoimmune disorders, such as rheumatoid arthritis, wegener 's granulomatosis, multifocal fibrosclerosis, sclerosing cholangitis, and sarcoidosis are also regarded as etiologic factors in particular cases3,4,5,7,15,17,19,22,24,26). the diagnosis of ihsp depends on exclusion of these possible causative factors. in this case, we tried to reveal possible causative factors but failed. although esr was slightly increased, it was normalized 2 months after the operation and seemed to be a non - specific finding rather than sign of hidden inflammatory disease. clinical manifestations of ihsp vary according to location and size. in the early stage of the disease, the patient may experience only localized pain, however, as the lesion grows, it may lead to radiculopathy or compressive myelopathy.8) typically, the symptoms caused by ihsp have an indolent nature with a chronic course5,9). histopathologically, ihsp is characterized by fibrosis and infiltration of inflammatory cells, such as lymphocytes, plasma cells, polymorphonuclear cells, eosinophils and macrophages, without necrotic change. however, in cases of secondary hypertrophic pachymeningitis, specific histopathologic findings might be different according to the nature of the underlying causative disease. in the present case typically, ihsp showed peripheral or nodular enhancement pattern and it represent to zone of inflammation.6) nevertheless, in this case, mri showed no enhanced portion. less inflammatory reaction, more fibrosis, and no enhanced portion are related to worse response to steroid therapy23). because of the lack of long - term follow - up studies, there is insufficient clinical information on the natural history and clinical course of the disease to establish an optimal management plan for patients with ihsp decompressive surgery for the patient with definite or progressive neurologic symptoms should be considered for preventing further deterioration. in addition, some authors suggest subsequent steroid therapy after surgery to reduce inflammatory reactions12), though the efficacy of this remains debatable. alternative clinical trial including chemotherapy with azathioprine, cyclophosphamide and methotrexate, or radiation therapy in selected patients has been reported, but these treatments showed limited efficacy1,5,11,16,20,21). there has been no previous report describing a case of ihsp with osteolytic lesion to our knowledge. in the present case, the reason of osteolysis is not clear, but it might be a vestige of inflammatory reaction. although there was no evidence of active inflammatory reaction according to histopathologic findings, it is hard to exclude the possibility of a change in activity of inflammation with time course. the clinical importance of ihsp with osteolytic lesion is that it must be distinguished from osteolytic neoplasm including giant cell tumor. most reports of ihsp have been limited to short - term follow - up after the initial treatment. according to previous reports, with long term follow - up exceeding 5 years, recurrence was noted in three of five cases28). in this regard, ihsp is a rare condition, but possibly under - recognized because of its indolent nature and non - specific symptoms. decompressive surgery should be considered for the patient with definite or progressive neurologic symptoms in order to prevent further deterioration. after the surgical treatment, scheduled follow up is mandatory because ihsp can be recurrent. | idiopathic hypertrophic spinal pachymeningitis (ihsp) is a chronic, progressive, inflammatory disorder characterized by marked fibrosis of the spinal dura mater with unknown etiology. according to the location of the lesion, it might induce neurologic deficits by compression of spinal cord and nerve root. a 58-year old female with a 3-year history of progressive weakness in both lower extremities was referred to our institute. spinal computed tomography (ct) scan showed an osteolytic lesion involving base of the c6 spinous process with adjacent epidural mass. magnetic resonance imaging (mri) revealed an epidural mass involving dorsal aspect of cervical spinal canal from c5 to c7 level, with low signal intensity on t1 and t2 weighted images and non - enhancement on t1 weighted - enhanced images. we decided to undertake surgical exploration. at the operation field, there was yellow colored, thickened fibrous tissue over the dura mater. the lesion was removed totally, and decompression of spinal cord was achieved. symptoms improved partially after the operation. histopathologically, fibrotic pachymeninges with scanty inflammatory cells was revealed, which was compatible with diagnosis of idiopathic hypertrophic pachymeningitis. six months after operation, motor power grade of both lower extremities was normal on physical examination. however, the patient still complained of mild weakness in the right lower extremity. although the nature of ihsp is generally indolent, decompressive surgery should be considered for the patient with definite or progressive neurologic symptoms in order to prevent further deterioration. in addition, ihsp can present as an osteolytic lesion. differential diagnosis with neoplastic disease, including giant cell tumor, is important. |
malaria is one of the main scourges of the world, affecting half a million people a year. it is caused by parasites belonging to the phylum apicomplexa, family plasmodiidae, and genus plasmodium. there are five known species that parasitize man, the most prevalent being plasmodium falciparum, p. vivax, and p. malariae in tropical areas such as latin america, the indian subcontinent, southeast asia, and parts of africa. p. ovale has been reported in africa, middle east, and the indian subcontinent, while p. knowlesi has been recently described as responsible for large foci of infections in southeast asia. the natural transmission occurs through the bite of infected female anopheles mosquito, anopheles darlingi being the most prevalent species in the country. the ministry of health directs therapy and provides free antimalarial medicines used throughout the national territory, in units of the unified health system (sus), through a national policy on malaria treatment. malaria caused by p. vivax (or p. ovale) is treated with chloroquine in brazil at a dose of 30 mg / kg divided into three days and primaquine in the 30 mg dose / day for 7 days or 15 mg / day for 14 days. also, low doses of chloroquine can be used for the prevention of vivax malaria. pregnant women and children under 6 months of age with vivax malaria receive only chloroquine in different dosage schedules. primaquine is the only antimalarial drug with effective activity against all the species gametocytes of plasmodium which cause malaria in humans, as well as against hypnozoites, latent forms of p. vivax and p. ovale responsible for relapses. however, it has hemolytic effects, especially in people with glucose-6-phosphate dehydrogenase deficiency (g6pd), in which primaquine as a stressor to the erythrocyte induces hemolysis. hemolysis induced by primaquine can result in discoloration of urine and faeces and it is dose related [8, 9 ]. gastrointestinal disorders, such as nausea, dizziness, and vomiting, are common but usually not present as severe complications, especially when primaquine is administered with food. with respect to chloroquine, there are relatively few adverse effects with use in usual doses, of which the most serious are retinopathy, cardiomyopathy, myopathy, and neuromyopathy. prolonged treatment or use of high level doses may cause retinal toxicity, long subtle symptoms of decreased visual acuity, diplopia, and bilateral loss of vision. adverse reactions of the gastrointestinal tract are the most common side effects, usually controlled by reducing drug dose. there are also reports of ototoxicity, tingling, itching, and change in skin color, in addition to seizures, insomnia, and paresthesia [12, 13 ]. the occurrence of symptoms specifically related to the intake of antimalarials and the overlap of symptoms of malaria with the side effects of primaquine and chloroquine may decrease adherence to treatment. therefore, it becomes important to assess the main side effects of antimalarial drugs in patients from endemic areas, where treatment is aimed not only at improving the clinical status but also at reducing the transmission of plasmodium. this study evaluated the frequency of the symptoms that commonly occur in vivax malaria before and after treatment and the frequency of side effects reported during the term of antimalarial treatment with chloroquine and primaquine in standardized doses according to the protocol of the brazilian ministry of health. the study was conducted in the urban area of the municipality of mncio lima, located in the western part of the brazilian amazon, in the state of acre. this municipality, with 5000 km, is bordered by the cities of cruzeiro do sul and rodrigues alves and the republic of peru. mncio lima has 14,884 inhabitants living in urban areas (57.3%), rural or riparian areas (37.9%), and indian villages (4.8%). the county is located 38 km from cruzeiro do sul and 650 km from rio branco. patients with microscopic diagnosis of vivax malaria were identified in microscopy stations of the city of mncio lima before the medication and invited to participate in the study. after signing the informed consent or having it signed by parents or legal guardians, patients answered a questionnaire on malaria symptoms that occurred up to the time of diagnosis (before antimalarial treatment), to verify the occurrence of the following symptoms : nausea, vomiting, diarrhea, pale stools, loss of appetite, mesogastric and/or hypogastric pain, pain in hypochondrium, headache, myalgia, arthralgia, back pain, retroocular pain, fever, chills, sweating, malaise or weakness, itchy throat, jaundice, choluria, dyspnea, and bitter taste sensation, covering up thereby symptoms commonly occurring in malaria and overlapping with possible side effects of chloroquine and primaquine. between 3 and 5 days after the start of medication, a second interview was conducted asking about the occurrence of the same symptoms plus some symptoms related to the use of chloroquine that are infrequent in malaria : blurred vision, itching, stinging sensation of the skin, convulsions, numbness, and insomnia. the distributions of relative and absolute frequencies, median, mean, and standard deviations of the variables of interest were calculated. as primaquine and chloroquine may lead to the onset of symptoms and also intensify or reduce some of the symptoms of malaria, the occurrence of symptoms before and after drug treatment was analyzed with the mcnemar 's test for paired samples. some of the symptoms considered to be side effects of chloroquine and primaquine and that are not usual in malaria were assessed only after drug treatment was started. the research protocol was submitted to the ethics committee for experimentation with human beings of universidade federal do acre and approved, cae number 22876013.9.0000.5010 (2013). informed consent was obtained from each adult participant or legal guardian in case of minors, before the start of the study. the study included 50 people with vivax malaria, 28 men and 22 women, aged between 7 and 68 years (average age 28.38 years). the average length of stay in an endemic area was 24.79 years, and about one - third of the study population (30%) lived in an endemic area for malaria between 11 and 20 years. of the 50 patients evaluated, only one had a primary infection, and all the others had had between 1 and 41 episodes of previous malaria, and 36% report having had more than 10 episodes of malaria. about 52% had an episode in the 12 months leading up to the current episode, ranging from one to 10, the number of malaria events in 2012. most of the patients had low parasitemia (less than 200 parasites / mm in 66% of cases), 12% of them had between 301 and 500 parasites / mm, and 12% were found to have 50110000 parasites / mm (table 1). the main symptoms observed in untreated malaria were fever (72%), chills (54%), sweating (54%), and weakness (42%), as well as pain symptoms including headache (76%), arthralgia (48%), and lower back pain (52%). less commonly reported symptoms were retroocular pain (36%) and myalgia (30%). gastrointestinal symptoms occurred in low frequency, such as bitter taste (30%), decreased appetite (32%), nausea (22%), vomiting (16%), and pain in hypogastric or mesogastric region (20%). before treatment, only 20% of patients reported dark urine, and no patient reported having had pale stools. after initiation of treatment, a significant reduction in the prevalence of fever (38%), arthralgia (26%), back pain (32%), and retroocular pain (18%) (p < 0.05, table 2) was noted. however, there was significant increase in the frequency of nausea (46%), diarrhea (26%), pale stools (12%), abdominal pain (38%), bitter taste in the mouth (60%), weakness (36%), and hypochondrial pain (32%) (p < 0.05, table 2). the frequency of choluria increased to 56% after initiation of antimalarial treatment (p = 0.01, table 2). other symptoms such as vomiting, loss of appetite, headache, myalgia, chills, and sweating, as well as respiratory symptoms and upper respiratory tract symptoms, suffered no major change in frequency (table 2). among the adverse effects of chloroquine described in the literature and which are not often reported in malaria patients without treatment, there were reported changes in visual acuity (54%), insomnia (46%), pruritus (22%), the feeling of stings into the skin (22%), and paresthesias (6%). most gastrointestinal symptoms appeared after the patient started the antimalarial treatment (table 3). the symptoms most commonly seen in patients with malaria reported in the literature are fever, chills, sweating, headache, myalgia, and arthralgia. da silva - nunes and ferreira evaluated 326 cases of untreated malaria, reporting high frequency of headache (84.8%), fever (80.9%), and myalgia (68.7%), while gastrointestinal symptoms were infrequent (< 20%). in pregnant women with vivax or falciparum malaria, the most frequent symptoms were also fever (97.9%), chills (71.7%), and headache (62.4%). the treatment of vivax malaria with chloroquine, a blood schizonticide, and primaquine (active against latent tissue forms of p. vivax or so - called hypnozoites) is very effective in reducing parasitemia and some of the symptoms caused by the plasmodium infection, such as fever and algic symptoms. fever tends to disappear between 24 and 48 hours after the beginning of treatment ; parasitemia decreases significantly at about 48 to 72 hours, and pain symptoms decrease rapidly. reported the disappearance of fever in 91.2% of patients, chills in 86% of patients, and headaches in 65.6% of patients at the end of the third day of treatment with chloroquine and primaquine and significant reduction of peripheral parasitemia between the second and third days of treatment. however, chloroquine can cause side effects or intensify symptoms already present, such as abdominal discomfort, nausea, vomiting, and diarrhea. these side effects can also occur during the use of primaquine being suitable to ingest the medication with food to avoid such side effects. chloroquine can rarely cause neurological symptoms, such as mental confusion, seizures, and coma, and cardiovascular symptoms such as hypotension, vasodilation, suppression of myocardial function, and cardiac arrhythmias, usually associated with rapid infusion of the drug parenterally. in usual doses for treatment of malaria, headache, blurred vision, and lichenoid rash can occur. chloroquine may block the entrance of potassium into the cells and primaquine also has an effect on blocking sodium channels. both may also have an effect on the chloride channels present in cardiac myocytes, which may explain the occurrence of cardiac and gastrointestinal side effects. in studies conducted in belm (par), silva. found, as major side effects of chloroquine, the following symptoms : itching (5.55%), epigastric pain (1.28%), diarrhea (0.85%), and choluria (3.42%). the itching and stinging sensation are explained by formation of haptens during the metabolism of chloroquine, which bind to degraded products erythrocytes or phospholipids involved in allergic reactions, stimulating the production of ige - like antibodies and degranulation of mast cells and basophils. also, the binding of chloroquine at the dermoepidermal junction may possibly result in stimulation of nerve fibers, causing these symptoms. regarding primaquine use, the most prevalent side effect is hemolytic anemia, resulting in jaundice and choluria. data on primaquine use worldwide indicates that, among 200 million people, there were 14 deaths in six decades related to its use, from which 12 were caused by severe hemolysis. hemolytic anemia can also occur in people without g6pd deficiency when using primaquine, although it is a very scarce event. the gene encoding the g6pd is located on the x chromosome (locus xq28), with a recessive pattern of inheritance linked to sex. in heterozygous females normal red blood cells can coexist with red blood cells deficient in g6pd, in variable proportion, and this can cause a milder hemolytic anemia when exposed to primaquine. at the same time, there are 180 different genetic variants of g6pd, resulting in different levels of hemolysis. the mediterranean variant, which predominates in europe, western and central asia, and north of india, is more severe, while the african variant (common in sub - saharan africa, amazon, and afro - americans) is a milder variant. in these milder variants, hemolysis will be clinically detected only after one or two days of exposure to primaquine. the prevalence of g6pd deficiency is between 3 and 30% in endemic countries for malaria, corresponding to 350 million people. in the americas, it has a lower prevalence, varying between 5 and 10% in the amazon region and higher levels in tropical africa, middle east, and the mediterranean basin, such as sudan and congo, where it is present in more than 20% of the population. in brazil, the frequency of g6pd deficiency varies between 1.7% and 6.0%, prevailing the african variant. in manaus, a city with high levels of transmission of malaria in the brazilian amazon, the prevalence of g6pd was 2.5%. this difference in prevalence may explain why, in brazil, primaquine is administered to all nonpregnant patients older than 6 months with an unknown g6pd deficiency status, while in other countries with higher prevalence of this enzymatic deficiency (or in which more severe variants are common) primaquine use is very much debated and controversial. these events are dependent on the extent of hemolysis, which is related to the severity of g6pd deficiency and the dose of primaquine. recommended primaquine doses used to block falciparum malaria transmission (0.25 mg of base per kilogram) are usually considered to have low toxicity, because it is a single - dose treatment. however, primaquine use in vivax malaria, aimed at preventing relapsing events, is a longer course (between 7 and 14 days), with varying dosage among malaria control policies, and therefore hemolytic events are more prone to happen. in a systematic revision, monteiro. detected 47 cases of hemolytic anemia in patients using primaquine in latin america and caribbean, and 23 occurred in brazil. however, brazil has the largest population at risk for malaria ; thus it is expected to have more cases reported. a few cases of primaquine - induced hemolysis have also been reported in other countries, such as cuba, el salvador, puerto rico, and trinidad and tobago, between 1963 and 2013. in our study, the frequency of choluria (dark urine) increased significantly from 6% to 56% in malaria patients after primaquine was started. since it is an event referred by the patient, we can not be sure how many of the patients really presented with choluria, or how severe was the choluria, but it is known that g6pd deficiency occurs among amazonian residents. it is possible that the hemolytic anemia is the cause of weakness and malaise, reported by these patients. however, none of the patients studied suffered from severe hemolysis or severe anemia (data not shown) or required hospitalization during or after malaria treatment. although severe events related to the use of primaquine were infrequent in our and other studies in the amazon, it is important to bear in mind the possible adverse side effects of primaquine and also mild anemia occurring in patients with the less severe forms of g6pd deficiency, which can be associated or not with weakness. reported that subjects with no g6pd deficiency showed reduction of 1 to 2 g / dl of hemoglobin after primaquine use, while in g6pd deficient patients hemoglobin levels decreased between 3 and 5 g / dl, with fast normalization after treatment was over. reported abdominal pain as a side effect for primaquine in falciparum malaria patients from myanmar, occurring in 16% of patients receiving a single dose. there is no clear evidence why primaquine can cause abdominal pain ; it can be related to the direct effect of the drug on an empty stomach or related to the release of pharmacological substances during hemolysis. despite its cause, it is noteworthy that, in our study, abdominal pain increased significantly from 6% to 32% after primaquine was started. although the present study has a limitation in the number of subjects studied, it was possible to detect significant association of symptoms and malaria treatment. thus, while the treatment of vivax malaria with a combination of chloroquine and primaquine leads to decrease in fever and pain symptoms, it can lead to the onset of gastrointestinal symptoms and hemolysis or enhances these symptoms when already present in the patient with malaria, contributing to reducing treatment adherence, especially during the use of primaquine, which has a longer course of treatment. moreover, the sensation of itching and stinging, although they do not occur in all patients, can be quite intense, hindering treatment with chloroquine. it is important to warn the patient of these possible side effects and seek measures to minimize them, either with concomitant use of antihistamines or antiemetics, according to the individual needs of each patient. the occurrence of severe hemolysis after primaquine use, although not common in brazil, can still occur, and since brazilian control programs currently do not have a policy for g6pd deficiency screening before malaria treatment is offered, health care personnel must be aware of it to interrupt primaquine use and manage its side effects properly. | side effects of antimalarial drug can overlap with malaria symptoms. we evaluated 50 patients with vivax malaria in mncio lima, acre, treated with chloroquine and primaquine. patients were evaluated for the presence of 21 symptoms before and after treatment and for reported side effects of these drugs after treatment was started. the most frequent symptoms before medication were headache, fever, chills, sweating, arthralgia, back pain, and weakness, which were present in between 40% and 76% of respondents. the treatment reduced the occurrence of these symptoms and reduced the lack of appetite, but gastrointestinal symptoms and choluria increased in frequency. there were no reports of pale stools before medication, but 12% reported the occurrence of this symptom after treatment started. other symptoms such as blurred vision (54%), pruritus (22%), paresthesia (6%), insomnia (46%), and stings into the skin (22%) were reported after chloroquine was taken. the antimalarial drugs used to treat p. vivax malaria reduce much of the systemic and algic symptoms but cause mainly gastrointestinal side effects that may lead to lack of adherence to drug treatment. it is important to guide the patient for the appearance and the transience of such side effects in order to avoid abandoning treatment. |
surgical methods for repairing unilateral cleft lips have advanced continuously over the past few decades. although a multitude of approaches have been described, the rotation - advancement technique described by dr. this technique releases the malformed medial lip segment from its columellar attachment and rotates it into normal position. the lateral lip segment is advanced with the alar base across the cleft. since its introduction, this procedure has been performed by innumerable surgeons worldwide. with experience, many cleft surgeons tend to further modify this technique for better outcome. this continuing evolution of the surgical technique is just a reflection of a plastic surgeon 's struggle to combine reconstructive principles with a good aesthetic sense to restore both form and function with beauty. any modification in the procedure which allows normal facial growth and development, near - normal facial appearance and lessens the need for future secondary procedures should be every cleft surgeon 's goal. the operating surgeon must have full understanding of the embryological and anatomical factors guiding the repair of cleft lip and should seek to improvise and make an attempt to normalise all the tissues involved in the cleft lip. it is our hope that the reader will take away some fundamental truths while reading this article, asking questions while learning some answers, with an open mind to envision the contents of this paper. this study was carried out in a high volume centre which receives a large number of children with clefts ranging from minor to severe in nature. during our initial years of practicing millard 's repair as our preferred technique for cleft lip repair vermilion notching was visible in the close - up view, even in nicely repaired lips [figure 1 ]. paramedian scars over the vermilion in continuation with the philtral line scar are often visible [figure 2 ]. in many cases, scar contracture was seen pulling the white roll up and distorting the cupid 's bow. sometimes medial hypoplastic vermilion or partial loss of medial vermilion due to previous surgery demand procedures to augment and/or replace the lost medial segment [figure 3 ]. (a) child with repaired cleft lip showing good symmetry with no noticeable deformity at a distance. (b) close - up view of the same child showing vermilion notching and a visible paramedian scar visibility of paramedian vermilion scars in an operated patient secondary cleft lip deformity showing inadequate vermilion on medial lip segment in bilateral cleft lip repair by veau iii method, we realised that the fall and smoothness of the white roll and vermilion was quite preserved and the repair exhibited no vermilion notching and scars over the vermilion region [figure 4 ]. subsequently, we modified the millard 's technique and incorporated the white roll vermilion turn down flap (wrv flap) from the lateral lip segment to be used for the construction of the vermilion and white roll on the medial lip segment. non - noticeable midline scar and absence of any vermilion deformity in bilateral cleft lip repair even in close - up view we have performed more than 100 cases using this technique till date and the results are promising, consistent with a satisfactory aesthetic outcome. the only drawback observed was in terms of the learning curve associated with this technique. after the child is intubated and draped, the marking is done as per millard 's rotation - advancement technique. the markings for the wrv turn down flap are as follows [green marking in figure 5a ]. on the medial lip segment, a line is drawn just above the white roll from the point designated as the white roll at the height of cupid 's bow on cleft side (point 3) to the point marked as depth of the cupid 's bow (point 1). a line is drawn perpendicular to the point 1 across the vermilion and mucosa which ends in the midline at the frenulum. (a) marking of white roll vermilion turn down flap (green marking). (c) close - up view showing the fall of the lip and symmetry achieved after the skin sutures are placed across the points mentioned. (d) after final suturing on the lateral lip segment, point 3 is marked after matching the vermilion and white roll thickness with that of the medial lip segment. a line is drawn just above the white roll from this point to point 1 (distance between point 3 and 1 should equal the distance between point 1 and 3) along the white roll. similar to medial lip segment, a perpendicular line is drawn from point 1 across the vermilion with a curvilinear or wavy marking following the mucosal crease. after the markings, the area is infiltrated with xylocaine with adrenaline solution (1:100000). after incising as per millard 's technique, the incision is then made on the medial lip segment from point 3 to point 1 just above the white roll carrying it down across the vermilion in the midline. the vermilion, part of orbicularis muscle within the incision line and the red lip portion is transected, and superior labial arteries cauterised. the orbicularis muscle is then judiciously dissected off the overlying skin and underlying mucosa. on the lateral lip segment, the incision is made from point 3 to point 1 just above the white roll carrying it across the vermilion till the maxillary border at the gingivo - buccal sulcus. a small triangle of skin and muscle between the incision of the millard 's technique on the lateral lip and the incision for the turndown flap is excised. rest of the steps of the procedure are done as per millard 's technique. with the approximation of the lateral nasal lining and the advanced alar base with the septal mucosal flap, the peri - oral orbicularis muscle is sutured across the cleft with 4 - 0 vicryl suture with little difference in our technique. the first suture between the muscles is placed at the nasal sill. the second suture approximates the muscle underlying the points 3 and 3. after this approximation, muscle and skin closure lies in orientation and remaining muscle is sutured [figure 5b ]. the wrv flap of the lateral lip segment is used for the construction of the white roll and vermilion on the cleft side. the thickness and length of the vermilion flap of the lateral lip segment is compared with that of the medial side. if the thickness is more, a small portion of the muscle is excised. if the length of the flap is more, it is trimmed to appropriate dimensions. it 's always better to err on the thicker side than on the thinner side. skin closure is done by suturing point 3 to point 3 and point 1 to point 1. care should be taken not to place any sutures over the white roll. sutures are placed 1-mm below or above the white roll at these points [figure 5c ]. the approximation of the white roll with the skin at the philtrum between point 1 and 3 is done either by one - half buried mattress suture or a loose non strangulating single simple suture [figure 5d ]. the final suture line lies at the philtral column for the skin portion and in the midline for white roll, vermilion and mucosa. the evaluation of results was done by the plastic surgery team, anaesthetists, smile train coordinator (owing to their work experience with different cleft surgeons) and non - related attendants. assessment was done in terms of symmetry achieved, visibility of notching and scars, fall and flow of the white roll and vermilion and form of the cupid 's bow. better symmetry is achieved in terms of a balanced protrusive vermilion, smoothness of the curve of cupid 's bow and a continuous regular outline and flow of white roll from lateral to medial when traced by the gazing eye following one corner of the lip to another. this article attempts to present a modification in millard 's repair and our experience with it in more than 100 cases. prospective evaluation and analysis is required to grade the content of this article and our team is already in process to standardise the parameters, collect data and evaluate the results with the focus on detailed analysis and comparison of different techniques used for primary repair of unilateral cleft lip. three children operated with wrv flap method as a primary repair [figures 68 ] and one re - do / revision case [figure 9 ] with secondary deformity are shown with their long - term follow - up pictures as illustrations of this technique. (a) pre - operative photograph of a 4-month - old child with unilateral cleft lip deformity, (b) 1-week post - operative, (c) 1-month post - operative and (d) 4 months post - operative (a) pre - operative photograph, (b) 1-week post - operative, (c) 1-year post - operative and (d) 5-year post - operative (a) pre - operative photograph of a child with cleft lip deformity, (b) close - up view, 1-year post - operative and (c) 3-year post - operative (a) intra - operative photograph of secondary cleft lip deformity showing loss of vermilion on medial lip segment, (b) marking of the white roll vermilion turn down flap, (c) after closure, (d) 3-month post - operative (worm 's eye view), (e) 3-month post - operative (bird 's eye view) the rotation - advancement repair has historically produced excellent results and is currently the most common technique used for unilateral cleft lip repair. in 1955, ralph millard was using le mesurier 's technique for unilateral cleft lip repair but he developed rotation - advancement repair thereafter as he was not satisfied with the results. his surgical philosophy was accepted worldwide and still remains unchallenged. triangular flaps dominated during the 1960s and its variations such as fisher repair numerous modifications of millard 's technique by noordhoff, mulliken and mohler and many others are used by 84% of the surgeons. objectively and subjectively assessed five different types of repair (millard 's, david z - plasty, modified z - plasty, tennison randall triangular flap and nakajima - yoshimura straight line) and found similar results with all with the exception of high rate of shortened lips with millard 's technique. the primary aim of cleft lip repair is to produce functional continuity of the orbicularis muscle, recreate symmetry, reconstitute cupid 's bow, produce a slight pout of the tubercle, balance the white roll and vermilion and achieve nasal symmetry. the benefits of millard repair are that it preserves the cupid 's bow and does not violate the philtral column. to achieve a normal look this repair is known for its flexibility allowing the surgeon to modify components of the repair throughout its execution. during the embryological development process, the upper lip is formed by the fusion of maxillary prominences with the median nasal processes in the midline. after their fusion, intermaxillary segment arises from the medial nasal prominences and forms the nasal tip, columella and the philtrum. the vermilion, which is the transition zone between the lip skin and the mucosa, also develops from the maxillary processes, which fuse in the midline represented as frenulum [figure 10a ]. the preferential junctional line for skin is philtral column and for the white roll, vermilion and mucosa is midline [figure 10b ] ; evident by the fact that in bilateral cleft lip repair, the scar lies in midline on the vermilion, which is barely visible even in close - up view. (a) illustration showing development of vermilion from maxillary processes favouring midline closure of the vermilion, white roll and the mucosa (adaptation from langmans medical embryology. (b) illustration showing the preferential junctional line for the upper lip. for skin portion, it should be the philtral column, and for white roll, vermilion and mucosa it should be midline it has been documented that 86% of the surgeons do not alter the type of technique depending on the preoperative cleft characteristics. numerous studies point out modifications made in the skin incision in rotation - advancement flap method to address different issues of nasal asymmetry, lip length and philtral scar but very few studies point out the need for modification or change required in the vermilion repair. reddy. studied and compared the outcome of rotation - advancement repair, pfeifer wave line incision and afroze incision. they subjectively evaluated (not a randomised control trial) and inferred afroze incision which is actually a combination of millard and pfeifer incision yields better results in terms of vermilion match, white roll match and scar appearance but equal to millard 's technique when nasal symmetry is compared and similar to pfeifer incision when lip length is compared. wrv flap addresses the issue of vermilion notching and scar appearance with a slight modification in the incision at the vermilion - skin junction preserving all the other elements of classic millard 's rotation - advancement flap. vermilion notching develops in repaired lips as a consequence of inadequate rotation of the medial lip segment, lack of bulk of muscle in the vermilion and scar contracture along the cutaneous or mucosal aspect of the lip. in his original articles this laterally based flap was fashioned as a tongue of posterior mucosa that was brought across into a relaxing incision on the medial side or it could be done as an anterior onlay or central tongue in dart. when the vermilion is attenuated, a posterior mucosal z - plasty and/or a relaxing incision behind the thin area can be used to release the mucosa. he had also stressed on the importance of performing inter - digitation at the junction of the white roll (vermilion - cutaneous junction), because when the vertical scar crosses this line, it causes an obvious break in colour and contour. byrd and stal used techniques similar to those of millard, specifically the lateral triangular vermilion flap to augment the deficient medial vermilion. in contrast to lateral vermilion flap used by millard, which consists of only mucosa, wrv flap has vermilion, orbicularis muscle and white roll as its components from the lateral lip segment. this flap is sutured in the midline across the cleft allowing more embryological and anatomical closure of the vermilion of the lip [figure 11 ]. (a) illustration showing final suture line after millard 's repair, (b) illustration showing final suture line after noordhoff 's repair, (c) illustration showing final suture line after white roll vermilion turn down flap mulliken executes three separate (laterally based) unilimb z - plasties during the mucosal - vermilion - cutaneous closure. the second unilimb z - plasty is at the vermilion - mucosal junction to prevent notching. this serves to augment the height of the medial vermilion and is similar to that described by noordhoff. the third is a small triangular flap (2 - 2.5 mm at its base) at the vermilion - cutaneous junction that carries white roll across the scar line and lowers the vermilion - cutaneous junction on the medial side of cupid 's bow. wrv flap breaks the vermilion - cutaneous junction into zigzag closure both in vertical as well as in anteroposterior plane making it less prone for scar contracture, which is seen with straight line closure more often. it also provides a solution to the problem of vermilion notching owing to its muscle component and the prevention of scar contracture at the mucosal aspect. there is no significant variation in this technique when done for secondary cases where vermilion of the medial lip segment is scarred, lost or deficient. it offers a reliable option to use vermilion with its white roll from the lateral segment for substitution on the medial side as no other method or technique can replace this tissue. disadvantage of this technique only includes associated learning curve as there is need for meticulous incision (preferably under magnification) just above the white roll in both the segments and not to err on the thinner side while raising the wrv flap. if the incision on either or both of the segments is made below the white roll, it will lead to double white roll or no white roll in the reconstructed lip, respectively. the aim of the technique in this article is to identify and develop an optimal incision design in cleft lip surgery. it would require prospective studies and statistical evaluation in future to grade the results when compared to conventional techniques. the eurocleft study, a previously performed, large scale, multi - centric study has demonstrated that constancy of protocols in a centre leads to best outcomes. any technique or modification individually can not necessarily produce the best results in all the patients but better results are achieved when they are analysed, and modifications are applied to operative principles based on experience. in presenting a modification, we hope to stimulate a discussion regarding the advantages of various techniques in cleft lip surgery. millard 's rotation - advancement repair has had a major impact on cleft lip surgery since the 1960s. critical analysis of post - operative results led to various modifications in the technique since then. performing such modifications, while maintaining original surgical goals, has allowed the millard 's repair to remain the most popular method of cleft lip repair throughout the world. wrv flap technique is effective in preventing and correcting many vermilion and white roll deformities with promising aesthetic outcome. wrv flap is now the preferred method at our centre for primary cleft lip repairs for restoring what millard termed ideal beautiful normal and for building hope while building smiles. | aim : numerous modifications of millard 's technique of rotation advancement repair have been described in literature. this article envisions a new modification in millard 's technique of primary unilateral chieloplasty.material and methods : eliminating or reducing the secondary deformities in children with cleft lip has been a motivating factor for the continual refinement of cleft lip surgical techniques through the years. vermilion notching, visibility of paramedian scars and scar contracture along the white roll are quite noticeable in close - up view even in good repairs. any scar is less noticeable if it is in midline or along the lines of embryological closure. white roll vermilion turn down flap (wrv flap), a modification in the millard 's repair is an attempt to prevent these secondary deformities during the primary cleft lip sugery. this entails the use of white roll and the vermilion from the lateral lip segment for augmenting the medial lip vermilion with the final scar in midline at the vermilion.result:with an experience of more than 100 cases of primary cleft lip repair with this technique, we have achieved a good symmetry and peaking of cupid 's bow with no vermilion notching of the lips.conclusion:wrv flap aims to high light the importance of achieving a near normal look of the cleft patient with the only drawback of associated learning curve with this technique. |
currently, those aged 65 years and older constitute the fastest growing segment of the canadian population. in 2012, there were only 230242 specialists in geriatric medicine in canada ; to meet the health - care needs of the elderly population, an increase in the number of physicians specialized in geriatric care is needed. career intentions are strongly influenced by exposure to role models in a particular clinical field and early patient contact. however, many canadian medical students make career choices early, often without much exposure to the field of geriatric medicine. in addition, thus, many students do not have any exposure to geriatric medicine throughout their entire undergraduate medical career. pre - clerkship medical students have noted that a lack of clinical exposure to certain specialties precluded them from making informed career decisions. previous interventions involving early clinical exposure to emergency medicine and infectious diseases have been shown to increase interest in those specialties. furthermore, interventions involving clinical contact with the elderly have also demonstrated an increase in positive attitudes towards caring for geriatric patients. the queen s geriatrics interest group (qgig) is a student - run initiative at the queen s university school of medicine and was developed to foster interest in the field of geriatric medicine. a new qgig initiative, the geriatrics pre - clerkship observership program, was developed in collaboration with the division of geriatric medicine at providence care st. the purpose of this study was to evaluate the impact of pre - clerkship observerships on student experiences and attitudes towards geriatric medicine. mary s of the lake hospital partnered to create a centralized sign - up system for geriatric medicine observerships. all first and second year queen s medical students (n=201) were eligible to sign up on a first - come - first - served basis. each observership time slot was scheduled as a four - hour weekend morning shift at st. the observerships coincided with weekend on - call rounds for the inpatient geriatric rehabilitation unit. this unit offers clinical assessment, treatment, and rehabilitation for frail seniors with complex health needs. during the observership, participants were paired with a resident with oversight from the attending staff physician on - call, who was either a geriatrician or physician with training in care of the elderly. residents were trainees in family medicine, internal medicine or psychiatry, completing their geriatric medicine rotations, or pgy3 residents in family medicine care of the elderly programs. during their observership, students performed tasks such as reviewing patient charts and medication lists, taking a patient history and conducting parts of the physical exam. pre - clerkship students participating in the observership were emailed surveys created using google forms (google inc.) the pre- and post - observership surveys collected information using three methods : two internally developed likert scale questionnaires to quantitatively assess the students previous experiences with, interest in, and knowledge of geriatric medicine pre - observership and the students clinical experience post-observership.the university of california los angeles geriatric attitudes survey (ucla gas), a fourteen - item likert scale questionnaire originally published in 1998 by reuben and colleagues, and then evaluated for validity and reproducibility in assessing pre- and post - intervention attitudes towards older patients among health - care professionals (see table s.1 in the supplementary materials file).narrative feedback of the participant s experience. two internally developed likert scale questionnaires to quantitatively assess the students previous experiences with, interest in, and knowledge of geriatric medicine pre - observership and the students clinical experience post - observership. the university of california los angeles geriatric attitudes survey (ucla gas), a fourteen - item likert scale questionnaire originally published in 1998 by reuben and colleagues, and then evaluated for validity and reproducibility in assessing pre- and post - intervention attitudes towards older patients among health - care professionals (see table s.1 in the supplementary materials file). descriptive statistics were used to characterize the participant sample. the mean and total score for each ucla gas statement was calculated, and scores were compared pre- and post - intervention. statements 2, 3, 5, 6, 8, 10, 11, 12, and 13 of the ucla gas are negatively worded and were reverse scored for these analyses. in the primary analysis, statistical significance was determined using unpaired t - tests on all of the pre - observership (n=27) and post - observership (n=22) responses for each ucla gas statement, as well as the mean total ucla gas scores. a secondary analysis involved conducting paired t - tests on the paired pre- and post - observership responses (n=18). two individuals independently reviewed the narrative feedback and conducted a thematic analysis to extract common themes. twenty - seven participants completed the pre - observership survey (response rate 64%) and 22 completed the post - observership survey (response rate 52%). characteristics of the participants who completed the pre- and post - observership surveys are summarized in table 1. responses to the pre- and post - observership internally developed questionnaires are summarized in table 2. characteristics of participants who completed the pre- and post - observership surveys responses to the pre- and post - observership internally - developed questionnaire the primary analysis was conducted using all pre - observership (n=27) and post - observership (n=22) ucla gas responses. figure 1 displays the mean scores of the pre- and post - observership responses to the ucla gas statements. unpaired t - tests conducted on the pre- and post - observership responses to each of the 14 ucla gas statements revealed no statistically significant differences. the unpaired t - test conducted on pre- versus post - observership mean total ucla - gas scores also failed to detect any statistically significant difference (p=.21). gas responses (primary analysis) and paired responses (secondary analysis) pre - obervership (n=27) and post - observership (n=22) responses to the 14 statements in the ucla - gas (1 = strongly disagree, 5 = strongly agree) a secondary analysis was conducted using the paired pre- and post - observership responses (n=18). the paired t - tests conducted on the paired responses showed statistically significant differences (p<.05) for two of the 14 statements (statements 4 and 11). however, as in the primary analysis, the paired t - test conducted on the pre- versus post - observership mean total ucla the majority of students reported little to no exposure to geriatric medicine within a clinical context prior to their involvement in the observership program. moreover, 85% of students agreed that there are currently too few curricular opportunities to learn about geriatric medicine during pre - clerkship. all of the participants (1) agreed that the observership was a worthwhile learning opportunity, (2) identified their preceptor as a good role model, and (3) recommended the observership program continue. narrative responses from the pre - and post - observership surveys underwent thematic analysis to discover common responses to the questions posed of participants (see tables s.2s.5) for summary of themes and sample quotes). prior to the observership, the common objectives were to learn more about geriatric medicine, work with the elderly, try something new, and gain clinical experience. themes appreciated from the responses realized a desire for insight into the career of a geriatrician, clinical exposure involving elderly patients, and an opportunity to practice clinical skills. in the post - observership survey, the principal areas of enjoyment with the experience were having a preceptor who was a good role model and teacher, learning about geriatric medicine and the patient population, and practicing clinical skills, along with an increased understanding of the pace of geriatric medicine, and an appreciation of the ease of setting up the observership. suggested key areas of improvement were offering observerships on weekdays and providing greater patient interaction. characteristics of the participants who completed the pre- and post - observership surveys are summarized in table 1. responses to the pre- and post - observership internally developed questionnaires are summarized in table 2. characteristics of participants who completed the pre- and post - observership surveys responses to the pre- and post - observership internally - developed questionnaire the primary analysis was conducted using all pre - observership (n=27) and post - observership (n=22) ucla gas responses. figure 1 displays the mean scores of the pre- and post - observership responses to the ucla gas statements. unpaired t - tests conducted on the pre- and post - observership responses to each of the 14 ucla gas statements revealed no statistically significant differences. the unpaired t - test conducted on pre- versus post - observership mean total ucla - gas scores also failed to detect any statistically significant difference (p=.21). summary of pre- and post - observership ucla gas responses (primary analysis) and paired responses (secondary analysis) pre - obervership (n=27) and post - observership (n=22) responses to the 14 statements in the ucla - gas (1 = strongly disagree, 5 = strongly agree) a secondary analysis was conducted using the paired pre- and post - observership responses (n=18). the paired t - tests conducted on the paired responses showed statistically significant differences (p<.05) for two of the 14 statements (statements 4 and 11). however, as in the primary analysis, the paired t - test conducted on the pre- versus post - observership mean total ucla the majority of students reported little to no exposure to geriatric medicine within a clinical context prior to their involvement in the observership program. moreover, 85% of students agreed that there are currently too few curricular opportunities to learn about geriatric medicine during pre - clerkship. all of the participants (1) agreed that the observership was a worthwhile learning opportunity, (2) identified their preceptor as a good role model, and (3) recommended the observership program continue. narrative responses from the pre - and post - observership surveys underwent thematic analysis to discover common responses to the questions posed of participants (see tables s.2s.5) for summary of themes and sample quotes). prior to the observership, the common objectives were to learn more about geriatric medicine, work with the elderly, try something new, and gain clinical experience. themes appreciated from the responses realized a desire for insight into the career of a geriatrician, clinical exposure involving elderly patients, and an opportunity to practice clinical skills. in the post - observership survey, the principal areas of enjoyment with the experience were having a preceptor who was a good role model and teacher, learning about geriatric medicine and the patient population, and practicing clinical skills, along with an increased understanding of the pace of geriatric medicine, and an appreciation of the ease of setting up the observership. suggested key areas of improvement were offering observerships on weekdays and providing greater patient interaction. the results of the secondary analysis, paired t - tests conducted on the paired responses, showed statistically significant differences only for ucla gas items 4 and 11. these non - significant results from our relatively small study may reflect that we were underpowered to detect modest positive benefits of the geriatrics observership program on pre - clerk student attitudes. alternatively, however, the statistically significant differences on two items may be a result of chance from multiple comparisons. our results are consistent with previous studies looking at structured pre - clerkship clinical experience in various subspecialties such as emergency medicine, general surgery,(11,12) and infectious disease. historically, short duration interventions (e.g., those lasting hours to days) have not shown significant difference in attitudes towards geriatric patients. for instance, hughes and colleagues examined the effect of an eight - day course in geriatric medicine, which, like our study, did not affect attitudes toward older people but did increase willingness for students to consider geriatric medicine. moreover, a study assessing the impact of a required palliative care educational intervention found an improvement in knowledge among medical students in addition to career exploration, which may ultimately contribute to better patient outcomes. they allow for students to learn in authentic clinical settings, as well as interact with practicing physicians and trainees in a given field of medicine. of note, previous studies have identified pre - clerkship clinical experiences as having a positive effect on students attitudes and interests towards a particular field, as well as helping them make more informed career choices. this study is the first to investigate pre - clerkship students experiences with structured observerships in geriatric medicine. the current north american matching process for residency programs pressure medical students to choose a specialty early on, with two - thirds of students entering their last year having already chosen their careers. early exposures to various clinical fields in pre - clerkship years thus have a great impact in students career decisions. however, the majority of pre - clerkship students participating in this study have had little to no prior exposure to geriatric medicine. potential barriers for students looking to set up observerships may include not knowing which physician to contact and difficulty in setting up a mutually agreeable time. this study demonstrates that a structured observership program was easy to establish and popular among medical students. moreover, the results of this study revealed that all participants found their preceptors to be good role models, with the majority of students noting the experience stimulated their interest in geriatric medicine as a career specialty. despite the lack of statistically significant changes in attitude as measured by the ucla gas, our program received otherwise positive narrative feedback. more specifically, all participants noted they would recommend this program to be continued, with 90% of the participants planning on joining the program again. the enthusiasm for more geriatric observerships suggests that an intervention of longer duration may have a positive effect on attitudes and interest towards geriatric medicine. in addition, as students chose to participate in the observership outside of regular curricular time, the observership program highlights an opportunity to increase early exposure to geriatric medicine through extracurricular time. similar programs may be adopted by other medical schools as an extracurricular means to increase early exposure to geriatric medicine in the pre - clerkship years, especially as many undergraduate medical programs have limited mandatory geriatric medicine exposure. further evaluation is needed to determine if there would be a statistically significant difference in the ucla gas given a larger sample size. in addition, the observership program may be used by residents and attending geriatricians to help identify students who are interested in geriatrics early on in their training ; this allows for further mentorship during medical student training. limitations of this study warrant consideration. due to the small sample size, the study was likely underpowered to detect important differences in attitudes resulting from the observership experience. in addition, there may have been selection bias, as those who chose to participate in the observership program may have greater interest in geriatric medicine than the average medical student population. the self - report nature of the surveys on attitudes could have influenced participants answers, resulting in response bias. there was also variability in the intervention, as each participant s experience was dependent on a number of non - modifiable factors, such as number of patients on the ward at the time of their observership and the nature of patient and preceptor interaction. the lack of long - term follow - up data limits the scope of this study from being able to examine whether any change in career choice comes as a result of participation in this program. in this study looking at structured pre - clerkship observerships in geriatric medicine with 42 participants, students enjoyed learning about the specialty, working with the preceptor and patients, and having the opportunity to practice clinical skills. students enjoyed the ease of setting up the observership and the pace of geriatric medicine, which allowed residents the time to teach and in turn helped build meaningful mentorship experiences. with the majority of students having had little to no exposure to geriatric medicine prior to the observership, our study demonstrated that experiences such as pre - clerkship observerships can stimulate interest in geriatric medicine. despite the lack of a statistically significant difference in preand post - observership attitudes per the ucla gas scores, all of the respondents felt the experience to be worthwhile and would like the observership program to continue for next year. overall, structured pre - clerkship clinical exposure to the field of geriatrics is an easily implementable method of fostering interest and understanding of geriatric medicine and, as such, may serve as an adjunct to the existing medical school curriculum. | background and purposeto foster interest in geriatric care, the queen s geriatrics interest group (qgig) collaborated with the division of geriatric medicine to arrange a geriatrics pre - clerkship observership program.methodsforty-two pre - clerkship medical students participated in the program between october 2013 and may 2014. participants were paired with a resident and/or attending physician for a four - hour weekend observership on an inpatient geriatric rehabilitation unit. the program was assessed using : (1) internally developed likert scales assessing student s experiences and interest in geriatric medicine before and after the observership ; (2) university of california los angeles geriatric attitudes scale (ucla - gas) ; and (3) narrative feedback.resultsall participants found the process of setting up the observership easy. some 72.7% described the observership experience as leading to positive changes in their attitude toward geriatric medicine and 54.5% felt that it stimulated their interest in the specialty. no statistically significant change in ucla gas scores was detected (mean score pre- versus post - observership : 3.5 0.5 versus 3.7 0.4 ; p=.35). all participants agreed that the program should continue, and 90% stated that they would participate again.conclusionsthe observership program was positively received by students. structured pre - clerkship observerships may be a feasible method for increasing exposure to geriatric medicine. |
polycyclic aromatic hydrocarbons or polynuclear aromatic hydrocarbons (pahs) are compounds produced through incomplete combustion and pyrolysis of organic matter. both natural and anthropogenic sources such as forest fires, volcanic eruptions, vehicular emissions, residential wood burning, petroleum catalytic cracking, and industrial combustion of fossil fuels contribute to the release of pahs to the environment. the presence of pah compounds in soils is an issue of concern due to their carcinogenic, mutagenic, and teratogenic properties. in 2008, 28 pahs have been identified as priority pollutants by the national waste minimization programme, a project which is funded by us environment protection agency. pahs which consist of fused benzene rings are hydrophobic in nature with very low water solubility and high octanol - water partition coefficient (k ow). hence, they tend to adsorb tightly to organic matter in soil rendering them less susceptible to biological and chemical degradation. prolonged aging time in contaminated soil promotes the sequestration of pah molecules into micropores and increases the recalcitrance of pahs towards treatment. thus the extraction process of pahs from soil for analysis is made more complicated due to these factors. in this paper, various analytical extraction techniques for pahs in soils will be reviewed, ranging from more widely applied methods such as soxhlet extraction, sonication, mechanical agitation, and accelerated solvent extraction to alternative ones such as supercritical and subcritical fluid extraction, microwave - assisted extraction, solid phase extraction and microextraction, thermal desorption and flash pyrolysis, as well as fluidised - bed extraction. the influencing factors in the extraction of pahs from soil such as temperature, type of solvent, soil moisture and other soil characteristics are also discussed. finally, a review of the models used to describe the kinetics of pah desorption from soils during solvent extraction will be provided. the soxhlet extraction has been vastly used as a benchmark technique in the extraction of pahs from soils and sediments. basically, in the soxhlet extraction technique, the solid sample is placed into an extraction thimble which is then extracted using an appropriate solvent via the reflux cycle. once the solvent is boiled, the vapour passes through a bypass arm into the condenser, where it condenses and drips back onto the solvent in the thimble. as the solvent reaches the top of the siphon arm, the solvent and extract are siphoned back onto the lower flask whereby the solvent reboils, and the cycle is repeated until all the sample is completely extracted into the lower flask. the main disadvantage of this extraction process is the use of large volumes of solvent, which can be more than 150 ml for the extraction of pahs from a mere 10 g of soil sample. in addition to that, this method is very labour intensive and time consuming, as the solvent has to be refluxed up to 24 hours to achieve considerable extraction efficiencies [4, 5 ]. the soxhlet extraction too has been shown to have relatively poor selectivity for pahs compared to bulk soil organic matter, with approximately a quarter to one third of bulk soil organic matter removed during extraction. studies have indicated that the chromatograms of extracts produced via soxhlet using gc - ms and gc - fid yielded more artefact peaks with branched alkane humps, demonstrating that compounds such as n - alkanes and humic substances other than pahs are coextracted using the soxhlet technique [6, 7 ]. other minor drawbacks of using the soxhlet apparatus include the likelihood of sample carryover, the need to fractionise extracts to avoid heavy contamination of gc injection port, and the unfeasibility of redissolving dried soxhlet extracts [8, 9 ]. nonetheless, the soxhlet extraction is still the preferred method because of its comparative extraction results despite the nature of matrix sample. not only does the soxhlet extraction yields similar results with methods such as the supercritical fluid extraction (sfe), microwave - assisted extraction (mae), accelerated solvent extraction (ase), and ultrasonic methods, but the results also show small variations with low relative standard deviations [1012 ] statistically, berset. showed that the soxhlet method resulted in median values which corresponded to the overall mean of other extraction procedures including ase, sfe, mae and sonication. the efficiency of the soxhlet extraction increases with molecular weight, reaching an efficiency range of 84100% for pahs with more than 4 rings. to further improve the soxhlet extraction technique, edward randall patented the automated soxhlet extraction method in 1974 this is a two - step procedure which combines boiling and rinsing such that the total extraction time is reduced while the evaporated solvent condenses rapidly for reuse, reducing the amount of total solvent required. in this improved technology, the extraction thimble is initially lowered directly into the flask containing the boiling solvent to remove residual extractable material while the extractable materials pass readily from the sample and dissolve into the solvent simultaneously. the level of solvent is then reduced to a level below the extraction thimble such that the configuration mimics the traditional soxhlet extractor whereby the pah is extracted by refluxing condensed solvent and collected in the solvent below the extraction thimble. with this improvisation, the pah extraction efficiencies and precisions were statistically improved, with almost 100% recovery rates. in addition to that, the compact design of the automated system also allows several samples to be extracted simultaneously with its multiple extraction cells assembly while being run unattended [4, 5 ]. the ultrasonic agitation, also known as sonication, is a technique which engages the acoustic energy of ultrasonic waves with a minimum frequency of 16 khz in fluid, causing rapid compression and rarefaction of fluid movement which results in the cavitation phenomenon, that is, the reoccurring formation and collapse of microbubbles. this agitation can be performed either by immersing a sonicator transducer also known as an ultrasonic horn into the sample solvent mixture or placing the sample solvent mixture directly into a sonication bath. the desired ultrasound is generated by means of piezoelectric ceramic attached either to the ultrasonic horn or the walls of the sonication bath. sun. claimed that sonication was better than the soxhlet because it provided higher extraction efficiencies, was more economical and easily operated. likewise, guerin noted that similar levels of extraction efficiency to the soxhlet extraction method could be attained through vigorous sonication. however, the level of extraction efficiency was observed to be highly dependent on the sample matrix and concentration of contaminants in the sample. contrary to these observations, other studies have indicated that sonication was less efficient than the soxhlet with relatively low recoveries particularly for lower molecular weight pahs (4476%) [13, 16 ]. the power amplitude and duration of sonication need to be carefully controlled in order to avoid extensive exposure to the irradiation which may degrade the contaminants in the sample and reduce the extraction rates of pahs. the decrease in efficiency during excessive sonication is due to an increase in broken carbonaceous particles and additional contact surface area which adsorbs the pahs more readily, causing a reversed adsorption cycle of pahs. additionally, further separation techniques such as centrifugation or filtration are required after the extraction process. this simple, low - cost method uses agitation or mixing action to extract the pahs from samples in a shake - flask placed onto a rotary shaker, or with a magnetic stirrer submersed into the flask directly. although it is an easy handling method with minimal glassware and smaller volumes of extraction solvent, this method has not been as widely used as the soxhlet and sonication due to the lower extraction efficiency and unsatisfactory quantitative results [5, 7 ]. although some studies reported that this method was comparable to the soxhlet technique, the results obtained using mechanical shaking showed larger variations and less selectivity due to the difficulty in quantifying the pah extracts [12, 17 ]. comparable results were only attainable with long shaking times to extend the contact time with solvent [18, 19 ]. accelerated solvent extraction (ase) or pressurised fluid extraction (pfe) is a fairly new technology which raises the solvent temperature above its boiling point but maintains it in the liquid phase by elevating the pressure. as a result, the high pressure aids in the solubilisation of air bubbles, thereby exposing more of the sample to the extraction solvent while increasing the capacity of the heated solvent to impart better solubility. today, ase systems are commercially available for extracting organic compounds from a variety of solid samples. the ase system is built up of several extraction cells on a loading tray proximate to an oven. during extraction, organic solvent is pumped into the extraction cells preloaded with soil samples while increasing the temperature and pressure to the desired values. once extraction is completed, a nitrogen cylinder is used to purge the samples of residual solvent. with the usage of the ase system, the recovery of pahs from soils and sediments was reported to be two times higher than using the soxhlet extraction method, while the accuracy was also improved with a relative standard deviation of less than 10%. other benefits of ase include reduction of solvent consumption and total time required due to the use of high pressures. the extraction procedure can be fully automated with an online purification column, preventing loss of the volatile pahs, avoiding tedious preparation and potential contamination as in the case of mechanical shaking [21, 22 ]. supercritical fluids exhibit a continuum of both gaseous and liquid phase properties. their physical characteristics including liquid - like density, low viscosity, high diffusivity and zero surface tension carbon dioxide which has a supercritical temperature and pressure of 31c and 74 bar, respectively, is widely employed in sfe as an environmentaly friendly solvent in its supercritical state. in a study by mige., comparisons between soxhlet and sfe extraction revealed that the recoveries of pahs for both methods were almost similar. although the sfe technique was more difficult to optimise, the technique provided extraction results with lower relative standard deviation and better selectivity, due to cleaner extracts. other studies [6, 23 ] also indicated that sfe removed only 8% of the bulk organic matrix in comparison with soxhlet extraction or ase which extracted a quarter to one third of bulk soil organic matter. furthermore, integrated sfe systems allow concentrated extracts to be directed straightaway into the cleanup column, reducing the need to remove the eluate manually. in certain sfe systems, the extracts may also be analysed directly by gc without any cleanup. this prevents extra contamination that may occur during manual handling [12, 24 ]. however, the high complexity of the sfe process may contribute to inconsistent results this system should be carried out in different laboratories. in the development of sfe, water has also been considered as the extraction fluid. however, the use of supercritical water is limited because of the high temperature (> 374c) and pressure (> 218 atm) requirements which creates a highly corrosive environment. thus, subcritical water extraction (swe) also known as pressurised hot - water extraction is used instead. as the temperature of water is raised from 100c to 274c under pressure, the hydrogen bonding network of water molecules weakens resulting in a lower dielectric constant and simultaneously decreasing of its polarity. thus, subcritical water becomes more hydrophobic and organic - like than ambient water, promoting miscibility of light hydrocarbons with water. in contrast to sfe which extracts mostly non polar organic compounds, it has been reported that swe gives better preference to more polar analytes, therefore providing a higher extraction efficiency of pahs with less or almost no extraction of other alkanes. wet oxidation or swe combined with oxidation using oxidising agents such as air, oxygen, or hydrogen peroxide was reported to remobilise bound organic residues, providing a higher extraction capability [27, 28 ]. in one study, swe combined with oxidation resulted pah soil extraction efficiencies within the range of 99.199.99% compared to extraction efficiencies within 7999+% using swe alone. another highly instrumental extraction technique is the mae whereby both solvent and samples are subjected to heat radiation energy attained from electromagnetic wavelengths between 1 m and 1 mm, with frequencies of 300 mhz to 300 ghz. microwave radiation is preferred compared to conventional heating due to its rapid heating which is reproducible and has less energy losses. modern designs of the microwave ovens include carousels which can hold at least twelve extraction vessels allowing simultaneous multiple extractions. the main advantages of the mae method are the reductions in solvent usage and time. in comparison to sfe, additionally, this unique heating mechanism provides selective interaction with polar molecules which greatly enhances the extraction efficiency of pahs [29, 30 ]. the major drawback of this method however is that the solvent needs to be physically removed from the sample matrix upon completion of the extraction prior to further analysis. in certain cases whereby samples are pretreated with activated copper bars to assist the extraction process, the removal of this copper is necessary for a cleaner extract. although a subsequent purification step can be implemented to rectify this problem, there may be possibilities of losing analytes or inducing contaminants with additional cooling time for this extra handling. furthermore, the sample allowance for analysis is limited to 1.0 g which is insufficient for a homogenous analysis. solid phase extraction (spe), a method that is generally used to clean up a sample has been used for rapid and selective extraction of pahs from soil samples. soil samples are washed with solvent to leach away undesired components before extraction of pahs with a different solvent into a collection tube. when this extraction technique is employed, filtering over an empty spe column or using purified sand prior to extraction is usually recommended to prevent soil samples clogging the spe column. a variation to the spe of pahs from soils is the solid phase microextraction (spme). ouyang and pawliszyn described the application of the technique on pah extraction from soils. this solvent free approach utilises a small diameter fused - silica fibre coated with the extracting phase and mounted in a syringe - like device for protection and ease of handling. the depth of injected needle is adjusted for headspace sampling before exposing the fibre which adsorbs the pahs from the soil. the exposed spme fibre is then transferred directly to the injection port of an analytical instrument such as a gc for quantitative analysis. the major advantage of the spme is its fast, simple and convenient extraction which can be done on - site. the configuration of the solid - phase microextractor offers solutions to sampling problems because it allows extraction of small volume of samples which can then be analysed without any pretreatment. when stored properly, the fibre on the needle can also be analysed several days later in the laboratory without significant loss of volatiles. the capability of the spme device to extract such small volumes of samples requires extreme precision during manufacturing to achieve homogeneity in the construction of the fibre (extraction phase surface) to provide consistency in extraction outcomes and qualities. one study using spme revealed that only volatile compounds such as lower molecular weight (lmw) pahs (less than 4 rings) were detected. another alternative pah extraction technique is thermal desorption which does not use solvents or high - pressure extraction equipments. the thermal desorption technique is commonly coupled with gc by direct injection of solid sample onto the cold injector. the carrier gas is temporarily halted while the injector is rapidly heated to the desired temperature approximately within 200500c to volatilise targeted compounds from soil. the carrier gas is then resumed and the isothermally extracted compounds are swept onto the gc column, providing a direct and rapid analysis of the contaminated soil. thermal desorption and online gc analysis technique has been widely employed in the analysis of pahs in various matters including fly ash, ambient air particulate matter as well as creosote and petroleum contaminated soil [3639 ]. the technique, however, requires prior calibration to allow for nonlinear response to sample size and concentration of contaminants. contrary to thermal desorption, pyrolysis (py) or high temperature distillation (htd) extraction technique employs high rate temperature ramping or flash pyrolysis at high temperatures. in flash pyrolysis, the sample is heated in a very short time using either inductive heating (also known as curie point pyrolysis) or ohmic heating using platinum foil. the significant increase in heat energy in the system causes thermal cracking of larger macromolecules into simpler monomers which are more volatile. due to its high heating velocity, accurate temperature reproducibility and wide temperature range, the py has successfully been applied to various nonvolatile compounds and matrices such as synthetic plastics, rubbers and paints. have demonstrated its novel application in the analysis of pahs in contaminated soil. here, induction heating of the soil sample is carried out in a ferromagnetic foil called pyrofoil in an oven equipped with a radio frequency field to reach the curie point temperature (1601040c) whereby the pyrofoil loses its magnetic properties and simultaneously adopts the specific property of a heated alloy. as such, the soil sample which is wrapped inside the pyrofoil is desorbed of the pahs and the pah bearing pyrolysates are transferred immediately into an online gc column for further analysis. pyrolysis methods have been a more popular choice than thermal desorption due to their capabilities in providing greater temperature control. with high temperature py method, the extraction speed is also significantly reduced, permitting a higher number of samples to be analysed. the main advantages of thermal desorption or pyrolysis with online gc is the exclusion of reconcentration and clean - up steps necessary for some other extraction methods. therefore, the contamination risks are lower with higher sensitivity and specificity when these methods are employed. similar to spme, the use of solvents are also eliminated, which subsequently reduces cost. nonetheless, the small sample size used (approximately 30 mg) may result in insignificant data analysis errors since it does not provide a good representative of the entire field soil. in addition, the temperature program used has to be carefully optimised to avoid the decomposition of the cellulose filter itself, which may result in formations of undesirable byproducts. fluidised - bed extraction (fbe) has also been reported in the specialised literature to extract pahs from soils. the system is analogous to the automated soxhlet extraction apparatus whereby the soil sample is loaded into an extraction tube secured with a filter at the bottom while the extraction solvent is filled into the basic vessel beneath the soil sample. the heating block of the device is first heated up to evaporate the extraction solvent through the filter which then condenses when in contact with the cooling bar above the soil sample. the condensed solvent then drips back into the soil sample and further down into the collected solvent. the constant penetrating flow of solvent vapour heats up and agitates the soil mixture, causing it to be fluidised. the collected solvent in the basic vessel is then concentrated for further analysis. in comparison with the conventional soxhlet extraction, the extraction duration and solvent used in the majority of analytical studies using ase, sfe, and mae, the pah extraction efficiencies were observed to generally increase with increasing temperatures, as can be seen in table 1 [9, 31, 4246 ]. elevated temperatures reduce both fluid density and viscosity, resulting in lower surface tension and improved contact between the solvent and targeted pah analytes. the diffusion of pahs through the soil as well as the diffusion of solvent into the interior of the soil matrix is enhanced. likewise, the desorption of pahs from the solid matrix and their solubilities in the extraction solvent are improved by increased temperatures. as such, the time to achieve equilibrium is significantly shortened. unfortunately, 2- and 3rings pahs are highly volatile and more susceptible to evaporation instead of extraction at higher temperatures. thus, the reported extraction efficiencies for lmw pahs were less than the higher molecular weight (hmw) pahs. a few papers reported that increasing temperatures caused a general decrease in the pah extraction efficiencies and recovery yields [44, 47 ]. while there is no certain explanation for this behaviour, it has to be noted that these studies were using sfe. table 2 is a bibliographic compilation of pah extraction studies from soils using various solvents. generally, the choice of extraction solvent is dependent on several factors, with one of them being the degree of pah concentration in the soil. for lowly polluted soil (g / kg dry weight sample), pahs are mainly found on the surface, therefore a more polar solvent such as acetone is preferred to break up the soil aggregates and to allow intensive contact between particles. for highly polluted soil (mg / kg dry weight sample) however, a relatively nonpolar solvent such as toluene or cyclohexane would be a better solvent. since the principles of solvent extraction are based on the theory of like dissolves like, the polarity of solvent with respect to the polarity of pah contaminants also plays a role in determining the extent of solubility. for instance, it was shown that dichloromethane as an extraction solvent for pahs resulted in low recoveries for all compounds, whereas hexane - acetone (1 : 1) was an effective extraction solvent for pahs [48, 49 ]. apart from pah concentration and polarity of solvents, extraction efficiencies vary from one technique to another. in mae, for example, solvents are chosen based on their dissipation factor (dielectric constant) which determines the degree of absorption of microwave energy [31, 49 ]. the effects of soil moisture on pah extraction efficiencies are dependent on the type of extraction technique employed as shown in table 3. with mae studies, pah extraction efficiencies this is mainly due to the ability of the localised superheating to form gas bubbles from existing water residues in soil and cause expansion of pores, allowing solvent penetration into the matrix. additionally, the high dielectric constant of water allows more microwave absorption which in turn provides more heating [29, 30 ]. similarly, a study using sfe showed that for water content less than 10 wt. %, the water in soil acted as a modifier to the extraction solvent which increased the fluid 's capability to penetrate further into the soil particles. other sfe and soxhlet experiments revealed that the presence of soil moisture decreased or did not significantly affect the efficiency of pah removal from soil. soil drying is therefore carried out in some cases to eliminate the influence of moisture on the pah extraction efficiency. comparisons between various drying methods showed that thermal drying of soil between temperatures of 25c and 40c for several days was best for prevention of losses of volatile pahs while air drying was reasonably sufficient and freeze drying was least preferable due to partial loss of highly volatile pahs such as naphthalene. the extraction process of pahs was observed to be significantly more difficult from high clay content soil (> 40%) due to the fact that 32% of the total carbon content where most of the hmw pahs resided in was concentrated in the clay fraction. strong adsorption of pahs to clay surfaces also result in reduced desorption during thermal extraction and less detectable hydrocarbons., pahs are more easily extracted from fine soil fractions such as fine silts and clays than larger aggregate size fractions. reduced particle sizes allow ample diffusion and better accessibility of solvent through the matrix, thus increasing the flow rate of solvent and rate of extraction [17, 51 ]. the dissolution and desorption of pahs can be fitted to a first - order mass transfer coefficient model : (1)cw = ce[1exp (kt) ], where c w is the liquid - phase concentration at any point in time, k is the lumped mass transfer coefficient, c e is the equilibrium liquid - phase concentration and t is the contact time with the extraction solvent. the desorption process in sediments and soils contaminated with hydrophobic contaminants can be classified as a biphasic process, with a fast and a slow component [5355 ]. this two - site kinetic model is described by (2)cw = cec1exp (k1t)c2exp (k2 t), where c w is the liquid - phase concentration at any point in time, c e is the equilibrium liquid - phase concentration, c 1 is the equilibrium liquid - phase concentration of the first stage (rapid), k 1 is the mass transfer coefficient of first stage, c 2 is the equilibrium liquid - phase concentration of second stage (slow), k 2 is the mass transfer coefficient of second stage, and t is the contact time with the extraction solvent. this model treats the process as a combination of two kinetically controlled reactions occurring simultaneously, whereby the first stage is governed by a rapid partitioning between the solid and liquid phases while the latter stage is which generally slower than the first is kinetically controlled by other processes. equation (2) can also be employed in its fractional form whereby the rapidly desorbing fraction is s while the slowly desorbing fraction is (1 s) : (3)ctco=1[sexp (k1t)][(1s)exp (k2 t) ], where c t / c o is the fraction of the pah extracted after time t. of the pah extraction technologies discussed here, soxhlet extraction, ultrasonic and mechanical agitation can be implemented easily since the processes are carried out with minimal instruments or glassware and at ambient pressures. in comparison, ase and mae provide a faster extraction with lesser solvent consumption albeit at higher capital costs and possibly operating costs. pah extraction using supercritical carbon dioxide or subcritical water is an environmentaly friendly technique but entails the use of high pressure equipment. spe and spme, thermal desorption and flash pyrolysis, as well as fluidised - bed extraction are novel alternatives which require further in - depth studies prior to wide - scale adoption in laboratories. it has to be recognised that no single extraction technology can be the solution for all extractions of pahs in soils and sediments. costs, the required accuracy and precision in results, analysis time, as well as technical competence are factors to be considered in deciding the right extraction technique. | this paper aims to provide a review of the analytical extraction techniques for polycyclic aromatic hydrocarbons (pahs) in soils. the extraction technologies described here include soxhlet extraction, ultrasonic and mechanical agitation, accelerated solvent extraction, supercritical and subcritical fluid extraction, microwave - assisted extraction, solid phase extraction and microextraction, thermal desorption and flash pyrolysis, as well as fluidised - bed extraction. the influencing factors in the extraction of pahs from soil such as temperature, type of solvent, soil moisture, and other soil characteristics are also discussed. the paper concludes with a review of the models used to describe the kinetics of pah desorption from soils during solvent extraction. |
for each imaging marker, separate base, rs, rw, and full models were fit to the population of hd participants and the population of healthy controls (both from trackhd). here, hd participants are defined as subjects who have tested positively for the hd gene expansion. hd participants may be divided into two groups : participants who have not yet been diagnosed with hd based on characteristic motor symptoms of the disease (called premanifest) and participants who have been so diagnosed (called manifest). for healthy controls the corresponding full model for hd participants (including both manifest and premanifest participants) has the following form : (3)yhdij = sc(ageij,c)+shd(capij,hd)+dhdi+hd1i+hd2i(ageijage0)+hdij(t)+hdij where ycij = logit(zcij) is the logit transformation of the observation zcij of the volume of a brain region from healthy control i at visit j. yhdij = logit(zhdij) is a similar observation made on an hd participant. the logit transformation is defined as logit(x)=log(p/(1p)), where p = x100. inverse logit transformations are applied to results from the models when estimates of zcij and zhdij are needed. this procedure is guaranteed to produce estimates of zcij and zhdij that are positive and bounded above by intracranial volume 100. ageij and capij are the age and cap score of subject i at visit j 1 (i.e., capij = ageij(cagil)/k). where cagi is the cag length of subject i. l and k are constants. for each imaging biomarker, separate models are fit with cap scores defined with l = 30 and k=6.27 and with values of l and k that have been optimized for each biomarker. when l = 30 and k = 6.27 the cap score will be equal to 100 at the expected age of onset of motor symptoms. the above connection with expected age at motor onset will hold only approximately for optimized choices of l and k. details on the methods used to choose optimal values of l and k are given below. 12) that estimate normal aging effects and the toxic effect of mutant huntingtin, respectively. sc and shd are linear functions of the five dimensional parameter vectors c and hd but may be highly nonlinear functions of age and cap. 12, the knots in sc and shd are placed at the 5th, 27.5th, 50th, 72.5th, and 95th percentiles of the age and cap score distributions, respectively. c is estimated in the population of healthy controls but held constant at its base model value when ref. the present models include site effects (three dummy variables) and a gender effect. c 1, hd 1 are random intercept terms (for healthy controls hd participants) c 2 and hd 2 are corresponding random slope terms. the hd = (hd 1, hd 2) and c = (c 1, c 2) are twodimensional normal random variables with mean zero and covariance matrices hd and c. in tables, the sds and correlations of these random variables will be designated by (int), (slope), and cor(int, slope). the baseline constant age0 is taken to be 18.the c and hd are a normal residual error terms for the control and hd populations : they are assumed to have mean zero and sds sd(c) and sd(hd), respectively. these sds will be designated as (error) in the tables.the c(t) and hd(t) are realizations of continuous time rws (technically wiener processes). these processes are assumed to be initialized to zero when subjects are 18 years of age. their sds are designated by (wc) and (whd) (or simply (w) if the context makes the reference population clear. following the definition of a wiener process, t years after initialization c(t) will have an sd of (t)(wc) and hd(t) will have an sd of (t)(whd).the,, and terms are assumed to be mutually independent. note that the spline functions affect only the overall population trend. random intercepts, rss, and rws are simply added on to this overall trend. 12) that estimate normal aging effects and the toxic effect of mutant huntingtin, respectively. sc and shd are linear functions of the five dimensional parameter vectors c and hd but may be highly nonlinear functions of age and cap. 12, the knots in sc and shd are placed at the 5th, 27.5th, 50th, 72.5th, and 95th percentiles of the age and cap score distributions, respectively. c is estimated in the population of healthy controls but held constant at its base model value when ref. the present models include site effects (three dummy variables) and a gender effect. c 1, hd 1 are random intercept terms (for healthy controls hd participants) c 2 and hd 2 are corresponding random slope terms. the hd = (hd 1, hd 2) and c = (c 1, c 2) are twodimensional normal random variables with mean zero and covariance matrices hd and c. in tables, the sds and correlations of these random variables will be designated by (int), (slope), and cor(int, slope). the c and hd are a normal residual error terms for the control and hd populations : they are assumed to have mean zero and sds sd(c) and sd(hd), respectively. these sds will be designated as (error) in the tables. the c(t) and hd(t) these processes are assumed to be initialized to zero when subjects are 18 years of age. their sds are designated by (wc) and (whd) (or simply (w) if the context makes the reference population clear. following the definition of a wiener process, t years after initialization c(t) will have an sd of (t)(wc) and hd(t) will have an sd of (t)(whd). the,, and terms are assumed to be mutually independent. random intercepts, rss, and rws are simply added on to this overall trend. the submodel in which c 2 and c(t) both vanish is called the base model. the submodel in which c(t) vanishes is called the rs model and the submodel in which c 2 vanishes is called the rw model. final models were fit in nonmem 7.3 using the first order conditional estimation method with interaction. graphics, data analysis, and data management were performed in r version 3.2.0.13 the base and rs models are random effects models of the kind that nonmem was designed to fit and their fitting is straightforward. the rw and full models, however, require special attention in order to estimate the sds of the random walks (s). (2) and (3) above reveals them to be special cases of the eqs. 10, the models of the current article reduce to a set of stochastic differential equations in which the measurement model is trivial (i.e., f(xit,i)=xij) and system 's dynamics are of a particularly simple form (i.e., the integral of g(xit, di,i) is given, depends on t, but does not depend on xit). this leads to a simple kalman filter algorithm, which is iterated at each step of the nonmem optimization process and implemented through a userdefined $ pred script (see the online supplementary material for details) and nonmem code. in order to facilitate the estimation of nonlinear trends, the cap score enters into the model of ref. 3 as an argument to the spline function shd. this complicates the process of fitting models that will optimize the choice of l for each imaging biomarker. note that k is a normalizing constant that is useful in providing a consistent interpretation for the cap score models but which does not affect the model fit. to find optimal values of l, we set k = 1 and fit base models to ref. 3 for each integer value of l between 21 and 40 inclusive. the akaike information criterion (aic) values for these models (subtracting off their minimum value) are plotted in figure 1 for each of the 10 imaging biomarkers. an appropriate normalizing constant kopt can be computed from the formula : (4)kopt=6.2743lopt13 plots of akaike information criterion (aic) for the base model fitted with fixed values of l between 21 and 40 for all imaging biomarkers. the number 43 is a (somewhat arbitrary) centering constant, chosen because it is a very common value in the track dataset and in data from other observational studies. note that lopt = 30 implies kopt = 6.27, which agrees with the values used in ref. 1 and produces a cap score that is equal to 100 at the expected age of motor onset. for any value of lopt we may define a corresponding version of the cap score as : (5)cap(lopt)=age(cagl)/kopt we have the following : (6)cap(lopt)=rcap(30) where (7)r=1+cag4343lopt1+cag434330and cap(30) is the version of the cap score with l = 30 and k = 6.27. if follows that cap(l) = 100 r at the expected age of onset of motor symptoms. model fitting in this section was done using version 3.1 of the nlme package in r.14 additional details are in the online supplementary material. all models were fit to 10 structural magnetic resonance imaging markers from the 36month cutoff of the track data.2 the 36month track dataset contains annual observations on 366 subjects (45% men) equally distributed between four sites in europe and north america. one third of the sample consisted of healthy controls. of the hd participants, half were premanifest and half were in early stages of manifest disease. all markers represent volumes of anatomic features of the brain expressed as fractions of the total intracranial volume. the markers selected for this analysis include five markers processed by the iowa center representing volumes of the thalamus, striatum, caudate nucleus, putamen, and whole brain. in addition, we consider five markers processed by the london center representing volumes of the caudate nucleus, whole brain, ventricle, cortical gray matter, and cortical white matter. the distinction between iowa and london markers is important because the london markers were obtained using either the boundary shift integral or voxelbased morphometry (procedures that quantify annual changes in different locations of the brain within each individual). by contrast, the iowa variables are simple snapshots of each brain at each time point. for each imaging marker, separate base, rs, rw, and full models were fit to the population of hd participants and the population of healthy controls (both from trackhd). here, hd participants are defined as subjects who have tested positively for the hd gene expansion. hd participants may be divided into two groups : participants who have not yet been diagnosed with hd based on characteristic motor symptoms of the disease (called premanifest) and participants who have been so diagnosed (called manifest). for healthy controls the corresponding full model for hd participants (including both manifest and premanifest participants) has the following form : (3)yhdij = sc(ageij,c)+shd(capij,hd)+dhdi+hd1i+hd2i(ageijage0)+hdij(t)+hdij where ycij = logit(zcij) is the logit transformation of the observation zcij of the volume of a brain region from healthy control i at visit j. yhdij = logit(zhdij) is a similar observation made on an hd participant. the logit transformation is defined as logit(x)=log(p/(1p)), where p = x100. inverse logit transformations are applied to results from the models when estimates of zcij and zhdij are needed. this procedure is guaranteed to produce estimates of zcij and zhdij that are positive and bounded above by intracranial volume 100. ageij and capij are the age and cap score of subject i at visit j 1 (i.e., capij = ageij(cagil)/k). where cagi is the cag length of subject i. l and k are constants. for each imaging biomarker, separate models are fit with cap scores defined with l = 30 and k=6.27 and with values of l and k that have been optimized for each biomarker. when l = 30 and k = 6.27 the cap score will be equal to 100 at the expected age of onset of motor symptoms. the above connection with expected age at motor onset will hold only approximately for optimized choices of l and k. details on the methods used to choose optimal values of l and k are given below. 12) that estimate normal aging effects and the toxic effect of mutant huntingtin, respectively. sc and shd are linear functions of the five dimensional parameter vectors c and hd but may be highly nonlinear functions of age and cap. 12, the knots in sc and shd are placed at the 5th, 27.5th, 50th, 72.5th, and 95th percentiles of the age and cap score distributions, respectively. c is estimated in the population of healthy controls but held constant at its base model value when ref. the present models include site effects (three dummy variables) and a gender effect. c 1, hd 1 are random intercept terms (for healthy controls hd participants) c 2 and hd 2 are corresponding random slope terms. the hd = (hd 1, hd 2) and c = (c 1, c 2) are twodimensional normal random variables with mean zero and covariance matrices hd and c. in tables, the sds and correlations of these random variables will be designated by (int), (slope), and cor(int, slope). the baseline constant age0 is taken to be 18.the c and hd are a normal residual error terms for the control and hd populations : they are assumed to have mean zero and sds sd(c) and sd(hd), respectively. these sds will be designated as (error) in the tables.the c(t) and hd(t) are realizations of continuous time rws (technically wiener processes). these processes are assumed to be initialized to zero when subjects are 18 years of age. their sds are designated by (wc) and (whd) (or simply (w) if the context makes the reference population clear. following the definition of a wiener process, t years after initialization c(t) will have an sd of (t)(wc) and hd(t) will have an sd of (t)(whd).the,, and terms are assumed to be mutually independent. note that the spline functions affect only the overall population trend. random intercepts, rss, and rws are simply added on to this overall trend. 12) that estimate normal aging effects and the toxic effect of mutant huntingtin, respectively. sc and shd are linear functions of the five dimensional parameter vectors c and hd but may be highly nonlinear functions of age and cap. 12, the knots in sc and shd are placed at the 5th, 27.5th, 50th, 72.5th, and 95th percentiles of the age and cap score distributions, respectively. c is estimated in the population of healthy controls but held constant at its base model value when ref. the present models include site effects (three dummy variables) and a gender effect. c 1, hd 1 are random intercept terms (for healthy controls hd participants) c 2 and hd 2 are corresponding random slope terms. the hd = (hd 1, hd 2) and c = (c 1, c 2) are twodimensional normal random variables with mean zero and covariance matrices hd and c. in tables, the sds and correlations of these random variables will be designated by (int), (slope), and cor(int, slope). the c and hd are a normal residual error terms for the control and hd populations : they are assumed to have mean zero and sds sd(c) and sd(hd), respectively. these sds will be designated as (error) in the tables. the c(t) and hd(t) these processes are assumed to be initialized to zero when subjects are 18 years of age. their sds are designated by (wc) and (whd) (or simply (w) if the context makes the reference population clear. following the definition of a wiener process, t years after initialization c(t) will have an sd of (t)(wc) and hd(t) will have an sd of (t)(whd). the,, and terms are assumed to be mutually independent. random intercepts, rss, and rws are simply added on to this overall trend. the submodel in which c 2 and c(t) both vanish is called the base model. the submodel in which c(t) vanishes is called the rs model and the submodel in which c 2 vanishes is called the rw model. final models were fit in nonmem 7.3 using the first order conditional estimation method with interaction. graphics, data analysis, and data management were performed in r version 3.2.0.13 the base and rs models are random effects models of the kind that nonmem was designed to fit and their fitting is straightforward. the rw and full models, however, require special attention in order to estimate the sds of the random walks (s). inspection of eqs. (2) and (3) above reveals them to be special cases of the eqs. 10, the models of the current article reduce to a set of stochastic differential equations in which the measurement model is trivial (i.e., f(xit,i)=xij) and system 's dynamics are of a particularly simple form (i.e., the integral of g(xit, di,i) is given, depends on t, but does not depend on xit). this leads to a simple kalman filter algorithm, which is iterated at each step of the nonmem optimization process and implemented through a userdefined $ pred script (see the online supplementary material for details) and nonmem code. in order to facilitate the estimation of nonlinear trends, the cap score enters into the model of ref. 3 as an argument to the spline function shd. this complicates the process of fitting models that will optimize the choice of l for each imaging biomarker. note that k is a normalizing constant that is useful in providing a consistent interpretation for the cap score models but which does not affect the model fit. to find optimal values of l, we set k = 1 and fit base models to ref. 3 for each integer value of l between 21 and 40 inclusive. the akaike information criterion (aic) values for these models (subtracting off their minimum value) are plotted in figure 1 for each of the 10 imaging biomarkers. an appropriate normalizing constant kopt can be computed from the formula : (4)kopt=6.2743lopt13 plots of akaike information criterion (aic) for the base model fitted with fixed values of l between 21 and 40 for all imaging biomarkers. the number 43 is a (somewhat arbitrary) centering constant, chosen because it is a very common value in the track dataset and in data from other observational studies. note that lopt = 30 implies kopt = 6.27, which agrees with the values used in ref. 1 and produces a cap score that is equal to 100 at the expected age of motor onset. for any value of lopt we may define a corresponding version of the cap score as : (5)cap(lopt)=age(cagl)/kopt we have the following : (6)cap(lopt)=rcap(30) where (7)r=1+cag4343lopt1+cag434330and cap(30) is the version of the cap score with l = 30 and k = 6.27. if follows that cap(l) = 100 r at the expected age of onset of motor symptoms. model fitting in this section was done using version 3.1 of the nlme package in r.14 additional details are in the online supplementary material. all models were fit to 10 structural magnetic resonance imaging markers from the 36month cutoff of the track data.2 the 36month track dataset contains annual observations on 366 subjects (45% men) equally distributed between four sites in europe and north america. one third of the sample consisted of healthy controls. of the hd participants, half were premanifest and half were in early stages of manifest disease. all markers represent volumes of anatomic features of the brain expressed as fractions of the total intracranial volume. the markers selected for this analysis include five markers processed by the iowa center representing volumes of the thalamus, striatum, caudate nucleus, putamen, and whole brain. in addition, we consider five markers processed by the london center representing volumes of the caudate nucleus, whole brain, ventricle, cortical gray matter, and cortical white matter. the distinction between iowa and london markers is important because the london markers were obtained using either the boundary shift integral or voxelbased morphometry (procedures that quantify annual changes in different locations of the brain within each individual). by contrast, the iowa variables are simple snapshots of each brain at each time point. table 1 presents aic statistics for comparing model fits of the base model to the rs, rw, and full models in the population of healthy controls. table 2 provides similar information for model fits in the hd population using optimal values of l from figure 1. in both tables, table 3 compares models based on cap(30) with models based on the cap(lopt) : here, values of aic less than zero indicate the superiority of the models based on cap(lopt). the aic statistic,15 is defined as 2log(lik)+2k, where 2log(lik) is the objective function minimized by nonmem and k is the number of model parameters. it seems from these tables that the base model generally provides a better fit to the data for healthy controls than it does to the data for hd subjects. the largest improvements on the base model, in both the healthy control and the hd populations, are for the cortical grey and cortical white matter variables : these improvements seem, most likely, to be accounted for by rs mechanisms particularly in the hd population. by contrast, in the hd population, rw mechanisms seem to be more important than rs mechanisms in explaining the volumes of the striatum, caudate (iowa only), putamen, whole brain (london only), and the ventricle. even in cases in which rs mechanisms outperform rw mechanisms (under the aic criterion), the rw mechanisms tend to show substantial improvement over the base model and the full model tends to show an improvement over the rs model. aic, akaike information criterion ; rs, random slope ; rw, random walk. entries in rows 24 represent the aic for the given model minus the aic for the base model. aic statistics for model comparisons in genepositive hd participants aic, akaike information criterion ; hd, huntington 's disease ; lopt, optimal l ; rs, random slope ; rw, random walk. entries in rows 35 represent the aic for the given model minus the aic for the base model. aic statistics for paired comparisons between models with optimal l and l = 30 aic, akaike information criterion ; lopt, optimal l ; rs, random slope ; rw, random walk. negative values indicate superiority of the model with optimal l. for the remainder of this section we focus on models for the striatum (iowa), which is regarded as the focal point for hd pathology. global descriptive plots are sidebyside plots with information on healthy controls on the left and information on hd subjects in the center and right. the lefthand panel plots the logit transformation of each marker controlling for covariates (y c dc) against age for healthy controls. the center and righthand panels plot the logit transformation of the striatum controlling for covariates and normal aging (yhdsc(age)dhd) against cap(30) and cap(lopt). the center and righthand panels are very similar in appearance. however, the connection with ageatmotor onset is more direct in the center panel which is, therefore, recommended for routine use. each subject 's initial status (control, premanifest, and manifest) is indicated by color coding. the solid trend lines provide visual representations of sc(age) (left panel) and shd(cap) (center and right panels). in particular, sc(age) represents the effects of normal aging (controlling for covariates) and shd(cap) represents diseaserelated effects (controlling for covariates and normal aging). the spaghetti plots show that observations on each subject span a very limited portion of the complete time course of the disease. the solid lines are central to our approach to estimating the complete time courses. both normal aging and hd pathology show a pronounced and wellknown negative correlation with striatal volume. panel (a) : y1=ydc vs. age in healthy controls ; panel (b) : y2=ysc(age)dhd vs. cytosineadenine age product (cap30) in huntington 's disease (hd) participants ; panel (c) : y2=ysc(age)dhd vs. cap(lopt) in hd participants. based on eqs. 2 and 3. figure 3 shows the results of 50 simulated trajectories of striatal volumes under the base, rs, rw, and full models. the simulations assume cag lengths of 42 and plot trajectories for ages between 18 and 70 years. aic values from table 2 indicate that the rw model has the best fit. visually, figure 3 shows that the rw model displays the smallest deviation about the trend line. the rw model is also lacking in signs of agerelated heteroscedasticity that are particularly apparent in the base model. simulated trajectories for striatum (iowa) : huntington 's disease (hd) participants trajectories are simulated under the base, random slope (rs), random walk (rw), and full models in the population of hd participants. the simulations are based on 50 replicates and assume cytosineadenineguanine (cag) lengths of 42. trajectories are simulated and plotted for ages starting at 18 years and ending at 70 years. simulated trajectories are for a male equally likely to be selected from any of the four sites. figure 4 presents scatter visual predictive checks for the full models of striatal volume. simulations were performed for healthy controls and genepositive hd subjects with cag lengths of 39, 40, 41, 42, 45, 48, 50, and 59. the restriction to subjects with the above cag lengths was made so that all results for each imaging marker could be presented on a single graph. in addition, to facilitate plotting on a single graph, all plotted data values include corrections for each subject 's covariates. simulations are based on 1,000 replicates for healthy controls and 1,000 replicates for hd subjects at each cag length. solid lines represent 5%, 50%, and 95% quantiles of the distribution of predicted observations from the rw model. the implied 90% predictive interval completely captures all observations from 75% of healthy controls and 80% of genepositive hd participants and captures some observations from 90% of healthy controls and 91% of genepositive hd participants. scatter visual predictive checks for striatum (iowa) : full model simulations use 1,000 replicates for healthy controls and genepositive huntington 's disease (hd) subjects with cytosineadenineguanine (cag) lengths of 39, 40, 41, 42, 45, 48, 50, and 59. solid black lines represent 5%, 50%, and 95% quantiles of the distribution of predicted observations. pathology in hd develops very slowly over many years. in the interest of understanding the dynamics of hd, considerable effort has been expended in collecting prospective data on individuals at various stages of the disease. at present, however, few subjects have been observed for the whole time course of the disease. as a consequence, if a complete disease progression model is wanted, there is a need to construct one by patching together many short time courses obtained from many different individuals and to adjust the resulting long time course estimate for covariates and changes that would be expected to occur in unaffected individuals. the current article aims to improve our understanding of hd by proposing a solution to this problem. our approach involves two novel methodological features : the use of rw error terms to model random aspects of disease dynamics and the use of the cap score to account for effects related to the length of the mutant cag expansion that lies at the root of hd. regarding the use of rw error terms, the framework is similar to that used in the stochastic differential equationbased approaches to the modeling of pharmacokinetic and pharmacodynamic.10, 16, 17, 18, 19, 20, 21 in the present study, the above framework is applied to the modeling of disease progression. in the case of hd, and perhaps more generally in the study of disease progression, our mechanistic understanding is not sufficiently developed to determine a specific differential equation that drives the pathological process. for this reason, we replace the differential equations used in pharmacokinetic / pharmacodynamic modeling with flexible regression splines. the regression splines are applied to the subject 's age at the time of observation for healthy controls and to the cap score in genepositive hd subjects. this has the effect of simplifying and streamlining the kalman filter algorithm of ref. regression splines were used because : (1) some clear nonlinear trends appear to be present in the data ; (2) the dynamics leading from excess cag length and/or aging to observed pathology are too complex to be modeled mechanistically at the present time ; and (3) we did not want to develop ad hoc empirical models for each of the dependent variables in our dataset. the introduction of rw error terms into disease progression modeling reflects a shift from a paradigm in which each subject 's disease progression is represented by a regression curve in twodimensional space, to a paradigm in which each subject 's progression is represented as a continuous time stochastic process measured with error at a discrete set of time points. stochastic processes of this sort are commonly used in the modeling of many natural and manmade phenomena from the trajectories of space vehicles to the movement of stock prices. a readable account of relevant applications and we feel that the stochastic process paradigm will, in time, demonstrate significant improvements over the simpler regression curve approach to disease progression modeling. future work will : (1) reproduce the work reported here on datasets that include longer time series of data for each subject. (2) apply the models developed here to other, noisier markers of the hd disease state. (3) extend the models developed here to multivariate contexts where two or more markers are analyzed simultaneously. (4) apply the modeling principles developed here to other neurodegenerative or trinucleotide repeat diseases. (5) investigate alternatives to the aic for models involving rw terms. although the use of rw error terms may be a general innovation that applies to a wide class of disease progression models, the cap score encapsulates many of the features that are specific to hd. as the name implies, the cap score is just a way of parameterizing the interactions between age and cag length that figure in our prediction formula. identical predictions could be obtained using more traditional parameterizations of the models in terms of main effects and interactions. from an interpretive point of view, however, the cap score (1) suggests a connection with mechanistic models based on the cumulative toxicity of mutant huntingtin ; (2) models the process by which increasing cag length accelerates the progression of pathology in hd ; (3) provides a connection with models that predict age at motor onset in hd ; and (4) allows for easier comparison between progression models for different imaging biomarkers. point 2 above although the role of cag length in accelerating the pathological process in hd is well established prior to motor onset, there remains some controversy regarding its role after motor onset. 4 found that the interval between motor onset and death is independent of cag length. the first interpretation suggests that the role of cag length as a driver of hd pathology diminishes as the disease progresses. the second interpretation posits two distinct cag length dependent processes one leading to motor onset and another leading to death. indeed, there is evidence that the role of cag length in disease progression is not so terminated.2, 3 we are interested in understanding how the effect of cag length on disease progression changes over time. this issue is of more than academic interest as it may have implications for the efficacy of gene silencing therapies in the later stages of the disease. supporting information click here for additional data file. supporting information click here for additional data file. | we present a novel, general class of disease progression models for huntington 's disease (hd), a neurodegenerative disease caused by a cytosineadenineguanine (cag) triplet repeat expansion on the huntingtin gene. models are fit to a selection of structural imaging markers from the track 36month database. the models are of mixed effects type and should be useful in predicting any continuous marker of hd state as a function of age and cag length (the genetic factor that drives hd pathology). the effects of age and cag length are modeled using flexible regression splines. variability not accounted for by age, cag length, or covariates is modeled using terms that represent measurement error, population variability (random slopes / intercepts), and variability due to the dynamics of the disease process (random walk terms). a kalman filter is used to estimate variances of the random walk terms. |
diabetes mellitus (dm) has been known as a potentially disabling chronic disease with multiple complications. in the kingdom of saudi arabia (ksa), diabetes has emerged as a major public health problem that has reached an epidemic stage. the crude prevalence of diabetes has been documented as 23.7%, accounting for 37.8% of saudis aged between 30 and 70 years. with the advances in the healthcare facilities in the kingdom, therefore, the complications associated with longer duration of the disease have become one of the challenges faced by health care institutions. of these complications, a retinal vascular disorder, retinopathy is considered the leading cause of blindness in the working age population and accounts for considerable adult work disability. its presence may also indicate and predict other diabetic complications. it is documented that more than 77% of patients who survive for over 20 years with dm are affected by retinopathy. untreated diabetic retinopathy (dr) not only leads to blindness, which is a personal catastrophe for the individual but also increases the economic burden of health care servicesin the community. dr is characterized by signs of retinal ischemia (retinal microvascular abnormalities, microaneurysms, hemorrhages, intra - venous caliber abnormalities, cotton - wool spots, and neovascularization) and/or signs of increased retinal vascular permeability. vision loss can result from several mechanisms, including neovascularization leading to vitreous hemorrhage and/or retinal detachment, macular edema, and retinal capillary nonperfusion. depending on these signs, retinopathy is classified into nonproliferative diabetic retinopathy (npdr) and proliferative retinopathy (pdr). a number of studies show marked differences in the prevalence of retinopathy in patients with type 2 diabetes. of the estimated 10.2 million us adults 40 years and older known to have dm, the estimated crude prevalence rates for retinopathy was 40.3%, while an urban population - based study from india documented the prevalence of dr to be 18%. similar to global prevalence differences the prevalence of dr reported in studies from the middle east also shows varied figures : united arab emirates (uae) (19%), kuwait (812%), oman (42.4%), egypt (42%), and jordan (64%). the studies from different regions of saudi arabia also show variable prevalence : al - hassa (30%), madinah (36.8%), aseer region (11.3%), riyadh (31%), and taif (36.1%). the risk factors associated with this complication are also not uniform in all the studies from different geographical regions. the risk factors and epidemiological determinants mostly documented in various studies are age, gender, obesity, duration of disease, presence of hypertension, dyslipidemia, uncontrolled diabetes, and geographical area. considering the variability of the prevalence of dr in different geographical regions and it is importance as a complication due to the fact that it not only results in serious consequences, it is a key indicator of systemic diabetic microvascular complications. it is, therefore, considered as a sentinel indicator of the impact of diabetes. this study has the principal aim of describing the most recent prevalence of dr and the associated risk factors in the type 2 diabetic patients attending the diabetes center at abha, ksa for follow - up. the objective of the present study was to assess the proportion and grades of retinopathy and its risk factors in diabetes type 2 patients. the diagnosed diabetic patients are referred to this center from different hospitals and primary health care centers (phccs) in this region. the sample size for this study was calculated according to swinscow, as 350 with the estimated prevalence of dr = 35.24 (average of dr prevalence reported from different geographical regions of saudi arabia). to compensate for the missing patients a total of 10,576 type 2 diabetic patients were registered in this center from january 2008 to december 2013. every 26 patient 's medical record was selected, and the patients were then contacted for their permission and to provide the relevant data in the questionnaire. the last medical investigation results shown in the records were noted in the checklist. to maintain confidentiality, data were collected anonymously with the approval of the research ethical committee of the college of medicine, king khalid university. the demographic parameters were age, gender, occupation, and family history of diabetes. clinical parameters noted were : duration of diabetes, age at onset of diabetes, control of blood sugar (hemoglobin a1c [hba1c ] 7% was considered as controlled, 7 - 9% as uncontrolled and > 9% poorly controlled), use of anti - diabetic drugs, dyslipidemia, obesity (classified as overweight body mass index [bmi ] 25.029.9 kg / m, obese 30.039.9 kg / m and morbidly obese 40.0 kg / m), blood pressure (grouped as normotensive and hypertensive receiving antihypertensive drugs). complications of diabetes included ischemic heart disease, peripheral vascular disease, cerebrovascular accident, cataract, neuropathies (diagnosed on clinical findings), nephropathy (presence of microalbuminuria / gross albuminuria or high creatinine level). the diagnosis and grading of dr were done by slit lamp (with a volk 90 d lens) examination and colored fundus photographs using a topcon trc - nw6 nonmydriatic fundus camera by a trained ophthalmologist in the diabetic clinic and findings were recorded in patients ' files. retinopathy was classified into npdr and pdr, npdr was further subdivided into mild (microaneurysms confined mainly to the area temporal to the fovea), moderate (vascular changes seen in one to two quadrants of the retina), and severe (vascular changes seen in more than two quadrants). the statistical package for social studies (spss) (spss version 17.0. in : cary nc, editor. descriptive statistics (number, the percentage for categorical variables, mean, standard deviation [sd ], and range for continuous variables) and chi - square tests () was used to test for the association. odds ratio (or) with 95% confidence interval (95% ci) were generated to quantify relationships with each risk factor. their ages ranged from 20 to 90 years, with a mean sd of 54.6 (12.3) years and a median of 54.0 years. the mean age of male and female diabetic patients were 54.93 years and 54.25 years. the mean age of patients with dr was significantly higher (p < 0.001) in comparison to patients without dr (57.3 vs. 53.1 years). the mean age of onset for dm was 43.91 years with dr while it was 46.30 years for diabetics (p = 0.03). a significant difference was observed in the mean duration of diabetes (13.4 7.9 years vs. 6.8 6.7 respectively, p < 0.001) between patients with dr and diabetics without retinopathy [table 1 ]. baseline characteristics of participants with and without diabetic retinopathy the overall prevalence of dr was 146 (36.4%). mild npdr was in 57.5% of the patients, moderate npdr in 19.9% and severe npdr in 11.0% while 11.6% of diabetic patients had pdr. analysis of baseline characteristics and different risk factors with different grades of retinopathy showed a significant difference in mean duration among the four grades of retinopathy ; (p = 0.001). post - hoc test revealed that the duration of dm was significantly different for pdr (p = 0.003) in comparison to npdr. similarly, the total mean cholesterol was different among the four grades (p = 0.019). this difference was found to be with the severe grade of npdr (post - hoc test) however, no significant difference was observed in the levels of high - density, low - density lipoprotein and other risk factors (data not shown). grades of retinopathy and association with maculopathy table 3 presents the potential risk factors of dr. in univariable analysis, the rate of retinopathy was significantly associated with older age group, younger age at onset, longer duration of disease, poorly controlled blood sugar, the presence of hypertension (receiving drug treatment), insulin use, and the presence of multiple complications. gender, higher bmi and dyslipidemia including total cholesterol, high - density lipoproteins (hdl), low - density lipoproteins (ldl) levels and smoking did not appear as significant risk factors. unadjusted or and 95% ci for risk factors of diabetic retinopathy in multivariable logistic regression analysis [table 4 ], longer duration of diabetes, younger age of onset and the use of insulin appeared as the strongest predictors of dr. odds of having retinopathy were higher among patients who had developed diabetes at a younger age (45 years) compared with patients who had developed diabetes aged more than 45 years (adjusted or [aor ] = 0.44, 95% ; ci : 0.21, 0.90). patients with a lengthy duration of diabetes (5 years or more) were more than twice as likely to develop retinopathy than the patients with shorter duration of diabetes (aor = 2.48, 95% ; ci : 1.25 4.94). the use of insulin with or without oral hypoglycemic drugs for the treatment of diabetes was almost 3 times likely to result in retinopathy. logistic regression analysis results - aor and 95% ci for factors that might be associated with the dr in abha, saudi arabia abnormal glucose metabolism has reached epidemic proportions in the kingdom, with the prevalence of diabetes at 23.7%. this has led to a considerable increase in the burden of diabetic complications including dr, which appears to be highly prevalent in the general adult saudi population. the overall prevalence of dr in our study was 36.4%, which is nearly the same as the global documented estimated prevalence of 34.6% in individuals with diabetes. it is also close to what was found in taiwan 35.0%, southern india and the reports from studies in different regions of kingdom of saudi arabia : al - hassa 30%, madinah 36.8%, taif 36.1%, and riyadh 31% our result shows a lower prevalence of dr than what is reported in the uk 50%, usa 40.3%, oman 42.4%, egypt 42%, and jordan 64%. the prevalence of dr in our study is higher than those documented in many other studies ; 21.9% in australia, 26.11% in spain, 19% in uae, 812% in two different studies in kuwait and 18% in india. the difference of prevalence could be explained by the fact that most of these studies were population based and also that different tools of measurement were used. the prevalence of dr reported by al - khaldi from aseer region was 11.3%, which is much lower than the results of our study in the same region. the variation could be due to the difference in study location and difference in the method of diagnosis. their study was conducted in a single phcc while our study was conducted at a diabetic clinic to which all patients from the phccs in the region are referred for annual screening, their diagnosis of retinopathy was based on fundoscopic examination, while in our study the diagnosis was made by colored photographs and slit lamp examination as it was the standard technique used in other studies. regarding the grades of retinopathy in our study, the proportion of mild grade of retinopathy is higher than that reported from oman and madina (ksa) but our finding is in agreement with that documented from hassa (ksa). the present study showed a lower prevalence of pdr than that of madina (ksa) but higher than that reported from uae and oman, and similar to the study in hassa (ksa). our study is in agreement with a review article which indicated that in patients with dr, severe vision impairment was not as common as mild vision impairment. the results of our study indicate that retinopathy increases with younger age at onset of diabetes and showed a significant association between dr and duration of diabetes, which is consistent with most of the previous studies. a study from sweden documents that prevalence of dr reached 100% after 30 years of diabetes. our study found no significant gender difference in the development of dr, which is in accord with multiple studies mostly from the middle east and saudi arabia but it is in contrast to a study from sweden, which documents higher rates for women than men ; and studies from madina, india, and uae where dr was observed to be more prevalent in male diabetics. many studies on dr have documented the close association of chronic hyperglycemia (with high hba1c) and the development of the condition. however, a longitudinal study by aiello. reported that the prevalence of dr in long - standing diabetes is not dependent on the control of the disease. similarly, the degree of glycemic control did not show any significant association with dr in the study sample in madina (ksa) and from uae. our finding showed significant association in univariable analysis but failed to reveal the same in multiple logistic regression. hypertension has been documented as a risk factor in studies from jordan, oman, and also by a longitudinal uk prospective diabetes study group. report from uae reveals that dr is marginally significantly associated with hypertension. while in contrast, many studies including those from hassa (ksa), riyadh (ksa) and from south india were not able to find any significant role of hypertension in the development of dr. in our study, the univarent analysis showed hypertension as a risk factor for dr, but this was not significant after adjusting for confounders. bmi and smoking did not appear as significant risk factors as reported by the studies in uae and tehran ; the latter finding is in contrast to a report from madina and south india that documented smoking to be associated with an increased prospect of dr. similar to van leiden 's study and the study in riyadh, the present study found that high total cholesterol, abnormal ldl, and hdl levels did not have a positive association with the development of dr, but contrasting results were observed in studies in hassa (ksa) jordan and oman. in our study, the total cholesterol level was significantly higher in the severe grade of dr, which may indicate that it could be a risk of the progression of dr to severe retinopathy, a finding that emphasizes the importance of good lipid control as a preventive measure for the progression of retinopathy. the univariable analysis revealed that the age of the patient, the number of other complications and presence of neuropathy and nephropathy were significant risks for dr, but these were not supported by multiple regression analysis. this finding is consistent with the study in oman in which similarly aged patients, poor control of diabetes (with hba1c 9), high systolic blood pressure and complications were documented as insignificant after multiple regression analysis. in the present study study, the strongest determinants for the development of dr were younger age at onset, longer duration of diabetes and the use of insulin, which may be due to the fact that most of the type 2 dm patients with longer duration ultimately end up using insulin. all these three risk factors have been documented in most of the studies related to dr. the limitation of our study is that a predictive inference can not be drawn from our observational data since a more extensive study is required. despite this limitation, our study provides a picture of the prevailing situation in this region, and the data is sufficient to exhibit the enormity of this complication in diabetic patients and emphasize the main priorities of attention in regional programmes for screening retinopathy in all patients with diabetes type 2 at an early stage in the phcc with recommended tools (presently not available in the phcc) and prevent its progression. our findings clearly demonstrate that retinopathy is a common complication of diabetes in diabetic patients at abha, aseer region and that the situation is no different from other regions of saudi arabia. this is in contrast to a previous study from the same region that documented the prevalence as much lower in this region. we support the idea that the retina of a diabetic patient provides a summary measure of lifetime exposure to the effects of hyperglycemia, and which emphasizes the fact that screening for dr at the initial stage of diabetes may prevent disability from blindness caused by dr. small investments in prevention, awareness and care can dramatically improve the quality of life of patients with long - standing diabetes. | objectives : to assess the proportion and grades of retinopathy and its risk factors in diabetes type 2 patients.materials and methods : this was a cross - sectional study of 401 type 2 diabetic patients. a questionnaire and checklist were used to collect the data. retinopathy was diagnosed and graded by fundus photographs and slit lamp examination. the duration of diabetes, age of patients, age at onset of diabetes, body mass index, hemoglobin a1c level, blood pressure, and complications were noted.results:the mean age of male and female patients was 54.93 and 54.25 years ; 57.6% were males. the mean age of onset and mean duration of diabetes were 43.91 and 13.4 years, respectively. the proportion of retinopathy was 36.4%. grades of retinopathy were : mild 57.5%, moderate 19.9%, severe nonproliferative 11%, and proliferative retinopathy 11.6% ; 7.2% of patients had maculopathy. retinopathy was significantly associated with older age, younger age at onset, longer duration of disease, poorly controlled blood sugar, hypertension, insulin use ; the presence of neuropathy and nephropathy appeared as a significant risk. younger age at onset, longer duration, and insulin use appeared as the strongest predictors for diabetic retinopathy.conclusions:more than a third (36.4%) of the diabetic patients attending a diabetic center had retinopathy. the control of the risk factors may reduce both prevalence and consequences of retinopathy. |
this is an ideal approach for physical and emotional development of babies, as well as for the recovery of mothers. breastfeeding is recommended by the american academy of pediatrics work group on breastfeeding, which affirms exclusive breastfeeding provides ideal nutrition that is sufficient to support optimal growth and development for approximately the first 6 months of life. studies have documented the role of exclusive breastfeeding[35 ] and its advantages such as economic impact and lowering the morbidity rate of babies and mothers. reducing the incidence of infectious diseases such as diarrhea and respiratory tract infections during the first year is also mentionable. benefits of breastfeeding for the mother include the following : increased levels of oxytocin, resulting in less postpartum bleeding and more rapid involution ; earlier return to prepregnant weight ; delayed resumption of ovulation resulting in increased child spacing ; improved postpartum bone remineralization and reduced hip fractures in the postmenopausal period ; and reduction in the risk of ovarian cancer and premenopausal breast cancer [american academy of pediatrics work group on breastfeeding ]. appropriate food and nutrition during infancy is essential for physical growth, mental development, and a healthy immune system. when these learned healthful habits and preferences are carried into adulthood, the likelihood of productivity, health, and well - being is increased and the risks of infectious and chronic disease are reduced. in recognition of the importance of breastfeeding, healthy people 2010 aimed for 50% of all mothers to continue breastfeeding through the first 6 months and 25% to be breastfeeding exclusively. the breastfeeding situation in iran is far from meeting the world health organization (who) recommendation and the exclusive breastfeeding prevalence has shown a downward trend at 4 and 6 months that continuously decreased. one of the reasons for the low breastfeeding rate is the fact that pregnant women were not provided with adequate health care professional 's advice in terms of breastfeeding. to overcome lactation barriers, while the benefits of breastfeeding are well known, we do not know the most effective means to promote breastfeeding among low - income, inner - city women. in an ideal setting (in developed countries), every pregnant woman 's health care plan might include providing the necessary support to ensure successful breastfeeding. however, in our country, limitation of resource to support breastfeeding is a fact. lorestan province is in western part of iran, approximating ilam province (iraq border) where one of iran 's undeveloped provinces is situated. this study was aimed to determine the effect of breastfeeding education based on the health belief model (hbm) toward primiparous women. a case control group, pre - test post - test quasi - experimental design was used. eight health centers were randomly selected from khorramabad city and each of them was assigned randomly to either a control or an experimental group. four of them were assigned as controls and the other four were assigned as experimental centers. the sample size estimation was made based on reports of similar studies. in total, 88 subjects were considered in such a way that 44 cases were allocated to each of control and experimental groups. according to the following criteria, all subjects were selected before delivery : primipara mothers, mothers who underwent normal pregnancy (followed by vaginal delivery at term), and mothers having no chronic diseases and not taking any medication. subjects who were assigned to the experimental group were provided a program consisting of group education. hbm was utilized to formulate the strategy for the education and behavioral skill - building interventions. perceived benefits, perceived barriers, and self - efficacy are three concepts from the hbm. the mothers in the study group participated in the breastfeeding education program during their prenatal period. the instruction was given in three sessions (each group of educational session was of 3040 minutes) in which each mother learned about the advantages of breastfeeding for herself and her child, nutrition of lactating women, how to position the infant on the breast and prevent common breastfeeding problems, rooming in, breastfeeding on demand, and the importance of exclusive breastfeeding, using the breast as the only source of nutrients (except for vitamin drops) during the first 4 months of life. mothers were also encouraged to contact the researchers at any time if they were worried about the baby 's condition or their breastfeeding performance. measurements of the infant 's weight, length, and head circumference were recorded after delivery and during each follow - up in the groups. instrument for data gathering which was made by the research team consisted of three sections (baseline socio - demographic, clinical knowledge and attitude, and the status of mother 's breastfeeding at the level of lactation). the levels of breastfeeding were classified according to the current world health organization (who) definitions. content validity and construct validity were established and had a high internal consistency reliability (=0.86). the other instrument used in this study was breastfeeding self - efficacy scale (bses) from dennis and faux, which had 33 items, and its minimum and maximum scores were 33 and 165, respectively. the bses was translated into persian by two linguistics and two experts in the health care field independently. after they reached an agreement, this version was back translated to english by two other persons. any discrepancies between the original english version and the back - translated versions were discussed with the translators to ensure equivalency of meaning. persian version of bses had high internal consistency reliability (=0.82). in the current study also, internal consistency reliability was high (=0.85). follow - up visits at the patients respective home were conducted 30 days after delivery and at the fourth month. descriptive analyses were conducted using frequencies and proportions for categorical variables, and means with standard deviations (meansd) were calculated for continuous variables. independent sample t - test and t paired test were performed to evaluate the differences between and within the groups dependent variables, pre - test and post - test. the sample size estimation was made based on reports of similar studies. in total, 88 subjects were considered in such a way that 44 cases were allocated to each of control and experimental groups. according to the following criteria, all subjects were selected before delivery : primipara mothers, mothers who underwent normal pregnancy (followed by vaginal delivery at term), and mothers having no chronic diseases and not taking any medication. subjects who were assigned to the experimental group were provided a program consisting of group education. hbm was utilized to formulate the strategy for the education and behavioral skill - building interventions. perceived benefits, perceived barriers, and self - efficacy are three concepts from the hbm. the mothers in the study group participated in the breastfeeding education program during their prenatal period. the instruction was given in three sessions (each group of educational session was of 3040 minutes) in which each mother learned about the advantages of breastfeeding for herself and her child, nutrition of lactating women, how to position the infant on the breast and prevent common breastfeeding problems, rooming in, breastfeeding on demand, and the importance of exclusive breastfeeding, using the breast as the only source of nutrients (except for vitamin drops) during the first 4 months of life. mothers were also encouraged to contact the researchers at any time if they were worried about the baby 's condition or their breastfeeding performance. measurements of the infant 's weight, length, and head circumference were recorded after delivery and during each follow - up in the groups. instrument for data gathering which was made by the research team consisted of three sections (baseline socio - demographic, clinical knowledge and attitude, and the status of mother 's breastfeeding at the level of lactation). the levels of breastfeeding were classified according to the current world health organization (who) definitions. content validity and construct validity were established and had a high internal consistency reliability (=0.86). the other instrument used in this study was breastfeeding self - efficacy scale (bses) from dennis and faux, which had 33 items, and its minimum and maximum scores were 33 and 165, respectively. the bses was translated into persian by two linguistics and two experts in the health care field independently. after they reached an agreement, this version was back translated to english by two other persons. any discrepancies between the original english version and the back - translated versions were discussed with the translators to ensure equivalency of meaning. persian version of bses had high internal consistency reliability (=0.82). in the current study also, internal consistency reliability was high (=0.85). follow - up visits at the patients respective home were conducted 30 days after delivery and at the fourth month. descriptive analyses were conducted using frequencies and proportions for categorical variables, and means with standard deviations (meansd) were calculated for continuous variables. independent sample t - test and t paired test were performed to evaluate the differences between and within the groups dependent variables, pre - test and post - test. all of the neonates were healthy singletons with a birth weight of at least 2500 g, which was considered appropriate for their gestational age. mean age of pregnant women participating in the study was 22 3.29 years and significant difference was not seen between the experimental and control groups. literacy level in a majority of mothers in the experimental group (56.8%) and the control group (50%) was high school education, and baseline data showed that there was no significant difference in this item, baby gender, and intention to breastfeeding between subjects in the control group and the experimental group [table 1 ]. demographical data for control and experimental subjects baseline data showed that there were no significant differences in terms of knowledge (p=0.209) and attitude (p=0.404) between subjects in the control group and the experimental group [table 2 ]. however, due to executing attuned educational program, knowledge and attitude mean increased. besides, a significant difference was demonstrated in the post - test scores of the two groups [table 3 ]. baseline scores and comparison of subject 's knowledge, attitudes, birth weight, and self - efficacy post - test scores and comparison of subject 's knowledge, attitudes, child weight, and self - efficacy the mean of child birth weight in the experimental group and control group was 3.11 0.336 and 3.10 0.281 kg, respectively. moreover, no significant difference was noted between the two groups (p=0.851) [table 2 ]. after the intervention, the mean of children 's weight in first month in the experimental group and the control group was 4.43 0.285 and 4.34 0.238 kg, respectively. here also, no significant difference was seen between the two groups (p=0.110). in the fourth month, in brief, the mean of weight in the experimental group was significantly higher than that in the control group (p=0.001) [table 3 ]. baseline data delineated that there were no significant differences in self - efficacy (p=0.428) between subjects in the control group and the experimental group, but after the education, in 1 and 4 months after delivery, post - test data showed that experimental group had significantly better scores in terms of self - efficacy scores statistically [table 3 ]. in the first month of birth, there was no statistically significant difference in the level of breastfeeding between subjects in the control group and the experimental group (p=0.293), but in the fourth month, exclusive breastfeeding in the experimental group was significantly higher than that in the control group (p=0.007) [figure 1 ]. mothers in our study had moderate mean scores in knowledge and attitude (both the groups) which might have been influenced by literacy level. some studies showed that among mothers with a high school education, breastfeeding initiation was 65%, compared to 86% among mothers with a college degree. but a study from somali reported that the knowledge and belief toward breastfeeding the child when the baby / mother gets sick and the mother gets pregnant is very poor. these are potentially harmful beliefs which could lead to the dangerous practice of abrupt cessation. the present study shows that breastfeeding knowledge and attitude of the experimental group after intervention was significantly better than those of the control group. this finding is consistent with the findings of the study conducted by other researchers[2325 ] that who reported a positive effect of the education on knowledge, attitudes, and support practices. mothers who fed their children with exclusive breastfeeding had higher (no significant) mean score in knowledge and attitude ; this finding is consistent with the result of a similar study which reported that high rate of exclusive breastfeeding was significantly associated with positive maternal attitudes toward breastfeeding. the influence of the medical staff played the biggest role in the decision of women about breastfeeding, and the influence of the nursing staff was greater than that of their doctors. thus, efforts should be made to ensure that more nurses involved in the maternal and child health care participate to equip the mothers with the adequate knowledge and skills to promote, nurture, and support breastfeeding practices among them. the results show that in the fourth month of birth, the exclusive breastfeeding rates in the experimental group (77.3%) significantly were higher than those of the control group (47.7%). this finding is consistent with the results of a similar study. in the other study, by 45 days, 29% of the control group continued to breastfeed and 56% in the second - level intervention group continued to breastfeed ; and in the dashti study, only 30% of mothers were completely implemented breastfeeding. exclusive breastfeeding rates at 4 and 6 months of age at a national level averaged 56.8 and 27.7%, respectively. self - efficacy in the experimental group was significantly higher than in the control group, 1 and 4 months postpartum. this finding is consistent with the finding of a similar study. according to many researchers, breastfeeding self - efficacy and the related concepts of confidence and perception of success mothers with high self - efficacy were significantly more likely to breastfeed their babies exclusively at 1 and 4 months postpartum than the mothers with low self - efficacy. after the intervention, there was no significant difference between the two groups in the mean weight of the children in the first month, but in the fourth month, the mean of the weight in the experimental group was significantly higher than in the control group. this finding is consistent with a similar study which reported that children who were exclusively breastfed had significantly higher weight gains and prolonged and exclusive breastfeeding may actually accelerate weight and length gain in the first few months. our explanation to this finding is that exclusive breastfeeding reduces exposure to contaminated fluids and foods and this helps to protect from diseases and in better child growth. the importance of breastfeeding for the prevention of morbidity and mortality from diarrhea is confirmed and highlighted. some studies have shown that increased duration of breastfeeding was associated with reduced prevalence of childhood overweight and obesity and that promoting infant nutrition and exclusive breastfeeding may be an important avenue toward addressing obesity and improving overall health in these populations. because of the economical, societal, and cultural differences, we suggest that researchers design longitudinal studies for assessing these relations in the lorestan province. prenatal education in this study based on hbm was successful, and knowledge, attitude, self - efficacy, and related indicators improved. the necessity of producing standard education package and education of pregnant mothers, especially in their first pregnancy, by health professionals is perceived because many studies have shown that behavior is affected by attitude, which, in turn, is influenced by knowledge. | background : breastfeeding is the most natural and essential way for feeding newborn babies. this is an ideal approach for physical and emotional development of babies, as well as for the recovery of mothers. this study was aimed to determine the effect of breastfeeding education based on the health belief model (hbm) toward primiparous women.materials and methods : in a case control group, quasi - experimental study, 88 subjects were allocated in control and experimental groups. subjects who were assigned to the experimental group were provided a program consisting of group education based on hbm during their prenatal period. instrument for data gathering was made by the researchers and standard questionnaire from dennis and faux for breastfeeding self - efficacy scale (bses). baseline interviews were conducted before delivery and follow - up visits were conducted after 30 days and at the fourth month after delivery. data were analyzed using spss (version 16) with c2, independent sample t - tests, and paired t-test.results:mean age of pregnant women who participated in the study was 22 3.29 years. after the program, the experimental group had significantly better scores in terms of self - efficacy, knowledge, and attitude scores statistically. in the fourth month, the mean of child weight in the experimental group was significantly higher than that of the control group (p=0.001) and exclusive breastfeeding was significantly higher than in the control group (p=0.007).conclusion : prenatal education in this study based on hbm was successful, and knowledge, attitude, self - efficacy, and related indicators improved. the necessity of producing standard education package and education of pregnant mothers, especially in their first pregnancy, by health professionals is perceived. |
indeed most clinical testing is done in sound attenuating booths, where background noise levels are typically below 20 db spl (for frequencies of audiometric interest). for performing behavioral (pure tone and speech audiometry) and physiological tests (auditory evoked potentials and oaes) the focus has been on maintaining a good signal to noise ratio for the test signals presented. the issue addressed in the present study pertains not to the test ear but to the contralateral ear that may or may not be occluded. in neonatal or newborn hearing screening with oaes most protocols do not specify any occlusion or plugging of the nontest ear (e.g., [111 ]). however, such screening tests are routinely carried out in a noisy hospital or clinic environments. newborn babies may be screened in patient 's rooms, clinical areas, or a neonatal intensive care unit (nicu), where ambient sound levels can be as high as 6070 db spl (e.g., [1216 ]). the american academy of pediatrics recommends that sound levels in an nicu should not exceed 45 db, but most often this is not the case. indeed a review by konkani and oakley reveals that ambient noise levels in typical nicus can exceed 80 db spl. it is now well established that oaes discovered by kemp in 1978 are suppressed or modulated by acoustic signals presented to the contralateral ear. the role of the olivocochlear neural efferent system in inhibiting outer hair cell activity is well understood [1824 ]. the consequent modulation of the outer hair cell mechanics and their contribution to oae generation are the basis of clinical tests of the contralateral oae suppression reflex [2536 ]. the question posed in the present study is do ambient noise levels, typical of oae screening environments, suppress oaes in the test ear by stimulation of the contralateral, nonoccluded ear ? in a sense the answer is already known in that numerous studies (as referenced above) have utilized contralateral sound stimuli to enable oae suppression, which have stimulus levels that are similar to those of ambient noise. furthermore, work including that by our own group has clearly shown that oae suppression is not a reflex with a defined threshold response. the efferent system enables oae suppression with contralateral stimuli over a wide range of stimulus intensities. in other words we tested 6 young adult females (1824 yrs.) with normal audiograms and robust oaes (signals above noise, in the normal range and repeatable). transient evoked (te) oaes (ilo88 otodynamics, hatfield, uk) and distortion product (dp) oaes (vivo 600dpr ; vivosonic, toronto, canada). in each of the 4 acoustic environments (described below) teoae and the ear canal was occluded with a standard memory foam earplug, and a circumaural headphone shell was also worn to achieve a combined attenuation greater than 40 db. we measured teoaes to click stimuli (ilo88 default mode) and quantified using the average db response. dpoaes were measured in the form of a dpgram ; 2f1-f2 signal levels as a function of f2 frequency (0.256 khz ; e.g., figure 3). (i) control experiments were carried out in a sound attenuated booth (single wall aco) with ambient sound levels below 25 db spl (100 hz16 khz). (ii) experiments were also made in the open laboratory environment, where ambient noise level was approximately 45 db spl. (iii) a study was made in noise - augmented environment in which white noise generation was adjusted to give an overall ambient noise level of 55 db spl. (iv) a recorded babble / shopping mall sound sample was used to provide a 55 db spl ambient noise that was more dynamic in character than the white noise augmented environment. all acoustic signal levels were measured in free field at the level of the subject 's head using a calibrated (b&k 4230, 94 db 1 khz) sound meter (larson davis 831) with half - inch condenser microphone (pcb piezotronics). we used a linear (nonweighted) mode with a 100 hz16 khz bandwidth. for each acoustic condition, teoae and dpoae signals with and without plugging of contralateral ear are compared with a two tailed, paired student 's t - test, after confirmation of normal data distribution with kolmogorov and smirnov analysis. figure 1 illustrates oae waveforms evoked by broadband click stimuli in the ilo88 (otodynamics) format ; results are from one subject. the upper two data records were made in the environment with a 55 db spl ambient noise level. note the attenuation of the wave forms in the nonplugged ear canal condition. in both cases the lower traces show control records in the sound booth ; contralateral ear occlusion does not alter teoae response. table 1 lists, for all 6 subjects, the teoae levels (average of 3 repeat recordings) for the contralateral ear plugged and nonplugged conditions. the upper panel shows records made in the sound booth with ambient noise levels < 25 db spl. there are no significant differences between contralateral ear plugged versus open ear canal conditions. significance and p values of paired t - test results the lower panels show comparisons in sound environments with noise levels at 45 db spl and in (white) noise and babble noise augmented environments (55 db spl). in the 45 db spl environment three subjects have statistically significant differences in oae level with versus without opposite ear plugging. in the 55 db spl ambient noise environments all but one subject show significant differences between teoae levels with and without opposite ear occlusion. overall there is a significant difference in teoae levels for environments with ambient noise levels of 45 db and above. figure 3 shows dpgrams for two subjects measured in an environment with ambient noise at 55 db spl. in each case the solid lines indicate dpoae level measured with contralateral ears plugged versus unplugged (dashed lines). note the suppression caused by the environmental noise, especially between 0.5 and 1 khz, where the decrease in dpoae level amounted up to 3 db. the 55 db ambient environmental noise results in a significant contralateral suppression in only some subjects. however, it will be noted that the subjects with a significant suppression effect are those with an initially higher level dpoae (subject list in table 2 is ordered according to dpoae level). furthermore, the p values for the paired t - test are mainly low hinting of an effect. indeed an analysis of pooled results graphed in figure 4 shows a very significant effect (p < 0.0001) of the 55 db spl environmental noise. there has been some considerable attention paid to the issue of ambient noise in environments in which oae screening tests are carried out. the main concerns however have related to the test ear rather than the contralateral ear. thus there is concern about the signal - to - noise ratio in the test ear that has to be high for getting a valid oae response [37, 38 ]. the authors are unaware of studies that have considered the effects of ambient noise on the contralateral ear. as previously mentioned, there are no provisions or recommendations to use occlusion of the contra lateral ears in screening testing, and thus the contralateral suppression effects on test ear oaes is an issue. the effects of contralateral acoustic stimulation on oaes have been extensively documented in experimental studies, animal models, and clinical research. it is surprising therefore that these effects have not been seriously considered in newborn hearing screening protocols that employ oae measures. in the present study, we have tested the hypothesis that moderate levels of environmental noise can suppress oae responses by activation of the olivocochlear efferent system. in the present study given that most hospital ward and clinic environments have ambient noise levels higher than 55 db spl we conclude that, unless the untested ear is occluded, there will almost certainly be a suppression effect. it should be noted that clinical diagnostic oae testing is almost always carried out in a low noise environment, typically in a sound attenuating booth. here however, in neonatal hearing oae screening the availability of a sound booth or even a quiet environment is not a reality. it has been suggested that the olivocochlear efferent system is not fully matured or operational in a neonatal human subject, and therefore the precaution of occluding the contralateral ear is unnecessary. it has been reported that in some species efferent innervation is one of the final stages of cochlear maturation [3941 ]. in the mouse, an altricious species however, the human is a precocious species with a much more mature peripheral auditory system at birth. there is some evidence that continued maturation of contralateral oae suppression continues for some weeks after term birth. however, a number of authors report that oae suppression reflexes can be recorded in at term [36, 44, 45 ]. the results of this present study indicate that with a 55 db ambient noise oae levels can be attenuated by as much as 3 db. it could be argued that such small attenuations will be of little significance in a screening test. however, it should be noted that this level of ambient noise is very low compared with that in a typical nicu or hospital clinic environment. furthermore, 3 db is a significant level change when the original oae signal level may be of a similar order of magnitude. will small oae attenuations make a difference in a pass / refer (fail) screening paradigm ? we suggest that it will definitely lead to more false positive results, and that means increasing parent anxiety and further healthcare costs. in oae screening tests, a nonoccluded contralateral ear will be stimulated by ambient environmental noise. noise levels above 55 db spl can significantly suppress oaes in the test ear and lead to false positive results. | newborn hearing screening is an established healthcare standard in many countries and testing is feasible using otoacoustic emission (oae) recording. it is well documented that oaes can be suppressed by acoustic stimulation of the ear contralateral to the test ear. in clinical otoacoustic emission testing carried out in a sound attenuating booth, ambient noise levels are low such that the efferent system is not activated. however in newborn hearing screening, oaes are often recorded in hospital or clinic environments, where ambient noise levels can be 6070 db spl. thus, results in the test ear can be influenced by ambient noise stimulating the opposite ear. surprisingly, in hearing screening protocols there are no recommendations for avoiding contralateral suppression, that is, protecting the opposite ear from noise by blocking the ear canal. in the present study we have compared transient evoked and distortion product oaes measured with and without contralateral ear plugging, in environmental settings with ambient noise levels < 25 db spl, 45 db spl, and 55 db spl. we found out that without contralateral ear occlusion, ambient noise levels above 55 db spl can significantly attenuate oae signals. we strongly suggest contralateral ear occlusion in oae based hearing screening in noisy environments. |
schizophrenia is a mental disorder usually beginning in adolescence or youth, and very often has a chronic disabling evolution (singh, 2010). due to its severity, schizophrenia represents an important health problem, involving an onerous burden both for patients and their families. the illness affects the subject s contact with reality, reducing the patient s relationships with other people, and therefore their communication skills. some patients diagnosed as schizophrenic show a structural alteration in significant elements of their language ability. the disease affects different levels of language at different times.13 disturbances in oral communication have been considered since the time of bleuler4 and kraepelin5 to be one of the central elements in schizophrenia.6 they can be of two kinds, ie, a decrease in verbal production, associated with a reduction of syntactic complexity, and disturbances in speech comprehension and coherence, also referred to as formal thought disorders (ftd). patients with schizophrenia often display a wide range of abnormal types of communication behavior, and language disorders in schizophrenia are mainly a loss of voluntary control of the word generation process.7 this population shows a language - processing deficit, affecting speech, semantics, syntax, and phonology.8 however, other authors consider that pragmatics is also a field where the linguistic disorders of the language of people with schizophrenia are focused.911 this has been perfectly demonstrated in the study by kuperberg who center the language violations of patients with schizophrenia in the pragmatic, semantic, and syntactic sections, and leave morphologic disorders as something residual and with a low prevalence in this population. there has been research into the possibility that schizophrenic speech could differ depending on the clinical manifestations of ftd. studies have also been carried out on whether ftd could have an influence on the lack of recognition of linguistic stimuli in people with schizophrenia, given that these patients show a tendency to have verbal disorders in their speech and inefficient inhibition mechanisms, resulting in impairment of the activation mechanisms of verbal processes.1322 often everyday conversations contain expressions with meanings other than the obvious ones. these disparities do not interfere with communication, provided that the speaker and the receiver (the person who speaks and the person who listens, respectively) share certain rules directing conversational interactions. the ability to communicate and understand these intentions, and the rules that regulate them, forms part of language semantics and pragmatics, and is impaired in schizophrenia.1,23,24 the aim of this study was to analyze how ftd affect semantics and pragmatics in patients with this disorder. the sample was composed of subjects with schizophrenia (n = 102) who met the diagnostic criteria for the disorder according to the dsm - iv - tr (diagnostic and statistical manual of mental disorders, 4th edition text revision).25 six people refused to take part in the study for various reasons. the average age of the trial population was 40.84 11.18 (range 2065) years. the population which took part in the study comprised 52 men (51%) and 50 women (49%). all participants were receiving ambulatory clinical treatment in centers belonging to the public health system, and they all signed the relevant informed consent. the following scales were used in the research process : the positive and negative syndrome scale (panss) for psychopathology measurements ; and the scale for assessment of thought, language, and communication (tlc) for ftd, word accentuation test (wat), system for the behavioral evaluation of social skills (sechs), the pragmatics section of the objective criteria language battery (bloc - sr) and the verbal sections of the wechsler adults intelligence scale (wais) iii for assessment of semantics and pragmatics. the panss, tlc, and wais iii scales have been used previously for research in patients with schizophrenia.2630 the rest of the tests (bloc - sr, wat, and sechs) have a wide diffusion, and their use has also been established in people with schizophrenia.31 the panss32 is a 30-item scale that measures the psychopathology present in the patient with schizophrenia, and is widely validated for evaluation of this disorder. the wais iii33 is a test designed to assess global intelligence and consists of two scales, ie, verbal and performance. each test in the wais - iii can be used independently and has recognized validity and reliability ; its validity for patients with schizophrenia has also been demonstrated. following other studies, in our investigation only the verbal scale was used ; this is a valid method with obvious benefits in its administration, and our purpose was to measure each participant s verbal capacity and use of language.34,35 the wat36 is a rapid and simple test designed to estimate the patient s premorbid cultural and intellectual level, in order to infer his current cognitive situation. it is based on the recognition of spanish words not frequently used in daily speech, written entirely in upper case letters and without accents. the hypothesis is that to read the words correctly, a subject needs to have seen them previously. reading aloud is a verbal capability more resistant than other verbal functions, like vocabulary, and the reading test is a useful tool to estimate the prior intelligence level, taking into account that people with a higher previous cultural level are deemed to have greater lexical richness.37,38 the bloc - sr39 is a language assessment battery for schoolchildren aged 514 years. in some cases, this battery has proven to be useful for language evaluation in disabled adults.40 the bloc - sr has been used in studies carried out in patients with schizophrenia, where its utility in detecting and depicting language issues in schizophrenia has been demonstrated.41 one of the differences between this scale and the rest of the language assessment tests is the fact that it does not provide information about what assessed subjects do not know, but mainly about what they actually do know, their already attained capabilities, and even the skills they could be more competent in. given the deficiencies these subjects show early on in the disease, flexibility and the way the information is provided are very important in assessing language in schizophrenia.42,43 all these factors determined that the pragmatics test in bloc - sr was the evaluation tool chosen in this study to assess these issues in people with schizophrenia. the assessment is carried out according to the definitions and criteria used in subtypes of abnormal language expression. the tlc test yields information on communication disorders using four scales, ie, flow of ideas, structure of speech, speech peculiarities, and verbal productivity. the sechs46 is a system that assesses particular and specific behaviors shown by the subject during social interactions, real or simulated, with other people. it consists of three blocks, ie, nonverbal communication, paralinguistic verbal communication, and linguistic verbal communication. the subject s behaviors are assessed and scored using a five - point likert scale. the sampling technique used was of an empiric or non - probabilistic type, in its intentional or unintentional modality, given that because of the characteristics of the study, various criteria were taken into consideration as follows for choosing the sample in order to make it more uniform : a diagnosis of schizophrenia, being in a period of clinical stability (ie, not in an acute phase of the disease), age 1865 years, and either gender. evaluation of the participants was carried out by the main researcher (a clinical psychologist). the study was performed in accordance with the ethical principles of the declaration of helsinki,47 and all the participants signed an informed consent form for participation in the research. statistical analysis of the data was carried out using the statistical package for social sciences version 19.0 (spss inc, chicago, il). the sample was composed of subjects with schizophrenia (n = 102) who met the diagnostic criteria for the disorder according to the dsm - iv - tr (diagnostic and statistical manual of mental disorders, 4th edition text revision).25 six people refused to take part in the study for various reasons. the average age of the trial population was 40.84 11.18 (range 2065) years. the population which took part in the study comprised 52 men (51%) and 50 women (49%). all participants were receiving ambulatory clinical treatment in centers belonging to the public health system, and they all signed the relevant informed consent. the following scales were used in the research process : the positive and negative syndrome scale (panss) for psychopathology measurements ; and the scale for assessment of thought, language, and communication (tlc) for ftd, word accentuation test (wat), system for the behavioral evaluation of social skills (sechs), the pragmatics section of the objective criteria language battery (bloc - sr) and the verbal sections of the wechsler adults intelligence scale (wais) iii for assessment of semantics and pragmatics. the panss, tlc, and wais iii scales have been used previously for research in patients with schizophrenia.2630 the rest of the tests (bloc - sr, wat, and sechs) have a wide diffusion, and their use has also been established in people with schizophrenia.31 the panss32 is a 30-item scale that measures the psychopathology present in the patient with schizophrenia, and is widely validated for evaluation of this disorder. the wais iii33 is a test designed to assess global intelligence and consists of two scales, ie, verbal and performance. each test in the wais - iii can be used independently and has recognized validity and reliability ; its validity for patients with schizophrenia has also been demonstrated. following other studies, in our investigation only the verbal scale was used ; this is a valid method with obvious benefits in its administration, and our purpose was to measure each participant s verbal capacity and use of language.34,35 the wat36 is a rapid and simple test designed to estimate the patient s premorbid cultural and intellectual level, in order to infer his current cognitive situation. it is based on the recognition of spanish words not frequently used in daily speech, written entirely in upper case letters and without accents. the hypothesis is that to read the words correctly, a subject needs to have seen them previously. reading aloud is a verbal capability more resistant than other verbal functions, like vocabulary, and the reading test is a useful tool to estimate the prior intelligence level, taking into account that people with a higher previous cultural level are deemed to have greater lexical richness.37,38 the bloc - sr39 is a language assessment battery for schoolchildren aged 514 years. in some cases, this battery has proven to be useful for language evaluation in disabled adults.40 the bloc - sr has been used in studies carried out in patients with schizophrenia, where its utility in detecting and depicting language issues in schizophrenia has been demonstrated.41 one of the differences between this scale and the rest of the language assessment tests is the fact that it does not provide information about what assessed subjects do not know, but mainly about what they actually do know, their already attained capabilities, and even the skills they could be more competent in. given the deficiencies these subjects show early on in the disease, flexibility and the way the information is provided are very important in assessing language in schizophrenia.42,43 all these factors determined that the pragmatics test in bloc - sr was the evaluation tool chosen in this study to assess these issues in people with schizophrenia. the assessment is carried out according to the definitions and criteria used in subtypes of abnormal language expression. the tlc test yields information on communication disorders using four scales, ie, flow of ideas, structure of speech, speech peculiarities, and verbal productivity. the sechs46 is a system that assesses particular and specific behaviors shown by the subject during social interactions, real or simulated, with other people. it consists of three blocks, ie, nonverbal communication, paralinguistic verbal communication, and linguistic verbal communication. the subject s behaviors are assessed and scored using a five - point likert scale. the sampling technique used was of an empiric or non - probabilistic type, in its intentional or unintentional modality, given that because of the characteristics of the study, various criteria were taken into consideration as follows for choosing the sample in order to make it more uniform : a diagnosis of schizophrenia, being in a period of clinical stability (ie, not in an acute phase of the disease), age 1865 years, and either gender. evaluation of the participants was carried out by the main researcher (a clinical psychologist). the study was performed in accordance with the ethical principles of the declaration of helsinki,47 and all the participants signed an informed consent form for participation in the research. statistical analysis of the data was carried out using the statistical package for social sciences version 19.0 (spss inc, chicago, il). the sample (table 1) comprised nearly equal numbers of men and women. the participants average age was 40.84 (range 2065) years. nearly half of the subjects had not continued their education beyond compulsory schooling (48.86%), while 18 of them had a university degree (17.64%). the scores obtained by participants on the verbal - wais (table 2) in the sections testing arithmetic (x = 7.51), digit span (x = 8.35), and similarities (x = 9.24) were lower, whereas in the sections concerning vocabulary, information, and comprehension they were quite stable. in the wat, the results indicated good premorbid language skills, with a mean of 23.96 3.40 from a maximum of 30 points. this indicates that language is affected by the disorder and rules out the possibility of a previous verbal impairment. for the pragmatics section in the bloc - sr scale, there was a lack of data for the population with schizophrenia, but this study showed that the parameters in this section were significantly affected (x = 63.57 21.26). the results for the panss, which identifies psychopathology, showed a mean of 57.94 13.97, and were consistent with those obtained in previous studies of patients with schizophrenia. the scale for tlc showed that the flow of ideas factor was more present (x = 13.88 7.57), and far above speech structure, speech peculiarities, or verbal productivity. on the sechs, used in this study to evaluate pragmatics, the score obtained was 46.02 16.181. the results for ftd in the participants (table 3) suggest that even if ftd are not limited to schizophrenia and often present in other pathologies, such as mania and depression, schizophrenic speech may differ according to the clinical manifestations of ftd in such a way that it may even be possible to diagnose schizophrenia from the patient s speech. finally, the relationship between ftd and language semantics and pragmatics was analyzed (table 4). in this section, the results showed a correspondence between tests assessing semantics and pragmatics and the subject s language disorders affecting communication. thus, positive correlations were found among tests measuring semantics and pragmatics (verbal - wais, wat, bloc - sr, and sechs). however, ftd measured using the tlc scale showed a negative correlation with these scales ; this means that the more ftd exist, the worse the results are for semantics and pragmatics. attention should also be drawn to the fact that the wat scale does not show a relationship with ftd, which means that these disorders do not affect the premorbid verbal level of the person with schizophrenia. the sample (table 1) comprised nearly equal numbers of men and women. the participants average age was 40.84 (range 2065) years. nearly half of the subjects had not continued their education beyond compulsory schooling (48.86%), while 18 of them had a university degree (17.64%). the scores obtained by participants on the verbal - wais (table 2) in the sections testing arithmetic (x = 7.51), digit span (x = 8.35), and similarities (x = 9.24) were lower, whereas in the sections concerning vocabulary, information, and comprehension they were quite stable. in the wat, the results indicated good premorbid language skills, with a mean of 23.96 3.40 from a maximum of 30 points. this indicates that language is affected by the disorder and rules out the possibility of a previous verbal impairment. for the pragmatics section in the bloc - sr scale, there was a lack of data for the population with schizophrenia, but this study showed that the parameters in this section were significantly affected (x = 63.57 21.26). the results for the panss, which identifies psychopathology, showed a mean of 57.94 13.97, and were consistent with those obtained in previous studies of patients with schizophrenia. the scale for tlc showed that the flow of ideas factor was more present (x = 13.88 7.57), and far above speech structure, speech peculiarities, or verbal productivity. on the sechs, used in this study to evaluate pragmatics, the score obtained was 46.02 16.181. the results for ftd in the participants (table 3) suggest that even if ftd are not limited to schizophrenia and often present in other pathologies, such as mania and depression, schizophrenic speech may differ according to the clinical manifestations of ftd in such a way that it may even be possible to diagnose schizophrenia from the patient s speech. finally, the relationship between ftd and language semantics and pragmatics was analyzed (table 4). in this section, the results showed a correspondence between tests assessing semantics and pragmatics and the subject s language disorders affecting communication. thus, positive correlations were found among tests measuring semantics and pragmatics (verbal - wais, wat, bloc - sr, and sechs). however, ftd measured using the tlc scale showed a negative correlation with these scales ; this means that the more ftd exist, the worse the results are for semantics and pragmatics. attention should also be drawn to the fact that the wat scale does not show a relationship with ftd, which means that these disorders do not affect the premorbid verbal level of the person with schizophrenia. the results in the semantics and pragmatics sections were inferior to the average values obtained in the general population.27,28,51 these outcomes suggest that the most significantly affected sections are those where attention, concentration, and formation of concepts are required, thus showing the effect of ftd on the semantic and pragmatic aspects of language in schizophrenia. this would correlate with the idea that abnormalities in associative connections between words and concepts have been considered a central element in schizophrenia. more specifically, the question is whether when patients with schizophrenia speak abnormally, the problem underlying their verbal disorders goes deeper than their speech and may be considered a product of thinking itself.52 if alterations in schizophrenic speech are the product of abnormal and disorganized thinking, then we may expect that these strange ideas may influence other aspects of their behavior, and that in other situations, these subjects could also display abnormal nonverbal behaviors and nonrealistic ideas.18 comparing the results obtained on the tlc scale with those in other studies, the values were similar. values are slightly higher for some of the attributes, specifically poverty of speech, pressure of speech, distractible speech, and blocking, where scores are double that of earlier ones ; for the remaining attributes, the results are very similar to those obtained in previous studies.48,53 furthermore, the data obtained concerning existing correlations between ftd and verbal disorders suggest that patients with schizophrenia also show a tendency to display interferences in their personal ideas in inappropriate contexts, apart from delusory ideas. our results showing a high correspondence between the semantics and pragmatic sections and the tlc scale support the opinion that speech disorders in schizophrenia are generally due to the presence of psychopathology, given the positive correlation between the two. the more serious the psychopathology, the greater the presence of thought disorders. our results suggest that verbal disorders in patients with schizophrenia should be considered as part of a disorder in thinking, and should be differentiated from disorders affecting only speech, in line with the suggestions of harrow.54 in general, the disorganized speech, abnormal ideas, and behavior observed in schizophrenia belong to a constellation of symptoms, a wide range of which are positive, and this helps give us a better understanding of the relationship between disorganized speech and thought disorders.30,55 the present study shows the relationship between the verbal - wais and the scales for ftd assessment, and found correlations between the verbal - wais and the tlc scales. the data obtained demonstrated that the more serious the ftd, the worse the performances in verbal - wais tests (particularly in its vocabulary, similarities, and comprehension sections) which allows us to conclude that ftd affect semantics and pragmatics. our results support the main hypothesis concerning a relationship between ftd and semantic memory, which has been reported in some15,26 but not all56 studies carried out. our study confirms this view, finding a link between ftd and semantic system impairment. to be precise, the more phonological and semantic fluency is observed, the greater the severity of ftd.57 this could lead us to interpret internal language as being incompatible with context and therefore with the external language generated by others. it is not difficult to imagine that if the patient s external language shows anomalies in semantic structure, then her / his internal language may also be affected by semantic failure. the results of this investigation are consistent with those obtained by kerns,58 who found that delusive patients produced more semantic associations than the norm in a verbal fluency task. our data correspond with the view that, from a clinical perspective, communication with schizophrenic patients can be improved by structuring speech interactions, bearing in mind that low verbal ability is associated with a deficiency in the generation of a speech plan, and is related to disorders of negative thinking in schizophrenia.59 the results obtained from our research would seem to coincide with the hypothesis that poverty of language in schizophrenia is due to difficulty in finding words.60,61 this may be verified, given that the results obtained in the vocabulary section of the verbal - wais seem to validate this hypothesis. these results are in contrast with those reported by berenbaum,6 who found no consistent results on this point in their study, and indicated that performance in finding words could not be associated with verbal ability, although it may be significantly related to the coherence of perturbed speech. the main conclusion we can draw from this study is that even though both speaker and listener know the different meanings of words, which is a necessary condition for sharing a message and a conversation, a breakdown seems to occur in this communicative competence in patients with schizophrenia, mainly affecting pragmatics. in our assessment of pragmatics, some difficulties were observed in capturing the interlocutor s communicative intention, and in being able to interpret the message according to each interlocutor and communicative situation.2 patients with schizophrenia show greater difficulties in their communication skills when different pieces of information are included in the conversation, when some adaptation to social conventions is required, when they have no direct instructions, and especially when some indirect action requirements are included in the conversation. what in one way or another seems to be evident is that in schizophrenia the superior level of the language structure seems to be compromised, and it is this level that is related to semantics and pragmatics ; when there is an alteration in this level, symptoms of ftd appear, with a wide - ranging relationship between both language and ftd.26,53,6163 the data obtained in this study concur with observations from an analysis of schizophrenic speech by champagne - lavau and stip1 who concluded that schizophrenia by definition implies the presentation of ftd, producing language distortions. our data also support the idea that the focus of the dysfunction in schizophrenia may be in thought processes. language deterioration forms part of a dysfunction in thinking, because pragmatics and speech analysis are the most significant features of language disorders in people with schizophrenia. | background : the aim of this study was to analyze how formal thought disorders (ftd) affect semantics and pragmatics in patients with schizophrenia.methods:the sample comprised subjects with schizophrenia (n = 102) who met the criteria for the disorder according to the diagnostic and statistical manual of mental disorders, 4th edition text revision. in the research process, the following scales were used : positive and negative syndrome scale (panss) for psychopathology measurements ; the scale for the assessment of thought, language, and communication (tlc) for ftd, word accentuation test (wat), system for the behavioral evaluation of social skills (sechs), the pragmatics section of the objective criteria language battery (bloc - sr) and the verbal sections of the wechsler adults intelligence scale (wais) iii, for assessment of semantics and pragmatics.results:the results in the semantics and pragmatics sections were inferior to the average values obtained in the general population. our data demonstrated that the more serious the ftd, the worse the performances in the verbal - wais tests (particularly in its vocabulary, similarities, and comprehension sections), sechs, and bloc - sr, indicating that ftd affects semantics and pragmatics, although the results of the wat indicated good premorbid language skills.conclusion:the principal conclusion we can draw from this study is the evidence that in schizophrenia the superior level of language structure seems to be compromised, and that this level is related to semantics and pragmatics ; when there is an alteration in this level, symptoms of ftd appear, with a wide - ranging relationship between both language and ftd. the second conclusion is that the subject s language is affected by the disorder and rules out the possibility of a previous verbal impairment. |
msl3 resides in the msl (male - specific - lethal) complex that upregulates transcription by spreading the h4k16 acetyl - mark. we discovered a dna - dependent interaction of msl3 chromodomain with the histone h4k20 monomethyl - mark. structure of a ternary complex shows dna minor groove accommodates the histone h4 tail, and monomethyllysine inserts in a four - residue aromatic cage in msl3. histone h4k16 acetyl - mark antagonizes msl3 binding, suggesting msl function is regulated by a combination of post - translational modifications. |
|
the performance of the treatment planning system (tps) is a key component in any radiation therapy process. many studies have been done to assess available treatment planning systems as well as to provide guidelines to be followed in the commissioning process, mainly for external beam calculations [13 ]. concerning brachytherapy, and mainly due to developments such as the use of remote afterloading, the availability of ct, mr or us imaging for structure delineation and source path definition or the use of low energy gamma ray sources, an increasing interest in the improved accuracy of brachytherapy dose calculations has emerged [46 ]. in order to help in organizing a quality assurance program there are some publications providing useful guidelines, namely for the quality control of treatment planning systems used in brachytherapy [3, 7 ]. the purpose of this work is to report the results of the commissioning process of the oncentra brachytherapy module recently available for the oncentra masterplan treatment planning system of nucletron. a set of tests has been identified in order to have a comprehensive assessment of the accuracy of dose calculations implemented in oncentra brachy (ob) when compared with the results of plato, version 14.3.7, also from nucletron, that has been used in the local clinical routine for the last years and was thus taken as a reference in these comparisons. the delineated set of tests included both simple geometrical catheter configurations and real clinical cases both for intracavitary gynaecological implants and interstitial breast implants. all clinical plans have been evaluated under the local clinical acceptance criteria that are based on dose - volume quality indexes. both dose - volume histogram (dvh) parameters and visual inspection of the resulting dose distributions have been compared. local clinical calculations follow different dosimetry protocols that use different optimization approaches. the same processes have been followed in the ob system under consideration. new optimization tools available in ob and not in our configuration of plato, such as the ipsa algorithm, have also been tested in order to achieve acceptable clinical plans. oncentra brachy, version 3.2, service pack 3.0 was benchmarked against plato, version 14.3.7, both from nucletron. commissioning tests were divided into two categories : simple geometric catheter configurations and clinical implant situations for endovaginal intracavitary and interstitial breast implants. for these tests, it was aligned along the y axis and centred with the xyz coordinate system. for a third configuration, 1c, two catheters were defined, also parallel to the y axis but with 1 cm separation between them. for each configuration, one or two dwell positions were activated. according to the recommendations of estro booklet no. 8 and assuming a cylindrical symmetry, a set of points was defined around the catheter(s) in order to calculate the delivered dose. the dose was prescribed to one of the defined points and it was considered to be 1 gy. one catheter defined along the y axis and centred with the xyz coordinate system. the dwell position that was activated is located at the (0, 0, 0) position. a2 with coordinates (-0.5, 0, 0) corresponds to the normalization point. a1, a3, a4 e a5 have, respectively, the following coordinates : (-1.0, 0, 0), (-0.5, 0.5, 0), (-0.5, 1.0, 0) and (0, -0.5, 0) ; b. one catheter aligned through the y axis and centred with the xyz coordinate system. two dwell positions were activated, respectively, at (0, -1.0, 0) and (0, 1.0, 0) coordinates. a2 with coordinates (-0.5, 0, 0) corresponds to the normalization point. a1, a3, and a4 have, respectively, the following coordinates (0, 0, 0), (-1.0, 1.0, 0) and (0, 1.5, 0) ; c. two catheters aligned parallel to the y axis and with a 1 cm separation between them. a3 with coordinates (-1.0, 0, 0) corresponds to the normalization point. a1, a2, a4 e a5 have, respectively, the following coordinates : (0, 0, 0), (0, 0.5, 0), (-1.0, 0.5, 0) and (-0.5, -1.0, 0) an excel worksheet was used for independent point dose calculations following the tg-43 dosimetry protocol. published dosimetric data were used for the ir source which is installed in the tcs, v2, selectron hdr treatment unit, from nucletron. for all these calculations a ir source strength of 18855.19 cgycm / h was used. at our radiotherapy department, using plato tps, endovaginal intracavitary gynaecological implants are performed with the cylinder applicator, from nucletron. according to the clinical prescription a certain length, starting from the most distal position in the applicator, is activated. the dose is prescribed to the applicator surface at four applicator points, defined centred with the activated length. in order to flatten the dose distribution, a set of dose points the dose distribution is optimized on those dose points and on distance, considering the dwell time gradient ratio (dtgr) equal to 0.5. according to the respective clinical prescription, three treatment plans of patients who had already been treated were reproduced in ob tps. a set of ct images and corresponding delineated volumes of four clinical cases (already treated patients) were randomly chosen for this study. the clinical target volumes (ctvs), corresponding to the volume encompassing the surgical clips with a margin of 7 mm or 10 mm, ranged from 7 cm to 22 cm. these volumes are always delineated in the oncentra masterplan target definition module (common to external beam calculation modules) and then exported to plato. our local clinical dosimetry protocol comprises a mixed dosimetry system that includes the auto - activation of source dwell positions along the ctv plus a 5 mm margin and the definition of basal points throughout the activated length (like in the stepping source dosimetry system). the dose prescription to 85% of the dose received by the basal points is modified by the use of the graphical optimization tool in order to fulfil the plan acceptance criteria, which are based on dose - quality indexes. the required coverage index is ci > 95% ; for the overdosage index, oi, values that correspond to an absolute volume less than 6 cc are accepted, and to reach a conformal treatment plan, the conformity index, coin, should be greater than 0.6 [10, 1214 ]. the plato treatment plans were reproduced in ob starting from the catheter reconstruction because, at this time, it is not possible to export treatment plans from plato to the ob system. treatment plan comparisons were done based on the calculated dose distributions, visualized on the ct axial images, as well as on the calculated dose - volume quality indexes (ci, oi and coin). in ob the ipsa algorithm was also tested and the optimized treatment plans were compared with the ones previously calculated in plato. the ipsa algorithm implies the definition of a set of dose objectives and their corresponding weights. so, the parameters dose and activation margins (mm) were set to zero, which prevents the dose distribution being expanded outside the delineated ctv and the activation of source dwell positions outside the target. in what concerns the target, just the parameter related to the minimum dose at the ctv surface was used and its weight was set to the maximum value of 200. in order to limit the volume irradiated with a dose higher than twice the prescribed dose, an auxiliary structure was defined, which corresponded to the external contour excluding the ctv. the objective for this volume was a dose around 80% to 100% of the prescribed dose with a relative importance of 100. if the target was less than 5 mm from the skin, the external contour was also used and the maximum dose to its surface was set as equal to half the prescribed dose, with a relative importance of 150. of course these settings constitute a starting point, which must be tuned for each case. for dvh calculations, the number of sampling points of 100 000 was chosen because it corresponds to the maximum number allowed in plato. regarding the number of bins the maximum allowed value of 800 was used in the ob system. regarding the calculation matrix, which is also possible to be defined in ob, the voxel was set to 1 mm. the set of activated positions and the corresponding dwell times obtained in ob with ipsa were manually introduced backwards in plato. for these tests, three simple configurations were created. for two of them, see figs. it was aligned along the y axis and centred with the xyz coordinate system. for a third configuration, 1c, two catheters were defined, also parallel to the y axis but with 1 cm separation between them. for each configuration, one or two dwell positions were activated. according to the recommendations of estro booklet no. 8 and assuming a cylindrical symmetry, a set of points was defined around the catheter(s) in order to calculate the delivered dose. the dose was prescribed to one of the defined points and it was considered to be 1 gy. one catheter defined along the y axis and centred with the xyz coordinate system. the dwell position that was activated is located at the (0, 0, 0) position. a2 with coordinates (-0.5, 0, 0) corresponds to the normalization point. a1, a3, a4 e a5 have, respectively, the following coordinates : (-1.0, 0, 0), (-0.5, 0.5, 0), (-0.5, 1.0, 0) and (0, -0.5, 0) ; b. one catheter aligned through the y axis and centred with the xyz coordinate system. two dwell positions were activated, respectively, at (0, -1.0, 0) and (0, 1.0, 0) coordinates. a2 with coordinates (-0.5, 0, 0) corresponds to the normalization point. a1, a3, and a4 have, respectively, the following coordinates (0, 0, 0), (-1.0, 1.0, 0) and (0, 1.5, 0) ; c. two catheters aligned parallel to the y axis and with a 1 cm separation between them. a3 with coordinates (-1.0, 0, 0) corresponds to the normalization point. a1, a2, a4 e a5 have, respectively, the following coordinates : (0, 0, 0), (0, 0.5, 0), (-1.0, 0.5, 0) and (-0.5, -1.0, 0) an excel worksheet was used for independent point dose calculations following the tg-43 dosimetry protocol. published dosimetric data were used for the ir source which is installed in the tcs, v2, selectron hdr treatment unit, from nucletron. for all these calculations a ir source strength of 18855.19 cgycm / h was used. at our radiotherapy department, using plato tps, endovaginal intracavitary gynaecological implants are performed with the cylinder applicator, from nucletron. according to the clinical prescription a certain length, starting from the most distal position in the applicator, the dose is prescribed to the applicator surface at four applicator points, defined centred with the activated length. in order to flatten the dose distribution, a set of dose points the dose distribution is optimized on those dose points and on distance, considering the dwell time gradient ratio (dtgr) equal to 0.5. according to the respective clinical prescription, three treatment plans of patients who had already been treated were reproduced in ob tps. a set of ct images and corresponding delineated volumes of four clinical cases (already treated patients) were randomly chosen for this study. the clinical target volumes (ctvs), corresponding to the volume encompassing the surgical clips with a margin of 7 mm or 10 mm, ranged from 7 cm to 22 cm. these volumes are always delineated in the oncentra masterplan target definition module (common to external beam calculation modules) and then exported to plato. our local clinical dosimetry protocol comprises a mixed dosimetry system that includes the auto - activation of source dwell positions along the ctv plus a 5 mm margin and the definition of basal points throughout the activated length (like in the stepping source dosimetry system). the dose prescription to 85% of the dose received by the basal points is modified by the use of the graphical optimization tool in order to fulfil the plan acceptance criteria, which are based on dose - quality indexes. the required coverage index is ci > 95% ; for the overdosage index, oi, values that correspond to an absolute volume less than 6 cc are accepted, and to reach a conformal treatment plan, the conformity index, coin, should be greater than 0.6 [10, 1214 ]. the plato treatment plans were reproduced in ob starting from the catheter reconstruction because, at this time, it is not possible to export treatment plans from plato to the ob system. treatment plan comparisons were done based on the calculated dose distributions, visualized on the ct axial images, as well as on the calculated dose - volume quality indexes (ci, oi and coin). in ob the ipsa algorithm was also tested and the optimized treatment plans were compared with the ones previously calculated in plato. the ipsa algorithm implies the definition of a set of dose objectives and their corresponding weights. so, the parameters dose and activation margins (mm) were set to zero, which prevents the dose distribution being expanded outside the delineated ctv and the activation of source dwell positions outside the target. in what concerns the target, just the parameter related to the minimum dose at the ctv surface was used and its weight was set to the maximum value of 200. in order to limit the volume irradiated with a dose higher than twice the prescribed dose, an auxiliary structure was defined, which corresponded to the external contour excluding the ctv. the objective for this volume was a dose around 80% to 100% of the prescribed dose with a relative importance of 100. if the target was less than 5 mm from the skin, the external contour was also used and the maximum dose to its surface was set as equal to half the prescribed dose, with a relative importance of 150. of course these settings constitute a starting point, which must be tuned for each case. for dvh calculations, the number of sampling points of 100 000 was chosen because it corresponds to the maximum number allowed in plato. regarding the number of bins the maximum allowed value of 800 was used in the ob system. regarding the calculation matrix, which is also possible to be defined in ob, the voxel was set to 1 mm. the set of activated positions and the corresponding dwell times obtained in ob with ipsa were manually introduced backwards in plato. at our radiotherapy department, using plato tps, endovaginal intracavitary gynaecological implants are performed with the cylinder applicator, from nucletron. according to the clinical prescription a certain length, starting from the most distal position in the applicator, the dose is prescribed to the applicator surface at four applicator points, defined centred with the activated length. in order to flatten the dose distribution, a set of dose points the dose distribution is optimized on those dose points and on distance, considering the dwell time gradient ratio (dtgr) equal to 0.5. according to the respective clinical prescription, three treatment plans of patients who had already been treated were reproduced in ob tps. a set of ct images and corresponding delineated volumes of four clinical cases (already treated patients) were randomly chosen for this study. the clinical target volumes (ctvs), corresponding to the volume encompassing the surgical clips with a margin of 7 mm or 10 mm, ranged from 7 cm to 22 cm. these volumes are always delineated in the oncentra masterplan target definition module (common to external beam calculation modules) and then exported to plato. our local clinical dosimetry protocol comprises a mixed dosimetry system that includes the auto - activation of source dwell positions along the ctv plus a 5 mm margin and the definition of basal points throughout the activated length (like in the stepping source dosimetry system). the dose prescription to 85% of the dose received by the basal points is modified by the use of the graphical optimization tool in order to fulfil the plan acceptance criteria, which are based on dose - quality indexes. the required coverage index is ci > 95% ; for the overdosage index, oi, values that correspond to an absolute volume less than 6 cc are accepted, and to reach a conformal treatment plan, the conformity index, coin, should be greater than 0.6 [10, 1214 ]. the plato treatment plans were reproduced in ob starting from the catheter reconstruction because, at this time, it is not possible to export treatment plans from plato to the ob system. treatment plan comparisons were done based on the calculated dose distributions, visualized on the ct axial images, as well as on the calculated dose - volume quality indexes (ci, oi and coin). in ob the ipsa algorithm was also tested and the optimized treatment plans were compared with the ones previously calculated in plato. the ipsa algorithm implies the definition of a set of dose objectives and their corresponding weights. so, the parameters dose and activation margins (mm) were set to zero, which prevents the dose distribution being expanded outside the delineated ctv and the activation of source dwell positions outside the target. in what concerns the target, just the parameter related to the minimum dose at the ctv surface was used and its weight was set to the maximum value of 200. in order to limit the volume irradiated with a dose higher than twice the prescribed dose, an auxiliary structure was defined, which corresponded to the external contour excluding the ctv. the objective for this volume was a dose around 80% to 100% of the prescribed dose with a relative importance of 100. if the target was less than 5 mm from the skin, the external contour was also used and the maximum dose to its surface was set as equal to half the prescribed dose, with a relative importance of 150. of course these settings constitute a starting point, which must be tuned for each case. for dvh calculations, the number of sampling points of 100 000 was chosen because it corresponds to the maximum number allowed in plato. regarding the number of bins the maximum allowed value of 800 was used in the ob system. regarding the calculation matrix, which is also possible to be defined in ob, the voxel was set to 1 mm. the set of activated positions and the corresponding dwell times obtained in ob with ipsa were manually introduced backwards in plato. tables 1a to 1c show the results of the calculations, using plato, ob and the independent manual calculation, in each of the defined points, considering the configurations shown in figs. there was a very good agreement as the percentage standard deviations were less than 1% for all the calculation points in all three catheter arrangements. 1a, using the plato, ob tps and manual calculations b. point dose calculation and percentage standard deviations for catheter geometry shown in fig. 1b, using the plato, ob tps and manual calculations c. point dose calculation and percentage standard deviations for catheter geometry shown in fig. 1c, using the plato, ob tps and manual calculations for each configuration, the total treatment time, calculated by both tps, was very similar. table 2 exemplifies, for one of the planned endovaginal implants, the obtained time pattern as well as the global treatment time in ob benchmarked against plato. if a value of 0.5 is considered for the dtgr parameter (on the left in table 2), the percentage difference in terms of total treatment time is -1.1%. nevertheless, if we look into the time spent by the source at each activated dwell position, although both tps attribute a higher weight to the extreme dwell positions, ob calculations resulted in a smoother time distribution. global and partial treatment times for an endovaginal gynaecological treatment, planned in plato and ob. within plato these treatment plans are optimized on dose points and on distance, using a value of 0.5 for the dtgr parameter (results shown on the left). in order to reproduce in ob the same time pattern a slightly different value of ob had to be used (results shown on the right) making in ob a slight change in the dtgr parameter, specifically using the value 0.452 instead of 0.5, resulted in a time pattern equivalent to the one obtained with plato for both the global and the partial time distribution (on the right in table 2). as can be seen in fig.. in terms of the dose distributions, analysed on the basis of the length and width of the 100% isodose, the plans generated by the two tps were equivalent. for these measures the ruler tool in plato and the measures dose on axis points, defined on applicator surface at every activated dwell position, calculated both with plato, dtgr = 0.5, and ob both with dtgr = 0.5 and dtgr = 0.452 the first observed difference between the two tps was related to the ctv volume calculation, which was done on both tps, indirectly, through dvh calculation and not using dedicated tools. in fig. 3, the ctv volumes are presented for each planned breast case as well as the percentage differences. as expected, the smaller the volume, the greater the relative difference between the calculated volume values. both ctvs had been delineated in the omp target definition module but the computed volume turned out to be different in ob and plato. the reason is related to the different strategies used by each tps to calculate the volume of delineated structures. in plato, the volume calculation is based on random points within the volume, and in ob the volume is calculated through the reconstruction of a 3d matrix. the percentage differences, considering the values calculated by plato as reference, are also shown figures 4 to 6 show the calculated values for the coverage index, ci, the conformity index, coin, and the overdosage index, oi, respectively. from the point of view of the calculated dose - volume quality indexes, the treatment plans in ob turned out to be equivalent and the planning sequence very similar to that of the plato system. some local differences were observed in terms of the individual catheters that were activated, but this could be justified by the fact that the complete catheter reconstruction had to be repeated in ob, which may introduce small differences in the source path definition. coverage index, ci, calculated for each treatment plan planned in plato and ob according to the local dosimetry protocol conformity index, coin, calculated for each treatment plan planned in plato and ob according to the local dosimetry protocol overdosage index, oi, calculated for each treatment plan planned in plato and ob according to the local dosimetry protocol in what concerns the use of the ipsa algorithm, the results for the calculated quality indexes ci, coin and oi are shown in figs. 7, 8 and 9, respectively, and compared with the same parameters from the original treatment plans, calculated with plato tps. from this point of view the treatment plans could be considered equivalent. a slightly better coin has been achieved at the expense of a higher oi, although below the limit value in our clinical practice. coverage index, ci, calculated for each treatment plan planned in plato and ob, using the ipsa algorithm conformal index, coin, calculated for each treatment plan planned in plato and ob, using the ipsa algorithm overdosage index, oi, calculated for each treatment plan planned in plato and ob, using the ipsa algorithm the major differences have been obtained in the number of activated catheters. as the parameters dose and activation margins within ipsa are constrained to zero, the number of activated catheters is substantially lower than used to be the case with our dosimetry implemented protocol. in consequence, the pattern of activation resulting from ipsa optimization was considerably different from the activation pattern achieved with the dosimetry system used in our clinical practice, which is a mix between the standard stepping - source dosimetry system and the conformal dosimetry system. however, the ipsa optimized plan manually replicated in the plato system resulted in a dose distribution with the same shape in each ct axial slice. tables 1a to 1c show the results of the calculations, using plato, ob and the independent manual calculation, in each of the defined points, considering the configurations shown in figs. there was a very good agreement as the percentage standard deviations were less than 1% for all the calculation points in all three catheter arrangements. 1a, using the plato, ob tps and manual calculations b. point dose calculation and percentage standard deviations for catheter geometry shown in fig. 1b, using the plato, ob tps and manual calculations c. point dose calculation and percentage standard deviations for catheter geometry shown in fig. 1c, using the plato, ob tps and manual calculations for each configuration, the total treatment time, calculated by both tps, was very similar. table 2 exemplifies, for one of the planned endovaginal implants, the obtained time pattern as well as the global treatment time in ob benchmarked against plato. if a value of 0.5 is considered for the dtgr parameter (on the left in table 2), the percentage difference in terms of total treatment time is -1.1%. nevertheless, if we look into the time spent by the source at each activated dwell position, although both tps attribute a higher weight to the extreme dwell positions, ob calculations resulted in a smoother time distribution. global and partial treatment times for an endovaginal gynaecological treatment, planned in plato and ob. within plato these treatment plans are optimized on dose points and on distance, using a value of 0.5 for the dtgr parameter (results shown on the left). in order to reproduce in ob the same time pattern a slightly different value of ob had to be used (results shown on the right) making in ob a slight change in the dtgr parameter, specifically using the value 0.452 instead of 0.5, resulted in a time pattern equivalent to the one obtained with plato for both the global and the partial time distribution (on the right in table 2). as can be seen in fig.. in terms of the dose distributions, analysed on the basis of the length and width of the 100% isodose, the plans generated by the two tps were equivalent. for these measures the ruler tool in plato and the measures dose on axis points, defined on applicator surface at every activated dwell position, calculated both with plato, dtgr = 0.5, and ob both with dtgr = 0.5 and dtgr = 0.452 the first observed difference between the two tps was related to the ctv volume calculation, which was done on both tps, indirectly, through dvh calculation and not using dedicated tools. in fig. 3, the ctv volumes are presented for each planned breast case as well as the percentage differences. as expected, the smaller the volume, the greater the relative difference between the calculated volume values. both ctvs had been delineated in the omp target definition module but the computed volume turned out to be different in ob and plato. the reason is related to the different strategies used by each tps to calculate the volume of delineated structures. in plato, the volume calculation is based on random points within the volume, and in ob the volume is calculated through the reconstruction of a 3d matrix. the percentage differences, considering the values calculated by plato as reference, are also shown figures 4 to 6 show the calculated values for the coverage index, ci, the conformity index, coin, and the overdosage index, oi, respectively. from the point of view of the calculated dose - volume quality indexes, the treatment plans in ob turned out to be equivalent and the planning sequence very similar to that of the plato system. some local differences were observed in terms of the individual catheters that were activated, but this could be justified by the fact that the complete catheter reconstruction had to be repeated in ob, which may introduce small differences in the source path definition. coverage index, ci, calculated for each treatment plan planned in plato and ob according to the local dosimetry protocol conformity index, coin, calculated for each treatment plan planned in plato and ob according to the local dosimetry protocol overdosage index, oi, calculated for each treatment plan planned in plato and ob according to the local dosimetry protocol in what concerns the use of the ipsa algorithm, the results for the calculated quality indexes ci, coin and oi are shown in figs. 7, 8 and 9, respectively, and compared with the same parameters from the original treatment plans, calculated with plato tps. a slightly better coin has been achieved at the expense of a higher oi, although below the limit value in our clinical practice. coverage index, ci, calculated for each treatment plan planned in plato and ob, using the ipsa algorithm conformal index, coin, calculated for each treatment plan planned in plato and ob, using the ipsa algorithm overdosage index, oi, calculated for each treatment plan planned in plato and ob, using the ipsa algorithm the major differences have been obtained in the number of activated catheters. as the parameters dose and activation margins within ipsa are constrained to zero, the number of activated catheters is substantially lower than used to be the case with our dosimetry implemented protocol. in consequence, the pattern of activation resulting from ipsa optimization was considerably different from the activation pattern achieved with the dosimetry system used in our clinical practice, which is a mix between the standard stepping - source dosimetry system and the conformal dosimetry system. however, the ipsa optimized plan manually replicated in the plato system resulted in a dose distribution with the same shape in each ct axial slice. table 2 exemplifies, for one of the planned endovaginal implants, the obtained time pattern as well as the global treatment time in ob benchmarked against plato. if a value of 0.5 is considered for the dtgr parameter (on the left in table 2), the percentage difference in terms of total treatment time is -1.1%. nevertheless, if we look into the time spent by the source at each activated dwell position, although both tps attribute a higher weight to the extreme dwell positions, ob calculations resulted in a smoother time distribution. global and partial treatment times for an endovaginal gynaecological treatment, planned in plato and ob. within plato these treatment plans are optimized on dose points and on distance, using a value of 0.5 for the dtgr parameter (results shown on the left). in order to reproduce in ob the same time pattern a slightly different value of ob had to be used (results shown on the right) making in ob a slight change in the dtgr parameter, specifically using the value 0.452 instead of 0.5, resulted in a time pattern equivalent to the one obtained with plato for both the global and the partial time distribution (on the right in table 2). as can be seen in fig.. in terms of the dose distributions, analysed on the basis of the length and width of the 100% isodose, the plans generated by the two tps were equivalent. for these measures the ruler tool in plato and the measures dose on axis points, defined on applicator surface at every activated dwell position, calculated both with plato, dtgr = 0.5, and ob both with dtgr = 0.5 and dtgr = 0.452 the first observed difference between the two tps was related to the ctv volume calculation, which was done on both tps, indirectly, through dvh calculation and not using dedicated tools. in fig. 3, the ctv volumes are presented for each planned breast case as well as the percentage differences. as expected, the smaller the volume, the greater the relative difference between the calculated volume values. both ctvs had been delineated in the omp target definition module but the computed volume turned out to be different in ob and plato. the reason is related to the different strategies used by each tps to calculate the volume of delineated structures. in plato, the volume calculation is based on random points within the volume, and in ob the volume is calculated through the reconstruction of a 3d matrix. the percentage differences, considering the values calculated by plato as reference, are also shown figures 4 to 6 show the calculated values for the coverage index, ci, the conformity index, coin, and the overdosage index, oi, respectively. from the point of view of the calculated dose - volume quality indexes, the treatment plans in ob turned out to be equivalent and the planning sequence very similar to that of the plato system. some local differences were observed in terms of the individual catheters that were activated, but this could be justified by the fact that the complete catheter reconstruction had to be repeated in ob, which may introduce small differences in the source path definition. coverage index, ci, calculated for each treatment plan planned in plato and ob according to the local dosimetry protocol conformity index, coin, calculated for each treatment plan planned in plato and ob according to the local dosimetry protocol overdosage index, oi, calculated for each treatment plan planned in plato and ob according to the local dosimetry protocol in what concerns the use of the ipsa algorithm, the results for the calculated quality indexes ci, coin and oi are shown in figs. 7, 8 and 9, respectively, and compared with the same parameters from the original treatment plans, calculated with plato tps. a slightly better coin has been achieved at the expense of a higher oi, although below the limit value in our clinical practice. coverage index, ci, calculated for each treatment plan planned in plato and ob, using the ipsa algorithm conformal index, coin, calculated for each treatment plan planned in plato and ob, using the ipsa algorithm overdosage index, oi, calculated for each treatment plan planned in plato and ob, using the ipsa algorithm the major differences have been obtained in the number of activated catheters. as the parameters dose and activation margins within ipsa are constrained to zero, the number of activated catheters is substantially lower than used to be the case with our dosimetry implemented protocol. in consequence, the pattern of activation resulting from ipsa optimization was considerably different from the activation pattern achieved with the dosimetry system used in our clinical practice, which is a mix between the standard stepping - source dosimetry system and the conformal dosimetry system. however, the ipsa optimized plan manually replicated in the plato system resulted in a dose distribution with the same shape in each ct axial slice. point dose calculations were performed in order to test the adequate use of the published dosimetric data for the ir source of the hdr selectron treatment unit and, simultaneously, to check the correct implementation of the tg-43 dosimetry protocol in ob. the calculations independently performed were consistent within 1% with the results of plato and ob. regarding the endovaginal intracavitary brachytherapy implants, we have found that the calculated treatment plans in both tps were consistent with each other. nevertheless, in order to reproduce the treatment plans accepted in our clinical practice, a slight change in the dtgr parameter had to be assumed. concerning more complex situations, such as interstitial breast brachytherapy implants, we have been able to reproduce our local dosimetry protocol. from the point of view of the calculated dose distributions, inspected on each ct slice, as well as from the calculated values for the dose - volume quality indexes, it was possible to achieve similar treatment plans, fulfilling the local clinical acceptance criteria. the use of the ipsa tool, available in ob, constitutes an accelerating factor in the treatment plan workflow. the obtained solutions, once adequate dose objectives and their respective weights were defined, were close to the clinically acceptable solutions. nevertheless, graphical optimization was still needed. the recently installed oncentra brachy module of omp nucletron was benchmarked against plato tps used so far in our clinical routine. different plans were tested from simple geometrical catheter configurations to clinical implants corresponding to intracavitary gynaecological implants and interstitial breast implants. having as our main purpose the commissioning of the ob version 3.2, service pack 3.0, we have concluded, at the end of this set of tests, that it is possible to use it in clinical routine. the workflow and available menus are similar to plato tps so the migration will be quite straightforward. nevertheless, we do stress here some limitations, namely the non - consideration of heterogeneities and the unavailability of shielding options for either gynaecological or rectum and anal canal cases. | purposeto describe the tests that have been performed in order to commission the brachytherapy module, version 3.2, service pack 3.0, of the oncentra masterplan treatment plan system (ob), from nucletron. the results were benchmarked against those obtained with the plato system, v 14.3.7, also from nucletron, used in the clinical routine.material and methodscommissioning was performed taking plato, v 14.3.7 as the standard tps used in clinical practice. commissioning tests were divided into two categories : i) simple geometric catheter configurations and ii) clinical intracavitary gynaecological and interstitial breast implants. for category i), also manual independent point dose calculations following the tg-43 dosimetry protocol were included in the comparisons. for category ii), the treatment plan comparisons were based on the calculated dose distributions in ct axial plans and on the dose - volume quality indexes following the local clinical acceptance criteria. similar optimization tools were used in both systems. ipsa in ob was tested for planning interstitial breast implants and compared with the optimization process used with plato in the clinical routine.results and conclusionsregarding the point dose calculations, the agreement was better than 1%. for the clinical compared cases and using the same optimization tools all plans ended in similar dose distributions and very close quality indexes. nevertheless, for endovaginal treatment plans, a slightly different value for the dtgr parameter had to be used (0.452, instead of 0.5 used as default in plato) in order to achieve the same dwell time for each activated source dwell position. concerning interstitial breast implants, the ipsa algorithm constitutes a fast tool to reach a close clinical acceptable solution but graphical optimization is still needed. considering these results the ob module was accepted for clinical use despite some persisting limitations, such as no consideration of heterogeneities or options for applicator shielding. |
62.4 million indians were reported to have type 2 diabetes mellitus (t2 dm) putting india on the forefront of diabetic epidemic across globe. fear of hypoglycaemia and gain in body weight are barriers for initiation of insulin therapy. modern insulin analogues are a convenient new approach or tool to glycaemic control, associated with low number of hypoglycaemia and favourable weight change. a1chieve, a multinational, 24-week, non - interventional study, assessed the safety and effectiveness of insulin analogues in people with t2 dm (n = 66,726) in routine clinical care. please refer to editorial titled : the a1chieve study : mapping the ibn battuta trail. the patient characteristics for the entire cohort divided as insulin - nave and insulin users is shown in the table 1. the majority of patients (79.2%) started on or switched to biphasic insulin aspart. other groups were insulin detemir (n = 94), insulin aspart (n = 90), basal insulin plus insulin aspart (n = 28) and other insulin combinations (n = 19). overall demographic data after 24 weeks of treatment, overall hypoglycaemic events reduced from 6.9 events / patient - year to 0.9 events / patient - year in insulin users whereas overall hypoglycaemia increased from 0.2 events / patient - year to 0.7 events / patient - year in insulin naive group. however, this hypoglycaemia incidence in insulin naive group at 24 weeks was still lower than that observed in insulin users at baseline. blood pressure decreased while overall lipid profile and quality of life improved at week 24 in the total cohort but the findings were limited by number of observations [tables 2 and 3 ]. all parameters of glycaemic control improved from baseline to study end in the total cohort [table 4 ]. overall efficacy data of the total cohort, 897 patients started on biphasic insulin aspart ogld, of which 769 (85.7%) were insulin nave and 128 (14.3%) were insulin users. after 24 weeks of starting or switching to biphasic insulin aspart, hypoglycaemic events decreased from 7.7 events / patient - year to 1.1 events / patient - year in insulin user group while hypoglycaemia increased from 0.2 events / patient - year to 0.8 events / patient - year in insulin naive group. a small increase in body weight biphasic insulin aspartoral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to biphasic insulin aspart for both insulin nave and insulin user groups [table 7 ]. biphasic insulin aspartoral glucose - lowering drug efficacy data of the total cohort, 28 patients started on basal + insulin aspart ogld, of which 15 (53.6%) were insulin nave and 13 (46.4%) were insulin users. after 24 weeks of starting or switching to biphasic insulin aspart, hypoglycaemic events remained nil in both insulin user and nave group similar to that of baseline. quality of life improved at the end of the 24 weeks [tables 8 and 9 ]. basal+insulin aspartoral glucose - lowering drug safety data mean hba1c and fpg value of glycaemic control improved from baseline to study end in those who started on or were switched to basal + insulin aspart oglds for both insulin nave and insulin user groups [table 10 ]. basal+insulin aspartoral glucose - lowering drug efficacy data of the total cohort, 94 patient started on insulin detemir ogld, of which 82 (87.2%) were insulin nave and 12 (12.8%) were insulin users. after 24 weeks of starting or switching to insulin detemir, hypoglycaemic events reduced from 0.8 events / patient - year to 0.4 events / patient - year in insulin naive group, whereas hypoglycaemia increased from 1.1 events / patient - year to 1.3 events / patient - year in insulin user group. quality of life improved after 24 weeks [table 11 and 12 ]. insulin detemiroral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to insulin detemir oglds for both insulin - nave and insulin user groups [table 13 ]. insulin detemiroral glucose - lowering drug efficacy data of the total cohort, 90 patients started on insulin aspart ogld was 90, of which 85 (94.4%) were insulin nave and 5 (5.6%) were insulin users. after 24 weeks of treatment starting or switching to insulin aspart, hypoglycaemic events decreased from 31.1 events / patient - year to 0.0 events / patient - year in insulin users while hypoglycaemia increased from 0.0 events / patient - year to 0.2 events / patient - year in insulin naive group. an increase in body weight was observed for insulin user group [table 14 and 15 ]. insulin aspartoral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to insulin aspart oglds for insulin nave group while mean hba1c and fpg values improved in the insulin user group [table 16 ]. of the total cohort, 897 patients started on biphasic insulin aspart ogld, of which 769 (85.7%) were insulin nave and 128 (14.3%) were insulin users. after 24 weeks of starting or switching to biphasic insulin aspart, hypoglycaemic events decreased from 7.7 events / patient - year to 1.1 events / patient - year in insulin user group while hypoglycaemia increased from 0.2 events / patient - year to 0.8 events / patient - year in insulin naive group. a small increase in body weight biphasic insulin aspartoral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to biphasic insulin aspart for both insulin nave and insulin user groups [table 7 ]. of the total cohort, 28 patients started on basal + insulin aspart ogld, of which 15 (53.6%) were insulin nave and 13 (46.4%) were insulin users. after 24 weeks of starting or switching to biphasic insulin aspart, hypoglycaemic events remained nil in both insulin user and nave group similar to that of baseline. quality of life improved at the end of the 24 weeks [tables 8 and 9 ]. basal+insulin aspartoral glucose - lowering drug safety data mean hba1c and fpg value of glycaemic control improved from baseline to study end in those who started on or were switched to basal + insulin aspart oglds for both insulin nave and insulin user groups [table 10 ]. of the total cohort, 94 patient started on insulin detemir ogld, of which 82 (87.2%) were insulin nave and 12 (12.8%) were insulin users. after 24 weeks of starting or switching to insulin detemir, hypoglycaemic events reduced from 0.8 events / patient - year to 0.4 events / patient - year in insulin naive group, whereas hypoglycaemia increased from 1.1 events / patient - year to 1.3 events / patient - year in insulin user group. insulin detemiroral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to insulin detemir oglds for both insulin - nave and insulin user groups [table 13 ]. of the total cohort, 90 patients started on insulin aspart ogld was 90, of which 85 (94.4%) were insulin nave and 5 (5.6%) were insulin users. after 24 weeks of treatment starting or switching to insulin aspart, hypoglycaemic events decreased from 31.1 events / patient - year to 0.0 events / patient - year in insulin users while hypoglycaemia increased from 0.0 events / patient - year to 0.2 events / patient - year in insulin naive group. an increase in body weight was observed for insulin user group [table 14 and 15 ]. insulin aspartoral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to insulin aspart oglds for insulin nave group while mean hba1c and fpg values improved in the insulin user group [table 16 ] our study reports improved glycaemic control and quality of life following 24 weeks of treatment with any of the insulin analogues (biphasic insulin aspart ; basal + insulin aspart ; insulin detemir ; insulin aspart) with or without ogld. overall, a small increase in body weight was observed for both insulin nave and users group. sadrs including major hypoglycaemic events or episodes did not occur in any of the study patients. though the findings are limited by number of patients, still the trend indicates that insulin analogues can be considered effective and possess a safe profile for treating type 2 diabetes in west bengal, india. | background : the a1chieve, a multicentric (28 countries), 24-week, non - interventional study evaluated the safety and effectiveness of insulin detemir, biphasic insulin aspart and insulin aspart in people with t2 dm (n = 66,726) in routine clinical care across four continents.materials and methods : data was collected at baseline, 12 weeks and at 24 weeks. this short communication presents the results for patients enrolled from west bengal, india.results:a total of 1133 patients were enrolled in the study. four different insulin analogue regimens were used in the study. patients had started on or were switched to biphasic insulin aspart (n = 897), insulin detemir (n = 94), insulin aspart (n = 90), basal insulin plus insulin aspart (n = 28) and other insulin combinations (n = 19). at baseline glycaemic control was poor for both insulin nave (mean hba1c : 8.5%) and insulin user (mean hba1c : 8.9%) groups. after 24 weeks of treatment, both the study groups showed improvement in hba1c (insulin nave : 1.3%, insulin users : 1.6%). sadrs including major hypoglycaemic events or episodes did not occur in any of the study patients.conclusion:starting or switching to insulin analogues was associated with improvement in glycaemic control with a low rate of hypoglycaemia. |
cardiovascular diseases are the leading cause of morbidity and mortality in end - stage renal disease (esrd) patients. pulmonary arterial hypertension (pah) is one of the cardiovascular complications and is characterized by sustained elevations of pulmonary artery pressure. pah is a rare disease in the general population, but the prevalence of pah is substantially higher in hd patients, with a range between 30% and 66% [2,47].the importance of pah has recently been recognized among esrd patients receiving hemodialysis (hd) treatment. the pathogenesis of pah in end - stage renal disease patients remains poorly understood, and there is a need for better understanding of the pathogenesis of the condition, which would help to individualize treatment of ph in this patient population. several factors, such as fluid overload, arteriovenous fistulae, anemia, hypoalbuminemia, cardiac dysfunction, bone mineral disorder, uremic vasculopathy, and non - biocompatible dialysis membranes, have been suggested in the etiopathogenesis. fluid overload is a common and serious problem that leads to severe complications in hd patients and has a great impact on the pathogenesis of cardiovascular disease. furthermore, it is also suggested that fluid overload plays an important determining factor in the development of pah. in clinical practice, fluid status is most commonly evaluated based on clinical signs, such as changes in body weight, edema, and blood pressure. however, these clinical signs may lead to an erroneous evaluation. in recent years, multifrequency bioelectrical impedance analysis (bia), which is a simple, safe, novel, rapid, noninvasive, and promising method, has been used to determine fluid status in patients on dialysis therapy. multifrequency bia has been well validated and is the criterion standard method for fluid status measurement. to the best of our knowledge, only a few studies have investigated the prevalence and the etiopathogenic mechanisms underlying development of pah in hd patients. in the present study, we aimed to determine if esrd patients on maintenance hemodialysis have an increased risk in pah development, and the possible etiologic risk factors. the study design included 77 patients with esrd receiving long - term hd therapy, 3 times per week in the dicle university hospital dialysis unit. the local human research ethics committee approved the study protocol, and informed consent was obtained from all patients at the time of study enrollment. all patients were dialyzed using 1.6 m surface area high - flux polysulfone dialyzers (fresenius, bad homberg, germany) with bicarbonate - based dialysate (glucose 1 mmol / l, na 140 meq / l, hco332 meq / l, k 2.0 meq / l, ca 1.25 mmol / l, mg 0.5 meq / l). the prescribed duration time was 5 h with a blood flow rate of 250350 ml / min and a dialysate flow rate of 500 ml / min. the adequacy of dialysis was assessed by using kt / v (k dialyzer clearance of urea, t dialysis time, v volume of distribution of urea) according to the single - compartment daugirdas formula and urea reduction rate [urr=100(1-ureapost - dialysis / ureapre - dialysis)% ] formula. the exclusion criteria were : (1) chronic obstructive pulmonary disease, congenital cardiac anomalies, pulmonary emboli, left ventricular ejection fraction 35 mmhg) found that the prevalence of pah (defined as pap 35 mmhg) occurred in 41.1% of their hemodialysis patients. in a study by yigla., pah (defined as pap > 35 mmhg) was observed in 39.7% of patients receiving hemodialysis. another study found that pah (defined as pap > 35 mmhg) occurred in 52% of patients receiving hemodialysis. in our study, despite the fact that pah is a common and serious disease in hd patients, it has not been granted enough importance in clinical practice, perhaps partly due to the small number of large - scale studies. pathogenesis of pah has not been completely elucidated and the mechanisms leading to the disease are still under investigation. to the best of our knowledge, this is the first study to investigate the relationship between fluid overload based on oh / ecw ratio measured by using bia and pah in patients receiving regular hd. a cross - sectional study by unal. that including 135 peritoneal dialysis (pd) patients and 15 disease - free controls demonstrated a close association between hypervolemia and pah by using bioimpedance analysis. observed significantly higher inferior vena cava diameter, increased left atrial diameter, and increased cardiac index among hd patients with pah than in those without pah, and speculated that pulmonary hypertension may occur in response to chronic volume overload. interestingly, the study showed that oh / ecw and fluid overload were significantly higher in hd patients with pah than those without pah. similarly, when patients were classified according to fluid status, spap levels were significantly higher in hd patients with fluid overload than in those without fluid overload post - hd. also, spap and oh / ecw levels and the frequency of pah were significantly reduced after hd, and a significant positive correlation was found between spap and oh / ecw. importantly, this study showed that fluid overload is an independent predictor of pah after hd. pah is a complex disorder that manifests as abnormally high blood pressure in the vasculature of the lungs. it is possible that chronic fluid overload associated with hyperdynamic circulation causes elevated right atrial pressure, elevated mean pulmonary artery pressure as a consequence of increased pulmonary blood flow in the pulmonary vasculature bed, and adversely affects left ventricular dysfunction, leading to pah in hd patients. fluid overload may cause a direct lung injury from chronic pulmonary congestion, adding yet a further pathophysiological mechanism to pah in this patient cohort. our study strongly supports to the role of hypervolemia in the development of pah in hd patients by demonstrating the close association between fluid status and pah. dry weight is a term referring to lowest tolerated post - dialysis weight achieved via gradual change in post - dialysis weight at which there are minimal signs or symptoms of either hypovolemia or hypervolemia. however, in clinical practice, determination of exact dry weight is still one of the greatest challenges for the nephrologists in dialysis patients. although excess fluid is removed by ultrafiltration in hemodialysis, patients still can be overhydrated. also, significant proportions of hemodialysis patients return to the pre - dialysis period with overhydration as a consequence of sodium and water overload. the high prevalence rate of pah in hd patients may be explained by the increased frequency of fluid overload in this patient population. despite some conflicting results, evidence suggests that anemia can contribute to pulmonary hypertension by aggravating hypoxia and increasing cardiac output in patients with esrd. interestingly, we observed significantly lower hemoglobin levels in patients with pah than in those without pah. the low levels of hemoglobin in hd patients with pah might be a result of hypervolemia. serum albumin levels were significantly lower in hd patients with pah compared to those without pah, which is in agreement with previously published studies. hypoalbuminemia was found not to be an independent predictor of pah in the present study, but may reflect the consequence of fluid overload leading to pah. in addition, hyperparathyroidism and increased calcium - phosphate product can cause precipitation of calcium phosphate in many soft tissues, which is suggested to be an important risk factor for pah development. akmal. demonstrated that chronic renal failure in a dog model is associated with increased pth activity and higher spap. furthermore, kumbar. showed that pulmonary arterial pressure was positively correlated with serum levels of phosphorus, caxp product, and pth in 36 pd patients. in contrast, our study and others did not reveal any significant association between caxp product, pth, and pah in esrd patients. this study has certain limitations, including the relatively small number of patients, and it did not have long - term follow - up. after achievement of euvolemia in these patients, remeasurement of spap would be needed in a future prospective study. moreover, we demonstrated a strong relationship between fluid overload and pah in hd patients. fluid overload is an independent predictor of pah intervention to reduce excess volume in overhydrated patients, and could lead to decreased spap values and increased incidence of pulmonary hypertension in hd patients. | backgroundpulmonary arterial hypertension (pah) is common disease among hemodialysis (hd) patients and is associated with increased morbidity and mortality. however, its pathogenesis has not been completely elucidated. we aimed to evaluate the frequency of pah in hd patients, as well as the relationship between fluid status and pah.material/methodswe enrolled 77 hd patients in this study. multifrequency bioimpedance analysis (bia) was used to assess fluid status. bia was performed before and 30 min after the midweek of hd. overhydration (oh)/extracellular water (ecw)% ratio was used as an indicator of fluid status. fluid overload was defined as oh / ecw 7%. echocardiographic examinations were performed before and after the hd. pulmonary arterial hypertension was defined as systolic pulmonary artery pressure at rest (spap) higher than 35 mmhg.resultspah was found in 33.7% of the hd patients. oh / ecw and the frequency of fluid overload were significantly higher in hd patients with pah than those without pah, whereas serum albumin and hemoglobin levels were significantly lower. spap level was significantly higher in hd patients with fluid overload than in those without fluid overload after hemodialysis session. furthermore, spap, oh / ecw levels, and the frequency of pah were significantly reduced after hd. we also found a significant positive correlation between spap and oh / ecw. multivariate logistic regression analysis demonstrated fluid overload to be an independent predictor of pah after hd.conclusionspah is prevalent among hd patients. this study demonstrated a strong relationship between fluid overload and pah in hd patients. |
a variety of non - neoplastic and neoplastic conditions involving the nasal cavity, paranasal sinuses (pns), and nasopharynx are commonly encountered in clinical practice. the presenting features and symptomatology of all sinonasal masses are similar, i.e., nasal obstruction, rhinorrhea, blood stained nasal discharge, epistaxis, oral symptoms, facial swelling, orbital symptoms, ear symptoms, etc. sinonasal masses can be divided into two main categories : non - neoplastic and neoplastic, which in turn, is further divided into benign and malignant. various pathologies ranging from non - neoplastic lesions to malignant sinonasal tumor may mimic a simple nasal mass. therefore, nasal endoscopy, radiology, and histopathology are employed conjointly to help us reach the diagnosis. advanced imaging techniques like computed tomography (ct) and magnetic resonance imaging (mri) help us to reach at a presumptive diagnosis. classically, benign neoplasms expand and remodel bone and aggressive malignancies destroy and invade adjacent tissues, causing ill - defined margins. mri gives superior soft tissue delineation in the adjacent infratemporal fossa, masticator space, and in evaluation of perineural, intra - orbital, and intra - cranial spread. however, a careful histopathologic examination (hpe) is necessary to decide the nature of a specific lesion. the hpe of the removed tissue provides the actual diagnosis of the varied conditions labeled as a sinonasal mass. thus, a detailed history, clinical examination, proper imaging, and most importantly thorough histopathologic evaluation are essential part of work up of patients, so that, a required and timely intervention is done. as for treatment the purpose of this prospective study was to classify various types of non - neoplastic and neoplastic lesions histopathologically presenting as sinonasal mass and provide a clinico - pathological profile of sinonasal masses in our hospital, which is a tertiary care center in the state of uttarakhand. this prospective study was conducted by the department of otorhinolaryngology, himalayan institute of medical sciences, swami ram nagar, dehradun, over a period of 12 months. all the patients attending the otorhinolaryngology department with complaint of sinonasal mass and found to have a mass arising from nose or pns during the study period were included in the study. previously treated cases of sinonasal disease with recurrence and patient 's not consenting evaluation as per proforma were excluded from the study. a total of 110 cases of sinonasal masses fulfilling these criteria were finally included in this study. prior approval from the institute ethics and research committee and written informed consent from the patients was taken. the patients selected for this study were subjected to a detailed history, clinical examination as per proforma and relevant radiologic investigations like ct scan (axial / coronal section) or mri nose and pns (whenever required). hpe of removed tissue either by biopsy or surgically excised specimen was carried out in most of the cases. in few cases, immuno - histochemistry was performed to confirm the diagnosis. the lesions were classified as non - neoplastic and neoplastic lesions ; the neoplastic lesions were further classified as benign and malignant. in the present study, the age distribution of the patients ranged from 6 to 80 years (mean age 39.4 years). the 2 decade was the commonest to be involved with 25 patients (22.72%) and male to female ratio was 1.8:1.0. majority of the patients belonged to the lower middle class group comprising 36 patients (32.72%). by occupation maximum number of patients were homemakers, i.e., 28 patients (25.45%) followed by students with 21 patients (19.09%). the most common presenting symptom was nasal obstruction seen in 96 patients (87.27%), followed by nasal discharge in 76 patients (69.09%). majority of patients 79 (72%) presented to the hospital within 1 year duration of onset of symptoms out of which nearly 27 patients (25%) presented within 3 month, whereas 31 patients (28%) had symptom duration of more than 1 year. in our study, 33 patients (30%) had a history of addiction in the form of smoking 20 (18.18%), alcoholism 8 (7.27%), and 5 (4.54%) had both. on examination, facial swelling was seen in 30 patients (27.27%) [figure 2 ]. most common facial swelling was cheek swelling in 15 patients (50%) followed by nasal swelling in 6 patients (20%). the appearance of nasal mass was polypoidal in 31 (58.5%), fleshy in 7 (13.2%), ulcero - proliferative growth in 3 (5.66%), septal bulge in 8 (15.09%), and lateral wall bulge in 4 (7.55%) patients. probing was done in all 53 patients with nasal mass, out of which most of the nasal masses were soft in consistency and maximum number of mass originated from lateral wall of nose in 33 patients (30%) followed by medial wall of nose in 8 patients (7.27%). ulcero - proliferative growth was the most common finding seen in 7 patients (6.36%), followed by palatal / alveolar bulge in 4 patients (3.63%). oropharyngeal mass, all appearing polypoidal in nature were observed in 3 patients (2.72%). significant posterior rhinoscopic finding was seen in 13 patients (11.81%) in form of polypoidal masses. nasal patency was reduced in 76 patients (69.09%) and decreased sense of smell was seen in 37 patients (33.63%) on examination. totally, 103 patients (93.6%) underwent nasal endoscopy and 87 patients (79.09%) had visible mass on endoscopy. after complete nasal examination, 101 patients (91.81%) had nasal mass and in 7 patients vestibular mass was found. on ocular examination 11 patients (10. %) had proptosis, 6 patients (5.45%) had restriction of eye movements, 5 patients (4.54%) had absent vision, and 1 patient (0.90%) had reduced vision. eye involvement was seen in 12 patients (10.09%) with neoplastic lesions, 5 patients with benign lesions, and 7 patients with malignant lesions. cranial nerve involvement was seen in 39 patients (35.45%). in majority of the patients, i.e., 37 patients (33.63%) cranial nerve i was involved whereas in 5 patients (4.54%) cranial nerve ii and in 1 (0.90%) cranial nerve v were involved. cervical lymphadenopathy was seen in 10 patients (9.09%). out of 110 patients, 63 patients (57.27%) were clinically diagnosed as non - neoplastic and 47 patients (42.73%) were diagnosed as neoplastic lesion, out of which 23 patients (48.93%) were benign and 24 patients (51.07%) were malignant. in non - neoplastic group, maximum number of patients with sinonasal polyps comprised 50 patients (45.54%) followed by septal abscess in 6 patients (5.45%). in neoplastic malignant group, growth in the nasal cavity had maximum number of patients comprising 11 patients (10%) whereas in benign group maximum number of patients with angiofibroma were seen in 8 patients (7.27%). symptomatology of sinonasal masses clinical photograph of sinonasal malignancy radiologic investigations were carried out in 99 patients (90%) as 11 patients did not require any radiologic investigation. maximum number of patients underwent ct scan comprising 95 patients (86.36%), out of which noncontrast computed tomography (ncct) was performed in 51 patients (53.68%) and contrast computed tomography (cect) in 44 patients (46.31), [figure 3 ] whereas 13 (11.11%) patients underwent x - ray and 8 patients (7.27%) underwent mri [figure 4 ]. in maximum number of 78 patients (78.78%) ct scan was taken followed by ct and x - ray in 11 patients (11.11%), ct and mri in 6 (6.06%), mri in 2 (2.02%), and x - ray in 2 (2.02%) patients. in the present study, on the basis of radiology, out of the 99 patients, 57 patients (57.57%) were non - neoplastic, 21 patients (21.21%) were benign, and 21 patients (21.21%) were malignant. in all the 99 patients (90%), clinical diagnosis correlated with the radiologic diagnosis. cect (axial section) showing odontogenic tumor magnetic resonance imaging (coronal section) showing cemento - ossifying fibroma hpe [figure 5 ] was carried out in 101 patients (91.81%), out of which 57 patients (56.44%) were non - neoplastic and 44 patients (43.56%) were neoplastic [table 1 ]. the hpe report was suggestive of round cell tumor, but immuno - histocytochemistry (desmin negative, nse postive) confirmed it to be olfactory neuroblastoma. in the present study, hpe report changed the clinical diagnosis in 4 patients (4.1%) and in 97 patients (96.03%) clinical and hpe diagnosis was same. three patients (3.09%) had clinically benign lesion, out of which 2 (2.06%) had inconclusive diagnosis and 1 (1.03%) was diagnosed as inverted papilloma, all of which were reported as inflammatory polyp after hpe. in one patient, who was clinically diagnosed as angiofibroma, the hpe revealed schwannoma. in the present study, it was finally concluded that out of total 110 patients, 66 patients (60%) were non - neoplastic and 44 patients (40%) were neoplastic out of which 20 patients (19.80%) were benign and 24 patients (23.76%) were malignant. there was change in final diagnosis of 4 patients (3.63%) out of 110 patients after hpe. the mean age of presentation in our study was 39.4 years, whereas the mean age for non - neoplastic, benign, and malignant lesions was 39.1, 27.1, and 51 years, respectively. in another study, the mean age of presentation was 22.5 years for non - neoplastic lesions, 26.8 years for benign lesions, and 35.3 years for malignant lesions. in one study, the peak age of presentation for benign, intermediate, and malignant lesions were 2, 5, and 6 decade respectively. it was observed in most of the studies that mean age was least for non - neoplastic lesions ; it increased for benign lesions and was highest for malignant lesions. in our study, mean age for non - neoplastic lesions was more when compared with benign lesions, as a large percentage of patients with benign lesions in our study were angiofibroma which was mostly seen in adolescent age group and this could be the reason for low mean age for benign lesions in our study. in our study, were affected more when compared with females and our findings are similar to other studies. the most common presenting symptoms in our study was nasal obstruction found in 87.27% cases which was unilateral in 55.45%, and bilateral in 31.81% cases, followed by nasal discharge (69.09%) and headache (60.90%). in a similar study of sinonasal masses, the most common symptom was nasal obstruction (94%), which was unilateral in 84% and bilateral in 14%, followed by loss of smell (68%) and epistaxis (50%). another study observed that the most common symptoms were nasal blockage (71%), nasal discharge (54%), and swelling or mass (39%). nasal obstruction was the most common symptom observed in other similar studies but the frequency of other symptoms varied. in this study, it was revealed that most patients of sinonasal mass presented to the hospital either within 3 months (25%) or after 1 year of onset of symptoms (28%). this was seen because in case of malignant condition the symptoms were reported early by the patients as they were either nasal bleed or maxillo - facial swelling. on the other hand, mild and chronic symptoms like nasal obstruction, nasal discharge, and headache were reported to the hospital only after they became troublesome. in our study, most common examination finding was facial swelling observed in 27.27% of cases, whereas in another study it was found in 48% of cases. moreover, in our study, most common facial swelling was cheek swelling (13.36%), followed by external nasal deformity (5.45%). in accordance with our study, another study also reported large number of patients with cheek swellings (15.68%) followed by external nasal deformity (11.76%). according to our study, maximum number of sinonasal masses were on left side (37.27%) followed by right side (29.09%) and only 25.45% were bilaterally present. in contrast to our study, one study reported bilateral sinonasal masses (44.7%) in majority of patients whereas the mass was located in right and left side in 31.6% and 23.6% patients, respectively. in our study, maximum numbers of mass were seen in iii pass of diagnostic nasal endoscopy (dne) in 78 patients (70.90%). dne is an advanced diagnostic tool and helps in detection of nasal pathology in an early stage. in our study, dne detected early polypoidal changes in nasal cavity and helped in early diagnosis of nasal masses which were missed on anterior rhinoscopy. in the present study, palatal / alveolar bulge in the oral cavity was seen in 10% of cases, this was in accordance with the similar study where palatal bulge was observed in 11.7% of cases. palatal bulge in our study was mostly seen in cases with neoplastic lesions which was suggestive of extension of sinonasal mass to oral cavity. in our study, proptosis was seen in 10% of cases, whereas others studies reported the incidence of 5.88% and 24%. proptosis in our study was mostly seen in neoplastic lesions (25%) which was in accordance with similar study. in present study, loss of vision in our study was seen in malignant lesions (16%) in which either orbit was involved by the sinonasal mass and caused stretching of optic nerve or when there was intra - cranial extension of mass involving the optic nerve pathway. in our study, this could be attributed to the fact that, in our study large numbers of patients were in advanced stage of sinonasal malignancies where metastasis to cervical lymph nodes occurred late in course of disease. in the present study, cranial nerve involvement was seen in 35.45% of patients, out of which cranial nerve i was involved in 33.63%, followed by cranial nerve in ii in 4.54% cases. in another study, it was observed that the cranial nerves ii, iv, and vi were most commonly affected in cases of malignancies. similarly, in our study also involvement of cranial nerves was seen in cases of sinonasal malignancy. radiologic investigations were done in 90% patients whereas in 10% of patients no radiologic investigation was required. x - ray was taken in very few cases suspected of having minimal inflammatory disease. in most of the cases of sinonasal mass, ct scan was advised directly as it depicted better anatomy of nose and pns and was helpful to the surgeon in cases where surgery was required. mass confined to nose and pns in ct scan was seen in 65.26% of patients and bony erosion, a feature of malignancy, was seen in 28.2% of lesions. mri was taken in 8% patients to determine the extension of sinonasal masses into orbit and intracranial cavity. mri was taken to see the actual soft tissue involvement in the patients where orbital or intracranial extension of neoplastic mass was suspected. ct scan is not reliable in assessing the extensions of the sinonasal mass lesions as retained or inspissated secretions and thickened mucosa within the pns can be misinterpreted as extensions of the malignancy (false positive). the false positivity of all the pns altered the tumor staging to a certain extent and therefore required complementary assessment by mri, which revealed the differences between true disease infiltration and obstruction secondary to infiltration of the draining ostia. mri is vital in establishing the surrounding soft tissue infiltration that determine the tumor resectability. one of the greatest advantages of mri is to help in distinguishing between tumor and retained secretions in the multiple sinus cavities. in our study, hpe was done in 91.81% patients. the distribution of various lesions into non - neoplastic and neoplastic in our study was compared with other studies as shown in table 2. there was a high incidence of malignant neoplastic lesion in our study when compared with other studies. among the non - neoplastic lesions nasal polyps were the commonest lesion seen in 80.30% patients. among the benign lesions, angiofibroma was the commonest one diagnosed in 35% patients. among the malignant lesions, carcinoma nasal cavity was the commonest lesion seen in 45.83% patients and the commonest histopathological type was squamous cell carcinoma (scc) seen in 33.33% patients. our results were accordance with two other studies where nasal polyps, angiofibroma, and scc were the most common non - neoplastic, benign, and malignant lesions, respectively. few other studies also reported similar findings for neoplastic and malignant lesions except in cases of benign lesions where various lesions other than angiofibroma were the commonest lesions. comparison of incidence of non - neoplastic and neoplastic sinonasal lesion in various studies in the present study, variation in clinical, radiologic, and hpe was noted in 4 patients (3.63%) and this was in accordance with similar study on sinonasal masses, in which 3.62% lesion showed difference in clinical, radiologic, and pathologic findings. in contrast, another study reported 1.1% of patients with histopathologic findings different from their clinical diagnosis and led to alteration in management. similarly, two more study observed that only 0.3% of their patients had histopathologic findings different from their clinical diagnosis. one study reported a much higher incidence of histopathology report variation from clinical opinion in nearly 6% of cases. all these studies point out to the common finding that histopathologic examination still remains the gold standard for diagnosis in most cases. the presenting features of all sinonasal lesions may be indistinguishable and therefore represent diagnostic and therapeutic dilemma. the similarities of non - neoplastic and neoplastic lesions at initial presentation may lead to a significant delay in the diagnosis. correlation of clinical, radiologic, and pathologic modalities is of utmost important for accurate diagnosis. all these modalities are complementary to each other. most importantly is a thorough histopathologic evaluation, an essential part of work up of patients with sinonasal mass, so that a correct and timely intervention can be made. | background : the purpose of this study was to classify various types of non - neoplastic and neoplastic lesions presenting as sinonasal mass and characterize their clinico - pathological profile in a tertiary care center in the state of uttarakhand.materials and methods : this was a prospective study where 110 cases of sinonasal masses were included over a period of 12 months. clinico - pathological study was carried out in these cases. a provisional diagnosis was made after clinical assessment and radiologic investigations, but final diagnosis was made after histopathologic examination.observations:the number of non - neoplastic lesions were more than the neoplastic lesion, 60% versus 40% respectively. in the neoplastic group, 19.8% and 23.76% patients presented with benign and malignant lesion, respectively. the incidence was more predominant in the age group of 11 - 20 years (22.72%) with male to female ratio of 1.08:1. in our study, among non - neoplastic lesions the occurrence of sinonasal polyps was highest seen in 80.30% cases. in neoplastic lesions, angiofibroma was most common benign lesion seen in 35% cases. carcinoma nasal cavity was the commonest malignant lesion seen in 45.83% cases. in 3.63% patients, clinical and radiologic diagnosis was not correlated with histopathologic diagnosis. only two cases required immuno - histocytochemistry to confirm the final diagnosis.conclusion:we concluded that for proper evaluation of a sinonasal mass, clinical, radiologic, and histopathologic evaluation should be carried out conjointly in all the cases. histopathology always gives a confirmatory diagnosis but in few cases immuno - histocytochemistry becomes the ultimate diagnostic technique for correct and timely intervention. |
the interferons are a complex group of virally induced host proteins produced by activated macrophages and lymphocytes. interferon alpha (ifn) has been used extensively in the treatment of hepatitis viruses, as well as a few hematologic, nephrologic, and dermatologic malignancies. although the exact mechanism of action of ifn remains unclear, its usefulness in clinical practice is well established. it is most commonly used to treat chronic hepatitis c virus (hcv), either as monotherapy or in conjunction with ribavirin. in the past, the dose used for this purpose has ranged from 3 to 5 million units daily with 8001,200 mg / day of oral ribavirin for 1 year. two pegylated ifn preparations enabling weekly dosing are now available and, along with ribavirin, are the current standard of care. a sustained viral response (svr) rate is defined as clearance of virus after 6 months following completion of active treatment. svr rates currently vary from 4080% in noncirrhotic patients depending upon the viral load, genotype, dosage, and formulation of ifn utilized. ifn has also been used in the treatment of chronic myelogenous leukemia (cml), multiple myeloma, and renal cell carcinoma. the doses used for these nonhepatic diseases, especially cml, are much higher than those used for the treatment of hcv. typical dosages range from 10 to 20 million units / day for 1218 months. nearly a third of ifn-treated patients with cml achieve complete cytologic remission and often remain disease - free for years [3, 4 ]. almost all patients experience transient flu - like symptoms with fever, weakness, myalgias, headache, and tachycardia. these symptoms typically subside over the next 24 hours and are less prominent with treatment continuation. more serious effects include cardiac arrhythmias, cardiomyopathy, polyneuropathy, and myelosuppression, as well as liver and renal failure. furthermore, various autoimmune diseases such as psoriasis, sprue, diabetes mellitus, thyroid disorders, and various forms of arthritis can be exacerbated or precipitated by ifn therapy. pulmonary side effects include pneumonitis, pulmonary fibrosis, and a single report of new onset pulmonary hypertension [6, 7 ]. resolution of these numerous untoward effects with discontinuation of the agent has been the rule. herein is reported a series of four individuals, who developed an irreversible, progressive, and severe form of pulmonary hypertension during treatment with ifn for chronic hcv. this complication has not been reported previously and should be considered as a rare but important adverse effect of ifn therapy. gb was a 35-year - old white male who initially presented with lower extremity edema and weakness and was found to have end - stage liver disease due to hcv and alcohol abuse. over the next several months, he developed decompensated liver disease with ascites. his family history was significant for a mother who died of lung cancer and a father with coronary artery disease. he started drinking excessively at the age of 16 and occasionally used other illegal drugs, including amphetamines, heroin, and intranasal cocaine. the liver edge was 3 cm below the costal margin and a palpable spleen tip was present. shifting dullness was present and pedal edema was noted to the level of the knees. initial laboratory evaluation revealed normal electrolytes, normal renal function, and a prothrombin time of 15.8 s (normal 10.812.8 s). serum tests were positive for hcv - rna genotype 1a infection with a viral load > 1 10 copies / ml. an abdominal computed tomography scan revealed a nodular cirrhotic liver with a volume of 1,600 cm. the presence of prominent perigastric varices and periumbilical collaterals consistent with portal hypertension were noted also. abdominal ultrasound documented the liver to have increased echogenicity. the portal and hepatic veins as well as the hepatic arteries were patent. a echocardiogram documented a left ventricular ejection fraction of 60% with normal heart valves and a normal estimated pulmonary artery pressure (pap). a liver biopsy was obtained and interpreted as showing grade 4, stage 4 disease. he was started on ifn 3 million units daily in may 1999 in an effort to clear his viremia prior to transplantation. postoperatively, he was found to have recurrent hcv with a viral load of 8.5 10 copies / ml. he was started on cifn at a dose of 15 ug / day. he again responded rapidly and was hcv polymerase chain reaction (pcr)-negative by 8 weeks. his only complaint during the treatment period was persistent fatigue, which was attributed to the ifn therapy. after approximately 1 year of therapy, he began to experience progressive dyspnea on exertion, fatigue, and edema. an examination at this time revealed a resting tachycardia ; a new grade iii / vi systolic ejection murmur which increased in intensity with inspiration. he was admitted to hospital for further evaluation and was found to have severe pulmonary hypertension with right heart failure. cardiac catheterization revealed pap of 81/30 mmhg, a cardiac output of 8.33 l / min, pulmonary vascular resistance (pvr) of 8.26 cm h2o / l / min, and a cardiac index of 2.61 l / min / m. he experienced no change in his symptoms with the use of short - acting vasodilators. he was classified as nyhc iii and was started on bosentan, an endothelin receptor blocker, as well as a calcium channel blocker, a diuretic, and digitalis. he failed bosentan as well as treprostinil, a prostacyclin analog, but had a minor response to epoprostenol. he required repeated admissions for progressive cardiac decompensation and the development of a persistent right - sided pleural effusion. ds was a 40-year - old female who was found to have an hcv infection while attempting to donate blood. her past medical history included mild asthma, depression, a panic disorder, and multiple orthopedic surgeries related to a motor vehicle accident 20 years earlier, at which time she received 3 units of packed red blood cells. physical examination revealed clear lungs, and cardiac examination was with regular heart rate and no murmur or gallop. the patient was found to have a genotype 1b infection with a viral load of 1.2 10 copies / ml. a liver biopsy was obtained and interpreted as showing grade 1 stage 1 disease. she was started on ifn therapy (3 million units daily) with ribavirin (800 mg daily). the ribavirin was discontinued after 4 months because of profound anemia (hgb 4.5 gm / dl). she failed to achieve viral clearance, despite being on maintenance therapy for 32 months. in february 2001, she reported progressive dyspnea on exertion, edema, and weight gain. an elevated jugulo - venous pressure was appreciated, the lungs were clear, and cardiac examination revealed a grade 2/6 systolic ejection murmur at the left lower sternal border with a prominent pulmonic second sound that increased with inspiration. an ekg showed sinus rhythm with voltage criteria for right ventricular hypertrophy and left atrial enlargement. she had unremarkable arterial blood gas on room air (ph 7.42, po2 102, pco2 33). a cardiac echocardiogram demonstrated normal left ventricular ejection fraction (59%), diffusely dilated, hypertrophied, and hypokinetic right ventricle, severe tricuspid regurgitation, and a small pericardial effusion without evidence of cardiac tamponade. right heart catheterization documented a right atrial pressure of 24 mm hg, right ventricle systolic pressure of 67 mm hg, right ventricle end diastolic pressure of 11 mm hg, pap of 71/34 mm hg with a mean pulmonary arterial pressure of 52 mm hg, and pulmonary artery wedge pressure of 24 mm hg. she was started on a diuretic and a calcium channel blocker and experienced a gradual worsening of her symptoms. subsequently, she was started on treprostinil, with stabilization but no reversal of her pulmonary hypertension. fm was a 50-year - old male who presented initially with a pericardial effusion in 1997. at that time, the effusion was drained, with no specific etiology being identified, although he was known to be hcv - positive. his past medical history was significant for obstructive sleep apnea, hyperthyroidism, and hypertriglyceridemia. social history revealed 40-pack - year tobacco use, which he terminated approximately 10 years earlier, and a distant history of alcohol and cocaine use. the laboratory data was remarkable for mild renal insufficiency (bun / cr 23 mg / dl/1.6 mg / dl) with a platelet count of 105,000/mm and a wbc count of 4.1 1,000 cells / mm. liver function tests were normal and he was found to have an hcv viral load of 2.5 10 copies / ml. a liver biopsy showed stage i disease with no portal or lobular inflammation and mild sinusoidal fibrosis. ifn therapy (5 million units / day) with ribavirin 200 mg bid was initiated. after being on therapy for 10 months physical examination showed him to have clear lungs, and a cardiac examination revealed an early systolic murmur with a prominent pulmonic second sound. his evaluation included pulmonary function testing, which showed a significant restrictive defect with dramatic reduction in diffusion capacity. computed tomography of the abdomen showed massive hepatomegaly (liver volume 3,448 cc), splenomegaly, and ascites. an echocardiogram documented severe left ventricular hypertrophy, enlargement of the right heart chambers with severe tricuspid regurgitation, and an elevated pap (80 mm hg). the ifn therapy was discontinued and treatment was initiated with a diuretic and a calcium channel blocker with stabilization, but there was no improvement in his pulmonary hypertension. dm was a 49-year - old male who was noted to have elevated serum aminotransferase levels (ast / alt 228/136 physical examination revealed clear lungs, cardiac examination with no murmurs, the abdomen was soft with a liver and a spleen palpable 34 finger breadths below the costal margins. complete blood count showed wbc 2.8 1,000 cells / mm and a platelet count of 80,000/mm. hcv genotype 1 was found with a viral load of 1.8 10 copies. a computed tomography scan of the abdomen revealed a cirrhotic liver with splenomegaly and evidence of portal hypertension with recanalization of the periumbilical veins. he was started on ifn therapy (peg - intron 2 g / kg / week) with ribavirin (200 mg bid). eight months after the initiation of therapy, the patient developed progressive dyspnea on exertion with increasing abdominal girth and pedal edema. pulmonary function tests documented a moderate to severe decrease in diffusion capacity with a mild reversible obstructive ventilatory defect. a cardiac echogram documented normal left ventricular size and function (ef 60%) and a normal right ventricular size. moderate tricuspid regurgitation was noted, with a markedly elevated pap of 80 mm hg. the patient was diagnosed as having severe pulmonary hypertension of unknown etiology and was treated with a diuretic and calcium channel blocker with good results. gb was a 35-year - old white male who initially presented with lower extremity edema and weakness and was found to have end - stage liver disease due to hcv and alcohol abuse. over the next several months, he developed decompensated liver disease with ascites. his family history was significant for a mother who died of lung cancer and a father with coronary artery disease. he started drinking excessively at the age of 16 and occasionally used other illegal drugs, including amphetamines, heroin, and intranasal cocaine. the liver edge was 3 cm below the costal margin and a palpable spleen tip was present. shifting dullness was present and pedal edema was noted to the level of the knees. initial laboratory evaluation revealed normal electrolytes, normal renal function, and a prothrombin time of 15.8 s (normal 10.812.8 s). serum tests were positive for hcv - rna genotype 1a infection with a viral load > 1 10 copies / ml. an abdominal computed tomography scan revealed a nodular cirrhotic liver with a volume of 1,600 cm. the presence of prominent perigastric varices and periumbilical collaterals consistent with portal hypertension were noted also. abdominal ultrasound documented the liver to have increased echogenicity. the portal and hepatic veins as well as the hepatic arteries were patent. a echocardiogram documented a left ventricular ejection fraction of 60% with normal heart valves and a normal estimated pulmonary artery pressure (pap). a liver biopsy was obtained and interpreted as showing grade 4, stage 4 disease. he was started on ifn 3 million units daily in may 1999 in an effort to clear his viremia prior to transplantation. postoperatively, he was found to have recurrent hcv with a viral load of 8.5 10 copies / ml. he was started on cifn at a dose of 15 ug / day. he again responded rapidly and was hcv polymerase chain reaction (pcr)-negative by 8 weeks. his only complaint during the treatment period was persistent fatigue, which was attributed to the ifn therapy. after approximately 1 year of therapy, he began to experience progressive dyspnea on exertion, fatigue, and edema. an examination at this time revealed a resting tachycardia ; a new grade iii / vi systolic ejection murmur which increased in intensity with inspiration. he was admitted to hospital for further evaluation and was found to have severe pulmonary hypertension with right heart failure. cardiac catheterization revealed pap of 81/30 mmhg, a cardiac output of 8.33 l / min, pulmonary vascular resistance (pvr) of 8.26 cm h2o / l / min, and a cardiac index of 2.61 l / min / m. he experienced no change in his symptoms with the use of short - acting vasodilators. he was classified as nyhc iii and was started on bosentan, an endothelin receptor blocker, as well as a calcium channel blocker, a diuretic, and digitalis. he failed bosentan as well as treprostinil, a prostacyclin analog, but had a minor response to epoprostenol. he required repeated admissions for progressive cardiac decompensation and the development of a persistent right - sided pleural effusion. ds was a 40-year - old female who was found to have an hcv infection while attempting to donate blood. her past medical history included mild asthma, depression, a panic disorder, and multiple orthopedic surgeries related to a motor vehicle accident 20 years earlier, at which time she received 3 units of packed red blood cells. physical examination revealed clear lungs, and cardiac examination was with regular heart rate and no murmur or gallop. the patient was found to have a genotype 1b infection with a viral load of 1.2 10 copies / ml. a liver biopsy was obtained and interpreted as showing grade 1 stage 1 disease. she was started on ifn therapy (3 million units daily) with ribavirin (800 mg daily). the ribavirin was discontinued after 4 months because of profound anemia (hgb 4.5 gm / dl). she failed to achieve viral clearance, despite being on maintenance therapy for 32 months. in february 2001, she reported progressive dyspnea on exertion, edema, and weight gain. an elevated jugulo - venous pressure was appreciated, the lungs were clear, and cardiac examination revealed a grade 2/6 systolic ejection murmur at the left lower sternal border with a prominent pulmonic second sound that increased with inspiration. an ekg showed sinus rhythm with voltage criteria for right ventricular hypertrophy and left atrial enlargement. she had unremarkable arterial blood gas on room air (ph 7.42, po2 102, pco2 33). a cardiac echocardiogram demonstrated normal left ventricular ejection fraction (59%), diffusely dilated, hypertrophied, and hypokinetic right ventricle, severe tricuspid regurgitation, and a small pericardial effusion without evidence of cardiac tamponade. right heart catheterization documented a right atrial pressure of 24 mm hg, right ventricle systolic pressure of 67 mm hg, right ventricle end diastolic pressure of 11 mm hg, pap of 71/34 mm hg with a mean pulmonary arterial pressure of 52 mm hg, and pulmonary artery wedge pressure of 24 mm hg. severe pulmonary hypertension with nyhc iii heart failure of uncertain etiology was diagnosed. she was started on a diuretic and a calcium channel blocker and experienced a gradual worsening of her symptoms. subsequently, she was started on treprostinil, with stabilization but no reversal of her pulmonary hypertension. fm was a 50-year - old male who presented initially with a pericardial effusion in 1997. at that time, the effusion was drained, with no specific etiology being identified, although he was known to be hcv - positive. his past medical history was significant for obstructive sleep apnea, hyperthyroidism, and hypertriglyceridemia. social history revealed 40-pack - year tobacco use, which he terminated approximately 10 years earlier, and a distant history of alcohol and cocaine use. the laboratory data was remarkable for mild renal insufficiency (bun / cr 23 mg / dl/1.6 mg / dl) with a platelet count of 105,000/mm and a wbc count of 4.1 1,000 cells / mm. liver function tests were normal and he was found to have an hcv viral load of 2.5 10 copies / ml. a liver biopsy showed stage i disease with no portal or lobular inflammation and mild sinusoidal fibrosis. ifn therapy (5 million units / day) with ribavirin 200 mg bid was initiated. after being on therapy for 10 months physical examination showed him to have clear lungs, and a cardiac examination revealed an early systolic murmur with a prominent pulmonic second sound. his evaluation included pulmonary function testing, which showed a significant restrictive defect with dramatic reduction in diffusion capacity. computed tomography of the abdomen showed massive hepatomegaly (liver volume 3,448 cc), splenomegaly, and ascites. an echocardiogram documented severe left ventricular hypertrophy, enlargement of the right heart chambers with severe tricuspid regurgitation, and an elevated pap (80 mm hg). the ifn therapy was discontinued and treatment was initiated with a diuretic and a calcium channel blocker with stabilization, but there was no improvement in his pulmonary hypertension. dm was a 49-year - old male who was noted to have elevated serum aminotransferase levels (ast / alt 228/136 physical examination revealed clear lungs, cardiac examination with no murmurs, the abdomen was soft with a liver and a spleen palpable 34 finger breadths below the costal margins. complete blood count showed wbc 2.8 1,000 cells / mm and a platelet count of 80,000/mm. hcv genotype 1 was found with a viral load of 1.8 10 copies. a computed tomography scan of the abdomen revealed a cirrhotic liver with splenomegaly and evidence of portal hypertension with recanalization of the periumbilical veins. he was started on ifn therapy (peg - intron 2 g / kg / week) with ribavirin (200 mg bid). eight months after the initiation of therapy, the patient developed progressive dyspnea on exertion with increasing abdominal girth and pedal edema. pulmonary function tests documented a moderate to severe decrease in diffusion capacity with a mild reversible obstructive ventilatory defect. a cardiac echogram documented normal left ventricular size and function (ef 60%) and a normal right ventricular size. moderate tricuspid regurgitation was noted, with a markedly elevated pap of 80 mm hg. the patient was diagnosed as having severe pulmonary hypertension of unknown etiology and was treated with a diuretic and calcium channel blocker with good results. in these four cases, each individual reported a new symptom of respiratory insufficiency after prolonged therapy with ifn. evaluation revealed pulmonary hypertension which was irreversible upon discontinuation of ifn and with no identifiable etiology. three of four were noncirrhotic and 2/4 were postliver transplant with good hepatic function and uncomplicated postsurgical course. the dosage and duration used were not unlike those used typically for hepatic or hematologic disease. the dosage of cifn used was 15 g daily, which was higher than the approved 9 g / three times per week ; however, this regimen is now commonly used. it was recently evaluated in a multicenter study, the direct trial, with validation of its safety and efficacy in those who fail standard therapy. also, it is unlikely that an interaction with any other medications, such as immunosuppressants, is contributory to this finding, but such an association can not be ruled out categorically. potential mechanisms that might explain this sequence of events might include a pre - existing condition, ifn-induced pulmonary hypertension, or the acceleration of a previously subclinical phenomenon caused by other factors such as human herpesvirus 8 (hhv8), hcv itself, or a previously unrecognized genetic predisposition. the development of primary pulmonary hypertension secondary to portal hypertension, called portopulmonary hypertension, is a well - known entity. this risk increases proportional to the duration of the portal hypertension, although there is no documented relationship to the severity of portal hypertension, degree of hepatic failure, or fraction of blood flow shunting through the lungs. it is most often seen in patients with end - stage liver disease and is considered as one of several rare sequelae of prolonged portal hypertension. in the present series, only case 4 had evidence of significant portal hypertension prior to the initiation of therapy. patients 1 and 3 had a liver transplant prior to the time of diagnosis and patient 2 had only mild hepatic fibrosis on biopsy. in each case, other causes of portal hypertension were pursued vigorously and systematically ruled out. numerous reports have linked hcv to idiopathic pulmonary fibrosis [11, 12 ], pneumonitis, and cardiomyopathy. in this setting, pulmonary hypertension is secondary to end - stage pulmonary fibrosis, which is easily recognized with standard radiologic evaluations. in this series, no evidence for the presence of pulmonary fibrosis was present in any of the four cases. thus, this series of cases suggests that an association between pulmonary hypertension and ifn therapy may exist. though considered uncommon, most reported cases of adverse pulmonary side effects related to ifn consist of an exacerbation of asthma, pleural effusion, an activation of sarcoidosis, bronchiolitis obliterans - organizing pneumonia, and bilateral pulmonary infiltrates and reversible pulmonary hypertension. several reports have described the phenomenon of bilateral interstitial and alveolar infiltrates, which have been shown histologically to be interstitial pneumonitis [1921 ]. in contrast, there is only one reported case of pulmonary hypertension which was reversible, having developed in a patient receiving ifn for cml. found that, 1 h after an infusion of ifn directly into the lungs of sheep, pap and pvr increased significantly and these events coincided with elevations of thromboxane b2 in the plasma. furthermore, the administration of oky-046, a selective thromboxane synthase inhibitor, prevented these ifn-mediated pulmonary artery changes. this study suggests that the thromboxane cascade, a mediator of inflammation, is directly involved in the effect of ifn on the lungs and may be a mediator in the development of pulmonary hypertension. hcv itself has been reported to cause an occult inflammatory reaction in pulmonary air spaces. reported elevated levels of polymorphonuclear neutrophils in the bronchoalveolar lavage specimens of individuals with hcv. this suggests that a low - grade chronic inflammatory reaction may be present in the lungs of individuals with hcv infection and may contribute to the alveolar and pulmonary arterial changes. using gallium 67 citrate scans, they evaluated patients with hcv before and after ifn therapy and were able to quantitatively show increased radionucleotide uptake post - treatment. these investigators concluded that ifn causes a gradual subclinical pulmonary inflammatory process in a majority of the individuals treated with the agent. as stated earlier, ifn causes an acute increase in the pvr and pap, which results in a transient hypoxia. this results in the local release of cytokines and arachidonic acid metabolites that promote further smooth - muscle contraction, resulting in a marked transient but reversible increase in the pulmonary vascular resistance. over a prolonged period of time, this phenomenon may promote arterial smooth - muscle hypertrophy that may lead to irreversible pulmonary artery hypertension. a second possibility is that hcv, like hiv, may have a direct effect on the pulmonary endothelium mediated by vasoactive amines, which leads to leukocyte adherence, inflammatory cytokine release, and endothelial cell proliferation. additionally, it has been shown that certain vasculotropic viruses, such as hhv8, play a significant etiologic role in primary pulmonary hypertension. co - infection with such viruses may yet be another etiologic factor in these individuals. this phenomenon may be subclinical initially but, with the added stress of prolonged ifn exposure, may result in pulmonary hypertension which may be irreversible. finally, a genetic predisposition such as the novel mutation in the bone morphogenetic protein receptor type ii (bmpr2) seen in certain familial forms of primary pulmonary hypertension may have been present in these four cases. ifn may promote the expression of this abnormal protein, which results in uncontrolled endothelial cell growth and proliferation alone or in response to insults such as hcv infection. regardless of the precise mechanism involved, these four cases suggest that pulmonary artery hypertension developing in individuals after prolonged ifn therapy may be irreversible and should be considered in individuals being treated with ifn who present with exertional dyspnea and do not have a readily identifiable inflammatory or embolic cause for pulmonary artery hypertension. further study is needed to identify the precise pathophysiology of this problem and the identification of individuals who might be at risk for developing this life - threatening complication of ifn therapy. | the interferons are a complex group of virally induced proteins produced by activated macrophages and lymphocytes, which have become the mainstay of therapy for hepatitis c infection. sustained viral response (svr) rates in noncirrhotic patients vary from 4080% with interferon - based therapy. this, along with transplantation, has drastically changed the course of hepatitis c virus (hcv) infection over the last two decades. numerous side effects associated with interferon therapy have been reported. these range from transient flu - like symptoms to serious effects such as cardiac arrhythmias, cardiomyopathy, renal and liver failure, polyneuropathy, and myelosuppression. pulmonary side effects including pneumonitis, pulmonary fibrosis, and reversible pulmonary hypertension have been reported. herein, we present four cases in which irreversible pulmonary hypertension was diagnosed after prolonged treatment with interferon alpha. in each case, other causes of pulmonary hypertension were systematically eliminated. pulmonary artery hypertension, which may be irreversible, should be considered in patients being treated with interferon alpha who present with exertional dyspnea and do not have a readily identifiable inflammatory or thromboembolic cause. |
oppositional defiant disorder (odd) consists of recurrent uncooperative, disobedient, and hostile behavior which is not accounted for by the developmental stage of the child. it is defined in dsm - iv - tr as an enduring pattern of negativistic, defiant, and disruptive behavior toward authority figures. it must be present for more than 6 months and must not be caused by psychosis or a mood disorder, and the behavior must negatively impact the child 's social, academic, or occupational functioning. it does not include the most aggressive aspects of conduct disorder which is directed toward people, animals and property. negativistic and defiant behaviors are expressed by persistent stubbornness, resistance to directions, and unwillingness to compromise, give in or negotiate with adults and peers. it may also involve deliberate and persistent testing of limits, usually by ignoring orders, arguing, and failing to accept blame for misbehavior. the prevalence of odd in the general population has been reported to be between 2% and 16%. it has been estimated that around 60% of patients with odd will develop conduct disorder and will have high risk for substance abuse. children with odd have substantially impaired relationships with parents, teachers, and peers. these children are not only impaired in comparison with their peers, but they also show greater social impairment than do children with bipolar disorder, depression, and anxiety disorders. oppositional defiant disorder has a high co - occurrence with attention deficit hyperactivity disorder (adhd). in 3565% of patients with adhd, children with adhd and comorbid odd tend to experience more severe adhd symptoms, greater functional impairment and poor quality of life than children with adhd alone. this means that families are under high levels of stress, dealing with several difficult behaviors. several studies from western countries have shown that psychostimulants like methylphenidate are effective in odd patients with comorbid adhd. in a meta - analysis of 28 studies, it was reported that stimulants are effective in overt and covert aggression - related behaviors in adhd in a short - term. atomoxetine is a selective norepinephrine reuptake inhibitor approved for the treatment of adhd since 2002. atomoxetine has also been used in the management of odd comorbid with adhd as some studies have evaluated its efficacy in a short term. hence, the present study was carried out to find out if methylphenidate and atomoxetine are efficacious in the treatment of odd comorbid with adhd. patients were inducted from those attending the child guidance clinic of a tertiary care hospital in north india from october 2010 to may 2012. this study is a subset of another trial which aimed to assess the efficacy of methylphenidate and atomoxetine in symptom reduction of adhd. patients of 614 years age, with a diagnosis of adhd, according to dsm - iv - tr were recruited for the trial. these patients were administered the vanderbilt adhd diagnostic parent rating scale (vadprs) to screen for the presence of comorbid odd. the patients with the diagnosis of odd with comorbid adhd were taken up in the present study. patients with a history of nonresponse or adverse drug reactions to either methylphenidate or atomoxetine and the patients who had taken any medication for adhd in the past 1-month were excluded. in addition, the patients with a history of heart disease, seizures, pervasive developmental disorder, substance abuse, mental retardation, or tic disorder were also excluded. before initiating treatment, electrocardiogram was performed for each patient to rule out any cardiac abnormality. the patients were allotted to two groups as per computer - generated table of random numbers (group a and group b). patients of group a received immediate release tablet methylphenidate (once or twice daily) and group b received tablet atomoxetine (once or twice daily). the initial sample consisted of 69 adhd patients randomized into methylphenidate and atomoxetine groups. of 69 patients with adhd, 15 from methylphenidate group and 22 from atomoxetine group fulfilled the criteria for the presence of comorbid odd, and these were included in the analysis of the present study [figure 1 ]. patients were started on tablet methylphenidate (immediate - release) 5 mg od or tablet atomoxetine 10 mg od on their first visit. efforts were made to increase the dose of methylphenidate up to 1 mg / kg / day and of atomoxetine up to 1.2 mg / kg / day once or twice daily depending upon the response and tolerability. the patients who could not come for weekly follow - up, were assessed fortnightly. on each visit, the various side effects were noted on each assessment on the adverse events checklist prepared for the study. they were then managed as per standard departmental protocol. written and informed consent was obtained from both parents / guardians and the children. chicago, spss inc., 2007), and it was represented in mean and (standard deviation). fisher 's exact test and chi - square test were used to compare categorical variables. mann chicago, spss inc., 2007), and it was represented in mean and (standard deviation). fisher 's exact test and chi - square test were used to compare categorical variables. mann at baseline, methylphenidate and atomoxetine groups were comparable with regard to mean age and sex distribution. in both the groups, males outnumbered the females for the presence of odd, the combined type of adhd was the most common, followed by inattention type and hyperactive / impulsive type. chi - square test was used to assess whether the two groups were comparable with respect to the number of patients with any of the three types of adhd, and no significant difference was found. patients were also screened for the presence of depression and anxiety, but none fulfilled the criteria for the same. the baseline vadprs total score and vadprs subscale scores (inattention, hyperactivity and odd) were comparable between the two groups on the mann - whitney test [table 1 ]. comparison on baseline characteristics five patients in the methylphenidate group and 8 in the atomoxetine group dropped out in the course of study. there was no statistically significant difference between the reasons for drop - outs between the two groups on the chi - square test (p = 0.349). the adverse effects which lead to drop out were reduction in appetite, headache, irritability in both the groups ; drowsiness and sadness in the atomoxetine group and fatigue in the methylphenidate group. improvement in adhd symptoms and odd symptoms as measured on vadprs score was assessed using wilcoxon signed rank test as data was not normally distributed. highly significant difference was found in vadprs scores in both the groups after 8 weeks. the mean vadprs (total and subscales) scores were compared in methylphenidate and atomoxetine groups using mann whitney test at 8 weeks and no statistically significant difference was found [table 2 ]. change in vadprs scores from baseline to 8 weeks at 8 weeks, according to vadprs, 8 children out of 10 (or 80%) ceased to fulfill the criteria for the presence of odd in the methylphenidate group. similarly, in the atomoxetine group, out of 14 children, 9 children (or 64.3%) ceased to have symptoms of odd at 8 weeks [figure 1 ]. the average dose administered at 8 weeks was 15.41 mg / day (or 0.490 mg / kg / day) in methylphenidate group and 17.21 mg / day (or 0.672 mg / kg / day) in atomoxetine group. according to the adverse effects checklist prepared for the study, a total of 7 (46.6%) patients from methylphenidate group and 12 (54.5%) from atomoxetine group developed some side effect during the course of the study. the various adverse effects reported by the patients in two groups are listed in table 3. these were compared between both groups, and no significant difference was found on the chi - square test. in addition, one case each reported insomnia and pain abdomen in the methylphenidate group. similarly one case each reported nausea, vomiting, and sadness in the atomoxetine group. majority of the children were males, the similar findings have been reported in earlier studies. the results showed that both methylphenidate and atomoxetine were highly effective in reducing the symptoms of odd. earlier short - term placebo - controlled trials of methylphenidate for odd comorbid with adhd have also shown it to be effective. some previous studies found atomoxetine to be superior than placebo in improving odd symptoms, while others did not. the dose of atomoxetine administered to the patients in the present study was well within the prescribed limit for management of adhd. it was unlike the findings of a previous study which reported that higher dose of atomoxetine was required to produce improvements in patients with adhd comorbid with odd, than those with adhd alone. in this study, 80% of the patients in the methylphenidate group failed to fulfill the criteria for diagnosis of odd at the conclusion of the study. this was also concordant with findings of an earlier study where methylphenidate treatment in the short - term lead to remission of odd in 9 out of 10 children. in the atomoxetine group, the remission of odd has not been directly evaluated in previous placebo - controlled trials of atomoxetine. the rate of occurrence of adverse effects was also consistent with results of some previous comparative trials of methylphenidate and atomoxetine in adhd. it was an open label trial, and placebo arm was not included due to ethical reasons. the improvement produced by both the drugs in odd symptoms might imply that defiant and hostile behaviors were an integral part of adhd and improvement in adhd also led to improvement in odd symptoms. furthermore, the follow - up period was short, and it needs to be seen whether improvement in odd symptoms sustains over the long period. nevertheless, this is the first study from india comparing efficacy of atomoxetine and methylphenidate in odd comorbid with adhd. the study indicates that odd comorbid with adhd shows considerable improvement with both methylphenidate and atomoxetine and symptoms of odd remits in majority with short duration of treatment. | background : oppositional defiant disorder (odd) is frequently comorbid with attention deficit hyperactivity disorder (adhd) and is associated with substantial functional impairments. methylphenidate and atomoxetine are well - established drugs for the management of adhd. some studies from western countries have reported these drugs to be effective in the management of odd comorbid with adhd. this study aimed to assess if methylphenidate and atomoxetine are efficacious in treating indian children with odd comorbid with adhd.subjects and methods : in this prospective, open - label study, 37 patients of age 614 years with a diagnosis of odd comorbid with adhd randomly received either methylphenidate (dose 0.21 mg / kg / day) or atomoxetine (dose 0.51.2 mg / kg / day) for 8 weeks. improvements in adhd and odd symptoms were assessed using vanderbilt adhd diagnostic parent rating scale (vadprs).results : at 8 weeks, there were statistically significant improvements in both adhd and odd symptoms in both methylphenidate and atomoxetine groups, as per vadprs. the improvements produced and tolerability was comparable in the two groups. 80% of the patients from methylphenidate group and 64.3% patients from atomoxetine group ceased to fulfill the criteria for the presence of odd at 8 weeks.conclusions:methylphenidate and atomoxetine are effective in the treatment of odd comorbid with adhd in short duration. |
they detected the odoriferous molecules dissolved in the water by the olfactory epithelium (oe) as the olfactory stimuli. the oe seems to be present from the beginning of the evolution of their olfactory system. later, they invaded the land and were forced to detect the odoriferous molecules in the air. however, the transition of their life style from in the water to on the land did not alter the functional mechanisms of the oe : the oe could detect only the odoriferous molecules dissolved in the liquid. this situation induced the development of the associated glands (bowman s glands) in the oe to dissolve the odoriferous molecules in their secretion to be perceived by the oe as the olfactory stimuli [2, 4, 7, 29, 34 ]. the absence of the bowman s glands in aquatic animals implies that they do not need associated glands of the oe to detect odoriferous molecules as olfactory stimuli because these molecules are already dissolved in the water. on the other hand, the vomeronasal organ (vno) 1.schematic drawings of the phylogenic tree of the vertebrates showing the presence (o) or absence (x) of the vomeronasal organ. modified after sarnat and netsky (1974) [ref.. asterisks () indicate extinct taxa.) ; and it seemed to be differentiated as the pheromone receptor [3, 26, 46 ]. the time and process of the differentiation of the vno from the oe is an important problem in the phylogeny of olfaction in vertebrates. schematic drawings of the phylogenic tree of the vertebrates showing the presence (o) or absence (x) of the vomeronasal organ. modified after sarnat and netsky (1974) [ref. the olfactory system in mammals is divided into two distinct systems, the main and accessory olfactory systems (fig. aob : accessory olfactory bulb, et : endoturbinates, in : incisor, mob : main olfactory bulb, ns : nasal septum, so : septal olfactory organ of masera, vno : vomeronasal organ. the main olfactory system consists of the main olfactory bulb (mob) as the primary center and the oe as the receptor. on the other hand, the accessory olfactory system consists of the accessory olfactory bulb (aob) as the primary center and the vno and the septal olfactory organ of masera (so) as receptors [1, 10, 17, 19, 38 ]. the mob consists of six layers, olfactory nerve layer, glomerular layer, external plexiform layer, mitral cell layer, internal plexiform layer and granule cell layer. the aob also consists of six layers with a few differences from the mob, the vomeronasal nerve layer, glomerular layer, mitral / tufted cell layer, plexiform layer, lateral olfactory tract and granule cell layer (fig. 3fig. 3.lamellar structure of the main (mob) and accessory olfactory bulb (aob) in the rat. ~ : mob, 1~6 : aob, : olfactory nerve layer, : glomerular layer, : external plexiform layer, : mitral cell layer, : internal plexiform layer, : granule cell layer, 1 : vomeronasal nerve layer, 2 : glomerular layer, 3 : mitral / tufted cell layer, 4 : plexiform layer, 5 : lateral olfactory tract, 6 : granule cell layer.). aob : accessory olfactory bulb, et : endoturbinates, in : incisor, mob : main olfactory bulb, ns : nasal septum, so : septal olfactory organ of masera, vno : vomeronasal organ. lamellar structure of the main (mob) and accessory olfactory bulb (aob) in the rat. ~ : mob, 1~6 : aob, : olfactory nerve layer, : glomerular layer, : external plexiform layer, : mitral cell layer, : internal plexiform layer, : granule cell layer, 1 : vomeronasal nerve layer, 2 : glomerular layer, 3 : mitral / tufted cell layer, 4 : plexiform layer, 5 : lateral olfactory tract, 6 : granule cell layer. as for the cytoarchitecture, output neurons of the mob are mitral cells and tufted cells, while these cells are not distinguished in the aob and called as mitral / tufted cells. in addition, various kinds of short axon cells are observed in both mob and aob and play significant roles as interneurons [21, 27 ]. we call these types of mob and aob the mammal - type mob and mammal - type aob in this review the glomeruli are the sites of synapse formation between axons of the receptor cells of the oe or vno and dendrites of the output neurons of the mob or aob. the axons of the output neurons of the mob run in the lateral olfactory tract. histochemical properties of individual glomerulus are different with each other in both mob and aob. each glomerulus shows distinct expression patterns in the kind and amount of glycoconjugates from the other. these findings are revealed by comparative studies on the immunohistochemical characteristics and lectin binding patterns among glomeruli in the mob and aob. in addition, these findings may suggest that there are functional assignments among glomeruli. the oe is distributed on the dorsocaudal aspect of the nasal septum and roof of the nasal cavity, and on the endoturbinates. the vno is a tubular structure situated at the base of the nasal septum and ends blindly. anteriorly, the vno opens into the nasal cavity with the small pore as in rodents or communicates with the oral cavity via the incisive duct as in ruminants, horses and carnivores. however, some marine animals, such as cetaceans and manatees, and the higher primates lack the von completely and are provided with only the main olfactory system. in mammals provided with the vno, medial and lateral walls of the lumen of the vno are covered with the vomeronasal sensory epithelium (vse) and non - sensory epithelium (nse), respectively. the vse consists of vomeronasal sensory, supporting and basal cells [39, 40 ].. functional mechanisms of the vno are different among mammalian species and depend whether it communicates with the nasal or oral cavity. as the secondary palate is completed in mammals, the nasal and oral cavities are separated by the hard and soft palates and communicate with each other by the incisive duct. the incisive duct is thought to be the rudiment of the internal nares (choanae) and opens at the base of the incisive papilla on the roof of the oral cavity. when the vno communicates with the nasal cavity, odoriferous molecules are uptaken into the vno by the mechanism of the vomeronasal pump of the vno [10, 20 ]. on the other hand, when the vno communicates with the oral cavity through the incisive duct, odoriferous molecules are uptaken into the vno with the inspirate by a unique mammalian behavior, the flehmen. in such a case, a part of odoriferous molecules are sent into the nasal cavity through the incisive duct. the so is a small patch of the epithelium similar to the oe and situated on the ventrocaudal aspect of the nasal septum [17, 38 ]. although the so is unique to mammals, its functional or phylogenetic significance is not fully understood at present. avian olfactory system consists of the mob and the oe, and lacks the accessory olfactory system. because of the avian behavior of the flight, the olfactory system is in general not well - developed in birds. since the secondary palate is incomplete and lacks the soft palate in birds, the nasal and oral cavities communicate with each other by the slit - like palatal fissure in the midline of the palate. the oe consists of olfactory, supporting and basal cells similar to that in mammals, but it occupies only a small area of the nasal cavity. as the olfactory cells in the oe are rather small in number in birds than in mammals, the oe is lower in height in birds than in mammals. the lamellar structure of the avian mob is almost the same as in mammals. right and left mobs are frequently fused in the midline [14, 48 ]. in conclusion, the avian olfactory system consists solely of the main olfactory system composed of mammal - type mob and mammal - type oe. reptiles constitute the paraphyletic group in taxonomy and have no common ancestors in phylogeny. therefore, we adopt three living reptilian groups, lizards, snakes and turtles, as reptilian representatives in this review (figs. 4 and 5fig. 4.transverse section of the nasal cavity in the turtle. c : nasal concha, mb : mushroom body, nse : non - sensory epithelium, oe : olfactory epithelium, vne : vomeronasal sensory epithelium. bar=500 m.). c : nasal concha, mb : mushroom body, nse : non - sensory epithelium, oe : olfactory epithelium, vne : vomeronasal sensory epithelium. bar=500 m. in reptiles, generally, the secondary palate is incomplete, except for crocodilians, and the nasal and oral cavities communicate with each other with varying degrees. the development of the vno is also various among reptilian species. in lizards, the vno is isolated from the nasal cavity and opens into the oral cavity via the vomeronasal duct at the anterior tip and ends blindly posteriorly. the ventral wall of the vno protrudes into its crescent lumen to form the mushroom body. although the mushroom body is covered with the non - sensory epithelium, the rest of the wall of the lumen of the vno is mostly covered with the vse [16, 30 ]. odoriferous molecules are uptaken into the vno by the action of the facial bones, jaws and the head itself. the vse projects to the aob whose cytoarchitecture is almost the same as in mammals and corresponds to the mammal - type aob. on the other hand, the nasal cavity of lizards is a single rounded chamber without the nasal concha and mostly covered with the mammal - type oe. the oe projects to the mob whose cytoarchitecture almost corresponds to mammal - type mob. in snakes, the distribution of the vse and non - sensory epithelium is also similar to lizards. histological structure of the vse, however, is unique to snakes and shows no resemblance to the other vertebrate species. the supporting cells are situated in the apical region of the vse and arranged in a single row. the supporting cell layer is demarcated by the connective tissue containing vessels from the underlying region of sensory cells and basal cells. the cytoarchitecture of the aob corresponds to mammal - type aob. on the other hand, functional mechanism of odoriferous molecules are attached to the sticky tips of the bifurcated tongue and sent into the von by the tongue - flicking [6, 10 ]. in addition, the nasal cavity becomes complicated in snakes and protrudes the single nasal concha from its lateral wall. the dorsomedial and the most of the dorsolateral wall of the nasal cavity is covered with the oe, while the ventral wall and a part of the dorsolateral wall of the nasal cavity are covered with the non - sensory epithelium. the projection pattern of the oe to the mob is almost the same as in lizards and mammals ; and the mob also shows the similar cytoarchitecture to lizards and mammals and corresponds to the mammal - type mob. that is, the mob in snakes corresponds to mammal - type mob. in turtles, the nasal cavity is a simple chamber devoid of the nasal conchae and divided into upper and lower chambers. these chambers are almost the same in size and demarcated by the non - sensory epithelium at their border ; and both lead to the choanae. the upper chamber is mostly covered with the oe containing ciliated and microvillous olfactory cells as in mammal - type oe and equipped with the associated glands, but the lower chamber is covered with a kind of sensory epithelium similar to the vse and devoid of the associated glands. we call this epithelium the lower chamber epithelium (lce) in this review. the presence or absence of the associated glands in the epithelium in upper or lower chambers may suggest that the upper and lower chambers take charge of the olfaction in air and in water, respectively. lectin binding patterns are different between upper and lower chambers, but g protein coupling to the olfactory receptors is commonly expressed in both upper and lower chambers. since the vno in general ends blindly at its caudal extremity and lacks g protein coupling to the olfactory receptors, the lower chamber in turtles does not correspond to the vno. the upper half receives the projection from the sensory epithelium in the lower chamber, while the lower half receives the projection from the oe in the upper chamber. the cytoarchitecture of the olfactory bulb is almost the same in both upper and lower halves and corresponds to mammal - type mob. these findings suggest that turtles lack the accessory olfactory system and that sensory epithelium in the lower chamber reminds us the fish - type oe described later in this review. since apodans are regarded as retrogressive animals and contain only a few species, we adopt anurans and urodeles as the representative of living amphibians. in anurans, the nasal cavity is divided into upper, middle and lower chambers (fig. red : lower chamber lined with the vomeronasal sensory epithelium.). in general, upper, middle and lower chambers are lined with the oe, the non - sensory epithelium and the vse, respectively. the oe in anurans corresponds to mammal - type oe, and the vse is a component of mammal - type vno. the oe and the vse project to mammal - type mob and mammal - type aob, respectively. therefore, the main and accessory olfactory systems are recognized as usual in anurans. in the african clawed frog, xenopus laevis, however, the middle chamber is lined with a sensory epithelium different from both oe and vse [25, 35 ]. we call this epithelium temporarily the middle chamber epithelium (mce) in this review. the mce contains ciliated and microvillous sensory cells, ciliated and microvillous supporting cells, and basal cells and lacks the associated glands, while the oe contains ciliated olfactory cells, microvillous supporting cells and basal cells, is equipped with well - developed associated glands as in terrestrial animals and corresponds to mammal - type oe. in xenopus, the mob is divided into upper and lower parts, each receiving projections from the oe and the mce, respectively. these findings suggest that the main olfactory system in xenopus is subdivided into two olfactory pathways, that is, from the oe to the upper part of the mob and from the mce to the lower part of the mob [11, 31, 41 ]. although lectin binding patterns are different between upper and lower parts of the mob, the cytoarchitecture is almost common in the whole mob and corresponds to that of mammal - type mob. the vse in the lower chamber projects to the aob situated dorsocaudally to the mob as usual. these findings may suggest that the oe and the mce take charge of the olfaction in the air and water, respectively. red : lower chamber lined with the vomeronasal sensory epithelium. in urodeles, the nasal cavity is rather primitive and consists of a broad single chamber. the vno is recognized as a lateral diverticulum of the nasal cavity. the main chamber of the nasal cavity, except for the diverticulum, is lined with the oe, and the lateral diverticulum is lined with the vse similar to that observed in the mammal - type vno. the oe and the vse project to the mob and the aob, respectively, as usual. the cytoarchitectures in the mob and aob are still primitive, but resembles those of mammal - type mob and mammal - type aob. fish olfactory system is generally believed to be composed solely of the main olfactory system and lacks the vno and the aob. the nasal pit is a tubular structure, opens to the exterior via anterior and posterior pores and has no communication with the oral cavity. the oe is not a sheet of the epithelium as in mammals and takes the forms of islets separated from the neighboring oe by the non - sensory epithelium. as our understandings about fish olfactory system are restricted to rather few species, we adopt flatfish and lungfish as the representative of living fish. the oe contains ciliated and microvillous olfactory cells, a special type of sensory cells, i.e., crypt cells, ciliated and microvillous supporting cells, and basal cells and lacks the associated glands [22, 45, 47 ]. we call this type of the or the fish - type oe in this review. the oe projects to the primitive olfactory bulb, where mitral and tufted cells can not be distinguished from each other and called collectively as mitral / tufted cells. this olfactory bulb in fish may correspond to mammal - type aob, and we call this olfactory bulb the fish - type mob in this review. in lungfish, many olfactory lamellae are suspended from the roof of the nasal pit and covered with islets of the fish - type oe separated from neighboring oe by the sensory epithelium, although the lungfish oe is devoid of crypt cells and different in the strict sense of the definition from that in flatfish. the oe projects to the primitive olfactory bulb as in flatfish, i.e., the fish - type mob. in addition, at the base of each lamella near the roof of the nasal pit, the covering of the lamella becomes depressed and form recesses (fig. (a) sagittal section of the nasal sac of the lungfish showing many lamellae hanging from the roof. recesses (arrows) are observed at the base of the lamellae and lined with the recess epithelium. a : anterior, d : dorsal, p : posterior, v : ventral. neighboring lamellar olfactory epithelia are separated by non - sensory epithelium (asterisk). bc : basal cell, orc : olfactory receptor cell, sp : supporting cell.). these recesses are lined with a sensory epithelium unique to the recesses in lungfish [23, 24 ]. the recess epithelium contains microvillous sensory cells, microvillous supporting cells and basal cells.. the recess epithelium may be the primordial vse, but is situated sporadically at the base of each olfactory lamella. on the other hand, as the vse is a single sheet of the epithelium, it is unclear how the spotted recess epithelia assemble to form a single sheet of the vse through any process. the truth has not yet come out. the olfactory organ of lungfish stained with he. (a) sagittal section of the nasal sac of the lungfish showing many lamellae hanging from the roof. recesses (arrows) are observed at the base of the lamellae and lined with the recess epithelium. a : anterior, d : dorsal, p : posterior, v : ventral. neighboring lamellar olfactory epithelia are separated by non - sensory epithelium (asterisk). bc : basal cell, orc : olfactory receptor cell, sp : supporting cell. in this review, we classified the olfactory receptor organs and their primary centers into several types (fig. 8fig. ce : chamber epithelium, oe : olfactory epithelium, so : septal olfactory organ of masera, vno : vomeronasal organ.). ce : chamber epithelium, oe : olfactory epithelium, so : septal olfactory organ of masera, vno : vomeronasal organ. the olfactory receptor organs are divided into fish - type oe, mammal - type oe, mce, lce, recess epithelium, mammal - type vno, snake - type vno and so. the mammal - type oe is dominant and observed in amphibians, reptiles, birds and mammals. the mammal - type vno is dominant and observed in amphibians, lizards and mammals. the primary olfactory centers are divided into mammal - type mob, mammal - type aob and fish - type mob. the mammal - type mob is dominant and observed in amphibians, reptiles, birds and mammals. the mammal - type aob is observed in amphibians, lizards, snakes and mammals, but absent in animals devoid of the vno. phylogenetically, the fish - type oe seems to be derived from the putative primitive oe. the mammal - type oe, mce, lce and recess epithelium seem to be descendants of the fish - type oe. the vno may be derived from the recess epithelium or fish - type oe and differentiate into the mammal - type vno and snake - type vno. the mammal - type mob first appears in amphibians and succeeds to reptiles, birds and mammals. the fish - type mob may be the ancestor of the mammal - type mob, while the mammal - type aob may be the remnant of the fish - type mob. | abstractthe olfactory receptor organs and their primary centers are classified into several types. the receptor organs are divided into fish - type olfactory epithelium (oe), mammal - type oe, middle chamber epithelium (mce), lower chamber epithelium (lce), recess epithelium, septal olfactory organ of masera (so), mammal - type vomeronasal organ (vno) and snake - type vno. the fish - type oe is observed in flatfish and lungfish, while the mammal - type oe is observed in amphibians, reptiles, birds and mammals. the mce and lce are unique to xenopus and turtles, respectively. the recess epithelium is unique to lungfish. the so is observed only in mammals. the mammal - type vno is widely observed in amphibians, lizards and mammals, while the snake - type vno is unique to snakes. the vno itself is absent in turtles and birds. the mammal - type oe, mce, lce and recess epithelium seem to be descendants of the fish - type oe that is derived from the putative primitive oe. the vno may be derived from the recess epithelium or fish - type oe and differentiate into the mammal - type vno and snake - type vno. the primary olfactory centers are divided into mammal - type main olfactory bulbs (mob), fish - type mob and mammal - type accessory olfactory bulbs (aob). the mammal - type mob first appears in amphibians and succeeds to reptiles, birds and mammals. the fish - type mob, which is unique to fish, may be the ancestor of the mammal - type mob. the mammal - type aob is observed in amphibians, lizards, snakes and mammals and may be the remnant of the fish - type mob. |
eighty - four consecutive patients with cts scheduled for surgery at our institution (an urban tertiary referral hospital) were prospectively recruited for the study between june 2011 and february 2012. all patients were referred by primary care physicians, general orthopaedic surgeons, neurologists, or rehabilitation physicians. we excluded those from the study with any other upper extremity problem besides cts, such as a history of forearm fracture or malunion, cervical radiculopathy, and cubital tunnel syndrome. we also excluded those from the study with systemic comorbidities, such as rheumatoid arthritis, diabetes mellitus, thyroid disease, and chronic renal failure. concurrent disorders and loss of follow - up led to a total of forty - seven patients being excluded from the final data analysis. the patients included consisted of 1 man and 36 women ; their ages ranged from 28 years old to 73 years old (average, 53.5 years old). this study was approved by the institutional review board of the authors ' hospital ; informed consent was obtained from all patients. cts was diagnosed based on clinical symptoms, such as tingling sensation of the hand. electrophysiologic studies were conducted for all patients to confirm the diagnosis ; only those with positive findings were included for analysis. we used the classification developed by bland12) : the classification consists of 7 grades from grade 0 (normal) to grade 6 (extremely severe) based on conduction time and amplitude. all patients underwent either unilateral or simultaneous bilateral open carpal tunnel release by a single surgeon (hsg) under local anesthesia. evaluations using the k - mhq and k - dash were performed preoperatively and six months postoperatively. the six - month interval period was chosen due to findings from a previous study : the study found that patients who have carpal tunnel release tend to plateau in functional and symptom improvement six months after surgery when assessed via questionnaire.13) the k - mhq is a 57-item hand - specific outcomes questionnaire that contains 6 domains : (1) function, (2) activities of daily living, (3) pain, (4) work performance, (5) aesthetics, and (6) patient satisfaction. patients are asked to answer each question for the relevant domain using a scale of 1 to 5. all scales except for work and pain assess each hand separately and are scored according to the affected hand or as an average for bilaterally affected hands. the k - mhq was translated by two of the authors (hsg and yhr), approved by the original developer (kevin chung, university of michigan, usa), and was validated for its reliability and cross - cultural adaptation for common hand disorders. the instrument is presented in the appendix 1.8) the k - dash questionnaire primarily consists of a 30 item scale concerning the patient 's health status for the preceding week. the items ask about the following issues : degree of difficulty in performing various physical activities because of an arm ; shoulder or hand problem (21 items) ; the severity of each symptom of pain, activity - related pain, tingling, weakness, and stiffness (5 items) ; the problem 's effect on social activities, work and sleep ; and its psychological impact (4 items). if at least 27 of the 30 items are completed, then a score ranging from 0 (no disability) to 100 (the most severe disability) can be calculated. the two optional scales of k - dash (sport / music and work) were excluded from this study. two - sample student t - tests were performed when comparing scores for patients who had unilateral carpal tunnel release versus patients who had simultaneous bilateral carpal tunnel release and comparing scores for the mild (bland grade 1 - 2) group versus moderate to severe (bland grade 3 - 5) group. the responsiveness of each questionnaire was evaluated in this study using a distribution - based methodology : this was performed by calculating the standardized response mean (srm).14) the srm was defined as the mean change between pre- and postoperative scores divided by the standard deviation of the total change. values 0.5, between 0.5 and 0.8, and 0.8 were considered to represent small, moderate, and large degrees of responsiveness, respectively.15) for the sample size calculation, we needed a total of 56 patients to achieve 90% power. however, due to concurrent disorders and a loss of follow - up, data analysis was performed for only 37 patients. however, as the study results were positive, retrospective power analysis indicated that the statistical power was adequate. eighty - four consecutive patients with cts scheduled for surgery at our institution (an urban tertiary referral hospital) were prospectively recruited for the study between june 2011 and february 2012. all patients were referred by primary care physicians, general orthopaedic surgeons, neurologists, or rehabilitation physicians. we excluded those from the study with any other upper extremity problem besides cts, such as a history of forearm fracture or malunion, cervical radiculopathy, and cubital tunnel syndrome. we also excluded those from the study with systemic comorbidities, such as rheumatoid arthritis, diabetes mellitus, thyroid disease, and chronic renal failure. concurrent disorders and loss of follow - up led to a total of forty - seven patients being excluded from the final data analysis. the patients included consisted of 1 man and 36 women ; their ages ranged from 28 years old to 73 years old (average, 53.5 years old). this study was approved by the institutional review board of the authors ' hospital ; informed consent was obtained from all patients. cts was diagnosed based on clinical symptoms, such as tingling sensation of the hand. electrophysiologic studies were conducted for all patients to confirm the diagnosis ; only those with positive findings were included for analysis. we used the classification developed by bland12) : the classification consists of 7 grades from grade 0 (normal) to grade 6 (extremely severe) based on conduction time and amplitude. all patients underwent either unilateral or simultaneous bilateral open carpal tunnel release by a single surgeon (hsg) under local anesthesia. evaluations using the k - mhq and k - dash were performed preoperatively and six months postoperatively. the six - month interval period was chosen due to findings from a previous study : the study found that patients who have carpal tunnel release tend to plateau in functional and symptom improvement six months after surgery when assessed via questionnaire.13) the k - mhq is a 57-item hand - specific outcomes questionnaire that contains 6 domains : (1) function, (2) activities of daily living, (3) pain, (4) work performance, (5) aesthetics, and (6) patient satisfaction. patients are asked to answer each question for the relevant domain using a scale of 1 to 5. all scales except for work and pain assess each hand separately and are scored according to the affected hand or as an average for bilaterally affected hands. the k - mhq was translated by two of the authors (hsg and yhr), approved by the original developer (kevin chung, university of michigan, usa), and was validated for its reliability and cross - cultural adaptation for common hand disorders. the instrument is presented in the appendix 1.8) the k - dash questionnaire primarily consists of a 30 item scale concerning the patient 's health status for the preceding week. the items ask about the following issues : degree of difficulty in performing various physical activities because of an arm ; shoulder or hand problem (21 items) ; the severity of each symptom of pain, activity - related pain, tingling, weakness, and stiffness (5 items) ; the problem 's effect on social activities, work and sleep ; and its psychological impact (4 items). if at least 27 of the 30 items are completed, then a score ranging from 0 (no disability) to 100 (the most severe disability) can be calculated. the two optional scales of k - dash (sport / music and work) were excluded from this study. statistical analysis was performed using ibm spss ver. 19.0 (ibm co., armonk, ny, usa). two - sample student t - tests were performed when comparing scores for patients who had unilateral carpal tunnel release versus patients who had simultaneous bilateral carpal tunnel release and comparing scores for the mild (bland grade 1 - 2) group versus moderate to severe (bland grade 3 - 5) group. the responsiveness of each questionnaire was evaluated in this study using a distribution - based methodology : this was performed by calculating the standardized response mean (srm).14) the srm was defined as the mean change between pre- and postoperative scores divided by the standard deviation of the total change.. values 0.5, between 0.5 and 0.8, and 0.8 were considered to represent small, moderate, and large degrees of responsiveness, respectively.15) for the sample size calculation, we needed a total of 56 patients to achieve 90% power. however, due to concurrent disorders and a loss of follow - up, data analysis was performed for only 37 patients. however, as the study results were positive, retrospective power analysis indicated that the statistical power was adequate. all domains of the k - mhq (function, activities of daily living, work, pain, aesthetics, and satisfaction) revealed significant postoperative improvement (p < 0.001) (table 1). comparing the unilateral and bilateral surgery group, there were no statistically significant differences preoperatively and postoperatively in mean function scores (p = 0.71 and 0.53, respectively), and in mean pain scores (p = 0.85 and 0.96, respectively). comparing the mild (bland grade 1 - 2) and moderate to severe (bland grade 3 - 5) group, there were no significant differences in mean preoperative and postoperative k - mhq scores (function : p = 0.33 and 0.51 ; pain : p = 0.59 and 0.25, respectively). k - dash scores decreased by 19 points, revealing a significant postoperative improvement (p < 0.001) (table 2). there were no significant differences between unilateral and bilateral patients in mean preoperative and postoperative k - dash scores (p = 0.82 and 0.54, respectively). there were no significant differences between mild and moderate to severe group in mean preoperative or postoperative k - dash scores, either (p = 0.22 and 0.35, respectively). the srm for the k - mhq ranged from medium (0.6) for the aesthetics scales, to large (0.8 - 1.0) for the pain, satisfaction, activities of daily living, work, and function scales. for patients who had unilateral surgery, the srms for the work and pain scales were 0.8 and 0.9, respectively. for patients who had bilateral surgery. the srm for k - dash was 0.9. for patients who had unilateral surgery, the srm for the k - dash was 0.8. for patients who had bilateral surgery, all domains of the k - mhq (function, activities of daily living, work, pain, aesthetics, and satisfaction) revealed significant postoperative improvement (p < 0.001) (table 1). comparing the unilateral and bilateral surgery group, there were no statistically significant differences preoperatively and postoperatively in mean function scores (p = 0.71 and 0.53, respectively), and in mean pain scores (p = 0.85 and 0.96, respectively). comparing the mild (bland grade 1 - 2) and moderate to severe (bland grade 3 - 5) group, there were no significant differences in mean preoperative and postoperative k - mhq scores (function : p = 0.33 and 0.51 ; pain : p = 0.59 and 0.25, respectively). k - dash scores decreased by 19 points, revealing a significant postoperative improvement (p < 0.001) (table 2). there were no significant differences between unilateral and bilateral patients in mean preoperative and postoperative k - dash scores (p = 0.82 and 0.54, respectively). there were no significant differences between mild and moderate to severe group in mean preoperative or postoperative k - dash scores, either (p = 0.22 and 0.35, respectively). the srm for the k - mhq ranged from medium (0.6) for the aesthetics scales, to large (0.8 - 1.0) for the pain, satisfaction, activities of daily living, work, and function scales. for patients who had unilateral surgery, the srms for the work and pain scales were 0.8 and 0.9, respectively. for patients who had bilateral surgery. the srm for k - dash was 0.9. for patients who had unilateral surgery, the srm for the k - dash was 0.8. for patients who had bilateral surgery, in this study, we evaluated the responsiveness of the k - mhq for cts and compared it with that of the k - dash. we found that the k - mhq had a level of responsiveness similar to that of the k - dash in the assessment of cts outcomes. kotsis and chung16) reported that the srm varied from 0.5 to 0.6 for the activity subscale and from 0.9 to 1.1 for the pain and satisfaction scales. the study by chatterjee and price7) showed the srm varied from 0.78 to 1.30 for the pain, aesthetics, and function scales and from 0.79 to 0.80 for the satisfaction, activity, and work scales (table 3). compared with these studies, the k - mhq was found to have a sufficient degree of responsiveness for assessing and comparing outcomes for korean patients with cts. previous studies found that the pain domain seemed to be the most responsive for the mhq, but as shown in table 3, our study found that the function domain appeared to be the most responsive. the reason for this difference is presumed that the high proportion (83.8%) of moderate to severe patients (bland grade 3 - 5) who had a sensory or motor deficit would experience comprehensive improvement in hand functioning. the aesthetics domain may not be pertinent to carpal tunnel release.17) in addition, aesthetics outcomes may worsen because of the scar after open carpal tunnel release. in this study, however, there was a significant improvement in the aesthetic domain after surgery, which concurs with previous study by the chatterjee and price.7) they suggested that patients may have improved their self - image secondary to better function following carpal tunnel release and their perception of their hand aesthetics therefore improved. in the present study, the k - dash is a more general questionnaire with questions that assess the collective arm, shoulder, and hand conditions. the combined function / symptom scale of the k - dash limits the measurement of symptom and function improvement after carpal tunnel surgery because symptoms are quicker to improve than functional outcomes.18,19,20,21) furthermore, the k - dash outcomes are not scored separately for each hand ; thus, it is difficult to interpret the k - dash outcome in conditions that often involve both hands, such as cts. compared with the k - dash, the k - mhq contains multiple domains, each of which can be scored individually. all domains (except for work and pain) assess the right and left hand separately, making it possible to assess both hands separately, and also allowing for scores of the affected hand to be compared with an unaffected control hand if only one hand is affected. in addition, the k - mhq is more region - specific than the k - dash in that it has questions relating to the hand only. first, our study did not have a balanced sex ratio : the study had an overabundance of female patients (97.3%). this limits the generalizability of our results to the population, but it is not likely to affect the conclusions of our study because outcomes of cts were not found to vary by gender.13) furthermore, similar demographics have been used in other prospective cts studies.18) second, we lacked other general health measurement questionnaires that can be used for comparison ; we also did not analyze any clinical factors such as physical findings that may influence the responsiveness of each score. third, we did not compare the k - mhq with the boston carpal tunnel scores, which is a disease specific scale and is known to have a greater responsiveness than k - dash in cts.11) in conclusion, the k - mhq was found to have a large degree of responsiveness after carpal tunnel release for korean patients with cts, which is comparable not only to the k - dash, but also to the original version of the mhq. the region - specific k - mhq can be used for outcomes research related to carpal tunnel surgery, especially for research comparing cts with various other hand and wrist conditions. | backgroundthe korean version of the michigan hand outcomes questionnaire (k - mhq) was recently validated ; however, the questionnaire 's responsiveness as well as the degree to which the instrument is sensitive to change has not been thoroughly evaluated in a specific condition in koreans. we evaluated the responsiveness of the k - mhq in a homogenous cohort of patients with carpal tunnel syndrome (cts) and we compared it with that of the korean version of the disability of the arm, shoulder, and hand questionnaire (k - dash), which was found to have a large degree of responsiveness after carpal tunnel release for korean patients with cts.methodsthirty-seven patients with cts prospectively completed the k - mhq and the k - dash before and 6 months after surgery. the responsiveness statistics were assessed for both the k - mhq and the k - dash by using the standardized response mean (srm), which was defined as the mean change of the original scores after surgery divided by the standard deviation of the change.resultsall domains of the k - mhq significantly improved after carpal tunnel release (p < 0.001). the srm for all scales but one (the aesthetics scale) showed large responsiveness of 0.8. the aesthetics scale showed medium responsiveness of 0.6. the combined function / symptom scale of the k - dash significantly improved after surgery (p < 0.001). the srm of the k - dash revealed large responsiveness of 0.9.conclusionsthe k - mhq was found to have a large degree of responsiveness after carpal tunnel release for korean patients with cts, which is comparable not only to the k - dash, but also to the original version of the mhq. the region - specific k - mhq can be useful for outcomes research related to carpal tunnel surgery, especially for research comparing cts with various other hand and wrist health conditions. |
the general clinical course of a typical convulsive status can be categorized as : early, established, refractory and super - refractory. se that continues or recurs 24 hours or more after the onset of anesthesia, including those cases in which se recurs on the reduction or withdrawal of anesthesia is known as super - refractory status epilepticus.1 while treatment guidelines exist for established and refractory status epilepticus, the management of super - refractory status epilepticus is not well established. we present here a case of super - refractory status epilepticus treated with doses of anesthetic medications beyond the recommended guidelines with a good clinical outcome. a 28-year old female, a known hypertensive for 2 years, had 2 episodes of generalized tonic - clonic seizures (gtcs) following 2 days of fever. she was managed initially at another hospital where she was given a loading dose of 3 g of levetiracetam. the next day, she was brought to our emergency department in a drowsy state following 2 more gtcs. on examination she was given a loading dose of fosphenytoin (20 mg / kg phenytoin equivalent), while levetiracetam was continued at 1,500 mg q12h. mri brain with and without the differential diagnosis was viral vs autoimmune encephalitis. at the time of admission, cerebrospinal fluid (csf) analysis was normal (glucose 66 mg / dl with blood glucose 118 mg / dl, protein 48 mg / dl, 2 cells, both lymphocytes). she regained consciousness and was stable for the next 3 days. on the 4th day, she developed one episode of gtcs. clobazam was added at a dose of 10 mg qhs. following this episode, she developed recurrent focal seizures originating from the right as well as left temporal regions with worsening of sensorium (fig. a loading dose of sodium valproate (40 mg / kg body weight) was given. after 2 hours, there was a recurrence of focal seizures with mild facial twitching, amounting to non - convulsive status epilepticus (ncse, fig. a loading dose of midazolam (0.2 mg / kg) was followed by maintenance infusion which was gradually increased to 3 mg / kg / hr (body weight 80 kg, total dose was 240 mg / hr). at this dose of midazolam infusion, she developed hypotension with blood pressure of 80/60 mmhg. at this stage, noradrenaline infusion was initiated and the dose was titrated (320 mcg / hour) with concurrent decrease in the rate of infusion of midazolam (decreased upto 80 mg lacosamide (400 mg loading, then 200 mg q12h) and topiramate (400 mg loading, then 200 mg q12h) were added to the regimen. due to continuation of ncse, thiopentone sodium infusion was initiated and gradually increased. at a dose of 6 mg / kg / hr (total dose 480 mg / hr), burst suppression was achieved. at this point, her hemogram, renal and hepatic parameters were within normal limits. after 5 days of iv methylprednisolone (ivmp), she was given 5 days of iv immunoglobulin (0.4 g / kg / day). evaluation for autoimmune state, including antibodies against n - methyl d - aspartate receptor and voltage - gated potassium channel as well as for systemic vasculitis was normal. as the csf parameters, and investigations for systemic autoimmune conditions were normal, we postulated a probable diagnosis of viral vs autoimmune encephalitis. after 12 hours of burst suppression, gradual withdrawal of midazolam and thiopentone was started. midazolam was completely stopped and thiopentone was reduced to 40 mg / hr without seizure recurrence, following which it was completely stopped. the second cycle of midazolam and thiopentone was started with doses of 80 mg / hr and 160 mg / hr respectively. control of seizures was achieved and they were gradually tapered off over the next 4 days. midazolam was restarted at 10 mg / hr and control was achieved at a dose of 50 mg / hr. midazolam was tapered and stopped over the next 2 days after seizure control (fig. she had developed mild proximal weakness of all limbs which was diagnosed as critical illness myoneuropathy. cognitive assessment showed severe attentional deficits. on discharge, she had mild proximal weakness, attention and occasional recent memory deficits. she continued to improve during the follow - up period. at the last visit, she had no residual weakness but had mild attention and recent memory deficits. the causes postulated include excitotoxicity, inhibitory neurotransmitter dysfunction, energy failure, inflammatory processes and network reorganization. the aim of treatment is to control seizures and prevent propagation of damage.2 however, the treatment of super - refractory status epilepticus is difficult and is hampered by the lack of established guidelines. the best treatment, of course, is treatment of the cause. for control of seizures, these include anesthetic agents (thiopentone, midazolam, propofol, ketamine and inhalation anesthetics), newer antiepileptics, magnesium, pyridoxine, immunotherapy, ketogenic diet, hypothermia, neuromodulation and surgery.2 the doses for midazolam and thiopentone for adults, as used in available literature, are up to 0.4 mg / kg / hr and 5 mg / kg / hr respectively.2 in our case, we used midazolam up to 3 mg / kg even at these doses, hypotension was transient and there were no other systemic complications. we postulate that this case is unique in the sense that the patient had only transient hypotension with anesthetic medications and the good clinical outcome is related to appropriate aggressive medical care in a young female. the outcome of patients with refractory and super - refractory status epilepticus (srse) is variable.3,4 as we gain more information, the prognosis of super - refractory status epilepticus will improve. in the absence of established guidelines, the treatment of super - refractory status epilepticus needs to be individualized. aggressive treatment, even with doses beyond those conventionally used, can result in a good functional outcome with minimal complications. | a 28-year old female was admitted with recurrent seizures following 2 days of febrile illness, after which she developed status epilepticus. midazolam and later thiopentone infusions were started after failure of regular intravenous antiepileptics. burst suppression was achieved at doses of 3 mg / kg / hr for midazolam and 6 mg / kg / hr of thiopentone. adjunctive medications included methylprednisolone, intravenous immunoglobulin and acyclovir. imaging and biochemical parameters were normal. she required 3 cycles of midazolam and 2 cycles of thiopentone for complete cessation of seizures. she recovered with mild attentional and recent memory deficits on follow up. treatment of super - refractory status epilepticus requires individualized regimens and may need doses beyond conventional limits. to the best of our knowledge, there is no such reported case from india. |
encapsulating peritoneal sclerosis (eps) is a rare and often fatal disease occurring most frequently in patients who have undergone peritoneal dialysis (pd). it is characterized by progressive intra - abdominal fibrosis resulting in compromised bowel motility and function. in addition to surgery and enteric rest, anecdotal case reports have suggested that tamoxifen and immunosuppressive therapy might be useful. we report a case of eps in a renal transplant recipient, despite treatment with tamoxifen and immunosuppression. this questions the role of these therapies in preventing or treating this increasingly recognized condition. a 60-year - old indo - asian male underwent capd as a therapy for esrf of unknown cause, from may 1994 to feb. 2006, when he was switched to apd. in 1998, he had an uncomplicated episode of culture negative peritonitis treated with two doses of ip vancomycin 1 g / week and netilmycin 50 mg ip daily for 1 week. two years later, cholecystitis was diagnosed and a cholecystectomy was performed. during surgery, omental adhesions were noted and a peritoneal biopsy revealed marked peritoneal thickening and fibrosis, which suggested a diagnosis of early encapsulating peritoneal sclerosis (eps). following his recovery, capd was resumed for lifestyle reasons and tamoxifen 20 mg od commenced. serial peritoneal equilibration test (pet) results demonstrated progression from high average to high transporter status suggesting ongoing membrane changes. his pd prescriptions were a pd4 1.36% glucose solution, up until his transporter status changed. prior to transplantation, he was using a 3.86% glucose solution. for several months prior to receiving a renal transplant, he was noted to have intermittent abdominal bloating, anorexia and diarrhoea. immediately pre - transplantation, he was asymptomatic, with a weight of 58.5 kg. he received a 1:1:1 mismatched cadaveric kidney transplant placed extra - peritoneally in may 2006. the graft functioned immediately and his serum creatinine fell to a baseline of 6080 mol / l. target tacrolimus levels of 1015 g / l in the early post - transplant period were achieved. in the following week an abdominal ct scan revealed moderate ascites, fluid - filled distended bowel loops and bowel wall oedema (figure 1). there was no ct evidence of eps and a diagnosis of post - operative ileus was made. symptoms persisted and a repeat abdominal ct 1 week later failed to show any changes. following conservative management and nutritional supplementation, symptoms resolved and he was discharged 3 weeks after transplantation with a serum creatinine of 83 mol / l and on tamoxifen 10 mg od. five months later, the patient complained of increasing abdominal distension and early satiety, and crp was 64 mg / l. a ct section through the pelvis during iv contrast enhancement at this time demonstrated a loop of dilated small bowel and peritoneal thickening in the left iliac fossa (figure 2). a diagnosis of eps with sub - acute bowel obstruction was made, and the patient was listed for an elective peritonectomy and adhesiolysis. this section from a ct performed 1 week after transplantation shows no evidence of eps. five months following transplantation : a ct section through the pelvis during iv contrast enhancement demonstrating the grafted kidney in the right iliac fossa with a loop of dilated small bowel present. there is an area of peritoneal thickening present in the left iliac fossa. on admission, he weighed 49 kg and complained of anorexia, vomiting and diarrhoea with intermittent colicky abdominal pain. at surgery, the peritoneal membrane appeared brown and grossly thickened, with partial cocooning of the small intestine. the peritoneum was excised and tpn was administered for 2 weeks until line sepsis prompted cessation. at this stage, the patient was tolerating oral nutrition. one month later, prior to his discharge, a barium follow through showed several adhesions with no obvious strictures or obstruction and a normal bowel transit time. despite his peritonectomy and continuing tamoxifen treatment, symptoms continued with early satiety, regular vomiting and weight loss to 44 kg. on mobilizing the small bowel from the duodenojejunal to the ileocaecal flexure, peristalsis was seen. currently, his symptoms are markedly improved with infrequent vomiting and achievement of a normal diet and a stable weight. this case report highlights some important clinical issues regarding diagnosis, treatment and management of eps. firstly, a diagnosis of eps was made following the surgical and pathological findings of adhesions and peritoneal fibrosis with inflammation at the time of his cholecystectomy. ct imaging done at this time and subsequently prior to his renal transplant did not demonstrate any evidence of eps. thus, it is unclear whether these findings represent early eps or peritoneal sclerosis in a pd patient, with adhesions secondary to cholecystitis. furthermore, this case also questions the value of ct as a screening tool. on re - reviewing the ct images from the early post - transplant period in light of his subsequent history, this gentleman chose to remain on pd for lifestyle reasons and started tamoxifen treatment in the hope of preventing further deterioration of his peritoneal membrane. tamoxifen has been proposed in several case reports and small case series as a potential therapeutic and prophylactic agent in the management of eps [57 ]. the rationale for its use has come from its role in other conditions such as retro - peritoneal fibrosis. this treatment continued pre- and post - transplantation but failed to prevent disease progression and the ensuing sub - acute bowel obstruction. it is possible that tamoxifen did afford protection or slow disease progression until an unidentified trigger, at the time of transplantation, led to rapid eps progression. the role of immunosuppression in the management of eps is further questioned by this case. agents such as cyclosporine, steroids, azathioprine and mycophenolate have been suggested as potential treatments. we have shown previously that mycophenolate mofetil can certainly cause diagnostic confusion due to its side - effect profile. we are currently attempting to address the role of immunosuppression using the uk eps registry. it is also interesting to note that there was a recurrence of bowel obstruction 6 months after the initial peritonectomy during which time the patient was also receiving tamoxifen and immunosuppression. finally, the importance of a high index of clinical suspicion is highlighted by his diagnosis with irritable bowel syndrome prior to transplant. there is a marked overlap in symptoms between these two conditions, which may lead to diagnostic confusion for specialists unfamiliar with the disease. it is possible, despite normal ct examinations, that these symptoms heralded disease progression. thus, familiarity with eps and the need for a high index of clinical suspicion are important determinants in making the diagnosis, and this is an important lesson from this case. in conclusion, this report questions the role of both tamoxifen and serial ct imaging in the management of patients either at risk of or with early stages of eps. | encapsulating peritoneal sclerosis (eps) is a rare disease in patients who have undergone peritoneal dialysis (pd). we report a case of eps following renal transplantation that highlights important clinical issues. initially, a presumptive diagnosis of eps was made following surgical and pathological findings at the time of cholecystectomy. ct imaging at this time did not confirm the diagnosis. the patient continued pd and commenced tamoxifen. prior to and immediately following transplantation, further ct imaging demonstrated no evidence of eps. acute bowel obstruction occurred 5 months post - transplantation and a diagnosis of eps was made both clinically and on ct imaging, despite immunosuppression and tamoxifen. the role of these therapies in managing eps post - transplant is discussed, in addition to the need for a high index of clinical suspicion to make the diagnosis. |
reactive lesions are characterized as excessive proliferation of connective tissue as a response to chronic irritation. among these types of lesions, those seen in the oral cavity include pyogenic granuloma (pg), peripheral fibroma, fibroepithelial hyperplasia, peripheral ossifying fibroma, and peripheral giant - cell granuloma (pgcg). pg and pgcg appear to be the ones commonly associated with implants, as in the past few years multiple case reports have been published [1, 2 ]. pg is defined as an inflammatory hyperplasia that usually appears as a response to irritants, trauma, hormonal changes, or certain medications [3, 4 ]. although classically it is called pg, a more correct name would be focal epithelial hyperplasia since the lesion is not strictly a granuloma or an infection [3, 4 ]. peripheral giant - cell granuloma (pgcg) is considered a reactive hyperplastic lesion, although its etiology is not entirely known. it is believed that its pathogenesis includes an excessive activation of osteoclasts, which is associated with a proliferation of macrophages, and possibly causes major bone resorption [2, 5 ]. pg is more frequent in women in their 20s, with a ratio of 3 : 2. in 75% of cases it occurs in keratinized gingiva, with location in order of frequency of tongue, lips, and then buccal mucosa [3, 4 ]. it is more common in the maxilla than in the mandible and in anterior as opposed to posterior areas. in contrast, pgcg usually appears in patients who are between their 40s and 60s, and it is slightly more frequent in women and tends to appear more often in the mandible than in the maxilla (table 1) [4, 5 ]. the treatment of these lesions generally involves eliminating the irritating factors as well as performing surgical removal [1, 2 ]. commonly associated with periodontal disease, where calculus is the irritating factor, surgical removal along with nonsurgical debridement is well described in the literature. implant rehabilitation has become more common in the last decade and several factors have been studied which could interfere with osteointegration and longevity. factors such as smoking, diabetes, and periodontal disease have been studied [711 ]. however, with regard to reactive lesions such as pg and pgcg there is no clear pathway for intervention or treatment to manage these lesions and maintain healthy tissue around the implants. the aim of this paper is to demonstrate the successful management of cases of pg and pgcg associated with implants and to review the literature for the various treatment options. to collect all relevant information about previous published treatments for pg and pgcg involving implants, the authors carried out an electronic search from to january 2000 to june 2015 (pubmed central, national library of medicine 's medline, scielo, scopus, and cochrane library) for reactive lesions related to implants (key words : granuloma, oral, and implants). these articles were obtained, and a hand search of their bibliographies identified any pertinent secondary references. the inclusion criteria included clinical trials, cohort studies, case - controlled studies, case series, and case reports, published in english, portuguese, french, and spanish, which included a clear description of the treatment employed. the search was limited to human studies and all articles which did not fit into the criteria were excluded. the full papers and abstracts identified through the search were independently reviewed by all authors (ejn, ra, afm, bgm, aed, and jll) for inclusion in this systematic review. if there was insufficient information provided in the abstract or if there was a disagreement between reviewers, the authors reviewed the full text before reaching consensus through discussion. the following data were collected : study year, gender, age, location of the implant / pg / pgcg, treatment used, relapse, follow - up, and histopathology (table 2). the author (jll) prepared data extraction tables and all authors contributed to summary reports of the selected journal articles and review of the literature. the case reports protocol was carried out with patient informed consent following guidelines according to the helsinki declaration of 1975, as revised in 2000. from the 55 articles initially selected, 39 studies were excluded as they were related to teeth or not directly related to implants. all 16 articles selected were case reports ; these ranged from reports of a single case to articles describing up to a maximum of 3 cases, such that a total of 21 patients were reported. of these there were 15 cases of pgcg [2, 5, 916, 21 ] and 6 of pg [4, 14, 1720 ] (table 2). as no experimental or observational studies were identified the authors agreed that it would not be reasonable to critically appraise the quality of the studies and consequently the results are presented from a review perspective. 1) while pg was seen more commonly in males (2 : 1) (table 2). the average age of the population who suffered pgcg was 49.6 the majority of published cases of pgcg associated with implants had suffered bone loss around the implant [2, 5, 1115 ], as only 4 of the published cases of pgcg did not experience bone loss [9, 10, 12, 21 ] (26.7%). on the other hand bone loss did not occur in cases of pg [4, 14, 1720 ]. the six cases of pg were treated with excision of the lesion and curettage, though one case involved excision with er - yag laser. the cases of pgcg were treated with a number of different strategies. in all of the cases the lesion was surgically removed, but in addition to this, in nine cases curettage was also performed [2, 4, 8, 9, 11, 14, 21 ], in two cases the prosthesis was replaced [10, 11 ], in one case the prostheses were temporarily removed, in another case a graft was performed, and in four cases the implant was explanted [2, 5, 12 ] (table 2). three of these were treated with excision and curettage only [2, 9, 12 ], while the other 3 also underwent explantation [2, 8, 12 ] (table 2). in fact, from the ones that underwent explantation, one had a pgcg with 8 times of recurrence and the other case which had three times was treated with curettage. a 52-year - old male came for consultation reporting two swellings intraorally adjacent to implants that had been placed three years earlier. these lesions had developed over 6 months and were not painful but did bleed on brushing. with regard to his medical history, of interest, he was diagnosed with antiphospholipid syndrome in 2001 and suffered an acute myocardial infarction in august 2011. he also suffered from focal segmental glomerulosclerosis and chronic kidney failure since 2010 but did not require hemodialysis and could be linked to systemic lupus erythematosus. with respect to his dental history, he suffered from advanced chronic generalized periodontal disease and had plaque and calculus deposits both supra- and subgingivally. due to his advanced periodontal disease the remaining upper and lower teeth had been splinted two years earlier. the patient 's regular medicines included 4 mg acenocoumarol, 100 mg acetylsalicylic acid, pantoprazole 40 mg (proton pump inhibitors), atorvastatin 40 mg (hmg - coa reductase inhibitors), amlodipine (calcium channel blockers), bisoprolol 5 mg (beta - blocker), and 360 mg mycophenolic acid. oral examination revealed two nodular erythematous sessile lumps of 1.5 cm diameter, with elastic consistency and granulomatous appearance. they were associated with the gingiva, located on the buccal and palatal / lingual sides of implants 3.6, 1.6, and 1.7 (figure 1). radiographic investigation revealed 5 mm of peri - implant bone loss associated with both lesions. an excisional biopsy was performed along with curettage and irrigation with chlorhexidine 0.5% of both the surgical site and the exposed implant threads. the microscopic description was that of ulcerated lesions covered by a fibrin and leukocyte membrane and made up of granulation tissue with a mixed inflammatory infiltrate with polymorphonuclears, together with vascular proliferation (figure 2). squamous epithelium with parakeratosis, dyskeratosis, acanthosis, and elongation of the epithelial peaks was observed at the far extremes. the results were compatible with a diagnosis of pyogenic granuloma, without any suggestion of malignancy. postoperatively there were no further issues and there was no evidence of relapse at 12-month follow - up (figure 3). a 64-year - old male came for consultation regarding a 15-day history of an exophytic mass associated with the buccal marginal gingiva of an implant supported dental prosthesis in the lower right quadrant. the patient 's medical history revealed complete atrioventricular block, coronary atherothrombosis with acute myocardial infarction in 2006, left ventricular dysfunction, pericarditis, and diabetes mellitus type 2. the patient 's regular medicines included carvedilol 6.25 mg, 1/day (beta - blocker), enalapril 5 mg, 1/day (ace inhibitor), furosemide 40 mg, 1/day (sulphonamide), tromalyt 150 mg, 1/a day (acetylsalicylic acid), omeprazole 20 mg, 1/day (proton pump inhibitors), and variable dosage of insulin. with respect to the patient 's dental history, he was partially dentate in the mandible as a result of periodontal disease and had multiple implant supported fixed prostheses, with a total of 10 implants placed 8 years earlier. on examination intraorally there was a swelling of 1 cm diameter on the buccal surface of implant 4.6. the lesion was reddish - purple in color and was well defined with an elastic consistency and an irregular texture. periapical radiograph revealed bone loss of 4 mm affecting both the mesial and distal surfaces of the implant (figure 4). histopathology confirmed that it was an ulcerated peripheral giant - cell granuloma, without suggestion of malignancy (figure 5). histologically it was described as a lesion covered by a parakeratinized stratified squamous epithelium, with areas of atrophy and ulceration in its thickness. a dense proliferation of multinucleated giant cells was dispersed on a stroma of the tissue, which was highly vascularized, with areas of hemorrhage, deposits of hemosiderin, and infiltrate due to accumulation of lymphoplasmacytic inflammatory cells. laboratory tests showed no abnormalities with regard to calcium / phosphate metabolism or parathyroid gland function. treatment involved complete excision of the lesion, curettage of the exposed implant threads, and irrigation with chlorhexidine 0.5%. postoperative healing was good and at 12-month follow - up there was no evidence of recurrence (figure 6). peri - implantitis with progressive bone loss is reported to be the most frequent complication associated with implants. its treatment is challenging and to do so correctly we must identify the pathology leading to peri - implantitis. in our view recognition of the soft tissue pathology by biopsy should be the first step for potential successful treatment. the etiology of these conditions when associated with implants is similar to that which is described when they are associated with teeth, where factors such as trauma, plaque deposits, or chronic infection have a major role. in cases associated with implants, incorrect or inadequate prosthesis (implant cap or healing cap, poorly adjusted suprastructures, etc.) is also considered to be a possible causative factor [2, 9 ]. with regard to inadequate prosthesis, bischof. replaced the prosthesis or temporarily removed the prosthesis, allowing for better plaque control, and they reported no recurrence. another suggested potential cause, although controversial, is that an inflammatory response to titanium may lead to development of granulomas [10, 1215, 22 ]. the clinical presentation and age group of the pg and pgcg cases described appeared to be similar when associated with teeth [2327 ]. our data collection showed pgcg is more frequent in women and in the posterior mandible. one could propose this may be due to greater plaque accumulation posteriorly due to difficult access for thorough oral hygiene. when associated with teeth, pg is also commonly seen in females [1, 2 ]. this is in contrast with our findings which suggest that when associated with implants it is more prevalent in men. nonetheless this may be an inaccurate conclusion and due to the small number of cases reported. in females, it has been suggested that the increase of estrogen and progesterone can influence gingival physiology, enhancing the tissue response to the local microbiota, with a predominance of more pathogenic microorganisms [20, 27, 28 ]. data from the selected articles suggests that bone loss from the implant site is more commonly associated with pgcg [2, 5, 1115 ] than pg. hernndez., cloutier., and bischof. support the hypothesis that bone loss occurs first, exposing the implant collar, which then contributes to irritating factors that lead to pgcg. again this could be related to difficult access for thorough oral hygiene though this may also be due to the greater occlusal load experienced posteriorly, as opposed to that experienced by the anterior teeth [2, 5, 10 ]. the prevalence of recurrence in cases of pg and pgcg is estimated to be 2.98.2% and 511%, respectively, but in cases associated with implants these figures increase [2, 9, 16, 17, 21 ]. recurrence has been reported in 6 of the 15 published cases of pgcg associated with implants (table 2). lester., in a review of 279 cases, noted a total of 10 recurrences on 5 implant cases ; 1 implant case had 2 recurrences, and another case with multiple implants had 8 recurrences. it was noted that while 2 of the 5 implant cases (40%) had multiple recurrences, 6 of 237 non - implant - related cases (2.5%) presented with multiple recurrences too. several possible explanations are considered, such as incomplete excision, but in addition these lesions may have been caused by combination of irritating factors, which therefore makes it challenging to eradicate all possible causes [2, 5, 8 ]. several treatments have been described when treating pg / pgcg when associated with implants, with excision and curettage being the most common. this is consistent with normal convention when these lesions are associated with teeth (being a relatively simple technique and with satisfactory results [1, 2, 9, 10, 12, 25, 26, 29 ]). other options have been described such as the use of er - yag laser or explantation of the implant and the provision of a new prosthesis [10, 11 ] or indeed temporary removal. it is suggested that use of the er - yag laser for granuloma excision offers advantages in comparison to conventional surgery techniques, especially by reducing the risk of bleeding, pain, and postoperative edema and also eliminating the need for sutures at the end of the procedure. given the small number of cases published, it is difficult to evaluate if explantation of the implant affects the number of recurrences or the amount of bone loss. recurrences of pg and pgcg have been described when associated with bad plaque control but also due to hormonal imbalance during pregnancy, especially in pg cases. the authors believe that more aggressive treatments such as explanation can be used as a secondary technique, only after excision and curettage have failed as explantation could be beneficial in improving plaque control and consequently reduce the number of relapses and amount of bone loss. the use of antimicrobials such as chlorhexidine, as described in our cases, is reported to offer improved plaque control in the treatment of peri - implantitis. in conclusion, we believe the primary approach to manage these two soft tissue conditions should be excisional biopsy and subsequent histopathology. the authors believe oral hygiene instruction should be one of the first steps in management as good plaque control could help reduce number of recurrences. this review of the literature highlights that histopathological diagnosis is important, as if pgcg is diagnosed histologically, then the clinician will be aware of a higher risk of bone loss and higher rate of recurrence. however, we recognize the limitations of this analysis due to the limited number of case reports published and consequently these conclusions should be interpreted with caution. further cohort studies with representative sample sizes, control group, and standard outcome measures are necessary. | introduction. pyogenic granuloma (pg) and peripheral giant - cell granuloma (pgcg) are two of the most common inflammatory lesions associated with implants ; however, there is no established pathway for treatment of these conditions. this paper aims to illustrate the successful treatment of pg and pgcg and also report a systematic review of the literature regarding the various treatments proposed. methods. to collect relevant information about previous treatments for pg and pgcg involving implants we carried out electronic searches of publications with the key words granuloma, oral, and implants from the last 15 years on the databases pubmed, national library of medicine 's medline, scielo, scopus, and cochrane library. results. from the electronic search 16 case reports were found showing excision and curettage as the main successful treatment. as no clinical trials or observational studies were identified the authors agreed to present results from a review perspective. conclusion. this is the largest analysis of pg and pgcg associated with implants published to date. our review would suggest that pgcg associated with implants appears to have a more aggressive nature ; however the level of evidence is very limited. further cohort studies with representative sample sizes and standard outcome measures are necessary for better understanding of these conditions. |
a 34-year - old woman presented acute subarachnoid hemorrhage (hunt and hess grade 2) with severe headache. left vertebral artery angiography demonstrated a 2.5 mm sized left side sca aneurysm with a narrow neck (fig. 1a). under general anesthesia, we coiled this aneurysm by using a 2 mm4 cm microplex hypersoft coil v - trak system (microvention, california, usa) (fig. the most proximal part of the detachment zone protruded minimally into the basilar artery (ba) after detachment (fig. we performed follow - up fluoroscopy of coil mass to check out coil stability for 2 postoperative days (pods), and there was no significant change of coil mesh (fig. 1d). in the ninth pod, she complained newly developed headache and dizziness. magnetic resonance imaging revealed a small size acute infarction in the left side sca territory, but there is no evidence of recanalization of the aneurysm or recurred subarachnoid hemorrhage. left side sca was intact on mr angiography (mra), however, fluoroscopy revealed unraveling of proximal coil loop and herniation into the ba (fig. 1e). herniated coil loop and remaining coil mesh were pulsating together with arterial pulsation. we initially considered stent placement to trap the coil loop, but decided to wait because she was stable and ba and its branches were intact on mra. oral aspirin 100 mg per day was given. during following three days, we repeated fluoroscopy and ascertained no further herniation of the coil loop. the shape of the herniated coil loop was changed and the herniated coil was spontaneously repositioned into the probable left side sca on fluoroscopy (fig. we confirmed no change in configuration of the herniated coil loop on follow - up fluoroscopy during 3 months, and we performed mra in the 90th pod. the previous infarction was resolved and there was no evidence of recanalization or sca occlusion. coil loop herniation into the parent artery is an uncommon complication of aneurysm embolization, and the incidence was 2.4 - 4.2% in previous reports (1, 2). the mechanism of coil herniation appeared to be coil instability after detachment and excessive embolization (2). contrarily, minimal protrusion of the coil 's detachment zone into the parent artery may occur not infrequently during embolization, and this situation can be managed uneventfully with or without anti - platelet treatment. in our institution, we usually check follow - up fluoroscopy during two pods in this situation. in our case, we could not indicate exactly the day when unraveling of coil developed, but probably it might occur near to ninth pod when the patient complained new headache and dizziness. delayed unraveling and herniation of coil loop was reported previously (3). in our case, it was difficult to insert last coil loop into aneurysm sac and we remained short detachment zone within the lumen of parent artery. this configuration is usually stable, but it may cause adverse consequence like our case. so - called ' stored tension ' (3) in last coil loop might cause delayed unraveling. in our opinion, if minimal protrusion of the detach - zone into the parent artery is present, we should consider the possibility of delayed herniation of coil loop, and follow - up fluoroscopy for the evaluation of coil mesh may be necessary during minimum two postoperative weeks. managements of coil herniation after detachment are controversial and include removal by using a snare (4), repositioning by using balloon (5), or trapping of coil by using stent placement (2, 6 - 8). occasionally, coil herniation is left in the lumen of parent artery with or without anti - platelet treatment if herniated coil aligns along the parent arterial wall or only a small closed loop is herniated (4). there was no systematic analysis about the fate and risky configuration of herniated coil loops in the parent arterial lumen. only a suggestion was presented that herniated coil with a free end pulsating in the direction of blood flow may be a risky configuration (4). in our case first, we might be able to remove the coil mesh by using a snare, but we should consider the state of the coil mesh with abundant thrombus and possible thromboembolism. we can stabilize the herniated coil loop along the wall of ba by the stent deployment ; however, we should consider the procedure related complication and delayed in - stent stenosis (8). because she was stable and relatively young, we deferred stent placement. in our opinion, the herniated coil loop may be affected by hemodynamics of the parent artery and coil 's tendency toward its natural loop shape. in our case, this restoration tendency made the last stable configuration of the herniated loop. in our opinion, follow - up fluoroscopy with anti - platelet medication may be another option and guide proper decision for management of this situation. in conclusion, minimal coil protrusion into the parent artery may undergo delayed further unraveling and herniation of a coil loop, and the shape of the herniated coil can be changed to favorable configuration. when we consider management of this condition, follow - up fluoroscopy may be helpful, and conservative management with anti - platelet medication may be one of the options of various treatments. | herniation of coil loops into the parent artery is one of the complications of endovascular embolization with detachable coils. in this clinical setting, we can not predict the consequence of the herniated coil loop. we report an unusual case of a superior cerebellar artery (sca) aneurysm with delayed coil herniation into the basilar artery and spontaneous reposition into the sca. |
we approached the psychiatric nurses working in two major tertiary psychiatric centers in india for participation in the study. to be included in the study, participants needed to be psychologically healthy, which was determined by a score of less than two on general health questionnaire, version 12 (ghq-12). a total of 101 staff nurses fulfilled the inclusion criterion and also consented for the study. all the participants filled up a sociodemographic information sheet and the following self - rating questionnaires. it is used to analyze and report individual differences in adjustment, and point out specific problem areas. it measures adjustment in six areas : family, health, social, emotional, occupational, and sexual adjustment. emotional maturity scale measures a construct of emotional maturity by the following components : emotional instability (inability to dispose of problems, need for constant help, stubbornness, temper tantrums), emotional regression (feeling of inferiority, aggression, restlessness and self - centeredness), social maladjustment (lack of social adaptability), personality disintegration (pessimism, reaction formation, rationalization), and lack of independence. higher the mean score on the scale, greater the degree of emotional immaturity and vice versa. the scale enjoys a good reliability coefficient using both test - retest and internal consistency methods. pgi general well - being scale is a 20-item questionnaire measuring how much the respondent has a sense of general physical well - being. it deals with various aspects of well - being such as worry, distress, life satisfaction, control, etc. locus of control scale is a 36-item self rating questionnaire measuring locus of control. the higher a person 's score in this scale, the more internally oriented the individual will be. the scale is highly reliable and valid having reliability coefficient of 0.55 and coefficient of temporal stability of 0.76. all the above scales were selected as they have been developed and standardized on indian population and have proven reliability and validity. as these scales are in hindi, they could be easily administered in the study population. the cbi is a public domain questionnaire measuring the degree of physical and psychological fatigue experienced in three subdimensions of burnout : personal, work - related, and client - related burnout. the cbi had acceptable reliability (internal consistency and homogeneity) as well as factorial and criterion - related validity. correlations between total burnout score and different sociodemographic and clinical variables were examined using pearson 's r for continuous variables and spearman 's rho for categorical variables. variables which had significant correlation were entered as independent variables in a multiple linear regression analysis. stepwise method was chosen as we did not have any past research data in this regard to base our model. it is used to analyze and report individual differences in adjustment, and point out specific problem areas. it measures adjustment in six areas : family, health, social, emotional, occupational, and sexual adjustment. emotional maturity scale measures a construct of emotional maturity by the following components : emotional instability (inability to dispose of problems, need for constant help, stubbornness, temper tantrums), emotional regression (feeling of inferiority, aggression, restlessness and self - centeredness), social maladjustment (lack of social adaptability), personality disintegration (pessimism, reaction formation, rationalization), and lack of independence. higher the mean score on the scale, greater the degree of emotional immaturity and vice versa. the scale enjoys a good reliability coefficient using both test - retest and internal consistency methods. pgi general well - being scale is a 20-item questionnaire measuring how much the respondent has a sense of general physical well - being. it deals with various aspects of well - being such as worry, distress, life satisfaction, control, etc. locus of control scale is a 36-item self rating questionnaire measuring locus of control. the higher a person 's score in this scale, the more internally oriented the individual will be. the scale is highly reliable and valid having reliability coefficient of 0.55 and coefficient of temporal stability of 0.76. all the above scales were selected as they have been developed and standardized on indian population and have proven reliability and validity. as these scales are in hindi, they could be easily administered in the study population. the cbi is a public domain questionnaire measuring the degree of physical and psychological fatigue experienced in three subdimensions of burnout : personal, work - related, and client - related burnout. the cbi had acceptable reliability (internal consistency and homogeneity) as well as factorial and criterion - related validity. correlations between total burnout score and different sociodemographic and clinical variables were examined using pearson 's r for continuous variables and spearman 's rho for categorical variables. variables which had significant correlation were entered as independent variables in a multiple linear regression analysis. stepwise method was chosen as we did not have any past research data in this regard to base our model. majority were female (n = 85 ; 84.2%), married (n = 94 ; 93.1%), and from tribal background (n = 71 ; 70.3%). thirty - six participants (35.6%) hailed from joint family, 61 (60.4%) from nuclear family, and four (4%) were living alone. sixty - six (65.3%) were christian, 29 (28.7%) hindus, three (3%) muslims, and three (3%) were from other religious background. participants had an average 20.79 8.21 years experience in nursing of which 15.19 9.00 years were spent in psychiatric nursing. they had 13.23 2.32 years of education of which 50 persons (49.01%) had a postgraduate diploma in psychiatric nursing. average income of the participants was indian rupees (inr) 14858.65 3654.08 per month. out of total 17 male participants, 14 (13.9%) were ex - servicemen. age, duration of total period of nursing, duration of army service, locus of control, sense of general well - being, adjustment, and emotional maturity had significant correlation with total burnout [table 1 ] while qualification, marital status and family status dis not have a significant correlation [table 2 ]. pearson 's correlation : burnout and continuous predictor variables spearman 's correlation : burnout and discrete predictor variables these variables were then included as independent variables in a stepwise multivariate regression analysis. r value implied that 43.9% of total variance in burnout in sample population was explained by the model. adjusted r value implied if this model was applied in psychiatric nursing population in general, still it would be able to explain about 41.5% of variance in total burnout scores. durbin - watson value implied that assumption of independent errors was satisfied [table 3 ]. emotional maturity, adjustment, duration of prior army service, and sense of general well - being were significant predictors of burnout score in decreasing order of significance. among the predictors, emotional maturity explained 31%, adjustment capacity 6.8%, army service 3.7%, and sense of well - being explained 2.4% of variance in total burnout scores. variation inflation factor (vif) and tolerance value confirmed that there was little collinearity among the predictors in the model [table 4 ]. zpred (x - axis) zresid (y - axis) histogram and scatterplot were drawn [figures 1 and 2 ]. these showed that the residuals are normally distributed and assumptions of linearity and homoscedasticity were satisfied. fulfilling these assumptions indicated that we can generalize the findings from this study in any similar indian psychiatric nursing population. model summary : multiple regression analysis normal plot of regression standardized residuals scatterplot of residuals and predicted values in the recent past, several asian studies have focused on burnout syndrome in nurses. compared with the prior studies of hospital staffs in other countries, doctors and nurses in mongolia had relatively higher burnout rates. emergency and surgical nurses appear to perceive higher levels of stress than ward- and clinic - based nurses. the most stressful situations for singaporean nurses were patient - related difficulties and conflicts with colleagues. organizational issues, such as lack of participation in planning and difficulty in making changes also contributed to work stress experienced by nurses. they also felt vulnerable to stress arising from the interface of work and family commitments. iranian nurses also reported perceived work dissatisfaction and health threats, and disequilibrium between family and work demands. psychiatric nurses in iran experienced a significantly greater degree of emotional exhaustion than the medical nurses. significant positive correlation was noted between ages, years of experience, frequency of on - calls, and emotional exhaustion for the psychiatric nurses. frequency of on - calls was also significantly associated with a sense of non - accomplishment. longer duration of service was accompanied by higher degree of emotional depersonalization for medical nurses. high scores in emotional tiredness correlated with depression and with personal difficulties. in saudi arabia, the prevalence of burnout syndrome among multinational nurses was high. frequency of depersonalization was 42%, whereas 45% had high emotional exhaustion and 71.5% had a sense of low personal accomplishment. the nurses in the patients wards and clinics were more emotionally exhausted with higher depersonalization. most of the above studies focused on external causes of burnout like organizational variables and interpersonal and emotional interactions at work. in the present study ; it was found that internal factors like emotional maturity, adjustment capability, sense of well - being as well as prior military training explained more than 41% variation in total burnout score ; which was significant at 0.001 level. there have to be some intrinsic variables as revealed in our study. among these predictors, the emotional immaturity construct as measured by emotional maturity scale in this study implied that persons who experienced high burnout were emotionally unstable, vulnerable to emotional regression, and personality disintegration had social maladjustment and suffered from lack of independence. in a way this is consistent with earlier reports that burnout in nurses was associated with more psychosomatic symptoms, more medication use, lower levels of positive affect, and less life satisfaction. further, a recent study has reported that a mindfulness course improved well - being and decreased burnout among healthcare providers in australia. burnout also appears to be related with inability to adjust with surrounding environment, as evidenced by significant prediction by adjustment score. indeed, persons who experienced burnout had poor adjustment in their family, society, health - related matters, and even in sexual life. it appears that poor adjustment skills along with poor management of emotions were sure recipe of burnout. previous studies also found that problematic relationships among team members increased burnout. verbal abuse from physicians was noted to be stressful for staff nurses. in a study of 260 registered nurses (rns), conflict with physicians however, a study exploring verbal abuse among 213 nursing personnel (95% rns) found the most frequent source of abuse was other nurses (27%), families were the second most frequent source of abuse (25%), while physicians ranked third (22%). this finding underlines the importance of good adjustment in work and home for reducing burnout. interestingly, prior military training prevented burnout in nursing personnel. this may be related to the inherent discipline and adaptation to challenges in army service. also, a sense of general physical well - being prevented burnout. may be such a feeling led to less chance of emotional exhaustion. interestingly all participants were free of any comorbid mental disorder as screened by ghq-12 which means there was no confounding effect of psychiatric morbidity among participants. individuals with an internal locus of control define stressors as controllable and are more likely to attempt to cope with them through problem focused action, and thereby do not suffer burnout. however, internal locus of control failed to predict burnout in the regression analysis. similarly in an earlier study, external locus of control had demonstrated a positive relationship with burnout. overall, this study has some valuable implications for psychiatric nursing as well as other mental health professionals. predictors of burnout such as emotional maturity, locus of control, general well - being, and adjustment may be modulated by proper training and therapeutic programs to promote positive mental health in mental health professionals. further, this study indicates that some people may be particularly prone to burnout than others. as, burnout leads to decrease in quality of care and in turn, financial loss for organizations, recruitment policy may be suitably tailored to identify personnel with low propensity to burn out. an important limitation of the present study was that the two hospitals were located at the same place. emotional maturity, adjustability, sense of general physical well - being as well as prior military training significantly predicted lower burnout. | background : research has not adequately focused on the issue of burnout in psychiatric nurses, despite the fact that they suffer considerable stress in their work. till date no study has been conducted on burnout among psychiatric nurses in india. further, there is a particular lack of research in internal variables predicting burnout in them.aims:to determine whether there are any internal psychological factors relevant to burnout in psychiatric nurses in india.materials and methods : we recruited 101 psychiatric nurses scoring less than two in general health questionnaire, version 12 (ghq-12) from two psychiatric hospitals after obtaining informed consent. all subjects filled up a sociodemographic data with global adjustment scale, emotional maturity scale, pgi general well - being scale, locus of control scale, and copenhagen burnout inventory (cbi). correlations between burnout and sociodemographic / clinical variables were done by pearson 's r or spearman 's rho. signi ficant variables were entered in a stepwise multiple linear regression analysis with total burnout score as dependent variable.results:age, duration of total period of nursing, prior military training, locus of control, sense of general well - being, adjustment capabilities, and emotional maturity had significant relation with burnout. of them, emotional maturity was the most significant protective factors against burnout along with adjustment capabilities, sense of physical well - being, and military training in decreasing significance. together they explained 41% variation in total burnout score which is significant at < 0.001 level. an internal locus of control was inversely correlated with burnout, but failed to predict it in regression analysis.conclusion:emotional maturity, adjustability, sense of general physical well - being as well as prior military training significantly predicted lower burnout. of them, emotional maturity was the most important predictor. internal locus of control was also correlated with lower burnout. |
deep brain stimulation (dbs), arguably, is the most dramatic development in the treatment of movement disorders since the use levodopa for parkinson s disease. when viewed from the more appropriate perspective of symptomatic rather than disease specific treatments, there does not appear to be any movement disorder that could not benefit.1 the indications are limited only by the co - morbidities that constrain the impact of dbs on quality of life and increase the risk of surgical complications. dbs is more effective than the best application of medications and for some conditions, the only effective treatment. further, dbs for movement disorders is the prototype from which dbs is being extended to other neurological and psychiatric disorders. but perhaps what is most remarkable is what is below the surface appearance in the clinical responses. until dbs, most treatments have focused on affecting dopamine receptors and more rarely on cholinergic receptors. to be sure there has been interest in the n - methyl - d - aspartate receptors but primarily as a means to improve dyskinesias secondary to long - term levodopa and dopaminergic medications. although one could argue that ultimately electrical activity is mediated through chemical neurotransmitter interactions with receptors, this is but a small component and is tantamount to saying that computers require electrons. this is true but only in the philosophical sense of trivially true, which means the statement does not perform any intellectual work such as contributing to a complete understanding. to equate the neurophysiology and pathophysiology of the basal ganglia - thalamic - cortical system with the actions of neurotransmitters is to ignore the immense computational power of electrically mediated interactions in the neuronal membrane particularly as they relate to information processing. dbs and related research provided and continues to provide opportunities to directly test theories of basal ganglia physiology and pathophysiology, an opportunity insufficiently taken advantaged of. already, observations obtained from dbs - related research demonstrate that current theories are wrong to the point where total rejection, rather than continual attempts at modification, is necessary. however, how to develop new hypotheses and theories is not clear. in one sense, a good place to start is where and how the current theories came to be wrong. while this approach would seem reasonable there are numerous obstacles philosophically2 and psychologically.3 never the less, the approach is important to attempt. the development of any new theory will be aided by an understanding of how current theories are wrong and why have these flawed theories persist. many of the problems of current theories are more matters of reasoning, those being inference, assumptions, presumptions, and the accepted level of ambiguity, than flaws of fact. just as the inappropriate use of a tool or method is grounds for criticism, methods of reasoning are tools that can be used inappropriately and should be subject to discussion just as misuse of any other tool. thorough criticism can provide very important lesions though the process could be mistaken as harsh or personal ; neither is the case here. at the least, such analyzes can point to potential pitfalls that could be avoided in the development of new theories. as will be discussed, theories are important for the development of therapies but perhaps most important, for the acceptance of new therapies, as was the case for the recent resurgence of interest in surgical therapies. the current state of understanding, or theory, regarding the pathophysiology and physiology of the basal ganglia, particularly as it relates to the clinical phenomenology of movement disorders, is in a state of disarray ; even if many physicians and scientists do not perceive this. note this statement is not a value judgment of any individual but reflects the current process of gaining scientific understanding in this field. also this statement does not say that there have not been any advances in scientific facts or technological improvements. indeed, there have been a remarkable explosion in scientific and technological advances ; however, generally they represent incremental increases of a kind within the current state of knowledge. the scientific and technological advances were either serendipitous or merely incremental interpolations within the same conceptual framework. the latter is due to the fact that the current conceptual framework generates the hypotheses and at the same time becomes the basis for interpreting the very observations that are meant to be tests of the hypotheses. most recent theories of basal ganglia physiology and pathophysiology may have internal validity but this does not vouchsafe external validity or validity in the real world. but even granting some internal validity, it is at the expense of any claim to intellectual rigor. those claims of rigor are given up when there is an arbitrary selectivity in what constitutes valid evidence. in other words, too often, current theories survive only when contravening observations are ignored. what is addressed in this review what is meant by state of understanding is the conceptual framework or theory that provides a context for the scientific facts and provides a trajectory to gaining new facts. progress will only be made outside the current conceptual framework that, necessarily, means a rejection of the current framework. these are bold, and perhaps brash statements but if the author is only partially correct, then the future of scientific understanding of the physiology and pathophysiology that underlie the clinical phenomenology is in doubt and at risk. even if it is only partially true that future therapeutic advances depend on scientific advances, then physicians must insist on a critical, rigorous, and deep reappraisal of current conceptual approaches. it will be insufficient to merely state that the current theories of basal ganglia physiology and pathophysiology are wrong ; it will be necessary to examine how they came to be wrong in the first place. this article can not hope to be a complete and exhaustive reappraisal but it can provide a survey of the various issues, problems, and possible alternatives. the archetypical theory under analysis is the globus pallidus interna rate theory that posits over - activity of the globus pallidus interna as causal to hypokinetic disorders such as parkinson s disease. similarly, the theory also posits that under - activity of the globus pallidus interna results in hyperkinetic disorders such as ballism and huntington s disease. in the case of hypokinetic disorders associated with degeneration of dopaminergic neurons of the substantia nigra pars compacta, the loss of dopaminergic inhibition of striatal neurons that project to the globus pallidus externa (called the indirect pathway) is posited to result in increased activity of these striatal neurons. as these particular striatal neurons are inhibitory onto neurons of the globus pallidus externa, there is a reduction of neuronal activity within the globus pallidus externa. as the globus pallidus externa is thought to be inhibitory onto neurons of the subthalamic nucleus and globus pallidus interna, the reduction in activity of the globus pallidus externa results in increased neuronal activity in the subthalamic nucleus and globus pallidus interna. the increased activity in the subthalamic nucleus increases the activity of the globus pallidus interna as the subthalamic nucleus is thought to be excitatory onto the globus pallidus interna. similarly, loss of excitatory dopaminergic input onto the striatal neurons that project to the globus pallidus interna (called the direct pathway) results in decrease in the activity of these striatal neurons causing a loss of these striatal neuronal inhibition onto the globus pallidus interna. the net result is further increase in the activity of globus pallidus interna neuronal activities. the net result of changes in neuronal activities in both the direct and indirect pathways is increased activity of the globus pallidus, which is theorized to be inhibitory onto neurons of the ventrolateral thalamus. the consequence is reduced activity within the ventrolateral thalamic - motor cortical system that results in decrease activity within the motor cortex and the hypokinetic symptoms of parkinson s disease. the globus pallidus interna rate theory is wrong for a great number of reasons (described elsewhere4). they are briefly summarized here in historical order to demonstrate that there has been counter evidence of long standing which raises serious questions about why the globus pallidus interna rate theory survived and continues to survive to this day. first, evidence is presented that over - activity of the globus pallidus interna is not a necessary condition for parkinsonism as parkinsonism can exist without increased globus pallidus interna neuronal activity. since 1979, induction of parkinsonism in non - human primates using dopamine antagonists and electrolytic lesions of the nigro - striatal pathway had not been associated with increased neuronal activity in the globus pallidus interna.5 in 1979, it was reported that globus pallidus interna neuronal activities initially were increased in non - human primates following induction of parkinsonism using n - methyl-4-phenyl-1, 2, 3, 6-tetrahydropyridine (mptp), but the neuronal activities tended towards normal rates following mptp while the animals were, presumably, still parkinsonian.6 since 1986, careful induction of parkinsonism in non - human primates with mptp did not produce changes in neuronal activities of the striatum, globus pallidus externa or ventrolateral thalamus as predicted by the globus pallidus interna rate theory.7 these observations were extended to the globus pallidus interna and reported in 2009.8 since 1989, recordings of neuronal activity in the motor cortex and supplementary motor area demonstrate no changes in baseline or resting neuronal activities following induction of parkinsonism using mptp.911 recordings of neuronal activity in the subthalamic nucleus of patients with parkinson s disease and patients with epilepsy in 2006 demonstrate no change in mean discharge frequencies or in the variability (coefficient of variation) in the discharge rate. further, the neuronal spike trains of both patients demonstrated the same random poison process.12 similarly, there is considerable evidence that over - activity of the globus pallidus interna neurons is not a necessary condition. in other words, it is possible to increase the activity of globus pallidus interna neurons without causing parkinsonism. dbs of the globus pallidus interna in non - human primates, of the type found therapeutic in humans, drives the output of the globus pallidus interna.1 dbs of the subthalamic nucleus in non - human primates and humans with parkinson s disease, of the type found therapeutic in humans, drives the output of the globus pallidus interna.24 dbs of the globus pallidus interna in humans drives the output of the globus pallidus interna as evidenced by recordings of ventrolateral thalamic neuronal recordings during globus pallidus interna dbs and yet the patient was not made parkinsonian.5 dbs of the subthalamic nucleus on one side of the brain causes increased neuronal activities in the contralateral subthalamic nucleus and yet, the parkinsonian symptoms ipsilateral to the stimulation in patients are improved and not worsened as would be expected from the globus pallidus interna rate theory.6 preliminary studies of dbs of the globus pallidus interna on one side of the brain causes increased neuronal activities in the contralateral globus pallidus interna and yet, the parkinsonian symptoms ipsilateral to the stimulation in patients are improved and not worsened as would be expected from the globus pallidus interna rate (montgomery jr. eb, walker hc and watts rl, 2009 unpublished observations). over - activity of the globus pallidus interna is neither necessary nor sufficient for the production of parkinsonism and consequently ; thus, it is highly unlikely that over - activity of the globus pallidus interna is causal to hypokinetic syndromes such as parkinson s disease. similarly, there is evidence against the notion that under - activity of the globus pallidus interna is causal to hyperkinetic disorders such as huntington s disease, levodopa - induced dyskinesia or dystonia. the most compelling evidence is the improvement in hyperkinetic disorders by surgical ablation of the globus pallidus interna (pallodotomy). yet despite the robust contravening scientific observations, the globus pallidus interna rate theory still is championed, though in the guise of increased anatomical complexity, with only at most, most indirect and causal nod to dissenting opinions related to the neuronal pathophysiology.7,8 there is evidence demonstrating an association of over - activity of the globus pallidus interna and subthalamic nucleus such as following induction of parkinsonism using mptp in laboratory animals. however, the fact that careful titration of mptp produces parkinsonism in non - human primates that does not produce over - activity strongly suggests that those studies demonstrating increased neuronal activity within the globus pallidus interna may have used excessive mptp which affects not only the dopaminergic neurons.9 to be sure, there have been many more articles published demonstrating increased globus pallidus interna activity associated with mptp - parkinsonism than publications demonstrating no increase in neuronal activity, but scientific (and logical) validity is not a matter of majority vote. there are countless more observations of the sun moving above the earth than there are observations of the earth moving around the sun. in the process of logical or scientific induction it is important to understand nature of robustness in multiple lines of converging evidence. in an exchange of letters to the editors regarding this issue 2009, montgomery pointed to microelectrode recordings of subthalamic nucleus neurons in subjects with epilepsy and parkinson s disease and noted no difference in discharge frequency or variability of discharge rate in direct contradiction to the globus pallidus interna rate theory.10 in a counter argument, obeso and olanow11 cited the plethora of studies supporting the notion that the globus pallidus interna and subthalamic nuclues is overactive. these included recordings of neuronal activities in the mptp- and 6-hydroxydopamine (6-ohda)-parkinsonian laboratory animals. obeso and olanow go on to site changes in cytochrome oxidase and glutamic acid decarboxylase imunostaining and in situ hybridization, 2-deoxyglucose uptake in parkinsonian human and laboratory animals, and c - h2o positron emission tomography showing hypoactivity of motor cortical areas in patients with parkinson s disease which was reversed by pallidotomy. first, obeso and olanow appeal to the notion of robustness of the multiple types of data, such as the enzymatic, glucose, and blood flow changes, as significant support for the claim of over - activity of the globus pallidus. however, such evidentiary robustness depends on the independence of the various claims.12 thus, a multitude of ways to look at the same metabolic changes does not constitute a multitude of independent corroborations. thus, the multiple claims related to metabolic and enzymatic changes do not increase the robustness of the claims in support of the over - activity of the globus pallidus interna. the second issue is whether enzymatic and metabolic changes trump direct microelectrode recordings regarding the claim of increased neuronal activity of the globus pallidus interna. there is considerable evidence that inferences drawn from neurometabolic changes are highly problematic and do not necessarily correlate with specific aspects of neuronal electrical activity.13 indeed, recordings of neuronal activities in the basal ganglia of non - human primates made parkinsonian by careful titration of mptp and 2-deoxylglucose autoradiography demonstrated robust changes in glucose utilization in the same animals that did not have any changes in baseline neuronal activities.14 this places further doubt on the reasonableness of using neurometabolic inferences to neuronal activities to trump direct recordings of neuronal activities. there is a human inclination to disregard contrary observations. perhaps to circumvent the difficulty of allowing neurometabolic and enzymatic changes to trump direct neuronal recordings, obeso and olanow wrote although we do not question his findings, it should be noted that his is the only report we are aware of indicating that subthalamic nucleus firing rate is as low as 7.5 hz in pd, and contrasts with multiple reports of greater firing rates (approximately 30 hz) in the subthalamic nucleus of patients with pd. indeed, we wonder if the low subthalamic nucleus firing frequencies that montgomery reported were derived from non - movement - related neurons in the ventral subthalamic nucleus, which typically have a lower firing frequency than those in the dorsolateral motor region. what obeso and olanow failed to note was that in the report by montgomery15 it was clearly stated that the neurons analyzed demonstrated sensory - motor driving consistent with these neurons being the relevant neurons and further and that the differences likely were related to different methods of neuronal spike detection which was applied to both subjects with parkinson s disease and epilepsy. thus, any systematic bias resulting from the different method would apply to both subjects and would not account for the lack of difference. another striking example was the early studies on the effects of the neurotoxin, mptp on neuronal activity in the globus pallidus interna. filion and colleagues were one of the first to demonstrate that mptp - parkinsonism in the non - human primate was associated with increased neuronal discharge rate in the globus pallidus interna. it is now known that this is not the case necessarily, and may reflect excessive doses of mptp. the striking aspect is that filion and colleagues earlier studied the effects of parkinsonism caused by neuroleptic medications, that is drug - induced parkinsonism, and parkinsonism caused by lesions of the dopaminergic nigro - striatal pathway. they found no increases in the neuronal discharge frequency in the globus pallidus interna in these parkinsonian non - human primates. the absence of changes in neuronal activity in the globus pallidus interna in these examples of parkinsonism are definitive evidence that the presence of increased activity in the globus pallidus interna is not a necessary condition for parkinsonism. the question is why did the results of mptp - parkinsonism trump parkinsonism induced by neuroleptics or lesions of the nigro - striatal pathway. it can not be because mptp - parkinsonism in non - human primates had a human analogue whereas the latter did not. similarly, there have been case reports of strokes involving the substantia nigra causing parkinsonism in humans. one suspects that the mptp - induced changes in globus pallidus interna neuronal activity was taken as prototypical while the lack of changes in the case of neuroleptics and structural lesions discounted and subsequently ignored is because the mptp related changes were consistent with the emerging globus pallidus interna rate theory. it is human nature to retain a theory with strong intuitive appeal even in the presence of strong contrary evidence.16 the question may arise why be concerned about theories of physiology and pathophysiology ? virtually every therapy for parkinson s disease, for example, arose before or independent of the globus pallidus interna rate theory. even the dopaminergic / cholingergic imbalance theories that were predecessors to the globus pallidus interna rate theory followed from and did not predict pharmacological therapies. dopaminergic and anti - cholinergic therapies ; surgical ablative therapies, such as thalamotomy, pallidotomy, subthalamotomy17 ; and dbs18 were in use before the advent of the globus pallidus interna rate theory. subthalamic dbs developed after the globus pallidus interna rate theory but this was an extension of surgical ablative therapies as evidenced by the early claims that high frequency dbs inhibited the stimulated target, which is now known to be false.3 the possible exception is the notion of reversing the neurotransmitter effects of the subthalamic nucleus onto the globus pallidus interna with an attempt to convert from the normal excitatory neurotransmitter, glutamate, to the inhibitory neurotransmitter gamma - aminobutyric acid (gaba).19 the notion is that over - activity of the subthalamic nucleus would suppress over - activity in the globus pallidus interna. the argument is advanced that the development of the globus pallidus interna rate theory was largely responsible for the resurgence of interest in pallidotomy and subsequently, dbs, in the early 1990s.18 alternative explanations, such as advanced imaging and surgical techniques are insufficient. indeed, some of the leaders in dbs surgery employed ventriculograms for localization in the same manner as done decades earlier. also, it was not as though there were sudden failures of other therapies such as pharmacological approaches. the long term complications and problematic responses to levodopa were apparent from the first large scale clinical use and for those reasons, controversies over the role of levodopa as initial therapy in parkinson s disease broke out as soon as there were viable alternatives, the first being bromocriptine. the development of the globus pallidus interna rate theory provided a cogent rationale for, initially, pallidotomy, and subsequently dbs as reflected in a commentary by goetz.20 thus, in a practical sense, theories are important. these therapies doubtlessly improved the quality of life for tens of thousands of patients so the resurgence of surgical therapies was right but for the wrong reason. what clearly are hypotheses in the globus pallidus interna rate theory have taken on the epistemic status of fact (termed quasi - fact) and have become arbitrators of grants and publications effectively blocking consideration of alternative hypotheses. admittedly this claim is based on the author s personal experience and informal discussions with colleagues. the necessary evidence seldom is made readily available. perhaps contrary to popular belief, the globus pallidus interna rate theory is not a theory of physiology or pathophysiology. rather, the theory is an anatomical and neurochemical theory that has been extrapolated into a theory of physiology.21 the approach is to substitute a single macro - neuron for the anatomical structures within the basal ganglia - thalamic - cortical system ; in the case of the striatum, there are two macro - neurons, one each for the direct and indirect pathways. the theory then asks, based on their neurotransmitters, how would these neurons interact ? the result is a one - dimensional push - pull dynamics that were described above. the consequences and failures of this macro - neuron one - dimensional push - pull theory have been reviewed elsewhere.9,21,22 the greatest problem of the globus pallidus interna rate theory is the complete lack of appreciation for dynamics, which is change in neuronal activities and states over time. merely piecewise increments in the complexity of the anatomy from that inherent in the globus pallidus interna rate theory is not likely to meet much greater success. rather, increases in complexity to the point of qualitative, rather than just quantitative, changes in the dynamics will be necessary, such as those of complex systems theory involving chaotic and non - linear interactions.23,24 a central and critical feature in the globus pallidus interna rate theory is the effects of putative inhibitory neurotransmitters. indeed, the one - dimensional push - pull dynamics rest on the notion of reciprocal activities in structures connected by pathways mediated by gaba. the changes in the in the efferent structure (the source of the gabaergic neurotransmission) is reciprocal to the activities in the afferent (where the effects of gaba take place). recordings of ventrolateral thalamic neuronal activities during high frequency dbs of the globus pallidus interna demonstrate an inhibition approximately 3 ms after the stimulation pulse lasting approximately 3 ms and consistent with inhibition of ventrolateral thalamic neurons by the output of the globus pallidus interna. however, the inhibition of the ventrolateral thalamic neurons was followed by rebound post - inhibitory rebound excitation.5 for the many ventrolateral thalamic neurons, the rebound excitation was sufficient to result in a net excitation following activation of globus pallidus interna output. similarly, post - inhibitory rebound excitation has been demonstrated in the rodent endopeduncular nucleus (the rodent analog of the globus pallidus interna)25 and subthalamic nucleus.26 thus, the globus pallidus interna rate theory fails, as it can not account for the effects of post - inhibitory rebound excitation. the conceptual confusion is equating the direct effects of inhibitory neurotransmitter effects on post - synaptic membrane potentials with a larger scale physiology of the neuronal response. there is nothing about gaba that consideration about it would necessarily lead to the notion of post - inhibitory rebound excitation. consequently, extrapolation from gaba, in terms of its chemical nature, does not lead, necessarily, to the physiological consequences, and indeed, in the globus pallidus interna rate theory, it leads to the wrong conclusion. the importance of post - inhibitory rebound excitation is well appreciated in the invertebrate nervous system27 and has lesions for any future theory of basal ganglia physiology and pathophysiology. unfortunately, there is a long history of equating neurochemistry with physiology.28 the conceptual confusion relative to arbitrarily assigning priority to observations gleaned from mptp - induce parkinsonism over those from other forms of parkinsonism parallels another conceptual confusion regarding the nosology of parkinsonism and parkinson s disease. there are a number of different levels or approaches to the definition of parkinsonism : these include syndromic or phenotypic, that is based on symptoms and signs ; pathological ; genetic ; and neurochemical. contrary to the aspirations of scientific reductionism, these approaches do not and can not achieve a single consilience such that any conceptualization becomes universal or not context dependent. in other words, there are many forms of parkinsonism depending on the circumstances and the questions to be answered. dopamine responsiveness then seems to be a logical criterion for parkinsonism though it has to be admitted that such logic is circular. the problem is that, not infrequently, patients, who have all the symptoms and signs of parkinsonism in a manner identical to those with dopamine responsive parkinsonism, do not respond to dopamine replacement. often this is attributed to atypical parkinsonism associated with a unique pathology ; however, autopsy control studies demonstrate patients with pathological idiopathic parkinson s disease that do not respond to dopamine replenishment therapy.29 the problematic nature of conflating the syndromic and neurochemical criteria is seen in the discovery of patients with retrospective re - consideration has led some to claim that these patients have a form of dystonia and therefore should not be confused with parkinson s disease. the patients with swedds where first identified during the course of clinical trials of medications for idiopathic parkinson s disease and were diagnosed by some of the most capable movement disorders neurologists. thus, the reasonable conclusion is that the syndromic (or phenotypic) definition of parkinson s disease does not stand in a one - to - one correspondence with the neurochemical definition, that being dopamine depletion. nor is the relation of phenotypic and neurochemical definitions stand as in the form if and only if logic ; that is one has phenotypic criterion if and only if one has a dopamine deficiency. the fact of the matter is that parkinsonism can be associated with many different pathologies including those that do not necessitate dopamine deficiency. lesions of the globus pallidus externa,30 striatum,31 and supplementary motor area32 have been associated with parkinsonism. similarly, effective treatments include direct electrical stimulation of the subthalamic nucleus, globus pallidus interna, ventrolateral thalamus, motor cortex and striatum and do not presuppose dopamine replenishment. the significance of these observations is that there must be numerous mechanisms that produce the symptoms, signs and disabilities of parkinsonism or perhaps, a set of variations along the same theme, the latter notion favored by occam s razor. what is striking is that these different mechanisms or variations do not appear to be considered in current theories and why these alternative mechanisms or variations have not been subject to investigation and exploitation for new therapies. perhaps the old adage when the only tool you have is a hammer you tend to see every problem as a nail when all one has is an anatomical / neurochemical theory with dopamine as its center point, then everything seems to revolve around dopamine. the first publications of the globus pallidus interna rate theory were in 1989.33 to be sure, there have been numerous published criticisms but these have been more technical such as at the level of anatomical and neurochemical complexity and not at the conceptual level.3436 indeed, some of the leading critics of the globus pallidus interna rate theory also have been its most consistent advocates8 ; thus, evidence of the continued appeal of the underlying conceptual structure of the globus pallidus interna rate theory. indeed, it is the continued invidious acceptance of the conceptual structure of the globus pallidus interna rate theory that allows the theory to continue despite the mounting contrary specific observations. indeed, a leading advocate pointed out would should have been a fatal flaw many years ago, that being that pallidotomy improved dyskinesia when, according to the globus pallidus interna rate theory, the opposite should have been the case. there are numerous corollaries and presuppositions that could have provided tests of the globus pallidus interna rate theory that appear to have escaped notice. this could only be if such corollaries or presuppositions were taken or assumed to be true or self - evident and consequently of little need for testing. but how can any theory of basal ganglia physiology and pathophysiology be considered complete unless a full and direct causality extends from degeneration of dopamine neurons in the substantia nigra pars compacta to the activities of the motor units that drive the phenotypic expression. the motor unit is the set of muscle fibers innervated by individual lower motor neurons in the spinal cord and brainstem. in one way, the globus pallidus interna rate theory obviates the necessity of a direct causal link all the way to the motor units by claiming that the basal ganglia, and particularly, the globus pallidus interna, do not generate the specific programs determining motor unit behavior ; this is done elsewhere (such formulation is the essence of a theory of physiology derivative of the globus pallidus interna rate theory called the action selection / focused attention theory). rather the role of the basal ganglia is to select which, presumably, pre - defined motor program is to be executed much like the role of a librarian in selecting books off the shelf. however, what is the evidence that motor programs exist as discrete ontological entities like books on a shelf ? yet, it would seem that this would be an important presupposition of the globus pallidus interna rate theory to validate. an alternative is that over - activity of the globus pallidus interna merely dampens activity within the ventrolateral thalamic - motor cortical circuit and thus, motor programs lack sufficient energy to sufficiently drive movement and bradykinesia and akinesia result. first, patient s bradykinesia depends on the conditions, for example, patients can move as fast to large targets as normal subjects can move to smaller targets.37 also, there is the phenomenon of hastening where subjects are asked to tap in synchrony with a metronome of increasing frequency.38 normal subjects are able to precisely follow the increasing frequency whereas patients with parkinson s disease fall behind the metronome, then further, the notion of insufficient activation would not explain the observation of co - contraction of antagonist muscles potentially interfering with the actions of the agonists thereby disrupting movement.39 clearly, parkinsonism is not merely a issue of insufficient activation of motor units. recent studies of motor unit recruitment suggest a very direct role in constructing the program for the orchestration of motor units necessary for normal movement. small motor units, defined by the number of muscle fibers innervated by the lower motor neuron, are recruited first at low force requirements. as the force requirements increase, progressively larger motor units are recruited. parkinson s disease alters the normal recruitment and in some cases reverses the order such that large motor unites are recruited before smaller units resulting in abnormal increase in generated force (montgomery, haung, walker and watts, unpublished observations, 2010). thus, the role of the basal ganglia - thalamic - cortical system is much more complex than merely selecting pre - defined movements or energizing muscle activations. there is nothing in the globus pallidus interna rate theory that could explain the effects of parkinson s disease on the order of motor unit recruitment. conceptual understandings, embodied by theories, are important and drive science and innovation, or they can hinder. a notion of scientific progress as incremental and progressive refinement of conserved knowledge is unlikely to be true. more often, new scientific hypotheses are born in opposition to current theories. however, success in scientific advancement will best be served when the scientific community nurtures the loyal opposition. this will happen only when it is seen as necessary and for that the highest levels of rigor and the active avoidance of complacency are critical. it is past time for efforts to explore and test radical alternatives to the globus pallidus interna rate theory ; radical because the basic presuppositions, assumptions, conceptual antecedents underlying the globus pallidus interna rate theory need to be thoroughly exposed and critiqued so that successor theories do not share the same fate. | deep brain stimulation (dbs), arguably, is the most dramatic development in movement disorders since the levodopa for parkinson s disease. yet, its mechanisms of action of dbs are unknown. however, dbs related research already has demonstrated that current concepts of basal ganglia pathophysiology are wrong. specifically, the notion that over - activity of the globus pallidus interna causes parkinsonism, the basis for the most current theories, is no longer tenable. the development of any new theory will be aided by an understanding of how current theories are wrong and why have these flawed theories persist. many of the problems of current theories are more matters of inference, assumptions, presumptions, and the accepted level of ambiguity than they are of fact. consequently, it is imperative that these issues be addressed. just as the inappropriate use of a tool or method is grounds for criticism, methods of reasoning are tools that can be used inappropriately and should be subject to discussion just as misuse of any other tool. thorough criticism can provide very important lesions though the process could be mistaken as harsh or personal ; neither is the case here. at the least, such analyzes can point to potential pitfalls that could be avoided in the development of new theories. as will be discussed, theories are important for the development of therapies but perhaps most important, for the acceptance of new therapies, as was the case for the recent resurgence of interest in surgical therapies. |
eldecalcitol is a new active vitamin d3 analogue with a hydroxypropyloxy group introduced at the 2 position of 1,25-dihydroxyvitamin d3. alfacalcidol, 1-hydroxyvitamin d3, is a prodrug of an active form of vitamin d3. a randomized, double - blind, placebo - controlled, clinical study demonstrated that, compared to a placebo, 1-year treatment with eldecalcitol significantly increased lumbar spine and total hip bone mineral density (bmd) in a dose - dependent manner. further, in comparison to alfacalcidol treatment, eldecalcitol treatment significantly decreased the incidences of vertebral fractures (morphometric and clinical) and wrist fractures, with marked increases in lumbar spine bmd and total hip bmd, as assessed by a 3-year, randomized, double - blind, clinical trial. on the basis of these results, a characteristic type of fracture frequently found in osteoporosis is the so - called fragility fracture. however, diagnosis of fragility fractures in patients with osteoporosis is often difficult in daily practice because of uncertainty in evaluating the degree of causative energy loaded onto the fracture site. recently, the world health organization (who) scientific group [3, 4 ] introduced a new approach to characterizing fractures relevant to osteoporosis. these osteoporotic fractures are fractures whose risk of incidence is associated with low bone mass and whose incidences rise with age after the age of 50 years. fractures pertinent to these criteria are those at the spine, distal forearm (wrist), humerus, ribs, clavicle / scapula / sternum, pelvis, tibia / fibula, hip, and other femoral fractures. we have already reported the reduction in the incidence of three major predefined nonvertebral fractures of the humerus, wrist, and hip. however, we did not analyze the incidences of osteoporotic fractures including major fractures used in the who fracture risk assessment tool (frax). in the present study, we analyzed the data derived from the phase iii clinical trial of the efficacy of eldecalcitol versus alfacalcidol on fracture prevention in osteoporotic patients (clinical trials gov number nct00144456) to determine the effect of eldecalcitol on the incidence of osteoporotic fractures in comparison to that of alfacalcidol. we also analyzed the effect of each agent on the risk of major osteoporotic fractures included in frax, clinical vertebral fracture and fractures of the hip, distal forearm, and humerus without discriminating between traumatic and nontraumatic fractures. then, we analyzed the incidences of osteoporotic fractures stratified by prespecified risk factors for fractures at baseline. details of the double - blind fracture prevention clinical study of eldecalcitol have been published previously. briefly, 1,054 patients with primary osteoporosis [5, 6 ] were divided into two groups : an eldecalcitol group (n = 528) and an alfacalcidol group (n = 526). they were given either oral eldecalcitol (0.75 g) or oral alfacalcidol (1.0 g) once a day for 3 years (36 months). patients with serum 25-hydroxyvitamin d values lower than 20 ng / ml at the time of enrollment were given an oral vitamin d3 supplement (400 iu) once a day without calcium supplementation. patients with lumbar spine or total hip bmd t score below 1.7 were enrolled if they had one to five vertebral fractures. patients without vertebral fractures were also enrolled if their lumbar spine or total hip bmd t score was below 2.6 and they were aged 70 years or older, or if their t score was below 3.4 and they were aged less than 70 years. patients with metabolic bone disease such as primary hyperparathyroidism, cushing s syndrome, premature menopause, poorly controlled diabetes mellitus (hba1c > 9 %), or other causes of secondary osteoporosis or patients who had a history of urolithiasis were excluded from the study. patients were also excluded if they had taken any oral bisphosphonates within 6 months before entry or for more than 2 weeks during the period 612 months before entry, or intravenous bisphosphonates at any time ; had taken glucocorticoids, calcitonin, vitamin k2, active vitamin d compounds, raloxifene, or hormone replacement therapy within 2 months ; had serum calcium levels above 10.4 mg / dl or urinary calcium excretion greater than 0.4 mg / dl gf ; or had serum creatinine above 1.3 mg / dl. the primary endpoint of the study was the incidence of nontraumatic new vertebral fractures, and the secondary endpoints were the percent change in lumbar spine bmd and total hip bmd, percent change of bone turnover markers, and incidence of nonvertebral fractures. the incidence of nontraumatic new vertebral fractures was evaluated by using lateral radiographs of the thoracic and lumbar spine obtained at baseline and at 6, 12, 24, and 36 months after initiation of drug administration. incidences of nonvertebral fractures were assessed using radiographic examinations at the clinical site by investigators, and the data were reported at the time of incidence to the central facility and analyzed. in this study, we compared the two treatment groups with respect to the incidence of osteoporotic fractures as defined by the who scientific group [3, 4 ], their site - specific incidences, and the incidence of major osteoporotic fractures included in frax. we also analyzed the incidence of osteoporotic fractures based on prespecified risk factors for fractures at baseline : age, serum 25-hydroxyvitamin d value, number and degree of severity of prevalent vertebral fractures, lumbar spine bmd, and total hip bmd. we performed the analysis for all subjects in the full analysis set (eldecalcitol group, n = 526 ; alfacalcidol group, n = 523). first, the incidences of fractures at any of the nine osteoporotic fracture sites and their subgroup analyses were evaluated by kaplan the incidences of major osteoporotic fractures were also estimated by the kaplan meier method. to compare the effects of eldecalcitol with those of alfacalcidol, we performed stratified log - rank tests (two - sided, 5 % significance level) and determined the hazard ratios and the 95 % confidence intervals of those incidences by stratified cox regression models, as described in the subgroup analyses of the previous report, with adjustment for the number of prevalent vertebral fractures at baseline (categories were no fracture, one fracture, or more than one fracture). we performed the analysis for all subjects in the full analysis set (eldecalcitol group, n = 526 ; alfacalcidol group, n = 523). first, the incidences of fractures at any of the nine osteoporotic fracture sites and their subgroup analyses were evaluated by kaplan the incidences of major osteoporotic fractures were also estimated by the kaplan meier method. to compare the effects of eldecalcitol with those of alfacalcidol, we performed stratified log - rank tests (two - sided, 5 % significance level) and determined the hazard ratios and the 95 % confidence intervals of those incidences by stratified cox regression models, as described in the subgroup analyses of the previous report, with adjustment for the number of prevalent vertebral fractures at baseline (categories were no fracture, one fracture, or more than one fracture). there were no significant differences in the patients background data with regard to age, percentage of male patients, body mass index, the prevalence of vertebral fractures, nonvertebral fractures, bmd, or metabolic bone markers (table 1).table 1baseline characteristics of enrolled patientseldecalcitol (n = 526)alfacalcidol (n = 523)age (years)72.2 6.5972.1 6.62male patients [n (%) ] 9 (1.71)15 (2.87)body mass index (kg / m)22.3 3.1922.3 3.20number of prevalent vertebral fractures1.19 1.281.25 1.36 0 [n (%) ] 198 (37.6)193 (36.9) 1 [n (%) ] 155 (29.5)159 (30.4) 2 [n (%) ] 173 (32.9)171 (32.7)prevalent vertebral fracture grade 0 [n (%) ] 198 (37.6)193 (36.9) grade 1 [n (%) ] 110 (20.9)118 (22.6) grade 2 [n (%) ] 132 (25.1)102 (19.5) grade 3 [n (%) ] 86 (16.3)110 (21.0)history of nonvertebral fracture absent [n (%) ] 367 (69.8)379 (72.5) present [n (%) ] 159 (30.2)144 (27.5)lumbar spine bone mineral density (bmd) t score2.70 0.942.72 0.90total hip bmd t score2.26 0.822.27 0.79bone alkaline phosphatase (bap) (u / l)33.4 14.433.8 12.5urinary ntx (nmol bce / mmol cr)58.0 58.757.0 32.7data are mean sd. there were no significant differences in the patients background data baseline characteristics of enrolled patients data are mean sd. there were no significant differences in the patients background data the incidence of all osteoporotic fractures for 3 years was 18.6 % in the eldecalcitol group and 25.2 % in the alfacalcidol group, according to the kaplan 1a), and the risk of osteoporotic fracture in the eldecalcitol group was significantly lower than in the alfacalcidol group (hazard ratio, 0.70 ; 95 % ci, 0.540.93 ; p = 0.013). the incidence of nonvertebral osteoporotic fractures was 5.8 % in the eldecalcitol group and 9.7 % in the alfacalcidol group (fig. 1b), indicating a significant decrease in the risk in the eldecalcitol group relative to that in the alfacalcidol group (hazard ratio, 0.59 ; 95 % ci, 0.370.94, p = 0.026).fig. 1kaplan meier estimates of the incidence of all osteoporotic fractures defined by the who scientific group (a), and the incidence of nonvertebral osteoporotic fractures in the eldecalcitol and alfacalcidol groups (b) kaplan meier estimates of the incidence of all osteoporotic fractures defined by the who scientific group (a), and the incidence of nonvertebral osteoporotic fractures in the eldecalcitol and alfacalcidol groups (b) the incidence of the four major osteoporotic clinical fractures used in frax (clinical vertebral fractures, and fractures of the humerus, distal forearm, and hip) for 3 years was 11.1 % in the eldecalcitol group and 16.3 % in the alfacalcidol group. the risk of these fractures was significantly lower in the eldecalcitol group than in the alfacalcidol group (hazard ratio, 0.66 ; 95 % ci, 0.460.94 ; p = 0.020) (fig.. 2kaplan meier estimates of the incidence of major osteoporotic fractures included in the fracture risk assessment tool (frax) in the eldecalcitol and alfacalcidol groups kaplan meier estimates of the incidence of major osteoporotic fractures included in the fracture risk assessment tool (frax) in the eldecalcitol and alfacalcidol groups in the subgroup analyses of osteoporotic fractures, all the values of the point estimates for hazard ratio in the eldecalcitol group were less than 1.0 compared to the alfacalcidol group. the categories of subgroups that showed marked significant differences (p < 0.01) were presence of prevalent vertebral fractures (hazard ratio, 0.66 ; 95 % ci, 0.490.89 ; p = 0.007), two or more prevalent vertebral fractures (hazard ratio, 0.59 ; 95 % ci, 0.410.86 ; p = 0.006), and total hip bmd t - score of less than 2.5 (hazard ratio, 0.55 ; 95 % ci, 0.360.84 ; p = 0.006) (fig. 3subgroup analyses of the effect of eldecalcitol in comparison with alfacalcidol on osteoporotic fractures subgroup analyses of the effect of eldecalcitol in comparison with alfacalcidol on osteoporotic fractures site - specific numbers of osteoporotic fractures of the vertebrae, ribs, clavicle / scapula / sternum, tibia / fibula, and distal forearm that occurred during the 3-year trial were smaller in the eldecalcitol group than in the alfacalcidol group, but a statistically significant difference was observed only for vertebra and distal forearm (vertebra : hazard ratio, 0.72 ; 95 % ci, 0.520.99 ; distal forearm : hazard ratio, 0.28 ; 95 % ci, 0.110.69) (table 2).table 2osteoporotic fractures defined by the who scientific group and their site - specific incidenceseldecalcitol (n = 526)alfacalcidol (n = 523)hazard ratio (95 % ci)all osteoporotic fractures901190.70 (0.540.93) nonvertebral osteoporotic fractures28460.59 (0.370.94) osteoporotic fractures at specific sites vertebra64830.72 (0.520.99) ribs8140.56 (0.231.33) pelvis312.95 (0.3128.34) humerus211.92 (0.1721.22) clavicle, scapula, sternum130.33 (0.033.20) hip751.41 (0.454.44) other femoral fracture01 tibia, fibula150.20 (0.021.69) distal forearm6210.28 (0.110.69)tibial and fibular fractures listed are those in women osteoporotic fractures defined by the who scientific group and their site - specific incidences tibial and fibular fractures listed are those in women this study clearly demonstrated that, compared with 1.0 g daily alfacalcidol administration, daily administration of 0.75 g eldecalcitol reduced the risk of osteoporotic fractures as defined by who and decreased the risk of major osteoporotic fractures included in frax. a significant decrease in the incidence of nonvertebral osteoporotic fractures was also observed in the eldecalcitol group. in the subgroup analysis, eldecalcitol was found to be more effective at reducing the risk of osteoporotic fractures than alfacalcidol in patients with total hip bmd t score less than 2.5. the hazard ratio for patients with two or more prevalent vertebral fractures was markedly smaller than the hazard ratios for patients with one or no prevalent vertebral fracture. thus, eldecalcitol seems to be more effective than alfacalcidol in preventing osteoporotic fractures in patients with multiple prevalent vertebral fractures. in the previous study, we demonstrated the efficacy of eldecalcitol in preventing morphometric vertebral fractures and nonvertebral fragility fractures at three major sites (humerus, wrist, and hip). in this study, we analyzed the incidences of all radiographically confirmed osteoporotic fractures of the vertebrae, ribs, pelvis, humerus, clavicle / scapula / sternum, hip, other femoral sites, tibia / fibula, and distal forearm.. we also calculated the incidences of the four major osteoporotic fractures listed in the frax [vertebrae (clinical fracture), hip, distal forearm, and humerus ]. these data compatibly indicated the superior efficacy of eldecalcitol compared to that of alfacalcidol on the prevention of fractures in patients with osteoporosis. the superiority of eldecalcitol in preventing nonvertebral osteoporotic fractures appeared to be largely the result of reductions in the incidence of fractures of the ribs, clavicle / scapula / sternum, tibia / fibula, and distal forearm. the effect of eldecalcitol on reducing the risk of osteoporotic fractures and nonvertebral osteoporotic fractures seems to depend on the potent effect of eldecalcitol in increasing bmd and strengthening bone structure. eldecalcitol was shown to increase lumbar bmd by 3.3 % and total hip bmd by 1.5 % in 1 year in comparison to placebo and to increase lumbar bmd by 3.3 % and total hip bmd by 2.7 % in 3 years compared to alfacalcidol. with eldecalcitol treatment, urinary ntx, a bone resorption marker, was observed to decrease by 20 % in 3 months in comparison to baseline levels and by 23 % in 3 years compared to that when treated with alfacalcidol. also, femoral bone geometry assessment using clinical computed tomography (multidetector - row ct) scanning has shown that, compared with alfacalcidol, eldecalcitol more markedly increases the cross - sectional cortical bone area in patients with osteoporosis, maintains the thickness of cortical bone, and improves the bone biomechanical parameters of the femoral neck. the volumetric bmd value at the femoral neck also significantly increased with eldecalcitol treatment compared to with alfacalcidol treatment. these data strongly suggest that eldecalcitol improves the material strength of bone and also the cortical bone structure. preventing a chain reaction of fragility fractures in patients with osteoporosis is critically important in daily clinical practice. meta - analysis studies suggest that a previous fracture history is associated with a significant (approximately doubled) increase in risk of any fracture compared with individuals without a prior fracture [8, 9 ]. robinson. reported that fractures of the hip, wrist, and proximal part of humerus were associated with a high risk of later re - fracture at any of the four sites they examined (hip, wrist, proximal part of the humerus, and ankle), and the relative risks were 5.76, 3.98, and 4.87, respectively. reported that absolute risk of subsequent fracture was increased in women across all age groups for most fracture types with clinical symptoms, including hip, vertebra, upper limb, ribs, and lower limb, and their relative risks were 2.79, 2.52, 1.69, 1.84, and 1.39, respectively. these data indicate that a prevalent fracture is a strong indicator of secondary fractures. this study confirmed the potent efficacy of eldecalcitol in preventing subsequent osteoporotic fractures in patients with prevalent, third, the study population was not large enough to reliably evaluate the subgroup analyses and analyses of site - specific osteoporotic fractures. daily administration of 0.75 g eldecalcitol reduces the risk of osteoporotic fractures compared with 1.0 g alfacalcidol administration in 3 years. eldecalcitol was also superior to alfacalcidol in reducing nonvertebral osteoporotic fractures, which could be the result of the potent effect that eldecalcitol has on bmd, bone structure, and bone turnover. | eldecalcitol, a vitamin d3 analogue, significantly reduces the risk of new vertebral fractures and increases bone mineral density (bmd) more than does alfacalcidol. to determine the effect of eldecalcitol on the incidence of all fragility fractures caused by osteoporosis, we conducted post hoc analyses of the phase iii clinical trial to evaluate the incidence of the osteoporotic fractures defined in the world health organization (who) technical report, and, also, the incidence of the major osteoporotic fractures utilized in the who fracture risk assessment tool (frax), and compared those in the eldecalcitol group with those in the alfacalcidol group. we also analyzed the incidence of osteoporotic fractures stratified by prespecified risk factors for fractures. eldecalcitol treatment reduced the incidence of osteoporotic fractures defined by the who more than alfacalcidol treatment (18.6 % vs. 25.2 % ; hazard ratio, 0.70 ; 95 % ci, 0.540.93). prevalent vertebral fractures, two or more prevalent vertebral fractures, and total hip bmd t score less than 2.5 were the risk factors for new osteoporotic fractures with significant differences between the two treatments. eldecalcitol also decreased the incidence of major osteoporotic fractures in the frax more than alfacalcidol (11.1 % vs. 16.3 % ; hazard ratio, 0.66 ; 95 % ci, 0.460.94). in conclusion, treatment with eldecalcitol reduced the risk of fragility fractures caused by osteoporosis compared with alfacalcidol administration, which may result from a potent effect of eldecalcitol on bmd, bone structure, and bone turnover. |
fractures of femur are among the most important causes of mortality in musculoskeletal injuries. owning to lack of adequate research to compare various techniques of fracture stabilization, there has not yet been an agreement over a protocol to utilize a specific type of splint for femoral fracture immobilization. this study was thus conducted to compare the effects of simple and traction splints on pain intensityimmediately after and at the 1, 6, and 12h after splinting among patients with femur fracture in the centers affiliated to isfahan university of medical sciences (isfahan, iran). prehospital emergency ambulances were divided into two groups of simple and traction splints using a table of random numbers. continuous convenient sampling was employed in each group to use either a simple or a traction splint for the patients with femur fractures. pain intensity of the patients was then measured by a visual analogue scale (vas) immediately, 1 h, 6 h, and 12 h after splinting. after splinting, pain intensity decreased significantly in both groups (p = 0.0001 in both groups). the reductions were significantly more in the traction splint group at the 1, 6(p = 0.0001), and 12h after splinting (p = 0.02) compared with the simple splint group. there was no significant difference in pain intensity immediately after splintingbetween the two groups (p = 0.441). the significant difference in pain reduction between the simple and traction splint groups at the 1, 6, and 12h after splinting emphasizes the superiority of traction splints. musculoskeletal system injuries, including fractures of femoral shaft, are major causes of mortality or disability in adults. the majority of such fractures occur in the middle and upper third area during activities such as skiing and bike riding. such injuries are also seen as a result of falls, sports accidents, work - related accidents, accidents with vehicles, and in some special cases in children abuse. as the femoral bone is the largest and the main weight - bearing bone in the body, femoral fracture and its treatment in fact, complications and mortality of femoral fracture have been reported in 46% and approximately 20 - 54% of the cases, respectively. a study in sweden has estimated the annual prevalence of femoral fracture as 9.9 - 10 in every 100,000 people. following femoral fractures, severe contraction of large muscles surrounding the hip can stretch the two ends of the broken bone toward each other and thus create harsh pain. prehospital care and transportation of patients at scenes of accident are often performed by trained staff in prehospital emergency systems. the main goal of such systems is to save life, prevent injury, and reduce pain exacerbation prior to the main treatment. a leading strategy, at both levels of basic and advanced emergency services is immobilization of musculoskeletal injuries. timely and accurate interventions of emergency nurses can save the lives of patients, prevent further injuries, and particularly reduce pain in patients with femoral fractures. splints, including simple and traction splints, are among the tools used for immobilization. however, due to their features and especially the way they are used, there is no consensus regarding the usage of a specific splint in a particular situation. in closed femoral fractures, the most commonly used splints are long wooden splints and traction splints, each of which have their own advantages and disadvantages. as the simplest splint type, wooden splints fix the organ and prevent the conversion of a closed fracture to an open fracture. traction splints are also common tools of treating femoral fractures in injured patients admitted in prehospital emergency units. therefore, many emergency medicine and nursing references have called traction splints as one of the most effective practices in prehospital emergency. although various immobilization tools (other types of splints) can reduce patientspain to some extent, some believe that in special cases, such as femoral fractures, traction splint can be applied. some specialists even believe in it as the most effective way to reduce adverse effects of femoral fractures, that is, pain. despite the mentioned benefits, using traction splints is accompanied by uncertainty owing to some complications such as damage to the neuromuscular system and/or pressure to the femoral neurovascular system as the femoral region contains femoral, sciatic, and popliteal nerves, as well as relevant blood vessels. as a result, bledsoe and barnes emphasized the necessity of reconsidering the use of traction splints in prehospital emergency. similarly, wood. stated that inserting a traction splint can prolong the presence of the prehospital emergency personnel at the scene of accident. on the other hand, inserting a traction splint by two staff members is associated with manipulating the injured organs to create tension and can thus exacerbate pain intensity or injury. in addition, possible difficulty in using traction splints during patient transfer in prehospital emergency systems has made the use of other types of simple wooden splints acceptable. therefore, despite the advantages of traction splints compared with simple splints, their application is still under debate due to the related complications and arguments about their effects on complications of femoral fracture, including pain. however, the recommendation of the american college of surgeons committee on trauma and illinois department of healthcare in the united states indicated for equipping all ambulance units with traction splints in prehospital emergency. as prehospital emergency nurses and technicians are responsible for splinting in prehospital conditions, it is necessary to query the effectiveness of various splint types on femoral fracture outcomes and mostly importantly pain. therefore, this study aimed to determine and compare the impacts of using simple and traction splints on pain intensity of patients with femoral fracture immediately and at the 1, 6and 12h after splinting in health centers affiliated to isfahan university of medical sciences, isfahan, iran. this was a quasi - experimental study on 30 patients who were diagnosed with a closed femoral shaft fracture by ambulance nurses based on the instructions of american association of surgeons. patients were included if they aged 15 - 65 years, were not addicted to any drugs, provided informed consents to participate in the study, and had full consciousness when completing the questionnaires. the subjects were all transferred to one of alzahra, isa ibn maryam, amin, kashani, shariati, or gharazi hospitals by the prehospital emergency services of isfahan. other inclusion criteria were maintaining the splint on the injured organ for at least for 12 h after splinting and using morphine sulfate as a painkiller. accordingly, patients were excluded if they were unwilling to continue participation, developed any problems incompatible with the inclusion criteria, and did not have the splint on the injured organ for 12 h. randomized sampling method was first used by allocating 31prehospital emergency codes. the personnel participated in 10 sessions about splint placement techniques (simple and traction) based on the instruction of the american association of emergency physicians (2011). they then took a test and were selected for splinting if they obtained the whole 13 scores of the test. after explaining the conditions for the subjects and obtaining their informed consent, one of the two splints was placed for them. pain intensity was measured using a visual analogue scale (vas) from 0 (no pain) to 10 (the highest pain intensity) immediately and at the 1, 6, and 12h after splinting. for adjustment and matching the conditions based on the issued protocol by the isfahan disaster and emergency management center, 5 mg of morphine sulfate the second part included the mechanism of the accident, the injured site, pain intensity at different times. it also assessed times related to prehospital emergency care provision, that is, the times of reaching the accident location, using morphine sulfate, splinting, and delivering the patient to the hospital, and splint replacement. the time and amount of using morphine sulfate as an intervening factor during the first 12 h data analysis was conducted using descriptive statistics such as frequency distribution, mean and standard deviation (sd), and inferential tests including analysis of variance (anova), independentt - test and chi - square test in spss18(spss inc., of the 35 patients with femoral shaft fracture in the simple splint group, one subject was excluded due to addiction and another due to unwillingness to continue participation. the traction splint group consisted of 34 subjects among whom twodid not consent to continue. the mean ages of the participants in the simple and traction splint groups were 29 (14.1) and 31 (14.8) years, respectively. there was no significant difference between the two groups in terms of age (t = 0.6 ; p = 0.547). males constituted 87.5% (n = 28) of the simple splint group and 90.6% (n = 29) of the traction splint group. chi - square test did not show significant differences in sex distribution between the two groups (= 0.16 ; p = 0.698). in addition, frequency distribution of marital status was not significantly different between the two groups, either. moreover, after excluding the mentioned patients and determining the final number of left and right injured legs, no significant differences were found between femoral fractures in the right and left legs. there were no significant differences between the two groups regarding the frequency of injury mechanisms (falling from height, vehicle accident, sport events, and occupational accidents). however, both groups had higher numbers of vehicle accidents. the spent time in the scene showed no significant difference between the two groups (p = 0.0001). as indicated in table 1, pain intensity decreased consistently in the simple splint group from the beginning of splinting until the end of the 12h (mean reduction between every two measurements : 0.53 units). however, in the traction splint group, pain intensity showed higher decreased at a higher rate between during the 1h after splinting (1.2 units) compared with the next two measurements (mean reduction : 0.66 units). pain intensity of patients with femur fractures at different times stratified by splint types in the simple splint group, mean score of pain intensity significantly reduced at the 12h compared with immediately after splinting (f = 15.7 ; p = 0.0001). a similar significant reduction was also observed in the traction splint group (f = 47.5 ; p = 0.0001). there was no significant difference between the two groups in mean scores of pain intensity immediately after splinting (p = 0.441). in contrast, measurements at the 1, 6, and 12h after splinting revealed significant differences between the two groups in terms of pain intensity (p = 0.0001 and p = 0.0001, and p = 0.02, respectively). the findings of this study indicated pain intensity in patients with femoral fractures immobilized with simple splints to be lower pain at 1, 6, and 12h after splinting compared with immediately after splinting. for the same reason, beck., lockey, saygi., anderson., and many reference books have emphasized the application of simple splint to reduce pain. on the other hand, scores of pain intensity of patients whose femoral fractures were immobilized with traction splints significantly reduced over time. although wood. reported contrasting results, limmer, houghton., and chu. such reduction could have been caused by decreased muscle resistance around the injured bone. to be more precise, after musculoskeletal injuries, a traction splint stretches the muscles consistently and gradually reduces pain as muscle spasm is relieved. furthermore, we found the mean reduction of pain intensity score during the first 12 h to be higher in the traction splint group compared with the simple splint group. this finding was in accordance with the results of lockey, chu., and ellis and also the guidelines of the american association of emergency physicians. among the challenges of using traction splints are the required splinting time in the scene of accident and the need for two staff members for their placement. however, we could not find a significant difference in the spent time for splinting between the traction and simple splint groups, which may emphasize the possibility of replacing traction splints instead of simple splints. besides, in this study, we observed higher efficiency of traction splints in pain reduction at 1and 6h after splinting. similar results were reported by el - dakhakhni, american college of emergency physicians, chaplean, and booth who confirmed the positive effects of traction splints and their superiority over simple splints. | background : fractures of femur are among the most important causes of mortality in musculoskeletal injuries. owning to lack of adequate research to compare various techniques of fracture stabilization, there has not yet been an agreement over a protocol to utilize a specific type of splint for femoral fracture immobilization. this study was thus conducted to compare the effects of simple and traction splints on pain intensityimmediately after and at the 1st, 6th, and 12thh after splinting among patients with femur fracture in the centers affiliated to isfahan university of medical sciences (isfahan, iran).materials and methods : this quasi - experimental study was performed on 32 patients with femur fractures. prehospital emergency ambulances were divided into two groups of simple and traction splints using a table of random numbers. continuous convenient sampling was employed in each group to use either a simple or a traction splint for the patients with femur fractures. pain intensity of the patients was then measured by a visual analogue scale (vas) immediately, 1 h, 6 h, and 12 h after splinting. the effects of the two techniques were finally compared.results:after splinting, pain intensity decreased significantly in both groups (p = 0.0001 in both groups). the reductions were significantly more in the traction splint group at the 1st, 6th(p = 0.0001), and 12thh after splinting (p = 0.02) compared with the simple splint group. there was no significant difference in pain intensity immediately after splintingbetween the two groups (p = 0.441).conclusion : the significant difference in pain reduction between the simple and traction splint groups at the 1st, 6th, and 12thh after splinting emphasizes the superiority of traction splints. |
guidelines, pathways, and checklists should be in place to evaluate patients with diabetes who are hospitalized for any reason. patients should have their shoes, slippers, and socks removed and their feet examined for the presence of ulceration, ischemia, infection, neuropathy, and charcot neuroarthropathy (cn). urgent consultations should be obtained with an appropriate specialist for patients manifesting systemic signs of infection, critical limb ischemia, soft tissue crepitation, or deep tissue gas seen on radiographs, or fractures or dislocations of the foot and ankle (2). timely (albeit less urgent) consultations should be obtained for less severe infection, noncritical ischemia, noninfected foot ulcers, or unexplained swelling in the foot or ankle. foot deformity can increase friction and cause pressure points, and simple paronychia and fungal skin infections can be a precursor to more significant infection. a process should be in place to reduce pressure on the heels of all inpatients with diabetes in order to prevent iatrogenic pressure sores of the heel (fig. (2) identified seven essential skills that might be required for an inpatient team caring for patients with diabetes. these skills provide a comprehensive framework for the treatment of patients with diabetes independent of specific medical or nursing specialty, and include the ability to stage a wound ; assess for peripheral vascular disease, peripheral neuropathy, wound infection ; debride a wound ; appropriately obtain wound cultures and select antibiotic therapy for infected wounds ; plan for hospital discharge ; and to prevent wound recurrence (table 1). eight essential skills necessary for treatment and prevention of diabetic foot disorders in hospitalized patients neurological evaluation at the bedside is aimed at detecting loss of protective sensation, using any of several validated techniques (the monofilament test, the neuropathy disability score, the biothesiometer / vibration test, or the touch test) (3). because depression is associated with neuropathy and indeed predicts first foot ulcer development, careful assessment of the patient 's affect should be made by the medical team caring for the patient (4,5). this is particularly important because psychological distress may also impact wound healing (6). the presence of ischemia should be assessed initially by history and physical examination, i.e., symptoms of claudication and palpation of the dorsalis pedis and posterior tibial pulses, and supplemented by evaluation with a handheld doppler if pedal pulses are absent. when more objective evaluation is needed, assessment of lower extremity perfusion by means of doppler waveform analysis, toe pressure measurement, transcutaneous oxygen measurement or arterial duplex ultrasound is recommended. information based on this might prompt more invasive vascular assessment, e.g., angiography, which may lead to open or endovascular intervention (3). proper staging / grading of the wound using a validated classification system that documents depth, presence of infection and presence of ischemia may reduce ambiguity (table 2) (7). diabetic foot ulcers (dfu) may be present in patients who are admitted for nonfoot problems, and these ulcers should also be evaluated by the diabetic foot team during the hospitalization. noninfected foot ulcers should be debrided at the bedside, covered with a moist wound dressing, and protected by appropriate pressure offloading (redistribution). measurements should be obtained after debridement, and the characteristics of the wound (undermining, tunneling, and type of tissue at the base of the wound) should be recorded. classification of wounds facilitates appropriate management (especially when different providers care for the patient over time) and has been shown to help predict wound outcomes (2,3). university of texas diabetic wound classification incorporating depth, presence or absence of infection, and presence or absence of ischemia more than half of dfus are clinically infected at the time of presentation (810). recognizing the presence of infection in a dfu is crucial because infection is often the immediate precipitating event for a lower extremity amputation. infection is diagnosed clinically by the presence of at least two signs or symptoms of inflammation or purulent secretions. diabetic foot infections (dfi) should be classified according to their severity, using one of the similar validated systems devised by the infectious diseases society of america (idsa) or the international working group on the diabetic foot (table 3) (11). diabetic foot infection classification schemes : idsa / international working group on the diabetic foot hospitalization is rarely required for mild infections and for only some of the patients with a moderate infection (defined as those with > 2 cm surrounding erythema or infection that penetrates deeper than the subcutaneous tissue). hospitalization is appropriate when a moderate infection is accompanied by limb ischemia or not responding to outpatient treatment. patients with severe (grade 4) infections (those accompanied by fever, leukocytosis, or severe metabolic perturbations) should be hospitalized. the most recent guidelines of the idsa define severe infection as the presence of local infection associated with signs of systemic inflammatory response syndrome (11). (table 3) although patients with diabetes can present with systemic signs of infection (fever, nausea, vomiting, anorexia, malaise, loss of glycemic control, etc.), they may not mount a robust systemic response (1214). correction of an abnormal white blood cell count or hyperglycemia should be tracked during hospitalization to help monitor the response to treatment (15). in most studies hyperglycemia is associated with poor wound healing and it is likely that its correction would increase the likelihood of a favorable outcome (16). plain film radiographs of the foot and ankle should be obtained to assess for bone destruction, deformity, foreign body, or soft tissue emphysema. the presence of soft tissue gas on radiographs, abscess or extensive gangrene should alert the team that prompt surgical intervention is required (figs. 2 and 3). a team approach to management is optimal in patients with dfi in order to increase the likelihood of limb salvage (2,17,18). the initial evaluation should identify and correct any glycemic, fluid, and electrolyte or metabolic disorders, consulting with specialists as necessary. patients with a dfi require a thorough examination of the foot, basic blood tests such as complete blood count, serum chemistries, and inflammatory markers (erythrocyte sedimentation rate and/ or c - reactive protein). when deep soft tissue or bone infection is suspected, additional imaging (magnetic resonance in preference to nuclear medicine studies) may be helpful. those with suspected limb ischemia should undergo further noninvasive vascular evaluation, although urgent treatment of deep infection takes immediate precedence. surgical consultation should be sought for patients with infections that are deep, extensive, or accompanied by osteomyelitis or limb ischemia (19). the presence of crepitus (or subcutaneous gas on radiographs), bullae, ecchymosis, or skin necrosis suggest a necrotizing soft tissue infection, which represents a surgical emergency (20) (figs. 2 and 3). infected wounds should be cultured, preferably by obtaining tissue samples during any surgical procedure or by tissue biopsy or wound base curettage. bone cultures are optimal for detecting the pathogen in osteomyelitis, but blood cultures are only necessary for those with a severe infection as defined by the idsa / international working group on the diabetic foot (pedis) classifications scheme (table 3). appropriate deep culture technique is important because the results direct antibiotic therapy, enabling clinicians to alter their initial broad - spectrum empiric regimen to more narrow - spectrum antibiotic coverage (11). initial therapy must usually be parenteral and empiric, based on the likeliest pathogens and their probable antibiotic susceptibility patterns (21). a broad - spectrum antibiotic regimen is recommended for severe infections, covering staphylococci, streptococci and commonly reported gram - negative pathogens. where the likelihood is more than minimal of infection with methicillin - resistant staphylococcus aureus, pseudomonas aeruginosa, extended - spectrum -lactamase producing gram - negatives, or obligately anaerobic bacteria, antibiotics effective against these organisms should be considered. no one agent or regimen has shown superiority in treating dfis, but those with demonstrated efficacy include -lactams (penicillins and cephalosporins), glycopeptides (e.g., vancomycin), carbapenems, linezolid, clindamycin, and fluoroquinolones (22). the ability to appropriately initiate and then modify antibiotic therapy, based on culture results and clinical response is important (11). proper antibiotic management of lower extremity infections reduces complications and length of stay (23). infectious diseases specialists should be consulted when cultures yield multiple or antibiotic - resistant organisms, the patient has substantial renal impairment, or the infection does not respond to appropriate medical or surgical therapy in a timely manner. discharge planning should be initiated when the signs and symptoms of infection are clearly responding to treatment (resolution of the local and systemic signs of infection and improvement in white blood cell count). most patients can be transitioned from parenteral to oral antibiotic therapy to complete a course of therapy as outpatients. patients or caregivers may need training on how to apply dressings and offloading devices, and therapy for glycemic control will often need adjustment. it is important to arrange for timely outpatient follow - up with the appropriate provider(s) prior to hospital discharge. even when managed at specialized centers, about half of patients hospitalized for dfi undergo a lower extremity amputation within a year (24). some patients with moderate infections, and virtually all patients with severe infections, will require some type of surgical intervention. a limb preservation team must be able to perform bedside and intraoperative incision and debridement to decompress limb - threatening abscesses and debride nonviable tissue. surgeons involved in this care should have knowledge and interest in this aspect of limb preservation (25). if insufficient blood flow to the extremities impairs delivery of antibiotics or oxygen, revascularization should be done as soon as the major infection has been adequately addressed. in this regard, prompt drainage of infection with or without partial foot amputation takes priority over revascularization. with the exception of a limb or life threatening infection, it is best to optimize the patient s medical condition prior to surgical intervention. it is usually best not to delay needed surgery while monitoring the response to antibiotic therapy. if a delay in operative intervention is likely, appropriate deep cultures should be obtained before starting broad - spectrum antibiotics. although surgery for soft tissue infections may need to be done urgently or emergently (especially for necrotizing or gas - forming infections), resection of infected bone (if needed) can usually be undertaken electively (26). available evidence does not support the benefits of most available adjunctive treatments, although some patients may benefit from treatment with negative pressure wound therapy (27), granulocyte colony stimulating factors (28) or hyperbaric oxygen therapy (29). a recent systematic review has reported that interventions in wound healing, with the possible exceptions of hyperbaric oxygen therapy and negative pressure wound therapy, are not guided by high level evidence due to the lack of controlled studies and poor methodological quality (30). serial debridements until a clean wound is obtained may be necessary to assess the need for further resection or amputation. staging of surgical intervention has been demonstrated as an effective strategy for acutely infected limbs (3133). pre- and postdebridement cultures of deeper tissues are useful for tracking the effectiveness of the debridement procedure (34,35). in addition to obtaining deep cultures during the debridement, specimens of bone and soft tissue for histological and pathological analysis can also be helpful. some patients who are receiving antibiotics may not yield a positive culture, but pathological examination (particularly of the bone) may demonstrate changes of acute and chronic osteomyelitis. the goal of debridement is to drain abscesses and remove all infected and devitalized tissue until there is only normal tissue colors of red (muscle), white (bone, tendon, ligament) and yellow (fat) remaining. painting the wound and injecting sinus tracts with blue dye provides a visual guide to identify contaminated tissue requiring debridement. serial debridements may be necessary to achieve a clean wound base due to the presence of biofilm, antibiotic resistant bacteria, immunocompromised status, or a compromised blood flow state. when the wound is clean and the bacteria are either absent or adequately covered, plans can then be made for secondary reconstruction and closure. after the debridement is performed, the wound should be copiously irrigated with fluid, and postdebridement deep tissue cultures should be taken. if high pressure pulsatile lavage is used for irrigation, care should be taken to avoid further tissue injury and dissemination of the infection beyond the involved area. if the wound is clean, negative pressure wound therapy may be used to accelerate healing (27,36). if there is concern that the wound is still not clean, packing of the wound with moist sterile gauze (wet to dry dressing changes) allows for mechanical debridement. individuals with diabetes who sustain foot and ankle fractures have increased morbidity and worse outcomes than patients without diabetes (3740). adverse outcomes are related to both predisposing factors leading to fracture and the impaired ability to support healing from insult or injury. patients with diabetes are more likely to be both vitamin d deficient and have poor bone quality (41,42). bone quality and strength in patients with diabetes may be diminished due to numerous factors, including chronic hyperglycemia and microvascular disease (43). neuropathic patients are at risk for developing gait instability due to impairment of proprioception and balance. the frequent presence of visual impairment combined with decreased balance and proprioceptive feedback increases the potential for stumbling and falling, leading to fracture in bone that is incapable of tolerating otherwise subpathological forces. several key factors may be responsible for impaired wound and fracture healing in patients with diabetes, although acute wound closure in experimentally induced human wounds does not appear to demonstrate significant delay in healing (44). patients with diabetes have low levels of upregulating growth factors that promote neovascularization and the recruitment of pluripotential cells and may have impairment in recruitment of circulating white blood cells to the wound (45,46). as a result of these metabolic aberrations, the end result is delayed soft tissue and bone healing, failure of orthopedic hardware and propensity for developing infection. unique to the neuropathic individual is the potential for a seemingly trivial injury to initiate the process leading to the development of cn. surgery is a form of trauma, and operative treatment of fractures, revascularization or debridement of infection can also initiate a cn event although the exact incidence is unknown. mounting evidence suggests that in this patient population trauma, often trivial, leads to the release of specific cytokines that upregulate osteoclasts to absorb bone (41). this bony absorption, in a patient who already has impaired bone quality and loss of protective sensation, may be the impetus for the development of cn (41,47). early findings of cn include unilateral foot and/or ankle swelling, erythema, and warmth, and many patients are misdiagnosed at this stage as having infection, gout, or thrombophlebitis (48). the absence of a foot wound in a patient with signs of inflammation should prompt the clinician to consider cn, especially in the absence of signs of a systemic response to infection. the treatment of ankle fractures in neuropathic individuals is fraught with complications, resulting in increased potential for catastrophic outcomes leading to amputation, severe deformity, and disability (39,40). rigid internal fixation with augmented methods of achieving stability is indicated in even minimally displaced fractures due to the high risk of progression to the development of cn (49,50). the evidence available on managing fractures in the foot is not as clear, as it is difficult to distinguish between an acute foot fracture in a neuropathic patient and an acute presentation of cn (41). these patients should be treated on an individual basis, attempting to distinguish among acute fracture, neuropathic fracture, and the initial presentation of cn. patients hospitalized with diabetic foot disorders typically have significant comorbidities, and management of concurrent cardiovascular disease, renal disease, anemia, and hyperglycemia is critical. usually these patients are managed by a general internist or hospitalist, and appropriate consultative services such as cardiology, nephrology, infectious diseases, and endocrinology should be available. although the optimal intensity of inpatient glucose control remains in some dispute, there is an emerging consensus, supported by two recent guidelines, one focused on intensive care unit (icu) care (51), the other on non - icu settings in inpatient care (15). both guidelines are the result of input from representatives of major key organizations involved in the inpatient care of dm. the consensus is that although hypoglycemia is to be avoided, the major goal should be correction and avoidance of hyperglycemia. both guidelines set preprandial glycemic targets at 140 mg / dl for the majority of patients (15,51). the american college of physician guideline, which has not reviewed all of the more recent randomized studies, recommended glucose of > 140 mg / dl and a target range of 140200 mg / dl in critically ill patients (52). in the non - icu inpatient setting there are now 19 studies (9 randomized and 10 observational) to support this conclusion. a meta - analysis and systematic review of the 19 studies concludes that although intensive glycemic control in the inpatient setting is not associated with a significant effect on the risk of death, myocardial infarction, or stroke, it is associated with a decreased risk of infection (53). there is now unequivocal evidence from randomized studies that hyperglycemia in hospitals is associated with adverse outcomes (15,53,54). there is also earlier evidence that hyperglycemia is associated with impaired wound healing (55,56). there is, however, an association between intensive insulin therapy and an increased incidence of hypoglycemia, leading both recent guidelines to avoid glucose levels under 100110 mg / dl. although fear of hypoglycemia has limited some efforts at reducing hyperglycemia, the lack of association of hypoglycemic events during therapy for hyperglycemia suggests that severe hypoglycemia may be merely a marker for more serious underlying disease (55). insulin is the preferred agent for reducing glucose levels in hospitalized patients (53). in patients with increased insulin resistance, such as those with sepsis, infection, or in the perioperative period, insulin needs are often greatly increased even in the presence of reduced or absent caloric intake. there is strong evidence that the use of sliding scale insulin regimens as monotherapy without basal insulin, is inappropriate and leads to poorer outcomes and increased hyperglycemia (54). either basal / bolus insulin algorithms with supplemental or correction doses of intravenous insulin (i.e., sliding scale) may be required. in some cases the use of continuous, variable insulin infusions with appropriate algorithms are most appropriate, particularly with critically ill patients, those in the perioperative period, and in some patients with uncertain oral intake or very variable or large insulin requirements. the normal outpatient insulin dosage often needs to be modified in patients while hospitalized. while in some cases the outpatient dosage may be reduced, patients with severe physical stress such as sepsis secondary to a foot infection, typically require increased insulin to achieve glycemic control (15). factors which may alter dosing in hospital settings include factors that may reduce insulin dosage, such as reduced caloric intake, worsening renal failure, increased age, or marked weight loss. factors that may increase insulin requirements include severe hyperglycemia and/or ketosis, infection, fever, severe pain, myocardial infarction, surgical procedure, or corticosteroid therapy. for noncritically ill patients with type 2 dm, one guideline suggests as a dosing regimen for insulin therapy (15) : 0.20.3 units / kg body weight for patients aged 70 years of age and/or an estimated glomerular filtration rate < 60 ml / min 0.4 units / kg body weight for patients not meeting the criteria above who have glucose levels 140200 mg / dl 0.5 units / kg body weight for patients not meeting the criteria above when the glucose levels are 201400 mg / dl in each case, 50% of the insulin should be given as long - acting insulin as a basal dose and 50% as nutritional doses using short - acting insulin (15). frequent reassessment is required throughout the hospitalization due to potential changes in clinical status as a result of cessation of food intake or worsening renal failure. it is important that there be a hospital - wide effort to provide education and training for the team responsible for the glycemic control of the patient, including a nurse - based hospital - wide program to initiate treatment of hypoglycemia and to prevent its occurrence (15). patients hospitalized with diabetic foot problems frequently require surgery, which induces a period of heightened physiologic stress requiring a systematic and comprehensive approach to appropriately assess, and where possible mitigate, risk. patients with diabetes have an equivalent risk of myocardial infarction to those known to have atherosclerotic coronary disease (57). ischemic heart disease is frequently asymptomatic in persons with diabetes, and diastolic heart failure is highly prevalent (5861). despite the increased incidence of cardiac disease and its attendant risks, considerable evidence suggests that noninvasive cardiac testing or revascularization fails to reliably lower this risk before noncardiac surgery, particularly in diabetes patients receiving appropriate -blockade and lipid - lowering (statin) therapy (6264). in the patient without unstable cardiac conditions (i.e., recent myocardial infarction or unstable angina, decompensated heart failure, significant untreated rhythm disturbances, or severe aortic stenosis), available evidence suggests that proceeding to necessary surgery without a delay for additional cardiac testing is generally appropriate (65). patients receiving oral antidiabetic medications should have these held for 24 h prior to surgery. intravenous insulin is optimal in the immediate perioperative period for type 1 diabetes, as well as for many type 2 diabetic patients undergoing major procedures and should typically be continued until a patient resumes eating (66,67). when subcutaneous insulin is used, long - acting analogs (e.g., glargine and detemir) may be given at usual dose the evening before surgery, but the dose should be reduced if the patient s typical fasting blood sugars are lower than 90100 mg / dl. patients receiving intermediate acting insulin (e.g., nph) should receive 50% of their usual dose on the morning of surgery, and short / rapid acting insulin (e.g., regular or lispro) should be withheld. current data do not permit definitive recommendations regarding optimal postoperative glycemic control goals, but targeting premeal blood glucose values of < 140 mg / dl and random values of < 180 mg / dl as recommended for the majority of hospitalized patients by a recent american diabetes association position statement is reasonable (68). the inpatient team should aim to seamlessly perform appropriate postoperative monitoring to reduce risk of reulceration and infection after hospital discharge to home, a rehabilitation unit, or a skilled nursing facility. ideally, elements of the same team that manages the inpatient care should oversee transition to outpatient care for preventative measures as the foot moves into remission. in addition, to nurses familiar with diabetes education, the inpatient team should include a dietitian who can provide nutritional assessments and further education on the importance of ideal body weight and diabetes management. continued optimal glycemic control will improve the probability of successful wound healing. as with the foot care service, optimal outcomes in patients with diabetes require patients to be knowledgeable about their disease and its complications and able to provide appropriate self - care to achieve treatment goals. most patients will be responsible for self - management after a hospital stay, making it critically important for nurses to provide education on diabetes self - management concepts, including foot care during the patient s hospitalization. the joint commission and american diabetes association recommend that inpatient programs specifically include patient education because this provides the foundation for self - care. patients who do not receive education are more likely to develop a major complication and incur higher diabetes - related hospital costs, while those who do can improve hba1c levels, reducing risk for dm - related foot problems (69). foot care education is strongly associated with various improved outcomes, including reduced foot complications and amputation rates (70). although hospitalization offers an opportunity to educate diabetic patients, teaching during a hospital stay can be challenging given that inpatients are ill and have competing demands, such as scheduled diagnostic and therapeutic procedures. nevertheless, a hospital admission for a diabetes - related foot problem provides a unique teachable moment because patients may be motivated to prevent further problems. even though staff nurses have competing demands and limited time for education, it is essential that they address key diabetes content areas, i.e., nutrition, activity, medication taking and monitoring, and risk reduction. during the assessment, nurses gather information about a patient s experiences, knowledge, technical skills, beliefs, and support systems. nurses can identify educational gaps (e.g., nutrition understanding) and use hospital team resources for educational support (e.g., the dietitian). by careful observation and teaching, nurses can also play a pivotal role in reducing the risks of in hospital complications such as decubitus heel ulcers. the primary focus of the education should be to address what the patient perceives to be the most critical area needing attention and to help the patient to prioritize self - care plans. in the case of a patient hospitalized for foot problems, the information and skills necessary to assure proper attention to foot care skills can be evaluated and reinforced with routine procedures, including blood glucose testing and injections. return demonstration during wound care procedures and dressing changes, provide teachable moments for the patient and caregiver. it is unrealistic to expect that comprehensive diabetes education beyond the delivery of basic skills can be provided during a stressful hospital admission. therefore, the nurse needs to assist in the coordination of a discharge transition plan that includes appropriate follow - up with an outpatient education program visit, preferably at an outpatient site staffed by members familiar with the inpatient diabetic foot team. we recognize that assembling an interdisciplinary team of specialists may be difficult in certain hospital environments (table 4). the leader of the team can be from any specialty, with the major asset being a passion for this type of work. strategies for success include incorporating both the administrative and professional components of the hospital (table 5). hospital administrators will become enthusiastic supporters if the team can demonstrate a reduction in hospital length of stay. even a modest one - day shorter hospital stay can translate into a reduction in hospital costs. professional staff members will support this concept if improved outcomes can be demonstrated such as a reduction in major amputations. major amputations may be associated with increased mortality, decreased function, and increased cardiac demands. one of the most effective ways to promote the inpatient management of the diabetic foot disorders is through medical education. hospitals with large departments may provide an opportunity to speak at subspecialty conferences such as infectious disease, endocrinology, plastic surgery, vascular surgery, orthopedic surgery, and podiatry. both clinicians and administrators need to understand the epidemiology and profoundly negative impact that diabetic foot disorders have on patient outcomes. the mortality of patients presenting with an acute cn event or dfu is surprisingly high (71). in fact, the 5-year mortality of patients with newly diagnosed dfus is nearly 50% and carries a worse prognosis than breast cancer, prostate cancer, or hodgkins lymphoma (72). a paradigm shift in our thinking is necessary to improve outcomes of patients with diabetic foot disorders, and we should strive to emulate the contributions made in centers that specialize in trauma, burns, stroke, and cardiology. time equates to tissue loss, and prompt intervention in patients with diabetic foot disorders may preserve limbs and restore function. goals of inpatient diabetic foot service secrets for success in establishing an inpatient team for management of diabetic foot disorders in conclusion, hospital admission in patients with diabetes is unfortunately commonplace. foot complications in this already impaired population constitute a major danger to the overall well - being of the patient and to the fiscal capacity of a health system. consideration for development of effective, systematic, interdisciplinary teams that focus on skills for inpatient management should be a priority in these complex patients. the goals of this interdisciplinary team should be to provide comprehensive evaluation, thorough risk assessment, definitive treatment, and coordination of discharge planning in patients with diabetes who are hospitalized for foot problems. prevention of foot problems in patients with diabetes who are hospitalized for unrelated causes should also be a priority. | the implementation of an inpatient diabetic foot service should be the goal of all institutions that care for patients with diabetes. the objectives of this team are to prevent problems in patients while hospitalized, provide curative measures for patients admitted with diabetic foot disorders, and optimize the transition from inpatient to outpatient care. essential skills that are required for an inpatient team include the ability to stage a foot wound, assess for peripheral vascular disease, neuropathy, wound infection, and the need for debridement ; appropriately culture a wound and select antibiotic therapy ; provide, directly or indirectly, for optimal metabolic control ; and implement effective discharge planning to prevent a recurrence. diabetic foot ulcers may be present in patients who are admitted for nonfoot problems, and these ulcers should be evaluated by the diabetic foot team during the hospitalization. pathways should be in place for urgent or emergent treatment of diabetic foot infections and neuropathic fractures / dislocations. surgeons involved with these patients should have knowledge and interest in limb preservation techniques. prevention of iatrogenic foot complications, such as pressure sores of the heel, should be a priority in patients with diabetes who are admitted for any reason : all hospitalized diabetic patients require a clinical foot exam on admission to identify risk factors such as loss of sensation or ischemia. appropriate posthospitalization monitoring to reduce the risk of reulceration and infection should be available, which should include optimal glycemic control and correction of any fluid and electrolyte disturbances. |
dentinal tissue continues to represent a challenge as regards bonding with resin - based adhesives,1 because of its complexity and dynamism.2 this substrate has been characterized as a biologic composite of collagen matrix, filled with apatite crystallites, dispersed between parallel micrometer - sized hypermineralized, collagen - poor dentinal tubules containing peritubular dentin.3 in general, 50% of the chemical composition of dentin substrate is made up of minerals, 20% of water and 30% of organic matrix, but it is known that this composition may change according to the depth of tooth.4 this is due to the fact that superficial dentin has few tubules and is composed predominantly of intertubular dentin. deep dentin (near pulp) is composed mainly of larger funnel - shaped dentinal tubules with much less intertubular dentin.5 the intertubular dentin plays an important role during hybrid layer formation in superficial dentin, and the contribution to resin retention is proportional to the intertubular dentin available for bonding.6 although the concept of hybrid layers refers to resin - infiltrated demineralized inter - tubular dentin, the penetration of resin into each dentinal tubule, forming the so - called resin tags, should also be considered for hybrid layer formation. in this context, these tags represent a minor fraction of superficial dentin sealed by resin, but a significant fraction of bonded surfaces in deep dentin.6 the contribution of tags to the total bond strength is proportional to their cross - sectional area and the cohesive strength of the polymer.7 the relative contribution of resin tags and the relative contribution of hybrid layer to the total bond strength are dependent on dentin depth. however, not only should these dentinal structures be taken into account, but also the variation of water content that occurs according to the depth of dentin. this is important because a significant water content of dentin is confined to dentinal tubules, and since the density of tubules varies with dentinal depth, it is expected that the water content of dentin is higher in deep dentin and lower in superficial dentin.8 this is especially important when considering current adhesive systems which, according to their underlying adhesion strategy, can be classified as etch - and - rinse and self - etching, the latter type being subdivided according to its acidity into strong (ph<1), intermediately strong (ph~1,5) or mild self - etching adhesives (ph~2).9 for the etch - and - rinse adhesive systems, basically two steps are required : selective dissolution of hydroxyapatite crystals and exposure of collagen network through etching, followed by in situ resin polymerization. with the aim of determining the contribution of resin infiltration to dentin bond strength using an etch - and - rinse adhesive system on middle dentin, gwinnett10 demonstrated that bond strength to smear layer - covered dentin is approximately half of what it is to smear layer - free dentin, indicating that the smear plug prevented monomer penetration into tubules to form resin tags. moreover, it was observed that the intertubular dentin remained mineralized and this fact should have prevented the formation of a hybrid layer. in a similar way, the intermediately strong and mild self - etching adhesive systems are able to demineralize the superficial dentin layer, retaining the residual hydroxyapatite still attached to collagen. but in this case, the remaining hydroxyapatite crystals may be an advantage, because they serve as a receptor for additional chemical bonding with functional monomers contained in some self - etching adhesives.11 moreover, the solvent type (water, acetone, alcohol or an association between them) varies among the different adhesives, the dentin water content, or more specifically the wetness of dentin, being an important factor to achieve optimal bonds. gianinni stated that depending on the region where the bond is established and the adhesive system being tested, the dentin depth may affect the bond strength values. although these authors found that bond strength to middle and deep dentin was lower than it was to superficial dentin, a water - based adhesive system was used, and its performance in a region that has a higher water content, such as deep dentin, may be compromised. toledano investigated the bond strength of different adhesive systems to either superficial or deep dentin. they found that the highest values for bond strength to deep dentin were obtained with a water - based self - etching adhesive that contained the functional monomer 10-mdp, and also with an acetone - based etch - and - rinse adhesive. this indicates that among other factors, the type of solvent may be important for bonding in different regions of the tooth. the acetone solvent may act positively in deep dentin, where the water content is higher, because acetone is the most hydrophilic solvent and is an excellent water - chaser.14 therefore, considering the importance of different bonding strategies, composition, acidity, solvent contained in adhesive systems and the influence these factors may have on bond strength to different regions of the tooth, the aim of this in vitro study was to evaluate the microtensile bond strength of a two - step ethanol - based etch - and - rinse adhesive system, a mild two - step water - based self - etching adhesive system that has a functional monomer in its composition and a strong one - step acetone - based self - etching adhesive system to superficial and deep dentin. the hypotheses tested were that : (1) dentin adhesives bond equally well to superficial and deep permanent dentin ; (2) there is no difference between etch - and - rinse and self - etch adhesives in bonding to these respective dentin substrates. the factors under study were dentin depth, at two levels : superficial dentin (sd) and deep dentin (dd) ; type of adhesive system, at three sublevels : two - step etch - and - rinse adhesive system (adper single bond 2 (sb), 3 m espe) ; two - step self - etching adhesive system (clearfil se bond (se), kuraray) and a one - step self - etching adhesive system (futurabond (fb) / voco). the association between depth of dentin and type of adhesive system resulted in 6 experimental groups. the composition and description of each material used in this study are shown in table 1. after approval by the research ethics committee (protocol no.2006/0245), non - erupted human third molars extracted within a six - month period and stored in thymol (0.1%, ph 7.0) immediately after extraction were used in this experiment. teeth were submitted to debriding with scalpel blades and periodontal curettes. to obtain superficial dentin (sd), 24 teeth were flattened in a water - cooled polishing machine (politriz aropol 2v, arotec, so paulo, sp, brazil) with 400-grit aluminum oxide abrasive paper. the occlusal surface was flattened until a central area of dentin (measuring about 5x5 mm) was obtained, with only the central area of the resin - tooth block being used. dentin surfaces were controlled for the absence of enamel by checking with a stereo - microscope (ek3st, cqa, so paulo, brazil). to obtain deep dentin (dd), 24 teeth were flattened in a water - cooled polishing machine (politriz aropol 2v, arotec, so paulo, sp, brazil) with 400-grit aluminum oxide abrasive paper until there was an 1-mm thickness of dentin in the central area next to the pulp (about 5x5 mm), measured with a digital caliper (mitutoyo, tokyo, japan). the pulp chambers were prepared for filling with a composite resin in order to increase the stick lengths and facilitate their fixation to acrylic devices for the microtensile bond strength tests : internal dentine walls were cleaned and etched with a phosphoric acid (condac 37, lot # 310107, fgm produtos odontolgicos ltda, joinville, sc, brazil) for 15 seconds, washed for the same time and gently dried with absorbent paper. the adhesive system adper single bond 2 (lot#6ja, 3 m espe, st. paul, usa) was applied in two consecutive layers ; the remaining solvent was evaporated with a brief, gentle dry air jet for 10 seconds and light polymerized for 20 seconds. after that, the pulp chamber of each tooth was filled with a composite resin (filtek z250, ud color, lot 7at, 3 m espe, st. paul, usa) using the incremental technique and light polymerized with a halogen light curing unit (ultralux el, dabi atlante, ribeiro preto, sp, brazil). superficial and deep dentin specimens were randomly divided into three groups according to the adhesive system used (n=8). all bonding procedures were performed in accordance with the manufacturers instructions and are described in table 1. after that, a composite resin block (filtek z 250, a1 color, batches # 5ay and # 6yn, 3 m espe, st. paul, usa), measuring 5x5 mm (height x width) was built on the bonding surface, by the incremental technique. each layer of composite (approximately 2-mm thick) was individually light polymerized for 40 seconds, with a visible light - curing unit (ultralux el, dabi atlante, ribeiro preto, sp, brazil). finally, the restoration was light polymerized for 20 seconds on each of its two sides. the light - curing unit output was periodically measured with a radiometer (newdent equipamentos ltda, ribeiro preto, sp, brazil) with a mean range of 620 mw / cm. throughout specimen processing, tooth - resin blocks were sectioned perpendicular to the bonding surface into 1.0-mm thick slabs, using a water - cooled diamond disc in a sectioning machine (minitrom, struers a / s, copenhagen, denmark). by rotating samples 90 and again sectioning them lengthwise, multiple beam - shaped sticks were obtained, each with a cross - sectional surface area of 1.0 mm. subsequently they were individually measured with a digital caliper (mitutoyo, tokyo, japan) and attached to a device specifically for tbs testing, with a cyanoacrylate adhesive (super bonder gel, henkel ltda., they were subjected to tensile stress in a universal testing machine (mem-2.000 model, emic, so jos dos pinhais, pr, brazil), at a crosshead speed of 0.5 mm / min and a 50n load cell until fracture. the bond strength values were reported in mpa and derived by dividing the imposed force (in kgf) at the time of fracture by the bond area (cm). when the specimens failed before actual testing, the tbs was determined from the specimens that survived processing. comparison was made by using the mean of each tooth (6 sticks per tooth). fractured specimens were observed under a stereomicroscope (ek3st, cqa, so paulo, brazil) at 30x magnification to assess the failure modes, which were classified as adhesive (lack of adhesion), cohesive in dentin (failure of the dental substrate), cohesive in composite resin (failure of the resin composite) or mixed (adhesive and cohesive failures). means and standard deviations were calculated, and the data were analyzed by two - way analysis of variance (anova). the factors under study were dentin depth, at two levels : superficial dentin (sd) and deep dentin (dd) ; type of adhesive system, at three sublevels : two - step etch - and - rinse adhesive system (adper single bond 2 (sb), 3 m espe) ; two - step self - etching adhesive system (clearfil se bond (se), kuraray) and a one - step self - etching adhesive system (futurabond (fb) / voco). the association between depth of dentin and type of adhesive system resulted in 6 experimental groups. the composition and description of each material used in this study are shown in table 1. after approval by the research ethics committee (protocol no.2006/0245), non - erupted human third molars extracted within a six - month period and stored in thymol (0.1%, ph 7.0) immediately after extraction were used in this experiment. teeth were submitted to debriding with scalpel blades and periodontal curettes. to obtain superficial dentin (sd), 24 teeth were flattened in a water - cooled polishing machine (politriz aropol 2v, arotec, so paulo, sp, brazil) with 400-grit aluminum oxide abrasive paper. the occlusal surface was flattened until a central area of dentin (measuring about 5x5 mm) was obtained, with only the central area of the resin - tooth block being used. dentin surfaces were controlled for the absence of enamel by checking with a stereo - microscope (ek3st, cqa, so paulo, brazil). to obtain deep dentin (dd), 24 teeth were flattened in a water - cooled polishing machine (politriz aropol 2v, arotec, so paulo, sp, brazil) with 400-grit aluminum oxide abrasive paper until there was an 1-mm thickness of dentin in the central area next to the pulp (about 5x5 mm), measured with a digital caliper (mitutoyo, tokyo, japan). the pulp chambers were prepared for filling with a composite resin in order to increase the stick lengths and facilitate their fixation to acrylic devices for the microtensile bond strength tests : internal dentine walls were cleaned and etched with a phosphoric acid (condac 37, lot # 310107, fgm produtos odontolgicos ltda, joinville, sc, brazil) for 15 seconds, washed for the same time and gently dried with absorbent paper. the adhesive system adper single bond 2 (lot#6ja, 3 m espe, st. paul, usa) was applied in two consecutive layers ; the remaining solvent was evaporated with a brief, gentle dry air jet for 10 seconds and light polymerized for 20 seconds. after that, the pulp chamber of each tooth was filled with a composite resin (filtek z250, ud color, lot 7at, 3 m espe, st. paul, usa) using the incremental technique and light polymerized with a halogen light curing unit (ultralux el, dabi atlante, ribeiro preto, sp, brazil). superficial and deep dentin specimens were randomly divided into three groups according to the adhesive system used (n=8). all bonding procedures were performed in accordance with the manufacturers instructions and are described in table 1. after that, a composite resin block (filtek z 250, a1 color, batches # 5ay and # 6yn, 3 m espe, st. paul, usa), measuring 5x5 mm (height x width) was built on the bonding surface, by the incremental technique. each layer of composite (approximately 2-mm thick) was individually light polymerized for 40 seconds, with a visible light - curing unit (ultralux el, dabi atlante, ribeiro preto, sp, brazil). finally, the restoration was light polymerized for 20 seconds on each of its two sides. the light - curing unit output was periodically measured with a radiometer (newdent equipamentos ltda, ribeiro preto, sp, brazil) with a mean range of 620 mw / cm. throughout specimen processing, tooth - resin blocks were sectioned perpendicular to the bonding surface into 1.0-mm thick slabs, using a water - cooled diamond disc in a sectioning machine (minitrom, struers a / s, copenhagen, denmark). by rotating samples 90 and again sectioning them lengthwise, multiple beam - shaped sticks were obtained, each with a cross - sectional surface area of 1.0 mm. subsequently they were individually measured with a digital caliper (mitutoyo, tokyo, japan) and attached to a device specifically for tbs testing, with a cyanoacrylate adhesive (super bonder gel, henkel ltda., they were subjected to tensile stress in a universal testing machine (mem-2.000 model, emic, so jos dos pinhais, pr, brazil), at a crosshead speed of 0.5 mm / min and a 50n load cell until fracture. the bond strength values were reported in mpa and derived by dividing the imposed force (in kgf) at the time of fracture by the bond area (cm). when the specimens failed before actual testing, the tbs was determined from the specimens that survived processing. comparison was made by using the mean of each tooth (6 sticks per tooth). fractured specimens were observed under a stereomicroscope (ek3st, cqa, so paulo, brazil) at 30x magnification to assess the failure modes, which were classified as adhesive (lack of adhesion), cohesive in dentin (failure of the dental substrate), cohesive in composite resin (failure of the resin composite) or mixed (adhesive and cohesive failures). means and standard deviations were calculated, and the data were analyzed by two - way analysis of variance (anova). considering the dentin depth, data analysis revealed that the superficial dentin showed the highest microtensile bond strength values, which differed statistically from those obtained in the deep dentin, irrespective of the adhesive system used (table 2 and figure 1). for both superficial and deep dentin, futurabond yielded the highest bond strength values, which were statistically similar to the bond strength values of clearfil se bond, but statistically different from those obtained when the single bond adhesive system was used. clearfil se bond and adper single bond 2 adhesive systems presented statistically similar bond strength values between them. considering the fractures of specimens (table 3), all groups showed a predominance of adhesive fractures, with a minor fraction of fractures occurring in the resin (cohesive in composite resin). none of fractures were classified as cohesive in dentin or mixed (involving dentin and composite resin). the results of the present study revealed that superficial dentin presented bond strength values that were statistically higher and different from values obtained in deep dentin. theoretically, the bond strength of dentin - bonding agents at any depth is dependent on the area occupied by resin tags, the area of intertubular dentin that is infiltrated by the resin and the area of surface adhesion.13 but, even if deep dentin were capable of producing higher bond strengths due to an increase in the total surface area available for forming hybridized tubule walls and intertubular dentin, the opposite has been found.12,1517 toledano speculated that even in the absence of dentin perfusion, contemporary adhesives may produce variable bonding results in superficial and deep dentin due to variations in their composition and the bonding approach. considering the adhesive systems and the depth of dentin, the results of the present study showed differences in bond strength of the tested adhesives, with the type of solvent and the ph of the adhesive system being important for the achievement of good bond strength to dentin. although the application of futurabond self - etching adhesive was incapable of yielding similar bond strength values between deep and superficial dentin, it yielded the highest bond strength values when the adhesive systems were compared in isolation. these values were statistically similar to those obtained when the clearfil se bond self - etching adhesive was used. futurabond is a one - step self - etching adhesive consisting of organic acid combined with hydrophobic monomers and hema, all dissolved in acetone. self - etching adhesive systems have been referred to as being user - friendly and less technique - sensitive because this approach eliminates the rinsing phase and the risk of making errors during application.18 this may have acted as a factor that influenced the results to some extent. moreover, the acetone solvent present in the futurabond adhesive is an excellent water - chaser, capable of avoiding residual water in dentin during its application. even when there are relatively few tags, such as in superficial dentin, they may be important for resin retention. but polymer tags could contribute to this retention if they are firmly attached to the walls of tubules.6 for this to occur, the peritubular dentinal matrix must be removed to expose the circumferentially oriented collagen fibrils. the aggressiveness of futurabond, represented by its low ph, may have acted positively by demineralizing the dentin matrix and probably helping the tags to bond to the exposed collagen inside the tubules. toledano stated that prolonging the time between adhesive application and drying should be considered in order to increase dentin bond strength, because it probably resulted in more optimal water permeation within this adhesive, contributing to a more complete dissociation of the acid functional monomers, and enhancement of the resin monomer infiltration. this was not considered in the present study, but the acetone - based adhesive could perform differently in deep dentin, if alternative bonding strategies were used instead of the manufacturer s instructions. although the water - based clearfil se bond adhesive does not have a low ph and is classified as being moderately aggressive (ph ~2.1), the bond strength values of this adhesive to both deep and superficial dentin were statistically similar to those of the futurabond group. the clearfil se bond has an acidic primer that is applied, followed by the application of the bond resin, without the rinsing phase. this low - sensitive technique, similar to that of futurabond, could be a factor that really influenced bonding to dentin. in addition to forming a micromechanical bond to dentin, this adhesive system is believed to incorporate a chemical interaction with the calcium in dentin because of the 10-mdp functional monomer, which has been rated as the most promising monomer for chemical bonding to the hydroxyapatite of enamel or dentin.20 perdigo stated that clearfil se bond is capable of providing consistently strong bonds to enamel and dentin, and the good performance of this adhesive system may be partly attributed to the intense chemical bond to tooth tissue.11 the two - step etch and rinse adper single bond 2 adhesive, which has the more sensitive technique, yielded statistically similar bond strength values to those obtained with the clearfil se bond, but different from the futurabond values, this difference being most evident in deep dentin. once again, increasing the sensitivity of the bonding technique, because of the conditioning and rinsing steps, may lead to more operating errors. this occurs because the ideal situation, in which this adhesive system completely penetrates demineralized dentin, is more difficult to achieve.9 the results of adper single bond 2 adhesive system in deep dentin can also be attributed to its specific composition, because this adhesive contains water and ethanol as solvents. toledano observed extensive nanoleakage with this adhesive and the authors stated that the presence of hema in this adhesive can lower the vapor pressure of water, with the water being more difficult to remove22 from demineralized deep dentin, thus impairing the diffusion of the bisphenol a diglycidyl ether dimethacrylate (bis - gma) resin monomer. moreover, incomplete resin infiltration can be caused by the acid copolymer,22 a component incorporated into the composition of adper single bond 2. the aim of the present study was to evaluate the influence of different bonding strategies on the bond to deep and superficial dentin, but bonding tests were performed 24 hours after the restorations were done. however, the durability of bonds between the adhesive system and dentin is of critical importance for the longevity of restorations because of the degradation that occurs at the adhesive interface. with respect to this factor, osorio demonstrated that self - etching adhesives with a ph < 1 and containing water or acetone as solvent yielded catastrophic bond failure after 1 year of water storage. therefore, although the results obtained in this study demonstrated good prospects for self - etching adhesives, their performance in a long - term degradation process should be carefully evaluated. bond strength obtained in superficial dentin was significantly higher than in deep dentin, for all adhesive systems tested. bonding to different regions of the tooth may be influenced by the type of solvent, with the acetone solvent from one - step adhesives being more indicated for achieving good bonding, particularly in deep dentin ; and by the presence of functional monomers (such as the 10-mdp) in water - based adhesives. although the bond strength of the etch - and - rinse adhesive system did not attain the values of the one - step acetone - based adhesive, its values were comparable with those of the two - step, water - based adhesive. | objectives : to evaluate the effect of different bonding strategies on the microtensile bond strength to deep and superficial permanent dentin.methods:forty-eight teeth were randomly flattened according to the dentin depth : superficial dentin (sd) and deep dentin (dd). subsequently, three adhesive systems were applied (n=8) : an etch - and - rinse (adper single bond 2 - sb), a mild two - step self - etching (clearfil se bond - se) and a one - step self - etching adhesive system (futurabond fb). each specimen was restored with a composite resin and sectioned into 1.0-mm2 thick slabs. after 24 hours, resin - dentin sticks were submitted to tensile stress in a universal testing machine (0.5 mm / min). data were submitted to two - way anova and tukey s test at a level of 0.05%.results : superficial dentin showed the highest microtensile bond strength values, which differed statistically from those obtained in the deep dentin, irrespective of the adhesive system used. fb yielded the highest bond strength values, which were statistically similar to the bond strength values of se, but statistically different from those obtained when the sb adhesive was used.conclusions:bond strength obtained in superficial dentin was significantly higher than in deep dentin, for all adhesive systems tested. adhesion was affected by the different bonding strategies : the one - step, low ph, acetone - based self - etching adhesive promoted the higher bond strength values, which were statistically similar to those obtained with the two - step, water - based self - etching adhesive. |
whole slide digital imaging (wsdi) offers an alternative to glass slides for diagnostic interpretation. prior work has mainly focused on wsdi for frozen section interpretation, with fewer studies on routine pathologic diagnosis and secondary consults.[19 ] wsdi presents an attractive alternative to shipping glass slides for expert consultation in diagnostically challenging cases, eliminating turnaround time and potential damage or loss of diagnostically critical glass slides. our institution has provided digital slide consultations for 2 affiliated hospital, zhejiang university, china, since 2010 and has utilized digital pathology embedded within the department for research and tumor boards since 2008. one high volume and diagnostically challenging area in pathology that could benefit from rapid expert consultation is the evaluation and grading of dysplasia in esophageal and gastric biopsies. we are unaware of prior studies addressing the use of wsdi for the evaluation of dysplasia in upper gi tract biopsies. thus, we undertook the present study to examine the accuracy and efficiency of wsdi in diagnosing gi dysplasia. both inter- and intraobserver variability in the glass slide diagnosis of esophageal dysplasia, even among expert pathologists, has been reported,[1013 ] and our intention in this study was not to repeat these prior studies. rather, given our prior experience with digital image diagnosis and our expertise in gastrointestinal pathology, we sought to establish whether diagnostic variability between glass slides and wsdi was similar or different than those reported for glass slide to glass slide evaluation. one hundred of cases of upper gi biopsies with diagnosis of negative, indefinite, low grade or high grade dysplasia were identified from the ucla pathology database. two of the authors (dg and sd) performed case selection and subsequent statistical analysis, but were not involved in interpreting digital images for this study. forty - two cases (37 esophageal and 5 gastric) were selected for inclusion, as were a control set of 10 cases with classic diagnostic features (tubular adenoma - 3 cases, sessile serrated adenoma - 2 cases, hyperplastic polyp, rectal adenocarcinoma, barrett 's esophagus without dysplasia, esophageal squamous mucosa with no dysplasia, and normal colonic mucosa). criteria for inclusion included cases in which the two case screeners agreed on the diagnosis and slides that were free of artifacts (folded tissue, uneven sections, bubbles, thick sectioning, unusually dark or light h and e stains) that can result in poor quality digital images. the final study set included 13 cases negative for dysplasia, 9 cases indefinite for dysplasia, 11 cases of low grade dysplasia, and 9 cases of high grade dysplasia [figure 1 ]. degrees of dysplasia : negative (a) indefinite (b) low grade (c) high grade (d) (hematoxylin - eosin stain, original magnification : 10) glass slides were anonymized to ensure pathologists were blinded to the diagnosis and scanned at 20x with an aperio xt scanner (aperio technologies, vista, ca) by translational pathology core laboratory (ucla). the initial screeners (dg and sd) reviewed all digital images to ensure they were in focus and of high quality. four specialty trained gastro - intestinal pathologists (bn, sh, dd, gc) with varying experience as an attending pathologist (6 months, 3 years, 9 years, and 13 years of experience) and computer skills reviewed the wsdi, then the glass slides after a minimum period of 34 weeks. digital images were reviewed on standard dell monitors with 1280 1024 pixel resolution and our computers were equipped with ati radeon hd2400xt video cards. final diagnosis, time required, problems encountered and whether or not the pathologist felt the need for 40x magnification were recorded for all cases. the time required for the diagnosis was recorded by each pathologist from the time the digital slide opened in the aperio viewer to diagnosis or from the time the slide was placed on the microscope stage to diagnosis. since the intention of this study was to examine variability in diagnosis between wsdi and glass slides, only intraobserver variability was calculated. three different sets of intraobserver variability statistics were calculated for each pathologist : wsdi to glass diagnosis for the set of control slides, wsdi to glass diagnosis for dysplasia and glass to glass diagnosis for dysplasia. for dysplasia cases, intraobserver variability was calculated using two different criteria, as used by previous authors : one approach used three clinically relevant categories (negative, indefinite / low grade, high grade) and the second approach used all four diagnostic categories (negative, indefinite, low grade, and high grade). a major diagnostic discrepancy was defined as a diagnosis of negative for dysplasia in one media versus a finding of any other diagnosis (indefinite, low grade, or high grade dysplasia) in the other. a minor discrepancy was defined as a difference in the grade of dysplasia assigned. for the control slides, a minor diagnostic discrepancy was defined as a difference in dysplasia grade and a major diagnostic discrepancy was defined as any diagnosis other than that 's pathologist 's glass slide diagnosis or the diagnosis of the two authors who selected the cases. kappa coefficient can be thought of as the chance - corrected proportional agreement, and possible values range from + 1 (perfect agreement) to 0 (no agreement above that expected by chance) to 1 (complete disagreement). all pathologists showed perfect correlation (1.0) between wsdi and glass diagnosis for the set of 10 control slides. all diagnoses also correlated perfectly with the diagnoses assigned by the two authors selecting the cases. as expected, in the set of dysplasia slides, all pathologists had major and minor discrepant diagnoses on wsdi to glass slide review and for glass to glass slide review. intraobserver kappa values for both wsdi to glass and glass to glass review were improved when calculated on the three clinically relevant categories [table 1 ]. intraobserver k values for three clinically relevant categories and for four categories overall, there was more variation in kappa values for wsdi to glass interpretation. table 1 shows the kappa values for each pathologist as calculated by the three clinically relevant categories or by all four categories. for wsdi to glass review, the kappa statistics were 0.36 (fair), 0.42 (moderate), 0.71 (good), and 0.78 (good) for the three clinically relevant categories and 0.28 (fair), 0.37 (fair), 0.63 (good), and 0.75 (good) for all four categories. for glass to glass review, the kappa statistics were 0.58 (moderate), 0.70 (good), 0.70 (good), and 0.75 (good) for the three clinically relevant categories and 0.50 (moderate), 0.56 (moderate), 0.64 (good) and 0.68 (good) for all categories. two pathologists had lower kappa values for wsdi in both sets of kappa calculations, while one pathologist had higher kappa value for wsdi [table 1 ]. table 2 shows the percentage of discrepant diagnoses by pathologist for both wsdi - glass and glass glass review. with wsdi, total discrepant diagnoses (major plus minor) for each pathologist ranged from 17% to 55%. major discrepancies ranged from 7% to 29% and minor discrepancies from 10% to 33% [table 2 ]. for glass glass review, total discrepant diagnoses (major plus minor) for each pathologist ranged from 21% to 36% ; major discrepancies ranged from 7% to 14% and minor discrepancies from 12% to 24% [table 2 ]. no correlation was noted between a pathologist 's experience and percentage of discrepant diagnoses on wsdi interpretation. review time and discrepancies for each pathologist the specific diagnoses on glass and wsdi slides in the discrepant cases are listed in table 3. discrepant dysplasia diagnoses between wsdi and glass slides occurred in 57 of 168 (34%) total possible incidences (4 pathologists 42 slides = 168 incidences). in 14 of these 57 discrepancies (25%), this involved only one pathologist with a discrepancy between their glass and wsdi diagnosis. in 16 of the 57 discrepancies (28%), two pathologists were discrepant between their glass and wsdi diagnosis, and in 27 of the 57 incidences (47%), three of four pathologists had discrepancies between their glass and wsdi diagnosis. discrepant dysplasia diagnoses from glass to glass review occurred in 48 of 168 (29%) total possible incidences. in 14 of these 48 incidences (29%), this involved only one pathologist with a discrepancy between the two passes on glass slide. in 9 of the 48 incidents (19%), two pathologists were discrepant, in 4 of the 48 incidents (8%) three of four pathologists had discrepancies, and in 1 of the 47 incidents (2%) all four pathologists were discrepant between their first and second review of the glass slides. specific diagnoses in the discrepant cases (wsdi vs glass) pathologists generally downgraded the degree of dysplasia on wsdi compared to the glass slides [tables 4 and 5 ]. dysplasia downgrading occurred in 53 of 60 wsdi cases (88%) and in 24 of 48 second review glass cases (50%). for wsdi, this included 26 of 29 cases (90%) with major discrepancies [table 3 ]. seven cases were upgraded on wsdi by three of the four pathologists ; three cases indefinite on wsdi were called negative on glass, two cases low grade on wsdi were diagnosed as indefinite on glass, and two cases high grade on wsdi were interpreted as low grade on glass. scanning at 40 was requested in 10 cases ; in 4 of these cases, the pathologist 's diagnosis was discrepant between wsdi and glass images. dysplasia downgrading or upgrading (wsdi vs glass) dysplasia downgrading or upgrading (glass pass#1 vs glass pass#2) wsdi review required more time than glass slide review (range 50% to 400% longer), depending on the case and the pathologist [table 2 ]. the time required for glass slide review was similar for the first and second glass slide review. other comments for wsdi interpretation included three cases for which the pathologist mentioned that the location of the biopsy would have helped and one case was far too blue / dark to accurately evaluate nuclear atypia. prior studies in frozen section correlation and second opinion diagnoses have indicated that digital slide review can enhance efficient use of expert pathologists time, increase the experience of reviewers for frozen sections and result in more rapid second opinion diagnoses.[14 ] the number of hospitals and reference labs with scanners continues to increase, and it is likely this will increasingly become part of routine pathology practice. wsdi has been utilized by the ucla department of pathology since 2008, including substantial experience with the use of wsdi for tumor boards and research studies. since 2010, prior internal studies involving digital interpretation of routine gi cases show our pathologists have perfect concordance (kappa 1.0) between wsdi and glass slides for routine cases such as gastric adenocarcinoma, barrett 's esophagus without dysplasia, chronic gastritis with or without h. pylori and candida esophagitis. however, we wished to further establish whether there might be difficulties in digital interpretation of more diagnostically challenging cases such as gi dysplasia, especially as questions related to gi dysplasia represent a large part of our current glass slide consultation practice. indeed, for wsdi interpretation to become fully integrated into pathologists routine practice, wsdi interpretations need to be comparable to their glass slide interpretations for all cases, both routine and challenging. our results show a greater range of intraobserver variability for wsdi to glass versus glass to glass interpretation among a group of four specialty trained gi pathologists. as reported by others, our kappa values were higher when clinically relevant categories (negative, indefinite / low grade, high grade) were considered. kappa values for three clinically relevant categories (negative, indefinite / low grade, high grade dysplasia) on wsdi were fair for one pathologist (0.36), moderate for one pathologist (0.42) and good for two pathologists (0.71 and 0.78) ; by contrast, for glass - to - glass kappa values were moderate for one pathologist (0.58) and good for three pathologists (0.70, 0.70, and 0.75). our kappa values for intraobserver variation of dysplasia for glass - to - glass interpretation are similar to that previously reported by montgomery and colleagues. in that study, kappa values ranged from 0.64 to 0.68 for the clinically relevant categories and 0.420.76 for the distinct histologic categories, compared to our values of 0.580.75 and 0.500.68, respectively. one pathologist in our group showed a large jump in kappa scores between media, from a fair score for wsdi - glass (0.42) to the highest kappa score (0.75 - good) for glass - glass review. interestingly, this pathologist reported a lack of diagnostic confidence in several wsdi cases (10 of 42 total cases, or 24%), and indicated the need for glass slide review in these cases to render an accurate diagnosis. this suggests that pathologists will have different degrees of comfort in adapting this new technology to their practice, especially for more subtle and problematic diagnoses (like dysplasia grading) as compared to diagnosing cancer versus normal tissue. another pathologist had the lowest kappa score on both wsdi and glass, which suggests that intrinsic factors that account for intraobserver variability may not be significantly influenced by the medium (digital versus glass) used for interpretation. these findings suggest that pathologists who decide to use wsdi for interpretation of gi dysplasia cases may benefit from regular, on - going, re - review of paired digital and glass images for continuing education, at least in the early stages of adoption. the most unexpected and significant result of our study is the finding that pathologists overwhelmingly downgraded dysplasia grade in wsdi versus glass slides. we did not expect this result at the beginning of the study, and thus did not design our study to address this finding specifically. possible causes include scanning magnification, color balance / dynamic range of the wsdi relative to glass slides, quality / resolution of the viewing monitors, and pathologist experience with dysplasia diagnosis using digital microscopy. while the scanning magnification used in this study (20) could play a role, pathologists only indicated the further need for 40 magnification in 10 out of a total of 168 cases. moreover, only 4 discrepant diagnoses were found out of the 10 cases where 40 magnification was requested. thus, while scanning magnification may have contributed to some discrepant diagnoses, it did not account for all discrepancies. in our study, pathologists used their standard computer monitor for imaging viewing. it is possible that interpretation using a high resolution monitor (such as barco coronis fusion wide - screen diagnostic color display system) or a larger monitor would have led to different results. one pathologist did mention that one wsdi was too blue and dark to interpret nuclear detail properly ; it is possible that subtle variations in color balance or dynamic range in the digital images led to misinterpretation of nuclear features which are critical for the evaluation of dysplasia. finally, it is possible that, with experience, there would be fewer cases of downgrading on digital images. wsdi took two to four times longer than glass slide interpretation for all pathologists. with multiple slides and cases pathologists may become faster in wsdi interpretation with experience, and we plan additional studies to address this question. however, for the present, wsdi does present additional technical challenges relative to glass slides. these include the speed with which images can be loaded into the viewer and the quality of the display monitor. furthermore, most digital slide viewers continue to rely on standard computer accessories (mouse and keyboard) that limit efficiency and ease of viewing. differences in hardware (scanners) and software (viewers) may impact the pathologist 's interpretation of the image reviewed or their diagnostic confidence. scanning at 40 takes significantly longer than 20 scans, and varies depending on the size of tissue being scanned and the scanner itself. we find 40 scans require from 50% to 500% more scanning time in our laboratory and result in files several fold larger than those of 20x scans. in a routine high throughput clinical practice, these incremental differences could significantly impact scanning time and server storage space. as a profession, we believe several of the concerns raised by this study (time required, discrepancies, confidence in diagnosis) are related to our limited experience with digital dysplasia diagnosis and speculate these problems will dissipate with increased usage of the digital platform. moreover, the rapid improvements witnessed in the hardware and software used for digital slide scanning and interpretation also would be expected to mitigate some of these concerns. in conclusion, our results indicate that pathologists can interpret upper gi dysplasia similarly on wsdi and glass slides, and thus wsdi potentially can be used for clinical diagnosis. however, some pathologists may encounter more challenges than others in using wsdi for this purpose. pathologists who adopt wsdi for the evaluation of gi dysplasia cases presumably should benefit from regular, on - going, re - review of paired digital and glass images for continuing education, at least in the early stages of adoption. furthermore, until additional studies are available, we believe our data support a judicious approach to digital dysplasia interpretation and indicate that, in some cases, pathologists may prefer to review the glass slides in order to render a diagnosis with confidence. | background : whole slide digital imaging (wsdi) offers an alternative to glass slides for diagnostic interpretation. while prior work has concentrated on the use of whole slide digital imaging for routine diagnostic cases, this study focuses on diagnostic interpretation of digital images for a highly challenging area, upper gastro - intestinal (gi) dysplasia. the aim of this study is to study the accuracy and efficiency of wsdi in the diagnosis of upper gi tract dysplasia.materials and methods : forty - two hematoxylin and eosin (h and e)-stained slides representing negative, indefinite, low grade and high grade dysplasia were selected and scanned at 20x (aperio xt). four attending gi pathologists reviewed the wsdi, then glass slides, with at least 34 weeks between each media ; glass slides were re - reviewed 1618 months later.results:intraobserver variability for three clinically relevant categories (negative, indefinite / low grade, high grade) was wider for wsdi to glass (kappa range 0.360.78) than glass to glass (kappa range 0.580.75). in comparison to glass slide review, wsdi review required more time and was associated with an unexpected trend toward downgrading dysplasia.conclusions:our results suggest : (1) upper gi dysplasia can be diagnosed using wsdi with similar intraobserver reproducibility as for glass slides ; however, this is not true for all pathologists ; (2) pathologists may have a tendency to downgrade dysplasia in digital images ; and (3) pathologists who use wsdi for interpretation of gi dysplasia cases may benefit from regular, on - going, re - review of paired digital and glass images to ensure the most accurate utilization of digital technology, at least in the early stages of implementation. |
animals : we collected 32 male and 25 female ryukyu long - furred rats. those were thought to have been killed by vehicles from december 2005 to september 2013 in the yambaru district, northern okinawa - jima island, japan (26002700n, 1273012830e), which is in the subtropical zone. total body length (tbl) and body weight (bw) were measured to within 1 mm and 1 g, respectively. lacteal gland thickness over 1 mm and teat length over 3 mm were defined as thick lacteal glands and elongated teat, respectively, for descriptive purposes in this study. testes (males) and ovaries and uteri (females) were surgically removed. the size of testes and preputial glands was measured at the point of greatest diameter and width, respectively, in 1 mm increments. ovaries were weighed to the nearest 0.1 g. ovary weight and the size of testes and preputial glands were presented as the average values of the bilateral organs. the presence of follicles and corpora lutea in ovaries, and fetuses and placental scars in uteri, was examined macroscopically. female that had large antral follicles (> 3 mm), large corpora lutea (> 3 mm), fetus or thick lacteal glands was defined as reproductively active in this study. testes were fixed in bouin s solution or 10% neutral buffered formalin for histological observation. if sampling or measurement was not possible because of damage or decay, data from that specimen were not used. histological observations : fixed testes were dehydrated and embedded in paraffin according to standard procedures. tissue sections (4 m thick) were stained with hematoxylin and eosin and observed using a light microscope (bz-9000, keyence, osaka, japan). the short diameter of 10 randomly selected round seminiferous tubules (long diameter / short diameter 3 mm), large antral follicles (> 3 mm), thick lacteal glands or fetuses) were not observed in females. table 1table 1.characteristics of each developmental stage in ryukyu long - furred ratscharacteristicjuvenilesub - adultadultcoat appearancesilky gray hairs on trunkthe coat resembles that of adult in appearance ; however, silky gray hairs remain on lower backyellowish brown hairs and partly long(more than 50 mm) bristle - hairs on backtotal body length (mm)less than 500500560more than 560mean sdmale : 621 30 (n=18)female : 594 16 (n=8)reproductionsexually immaturesexually immaturesexually mature. the number of animals allocated to each developmental stage and month for both sexes is shown in table 2table 2.the number of animals allocated to each developmental stage and month for both sexes (male / female) in this studyjanfebmaraprmayjunjulaugsepoctnovdectotaladult0/31/10/01/02/11/11/02/10/12/02/03/115/9subadult0/00/01/00/00/31/10/30/01/20/00/00/0 3/9juvenile0/20/00/10/00/00/11/10/00/00/00/01/1 2/6total0/51/11/11/02/42/32/42/11/32/02/04/2 20/24. adults had yellowish - brown hair, some long (> 50 mm) bristle hairs on their backs (fig. most animals (12 of 15 males and 6 of 9 females) with tbl > 560 mm were sexually active or mature. the coats of subadults resembled those of adults except for silky gray hair on the lower back (fig. 1b), and the tbl of subadults ranged from 500 to 560 mm. body weights of adult male and female were 587 121 g (n=12) and 570 108 g (n=6), respectively. appearance of ryukyu long - furred rats in juvenile (a), sub - adult (b) and adult (c). relationships between total body length and sexual maturation in males (a) and females (b). solid squares indicate females with corpora lutea, elongated teats or placental scars, which are indicative of the sexual maturation. open squares indicate females with no corpus luteum, short teats or no placental scar. in this study, indicators of sexually activity (large corpora lutea (> 3 mm), large antral follicles (> 3 mm), thick lacteal glands or fetuses) were not observed in females. morphology of the male reproductive organs : male reproductive organs consisted of paired testes, urethra, penis and associated ducts and glands (i.e., seminal vesicles, prostate, bulbourethral gland and preputial gland) (fig. 3afig. 3.reproductive organs in a sexually mature male (a) and female (b) in the estimated breeding period.. the preputial glands of adults were significantly larger during september through february (23.7 5.6 mm, n=13) than during march through august (13.5 4.6 mm, n=9) (fig. 4.seasonal changes in seminiferous tubule diameter (a) and testis length (b) in sexually active and inactive adult males, and preputial gland width (c) in adult males and females. solid circles indicate sexually active males with spermatozoa in the seminiferous tubules (a, b). open circles indicate sexually inactive males with no spermatozoa in the seminiferous tubules (a, b).). reproductive organs in a sexually mature male (a) and female (b) in the estimated breeding period. seasonal changes in seminiferous tubule diameter (a) and testis length (b) in sexually active and inactive adult males, and preputial gland width (c) in adult males and females. solid circles indicate sexually active males with spermatozoa in the seminiferous tubules (a, b). open circles indicate sexually inactive males with no spermatozoa in the seminiferous tubules (a, b). testes : seasonal changes in seminiferous tubule diameter and testes length in adult males are shown in fig. the seminiferous tubule diameter in adult was significantly small (136 28 m, n=8) from april to august and significantly large (216 27 m, n=12) from september to february (fig. 4a). from april to august, three out of eight adult rats had no spermatozoa in the seminiferous tubules, and their seminiferous tubules contained sertoli cells and germ cells from spermatogonia to degenerating round spermatids (fig. 5a and 5bfig. 5.seminiferous tubules of adult ryukyu long - furred rats in the estimated non - mating (may ; a, b) and mating (october ; c, d) seasons. (b) and (d) are high maginification figures of (a) and (c), respectively. se, sertoli cells ; spg, spermatogonia ; spc, spermatocytes ; rsp, round spermatids ; sp, elongate spermatids. the seminiferous tubules contained sertoli cells and germ cells from spermatogonia to spermatozoa (fig. 5c and 5d). the length of testes changed in a similar manner ; testes were significantly short (16.2 2.0 mm, n=7) from april to august and long (23.4 5.2 mm, n=11) from september to february in adults. the diameter of seminiferous tubules and the length of testes in immature animals (subadults and juveniles) were 106 38 m (n=5) and 11.7 5.7 mm (n=6), respectively. seminiferous tubules of adult ryukyu long - furred rats in the estimated non - mating (may ; a, b) and mating (october ; c, d) seasons. (b) and (d) are high maginification figures of (a) and (c), respectively. se, sertoli cells ; spg, spermatogonia ; spc, spermatocytes ; rsp, round spermatids ; sp, elongate spermatids. morphology of the female reproductive organs : female reproductive organs consisted of paired ovaries and oviducts, uterus, cervix (fig. seasonal changes in adult female preputial glands were small (13.6 5.1 mm, n=9). ovary, uterus and mammaries : we did not detect large antral follicles, fetuses, thick lacteal glands or large corpora lutea. because of the small corpora lutea and follicles, ovary weight was low throughout the year (0.09 0.05 g, n=7) with one exception. in that case, the ovaries weighed 0.20 g, and many small follicles (approximately 2 mm diameter) were observed. on the other hand, of the seven adult females collected throughout the year, three (43%) had small corpora lutea (approximately 12 mm diameter). six (60%) out of the ten adult females collected throughout the year had elongated teats, and four (50%) out of eight adult females collected throughout the year had placental scars. coat appearance and body size are basic growth indicators that enable estimation of developmental stage by observation of mammals in the wild. although coat characteristics in adult ryukyu long - furred rats have been reported previously, relationships between coat appearance, tbl and sexual maturity have been clarified in the present study. the degree of sexual maturity can be estimated by coat appearance or morphometric characteristics in many species. for example, in eastern gray squirrels (sciurus carolinensis), fur on the rumps of adults has a distinct yellowish streak near the base that is absent in juveniles. in the large japanese field mouse (apodemus speciosus), most males with bw > 30 g and most females with bw > 25 g have attained sexual maturity. the morphology of ryukyu long - furred rat reproductive organs, except for the preputial glands, resembled that of other rodents, such as laboratory rats. preputial glands of the ryukyu long - furred rat were very large in males, and the size of these glands was synchronized with reproductive activity. some rodents, such as the south american water rat (nectomys squamipes), have fairly large preputial glands, which produce sex pheromones in males and females. in male laboratory mice, sex pheromones secreted from preputial glands may provide an important form of communication in the wild for the ryukyu long - furred rat. environmental factors including food availability, ambient temperature, rainfall and the day / night cycle influence seasonal reproductive changes in wild mammals. the seasonal changes in seminiferous tubule diameter and testes length, and the lack of spermatozoa in early summer in adult males indicate that the ryukyu - furred rat would be a seasonal breeder. the potential mating season in this species is relatively long (september to february), as indicated by the large reproductive organs in males during this period. small mammals generally have a longer reproductively active season than large or long - lived mammals, which represents an opportunistic breeding strategy for short - lived (usually 2 months. embryonic diapause or delayed implantation, both of which extend the gestation period, is widespread in rodents. therefore, the delivery season can not be estimated for the ryukyu - furred rat from our data ; additional data from pregnant or mothering females are needed to clarify this point. in females, corpora lutea, placental scars and elongated teats indicate ovulation, pregnancy and lactation, respectively. from our observations of corpora lutea and placental scars, we estimate that the litter size of the ryukyu - furred rat ranges from 2 to 12 with an average of 6. to our knowledge, pregnant ryukyu long - furred rats have not been collected or captured to date, and further investigations of litter size are needed. in conclusion, reproductive characteristics including seasonal changes, sexual maturity and morphology of reproductive organs in the ryukyu long - furred rat were clarified in this study. the results presented here provide fundamental knowledge that will be useful for in situ and ex situ conservation of this rare species. | the ryukyu long - furred rat, diplothrix legata, is a large rodent distributed only on amami - ohshima island, tokuno - shima island and okinawa - jima island, japan. this animal is endangered as a result of deforestation, predation by introduced carnivores and mortality caused by vehicles. we performed theriogenological examinations of 32 male and 25 female ryukyu long - furred rats carcasses collected from wild populations on northern okinawa - jima island from december 2005 to september 2013. adult males had remarkably large preputial glands. seminiferous diameter of adult was significantly small (136 28 m, n=8) from april to august. numerous spermatozoa were observed from september through february, and seminiferous diameter was significantly large (216 27 m, n=12) during this time in adults ; testes length changed in a similar pattern. these findings indicate that the mating season may occur from september through february. size (body length) at sexual maturity was estimated to be > 560 mm in both sexes. from observation of corpora lutea and placental scars, litter size was estimated to range from 2 to 12 (average=6, n=4). these results provide fundamental knowledge that will be beneficial for in situ and ex situ conservation of this rare species. |
herpes simplex virus (hsv) mastitis in a nonlactating female is extremely rare. to the best of our knowledge, we describe the first case of herpes simplex mastitis diagnosed on scrape cytology smears prepared from the ulcer over the nipple of the left breast. possible modes of infection and the importance of distinguishing these cases from other causes of mastitis are also discussed. a 36-year - old lady presented to the outpatient department with pain and swelling in the left breast since two days. she had been given oral ciprofloxacillin and topical mupirocin by the local physician, but there was no improvement in her condition., there was 10 cm area of indurated erythema on the medial aspect of the left breast along with an ulcer measuring five mm in diameter on the medial aspect of the nipple. air - dried smears prepared from the scrapings of the ulcer were sent to us for cytological examination. microscopic examination of scrape cytology smears revealed isolated as well as aggregates of keratinocytes showing marked nuclear pleomorphism and nuclear enlargement. these keratinocytes revealed homogenous opaque nucleus and dense basophilic cytoplasm with well - defined cell boundaries [figure 1 ]. numerous multinucleated giant cells with ground glass nucleus and nuclear molding were also seen [figure 1 ]. keratinocytes showing marked nuclear pleomorphism and nuclear enlargement (giemsa, 200) ; inset shows multinucleated giant cells with ground - glass nucleus and nuclear molding (giemsa, 400). however, herpes simplex can affect any skin or mucous membrane surface, in addition to the eyes, central nervous system and viscera. few cases of maternal infant transmission of the virus during breastfeeding resulting in nipple lesions have been documented[46 ] and only rare cases have been reported in nonlactating women. furthermore, development of breast lesions as the first and the sole manifestation of clinically apparent hsv infection without oral or genital herpes is uncommon. there is little information regarding transmission of hsv to the breast except in cases associated with neonatal breast feeding. in the present case, further enquiry failed to reveal the source of hsv infection and we are left to speculate the mode of infection. the first possibility is that the virus was transmitted to the breast through autoinoculation from an asymptomatic oral or genital lesion. autoinoculation to other body sites such as face, fingers and eyes has been documented. the second possibility is that the present lesion may be a primary infection of the breast from recent sexual contact with an asymptomatic hsv carrier. the infected asymptomatic carrier can carry the virus in the saliva and can transmit the virus through close personal contact. kobayashi. have described the cytologic changes in the smears from nipple discharge of two cases with hsv infections. the cytology of nipple discharge smears of their cases revealed the ground - glass appearance of the nuclei with multinucleated syncytial cells. in addition, positive hybridization was found with intense staining for the hsv dna in the nuclei of cells having a ground - glass appearance. they concluded that cytologic observation together with an in situ hybridization procedure may be a rapid and valuable tool for the detection and final demonstration of hsv infections. in contrast to impression cytology, the scrape cytology is a traumatic procedure. scraping the lesion collects in situ cells. a certain degree of expertise is required for scraping and making the smear. in scrape cytology smear, cell - to - cell relation is not maintained. to compensate for all these drawbacks, scrape cytology offers a better cell yield even in keratinising lesions and small focal lesions. results of scrape cytology are likely to be more specific and sensitive. in our case, air - dried scrape cytology smears stained with giemsa stain revealed characteristic cytological features of hsv infection. it is important to establish the correct clinical diagnosis and confirm it with cytology smears. it is also important to distinguish herpes mastitis from bacterial mastitis since herpes mastitis heals spontaneously in 710 days without scarring, whereas bacterial abscess requires surgical drainage with residual scarring. in addition, it is important to distinguish herpes simplex mastitis from varicella zoster mastitis, because zoster infection can become confluent, hemorrhagic, heal slowly with scarring and can be associated with residual neuralgia. to conclude, in suspected cases, scrape smears can be of great value in the early diagnosis of herpes simplex mastitis. | herpes simplex virus (hsv) is a rare cause of breast infection. few cases of maternal - infant transmission of the virus during breastfeeding resulting in nipple lesions have been documented. only three cases have been reported in nonlactating women. we report an additional case of hsv mastitis in a 36-year - old nonlactating female who was diagnosed on scrape cytology smears. |
inflammatory bowel disease (ibd) is defined as chronic inflammatory disease of the gastrointestinal tract with several periods of clinical relapse and remission. there are two forms of ibd including crohn s disease (cd) and ulcerative colitis (uc) (1). it affects the colon and its symptoms are bloody diarrhea and rectal bleeding (3, 4). crohn s disease often affects the terminal ileum and colon with symptoms, such as abdominal pain, diarrhea and weight loss (1). although it is said that several factors, including genetic and environmental, bacterial and viral, nutritional, psychological and immunological factors seem to be involved in causing ibd, the exact etiology of this disease has not been known yet (5). in this study, we focused on the viral factors. as we know, ibd has several periods of clinical relapse and remission and this feature is similar to infections caused by viruses of herpesviridae family (1). human cytomegalovirus (hcmv) is a double stranded dna virus which belongs to the herpesviridae family and is a beta human herpesvirus type 5 (6, 7). human cytomegalovirus affects between 40% and 100% of the general population (6, 8) ; it usually remains asymptomatic in the healthy adults ; however, it can cause symptomatic disease in the immunocompromised patients (7). human cytomegalovirus disease may occur in various organs. hcmv infections involve any part of the gastrointestinal tract, and induce ulcers with hemorrhage (4). recently, an association between ibd and the presence of hcmv has been reported (4, 9). the risk of infection with hcmv increases in ibd patients as a result of receiving immunosuppressive agents (10, 11), and this viral infection evoke the severity of inammatory diseases (12, 13) ; however, the role of antiviral treatment is also unclear. to date, there havent been any controlled trials of antiviral therapy to clarify this issue (8) ; therefore, we can not decide about the use of antiviral therapy in these patients (6). human cytomegalovirus shows genetic variations in virulent genes, such as ul55 (14, 15). the ul55 gene encodes glycoprotein b (gb), which is the major envelope glycoprotein of cmv (15, 16). on the basis of genetic variation in the ul55 gene, hcmv can be classied into 4 glycoprotein b (gb) genotypes (17). also, the hcmv gb has an important role in tissue tropism, virus penetration into the host cell and fusion of infected cells. therefore, it is an important target for humoral and cellular immune responses (15). since the uc is recurrent and is one of the important causes for referring to the specialist, hospitalization of the patients accompany with work - loss and high treatment costs (3), an evaluation of rapid diagnosis of hcmv infection is important for an appropriate antiviral treatment and to prevent the serious complications of the disease this study was conducted to detect hcmv dna in intestinal tissue specimens of patients with flare uc by the nested polymerase chain reaction (pcr) in ahvaz city, iran. ahvaz city is the center of khuzestan province located in the south - west of iran with 1.5 million populations. this study aimed to determine the prevalence and the glycoprotein b genotypes of hcmv among the patients with hcmv disease superimposed on an uc flare that required hospitalization in imam khomeini hospital in ahvaz, iran, during 2010- 2012. intestinal samples were taken from 98 patients with uc disease including 53 males and 45 females (mean age sd, 38.95 17.93) referred to imam khomeini hospital in ahvaz city, iran, during 2010 - 2012. all patients were diagnosed with uc by clinical, laboratory, endoscopic, and histological ndings in accordance with leonard - jones criteria (18). the control group consisted of 67 individuals with noninflammatory disease, who were evaluated by colonoscopy for anemia, change bowel habit or rectal bleeding, granolomatosis or colonal papilomatosis diseases, and were matched in age (5 years), sex, and date of hospital admission with the uc patients. tissue sections (20 m thick ; 8 or 10 sections from each block) were deparaffinized with 1 ml xylene in 1.5 ml dnase - free micro tubes at 45c for 15 minutes. after 15 minutes, xylene was removed and this step was repeated twice. the tissues were washed with ethanol 100%, 80%, 60% and then ethanol 40%. the tubes were kept at room temperature with an opened cap to completely evaporate ethanol. the dna extraction from deparaffinized colon specimens was performed by the high- pure pcr template preparation kit (roche, germany) according to the manufacturer s instructions. the extracted dna was eluted in 100 l dnase - free mili - q water and stored at -20c before being used as a template to detect cmv dna. human cytomegalovirus dna was detected using the seminested pcr with the paired primers conserved for the gb gene (ul55 region) including, gb1043/gb 1724 and gb1043/gb1604 (15, 19). human beta - globin gene was used as internal control to check the absence of pcr inhibitors and dna quality (20). dna quality was evaluated by pcr using forward primer pco3 : 5-acacaactgtgttcactagc-3 and reverse primer pco4 : 5-caacttcatccacgttcacc-3 that amplify a 110 bp product from the human -globin gene (21). the first pcr was conducted in a total volume of 25 l of a reaction buffer that included the following components : 0.4 m of each gb1043 and gb1724 outer primer (10 pmol / reaction), 200 m of each of the 4 deoxynucleotides, 100 ng dna template, 1.25 u of taq dna polymerase, 1 pcr buffer containing 1.5 mmol / l mgcl2 and dnase - free mili - q water. themocycler (tc-512, techne, uk) was programmed with an initial denaturation for 5 minutes at 95c, and then followed by 35 cycles consisting of a denaturation step, 94c for 40 seconds, an annealing step, 57c for 50 seconds, and an extension step was 72c for 60 seconds. for the second reaction, 2 l of the first pcr product was added to a tube containing the 0.4 m of each gb1043 and gb1604 inner primers (10 pmol / reaction), with the same pcr reagents as in the first reaction. second thermocycling conditions were as follows : initial denaturation at 95c for 5 minutes, 35 cycles consisting of 94c for 40 seconds, 58c for 50 seconds, 72c for 60 seconds, and 72c for 5 minutes. pcr products were analyzed by electrophoresis on 2% agarose gel (cinagene, iran) containing dna safe stain and electrophoresed for about 45 minutes at 100 volts in 0.5 tbe buffer. the gel was visualized on uv transilluminater (vilber lourmat, france). a dna band with 580 bp was considered as a positive sample and subjected to genotyping. the cmv - positive pcr products were puried with a qiaquick pcr purication kit (qiagen, united kingdom) and were subjected for automated sequencing (takapozist co., tehran, iran). genotyping of hcmv glycoprotein b (gb) was carried out by sequencing for 12 cmv - positive samples. the phylogenetic tree analysis was used to compare the genetic distances for all 12 isolates. the phylogenetic tree was constructed by the neighbor - joining method with the bootstrap test of phylogeny in molecular evolutionary genetics analysis (mega) program, version 4 (23, 24). bootstrap resampling strategy and reconstruction were carried out 1000 times to confirm the reliability of the phylogenetic tree (25). clinical characteristics were compared using the chi - square test or fisher s exact test and student s t - test. chicago, il) and p - values of 0.05 or less reported as statistically significance. intestinal samples were taken from 98 patients with uc disease including 53 males and 45 females (mean age sd, 38.95 17.93) referred to imam khomeini hospital in ahvaz city, iran, during 2010 - 2012. all patients were diagnosed with uc by clinical, laboratory, endoscopic, and histological ndings in accordance with leonard - jones criteria (18). the control group consisted of 67 individuals with noninflammatory disease, who were evaluated by colonoscopy for anemia, change bowel habit or rectal bleeding, granolomatosis or colonal papilomatosis diseases, and were matched in age (5 years), sex, and date of hospital admission with the uc patients. tissue sections (20 m thick ; 8 or 10 sections from each block) were deparaffinized with 1 ml xylene in 1.5 ml dnase - free micro tubes at 45c for 15 minutes. after 15 minutes the tissues were washed with ethanol 100%, 80%, 60% and then ethanol 40%. the tubes were kept at room temperature with an opened cap to completely evaporate ethanol. the dna extraction from deparaffinized colon specimens was performed by the high- pure pcr template preparation kit (roche, germany) according to the manufacturer s instructions. the extracted dna was eluted in 100 l dnase - free mili - q water and stored at -20c before being used as a template to detect cmv dna. human cytomegalovirus dna was detected using the seminested pcr with the paired primers conserved for the gb gene (ul55 region) including, gb1043/gb 1724 and gb1043/gb1604 (15, 19). human beta - globin gene was used as internal control to check the absence of pcr inhibitors and dna quality (20). dna quality was evaluated by pcr using forward primer pco3 : 5-acacaactgtgttcactagc-3 and reverse primer pco4 : 5-caacttcatccacgttcacc-3 that amplify a 110 bp product from the human -globin gene (21). the first pcr was conducted in a total volume of 25 l of a reaction buffer that included the following components : 0.4 m of each gb1043 and gb1724 outer primer (10 pmol / reaction), 200 m of each of the 4 deoxynucleotides, 100 ng dna template, 1.25 u of taq dna polymerase, 1 pcr buffer containing 1.5 mmol / l mgcl2 and dnase - free mili - q water. themocycler (tc-512, techne, uk) was programmed with an initial denaturation for 5 minutes at 95c, and then followed by 35 cycles consisting of a denaturation step, 94c for 40 seconds, an annealing step, 57c for 50 seconds, and an extension step was 72c for 60 seconds. for the second reaction, 2 l of the first pcr product was added to a tube containing the 0.4 m of each gb1043 and gb1604 inner primers (10 pmol / reaction), with the same pcr reagents as in the first reaction. second thermocycling conditions were as follows : initial denaturation at 95c for 5 minutes, 35 cycles consisting of 94c for 40 seconds, 58c for 50 seconds, 72c for 60 seconds, and 72c for 5 minutes. pcr products were analyzed by electrophoresis on 2% agarose gel (cinagene, iran) containing dna safe stain and electrophoresed for about 45 minutes at 100 volts in 0.5 tbe buffer.. a dna band with 580 bp was considered as a positive sample and subjected to genotyping. the cmv - positive pcr products were puried with a qiaquick pcr purication kit (qiagen, united kingdom) and were subjected for automated sequencing (takapozist co., tehran, iran). tissue sections (20 m thick ; 8 or 10 sections from each block) were deparaffinized with 1 ml xylene in 1.5 ml dnase - free micro tubes at 45c for 15 minutes. after 15 minutes the tissues were washed with ethanol 100%, 80%, 60% and then ethanol 40%. the tubes were kept at room temperature with an opened cap to completely evaporate ethanol. the dna extraction from deparaffinized colon specimens was performed by the high- pure pcr template preparation kit (roche, germany) according to the manufacturer s instructions. the extracted dna was eluted in 100 l dnase - free mili - q water and stored at -20c before being used as a template to detect cmv dna. human cytomegalovirus dna was detected using the seminested pcr with the paired primers conserved for the gb gene (ul55 region) including, gb1043/gb 1724 and gb1043/gb1604 (15, 19). human beta - globin gene was used as internal control to check the absence of pcr inhibitors and dna quality (20). dna quality was evaluated by pcr using forward primer pco3 : 5-acacaactgtgttcactagc-3 and reverse primer pco4 : 5-caacttcatccacgttcacc-3 that amplify a 110 bp product from the human -globin gene (21). the first pcr was conducted in a total volume of 25 l of a reaction buffer that included the following components : 0.4 m of each gb1043 and gb1724 outer primer (10 pmol / reaction), 200 m of each of the 4 deoxynucleotides, 100 ng dna template, 1.25 u of taq dna polymerase, 1 pcr buffer containing 1.5 mmol / l mgcl2 and dnase - free mili - q water. themocycler (tc-512, techne, uk) was programmed with an initial denaturation for 5 minutes at 95c, and then followed by 35 cycles consisting of a denaturation step, 94c for 40 seconds, an annealing step, 57c for 50 seconds, and an extension step was 72c for 60 seconds. for the second reaction, 2 l of the first pcr product was added to a tube containing the 0.4 m of each gb1043 and gb1604 inner primers (10 pmol / reaction), with the same pcr reagents as in the first reaction. second thermocycling conditions were as follows : initial denaturation at 95c for 5 minutes, 35 cycles consisting of 94c for 40 seconds, 58c for 50 seconds, 72c for 60 seconds, and 72c for 5 minutes. pcr products were analyzed by electrophoresis on 2% agarose gel (cinagene, iran) containing dna safe stain and electrophoresed for about 45 minutes at 100 volts in 0.5 tbe buffer. the gel was visualized on uv transilluminater (vilber lourmat, france). a dna band with 580 bp was considered as a positive sample and subjected to genotyping. the cmv - positive pcr products were puried with a qiaquick pcr purication kit (qiagen, united kingdom) and were subjected for automated sequencing (takapozist co., tehran, iran). genotyping of hcmv glycoprotein b (gb) was carried out by sequencing for 12 cmv - positive samples. the phylogenetic tree analysis was used to compare the genetic distances for all 12 isolates. the phylogenetic tree was constructed by the neighbor - joining method with the bootstrap test of phylogeny in molecular evolutionary genetics analysis (mega) program, version 4 (23, 24). bootstrap resampling strategy and reconstruction were carried out 1000 times to confirm the reliability of the phylogenetic tree (25). clinical characteristics were compared using the chi - square test or fisher s exact test and student s t - test. chicago, il) and p - values of 0.05 or less reported as statistically significance. a total of 98 cases with flare uc, including 53 males and 45 females (mean age sd, 38.95 17.93), referred to imam khomeini hospital in ahvaz city during 2010 - 2012, and 67 controls with noninflammatory disease, who were matched in age (5 years), sex, and date of hospital admission with uc patients, were participated in this study. the common intestinal locations for uc were proctitis (13.3%), pancolitis (19.4%), rectosigmoid (21.4%), left - side colitis (11.2%), rectosigmoid - decending colon (18.4%) and extend colitis (16.3%). the highest rate of uc was observed in rectosigmoid and pancolitis, whereas the lowest rate was in left colitis. sixty - one (62%) flare uc patients were treated with immunosuppresive drugs during sampling. the demographic and clinical profiles of the 98 flare uc patients are summarized in table 2. the histopathologic examination confirmed diagnosis of uc in all patients of the case group ; whereas the absence of any inflammatory disease was confirmed in the control group. the -globin dna was detectable in all formalin - fixed paraffin - embedded specimens. the hcmv genome in the intestinal tissue was found in 12 (12.2%) uc patients. these 12 cmv - positive uc patients were 8 males (66.7%) and 4 females (33.3%) with mean age sd of 35.17 9.85. the highest rate of the intestinal location of uc was in pancolitis (41.7%). table 3 summarizes the association of various demographic and clinical variables associated with cmv - infection. in this study, detection of cmv genome in the intestine was commonly associated with uc (p = 0.002). however, detection of cmv genome was not statistically associated with age and sex, duration of disease, race, place, education, location of disease, and use of immunosuppressive drugs. abbreviations : lane m, molecular size maker, 100 bp dna ladder ; lane n, negative controls ; lane p, positive control ; lane 1 - 8, amplified products (580bp) on agarose gel electrophoresis. the genbank accession numbers for the hcmv sequences isolated from cmv - positive uc patients in this article are kc525998, kc525999, kc526000, kc526001, kc526002, kc526003, kc526004, kc526005, kc526006, kc526007, and kc526008. the result of cmv - genotyping by sequencing based on mega software revealed 11 cases (91.7%) for gb1, and 1 case (8.3%) for gb3 genotypes, respectively among the uc patients. the genbank accession numbers for the sequences are as follows : m60929.1 for genotype gb1, m60931 for genotype gb2, m85228.1 for genotype gb3, m60926.1 for genotype gb4. the phylogenetic tree analysis was conducted with sequences corresponding to nt positions 1047 to 1624 within the gb gene and constructed using the neighbor - joining method in mega4. it usually causes asymptomatic infections and remains persistent in healthy individuals (9), but it causes symptomatic diseases in immunocompromised patients. in these patients, the hcmv disease may occur in various organs (7). in recent years, the role of hcmv disease in ibd has been described (26, 27) and hcmv tends to invade and stay in inflammatory areas (28). proposed that the cross - reactive immune responses between human and viral proteins might cause an autoimmune response, which lead to ibd (29). on the other hand, ibd patients are in immunodeficiency state as a result of treating with immunosuppressive agents ; therefore, the risk of hcmv infection increases in these patients and this virus can worsen the condition of ibd (10, 11). thus, hcmv infection might cause uc or occur as a result of uc injuries in the intestinal mucosa. the exact role of hcmv in uc disease is still unclear (28). in recent years, some studies have reported the high prevalence of hcmv in intestinal tissue biopsies among ibd patients in different regions of the world (9, 28), and even cmv cytotoxic auto antibodies have been detected in more than 50% of patients with either uc or cd (30, 31). discovered cmv infection prevalence of 21.4% among ibd patients in italy (32). in another survey, kandiel. studied the prevalence of cmv infection in patients with ibd. in their study, cmv infection prevalence was 21%- 34% among american patients (12). in the present study, the hcmv prevalence was evaluated in flare uc patients in comparison with individuals with noninflammatory disease as control group. in the intestinal biopsy, cmv genome was detected in 12.2% of uc patients but not detected in the control group. recently, some studies have reported that there is an association between cmv infection and ibd (10, 28, 32). in our study, an association was observed between the presence of cmv in the intestinal biopsy and uc disease. however, no significant difference was found between cmv - positive uc patients and cmv - negative uc patients regarding several demographic and clinical parameters. studied the prevalence of cmv infection among ibd patients in italy. in their study, cmv was diagnosed in the rectal specimens of seven (five with uc and two with cd) out of 19 (36%) patients with refractory disease. they came to this conclusion that the cmv infection is a frequent cause of ibd (26). in another survey, wada. detected cmv infection in 16 of 47 patients (34%) with uc in japan. proportion of female patients, age at the time of determination was significantly higher in the cmv - positive group (59.1%) than in the cmv - negative group (13.6%). the prevalence of endoscopically severe uc was higher in patients with cmv antigenemia than in those without cmv antigenemia (p = 0.016) (27). dimitroulia. studied frequent detection of cmv in the intestine of patients with ibd in greece. in their study, cmv genome was found in 27.1% of the ibd patients, while in the control group was 2.2%. since the cmv infection was frequently found in patients with ibd as compared with the control group, they came to this conclusion that detection of cmv genome in the intestine was associated with ibd (9). although there was an association between hcmv and uc disease, the exact role of cmv in ibd patients is still unclear ; some studies suggest that cmv has a nonpathogenic role in the intestine of ibd patients, while others report the adverse effects of cmv on clinical results of ibd patients (13, 32, 33). this diversity of clinical outcome of cmv might be explained by studies on the genotyping of the virus. in previous studies, the gb genotype 1 and gb genotype 2 were found more frequently in different groups such as bone marrow, stem cell and renal transplant recipients, immunocompromised and hiv infected patients (16, 34, 35). however, among gb type 1 and type 2, gb type 1 was the most frequent (16), while type 2 was more frequent in hiv - infected patients (35, 36). some studies revealed that mixed gb genotype infections are associated with higher viral loads, delayed viral clearance, virulence patterns, virologic outcomes, progression to cmv disease, increased rate of graft rejection, more often coinfections with other herpesviruses and sever clinical manifestation (14, 16, 37). in our study, the result of cmv genotyping revealed 11 (91.7%) for gb1, and 1 (8.3%) for gb3 genotypes, respectively among the uc patients. in present study, hcmv gb1 genotype was predominant, which suggests that there might be an association between gb genotype 1 and uc disease. found gb1 (28.9%), gb2 (19.6%), gb3 (23.7%) ; gb4 (2.0%) and mixed genotypes in 25.8% among immunocompromised patients, and revealed that the presence of multiple gb genotypes in infected patients associated with severe clinical outcomes in contrast to patients infected with a single gb genotype (16). gonzalez - ramirez. studied the frequency distribution of cmv genotypes in mexican children with allogeneic bone - marrow transplantation. they found gb1 (30%), gb2 (27%), gb3 (13%), gb4 (3%) and mixed genotypes in 8/30 patients (27%). in their study, genotypes gb2 and gb1 had the highest frequency (34). in another study, dieamant. determined the distribution of gb genotypes in allogeneic hematopoietic stem - cell transplant (hsct) recipients with cmv infection in brazil. they found gb1 (46.6%), gb2 (33.3%), gb3 (6.7%) ; gb4 (6.7%) and mixed infection (6.7%) genotypes in this population. in their study, genotype gb type 1 was the most prevalent genotype, and they revealed that the mixture of hcmv gb genotypes was associate with gastrointestinal disease (17). genotype information is important for predicting tropism and virulence of hcmv, treatment and antiviral resistance, progression to hcmv disease, graft rejection, viral loads and recurrent infection (14, 38). since glycoprotein b (gb) is involved in virulence, virulence differs among different cmv genotypes (15, 38). moreover, genotype determines the length of therapy e.g. mixed gb genotype infections are associated with higher viral loads and delayed viral clearance (14, 37). in addition, for treatment purposes, detection of hcmv genotypes in different regions and different groups of patients can be used for the purpose of molecular epidemiology (14). furthermore, these ndings can facilitate the choice of recombinant hcmv glycoprotein vaccine required to immunize high - risk group (39). in conclusion, in this case - control study, overall cmv prevalence was 12.2% among the uc patients (p = 0.002). in present study, high prevalence of 91.7% cmv gb1 genotype was observed among the flare uc patients, which suggests that there might be an association between the gb genotype 1 and uc disease. | background : the human cytomegalovirus (hcmv) is a common pathogen which usually remains asymptomatic in the healthy adults ; however, it can cause a symptomatic disease in the immunocompromised patients. the risk of infection with hcmv increases in ulcerative colitis (uc) patients as a result of receiving immunosuppressive agents.objectives:this study aimed to determine the prevalence and the glycoprotein b genotypes of hcmv among the patients with hcmv disease superimposed on an uc flare that required hospitalization in imam khomeini hospital in ahvaz, iran, during 2010- 2012.patients and methods : in this case - control study, formalin - fixed paraffin - embedded intestinal tissue samples were taken from 98 patients with uc disease including 53 males and 45 females (mean age standard deviation, 38.95 17.93) and 67 control patients with noninflammatory disease who were referred to imam khomeini hospital during 2010 - 2012. detection of hcmv genome in intestinal samples was carried out by seminested polymerase chain reaction. glycoprotein b genotypes were determined by sequencing.results:among 98 patients with uc, only 12 (12.2%) patients were positive for hcmv genome, while the hcmv genome was not detected in any of the controls. (p = 0.002). the distribution of hcmv gb genotypes in 12 cmv - positive uc patients was as follow : gb1, 11 (91.7%) and gb3, 1 (8.3%). the most prevalent genotype in cmv - positive uc patients was gb1.conclusions:in this study, high prevalence of 91.7% hcmv gb1 genotype was predominant among hcmv - positive uc patients, which suggests that there might be an association between hcmv gb genotype 1 and uc disease. |
epithelioid hemangioendothelioma (eh) is a rare vascular soft tissue tumor of intermediate malignancy between hemangioma and angiosarcoma in terms of frequent local recurrences and metastatic potential1. although initially described most common in the soft tissues, other frequent sites include viscera and long bone have been well reported, for example, the liver, lung, femur, tibia and humerus2 - 4. involvement of various types of bone and soft tissue by eh is rare5. there have been no formal case reports about the epithelioid hemangioendothelioma with involvement of the different site in the same lower extremity. here, we reported one such case and discussed its clinicopathological features, pathogenesis and treatment with literature review. a 59-year - old female patient visited our orthopaedics clinic with complaints of increasing swelling, pain, anesthesia of the left lateral lower leg and extension loss of the left great toe of six months duration. on physical examination a 2.0 cm mass showing tender and palpable was located on the posterolateral aspect of the proximal lower leg, appearing to arise from the left fibular head. a positive tinel sign at the proximal fibula led us to suspect compressive neuropathy of the peroneal nerve. radiographs showed a lytic lesion causing irregular cortical bone thinning in the body of the upper fibula with a surrounding slight soft tissue swelling (figure 1 a). then we made further both lower extremities x - ray examination, found the similar osteolytic lesion in the distal tibia and cuboid bone (figure 1 b, c). routine blood laboratory data were within normal limits at the time and the patient had no previous history of tumor and family history of tumor. however, magnetic resonance image (mri) for left lower extremity manifested multiple solid lesions in the gastrocnemius muscle at the level of the head of the fibula and multifocal lesion with irregular borders at the upper fibula, distal tibia, cuboid bone and calcaneus (figure 2). right lower extremity and other parts of the left lower extremity were apparently normal. histopathological examination of the needle aspiration biopsies from cuboid bone and tibia showed a neoplastic infiltration composed of vascular structures of different caliber lined with mild atypical endothelial cells in a myxoid stroma. the epithelioid cytomorphology were polygonal or spindle shaped, which had vesicular nuclei, unapparent nucleoli and eosinophilic cytoplasm with intractyloplasmic vacuoles and were easily identified (figure 3). owing to these findings ; there was not much doubt that the patient was diagnosed as multifocal epithelioid hemangioendothelioma. fibular head resection and curettage of other parts of the left lower extremity lesions with allogeneic bone particles filling were performed ; curettage using sharp curet was done and subsequently supplemented with chemical cautery by using phenol solution. symptoms of the peroneal nerve entrapment include anesthesia and extension loss were relieved through the removal of eh lesions. the resected soft tissue and bone lesions sent for pathologic examination were measured 5.5x3.0x1.5 cm and 6.5x3.5x2.5 cm. the hematoxylin eosin stained the tissue section after decalcification revealed tumor tissue showing the same characteristics with the previous biopsy results. the postoperative course was uneventful. at 28 months after surgery without further therapy, no local recurrence or internal organ metastasis the term epithelioid hemangioendothelioma was first definitively described for a vascular neoplasm of soft tissue in 1982 by weiss and enzinger6. at that time, they recognized that the clinical behavior of these tumors was neither completely benign nor fully malignant and used the term hemangioendothelioma to reflect metastatic potential intermediate malignancy between hemangioma and angiosarcoma. in deyrup 's recent report of 49 cases of eh, originating from the soft tissue mostly occur between the ages of 9 and 93 (mean age, 49 yr.), and affects the sexes equally7. similar to eh in soft tissue, eh of bone has been encountered in virtually all age groups and can be multicentric, although it appears to peak both during the second and third decades and again in the later decades of life4, 8. tsuneyoshi. 9 observed that the next most frequent characteristic pattern of eh was a lytic lesion with variable degrees of peripheral cortication, and although it may affect any portion of the skeleton, it tends to involve bones of a particular anatomical area. in their review of the literature, abrahams found that the lesions are distributed throughout the skeleton with a predilection for involvement of the calvaria, axial skeleton and lower extremity. involvement of multiple bones has been showed a tendency to develop in the lower extremities 10. in 2008, deyrup reported 49 cases of eh of soft tissues in total, and the majority of cases are associated with low mortality, but some metastasize and cause patient death. many other sites of involvement of bones and soft tissues are possible, such as the maxilla, spine region, the head and neck region, but to our knowledge, only few cases have been reported12 - 17. when there is lower extremity involvement, multicentric epithelioid hemangioendothelioma has been known to involve the femur, tibia, phalange, cuneiform, tarsal navicular and metatarsal bone either as the first or subsequent tumor but multiple involvement of bones and soft tissue in the same lower extremity is very rare (table the peroneal nerve is a branch of the sciatic nerve, which passes behind the biceps femoris muscle and superficial to the lateral head of gastrocnemius. the peroneal nerve courses distally around the fibular neck, which makes it vulnerable to entrapment. eh originating from the lateral head of gastrocnemius is still unclear whether separate lesions represent multicentric disease or metastases, although it is multifocal in more than 50% of cases24. various mechanisms have been described including metastatic spread, malignant transformation and one time multi - focal formation5, 25, 26. the majority of eh cases are associated with low mortality, but some metastasize and cause patient death27. tumors that initially appeared as histologically benign, but then progressed to metastatic disease have been well documented28. 26 also reported a case that a patient suffering from a vascular neoplasm with initial manifestation in the pelvis and subsequent development of lesions of eh in the spleen, liver, and lung during a ten - year course of disease, and then they assumed that involvement of visceral organs was caused by metastatic spread because of some genes expression. therefore, we began to believe this hypothesis that eh does not represent a distinct entity, but rather an intermediate state of endothelial dedifferentiation with highly variable and unpredictable prognosis. in the present case, although we have not discovered that the multicentric eh occurred at different times (usually longer gap) or within a short period of time (simultaneously), no visceral involvement or lymph node metastasis will appear to have a good prognosis. synchronous involvement of adjacent bones is common, but in some cases, completely separate synchronous foci are present in anatomically distant sites. the differential diagnosis of eh primarily depends upon the site of origin of the tumor includes epithelioid hemangioma of bone, metastatic carcinoma, and epithelioid sarcoma. epithelioid hemangioma of bone also contains epithelioid endothelial cells that are large and cuboidal with eosinophilic cytoplasm. however, in epithelioid hemangioma, well developed vascular channels are observed, in contrast to the primitive vascular channels differentiation seen in eh. the hyalinized or myxoid is also typical of eh, which is not usually observed in epithelioid hemangioma. besides, epithelioid hemangioma of the bone is always a benign course and less likely to be multifocal30. most metastatic carcinoma to soft tissue or bone show exceedingly greater nuclear atypia and increased mitotic activity than that usually observed in eh20. the apparent desmoplastic reaction of metastatic carcinoma, and the positive immunoreaction with endothelial antigens in eh are useful features in the differential diagnosis. in kleer. 's 4 report of 40 cases of eh, two cases were excluded because follow - up showed that they represented metastatic carcinoma. epithelioid sarcoma generally occurs in young adults and most often involves the distal extremities with cutaneous ulceration ; in this type of tumors, very typical nodulars composed of round epithelioid cells are seen, which surround central cores of necrotic debris and collagen ; the vascular channels are usually observed as irregular sinusoidal channels, and necrosis is common5. in difficult cases, the results of immunohistochemistry have been recognized for a useful adjunct for differential diagnosis of eh. most cases of eh show diffuse and strong immunopositivity for vimentin and some endothelial markers such as factor viii, cd31 and cd34, and immunohistochemical analysis identifies the metastatic carcinoma cells in the absence of reactivity for endothelial markers 31. in the present case, the tumor cells were stained diffusely and intensely with antibodies to vimentin, showing immunoreactivity for factor viii, cd31, cd 34 and sma. although eh is a rare tumor of vascular origin, the treatment method is based on general oncological principles28. some authors have been closely studied the pathobiologic behavior of eh occurring in the lung, liver, soft tissue, and bone, which indicate that the behavior and metastatic potential of eh vary greatly, seeming to depend upon its origin9, 28, 29, 33, 34. in their report of eh of bone, kleer.4 also believed that the presence of visceral involvement appears indicative of a poor prognosis, regardless of the primary origin of the tumor. in their report of eh, weiss. found that the mortality associated with eh is 13% in soft tissue disease, 35% in liver disease, and 65% in lung disease after a minimum of 4 years of follow - up ; metastatic disease occurred in approximately 20% of patients with soft tissue disease28. reviewed the literature on eh and suggested that benign lesions should undergo complete and wide local excision without the need of adjuvant treatment ; malignant lesions should be treated similarly to other high - grade sarcomatous lesions, using wide local excision and possible chemotherapy35. in addition, several studies have suggested that multifocal lesions have a better prognosis than unifocal ones9, 36. in one series of multifocal tumors, moreover, the patients with eh may show partial spontaneous regression in number and size37. thus, in the present case, we excised the gastrocnemius eh and multifocal lesions of bone involving the same lower limb with an osteotome together, which was not followed by radiation or chemotherapy. in our experience, if the tumor is accessible for resection and there are no multiple organs metastasis, radical resection is a useful treatment of choice. although radiation therapy alone has been effective in some patients with multicentric tumors, the potential complications of this treatment must be considered. for eh lesions involving multiple bones or parenchymal organs, chemotherapy is an accepted option, despite the role of chemotherapy is not clear 10. besides, in view of the high incidence of multifocal lesions of eh in addition, the survival rate of eh patients is not only with treatment - related, but also with the nature of the tumor itself. proposed that eh be categorized as low risk and high risk for aggressive behavior, on the basis of mitotic activity and tumor size7. in the present case, because of the wide resection achieved and the low aggressiveness of the lesion, no adjuvant therapy was decided, and 6 years after there are no signs of recurrence or metastasis. eh involving the same lower limb includes soft tissue and bones without the parenchymal organs metastasis has rare been reported, although it represents a rare vasoformative tumor that has been more frequently identified over the past twenty years. eh can mimick either benign or malignant conditions with unpredictable behavior, thus early diagnosis and early treatment are particularly important. in addition, imaging strives to be comprehensive because of the high incidence of multifocal lesions, any metastatic lesion should not be missed ; moreover, cell immunohistochemistry plays a meaningful role in providing for an accurate diagnosis and the different diagnosis in cases of eh to further guide the clinical treatment. although no therapeutic modality other than surgery is effective in eh, some patients can take to assist in the treatment of chemotherapy or radiation therapy for metastatic disease. however, we still can not define the role and timing of adjuvant therapy after initial surgical resection, close follow - up is really an effective means of preventing tumor recurrence. | epithelioid hemangioendothelioma (eh) is an uncommon low - grade malignant soft - tissue tumor ; no case has been previously reported where multicentric epithelioid hemangioendothelioma occurred in the same lower extremity at different sites. we report a case involving the common peroneal nerve and subsequently the long bone and the short bones of the same lower extremity, and also review the literature. after establishing case of several lesions, we reviewed the histopathology properly and followed up the patient for a long time with serial whole body assessment to pick up any subsequent lesions. |
mixed gonadal dysgenesis (mgd) is an abnormal sexual differentiation syndrome usually presenting with ambiguous genitalia, but the phenotype can vary from a normal male to female with or without turner stigmata (1,2,3). originally, mgd was defined on the basis of gonadal morphologic features, i.e., an abnormal testis on one side and a rudimentary gonad, streak gonad, or no gonad at all on the other (4). however, some investigators have come to consider mgd a broad syndrome that includes certain patients with bilateral testes or bilateral streak gonads because of the clinical variety in patients with 45,x/46,xy mosaicism (2, 5). the most common gonads in mgd are dysgenetic testis on one side and a streak gonad on the other side, and the typical karyotype is 45,x/46,xy mosaicism (6, 7). karyotype analysis is an essential component in the diagnosis of mgd, and is usually performed on peripheral lymphocytes using the g - banding technique. for example, it is influenced by the number of cells examined or by different percentages of mosaicism in different tissues. here we discuss the limitations of karyotype analysis of peripheral lymphocytes with the g - banding technique in four cases. g - banding karyotype analysis was performed on peripheral lymphocytes and fibroblasts of gonads by standard methodologies. fibroblasts or fibroblast - like cells were cultured for karyotype analysis from gonads after gonadectomy. in this paper, we refer to this as karyotype of gonad. fish analysis was also performed on peripheral lymphocytes and fibroblasts of gonad using three probes : the x centromeric satellite probe (dxz1), the y centromeric alpha satellite probe (dyz3) and the telomeric yq12 probe (dyz1). one thousand interphase cells were analyzed by fish in case 2 and case 4, and one hundred cells were analyzed in case 3. case 1, a female, was referred to our hospital for ambiguous genitalia at 5 mo of age. she was born at 38 wk gestation, birth weight 2520 g, by vaginal delivery. g - banding karyotype analysis of peripheral lymphocytes from umbilical cord blood was 45,x/46,xy. she had clitoromegaly (2 cm of length), scrotum - like labia major and urogenital sinus. the right gonad was palpable in the inguinal region ; the left gonad was not palpable. considering the patient s asymmetrical external genitalia and karyotype at birth, mgd was suspected. the macroscopic findings showed uterus, bilateral testis - like gonads, ductus deference and epididymis. histological findings of the gonads were dysgenetic testes with immature seminiferous tubules and hyperplasia of leydig cells. no ovarian tissues were found. although the histological findings suggested dysgenetic male pseudohermaphroditism, we evaluated this patient s condition as a mgd variant. although g - banding karyotype analysis with peripheral lymphocytes at seven months of age showed 46,xy, chromosome analysis with gonads at the same time showed mosaicism as follows : left gonad 45,x/46,x+mar ; and right gonad 45,x/46,x+mar/47,x+2mar. this marker chromosome is presumably idic(y)(q11), based on the result of fluorescence in situ hybridization (fish) analysis with peripheral lymphocytes at seven years of age, 46,x, idic(y)(q11),ish idic(y). the points to note about this case regarding the karyotype analysis are as follows : 1) the percentage of the 45,x cell line decreased in peripheral lymphocytes after birth ; and 2) karyotype analysis with gonads provided more information than that of peripheral lymphocytes for clinical evaluation. case 2 was a legally registered male who was referred to our hospital at 9 mo of age for evaluation of ambiguous genitalia. he was born at 40 wk gestation and his birth weight was 2788 g. on examination, penile hypospadias and bifid scrotum were noted. the right testis was palpable in the scrotum, but the left was impalpable. although g - banding karyotype analysis with peripheral lymphocytes was 46,xy [50 cells ] with metaphase cells, the peripheral lymphocyte fish technique using interphase cells showed 45,x/46,xy. the left gonad was consistent with a streak gonad and its g - banding karyotype analysis showed mosaicism, 45,x/46,xy. the points to note about this case regarding the karyotype analysis are as follows : 1) fish analysis with peripheral lymphocytes was useful for detecting low frequency mosaicism ; and 2) g - banding karyotype analysis of the gonad was also useful in the evaluation of mgd. case 3 was legally registered female who was pointed out to have mild clitoromegaly at 6 mo of age. g - banding karyotype analysis of peripheral lymphocytes at six months of age showed 45,x/46,xy and 45,x/46,xy at one year of age. the left gonad was palpable in the inguinal region, but the right gonad was not palpable. the patient received bilateral gonadectomy and karyotype analysis from both gonads was performed at the age of 1 yr. the left gonad was an atrophic or hypoplastic testis, 45,x/46,xy, and the right one was a streak gonad, 45,x/46,xy by fish analysis. on histological examination, the left gonad contained seminiferous tubules and a small number of spermatogonia ; hyperplasia of leydig cells was not detected. the point to note about this case regarding the karyotype analysis is that the difference in the ratio of mosaicism in the gonads of both sides was consistent with the phenotypes of the gonads and external genitalia. case 4 was a legally registered female who was referred to our hospital because of short stature at 11 yr of age. both gonads were streak gonads and gonadoblastoma was detected partially in the left gonad on histological examination. the karyotype analysis with fish was 45,x/46,xy on the right side, and 45,x/46,xy on the left side. the point to note about this case is that the difference in the ratio of mosaicism in the gonads is more consistent with the histological findings than that in peripheral lymphocytes. case 1, a female, was referred to our hospital for ambiguous genitalia at 5 mo of age. she was born at 38 wk gestation, birth weight 2520 g, by vaginal delivery. g - banding karyotype analysis of peripheral lymphocytes from umbilical cord blood was 45,x/46,xy. she had clitoromegaly (2 cm of length), scrotum - like labia major and urogenital sinus. the right gonad was palpable in the inguinal region ; the left gonad was not palpable. considering the patient s asymmetrical external genitalia and karyotype at birth, mgd was suspected. the macroscopic findings showed uterus, bilateral testis - like gonads, ductus deference and epididymis. histological findings of the gonads were dysgenetic testes with immature seminiferous tubules and hyperplasia of leydig cells. no ovarian tissues were found. although the histological findings suggested dysgenetic male pseudohermaphroditism, we evaluated this patient s condition as a mgd variant. although g - banding karyotype analysis with peripheral lymphocytes at seven months of age showed 46,xy, chromosome analysis with gonads at the same time showed mosaicism as follows : left gonad 45,x/46,x+mar ; and right gonad 45,x/46,x+mar/47,x+2mar. this marker chromosome is presumably idic(y)(q11), based on the result of fluorescence in situ hybridization (fish) analysis with peripheral lymphocytes at seven years of age, 46,x, idic(y)(q11),ish idic(y). the points to note about this case regarding the karyotype analysis are as follows : 1) the percentage of the 45,x cell line decreased in peripheral lymphocytes after birth ; and 2) karyotype analysis with gonads provided more information than that of peripheral lymphocytes for clinical evaluation. case 2 was a legally registered male who was referred to our hospital at 9 mo of age for evaluation of ambiguous genitalia. he was born at 40 wk gestation and his birth weight was 2788 g. on examination, penile hypospadias and bifid scrotum were noted. the right testis was palpable in the scrotum, but the left was impalpable. although g - banding karyotype analysis with peripheral lymphocytes was 46,xy [50 cells ] with metaphase cells, the peripheral lymphocyte fish technique using interphase cells showed 45,x/46,xy. the left gonad was consistent with a streak gonad and its g - banding karyotype analysis showed mosaicism, 45,x/46,xy. the points to note about this case regarding the karyotype analysis are as follows : 1) fish analysis with peripheral lymphocytes was useful for detecting low frequency mosaicism ; and 2) g - banding karyotype analysis of the gonad was also useful in the evaluation of mgd. case 3 was legally registered female who was pointed out to have mild clitoromegaly at 6 mo of age. g - banding karyotype analysis of peripheral lymphocytes at six months of age showed 45,x/46,xy and 45,x/46,xy at one year of age. the left gonad was palpable in the inguinal region, but the right gonad was not palpable. the patient received bilateral gonadectomy and karyotype analysis from both gonads was performed at the age of 1 yr. the left gonad was an atrophic or hypoplastic testis, 45,x/46,xy, and the right one was a streak gonad, 45,x/46,xy by fish analysis. on histological examination, the left gonad contained seminiferous tubules and a small number of spermatogonia ; hyperplasia of leydig cells was not detected. the point to note about this case regarding the karyotype analysis is that the difference in the ratio of mosaicism in the gonads of both sides was consistent with the phenotypes of the gonads and external genitalia. case 4 was a legally registered female who was referred to our hospital because of short stature at 11 yr of age. her growth followed the 2 standard deviation growth curve. both gonads were streak gonads and gonadoblastoma was detected partially in the left gonad on histological examination. the karyotype analysis with fish was 45,x/46,xy on the right side, and 45,x/46,xy on the left side. the point to note about this case is that the difference in the ratio of mosaicism in the gonads is more consistent with the histological findings than that in peripheral lymphocytes. we presented four cases with mgd in order to show that the analysis of karyotype by fish or by using gonads is useful for diagnosis of mgd and understanding the phenotype of gonadal tissues. originally, mgd was defined on the basis of gonadal morphological features, i.e., an abnormal testis on one side and a rudimentary gonad, streak gonad, or no gonad at all on the other (4). mgd typically results from 45,x/46,xy mosaicism and presentation is usually with ambiguous genitalia, but the phenotype can vary from that of a normal male to a female with or without turner syndrome stigmata and at a risk of gonadoblastoma (1,2,3, 6, 7). previous reports showed that most subjects with 45,x/46,xy mosaicism have ambiguous genitalia or are phenotypically male, and that gonads were paired equally as bilateral testes, testis plus gonad, or bilateral streak gonads (8, 9). consequently, some investigators have already come to consider mgd a broad syndrome that includes certain patients with bilateral testes or bilateral streak gonads [2, 5 ]. whenever an interpretation of mgd is made, the result of karyotype analysis is an essential component of the diagnosis. conventional karyotype analysis of peripheral lymphocytes by the g - banding technique is supposed to have several limitations in the diagnosis of mgd. first, the detection of mosaicism in mgd depends on in vivo or in vitro selection against one of the cell lines ; i.e., the number of the cells analyzed is one of the critical factors (10, 11). second, karyotype analysis with peripheral lymphocytes may not reflect that in the gonad, which is theoretically more valid for interpreting phenotypes of gonads and external genitalia in patients with mgd. finally, other newer techniques, such as fish, may be more useful than g - banding analysis of peripheral lymphocytes. the difference between g - banding karyotype analysis with peripheral lymphocytes and that with gonads at seven months of age in case 1, namely disappearance of the 45,x cell line in peripheral lymphocytes (see table 2table 2 results of cytogenetic analysis of four patients with mixed gonadal dysgenesis, difference at birth and at 7 months), may have resulted from a difference in the turnover cycle of peripheral lymphocytes and gonadal fibroblasts. held. suggest that there may be an in vivo selection against rearranged sex chromosomes, based on the continual decrease of the abnormal sex chromosome observed in long - term in vitro culture (12). the 46,xy (or its variant forms such as 46,x, idicy) cell line probably has a longer life than 45,x in the cell cycle. about 60 percent of cases were re - evaluated after birth, and 80 percent of them showed decreased percentages of 45,x. in case 1, the 45,x cell was not present at 7 mo of age although it was detected in the umbilical cord (14%). these results, in case 1, indicate that natural selection of the normal cell line in lymphocytes may occur not only during the prenatal period but also after birth. fish analysis with interphase cells is more valuable for detecting mosaicism in this disorder as case 2 (case 2 was the only case in which both g - banding and fish karyotype analysis were performed on peripheral lymphocytes). this may be due to the large number of cells analyzed in fish, or due to the fact that the cells used in fish analysis are in the interphase (not the metaphase as in conventional g - banding analysis of peripheral lymphocytes). reddy. also reported the utility of fish for detecting low frequency mosaicism in mgd (15). there have also been several studies of turner syndrome reporting the detection of the y chromosome by fish (16,17,18). phenotypes of gonads (testis or streak gonad) and resultant external genitalia in mgd are presumably more influenced by karyotype of gonadal fibroblasts than that of peripheral lymphocytes. although karyotype analysis of gonadal tissue - specific cell types such as sertoli cells is difficult, gonadal fibroblasts have enough karyotype information. the predominance of 45,x cells or 46,xy cells in a developing gonad would promote the development of a streak gonad or a testis, respectively. in previous studies, no correlation has been reported between the percentage of 45,x and 46,xy cells in peripheral lymphocytes and the degree of phenotypic masculinization (8, 19). moreover, monozygotic twins with different phenotypes (presumably due to different ratios of mosaicism of gonadal tissue) have been reported (20,21,22). different levels of mosaicism of karyotype between lymphocytes and gonadal tissues have already been reported (23,24,25). the results of all four cases in this study confirmed that karyotype analysis of the gonad is more consistent with the phenotype of the gonad and external genitalia. we further speculate that natural selection, such as disappearance of 45,x cell line as described above, may occur less frequently in the gonad than in peripheral lymphocytes. in conclusion, evaluation of the karyotype with peripheral lymphocytes by the g - banding technique has limitations in the diagnosis and evaluation of mgd. second, fish analysis is more useful for detecting low frequency mosaicism through analysis of a large number of cells. finally, the phenotype of gonads and external genitalia is more consistent with the karyotype of gonads than that of peripheral lymphocytes. | mixed gonadal dysgenesis (mgd) is an abnormal sexual differentiation syndrome usually presenting with ambiguous genitalia. karyotype analysis is one of the essential components in the diagnosis of mgd and is conventionally done with peripheral lymphocytes by the g - banding technique. it is speculated that this conventional karyotype analysis has limitations since there are often difference in gonadal tissue analysis. here we present four cases of mgd, in which karyotype analysis were performed by peripheral lymphocytes fluorescence in situ hybridization (fish), gonad fibroblasts fish and gonad fibroblasts g - banding technique, in addition to the conventional peripheral lymphocytes g - banding technique. in case 1, the percentage of the 45,x cell line in lymphocytes decreased after birth and detection of mosaicism could only be done by karyotype of gonads at 7 mo of age. in case 2, fish analysis with peripheral lymphocytes was more useful for detecting low frequency mosaicism. in all cases, phenotype of gonads and external genitalia were more consistent with karyotype of gonads than that of the peripheral lymphocytes g - banding technique. in conclusion, conventional g - banding karyotype analysis with peripheral lymphocytes has limitations in the diagnosis and evaluation of mgd. karyotype analysis by fish or by using gonads is useful for diagnosing mgd and understanding of the phenotype of gonadal tissue. |
premature ejaculation is the most prevalent sexual dysfunction among males, with a prevalence of more than 30%. given its prevalence, the onus was on us, the treating urologists, to provide these patients with optimal treatment. however, even today, a century since the first reported case, there are various versions in its definition, classification and treatment. most worrying on the part of the patient is the absence of a standard, effective treatment without significant adverse effects. a range of treatment modalities has been described, varying from psychotherapy and oral medication to local applications, yet the so - called though dapoxetine 30 mg is being widely used as the treatment of premature ejaculation, there are patients who fail to comply with the treatment due to its adverse effects or inefficacy. we decided to evaluate the efficacy of on demand silodosin 4 mg in patients who were dissatisfied with dapoxetine, as there are recent reports suggesting the efficacy of silodosin in the treatment of premature ejaculation [3, 4 ]. patients who self - reported premature ejaculation and expressed dissatisfaction with on demand treatment with dapoxetine 30 mg were included in the study. the study participants were asked to record the reason for their dissatisfaction with the treatment before their inclusion in the study. approval for the proposed study was granted by the institutional ethical committee. before inclusion in the study, written informed consent was obtained from each patient and his partner. according to available literature, the prevalence of premature ejaculation in males is reported as 30%. in order to ensure the power of the study in excess of 80%, at a significance level of 95%, we calculated the minimum sample size for each (the two) group(s). this sample size calculation was performed using the formula [n = 2 {z1 + z1/d 0 } p (1p) ]. here n corresponds to the number of subjects in each group, p corresponds to prevalence of premature ejaculation, z corresponds to the standard normal deviate for a one - sided test, d corresponds to expected difference and 0 corresponds to the clinically accepted margin of error, which is taken as 0.05. using computer - generated simple random numbers between one and 64, the total sample was divided into two groups, group a and group b respectively. patients in group a received silodosin 4 mg three hours prior to the proposed intercourse. patients in group b received a placebo three hours prior to proposed intercourse. during the study, only the patients were blinded (not the investigator). intravaginal ejaculatory latency time (ielt), premature ejaculation profile (pep) and the clinical global impression of change for premature ejaculation (cgic) were recorded in patients, prior to the initiation of the treatment and the very next day of the treatment with drug. similarly, the premature ejaculation profile (pep) was recorded in partners as well, as the format allows separate recording of responses from the partners. data analysis was done by applying student s t - test, using the statistical package for the social sciences (spss) trial version 17. according to available literature, the prevalence of premature ejaculation in males is reported as 30%. in order to ensure the power of the study in excess of 80%, at a significance level of 95%, we calculated the minimum sample size for each (the two) group(s). this sample size calculation was performed using the formula [n = 2 {z1 + z1/d 0 } p (1p) ]. here n corresponds to the number of subjects in each group, p corresponds to prevalence of premature ejaculation, z corresponds to the standard normal deviate for a one - sided test, d corresponds to expected difference and 0 corresponds to the clinically accepted margin of error, which is taken as 0.05. using computer - generated simple random numbers between one and 64, the total sample was divided into two groups, group a and group b respectively. patients in group a received silodosin 4 mg three hours prior to the proposed intercourse. patients in group b received a placebo three hours prior to proposed intercourse. during the study, only the patients were blinded (not the investigator). intravaginal ejaculatory latency time (ielt), premature ejaculation profile (pep) and the clinical global impression of change for premature ejaculation (cgic) were recorded in patients, prior to the initiation of the treatment and the very next day of the treatment with drug. similarly, the premature ejaculation profile (pep) was recorded in partners as well, as the format allows separate recording of responses from the partners. data analysis was done by applying student s t - test, using the statistical package for the social sciences (spss) trial version 17. during the study period, we had a total of 143 patients subjected to treatment with on demand dapoxetine 30 mg for self - reported premature ejaculation. of this, 64 patients had expressed their unhappiness with the treatment. of these 64 patients, 24 reported no improvement of premature ejaculation with dapoxetine treatment, whereas the remaining 40 reported their dissatisfaction due to adverse events, mainly dizziness. the study participants were split into group a and group b. group a included 33 patients and their partners. the average age of patients in group a was 32.6 3.53 years, whereas the average age of patients in group b was 33.1 3.43 years. the average age of their partners in group a was 28.7 2.83 years and the average age of the partners in group b was 28.7 3.14 years. group b consisted of 26 patients with lifelong premature ejaculation and 5 patients with acquired premature ejaculation. the difference between the two groups was not statistically significant. the intravaginal ejaculatory latency time (ielt), recorded with a stopwatch operated by the partner, showed a statistically significant improvement post - treatment in the silodosin - treated group compared to placebo as shown in figure 2. diagram showing pre-(indicated in blue) and post - treatment (indicated in red). the premature ejaculation profile consisted of four questions related to satisfaction with sexual intercourse, control over ejaculation, ejaculation - related distress and ejaculation - related difficulty in interpersonal relationships respectively. the first two questions i.e. satisfaction with sexual intercourse and control over ejaculation were assessed according to a five - point, ascending scale, with one representing very poor and five representing very good. the last two questions, i.e. ejaculation - related distress and ejaculation - related difficulty in interpersonal relationships were assessed in descending order, with five representing extreme and one representing negligible or nil. the patient s ejaculatory control and associated distress could be scaled according the partner s perception as well. it clearly shows statistically significant improvement (p < 0.05) in the silodosin - treated group in all four subsets of premature ejaculation profile in both patients and their partners. average scores in two groups (pre and post treatment) in different premature ejaculation profile subsets the patients were asked to rate the effect of treatment on premature ejaculation using a seven - point response scale to measure clinical global impression of change for premature ejaculation. the seven points correspond to very much improved, much improved, minimally improved, no change, minimally worse, much worse and very much worse respectively. the silodosin - treated group reported an average score of 1.82 0.85 (corresponding to much improved), whereas the placebo treated group reported an average score of 3.8 0.63 (corresponding to almost no improvement). the scatter diagrams showing the clinical global impression of change for premature ejaculation (cgic) ratings by patients in the two groups are shown in figure 3 and 4 respectively. scatter diagram showing clinical global impression of change for premature ejaculation in group a patients (x axis represents patients and y axis represents clinical global impression of change score). scatter diagram showing clinical global impression of change for premature ejaculation in group b patients (x axis represents patients and y axis represents clinical global impression of change score). surprisingly, very few adverse events were reported by the silodosin - treated group. this included reduced quantity of ejaculate as reported by 26 out of 33 and uncomfortably delayed ejaculation by four. premature ejaculation is defined as a male sexual dysfunction characterized by (i) ejaculation which always or nearly always occurs prior to or within about one minute of vaginal penetration from the first sexual experience or a clinically significant bothersome reduction in latency time often to about 3 minutes or less (ii) the inability to delay ejaculation on all or nearly all vaginal penetrations ; and (iii) negative personal consequences, such as, distress, bother, frustration, and/or the avoidance of sexual intimacy. though there are many treatments prescribed for premature ejaculation, none, thus far, has been able to provide most satisfactory treatment to the patient. at present, selective serotonin reuptake inhibitors (ssris), specifically dapoxetine, forms the mainstay of pharmacotherapy due to the delay it causes in ejaculation by inhibition of the ejaculatory reflex through inhibitory descending pathways from higher centres. but these are associated with significant adverse effects, including psychiatric and neurologic complications along with unwanted sexual side effects. these effects are less prominent when on demand treatment is given ; however, adverse effects such as dizziness, loss of libido and nausea still appear even on on demand treatment with dapoxetine, making it less than optimal drug for the patient. we have had many such patients who desired pharmacotherapy with a drug other than dapoxetine, which prompted our search for a better, more tolerable drug. alpha blockers have long been established in the management of lower urinary tract symptoms. however, their use is associated with patient - reported sexual side effects, mainly retrograde ejaculation and anejaculation. the basis of these effects was reported to be their action on seminal vesicles, which have abundant alpha 1a adrenergic receptors. silodosin is a highly selective antagonist for this receptor and has been proved effective in the treatment of premature ejaculation at a dosage of 8 mg by masciovecchio s. hence, we decided to study its effectiveness in those patients dissatisfied with dapoxetine treatment. the dose had to be halved in view of the high incidence of anejaculation at a dose of 8 mg, as reported by masciovecchio s.. sato y. reported reduced incidence of anejaculation at a 4 mg dose. we found significant improvement in intravaginal ejaculatory latency time (ielt), which is in line with the reports of masciovecchio s. and both the patients and their partners reported better satisfaction with intercourse following silodosin treatment as compared to placebo. control over ejaculation was also reported to be good in the silodosin group, with very little ejaculation - related distress. in our study, only four patients reported uncomfortably - delayed ejaculation, and reported minimally - worse to worse on the cgic scale, following treatment with silodosin. though other studies have reported an incidence of anejaculation in about 2025% of patients, none of our patients reported anejaculation [1, 3 ]. have reported some discomfort while achieving orgasm in more than 80% of studied patients, none of our patients reported any discomfort during orgasm. a separate study is required to evaluate the efficacy of a lower dose of silodosin in those patients who reported uncomfortably - delayed ejaculation. the safety of alpha blockers in humans has been well - established for more than three decades by their use in patients with lower urinary tract symptoms (luts). however, using their major adverse event to our advantage was a novel idea floated by masciovecchio s. and sato y. [1, 3 ]. as there is a significant subset of patients who are dissatisfied with present standard pharmacotherapy with dapoxetine, mainly due to its adverse effects, the search continues for a safer and better alternative. we are the first to try silodosin in this group of patients, who have either failed therapy with dapoxetine or were unhappy due to its adverse effects. though premature ejaculation remains the most common sexual dysfunction in males, the number of patients seeking help from their treating physician for this complaint are considerably lower. similar was the case in our study, wherein the sample size became quite small as we had picked only that subset of patients self - reporting premature ejaculation who were dissatisfied with dapoxetine treatment. we acknowledge that this reduces the statistical power of the study for generalization of its findings. however, the use of silodosin as second - line treatment for premature ejaculation is a novel idea and our study supports such an approach. a larger, multicentre study, in this regard, is likely to provide stronger evidence in this aspect. silodosin, a drug that has already been proved safe for human use by its safety profile in the treatment of luts, is a safe and better - tolerated alternative to dapoxetine in the management of premature ejaculation. | introductionpremature ejaculation is a common sexual disorder, which is usually underreported. multiple treatment methodologies are in use due to the absence of an effective, universally acceptable treatment modality. the most common drug used is dapoxetine, which has adverse effects limiting its long - term use. hence, we decided to evaluate the effectiveness of on demand silidosin 4 mg in patients with premature ejaculation, who were dissatisfied with dapoxetine 30 mg.material and methodsthe study included 64 patients who reported premature ejaculation who were unhappy with the treatment with on demand dapoxetine 30 mg, either due to its adverse effects or because of its overall inefficacy. they were divided into two groups of 33 and 31 respectively by simple randomization, with group a treated with on demand silodosin 4 mg three hours prior to intercourse, whereas group b was treated with placebo. pre- and post - treatment intravaginal ejaculatory latency time (ielt), premature ejaculation profile (pep) and clinical global impression of change (cgic) for premature ejaculation were evaluated.resultspatients in group a (silodosin 4 mg) reported statistically significant improvement (p < 0.005) in intravaginal ejaculatory latency time (ielt), premature ejaculation profile (pep) and clinical global impression of change (cgic) for premature ejaculation, with four patients reporting uncomfortably - delayed ejaculation.conclusionson demand silodosin 4 mg is an effective treatment option with very few adverse events in those patients suffering from premature ejaculation, who are dissatisfied with dapoxetine 30 mg due to its adverse effects or inefficacy. |
many transition - metal dichalcogenides form layered structures related to that of cdi2 and these are emerging as extremely important functional materials. recent developments in graphene science have inspired the exploitation of the remarkable properties of layered transition - metal chalcogenides, such as strong spin splitting and access to a range of bandgaps. these materials are promising candidates for spintronics, energy storage devices, electrocatalysts for hydrogen evolution, and as high - performance materials for optoelectronics. titanium diselenide is one of the most widely studied metal chalcogenides due to its intriguing electronic properties. in addition to semimetallic behavior, it exhibits charge density wave transitions at lower temperatures and superconductivity with cu intercalation. the properties of tise2 can vary with the form, morphology, and thickness of the films ; for example, recently prepared one - dimensional chains in the hybrid organic phase tise2(en) (en = 1,2-diaminoethane) have a direct bandgap of 1.21 ev compared to the bulk phase, which has a 0.2 ev overlap between the conduction and valence bands. by sintering pellets of tise2 under ar, hence, the ability to control the size, dimensionality, and morphology could offer an entry into new behavior and applications of chalcogenide materials. we have recently shown that highly selective growth of crystalline single - phase snse2 films within photolithographically patterned substrates can be achieved via single - source reagents [sncl4{buse(ch2)nsebu } ] (n = 2 or 3). selective growth specifically within small conductive tin features on the micrometer / submicrometer diameter is a very attractive prospect for a number of applications in the electronic industry, including phase change memory materials and thermoelectric materials. previous chemical vapor deposition (cvd)-based approaches to the deposition of metal chalcogenide films have included both single- and dual - source atmospheric pressure cvd. the latter used volatile mclx with a range of thiols, thiolates, or dialkyl diselenides, or aerosol - assisted cvd using m(nme2)x and rsh or bu2s. we have used group 4 metal bis - cyclopentadienyl complexes with selenolate ligands as single - source precursors for cvd of mse2 films (m = ti, zr, and hf), and the o - xylyl - based chalcogenoether complexes [ticl4{o - c6h4(ch2eme)2 } ] as reagents to deposit tie2 (e = s or se). winter and co - workers previously used [ticl4(seet2)2 ] (2) for production of tise2 thin films, but these were reported to be unstable in air, degrading to give amorphous titanium oxy - selenide materials. here we report the low - pressure chemical vapor deposition (lpcvd) of single - phase, crystalline tise2 thin films onto sio2 and tin substrates using the molecular single - source precursor [ticl4(sebu2)2 ] (1). this work demonstrates that the approach, specifically using selenoether complexes as single - source precursors to achieve very highly selective film growth, is also relevant to the transition - metal chalcogenides. moreover, we show that the scale of the patterning directly influences the morphology of the deposit, and we describe the use of synchrotron - based microfocus x - ray diffraction, together with scanning electron microscopy, to probe the morphology of the materials deposited as a function of template hole size, down to features of dimensions 2 m diameter 1 m deep. all reactions were conducted using schlenk, vacuum line, and glove box techniques under a dry nitrogen atmosphere. buli was obtained from aldrich and used as - received. bu2se and [ticl4(seet2)2 ] (2) infrared spectra were recorded as neat thin films (unless otherwise stated) between csi plates using a perkin - elmer spectrum100 spectrometer over the range 4000200 cm. h and c{h } nmr spectra were recorded in cdcl3 or cd2cl2, using a bruker av300 spectrometer. se{h } nmr spectra were recorded using a bruker dpx400 spectrometer and are referenced to neat me2se. electrospray (es) ms data were obtained from solutions in mecn using a vg biotech platform. thermogravimetric analyses (tga) used a mettler toledo tga / sdta851e analyzer under a flow of ar at 65 ml / min, contained within a dry, n2-purged glove box. [ticl4(bu2se)2 ] (1) : bu2se (0.386 g, 2.0 mmol) was dissolved in ch2cl2 (5 ml) and added to a solution of ticl4 (0.188 g, 1.0 mmol) in rigorously anhydrous ch2cl2 (10 ml). a red solution was formed immediately and further stirred for 1 h. the volatile components were removed in vacuo to give a dark red oil. ir (neat thin film) : /cm = 354 (sh), 395 (vs), 430 (sh) (ti cl). h nmr (cdcl3, 295 k) : = 0.96 (t) [3h ] me, 1.47 (m) [2h ] ch2, 1.78 (m) [2h ] ch2, 3.00 (br) [2h ] ch2se. c{h}(cdcl3, 295 k) : = 13.52, 22.86, 31.70, 35.13. calcd for c16h36cl4se2ti : c, 33.4 ; h, 6.3. found : c, 33.3 ; h, 6.5%. substrates were prepared as described in ref (10). in a typical experiment, ca. 120 mg of the reagent and the substrates (1 5 25 mm) were loaded into a closed - end silica tube in a glove box. the tube was set in the furnace such that the precursor was (ca. the tube was evacuated to 0.5 mmhg, and the furnace was set to 873 k (the temperature in the hot zone was measured as 858 k). 20 min the tube position was adjusted to move the precursor further toward the hot zone (ca. 1 cm away from edge of the heated zone) until the oil gradually began to evaporate. at this point the sample position was maintained until the entire precursor had evaporated, leaving behind no residue. the tube was then cooled to room temperature and transferred to the glove box where the tiles were removed and stored for further characterization. the lpcvd experiments using precursor (1) produced purple matt powdery films of tise2, with dense coverage on tiles in the hottest zone where the temperature was about 845858 k. no significant differences were observed in the film morphology across the tiles. in contrast, using 510 mg of precursor resulted in very thin films which were purple and reflective in appearance ; these tended to be much more sensitive to moist air. however, upon careful handling within the glove box, good quality tise2 films could be retained without degradation for several weeks. xrd patterns were collected in grazing incidence (1 = 3) using a bruker d8 with gadds diffractometer (cu k1) for phase identification purposes. to examine preferred orientation, a rigaku smartlab system with a 2-bounce primary monochromator (cu k1) was used in symmetric 2 geometry and the data refined against a standard literature tise2 model using the gsas package. the march - dollase preferred orientation ratio was used to model crystallite orientation relative to the substrate normal. microfocus xrd patterns were collected at beamline i18 of the diamond light source using 16.8 kev (0.738) x - rays focused to a 2 4 m fwhm spot. an aligned optical microscope was used to locate regions of interest on the sample and diffraction patterns were collected through the 0.6 mm si substrate and 125 nm tin film using a 4000 2500 pixel ccd detector ; a data collection on an identical substrate with no deposited film was used to subtract the substrate contributions to the signal. raman scattering spectra of the deposited films were measured at room temperature on a renishaw invia micro raman spectrometer using a helium scanning electron microscopy (sem) was performed on samples at an accelerating voltage of 10 kv using a zeiss evo ls 25, and energy dispersive x - ray (edx) data were obtained with an oxford inca x - act x - ray detector. the cross - section sem measurements were carried out with a field emission sem (jeol jsm 7500f) at an accelerating voltage of 2 kv. hall measurements were performed at room temperature on a nanometrics hl5500pc with a current of 1 ma. mm) were loaded with 58 mg of reagent into a closed - end silica tube in a glove box as described above, and depositions were performed similarly over ca. we have previously described the synthesis, properties, and structures of thio- and selenoether complexes of tix4. these are distorted cis - octahedral complexes of the form [tix4(l l) ], where l l is mee(ch2)neme (e = s, se ; n = 2 or 3), o - c6h4(ch2eme)2, and o - c6h4(eme)2. all of these complexes are hydrolytically sensitive, forming oxo - bridged dinuclear species upon partial hydrolysis. the [ticl4(seet2)2 ] (2),o - xylyl - diselenoether, and o - xylyl - dithioether complexes of titanium(iv) chloride were tested as reagents for low - pressure cvd, yielding tise2 and tis2, respectively. the sulfide remains a very rare example of metal sulfide film growth via a single - source metal - thioether complex. the moisture - sensitive [ticl4(sebu2)2 ] (1) was synthesized and isolated in good yield as a dark red oil by direct reaction of ticl4 and ligand in anhydrous ch2cl2. the compound showed no degradation over several weeks if stored under n2 in the freezer. samples were manipulated in an n2 purged, dry (< 1 ppm h2o) glove box and was characterized by ir, h, c{h }, and se{h } nmr spectroscopy, with the data in very good agreement with related complexes, and consistent with a distorted cis - octahedral coordination environment. the n - butyl substituents were introduced in the ligand with the aim of providing an easy thermal decomposition pathway via -hydride elimination, for the reagent during the cvd experiments. a similar cis - octahedral moiety is present in [ticl4(seet2)2 ] (2), which was obtained and characterized similarly. tga measurements on (1) and (2) (esi) show the onset of evaporation at 380 and 360 k, respectively, with mass loss occurring in a single step for (1), leaving a residue (8.5%) which is unaffected above 570 k. for (2), mass loss occurs in three steps, with loss of 67% between 360 and 430 k, followed by further mass losses of 18% between 430 and 480 k and 8% between 480 and 560 k, with a small amount of residue (11%) remaining at higher temperatures. in both cases the residue is significantly less than that expected for decomposition to tise2 (35.7% and 44.4%, respectively, for (1) and (2)) ; hence, it appears that the tga data show evaporation of the precursor as the dominant thermal process under 1 atm pressure of inert gas. lpcvd experiments using (1) were performed using freshly prepared samples, as the reagent tended to darken over a few days to weeks if maintained at room temperature in the glove box, indicative of decomposition. lpcvd of complex (1) was undertaken with the furnace temperature set at 873 k, leading to complete evaporation of the precursor compound and deposition of intensely purple matt films onto the sio2 substrate. reducing the temperature to 773 or 823 k resulted in poorer coverage and incomplete decomposition of the precursor ; hence, the deposition temperature of 873 k was selected (this was also the temperature previously used for lpcvd experiments on (2)). 50100 mg of precursor and sem analysis on these tise2 films showed a regular morphology formed of hexagonal plate crystallites. most of the crystallites are aligned with their flat surfaces perpendicular to the substrate surface (figure 1a, b) and cross - sectional sem showed these films were 45 m thick. however, cross - section sem analysis of reagent - limited films grown at 873 k using 57 mg of precursor (1) showed films that were much thinner (ca. sem images of hexagonal tise2 : (a) top view and (b) cross section of film deposited from 100 mg of reagent, showing the film thickness of 4 m ; (c) top view of a much thinner snse2 film deposited using 5 mg of reagent ; (d) cross section of this thin film. lpcvd experiments using precursor (2), which is a solid at ambient temperatures, were in accord with those reported by winter and co - workers, and although visually the two reagents appear to behave quite similarly, in our hands precursor (2) tended to give much thinner films of tise2. xrd measurements on the material deposited from (1) confirmed it as crystalline hexagonal tise2 in all cases, with strongly textured diffraction patterns as expected from the large, oriented crystallites observed in the sem images. rietveld refinement of a pattern from a thick film collected in symmetric 2 geometry (figure 2) revealed lattice parameters of a = 3.53489(14) and c = 6.0036(4), close to those of bulk tise2 (space group p3m1, a = 3.540(1) and c = 6.008(3)). as expected from the crystallite orientations observed by sem, the data show a clear suppression of the intensity of reflections strongly associated with the c - axis ; this was modeled via a preferred orientation fraction of 0.605(2) in the 110 direction. fit to the xrd pattern for tise2 in p3m1 (rwp = 1.7%, rp = 1.2%). crosses mark the data points, the upper continuous line the fit, and the lower continuous line the difference. tick marks show the positions of allowed reflections, the first five of which are also labeled. the edx measurements show that the ti : se ratio is 1:2 (29.2% ti, 59.2% se), and while there is no residual cl impurity present, a small amount of carbon (7.0%) incorporation is observed, most likely as residual contamination on the surface of the crystallites derived from the butyl substituents in the precursor (si and o from the silica substrate account for the remaining 5%). raman spectra were recorded on several samples and showed an intense peak at 197 cm and a weaker peak at 138 cm (figure 3) corresponding to raman active a1 g and eg symmetry phonons of the bulk hexagonal 1t - tise2, respectively. measurements taken at several regions on the sample showed no significant variation in peak width or relative intensities. other peaks corresponding to secondary phases such as tio2 were not evident. raman spectrum of tise2 thin film grown by lpcvd at 873 k from (1) showing the a1 g and eg modes. the broad features to high frequency are from the substrate. thin films were deposited on a sputtered sio2 film to insulate the substrate. the experiments were conducted under a magnetic field of 0.5 t at 300 k. the resistivity of the tise2 films was found to be (3.36 0.05) 10 cm. similar values have been reported in literature and this high conductivity is consistent with the very small bandgap for tise2 of around 150 mev. this small bandgap results in a near intrinsic semiconductor with both electrons and holes contributing to the conductivity and hall coefficient as given in1 the hall coefficient is (9 2) 10 cm / c, hence a minimum electron carrier density of 1 10 cm. the sign of the hall coefficient might indicate n - type conduction, but is more likely to reflect the higher electron than hole mobility. reagent - limited lpcvd experiments using 57 mg of precursor were undertaken onto photolithographically patterned sio2/tin substrates. this resulted in very highly selective deposition within the conducting tin holes of the patterned substrates (figure 4). the coverage was densest on the substrates which lay in the hotter zone of the furnace. this high substrate selectivity was observed for all sizes of holes varying from the large (80100 m) diameters to the smaller (25 m) diameters, as illustrated in the figures 5 and 6, respectively. sem images : (a) showing selective growth of tise2 onto the tin on a patterned tin (left)/sio2 (right) substrate ; (b) showing selective deposition of tise2 within 5 m tin hole of a tin / sio2 patterned substrate. sem image (a) and edx element maps (b)(d) confirming the selective deposition of tise2 occurring only within the holes (80 m diameter) with growth occurring preferentially onto the tin surface. sem image (a) and edx element maps (b)(d) confirming the selective deposition of tise2 occurring only within the holes (2 m diameter) with growth occurring preferentially onto the tin surface. substrate selective deposition of tise2 into 2 m diameter holes is successful on a smaller scale than observed for snse2 where this scale of selectivity was limited (to 5 m) by the size of the individual snse2 crystallites (1.6 2.0 m across the hexagon). the sem images suggest that the average size (in x y plane) of individual tise2 crystallites varies from 1.2 m (within 100 m tin holes) to 600 nm (within 2 m tin holes). microfocus x - ray diffraction experiments were performed at beamline i18 of the diamond light source using a 2 4 m beam impinging on the region of sample of interest normal to the substrate and with the diffracted beam collected after passing through the substrate. figure 7 shows typical diffraction patterns after subtraction of a background collected on a blank substrate. these patterns show conclusively that the same material was being produced in all hole sizes as on flat substrates. the beam size was small enough for the sampling region to be the same with these differently sized holes and a grid of sample positions was collected to ensure that patterns were obtained with the beam in the center of the hole, but it was found that the patterns collected from samples deposited into smaller holes were always much more heavily textured than from those deposited in larger holes. this suggests a smaller number of crystallites in the beam footprint in smaller holes, which could be related to a smaller amount of deposit, or to larger crystallites. examination of the crystallite sizes in sem images (figure 8) showed that both the length and thickness of crystallites increases with the hole size but that the thickness of the crystals stops increasing above 20 m hole size, whereas their lengths continue to increase. microfocus x - ray diffraction patterns collected on tise2 samples selectively deposited into 100 m (a) and 5 m (b) holes. variation of crystallite length (along a - axis of hexagonal plate) (a) and width (along c - axis) (b) with the size of hole into which the sample is deposited. the black line is to provide a guide to the eye and the values / error bars were obtained by sem measurement of 10 crystallites in a sample. the smallest holes have a diameter of 2 m and a depth determined by the 1 m thickness of the silica film. combining the diffraction and sem results shows that a smaller number of crystallites is deposited per unit area in the smaller holes and that the crystallite size is also smaller. the obvious explanations are that diffusion to the surface is less efficient than in the larger holes or that the smaller deposition area acts less efficiently to supply adsorbed species to the growth process. neither is compelling since, with no carrier gas, the boundary layer for diffusion should be very thin and the aspect ratio of the smallest holes is not large, whereas a larger area may contain more adsorbed material, but it also has a larger area across which growth can occur. it may be that the hydrophilic side walls of the holes have a more significant effect on the transport of the precursor as the hole size becomes smaller, and that this is the determining factor controlling growth into the holes. the high selectivity of tise2 onto the tin regions using patterned sio2/tin substrates can be attributed to variation in the nature of the surfaces. we have recently correlated the selective deposition with the wetting property of the substrate surface. cao and co - workers have very recently demonstrated a strong mediation effect of substrates for growth of layered chalcogenide materials signifying dynamics of growth reaction which leads to facile migration of metal chalcogenide adatoms onto substrates. this very high selectivity for film deposition from the single - source selenoether ligand complexes onto the highly conducting tin is attractive for potential applications of chalcogenide materials in electronic devices. the molecular complex of titanium(iv) chloride with di - n - butyl selenide, (1), has been shown to function as an efficient single - source precursor for the low - pressure cvd of single - phase, crystalline tise2, apparently superior to the more hydrolytically sensitive diethyl selenide analog, (2), reported previously. reagent (1) provides strong evidence for selective deposition of tise2 within photolithographically micropatterned templates via cvd, and importantly, establishes that the high substrate selectivity previously observed for snse2 is not unique to that system, but may be a much more common phenomenon of metal chalocogenide cvd using single - source precursors derived from metal halide complexes with suitable chalcogenoether ligands. precursor (1) forms smaller crystallites than observed for snse2, and allows filling of the (smallest) 2 m diameter holes with the desired tise2 stoichiometry. microfocus xrd experiments show that the crystallite sizes increase with increased template hole size. | the neutral, distorted octahedral complex [ticl4(senbu2)2 ] (1), prepared from the reaction of ticl4 with the neutral senbu2 in a 1:2 ratio and characterized by ir and multinuclear (1h, 13c{1h }, 77se{1h }) nmr spectroscopy and microanalysis, serves as an efficient single - source precursor for low - pressure chemical vapor deposition (lpcvd) of titanium diselenide, tise2, films onto sio2 and tin substrates. x - ray diffraction patterns on the deposited films are consistent with single - phase, hexagonal 1t - tise2 (p3m1), with evidence of some preferred orientation of the crystallites in thicker films. the composition and structural morphology was confirmed by scanning electron microscopy (sem), energy dispersive x - ray, and raman spectroscopy. sem imaging shows hexagonal plate crystallites growing perpendicular to the substrate, but these tend to align parallel to the surface when the quantity of reagent is reduced. the resistivity of the crystalline tise2 films is 3.36 0.05 103 cm with a carrier density of 1 1022 cm3. very highly selective film growth from the reagent was observed onto photolithographically patterned substrates, with film growth strongly preferred onto the conducting tin surfaces of sio2/tin patterned substrates. tise2 is selectively deposited within the smallest 2 m diameter tin holes of the patterned tin / sio2 substrates. the variation in crystallite size with different diameter holes is determined by microfocus x - ray diffraction and sem, revealing that the dimensions increase with the hole size, but that the thickness of the crystals stops increasing above 20 m hole size, whereas their lengths / widths continue to increase. |
lymphomatoid granulomatosis (lyg) is a multisystem disorder of unknown aetiology ; although recent data indicate that lyg is an epstein - barr virus (ebv) positive b - cell proliferation associated with an exuberant t - cell reaction15. it is an angiocentric malignant lymphoma characterized by a polymorphic lymphoid infiltrate, an angiitis, and granulo - matosis. although it may affect virtually any organ, it is most frequently characterized by pulmonary, skin and central nervous system involvement6. plg was first described as a clinico - pathologic entity by averill liebow and colleagues in 19727. since that time, the clinical implications of this lesion have remained controversial, as evidenced by a long list of competing synonyms including angiocentric immunoproliferative lesion and angiocentric lymphoma810. some have argued that the histopathologic pattern of lymphomatoid granulomatosis, which can occur in pulmonary and extrapulmonary tissue, is a nonspecific manifestation of diverse pathogenetic conditions, including autoimmunity, infection, and malignancy11. the diagnosis of this condition is often difficult as the physical signs, history, chest x - ray, and routine laboratory investigations are usually non- specific. as far as we know no case of pulmonary lyg has been reported in nigeria. patient is a 52-year old nigerian male of ibo extraction working with a road construction company, and was admitted into our hospital on 27 march 2001 on account of recurrent right sided, non - radiating chest pain of 25 years duration, breathlessness of 6 years duration ; and recent onset of weight loss of 4 months duration. he had earlier been treated by three private hospitals for pneumonia and tuberculosis although the sputum was negative for acid- fast bacilli as was the mantoux test. he was referred to the unit on account of chest x - ray and ct - chest findings suggestive of right thoracic empyema. he was afebrile, anicteric, not pale and had no digital clubbing, nor peripheral oedema. the chest examination showed tracheal deviation to the left, diminished excursion of the right hemithorax with stony dull percussion notes on the right mid- and lower zones. the tactile fremitus and vocal resonance were diminished on the same zones with absent right basal breath sounds. the unit 's admitting diagnosis was that of right pleural effusion of uncertain aetiology to rule out mesothelioma. a diagnostic thoracentesis using a size 21 g hypodermic needle was dry. however, there was the feeling of traversing through thickened parietal pleura. bronchoscopy was scheduled but was not done due to faulty venturi system. on 30 march 2001 this was later converted into a formal posterolateral thoracotomy, decortication of lung, and biopsy of lung parenchymal nodular masses following intraoperative diagnostic thoracentesis that yielded 200mls of purulent exudate. other findings intra - operatively included very thick nodular parietal pleura = 2.0 cm and thickened visceral pleural = 0.5 cm with nodularities of the right lung parenchyma, right hemidiaphragm, and the oblique fissure. the pleural fluid microbiology yielded coliform organism sensitive to co - trimoxazole, ampicillin, gentamycin, and cefuroxime. histopathologic examination of the pleural specimen showed several pieces of whitish greyish tissue, firm and rubbery in consistency and aggregating 12 11 4 cm. the specimen of the lung consisted of a piece of brownish tissue soft in consistency and measuring 2 1 1.5 cm. the histologic section of both specimens showed complete effacement of normal structures by an infiltrating sea of lymphocytes of varying sizes, plasma cells, and numerous large immunoblast - like cells. based on this histology he was commenced on cytotoxic chemotherapy consisting of tabs cyclophosphamide 400mg / m2 daily 5/7 and tabs predinosolone the course would be repeated every 3 weeks until remission or no further improvement. additionally, he had intrapleural cyclophos - phamide instillation prior to removal of the chest drains. he was discharged to the clinic on the 24 post operative day. on 14 may 2001 the repeat chest x - ray at this time showed some improvement with residual patchy nodularities in the right lung, ipsilateral pleural fluid and thickening. he thereafter defaulted until a year later (15 april 2002) when he re - presented with loss of appetite and weight loss 3/12 ; fever and shortness of breath 2/52. physical examination revealed pallor, grade 2 pitting leg oedema, and bilateral mobile axillary lymphadenopathy. the chest examination showed increased tactile fremitus and vocal resonance with diminished breath sounds over the right basal hemithorax. he declined re- admission for further evaluation, and had since been lost to follow - up. however, oral communication with a neighbour as of september 2003 would seem to indicate that he had remained in some apparent health. it is a slowly progressive and characterized histologically by the angiocentric proliferation of large, atypical lymphohistiocytic cells with variable numbers of small lymphocytes, plasma cells, histiocytes, and eosinophils. the disease has characteristics of an inflammatory granulomatous process as well as those of a lymphoproliferative disease hence the term although the disease affects primarily the lung, extrapulmonary manifestation especially in the central nervous system, skin, kidney, spleen, liver, heart and lymph nodes has been described61415. involvement limited to tongue, nasal cavity and nasopharynx may mimic wegener 's granuloma (wg)1617. however unlike wg, poorly controlled lyg often evolves into, and terminates in a malignant lymphomatous process18. in addition, lyg does not show as favourable a response to chemotherapy and corticosteroid as does wg, nor does it share the relatively good prognosis of extranodal lymphomas in general and primary pulmonary lymphomas in particular. the key microscopic picture is the presence of a polymorphic infiltrate rich in plasma cells, immunoblasts and atypical large lymphoid cells, with a tendency to involve the walls of pulmonary vessels and to collect in the subendothelial spaces. although immuno histochemistry was not done, it typically shows that most of the malignant cells react to b- cell markers with few normal t cells. however, occurrence in childhood has been documented1519, as well as in the immunosuppressed20. additionally, misdiagnosis by peripheral hospitals could have contributed to the delay in definitive diagnosis. the symptoms in our case were mainly respiratory as has been noted by katzenstein, carrington, and liebow14. indeed lung involvement is the sine qua non of lyg17. as was the experience of others, the laboratory findings in our case were non - specific and although pleural effusion has been known to occur in lyg12, commoner causes of pleural effusion in our environment like pneumonia, empyema and tuberculosis needed to be ruled out. this may explain the rationale for anti - tuberculous trial in the peripheral centre. besides pleural effusion of uncertain aetiology, differential diagnosis of mesothelioma in our patient was considered on account of the long duration of history and the nature of his work even though it was difficult to establish history of direct exposure to asbestos2223. serology for ebv was not done in our case although ebv need not be present to incite this illness15. there was evidence of some remission, even though incomplete, following the first course of chemotherapy. however, his representation a year later with evidence of relapse was a pointer to the on - going process of the lesion. whether this case had progressed to lymphoma was difficult to say as he declined a re - admission and further investigation. nonetheless, as noted by fauci, haynes, costa, cyclophosphamide with corticosteriod can induce long - term remission in lyg and if complete remission occurs, lymphoma does not develop. however in patients in whom this regimen does not induce satisfactory remission, the disease almost invariably evolves into a lymphoma that is generally refractory to therapy. lyg should be considered in long - standing nodular pulmonary lesion and pleural effusion of uncertain aetiology. | lymphomatoid granulomatosis (lyg) is a rare angiocentric lymphoproliferative process predominantly affecting the lung. the diagnosis of this condition is often difficult as the physical signs, history, chest x - ray, and routine laboratory investigations are usually non - specific. nevertheless, it is important to establish a tissue diagnosis, as this lymphoproliferative disorder can be refractory to treatment and even progress to overt lymphoma. we report a case of pulmonary lyg in a 52-year old nigerian man of ibo extraction treated in our centre in 2001 and followed up for a year. the difficulty in making diagnosis is highlighted and treatment modality discussed. |
eleven volunteers were involved in this experiment and for the evaluation of musculoskeletal pathology, all underwent mr imaging procedures. the sex ratio was 7:4 (male : female) and their ages ranged from 15 to 68 (mean, 40.4) years. all experiments were carried out with institutional review board approval and the subjects informed consent. during musculoskeletal mr examination, the step involving contrast - enhancement was replaced by this experiment. just before the acquisition of contrast - enhanced musculoskeletal mr images, test - bolus and main bolus studies were performed consecutively. because no arterial enhancement phase was needed during this imaging procedure, our experiment did not lead to the deterioration of musculoskeletal mr images. for the test - bolus study, 2 ml of contrast media (omniscan, nycomed imaging as, oslo, norway) was injected into the right antecubital vein of the upper extremity through a 20 - 21 gauge needle at a rate of 3 ml / sec, using a power injector (medrad, indianola, pa). in order to propel the previously injected contrast bolus, 20 ml of normal saline was subsequently injected behind the contrast medium at the same rate. repeated acquisition of image data coincided with the start of contrast injection, and images were acquired for a period of 120 seconds. a 1.5 t mri scanner (magnetom vision plus ; siemens medical systems, erlangen, germany) was used with the pulse sequence set at two - dimensional turbo fast low angle shot (turbo - flash). repetition time (tr), echo time (te), and flip angle (fa) were 8.5 msec, 4.0 msec, and 10 degrees, respectively. slice thickness, field of view (fov), numbers of phase encoding (ny) and frequency encoding (nz) were 8 mm, 263350 mm, 96 and 256, respectively. the receiver bandwidth was 355 hz / pixel and data oversampling was the read - out gradient. a saturation band was not added. temporal resolution was one second and acquisition continued for 120 seconds by means of two sequential 60-second scans, without intermission. this repeated acquisition was performed in a single slice at the level of the infrarenal abdominal aorta. the main - bolus study involved the use of the same pulse sequence at the same location. the dose of injected contrast material was 0.1 mmol / kg and the injection rate was the same as that of the test - bolus. acquisition continued for 180 seconds in three consecutive phases, during which time the subjects breathed normally. after the reconstruction of raw data, time - intensity curves for each phase of each part of the study were drawn corresponding to the aorta and the inferior vena cava. in order to cover the whole cross sectional area of the aorta and the inferior vena cava, regions of interest (roi 's) were drawn as large as possible. to reduce inter - observer error between the test - bolus and main bolus studies, all roi 's were drawn by a single researcher. automatic scaling was selected for each time - intensity curve obtained during the first phase. for the time - intensity curves of the second and third phases, maximum signal intensity was manually equalized to that of the first phase curve in order to provide a normalized series of curves across the three phases. the parameters measured from the time - intensity curves were arterial and venous enhancement time (tae and tve), arteriovenous circulation time (tav), arterial peak - enhancement time (tp), enhancement duration (ed) and enhancement expansion ratio (eer) (fig. enhancement time was defined as the time interval between the starting point of data acquisition and the point at which half - maximum height in the upstroke portion of the time - intensity curve was seen, and from it, the arrival time of the contrast bolus at the target vessel could be inferred. the formula for the arteriovenous circulation time (tav) was as follows : - where tav is the period of pure arterial enhancement before subsequent venous enhancement. tp is the time taken to reach the peak of the arterial time - intensity curve and represents the time for peak enhancement. ed was defined as the time interval between the rising point of the arterial time - intensity curve and the end point of the downstroke of the curve as it approached the baseline of residual enhancement. in traditional timing methods, this parameter is regarded as equal to infusion time ; thus, instead of ed, infusion time was used as a variable to fit the center of the main bolus to the center of data acquisition time. since ed was presumed to be longer than infusion time, eer was also measured, and was calculated according to the following formula : - where ti = infusion time of contrast media (sec) test - bolus and main bolus studies were performed with as short an intermission as possible. test bolus and main bolus in a single volunteer were thus compared on the assumption that both studies were performed while physiological status was the same. eleven volunteers were involved in this experiment and for the evaluation of musculoskeletal pathology, all underwent mr imaging procedures. the sex ratio was 7:4 (male : female) and their ages ranged from 15 to 68 (mean, 40.4) years. all experiments were carried out with institutional review board approval and the subjects informed consent. during musculoskeletal mr examination, the step involving contrast - enhancement was replaced by this experiment. just before the acquisition of contrast - enhanced musculoskeletal mr images, test - bolus and main bolus studies were performed consecutively. because no arterial enhancement phase was needed during this imaging procedure, our experiment did not lead to the deterioration of musculoskeletal mr images. for the test - bolus study, 2 ml of contrast media (omniscan, nycomed imaging as, oslo, norway) was injected into the right antecubital vein of the upper extremity through a 20 - 21 gauge needle at a rate of 3 ml / sec, using a power injector (medrad, indianola, pa). in order to propel the previously injected contrast bolus, 20 ml of normal saline was subsequently injected behind the contrast medium at the same rate. repeated acquisition of image data coincided with the start of contrast injection, and images were acquired for a period of 120 seconds. a 1.5 t mri scanner (magnetom vision plus ; siemens medical systems, erlangen, germany) was used with the pulse sequence set at two - dimensional turbo fast low angle shot (turbo - flash). repetition time (tr), echo time (te), and flip angle (fa) were 8.5 msec, 4.0 msec, and 10 degrees, respectively. slice thickness, field of view (fov), numbers of phase encoding (ny) and frequency encoding (nz) were 8 mm, 263350 mm, 96 and 256, respectively. the receiver bandwidth was 355 hz / pixel and data oversampling was the read - out gradient. a saturation band was not added. temporal resolution was one second and acquisition continued for 120 seconds by means of two sequential 60-second scans, without intermission. this repeated acquisition was performed in a single slice at the level of the infrarenal abdominal aorta. the main - bolus study involved the use of the same pulse sequence at the same location. the dose of injected contrast material was 0.1 mmol / kg and the injection rate was the same as that of the test - bolus. acquisition continued for 180 seconds in three consecutive phases, during which time the subjects breathed normally. after the reconstruction of raw data, time - intensity curves for each phase of each part of the study were drawn corresponding to the aorta and the inferior vena cava. in order to cover the whole cross sectional area of the aorta and the inferior vena cava, regions of interest (roi 's) were drawn as large as possible. to reduce inter - observer error between the test - bolus and main bolus studies, all roi 's were drawn by a single researcher. automatic scaling was selected for each time - intensity curve obtained during the first phase. for the time - intensity curves of the second and third phases, maximum signal intensity was manually equalized to that of the first phase curve in order to provide a normalized series of curves across the three phases. the parameters measured from the time - intensity curves were arterial and venous enhancement time (tae and tve), arteriovenous circulation time (tav), arterial peak - enhancement time (tp), enhancement duration (ed) and enhancement expansion ratio (eer) (fig. enhancement time was defined as the time interval between the starting point of data acquisition and the point at which half - maximum height in the upstroke portion of the time - intensity curve was seen, and from it, the arrival time of the contrast bolus at the target vessel could be inferred. the formula for the arteriovenous circulation time (tav) was as follows : - where tav is the period of pure arterial enhancement before subsequent venous enhancement. tp is the time taken to reach the peak of the arterial time - intensity curve and represents the time for peak enhancement. ed was defined as the time interval between the rising point of the arterial time - intensity curve and the end point of the downstroke of the curve as it approached the baseline of residual enhancement. in traditional timing methods, this parameter is regarded as equal to infusion time ; thus, instead of ed, infusion time was used as a variable to fit the center of the main bolus to the center of data acquisition time. since ed was presumed to be longer than infusion time, eer was also measured, and was calculated according to the following formula : - where ti = infusion time of contrast media (sec) test - bolus and main bolus studies were performed with as short an intermission as possible. test bolus and main bolus in a single volunteer were thus compared on the assumption that both studies were performed while physiological status was the same. using pearson 's correlation, average tae 's in the test - bolus and main bolus studies were 12.73 and 13.00 seconds, respectively. when the main bolus time - intensity curve was compared with that of the test - bolus, tae ratios ranged from 0.89 to 1.43 with an average of 1.05, implying a slightly delayed tae for the main bolus. this latter showed a higher maximal signal intensity at tp than did the test bolus. average tav 's of the test - bolus and main bolus studies were 15.09 and 16.36 seconds, respectively. the average ratio of tav ratio 1.10, indicative of a slightly longer tav for the main bolus. for these two comparisons, the correlation coefficients of 0.95 (p < 0.01) and 0.92 (p < 0.01), respectively, were statistically significant. the correlation coefficient of tve 's between test and main boluses was 0.98 (p < 0.01) (tables 1 and 2). the ed 's of both main and test bolus were increased more than did infusion times. since no acute translation point was detected in the down - slope of the time - intensity curve, the ed of the main bolus was hard to define accurately. the eer of the test - bolus study showed a wide range, from 16.00 to 67.16 (average, 25.43) depending on the subject. the tp of the main bolus was 1.7 times longer than that of the test bolus. the comparisons of ed, eer and tp showed no statistically significant correlations with high standard deviations (tables 1 and 2, fig. 2), though it was clear that tp in the test - bolus study matched the initial portion of the main bolus. the matched portion ranged from 0 to 13.33 (average, 5.4) percentile of the main bolus (fig. the most accepted traditional method for calculation of the scan delay time (1) fits the center of data acquisition to a point consisting of the arterial peak enhancement time of the test - bolus and half of the injection duration, with the purpose of matching the centers of k - space and the main bolus. as seen in the results of this study, however, the arterial peak enhancement time acquired from the test - bolus study matched the initial portion (less than the 13th percentile) of the main bolus rather than its center. in addition, the mismatch between arterial peak enhancement time and the center of the main bolus was not compensated for by adding one half of the injection duration, since the bolus tends to elongate more than the duration of injection. in fact, the traditional method places the center of data acquisition at the initial portion of the main bolus, making the initial portion of k - space acquire the unenhanced and less enhanced arterial signal. infusion time and arterial enhancement time, the parameters for determining scan delay time by the traditional method, therefore showed poor statistical correlation between test and main boluses. on the basis of the results of this study, we are able to suggest the most reliable parameters for determining the scan delay time in mr angiography. from the time - intensity curves obtained from the test and main bolus injections, we found that arterial and venous enhancement times and arteriovenous circulation time obtained from the test bolus showed statistically significant correlation between the test and main boluses. that is, these three parameters predicted the shape of main bolus. in this study, standardization of the parameters was achieved by selecting approximate median values of adjacent plots on the time - intensity curve, which was affected by pulsating arterial flow (fig. arterial and venous enhancement times were defined as the times showing half - maximum intensities. arteriovenous circulation time was subsequently defined as the gap between arterial and venous enhancement times, and might represent pure arterial enhancement without venous contamination. it was also noted that the circulation time of the main bolus showed a slight delay (a factor of 1.10 on average) compared to the test - bolus. in the main bolus, due to increased venous peak signal intensity, the time of half - maximum intensity (venous enhancement time) was delayed, leading to increased arteriovenous circulation time (fig. arterial enhancement time of the main bolus was also slightly delayed (a factor of 1.05, on average) compared with that of the test bolus. although the causes of slight delays in arteriovenous circulation time and arterial enhancement time are not clearly understood these parameters showed close statistical correlation between test and main boluses. to elucidate the causes and the implications of these delays, a more comprehensive study is required. with regard to enhancement duration, which might play a role in determining scan delay time, the test - bolus time - intensity curve showed a definite rising point and a point at which it reached a post - enhancement plateau, so there was no difficulty in measuring bolus length. for the test bolus, the duration of enhancement was definitely greater than the infusion time of the contrast medium. on the main bolus time - intensity curve, the point at which the post - enhancement plateau was reached could not be clearly defined ; this was because the elevated curve did not show a sharp deviation towards the plateau. it was clear, however, that for the main bolus, arterial enhancement time was much longer than infusion time. to investigate the correlation between enhancement duration and infusion time we calculated the enhancement expansion ratio defining this as enhancement duration divided by infusion time. there was, however, no significant correlation between this ratio and infusion time of the test bolus. since, in the case of the main bolus, accurate measurement was not available, a comparison of the enhancement expansion ratio between the test and main bolus was not possible. these findings suggest that the enhancement expansion ratio can not be used as a parameter for predicting the characteristics of the main bolus. other considerations in this study were the effect of saline flush and the amount and injection rate of the test bolus. during the injection of contrast media, saline flushing was routinely added in ce - mra, though the effect of this was not clearly confirmed. our experience suggests that if a contrast bolus is followed by a saline bolus, the former will be pushed, and a higher flow rate than that of normal venous blood thus achieved. the contrast bolus is thus able to reach the right atrium with less dilution by unenhanced blood from conjoining venous branches. in the test - bolus study, 2 ml of contrast media was injected at a rate of 3 ml / sec. although some reports have suggested that 1 ml of contrast bolus should be sufficient for a time - intensity curve (6, 8, 14), a 2 ml test bolus was used in order to achieve improved definition of the venous time - intensity curve. as for the injection rate, no published report, as far as we know, has suggested an optimal injection rate for the three - dimensional turbo - flash sequence. it has, however, been reported that an adequate injection rate for evaluating the abdominal aorta in a three - dimensional fisp sequence is 2 ml / sec (15). in this study, because venous enhancement was known to be related to injection rate (6, 9, 14), the injection rate of contrast media for the augmentation of venous enhancement was set to a relatively high value, namely 3 ml / sec. finally, the effect of respiratory motion and pulsating blood flow on the time - intensity curves requires comment. at the level of image acquisition, the aorta and inferior vena cava were located at the center of a radially redundant respiratory motion. the rois were not shifted over the boundaries of target vessels in all serially acquired images, and free breathing was therefore allowed during acquisition. periodic signal changes occurred in the aorta due to pulsating blood flow, however, and the resultant fluctuations were noted in the time - intensity curves. according to recent reports (6, 14), the addition of presaturation slabs at the superior and inferior aspects of the acquisition area is an effective way of reducing such flow - related signal changes in arteries and veins. as a result of this study firstly, the contrast bolus in the systemic artery was extensively and variably elongated, compared with infusion time. this latter, which is commonly used for scan - timing calculations, thus appears to be an inappropriate variable to substitute for the length of the main bolus. secondly, among the parameters examined, the arterial and venous enhancement times and the arteriovenous circulation time of the test bolus were consistent with the characteristics of the main bolus. other parameters such as peak enhancement time, enhancement duration and enhancement expansion ratio showed no statistical consistency between test and main boluses. in conclusion, the application of reliable parameters to the determination of scan delay time by means of mr angiography is likely to provide higher quality images. | objectiveto determine whether the time - intensity curves acquired by test and main dose contrast injections for mr angiography are similar.materials and methodsin 11 patients, repeated contrast - enhanced 2d - turbo - flash scans with 1-sec interval were obtained. both test and main dose time - intensity curves were acquired from the abdominal aorta, and the parameters of time - intensity curves for the test and main boluses were compared. the parameters used were arterial and venous enhancement times, arterial peak enhancement time, arteriovenous circulation time, enhancement duration and enhancement expansion ratio.resultsbetween the main and test boluses, arterial and venous enhancement times and arteriovenous circulation time showed statistically significant correlation (p < 0.01), with correlation coefficients of 0.95, 0.92 and 0.98 respectively. although the enhancement duration was definitely greater than infusion time, reasonable measurement of the end enhancement point in the main bolus was impossible.conclusiononly arterial and venous enhancement times and arteriovenous circulation time of the main bolus could be predicted from the test - bolus results. the use of these reliable parameters would lead to improvements in the scan timing method for mr angiography. |
the cellular plasma membrane restricts the internalization of macromolecules from the outside environment. as such, several methods have been developed to facilitate the delivery of macromolecules into cells such as the use of liposomes, electroporation, and viral transfection. cell - penetrating peptides (cpps), which are generally composed of 4~30 basic amino acid rich sequences, are promising tools for delivering macromolecules into the cells (123). in 1965, it was demonstrated that basic amino acid - rich histones and basic poly - amino acids can stimulate the internalization of albumin into tumor cells (4). later studies showed that conjugation of poly - l - lysine to albumin enhanced cellular uptake (5). in 1988, cell membrane penetration of trans - acting activator of transcription (tat) protein from human immunodeficiency virus-1 (hiv-1) was observed (6). it was shown that the arginine and lysine rich domain of tat was critical for membrane penetration (7), and covalent binding of this domain with other proteins induced cellular uptake of proteins (8). these studies led to the identification of a number of cpps including vp22, a cpp derived from viral protein (910) ; penetratin derived from the antennapedia, a drosophila homeoprotein (1112) ; and transportan, derived from a neuropeptide (13). in addition to these natural sequences, synthetic cpps such as poly - arginine (14), model amphipathic peptide (map) (15), and tp2 (16) were also generated. these cpps are internalized across the plasma membrane alone or together with macromolecules such as proteins and nucleic acids. however, it is known that small cpps can be internalized by both endocytosis and direct translocation across the membrane whereas large cpp - cargo molecules are internalized only via the endocytic pathway (21718). after internalization, the cpp - cargo molecules enclosed in endosomes fuse with the lysosome. however, due to as yet unknown natural properties of some cpps or modifications such as conjugation with chemicals escaping from the endosome or amino acid sequences, cpps can escape from the endosome and diffuse into the cytoplasm before lysosome fusion (119). because of the basic amino acid - rich characteristic of cpps, similar to the nuclear localization sequence (nls), some cpps can translocate into the nucleus and as such, transcription factors and plasmid dnas are often used as cargo for cpps (2021). chemical conjugation or cpp sequence addition at the n- or c - terminal of the protein induces cell internalization. addition of an 11 amino acid tat sequence to the n - terminal of 116-kda -galactosidase (-gal) led to in vitro and in vivo cellular internalization of the recombinant tat--gal (8). owing to their positively charged amino acid - rich characteristics, cpps can bind to negatively - charged nucleic acids (23). several studies have explored delivery of plasmid dna (pdna) using cpps and a simple mixture of pdna with tat facilitated the transfection of pdna into cells (2425). however, the transfection efficiency of cpp / nucleic acid complexes is low, and various methods have been developed to overcome this limitation, such as the addition of chloroquine, which induces endosomal escape, (28) and using cpp - conjugated rna binding domain (rbd) for rna delivery (2930). also small molecules such as taxol and methotrexate conjugated with cpps showed improved drug efficiency. because of decreased transport and increased efflux. it was reported that various tumor cells showed resistant to chemotherapy while cpp - conjugated small molecules increased drug delivery into cells and showed better therapeutic efficiency to tumor cells (3132). from the cargo delivery properties, tat - linked c - jun n - terminal kinase (jnk)-inhibiting peptide, called xg-102, is undergoing clinical phase iii that targeted different diseases such as inflammation and hearing loss. kai-9803 and kai-1678 are tat - cpp conjugated protein kinase c inhibitor peptide for myocardial infarction and pain. tat - cpp using botulinum toxin type a, named rt001, is currently in clinical phase iii for treatment of wrinkles (17). besides these molecules, various molecules using cpps have been underwent or are currently in clinical phase but there are no fda approved molecules yet. one of the most promising therapeutic approaches using cpp is its application in dendritic cell (dc) vaccine based treatment of cancer and infectious diseases. the predominant method of dc immunization involves the use of antibodies or molecules that target surface receptors such as c - type lectin receptors, fc receptors, and integrin. the endosome with the antigens is fused with the lysosome and antigens are degraded by protease, and then loaded onto mhc class ii. moreover, some dcs can cross - present antigens on mhc class i to cd8 t cells ; however, the mechanism is not clearly understood. endocytosed antigens can also escape into the cytoplasm, undergo proteasome degradation, and ultimately transported to the endoplasmic reticulum (er) (3334). accordingly, cpp - antigens can be internalized into dcs and loaded onto mhc molecules. because cpp - antigens can be internalized into dcs without receptor targeting molecules, this method is independent of receptor expression. also, the natural propensity for endosome escape demonstrated by some cpps enable antigen presentation by mhc class i molecules, leading to more efficient ctl responses than the naked antigen pulsing method. in this review, we highlight various cpp applications for immune modulation including dc - based vaccination, and discuss the advantages of using cpps in dendritic cell biology. one of the initial strategies was delivery of dominant - negative signaling molecules that can competitively inhibit the function of endogenous proteins in immune cells. ras is an important signaling protein for th2 differentiation after tcr stimulation (35). intranasal delivery of dominant - negative ras (dnras) using tat - cpp blocked ova induced eosinophilia and lymphocyte accumulation in the bronchoalveolar lavage (bal) fluid. lung histology demonstrated a decrease in cellular infiltration and mucus - containing epithelial cells in tat - dnras pretreated mice (36). phosphoinositide 3-kinase (pi3k) signaling is an important pathway down - stream of the costimulatory molecules in t cells and b cells, which contributes to asthma by phosphorylation of ptdlnsp2, immune cell recruitment, activation, and apoptosis. p85 is a pi3k adaptor protein and p85 knockout mice die within a few weeks of birth due to immunodeficiency (37). after intraperitoneal injection of dominant - negative p85, which lacks the binding site for the catalytic subunit conjugated to tat - cpp, lymphocyte and eosinophil numbers were reduced. in addition, the level of il-4 and il-5 decreased in the bal fluid in ova immunized mice (38). zap-70 is a proximal tcr signaling molecule that induces phosphorylation of downstream molecules such as lat and slp-76 (39). mutation of tyrosine 318 (y318f mutant), which is the amino acid for phosphorylation, impairs t cell activation signaling. treatment of dominant negative zap-70-y318f conjugated with human derived cpp, named hph-1, reduced phosphorylation of tcr signaling and inhibited secretion of il-2 after tcr stimulation (40). stat-6, a cytokine receptor that regulates il-4/il-13 gene expression, is also critical to allergic airway diseases and t cells from stat-6 knockout mice can not be differentiated into th2 cells (41). intranasal administration of a tat - cpp conjugated dominant - negative stat-6 peptide induced the asthma model in mice through ova stimulation. moreover, there was a significant decrease in the number of immune cells from bal fluid and mucus production in the lung (42). retinoic acid - related orphan receptor gamma t (rort) is a lineage specific transcription factor for th17 differentiation (43). dominant negative truncated form of rort without its dna binding conjugated with hph-1-cpp showed reduced il-17 production and th17 differentiation results amelioration of experimental autoimmune encephalomyelitis (eae) (44). in addition to delivering dominant negative molecules into cells, intracellular delivery of negative regulators of key signaling pathways of the immune system was another strategy utilized for cpp mediated immune modulation. cytotoxic t - lymphocyte - associated protein 4 (ctla-4) is expressed in activated t cells and regulatory t cells, and functions to down - regulate the immune system (45). treatment with the cytoplasmic domain of ctla-4 (ctctla-4) recombinant protein conjugated to hph-1-cpp inhibited il-2 secretion from activated t cells. intranasal administration of hph-1-ctctla-4 reduced th2 cytokines as well as the number of immune cells from bal fluid. inhibition of inflammatory cell infiltration and mucus containing epithelial cells was also observed in an ova induced mouse asthma model (46). intravenous injection of hph-1-ctctla-4 also inhibited inflammation and bone destruction in a collagen induced autoimmune arthritis model through inhibition of t cell responses (47). another application involved intravenous injection of ctctla-4 conjugated with dnp2-cpp, which can penetrate the blood - brain barrier and deliver the protein into the brain and spinal cord in an experimental autoimmune encephalomyelitis (eae) model. this resulted in reduced ifn- or il-17a producing cd4 t cells in the spinal cord, and ameliorated eae (48). in other study, suppressor of cytokine signaling 3 (socs3) a repressor of il-6 induced phosphorylation of stat3 was linked with mtm - cpp and it showed inhibition of inhibited inflammatory liver injury induced by enterotoxin b (seb), lipopolysaccharide (lps), and lectin concanavalin a (cona) (49). foxp3, a master transcription factor for regulatory (treg) t cells, was generated as a recombinant protein conjugated to tandem repeated form of hph-1-cpp, named hhph-1. it could be translocated into the nucleus and convert cd4 cd25 t cells to treg like cd25ctla-4 cells. in addition, systemic delivery of hhph-1-foxp3 suppressed allergic airway inflammation and autoimmune responses in a colitis model and in scurfy mice (50). nf-b is an important transcription factor that regulates multiple genes related to immune responses (51). in pharmaceutical studies, nf-b essential modulator (nemo) is a subunit of the ib kinase complex (ikk) that activates nf-b through phosphorylation (52). the nemo binding domain (nbd) is an 11-amino acid peptide that can block the interaction of nemo with ikk and inhibit nf-b activation. nbd conjugated to tat - cpp inhibited lps - induced ikk activity, accelerated constitutive apoptosis of human polymorphonuclear neutrophils (pmns), and inhibited lps - delayed apoptosis (53). nuclear factor of activated t cells (nfat) is a key transcription factor for t cell activation and il-2 production (54). the vivit peptide was identified as an inhibitor for nfat signaling through the interfering interaction of calcineurin with nfat (55). intranasal delivery of a sim-2-vivit peptide inhibited airway inflammation in an ova - induced experimental asthma model (56). mitogen - activated protein kinase activated protein kinase 2 (mk2) is a serine / threonine kinase that regulates cytokine expression at the transcriptional and post - translational levels by stabilizing the mrna of inflammatory cytokines (57). the mk2 inhibitory peptide, kkkalnrqlgvaa, conjugated to various cpps blocked the production of inflammatory cytokines such as il-6 and tnf in lps stimulated macrophages (58). when sirna targeting mitogen - activated protein kinase (mapk) was conjugated to tat - cpp or penetratin - cpp and delivered into the cells, mapk mrna levels were reduced by sirna - cpp in vitro ; however, intratracheal administration of sirna - cpp did not affect mapk mrna levels in vivo (59). decoy oligonucleotides that consist of a double - stranded short oligonucleotide corresponding to a gene promoter can block the binding of transcription factors to promoter regions. a nf-b decoy was hybridized to the peptide nucleic acid (pna) and pna was linked to transportan - cpp by disulfide bond. following intracellular delivery, this complex blocked nf-b binding activity and decreased il-1 induced il-6 mrna (60). however, the long - term systemic administration of mtx may induce serious adverse effects. in this reason, previously mtx conjugated with cell - penetrating peptide, hph-1, was used for transcutaneous topical administration for rheumatoid arthritis. this cell - penetrating mtx showed successful therapeutic effects in collagen induced arthritis model by inhibiting pro - inflammatory cytokine expressions and inflammation (61). cyclosporine a (cysa) was also conjugated with poly - arginine (r7) to enhance its delivery efficiency in vitro and in vivo, especially topical skin delivery. as we summarized, various therapeutic cargo molecules including proteins, peptides and nucleotides have been applied in immune disease models targeting key functional molecules in immune cell activation and differentiation. there have also been various clinical trials under investigation for the commercialization of cpp conjugated bio - drugs in immune diseases (17). biologic drug targeting of intracellular events using cpp could open a new area of investigation into drug development.. they can initiate antigen specific adaptive immune responses in their role as antigen presenting cells (63). because of this critical function, they are considered potent immunotherapeutic agents, especially for treating various cancers (64). in 1995, the first attempt at ex vivo dc - based cancer vaccination was reported for the treatment of melanoma (65), and since then, numerous clinical trials using dc vaccination have been completed or are currently underway. ex vivo dc manipulation is the most common methodology used in clinical trials. this requires the isolation of dcs or their precursors from patients or donors (66). autologous cells have the advantage of no risk of graft - versus - host disease but allogeneic cells could induce efficient immune boosting (6768) because the isolated cells may have immune suppressive characteristics (6970). after obtaining the cells, manipulation is performed, including appropriate antigen loading (71), maturation, and activation (7273). successfully manipulated dcs are then reinjected into patients by various routes including intradermal / subcutaneous (74), intranodal (75), intratumoral (7677), or intravenous (78) injection. for example, to treat melanoma, mature dcs (79), cd34 cells (80), or monocyte - derived dcs (81) pulsed with peptide antigen showed significant immune responses. in addition to using peptide antigen, killed allogeneic tumor cells were also used as antigens and they demonstrated successful immunogenicity, clinical responses and prolonged survival (82). dc vaccination approaches have been used to treat other types of cancer including prostate cancer (83), colon cancer (84), or glioma (85), and multiple myeloma (86), and have demonstrated successful immunogenicity and t cell responses. another methodology for dc vaccination is the in vivo dc targeting approach. because ex vivo dc manipulation and reinjection in patients is generally regarded as an expensive and laborious process (66), the injection of antigen coupled to dc cell surface targeting monoclonal antibodies (mab) has been applied. the use of dec205 (87), dc surface lectins dcir (88), dectin 1 (89), clec9a (90), and langerin (91) targeting antibodies coupled to antigens was evaluated. animal studies demonstrated that antigen delivery using these molecule specific antibodies induced antitumor immunity involving t cell responses and antigen specific antibody responses. this approach was also used for anti - viral vaccination using an anti - dec205 antibody coupled to the hiv gag protein (92). this approach was also successful, demonstrating induction of robust t cell immunity in nonhuman primates. however, this method can only be used with known antigen because the cells need to be prepared experimentally prior to injection. this is in contrast to ex vivo dc manipulation that utilizes tumor cell lysates or apoptotic cell bodies as antigen. also, to induce efficient dc activation and robust adaptive immunity, adjuvant is needed (93) furthermore, the impact of the interaction between cell surface molecules on dcs and targeting mabs is carefully characterized to induce only accurate and expected immune responses (94). although ex vivo dc manipulation has demonstrated clinical success, its efficiency has not been regarded as effective. it has been reported that enhancing antigen delivery efficiency and long lasting antigen presentation could improve this weakness by using cell - penetrating peptide conjugated antigens. for example, cpp1 (aavllpvllvllaap) conjugated peptide antigen pulsed dcs induced successful anti - tumor responses in vivo with much higher efficiency than only antigen pulsed dcs (95). this suggests that cpp mediated antigen delivery in the cytoplasm facilitates antigen presentation by newly synthesized mhc class i molecules, which lead to long - term immunological responses. accordingly, one of best - characterized cpps, tat, has been used as part of various dc vaccination strategies. tat fused leishmania homolog of receptors for activated c kinase (lack) was used to induce immune responses against leishmaniasis through dc vaccination (96). tat - lack pulsed dcs induced higher proliferation of cd8 t cells and ifn - gamma releasing th1 or tc1 cells than lack only pulsed dcs, suggesting that tat enhanced vaccination efficiency. in another study, the ova protein fused with tat (tat - ova) induced antigen specific cytotoxic lymphocytes (ctl) while ova lacking tat could not enter the mhc class i presentation pathway (97). in a breast tumor model, mature tat - her / neu pulsed dcs induced her2/neu specific cd8 t cell responses and cd4 t cell responses (98). another cpp, called penetratin (antp), a 16-mer peptide, has also been used for dc vaccination, and its efficacy has been confirmed through in vitro and in vivo experiments (99). dcs pulsed with penetratin linked to the cd4 or cd8 specific ova epitope for 24 h and co - cultured with ot - i or ot - ii cells successfully induced t cell proliferation. in addition, in vivo injection of the penetratin - antigen complex induced an immune response against ova expressing tumor cells, and its ability to reduce tumor size was enhanced through adjuvant co - injection. poly - arginine (r9) has also been efficiently applied in dc vaccination strategies, in terms of inducing antigen specific t cell proliferation and reducing tumor size (100). recently, a new cpp named, z12 was used for direct antigen delivery in vivo to dendritic cells, and showed robust cd4 and cd8 t cell mediated antitumor immune responses (101). collectively, these studies suggest that cpp can be used for dc vaccination against infectious diseases or various cancers. although cpps can only be coupled to known antigens for preparing fusion proteins or peptides, cpp - antigen delivery efficiency and location in the cytoplasm can significantly enhance the efficiency of cytotoxic t lymphocyte (ctl) activation, presumably via cross - presentation. this dc vaccination method has been shown to be more effective than naked antigen pulsing methods. cpp can interact with cell surface molecules such as glycosaminoglycans (gags), which are negatively charged - cell surface glycoproteins (102103). most well characterized cpps are positively charged amino acid based sequences. under physiological conditions, their electrostatic interaction with gags can easily be formed, and this cpp - cell surface molecule interaction induces internalization of cargo molecules into the cytoplasm. the internalization mechanisms are defined as macropinocytosis or clathrin-, caveolin - mediated endocytosis, which lead to the formation of endosomes (17). in dc vaccination using cpps, these mechanisms significantly enhance antigen delivery efficiency compared to free antigen delivery systems, and mimic the antigen presentation pathway of naturally phagocytosed antigens. because internalized cpp conjugated antigens in dcs are in the endosome, they can be encountered by two pathways : mhc class ii presentation or mhc class i presentation by cross - presentation (104). when dcs uptake an antigen, the phagocytosed endosome fuses with the lysosome and the antigen is then degraded into peptides. in this late endosome, antigens can be loaded onto mhc class ii and presented on the surface of dcs. cd4 t cells can recognize this mhc class ii - antigen complex for inducing adaptive immune responses. also, in terms of dc vaccination, mhc class i cross - presentation is an important process for recruiting cd8 t cell responses against specific antigens. antigens that escape from endosomes are degraded through proteasomal degradation and can be loaded on mhc class i in cytosolic vesicles through the transporter associated with antigen processing 2 (tap2) molecule. degraded antigen peptides can also be transported into the endoplasmic reticulum (er) through the tap 1 molecule, and loaded on mhc class i molecules in the er (105). the mhc class i - antigen complex is presented on the dc surface for cd8 t cell recognition. alternatively, antigens can be directly degraded in the endosome by phagosomal degradation and loaded on mhc class i molecules (106). several previous studies demonstrated that endocytosed cpp - cargo proteins exhibit functions as enzymes, transcription factors, or inhibitors suggesting that cpp - proteins can escape the endosome. for this reason, the cpp - antigen can also be processed for antigen presentation via the same pathways used for naturally occurring antigens (107). the cytosolic delivered antigen can be presented on mhc class i, and they play a critical role in the efficacy of dc vaccinations. some amount of endocytosed cpp - antigen also can be trapped in the endosome and undergone phagosomal degradation and mhc class ii or mhc class i presentation. because cpps use the endocytic pathways of dendritic cells, cpp - antigens could efficiently share antigen presentation mechanisms (fig. previous studies demonstrate that cpp - mediated dc vaccination approaches are promising, especially ex vivo dc manipulation, because of the highly enhanced antigen delivery efficiency. it has been shown that r9 linked antigens can induce immune responses with higher efficiency than tat, suggesting that higher cargo delivery ability leads to higher immune responses (100). in a recent paper, the in vivo immune response boosting ability by cpp - using dc vaccination was much higher than antigen only (101). it is presumably due to cpp linked cargo molecules is preferentially delivered into phagocytic cells compared to other immune cell types (48). the advantage of cell - penetrating peptides over dc surface molecule specific antibody methods has been reported. a previous study demonstrated that delivery and cross presentation efficiency was not significantly different between a dc - sign targeting antibody and the cpp coupling method (108). using in vivo delivery of cpp - antigen molecules to bypass the expensive and laborious ex vivo dc manipulation method does not overcome the issues of antigen specificity because despite the many advantages of cpps, they are still regarded as a nonspecific delivery tool (109). immunogenicity of cpp itself is still concerned as a critical limitation especially if it is originated from non - self while hph-1-ctctla-4 which is human chimeric protein did not induce specific antibody (46). in addition, appropriate cpp - antigen coupling via covalent or non - covalent conjugation and its purification processes is another technical hurdle for versatile application. nevertheless, the advantages of using cpp for dc vaccination are important for effective therapy and include efficient cytosolic delivery through endosome escape, induction of both cd4 and cd8 t cell responses, dc surface molecule independency, and high efficiency.. they can initiate antigen specific adaptive immune responses in their role as antigen presenting cells (63). because of this critical function, they are considered potent immunotherapeutic agents, especially for treating various cancers (64). in 1995, the first attempt at ex vivo dc - based cancer vaccination was reported for the treatment of melanoma (65), and since then, numerous clinical trials using dc vaccination have been completed or are currently underway. ex vivo dc manipulation is the most common methodology used in clinical trials. this requires the isolation of dcs or their precursors from patients or donors (66). autologous cells have the advantage of no risk of graft - versus - host disease but allogeneic cells could induce efficient immune boosting (6768) because the isolated cells may have immune suppressive characteristics (6970). after obtaining the cells, manipulation is performed, including appropriate antigen loading (71), maturation, and activation (7273). successfully manipulated dcs are then reinjected into patients by various routes including intradermal / subcutaneous (74), intranodal (75), intratumoral (7677), or intravenous (78) injection. for example, to treat melanoma, mature dcs (79), cd34 cells (80), or monocyte - derived dcs (81) pulsed with peptide antigen showed significant immune responses. in addition to using peptide antigen, killed allogeneic tumor cells were also used as antigens and they demonstrated successful immunogenicity, clinical responses and prolonged survival (82). dc vaccination approaches have been used to treat other types of cancer including prostate cancer (83), colon cancer (84), or glioma (85), and multiple myeloma (86), and have demonstrated successful immunogenicity and t cell responses. another methodology for dc vaccination is the in vivo dc targeting approach. because ex vivo dc manipulation and reinjection in patients is generally regarded as an expensive and laborious process (66), the injection of antigen coupled to dc cell surface targeting monoclonal antibodies (mab) has been applied. the use of dec205 (87), dc surface lectins dcir (88), dectin 1 (89), clec9a (90), and langerin (91) targeting antibodies coupled to antigens was evaluated. animal studies demonstrated that antigen delivery using these molecule specific antibodies induced antitumor immunity involving t cell responses and antigen specific antibody responses. this approach was also used for anti - viral vaccination using an anti - dec205 antibody coupled to the hiv gag protein (92). this approach was also successful, demonstrating induction of robust t cell immunity in nonhuman primates. however, this method can only be used with known antigen because the cells need to be prepared experimentally prior to injection. this is in contrast to ex vivo dc manipulation that utilizes tumor cell lysates or apoptotic cell bodies as antigen. also, to induce efficient dc activation and robust adaptive immunity, adjuvant is needed (93) furthermore, the impact of the interaction between cell surface molecules on dcs and targeting mabs is carefully characterized to induce only accurate and expected immune responses (94). although ex vivo dc manipulation has demonstrated clinical success, its efficiency has not been regarded as effective. it has been reported that enhancing antigen delivery efficiency and long lasting antigen presentation could improve this weakness by using cell - penetrating peptide conjugated antigens. for example, cpp1 (aavllpvllvllaap) conjugated peptide antigen pulsed dcs induced successful anti - tumor responses in vivo with much higher efficiency than only antigen pulsed dcs (95). this suggests that cpp mediated antigen delivery in the cytoplasm facilitates antigen presentation by newly synthesized mhc class i molecules, which lead to long - term immunological responses. accordingly, one of best - characterized cpps, tat, has been used as part of various dc vaccination strategies. tat fused leishmania homolog of receptors for activated c kinase (lack) was used to induce immune responses against leishmaniasis through dc vaccination (96). tat - lack pulsed dcs induced higher proliferation of cd8 t cells and ifn - gamma releasing th1 or tc1 cells than lack only pulsed dcs, suggesting that tat enhanced vaccination efficiency. in another study, the ova protein fused with tat (tat - ova) induced antigen specific cytotoxic lymphocytes (ctl) while ova lacking tat could not enter the mhc class i presentation pathway (97). in a breast tumor model, mature tat - her / neu pulsed dcs induced her2/neu specific cd8 t cell responses and cd4 t cell responses (98). another cpp, called penetratin (antp), a 16-mer peptide, has also been used for dc vaccination, and its efficacy has been confirmed through in vitro and in vivo experiments (99). dcs pulsed with penetratin linked to the cd4 or cd8 specific ova epitope for 24 h and co - cultured with ot - i or ot - ii cells successfully induced t cell proliferation. in addition, in vivo injection of the penetratin - antigen complex induced an immune response against ova expressing tumor cells, and its ability to reduce tumor size was enhanced through adjuvant co - injection. poly - arginine (r9) has also been efficiently applied in dc vaccination strategies, in terms of inducing antigen specific t cell proliferation and reducing tumor size (100). recently, a new cpp named, z12 was used for direct antigen delivery in vivo to dendritic cells, and showed robust cd4 and cd8 t cell mediated antitumor immune responses (101). collectively, these studies suggest that cpp can be used for dc vaccination against infectious diseases or various cancers. although cpps can only be coupled to known antigens for preparing fusion proteins or peptides, cpp - antigen delivery efficiency and location in the cytoplasm can significantly enhance the efficiency of cytotoxic t lymphocyte (ctl) activation, presumably via cross - presentation. this dc vaccination method has been shown to be more effective than naked antigen pulsing methods. cpp can interact with cell surface molecules such as glycosaminoglycans (gags), which are negatively charged - cell surface glycoproteins (102103). most well characterized cpps are positively charged amino acid based sequences. under physiological conditions, their electrostatic interaction with gags can easily be formed, and this cpp - cell surface molecule interaction induces internalization of cargo molecules into the cytoplasm. the internalization mechanisms are defined as macropinocytosis or clathrin-, caveolin - mediated endocytosis, which lead to the formation of endosomes (17). in dc vaccination using cpps, these mechanisms significantly enhance antigen delivery efficiency compared to free antigen delivery systems, and mimic the antigen presentation pathway of naturally phagocytosed antigens. because internalized cpp conjugated antigens in dcs are in the endosome, they can be encountered by two pathways : mhc class ii presentation or mhc class i presentation by cross - presentation (104). when dcs uptake an antigen, the phagocytosed endosome fuses with the lysosome and the antigen is then degraded into peptides. in this late endosome, antigens can be loaded onto mhc class ii and presented on the surface of dcs. cd4 t cells can recognize this mhc class ii - antigen complex for inducing adaptive immune responses. also, in terms of dc vaccination, mhc class i cross - presentation is an important process for recruiting cd8 t cell responses against specific antigens. antigens that escape from endosomes are degraded through proteasomal degradation and can be loaded on mhc class i in cytosolic vesicles through the transporter associated with antigen processing 2 (tap2) molecule. degraded antigen peptides can also be transported into the endoplasmic reticulum (er) through the tap 1 molecule, and loaded on mhc class i molecules in the er (105). the mhc class i - antigen complex is presented on the dc surface for cd8 t cell recognition. alternatively, antigens can be directly degraded in the endosome by phagosomal degradation and loaded on mhc class i molecules (106). several previous studies demonstrated that endocytosed cpp - cargo proteins exhibit functions as enzymes, transcription factors, or inhibitors suggesting that cpp - proteins can escape the endosome. for this reason, the cpp - antigen can also be processed for antigen presentation via the same pathways used for naturally occurring antigens (107). the cytosolic delivered antigen can be presented on mhc class i, and they play a critical role in the efficacy of dc vaccinations. some amount of endocytosed cpp - antigen also can be trapped in the endosome and undergone phagosomal degradation and mhc class ii or mhc class i presentation. because cpps use the endocytic pathways of dendritic cells, cpp - antigens could efficiently share antigen presentation mechanisms (fig. previous studies demonstrate that cpp - mediated dc vaccination approaches are promising, especially ex vivo dc manipulation, because of the highly enhanced antigen delivery efficiency. it has been shown that r9 linked antigens can induce immune responses with higher efficiency than tat, suggesting that higher cargo delivery ability leads to higher immune responses (100). in a recent paper, the in vivo immune response boosting ability by cpp - using dc vaccination was much higher than antigen only (101). it is presumably due to cpp linked cargo molecules is preferentially delivered into phagocytic cells compared to other immune cell types (48). the advantage of cell - penetrating peptides over dc surface molecule specific antibody methods has been reported. a previous study demonstrated that delivery and cross presentation efficiency was not significantly different between a dc - sign targeting antibody and the cpp coupling method (108). using in vivo delivery of cpp - antigen molecules to bypass the expensive and laborious ex vivo dc manipulation method does not overcome the issues of antigen specificity because despite the many advantages of cpps, they are still regarded as a nonspecific delivery tool (109). immunogenicity of cpp itself is still concerned as a critical limitation especially if it is originated from non - self while hph-1-ctctla-4 which is human chimeric protein did not induce specific antibody (46). in addition, appropriate cpp - antigen coupling via covalent or non - covalent conjugation and its purification processes is another technical hurdle for versatile application. nevertheless, the advantages of using cpp for dc vaccination are important for effective therapy and include efficient cytosolic delivery through endosome escape, induction of both cd4 and cd8 t cell responses, dc surface molecule independency, and high efficiency. cpps are considered an attractive therapeutic application tool and numerous approaches utilizing cpps were reported to successfully treat various diseases in animal models. cpp coupling to antigens in dc vaccination strategies have also recently been highlighted in cancer therapy. cpp - tumor antigens for ex vivo dc manipulation efficiently enable induction of antigen specific effector t cell responses, including ctl responses. the direct application of cpp - antigen for in vivo targeting has also been successful in generating antigen specific immune responses. however, the current limitation of cpp coupling to a limited number of antigens and still less in vivo efficiency requires further investigation. a way of overcoming this limitation would be to use highly efficient cpp for in vivo delivery or various other coupling methods involving simultaneous use of several antigens in order to broaden its application. based on the understanding of current dc vaccination strategies, we expect to develop successful therapeutic and/or preventive dc vaccinations for treatment of cancer or infectious diseases. | cell - penetrating peptides (cpps) are short amino acids that have been widely used to deliver macromolecules such as proteins, peptides, dna, or rna, to control cellular behavior for therapeutic purposes. cpps have been used to treat immunological diseases through the delivery of immune modulatory molecules in vivo. their intracellular delivery efficiency is highly synergistic with the cellular characteristics of the dendritic cells (dcs), which actively uptake foreign antigens. dc - based vaccines are primarily generated by pulsing dcs ex vivo with various immunomodulatory antigens. cpp conjugation to antigens would increase dc uptake as well as antigen processing and presentation on both mhc class ii and mhc class i molecules, leading to antigen specific cd4 + and cd8 + t cell responses. cpp - antigen based dc vaccination is considered a promising tool for cancer immunotherapy due to the enhanced ctl response. in this review, we discuss the various applications of cpps in immune modulation and dc vaccination, and highlight the advantages and limitations of the current cpp - based dc vaccination. |
a brain - computer interface (bci) mesures neuronal signals by using an electrocorticogram (ecog), electroencephalogram (eeg), event - related brain potentials (erps), magnetoencephalography (meg), or real - time magnetic resonance imaging (rt - mri) without peripheral physiologic activities1. biofeedback consists of sensory stimulation such as visual, auditory, tactile, and proprioceptive, stimulation sent to direct the movement of muscles by the brain, and functional electrical stimulation (fes) uses electrical stimulation to overcome paralysis by directly activating nerves to stimulate motor function. most bcis are designed based on motor imagery (mi) and movement execution (me)3. bci technology is used in the fields of medical treatment and education as a form of neuro - feedback. early technology was developed to allow individuals with severe motor disabilities such as amyotrophic lateral sclerosis to communicate and interact with their external environment4. later on, bci technology was applied to rehabilitation exercises for motor neuron rehabilitation in quadriplegic patients with spinal injury1. however, research on the application of bci for stroke patients is limited3. fes is used to facilitate normal movement in patients with paralysis due to upper motor neuron diseases such as stroke, multiple sclerosis, and spinal cord injury5. peripheral mechanisms entail fes applied to stimulate the patient s remaining motor units to enhance muscular strength, increase range of motion, and reduce stiffness6. central mechanisms occur by a reorganization of the cortex based on neurophysiological responses to help control movement through neural plasticity in stroke patients7. recently, bci technology has been applied to rehabilitation training using fes, robots, and assistance tools as feedback training3. the purpose of this study was to assess the effect of bci - based fes (bci - fes) in stroke on brain activation. ten subjects from s hospital in seoul, south korea, diagnosed with chronic hemiparetic stroke, were enrolled in this study. the subjects were provided with a full explanation of the experimental procedure, and provided written consent signifying voluntary participation. the sahmyook university human studies committee approved this study (syuirb2012 - 010). patient demographic information is provided in table 1table 1.characteristics of the participants (n=10)bci - fes group(n=5)fes group(n=5)gender (%) male / female4 (80.0) / 1 (20.0)4 (80.0) / 1 (20.0)age (y)43.6 (10.9)50.2 (7.1)height (cm)173.1 (10.5)166.2 (9.6)weight (kg)70.3 (14.8)65.6 (5.6)months after stroke16.4 (19.2)8.4 (2.2)side of hemiplegia (%) right / left2 (40.0) / 3 (60.0)2 (40.0) / 3 (60.0)type of stroke (%) infarction / hemmorrahge2 (40.0) / 3 (60.0)1 (20.0) / 4 (80.0)n (%) or mean (sd). the inclusion criteria were as follows : (1) patients were studied more than six months after clinical diagnosis of ischemic or hemorrhagic hemiparetic stroke, (2) scored more than 24 points on the mini - mental state examination, and (3) were able to walk independently more than 10 m. the exclusion criteria were as follows : (1) severe hemineglect, (2) history or current diagnoses of other neurological diseases or musculoskeletal conditions8, and (3) prior adverse reaction to fes application. the participants in both the bci - fes group and fes group participated in the program according to the designated schedule and were randomly allocated to either group ; one research assistant participated in training, and two research assistants performed study measurements. research assistants were educated and trained on the usage of equipment, measurement method, and training programs prior to the study to minimize errors. bci - fes patients received ankle dorsiflexion training with fes for 30 minutes per day for a total of 5 times under the brain - computer interface based program. fes participants received ankle dorsiflexion training with fes for the same time. in the bci - fes - based training, fes was applied to train the participants when they were concentrating on the moving ankle motion on the monitor screen, and brainwave patterns were displayed as the ratio of sensorimotor and m - beta waves to theta waves. the bci equipment consisted of a monitor screen for the subjects, a brainwave measurement tool (polyg - i), a laptop to record and process brainwave activity, a usb output board to link the brain waves to fes signals when the activity was high, and fes and eeg sensors to receive brainwave information. as factors of the external environment such as temperature, place, intensity of illumination, noise, and smell can influence performance and brain activity, participants were provided with private space without external stimuli. to measure brainwave activity, electrodes were attached on the frontopolar 1 (fp1), and frontopolar 2 (fp2) regions, with the reference electrode attached behind the right earlobe, and ground electrode attached on the left earlobe. for fes training, an inactive electrode was attached to the proximal tibialis anterior (located 5 cm inferior to the head of fibula), which is an antagonist of plantar flexor muscles, and an active electrode was attached to the distal tibialis anterior (located on the lateral upper 5 cm of the fibula). the study participants sat comfortably on chairs with armrests and concentrated to move their ankles by looking at a monitor screen displaying a dorsiflexing ankle. for measuring brain waves, the concentration index was quantified as in the formula above. in a state of concentration, the theta rhythm decreases, while the smr (1215 hz) and mid - beta rhythms (1620 hz) increase. increased smr implies unfocused attention ability, whereas mid - beta rhythms connote focused attention and cautiousness. therefore, the concentration index was quantified by a ratio involving smr, mid - beta, and theta waves as expressed by the formula : (smr + mid - beta)/theta. before performing measurements, the experimenter passively modulated the stimulated current intensity of frequency 35 hz, and pulse with 250 s from 1 ma to 50 ma according to the response from the subject s ankle joint, and input them as they reacted. to gauge the focused threshold of the subjects, 10 times of focused inspections were implemented before the training to build an average threshold, and the concentration index threshold was input into the computer algorithm. after these steps, the subjects were instructed to focus on the movement of the ankle on the monitor screen. when the measured concentration index exceeded the threshold of the concentration index where the degree of the subject s concentration was recorded, this information was transferred to the usb output board to activate the fes equipment. however, when the measured concentration index did not exceed the threshold, this information was transferred to the usb output board to turn off the fes equipment. therefore, fes activation occurred based upon the degree of concentration of the subject. in addition, when the measured concentration index exceeded the threshold to turn on the fes, the electrical stimulation was set to last a maximum of 5 seconds in order to avoid muscle fatigue. microstim (medel gmbh, germany) equipment was used for both bci - fes based training and fes training. this equipment has an adjustable frequency, contraction time, relaxing time, and pulse width and consists of a foot switch, a pair of surface electrodes measuring 50 50 mm, and a stimulator. an inactive electrode was attached to the proximal tibialis anterior (located 5 cm inferior to the head of fibula), which is an antagonist of plantar flexor muscles, and an active electrode was attached on the distal tibialis anterior (located on the lateral upper 5 cm of the fibula). the waveform was rectangular biphasic and the therapeutic exercise was adjusted so as not to exceed 50 ma for the patients to endure as much dorsiflexion as possible. the ramp - up for the maximum intensity was set to take place in 2 seconds, and the duration of stimulation was set to last 7 seconds. in order to avoid muscle fatigue because of electrical stimulation, the off - time was set to last 7 seconds, pulse frequency was 35 hz, and pulse width was 250 s. a poly - i instrument (laxtha, inc., daejeon, south korea) was used to take eeg measurements. each eeg measurement was recorded for one and a half minutes while the subjects were instructed to maintain a comfortable posture with the eyes open and refraining from speaking or moving to minimize interference from artifacts. eeg electrodes were attached to four places on the scalp using the monopolar derivation method. the four sites included frontopolar 1 (fp1), frontopolar 2 (fp2), central lobe 3 (c3), and central lobe 4 (c4) in order in accordance with the international 1020 system. moreover, reference and ground reference electrodes were placed behind the right earlobe and left earlobe, respectively. the electrodes used were gold - plated disc - shaped eeg electrodes (elefixz-401ce, nihon kohden, tokyo, japan)9. for eeg data analysis, a quantitative analysis was conducted using telescan 2.98 (laxtha inc. 70 seconds of each measurement after excluding the first and last ten seconds was analyzed. brain waves were categorized following convention into theta (48 hz), alpha (813 hz), sensorimotor rhythm (1215 hz), mid beta (1520 hz), and high beta waves (2030 hz). the attention index is the ratio of theta waves to smr and mid beta waves, and the activation index is the median age frequency 50%. wilcoxon s test was used to compare the pretest and posttest results within each group, and the mann - whitney test was performed to compare the two groups before and after training. differences in brain activation after the interventions are shown in table 2table 2.comparison of brain waves within groups and between groups (n=10)parametersvalueschange valuesbci - fes group(n=5)fes group(n=5)bci - fes group(n=5)fes group(n=5)beforeafterbeforeafterbefore - afterbefore - afterattention indexfp10.3271 (0.16)0.6328 (0.42)0.4530 (0.56)0.5239 (0.75)0.3057 (0.34)0.0709 (0.21)fp20.2630 (0.11)0.6824 (0.49)0.2951 (0.21)0.3171 (0.28)0.4194 (0.44)0.0220 (0.11)activation indexfp11.3375 (1.07)2.8750 (2.33)1.4625 (1.60)0.9125 (0.44)1.5375 (2.23)0.5500 (1.22)fp22.1375 (1.69)2.7950 (2.58)2.3750 (1.96)1.6000 (0.77)0.6575 (2.13)0.7750 (1.88)values are means (sd). the bci - fes group showed significant differences in fp1 and fp2 of the attention index, and fp1 of the activation index following the intervention. there were significant differences in fp1 of the activation index between the two groups after the interventions. brain waves are defined as electrical signals generated during exchange of information among neurons. they contain important information in a specific pattern varying according to state of awareness and mental activity. high theta wave activity and low beta wave activity are common in patients with attention deficit disorder10. duffy.11 reported that alpha and beta were decreased in quantitative brain wave analysis of elderly individuals, and kaiser.12 reported a significant correlation between event - related desynchronization (erd) of the unaffected hemisphere with severity of damage in patients recovering from stroke, and between erd on the affected side and severity of spasticity. nevertheless, there is very little, research on brain wave analysis in stroke patients. our study was aimed at grasping the changes in the attention and brain activation indexes depending on the training method applied to stroke patients. attention or concentration is defined as the ability to focus and be clearly aware of a stimulus or to react solely to an internal or external stimulus. it is a significantly important psychological task in a variety of settings such as in learning or in sports conditions13. however, inability to concentrate following brain injury is one of the most common problems reported14. parker.15 reported that patients with apoplexy or traumatic brain damage were unable to concentrate on a single problem or situation. duchet.16 reported that the deficit of concentration common in stroke or traumatic brain injury can decrease global functioning in learning and daily activities. given that each domain in the brain plays a specific role in cognition and specific functions may be impaired if one is affected, the fp1 domain has been implicated in concentration disorders, whereas judgment and impulse control are relevant to decreased function of the fp2 domain17. in our study, the bci - fes group showed significant differences in the fp1 and fp2 attention indices, and the fp1 activation index. on the other hand, the concentration of the fp1 and fp2 domains increased because the chance to exceed the brain wave concentration index threshold increased following training of the patients. in order to measure the degree of concentration during bci - fes training, electrodes were attached to fp1 and fp2 to measure the concentration index of the brain wave (smr+mid beta / theta). even though the threshold of the bci program was set up based on the concentration index, individuals varied in concentration ability, and the small sample size means that baseline concentration ability differences could significantly alter the results. second, when the concentration index figure of the bci program exceeded the threshold to activate the fes, the time of functional electrical stimulation was set up to last 5 seconds so that muscle fatigue would not occur and to provide a resting phase. however, fes often continuously activated within 5 seconds because of some patients excellent ability to concentrate, thereby limiting the amount of resting phase. as part of this study, electrodes were attached to fp 1 and fp 2 in an isolated environment without external influences to measure the concentration index. however, some electrodes attached to patients who showed a high degree of participation detached from their foreheads due to perspiration. in order to prevent this problem, electrode pads, rather than electrode glue, were used to fix the electrodes, and straps were used to prevent pads from falling off, which may serve as additional sensory stimuli and could potentially bias results. fourth, attachment of electrodes was studied in a unipolar induction method when measuring brain waves in this study. with the unipolar induction method, electric potential activity however, assessing small local differences is difficult, and noise artifacts can limit detection of subtle differences. in the future, the use of bci - fes - based training can be revised to rehabilitate not only ankle movements, but also upper extremity motor function. additional research and clinical use of bci systems is needed to develop programs suitable for rehabilitation of not only stroke patients but also patients with various disabilities because very little work has been done with these populations. | [purpose ] this study sought to determine the effects of brain - computer interface - based functional electrical stimulation (bci - fes) on brain activation in patients with stroke. [subjects ] the subjects were randomized to in a bci - fes group (n=5) and a functional electrical stimulation (fes) group (n=5). [methods ] patients in the bci - fes group received ankle dorsiflexion training with fes for 30 minutes per day, 5 times under the brain - computer interface - based program. the fes group received ankle dorsiflexion training with fes for the same amount of time. [results ] the bci - fes group demonstrated significant differences in the frontopolar regions 1 and 2 attention indexes, and frontopolar 1 activation index. the fes group demonstrated no significant differences. there were significant differences in the frontopolar 1 region activation index between the two groups after the interventions. [conclusion ] the results of this study suggest that bci - fes training may be more effective in stimulating brain activation than only fes training in patients recovering from stroke. |
in the previous issue of critical care, toufekoula and colleagues investigated the serum and tissue concentrations of malondialdehyde (mda) as readout for lipid peroxidation during sepsis. they submitted rats to sepsis by multidrug - resistant (mdr) isolates of pseudomonas aeruginosa, which showed significantly higher mda concentrations in liver, spleen and aorta compared to control animals. the rat data were compared to an historic cohort of patients (n = 93) with mdr gram - negative bacteria - induced ventilator - associated pneumonia, in which mda serum concentrations during the first 7 days were elevated and correlated with survival during sepsis - induced hepatic or cardiopulmonary failure. sepsis induced by mdr gram - negative bacteria is a growing concern in intensive care units. a vulnerable patient population, long - term use of invasive medical equipment and increasing use of broad - spectrum antibiotics considerably affect overall morbidity, mortality and health care costs. despite the amount of research in the field of sepsis, a link between specific toxic mediators and patient outcome, which would enable biomarkers of organ failure to be defined and therapy adjusted accordingly, has not been established. the study by toufekoula and colleagues features a dual approach to the organ distribution pattern of lipid peroxidation during sepsis. in vivo data from rats this combined approach greatly enhances the value of the study since transferring results from rodent models to the clinical situation in septic patients is challenging. thus, comparing experimental and clinical data as presented by toufekoula and colleagues is an excellent example of translational research. in the rat sepsis model, however, in ventilator - associated pneumonia different strains of p. aeruginosa may differ considerably with regard to onset and mortality. moreover, the pattern in which organs are affected differs according to the infectious agent. thus, the patterns of mda production as reported by toufekoula and colleagues might not be extrapolated to sepsis induced by other types of bacteria, which emphasizes the need to stratify both rodent and human sepsis for the underlying pathogen. additionally, toufekoula and colleagues induced sepsis in the rats by intraperitoneal injection, while sepsis in patients was caused by bacterial migration through the lung. this might explain why patients with pulmonary failure (that is, acute respiratory distress syndrome) showed high circulating mda levels whereas pulmonary mda concentrations in septic rats remained rather unchanged. this highlights the fact that the way organs are affected in humans might differ markedly from animal models and may be directly dependent on the route of infection. recently, circulating lipid peroxidation products (other than mda) during sepsis were shown to correlate with increased hospital mortality rates. however, the present study shows that the concentrations of circulating mda have to be interpreted with utmost caution in septic patients. survivors among septic patients with hepatic dysfunction or with acute respiratory distress syndrome and concomitant cardiovascular failure showed higher circulating mda concentrations than non - survivors. in contrast, survivors with acute renal dysfunction displayed lower circulating mda levels than non - survivors. questions concerning the underlying mechanism or the hypothesis that a toxic end product may predict survival under certain circumstances can not be answered from this descriptive study. microdialysis is an established method to monitor both metabolic and inflammatory markers in clinical settings. several methods for mda detection in microdialysis fluid have been described and it would be of great interest to evaluate mda production directly in different organs throughout the course of sepsis. nevertheless, as an additional parameter, circulating mda may potentially become a valuable tool in evaluating septic patients concordant with the recently proposed model of ' bioscore ' combining different biomarkers in one model. understanding the pathophysiology during mdr p. aeruginosa - induced ventilator - associated pneumonia and sepsis is desperately needed as infection rates are likely to increase in the future and novel therapeutic options will not be readily at hand. the study by toufekoula and colleagues provides valuable information about mdr p. aeruginosa - induced sepsis and, thus, a data foundation for mda quantification in vital organs. although the data are entirely descriptive, the study sheds light on mda as a promising biomarker, which may potentially facilitate the evaluation of intensive care patients during the course of severe sepsis. | multidrug - resistant gram - negative induced sepsis poses an increasing threat to the vulnerable intensive care patient. the study by toufekoula and colleagues reports the serum and tissue concentration of malondialdehyde (mda), the toxic end product of lipid peroxidation, during the course of experimental and human gram - negative sepsis. the complementary results from this dual experimental and clinical approach argue for highly compartmentalized lipid peroxidation during sepsis. establishing a correlation between mda concentration and survival provides valuable insights into the pathophysiology of gram - negative sepsis. yet, further studies are needed to understand and establish mda as a biomarker during sepsis aggravated by organ failure. |
postoperative acute kidney injury (aki) occurs frequently after coronary artery bypass surgery (cabg), worsening short - term and long - term clinical outcomes and survival, and increasing patient costs (123). because there is currently no effective therapy for aki, factors predictive of aki and predictive models that estimate patient risk for aki may be useful in optimizing perioperative care and preventing aki in these patients. however, although several predictive risk models for aki have been proposed, these models are currently limited by differing definitions, small cohorts, or a lack of validation (4). several recent studies suggested that elevated serum concentrations of uric acid may be associated with kidney disease without intrarenal uric acid crystal deposition (56). additionally, hyperuricemia associates directly with hypertension, metabolic syndrome, chronic kidney disease, and peripheral vascular disease (7). moreover, hyperuricemia is a common finding in patients with coronary vascular disease (78). thus, preoperative hyperuricemia may be linked to an increased risk of aki after cabg. recent few studies found a link between preoperative uric acid concentrations and postoperative aki (91011), although these studies included the relatively small numbers of patients or several types of operations. therefore, to confirm previous findings, we performed a retrospective cohort study investigating the association between preoperative elevated uric acid concentrations and the frequency of postoperative aki in a large and homogeneous cohort of adult cabg patients. furthermore, we also investigated whether preoperative uric acid is a useful predictor of postoperative aki in patients undergoing cabg by discrimination and reclassification measures. a review of the asan medical center coronary artery bypass surgery and anesthesia database identified patients who underwent cabg between january 1, 2006, and october 31, 2011. information in this database was prospectively collected, beginning in 2006, for continuous assessment and improvements in quality of care for all patients undergoing cabg at our institution (12). patients were excluded if their serum uric acid and creatinine concentrations were missing ; if they had undergone preoperative dialysis ; if they had undergone emergent surgery ; if they had undergone any other type of cardiac surgery in addition to cabg ; if they had a prior history of organ transplantation or nephrectomy ; or if they had been treated with allopurinol. patient data, including demographic, laboratory, and medication data, comorbidities, perioperative management, and mortality, were acquired using the asan medical center coronary artery bypass surgery and anesthesia database and the computerized patient record system (asan medical center information system electronic medical record). this observational study was performed in accordance with strengthening the reporting of observational studies in epidemiology guidelines. the primary end point was the occurrence of aki (increase in serum creatinine of 0.3 mg / dl or 150% from baseline or initiation of renal replacement therapy [rrt ]) after cabg. aki was staged using the aki network classification of changes in serum creatinine concentration within the first 48 hr after operation (13). data on urine output were not used for diagnosis of aki due to insufficient recording in all patients and the effects of administered diuretics. serum creatinine levels were measured preoperatively, on arrival at the icu, 6 hr after surgery, and 1 and 2 days after surgery. the concentration that was measured closest to the time of surgery was considered to be the baseline creatinine level. the highest concentration that was measured in the first 48 hr after surgery was used for the primary endpoint evaluation. the preoperative estimated glomerular filtration rate (egfr) was determined using the chronic kidney disease epidemiology collaboration (ckd - epi) equation (egfr=141min (scr/, 1)max (scr/, 1)0.9931.018 [if female]1.159 [if black ], where scr is serum creatinine, is 0.7 for females and 0.9 for males, is -0.329 for females and -0.411 for males, min indicates the minimum of scr / k or 1 and max indicates the maximum of scr / k or 1) (14). serum uric acid was measured by an enzymatic method using an automatic biochemistry analyzer (cobas 8000 modular analyzer series ; roche diagnostics gmbh, vienna, austria) and the reference range for this uric acid assay at our institution is 3.0 - 7.0 mg / dl. as previously described (1215), cabg and perioperative management were performed using standard techniques. continuous variables were reported as meanstandard deviation or median with interquartile range, and categorical variables as numbers and percentages. univariate comparisons between groups were performed using the chi - square test for categorical variables and student 's t - test or the mann - whitney rank - sum test for continuous variables, as appropriate. to test the hypothesis that preoperative uric acid is associated with postoperative aki, logistic regression analyses were performed. initially, all preoperative and intraoperative variables in table 1 were evaluated independently for their possible effect on the occurrence of postoperative aki. all variables with a p value 12,000, prior cabg, congestive heart failure, peripheral vascular disease, hypertension, and preoperative intraaortic balloon pump. all reported p values are two - sided, and p values 12,000, prior cabg, congestive heart failure, peripheral vascular disease, hypertension, and preoperative intraaortic balloon pump. all reported p values are two - sided, and p values 6.0 mg / dl was associated with a nearly 4-fold increased risk of aki and a longer hospital stay than preoperative uric acid 6.0 mg / dl (9). another study, in 190 patients undergoing cardiovascular surgery, found that, after adjustment for confounders by multivariate logistic regression analysis, serum uric acid concentrations 7.0 mg / dl were associated with a 35-fold higher risk of aki, and increased hospital stay and duration of mechanical ventilation support, than serum uric acid concentrations < 7.0 mg / dl (10). our previous study in patients undergoing cardiovascular surgery also found that preoperative hyperuricemia was an independent risk factor of postoperative aki and was related to poor outcomes (11). our findings are in agreement with those of the above studies and suggest a similar relationship between preoperative uric acid and postoperative aki. our study, however, included a much larger number and more homogeneous population of consecutive patients undergoing cabg, as well as adjusting for a great number of confounders, known as risk factors of aki in other studies, using a comprehensive and accurate data obtained by data abstractors who were blinded to the objectives of this study. furthermore, our results were consistent across several subgroups and in the analysis using severe aki as outcome given the growing burden of aki in patients undergoing cabg, validation of uric acid as a simple and convenient prognostic indicator would be valuable. most studies assessing renal risk have not included preoperative measure of uric acid. in our study, c statistics increased slightly, albeit significantly, after adding uric acid to the multivariate model in the whole study cohort, whereas the increase did not reach significance in other models. however, c statistic may be relatively an insensitive method to evaluate the impact of adding new predictors to established predictive models (21). in the present study, the improvement in model performance and the added predictive value obtained by adding serum uric acid to the baseline risk models, as gauged by two new metrics (idi and nri), which could overcome the limitation of c statistics and quantify risk prediction improvement offered by a new marker, were significant for aki. moreover, the additional predictive values of serum uric acid were consistent across existing reference models (nnecdsg models) and models for different subgroup population (cabg with and without cardiopulmonary bypass). these findings indicate that preoperative serum uric acid can improve the predictive ability of established risk prediction models for aki in patients undergoing cabg. serum uric acid is excreted mainly by the kidney, which means that a rise in the serum uric acid level may be inevitable in patients with renal dysfunction. therefore, whether preoperative elevated uric acid level is simply a marker of preoperative renal dysfunction or whether it is actually responsible for postoperative aki remains unknown. however, our subgroup analyses showed that, in patients with preoperative normal renal function, preoperative elevated uric acid level was also independently related to the increased risk of postoperative aki. in addition, several studies suggest that uric acid may itself be a potential contributor to renal injury. uric acid is reported to impair renal blood flow autoregulation through renal vasoconstriction, which is caused by activation of renin - angiotensin system and inhibition of renal neuronal nitric oxide synthase (7). uric acid was also shown to induce proinflammatory activities and oxidative stress (72223). furthermore, our present data show a dose - response relationship between serum uric acid level and the incidence of aki, which could support the hypothesis of a causal relationship (24). overall, these observations indicate that hyperuricemia may be causally associated with postoperative aki rather than just being a simple marker. thus, preoperative elevated serum uric acid may promote a higher incidence of postprocedural aki in patients undergoing cabg. our study did not show a j - shaped relationship between serum uric acid and aki as seen in a previous study (10). this discrepancy may be explained by the difference in baseline characteristics of study populations (ethnicity, cormobidities, or inclusion of off - pump surgery), or differences in perioperative management strategies. in addition, although uric acid has been known to be a major antioxidant and the relative contributions of the individual antioxidants may be different, a decrease in the levels of one antioxidant (i.e., uric acid) could be compensated by other oxidants (25). in other words, a lack of uric acid and its antioxidant capacities, but maintained by other antioxidants, may be associated with lower postoperative aki in our cohort. we found that the incidence of post - cabg aki was higher in patients with serum uric acid 5.6 mg / dl for males and 5.0 mg / dl for females than < 5.6 mg / dl and < 5.0 mg / dl, respectively. thus, our results suggest that the association between preoperative hyperuricemia and postoperative aki is not restricted to the normal range. in other words, elevated preoperative serum uric acid, even when within the normal range, may be associated with a higher risk of postoperative aki in patients undergoing cabg. these findings are consistent with the results of previous studies, showing that mildly elevated uric acid concentrations within the normal range (5.5 mg / dl) have oxidant and inflammatory effects, and were associated with aki and increased cardiovascular risk (1026). however, the clinical significance of this cut - off value requires validation in larger clinical studies. first, measuring preoperative serum uric acid may be of value in identifying patients at high risk for aki. that is, our findings suggest that patients with preoperatively elevated uric acid could be considered at high risk for aki. these patients may therefore require intensive monitoring and care during the perioperative period to prevent post - cabg aki. second, if the relationship between preoperative hyperuricemia and post - cabg aki is indeed causal, preoperative hyperuricemia may be a modifiable risk factor. that is, reducing uric acid concentration, especially in patients undergoing elective surgery, may minimize the risk of aki after cabg. indeed, several recent small clinical studies showed that uric acid - lowering treatment could slow the progression of renal disease and reduce cardiovascular risk in patients with chronic kidney disease, as well as reducing renal structural injury in patients undergoing cardiovascular surgery (272829). additional large, prospective, controlled randomized trials may be needed to determine whether hyperuricemia correction prior to cabg improves renal outcome. first, due to its retrospective, observational design, our findings should be deemed hypothesis - generating, and the causal association between preoperative hyperuricemia and post - cabg aki not definitively determined. second, as with any observational study, despite including many variables in our analyses, we could not exclude the effects of other hidden or unknown factors on the observed relationship. third, although subgroup analyses can provide additional information, issues related to multiple statistical testing, the lack of power, and the occurrence of false positive and/or false negative results may limit these findings. fourth, despite excluding patients treated with allopurinol, other drug therapy including angiotensin - converting enzyme inhibitor or angiotensin receptor blocker could also affect preoperative serum uric acid levels (30). additionally, the value of risk models may be dependent on the outcome and the population being examined. the nnecdsg model was originally developed to predict severe renal insufficiency in patients with cabg with a preoperative normal renal function (18). this may explain the lower predictive power compared to c statistic (0.72) shown in original papers. finally, this was a single - center study performed at a tertiary care academic medical center. therefore, caution is advised when generalizing these results to centers with different patient profiles. in conclusion, our current large observational study confirmed that preoperatively elevated serum uric acid was significantly associated with aki and improved the ability to predict the development of aki in patients undergoing cabg. further studies are warranted to evaluate the additional predictive value of serum uric acid in other cohorts and the benefit of preoperatively lowering uric acid levels to reduce postoperative aki. | an elevated serum concentration of uric acid may be associated with an increased risk of acute kidney injury (aki). the aim of this study was to investigate the impact of preoperative uric acid concentration on the risk of aki after coronary artery bypass surgery (cabg). perioperative data were evaluated from patients who underwent cabg. aki was defined by the aki network criteria based on serum creatinine changes within the first 48 hr after cabg. multivariate logistic regression was utilized to evaluate the association between preoperative uric acid and postoperative aki. we evaluated changes in c statistic, the net reclassification improvement, and the integrated discrimination improvement to determine whether the addition of preoperative uric acid improved prediction of aki. of the 2,185 patients, 787 (36.0%) developed aki. preoperative uric acid was significantly associated with postoperative aki (odds ratio, 1.18 ; 95% confidence interval, 1.10 - 1.26 ; p<0.001). adding uric acid levels improved the c statistic and had significant impact on risk reclassification and integrated discrimination for aki. preoperative uric acid is related to postoperative aki and improves the predictive ability of aki. this finding suggests that preoperative measurement of uric acid may help stratify risks for aki in in patients undergoing cabg.graphical abstract |
our understanding on genetic factors affecting nerve injury and regeneration is primarily derived from numerous mouse models. alterations of nerve regeneration are then observed in these mice (osterloh., 2012 ; wilhelm., 2012). although critical information has been learnt from these models, it is often difficult to know how these findings can be translated into humans. the mechanical force during each injury can not be the same, which makes any controlled study formidable among humans with nerve injures. are there any individuals or families with specific genetic mutations that would render neurological deficits when mechanical stress on these individuals is no more than ordinary physical activities ? these mechanical stresses result in no symptoms in normal subjects, but are sufficient to cause dysfunction of the nerves with the mutation. hereditary neuropathy with liability to pressure palsies (hnpp) says yes to this question. as its name denotes, this autosomal dominant inherited disorder typically presents with focal sensory loss and/or muscle weakness when the related peripheral nerves are challenged by mechanical stress. for instance, a patient with hnpp sits with one leg crossed on the other leg, which imposes mechanical pressure on the peroneal nerve at the fibular head. a half hour of this benign pressure is often sufficient to induce a foot drop on the crossed leg that may last hours to months in patients with hnpp (earl., 1964 ; li., strenuous physical activities in hnpp patients, such as running 10 miles with a 50 lb backpack, may lead to severe arm paralysis and protracted recovery (horowitz., 2004). gene mapping has revealed that patients with hnpp are associated with a heterozygous deletion of chromosome 17p12 (c17p12) (chance., 1993). humans with a heterozygous truncation mutation of pmp22 manifest an hnpp phenotype identical to that in patients with the heterozygous deletion of c17p12, supporting a causal role of loss of pmp22 function but not other genes in c17p12 (nicholson. mice with heterozygous knockout of pmp22 gene recapitulate the pathology of humans with hnpp (adlkofer., 1995). application of mechanical compression on pmp22 mouse nerves induced conduction block (failure of action potential propagation) more rapidly than that in pmp22 mouse nerves. this finding is well in line with the focal sensory loss and muscle weakness in hnpp patients when their nerves are exposed to mild mechanical stress (li. utilizing the pmp22 mouse model, molecular mechanism underlying the impaired action potential propagation in hnpp has been investigated lately (guo., 2014). it is primarily localized in adult myelinating schwann cells, while its expression is diffuse in the developing nervous system (parmantier., 1995, 1997 ; interestingly, demyelination is not found until the late stage of the disease (bai., 2010). although demyelination is widely regarded as one of the most important mechanisms which alter nerve conduction, effective nerve conduction is also thought to require a proper myelin seal through myelin junctions (such as tight junctions, adherens junctions). these junctions seal the spaces between adjacent myelin lamellae as well as spaces between the myelin and axolemma (hartline and colman, 2007). we found that deficiency of pmp22 dislocates junction protein complexes in myelin (figure 1). this change yields excessively permeable myelin that allows an entry of dextran molecules up to a size of 70 kda (guo., 2014). myelin junction disruption (modified from figure 6h i in guo., annals of neurology 2014). upper panel : myelin junctions in a pmp22 nerve fiber are depicted in paranodes and mesaxons. schmidt - lanterman incisures in inter - nodes are omitted since junctions in the incisures have changes similar to those in paranodes and mesaxons. lower panel : a pmp22 nerve fiber shows disruption or loss of junction protein complexes (tight junctions, ad - herens junctions) in paranodes and/or mesaxons. these junction pro - teins may be found in aberrant locations, including pernuclear regions of myelinating schwann cells. abnormal assembly of these junctions (including jam - c transmembrane adhesion) also loosens adhesion between paranodal myelin lamellae (arrow on the right). these changes increase myelin permeability that shunts current out of nerve fiber in the absence of demyelination, called functional demyelination. the severity of abnormally increased myelin permeability was found to vary in different nerve fibers (guo., 2014), and would produce two different populations of myelinated nerve fibers. those in the first group have severely leaky myelin that would shunt current out of nerve fibers, leading to failure of action potential propagation in the absence of demyelination. those in the second group have a mildly increased permeability of myelin, which still allows action potential to propagate, but would compromise the safety factor of action potential propagation. the nodes of ranvier in myelinated nerve fibers typically generate depolarizing currents five times higher than the minimum required for the induction of an action potential. this surplus is called the safety factor (kaji., 2000). this partially compromised safety factor would put the pmp22-deficient nerve fiber at risk to conduction failure if the fiber is challenged by additional external factors, such as mechanical stress. taken together, studies in hnpp reveal a new concept that specific human genetic factor, such as pmp22, may critically affect human nerve susceptibility to injures and recovery after the trauma. one mechanism to achieve this biological effect is through pmp22 's regulation of myelin junction formation and stability. there are three types of junctions in myelin, including tight junctions, adherens junctions, and septate junctions. the first two are often autotypic junctions between myelin laminae of the same cell. the third one is situated between the most inner lamina of schwann cells and axolemma (hartline and colman, 2007). desmosomes were initially reported in myelin, but were later proven to be adherens junction (fannon., 1995). under freeze - fracture electron microscopy, tight junctions appear as micro - strands extruding out of the membrane (tetzlaff, 1978). in the peripheral nerve myelin, these junctions are localized in non - compact myelin such as paranodal loops, schmidt - lanterman incisures, and inner / outer mesaxons (poliak., 2002). the strands are formed by polymerization of claudins, a family of tetraspan membrane proteins. c - terminals of claudins interact with a group of cytoplasmic proteins containing pdz - domains such as zo1 or zo2 (itoh., 1999). on the other hand, these pdz - containing proteins also interact with actins and link the tight junction strands to the cytoskeleton for junction stabilization (hartsock and nelson, 2008). e - cadherins have a large glycosylated extracellular domain, a single transmembrane domain and a cytoplasmic tail at the c - terminal that interacts with catenins (-catenin, -catenin and p120 catenin). there is another family of proteins, called jam (jam - a, jam - b and jam - c) that expresses nearby junctions. jam contains a large extracellular ig - domain, a transmembrane domain, and a cytoplasmic c - terminal. interactions between the ig - domain of jam from two opposing membranes may form homotypic dimers. 2000a), sealing the opposing membranes juxtaposed to tight / adherens junctions, and further strengthening the seal of myelin inter - membrane space (bazzoni., 2000b ; ebnet., 2000). ablation of jam - c in mice results in hnpp - like pathology and alters nerve conduction (scheiermann., 2007). finally, septate junctions are localized between paranodal myelin loops and axolemma. the protein constituents of septate junction include neurofascin-155 (nf155) located at the tips of paranodal myelin loops and the nf155-interacting partners (caspr and contactin) on the axolemma. under freeze fracture em, septate junctions (also called transverse bands) are ridges spiraling along the paranodal axolemma which bridge the tips of paranodal myelin loops and axolemma (rosenbluth, 2009). removal of any septate junction protein detaches paranodal myelin loops from the axolemma and impairs action potential propagation (bhat., 2001 ; boyle., 2001 ; sherman., 2005) our observation in pmp22 mice shows abnormal formation and maintenance of these tight / adherence junctions in pmp22 deficiency. this finding not only offers a novel mechanism to explain nerve conduction defect in the disease (guo., 2014), but also has additional physiological implications. after the developmental stage, when the myelinated nerve fiber has matured, its diameter, internodal length and myelin thickness remain stable. our study provides an alternative mechanism that may fine - tune conduction by tightening or loosening the myelin junctions. acquired or sporadic diseases can be studied by utilizing genetic models. a typical example is those studies in amyotrophic lateral sclerosis (als). a variety of rodent genetic models, such as the sod1 and tdp43 transgenic mice, have been used to study the pathogenic mechanisms of the disease. while als patients with mutations in sod1 or tdp43 are rare, investigations using these transgenic mice have made remarkable contributions to our understanding in the pathogenesis of als in general (swarup and julien, 2010). we believe that a similar advance in nerve injures could be achieved through the use of genetic models.. this strategy should motivate investigators to seek more families that might reveal additional genetic factors relevant to nerve injures. sh3tc2 (src homology 3 domain and tetratricopeptide repeats) may become the next candidate gene. autosomal recessive mutations in sh3tc2 have been associated with an inherited peripheral nerve disease, called charcot - marie - tooth disease type-4c (cmt4c). patients with cmt4c usually present with an early onset neuropathy with severe axonal loss and dysmyelination (kessali., 1997). however, humans with heterozygous mutations in sh3tc2 may present with carpal tunnel syndrome only (lupski., it is tethered to cellular membrane via its myristic acid anchor and is involved in regulation of endosome recycling through its interaction with rab11 (stendel., 2010). how these molecular functions relate to nerve resistance to mechanical stress is still unknown. finally, nerve entrapments (focal compression) are common neurological conditions in humans ; including median nerve entrapment at the wrist (carpal tunnel syndrome), ulnar nerve across the elbow, and peroneal nerve across the fibular head. | genetic factors may be learnt from families with gene mutations that render nerve - injury susceptibility even to ordinary physical activities. a typical example is hereditary neuropathy with liability to pressure palsies (hnpp). hnpp is caused by a heterozygous deletion of pmp22 gene. pmp22 deficiency disrupts myelin junctions (such as tight junction and adherens junctions), leading to abnormally increased myelin permeability that explains the nerve susceptibility to injury. this finding should motivate investigators to identify additional genetic factors contributing to nerve vulnerability of injury. |
polycystic ovarian syndrome (pcos) is the most common cause of anovulatory infertility and is responsible for 70% of infertility cases due to anovulation. clomiphene citrate (cc) has been the most widely used drug for the treatment of infertility since its introduction into clinical practice in the 1960s. it is known that clomiphene citrate results in an ovulation rate of 6085% but a conception rate of only about 20%. cc has a long half - life (2 weeks), and this may have a negative effect on the cervical mucus and endometrium, leading to discrepancy between ovulation and conception rates.[35 ] there has been a search for a compound capable of inducing ovulation but devoid of the adverse antiestrogen effects of cc. recent studies have suggested that letrozole, an aromatase inhibitor, does not possess the adverse antiestrogenic effects of clomiphene and is associated with higher pregnancy rates than cc treatment in patients with pcos. though evidence from larger trials is still awaited, some encouragement may be taken from the success of preliminary results showing aromatase inhibitor letrozole may be regarded as a possible replacement for cc for the first - time treatment of anovulatory infertility.[379 ] the aim of this present prospective randomized trial was to compare results of letrozole with cc in patients with pcos. this prospective randomized controlled trial was performed at a tertiary care hospital from january 2005 to january 2010. the inclusion criteria included patients in the age group of 2035 years having infertility for more than one year, body mass index (bmi) < 28, and patients of anovulatory pcos. the patients of pcos were recruited in the presence of oligomenorrhea (i.e., interval between periods were 35 days) or amenorrhea (i.e., absence of vaginal bleeding for 6 months), hirsutism, enlarged ovaries with multiple follicles (10 measuring 28 mm in diameter) as per rotterdam 's criteria on transvaginal ultrasonography (usg), and/or elevated serum testosterone. finally the diagnosis of pcos was made on the basis of revised rotterdam 2003 criteria. presence of two out of three criteria (oligo and/or anovulation, clinical biochemical sign of hyperandrogenism, and polycystic ovaries) was recommended as a diagnostic of pcos. in all patients, this included tubal patency test, pelvic ultrasonography, husband semen analysis, and serum hormone measurements (fsh, lh, prolactin, estradiol, progesterone, and testosterone) on the 2 to 5 day of the cycle. patients having abnormality in any of these tests, which may be responsible for reproductive failure, were excluded form the study. all patients underwent laparoscopy and patients who had other factors, found on laparoscopy, which may be responsible for infertility, were also excluded from the study. on basis of previous studies, to achieve a statistically valid comparison of pregnancy rates in the two groups, with a type i error of 0.05 and a power of 80%, a sample size of at least 40 women in each arm was required. randomization of recruited women was carried out using online software (http://www.randomization.com) to generate a random number table. all patients were randomized to receive one of the two drugs to be given over the next 3 months. randomization codes (a, b) were packed into sealed opaque envelopes by an individual not involved in enrollment, treatment and follow - up of subjects to ensure concealment of allocation. one resident had the responsibility for dispensing the trial drugs to the patient based on the unique randomization code. at the end of allocation, patients in letrozole group received ovulation induction with letrozole with starting dose of 2.5 mg, increasing up to 5 mg daily. patients in clomiphene citrate group received cc with starting dose of 50 mg, increasing up to 100 mg daily. in both the groups, treatments were administered from day 3 to day 7 (total of 5 days) of a spontaneous cycle or withdrawal bleeding after a 5-day course of 10 mg / day medroxyprogesterone acetate. serial transvaginal ultrasound was performed in each cycle in both the groups from 12 to 16 day until a mature follicle of diameter 18 mm or more and trilaminar layer of endometrial pattern were seen. the number of follicles and endometrial thickness (et) in each cycle in patients of both the groups were documented. ultrasound in all patients was demonstrated by single observer (first author) to remove the inter - observer bias. injection hcg 10,000 iu intramuscularly was given to the patients when a dominant follicle 18 mm and et 6 mm were observed. ovulation was confirmed by seeing follicle collapse on subsequent usg and elevated serum progesterone (25 each woman was asked to have timed intercourse 24 h to 36 h after ovulatory dose of hcg. women in both the groups without evidence of ovulation and with negative pregnancy tests were asked to follow the respective schedule of treatment in subsequent cycles. chemical pregnancy was assessed by serum level of beta hcg measurement once the patient missed her period. the mean number of follicles, endometrial thickness, ovulatory cycle rate, conception rate, and pregnancy outcome were compared in both the groups. 38 patients did not meet inclusion criteria and eight patients were lost to follow - up in between the study, and therefore, 204 patients entered and completed the study. a total of 612 cycles of ovulation induction were carried out in 204 patients, out of which 294 cycles were in the letrozole group and 318 cycles were in the cc group. of 106 patients in cc group, 69 patients had been given 50 mg clomiphene in all three study cycles, 18 patients were given 50 mg clomiphene in two cycles and stepped up to 100 mg in the third cycle, and 19 patients received 50 mg clomiphene in first cycle and 100 mg for second and third cycle. in the letrozole group, 72 patients received 2.5 mg letrozole in all three cycles, 14 patients received 2.5 mg for first two cycles and 5 mg in the third cycle, while 12 patients were stepped to 5 mg from the second cycle. flow of participants through the study table 1 summarizes the demographic profile of patients and the response of the women in the two groups to ovarian stimulation. there was no statistically significant difference in the mean age, bmi, and duration of infertility in both groups of patients. comparison of different variables in clomiphene citrate group and letrozole group based on meansd value the mean number of dominant follicles (18 mm) in the letrozole and cc group was not statistically different (letrozole 1.860.06 versus cc 1.920.17, p=0.126). the mean midcycle trilaminar layer of endometrial thickness in the letrozole group was 9.10.3 mm compared with 6.31.1 mm in cc group, which was statistically significant (p=0.014). we found no significant correlation with the number of dominant follicle and et in both letrozole and cc groups. the mean total e2 on the day of hcg administration was significantly higher in cc group as compared with letrozole group (364.271.4 pg / ml versus 248 42.2 pg / ml p=0.024). table 2 shows number of ovulatory cycles, number of pregnancies, pregnancy rate / cycle and number of miscarriages and live births in each group. the ovulation rate in letrozole group and cc group was similar (84 of 98 patients (85.7%) [196 out of 294 cycles (66.6%) ] in letrozole groups versus (92 of 106 patients (86.67%) [216 out of 318 cycles (67.9%) ] in cc group. there was no occurrence of ovarian hyperstimulation syndrome (ohss) in letrozole group compared with two cases of mild ohss in cc group, which were managed conservatively. out of 98 cases, 43 women became pregnant (43.8%) in letrozole group compared with 28 women who became pregnant out of 106 patients (26.4%) in cc group, which was statistically significant (p=0.041). pregnancy rate (pr) per cycle was also higher in letrozole group (14.6%) in comparison with the cc group (8.8%), although this difference was not statistically significant (p=0.061). two twin pregnancies and one triplet pregnancy occurred in the cc group and none in the letrozole group. the rate of spontaneous abortion in the first trimester was similar in both groups (4.08% in letrozole group versus 7.42% in cc group). there was significant difference between the two groups in terms of live birth rate (39 [39.7% ] in the letrozole group versus 21 [19.8% ] in the cc group p=0.045). comparison of ovulatory cycle, conception, and pregnancy outcome in clomiphene citrate group and letrozole group based on n (%) for many years, cc has been used as the first treatment of choice for patients with pcos. it is generally accepted that cc reduces uterine receptivity, and thus reduces the chances of conception. it is associated with endometrial thinning in 1550% of patients, probably due to estrogen receptor depletion.[1214 ] furthermore, the use of cc may block estrogen receptors in the cervix, producing a negative effect on the quality and quantity of cervical mucus. inappropriate development of the endometrium is associated with low implantation rate and early pregnancy loss due to luteal phase defect. aromatase inhibitors are non - steroidal compounds that suppress estrogen biosynthesis by blocking the action of the enzyme, aromatase, which converts androstenedione and testosterone to estrogens. letrozole is a potent reversible oral aromatase inhibitor, which has been widely used in post - menopausal women with metastatic breast cancer. it is given in a dose of 2.55 mg / day and has been shown to achieve optimal suppression of serum estrogen level and is almost free of side effects.[1618 ] the efficient estrogen - lowering property of letrozole could be utilized to temporarily release the hypothalamus from negative feedback effect of estrogen and thereby inducing an increased discharge of fsh. with letrozole, estrogen production is eventually advanced by the induced fsh discharge, but in contrast to the use of cc, the hypothalamus is able to respond to estrogen feedback with a negative feedback mechanism. this helps in modulating an overzealous discharge of fsh, which in turn is more likely to result in a mono - follicular ovulation with moderate estrogen concentration. letrozole also has an added positive effect, because peripherally, it may increase follicular sensitivity to fsh through amplification of fsh receptor gene expression.[1922 ] although letrozole creates an estrogen - deficient environment, it has no negative effect on the endometrium and cervix due to its short half - life (45 h). in contrast, cc has a long half - life (2 weeks), and it is possible that cc concentrations could accumulate over subsequent cycles. therefore, ovulation induction by letrozole is superior to cc in terms of follicular growth and endometrial response. in contrast, one study did not show any advantage to the use of letrozole over cc as a first - line treatment for induction of ovulation in women with pcos. it is reported that using 2.55 mg / day of letrozole has a better endometrial response compared with endometrial response using cc in the dose of 50100 mg / day. this has also been reported that when letrozole is used in the dose of 7.5 mg and compared with 100 mg of cc, there was no significant difference in et. in contrast, another study reported that the endometrial development was higher in letrozole group using 7.5 mg of letrozole compared with that of 150 mg of cc. most commonly used doses in previous studies has been between 2.5 and 7.5 mg. in our study, we used 2.5 mg daily of letrozole, increased to maximum 5 mg daily. in the present study, though the mean number of dominant follicles (18 mm) was comparable in both the letrozole and cc group, the mean endometrial thickness was significantly better in letrozole group [(9.10.3 mm) compared with cc group (6.31.1 mm) ]. similar findings were reported in our previous study, which demonstrated that endometrial thickness and sub - endometrial blood flow were significantly better in cases receiving induction with letrozole than cc despite comparable follicular response. al - fozan. also reported similar result in a randomized control trial of letrozole versus cc in women undergoing superovulation. similar to our previous study, there was no positive correlation between et and number of dominant follicles in both the group in the present study. it has been reported that serum e2 level on the day of hcg administration was statistically significantly lower in the letrozole group than the cc group. in our study, we have also found that the mean total e2 on the day of hcg administration was significantly higher in cc group as compared with letrozole group. unlike cc, which blocks and depletes estrogen receptors this explains a significantly higher et on the day of hcg administration with letrozole compared with cc. hcg was routinely administered to these women to allow follicle maturation and exactly time the intercourse for these couples, to increase the favorable outcome. it has been proved that routine documentation of follicle monitoring, individualization of hcg dose, and documentation of ovulation has been especially beneficial in pcos patients. with cc, supraphysiologic levels of estrogen can occur without control suppression of fsh because the normal estrogen receptor - mediated feedback mechanisms are blocked. this results in multiple follicular growth and higher multiple pregnancy rates with cc than are found in letrozole cycles. rashida begam. reported higher ovulation rate (62.5%) with letrozole compared with 37.50% with cc. mitwally and casper using 2.5 mg / day of letrozole achieved 75% and 100% ovulation in anovulatory and ovulatory patients respectively. ovulation rate was found to be similar reported by bayer., (81% in letrozole group versus 85% in cc group). in the present study, we found comparable ovulatory rates (66.6% in letrozole group and 67.9% in cc group). though number of pregnancies in the present study is significantly higher in letrozole group (43.8%) compared with cc group (26.4%), there was no significant difference in pregnancy rate per cycle. this may be due to the fact that pregnancy depends on multiple factors in a particular cycle and therefore may not reflect the difference. similar result was reported with use of 7.5 mg / day of letrozole and 150 mg / day of cc in patients of pcos who failed to ovulate with 100 mg of cc in previous cycle. letrozole producing mono - follicular development reduces the chances of multiple pregnancies compared with cc. reported low multiple gestation rates with aromatase inhibitors for ovulation induction. in our study, there was no multiple gestation in letrozole group compared with three multiple pregnancies in cc group. efficacy of letrozole in inducing ovulation with successful outcomes has been studied even in assisted reproduction for intrauterine insemination (iui) and in vitro fertilization techniques. besides ovulation induction in anovulatory infertility, extended letrozole regimen had a superior efficacy as compared with clomiphene citrate in patients of unexplained infertility undergoing superovulation and iui. letrozole has even been compared with recombinant fsh in inducing ovulation in women with pcos and has been found to be a suitable and cost - effective inducing agent. similar to previous studies, there was no difference in the number of miscarriage in two groups in our study. favorable pregnancy outcome with letrozole was reported by various studies. a multicentric retrospective study in canada by tulandi. on pregnancy outcome after letrozole induction of ovulation concluded that the concern about letrozole use for ovulation induction was unproven. in the present study, we found the live birth rate was significantly better in letrozole group compared with cc group, and there was no congenital malformation in either group. in conclusion, our results of randomized trial suggest that letrozole is as good as cc in terms of ovulation rate. letrozole was also found to be superior in terms of number of pregnancy than cc. therefore, letrozole is a safe and better alternative to cc in ovulation induction protocol for patients of anovulatory pcos, and it may be considered as a first - line treatment for ovulation induction in these patients. | objectives : to compare the efficacy of letrozole and clomiphene citrate (cc) in patients of anovulatory polycystic ovarian syndrome (pcos) with infertility.materials and methods : this prospective randomized clinical trial included 204 patients of pcos. 98 patients (294 cycles) received 2.55 mg of letrozole ; 106 patients (318 cycles) received 50100 mg of cc (both orally from days 37 of menstrual cycle). the treatment continued for three cycles in both the groups. main outcome measures : ovulation rate, endometrial thickness, and pregnancy rate. statistical analysis was done using spss 13 software. p value less than 0.05 was considered significant.results:the mean number of dominant follicles in letrozole groups and cc groups was 1.860.26 and 1.920.17, respectively (p=0.126). number of ovulatory cycle in letrozole group was 196 (66.6%) versus 216 (67.9%) in cc group (p=0.712). the mean mid - cycle endometrial thickness was 9.10.3 mm in letrozole group and 6.31.1 in cc group, which was statistically significant (p=0.014). the mean estradiol [e2 ] level in clomiphene citrate group was significantly higher in cc group (364.271.4 pg / ml) than letrozole group (248.2 42.2 pg / ml). 43 patients from the letrozole group (43.8%) and 28 patients from the cc group (26.4%) became pregnant.conclusion:letrozole and cc have comparable ovulation rate. the effect of letrozole showed a better endometrial response and pregnancy rate compared with cc. |
prostate cancer is the fourth most common cancer worldwide and is the second most lethal cancer (1, 2). the incidences of prostate cancer have been rising recently ; for example, in the united states, there are expected to be about 221,000 new prostate cancer diagnoses and about 27,500 prostate cancer deaths in 2015 (3, 4). it has been evident that prostate cancer cases are growing in iranian men (5). in 2010 there were estimated to be 3856 new cases of prostate cancer, making it the third most commonly diagnosed cancer in iranian men (6). in this regard, according to the iranian annual national registration center report, the incidence of prostate cancer in hamadan province has been reported 6.87 cases per hundred thousand population over 50 years in 2010 (6). despite major differences in the incidence of prostate cancer, it can primarily be considered associated with men older than 65 years, since 75% of new cases are diagnosed in men over 65 years (6, 7). it is due to the asymptomatic nature of the disease in the early stages. however, racial differences (3), genetic and environmental factors, family history (1), hormonal changes related to aging (8, 9) infection, poor nutrition (especially unsaturated fats) (10), smoking and alcohol consumption (11), etc. can be mentioned as the other reasons. the four fold increase in the number of men older than 65 years by 2050 (12) and the huge cost imposed on the health care systems due to prostate cancer (2) imply the importance of prostate cancer more (12). meanwhile, owing to asymptomatic nature of prostate cancer, to reduce mortality, screening can be used in asymptomatic patients to diagnose the prostate cancer (8). therefore, american cancer society suggested prostate cancer screening for all men over 50 years (13). there are different screening and diagnostic procedures including urodynamic studies, sonography, laboratory tests, symptoms and physical examinations (14). serologic test for assessing prostate - specific antigen (psa) level is the most important method, which is also the most practical one, easiest and most sensitive detection test (97% specificity and 67% sensitivity). it is recommended as the first diagnostic test and its digital rectal exam (dre) for diagnosis and follow - up for prostate cancer for individuals over 50 years is advised (9, 13). timely treatment and eradication of prostate cancer before metastasis can be achieved by early diagnosis with the psa test (13). the results of various studies are emphasized on the effectiveness of psa screening test in the diagnosis of cancer. they also introduce factors such as aging, higher income and better general health, as predictors of screening tests. these studies have emphasized risk - awareness strategies and intervention based on the increased information in prostate cancer prevention programs for health educators (12, 15 - 17). this study aimed to evaluate prostate cancer screening behavior and the related factors and was done on men over 50 years in hamadan. this analytical study was performed cross - sectionally on 200 men over 50 years in hamadan city, west of iran in 2014. two geographic regions were selected by clustering method. in each cluster, three health centers were selected. the sample size was indicated in terms of the number of households in each health center. the selected household was considered as a starting point to collect data in that area. then, referring to the address of the selected households, all households locating on the right side were considered as the study population. the interviewers received the necessary guidance to complete the questionnaires equally participating in the briefing. they informed the participants that all questionnaires are confidential and they are collected for statistical analysis. the questionnaire was designed in three sections : (a) demographic characteristics : including age, educational level, marital status, economic status and having history of cancer in family ; (b) prostate cancer screening behaviors : cancer screening behaviors included psa blood test and dre in 4 questions, replying with no and yes. the point 1 was given to yes answer, and zero was given to no answer ; and (c) psychological factors : psychological scales were measured in relation to prostate cancer screening behaviors. 26 items were composed under three major constructs : knowledge, perceived threat, and perceived efficacy. content validity of questionnaire was confirmed by 10 health education and promotion experts through calculating the content validity index (cvi) and content validity ratio (cvr). knowledge, 11 items were designed to measure knowledge of prostate cancer and benefits of screening behaviors (e.g., with increasing age, the risk of prostate cancer increases.). the items were rated on a 3-point scale ranging from 1 (yes) to 3 (no). higher scores indicate high level of knowledge toward prostate cancer and benefits of screening behaviors. an estimated reliability coefficient for knowledge scale was 0.75 which demonstrated internal consistency of this questionnaire. these were measured in relation to perceived susceptibility (3 items) and perceived severity (8 items). a sample item is it is likely to get prostate cancer in the future. the items were rated on a 5-point scale ranging from 1 (strongly disagree) to 5 (strongly agree). an estimated reliability coefficient for perceived threat scale was 0.88 which reveals internal consistency of this questionnaire. 4 items were designed to measure perceived efficacy of prostate cancer screening behaviors (e.g., how confident are you that you can regularly do blood tests related to prostate cancer ?). the items were rated on a 5-point scale ranging from 1 (strongly disagree) to 5 (strongly agree). an estimated reliability coefficient for perceived efficacy was 0.79 which demonstrated internal consistency of this questionnaire. all statistical analyses were performed using version 18.0 of the statistical software package spss (spss inc., chi - square, fisher s exact tests and logistic regression were used to investigate the predictors of prostate cancer screening behaviors. this analytical study was performed cross - sectionally on 200 men over 50 years in hamadan city, west of iran in 2014. two geographic regions were selected by clustering method. in each cluster, three health centers were selected. the sample size was indicated in terms of the number of households in each health center. the selected household was considered as a starting point to collect data in that area. then, referring to the address of the selected households, all households locating on the right side were considered as the study population. the interviewers received the necessary guidance to complete the questionnaires equally participating in the briefing. they informed the participants that all questionnaires are confidential and they are collected for statistical analysis. the questionnaire was designed in three sections : (a) demographic characteristics : including age, educational level, marital status, economic status and having history of cancer in family ; (b) prostate cancer screening behaviors : cancer screening behaviors included psa blood test and dre in 4 questions, replying with no and yes. the point 1 was given to yes answer, and zero was given to no answer ; and (c) psychological factors : psychological scales were measured in relation to prostate cancer screening behaviors. 26 items were composed under three major constructs : knowledge, perceived threat, and perceived efficacy. content validity of questionnaire was confirmed by 10 health education and promotion experts through calculating the content validity index (cvi) and content validity ratio (cvr). knowledge, 11 items were designed to measure knowledge of prostate cancer and benefits of screening behaviors (e.g., with increasing age, the risk of prostate cancer increases.). the items were rated on a 3-point scale ranging from 1 (yes) to 3 (no). higher scores indicate high level of knowledge toward prostate cancer and benefits of screening behaviors. an estimated reliability coefficient for knowledge scale was 0.75 which demonstrated internal consistency of this questionnaire. these were measured in relation to perceived susceptibility (3 items) and perceived severity (8 items). a sample item is it is likely to get prostate cancer in the future. the items were rated on a 5-point scale ranging from 1 (strongly disagree) to 5 (strongly agree). an estimated reliability coefficient for perceived threat scale was 0.88 which reveals internal consistency of this questionnaire. 4 items were designed to measure perceived efficacy of prostate cancer screening behaviors (e.g., how confident are you that you can regularly do blood tests related to prostate cancer ?). the items were rated on a 5-point scale ranging from 1 (strongly disagree) to 5 (strongly agree). an estimated reliability coefficient for perceived efficacy was 0.79 which demonstrated internal consistency of this questionnaire. these were measured in relation to perceived susceptibility (3 items) and perceived severity (8 items). a sample item is it is likely to get prostate cancer in the future. the items were rated on a 5-point scale ranging from 1 (strongly disagree) to 5 (strongly agree). an estimated reliability coefficient for perceived threat scale was 0.88 which reveals internal consistency of this questionnaire. 4 items were designed to measure perceived efficacy of prostate cancer screening behaviors (e.g., how confident are you that you can regularly do blood tests related to prostate cancer ?). the items were rated on a 5-point scale ranging from 1 (strongly disagree) to 5 (strongly agree). an estimated reliability coefficient for perceived efficacy was 0.79 which demonstrated internal consistency of this questionnaire. all statistical analyses were performed using version 18.0 of the statistical software package spss (spss inc., chi - square, fisher s exact tests and logistic regression were used to investigate the predictors of prostate cancer screening behaviors. the participants were aged between 50 and 81 years with a mean age of 57.9 6.7 years. 36.5% were illiterate or could only read and write, and 80% of the participants were married. only 5.1% of the participants assessed the economic status of their families good and 4% of the participants pointed out the history of prostate cancer in their first degree family members. according to table 1, the participants achieved 18.5%, 49.3% and 50.3%, of a maximum score for knowledge, perceived threat and effectiveness of prostate screening behaviors (table 2). there is a significant difference in prostate cancer screening behavior (dre and psa test) between different age groups (p < 0.05).the dre and psa test increased with ageing (table 3). table 4 shows the results of logistic regression analysis, the odds ratio (or) and 95% confidence intervals for the variables. according to the results, knowledge and perceived threat consequences of prostate cancer were psychological predictors of prostate cancer screening behaviors among men over 50 years of age. abbreviations : b, unstandardized regression coefficient ; se, standard error ; ci, confidence interval. this study aimed to assess factors associated with prostate cancer screening behavior among men over 50 years in hamadan. frequency of dre and psa test in the participants were reported 8.5% and 7.5%, respectively for evaluation of prostate cancer screening behavior. the prostate cancer screening behavior was reported 6.8%by rezaeian. (18) in rafsanjan among retried men a stable and regular behavior which is consistent with this study results. however, the rate of prostate cancer screening behavior in some non - iranian studies has been reported equal or equal to 50% (15, 19, 20). since the psa test is considered as one of the most effective practices for prostate cancer screening in prevention and early diagnosis, it is regarded essential during life. therefore, in educational programs the severity and seriousness and the advantages of these kinds of behavior must be emphasized. paying attention to the barriers for this behavior, such as financial difficulties, access to services and insurance as well as the health centers should play a positive role in screening which should be considered in health planning and strategies. it must be noted that participants age had significant association with prostate cancer screening behavior among the demographic variables ; in other words, people are thinking about taking care of themselves by aging and the increased risk of prostate cancer leading to perceived severity of the prostate cancer. other studies presented similar results : khani - jeihooni and kashfi (21), parker. (22), and winterich (23) showed that prostate cancer screening behaviors are significantly associated with age. also, the results in this section are consistent with the findings of other similar studies (5, 15, 24). in this study, results of studies by khani - jeihooni and kashfi (21), atulomah. also, knowledge predicts prostate cancer screening behaviors, this means that by increasing the knowledge level, prostate cancer screening behaviors also increase. it seems that knowledge has a determinant role in men s performance regarding screening behaviors. thus, implementation of educational programs toward benefits of screening behaviors will have significant role in promoting prostate cancer screening behaviors. generally, perceived threat is not desirable compared with risk of prostate cancer in psychological factors associated with prostate cancer screening behavior, and further training is needed for men. it may be due to the fact that participants do not expect to have prostate cancer or an intense fear of having painful consequences of this disease prevents them to think about prostate cancer. but adverse effects are expected in case of non - timely diagnosis almost in all men. these findings are consistent with the few other studies (14, 27, 28). the participants belief in their efficacy and ability for prostate cancer screening behavior were moderate (50.3% of the maximum score). it seems that perception higher efficiency of screening behaviors will increase the likelihood of these behaviors. the results in this section are consistent with the findings of other similar studies. for example, studies by khani - jeihooni and kashfi (21), alidosti. (30) showed that self - efficacy has an important role in promoting cancer prevention behaviors. the results show that the participants perceived threat is not desirable so the participants perceived efficacy was relatively favorable. it is notable that initially individuals are assessed the risk threat for seriousness and eligibility, who are more motivated by increasing the perceived threat to start second assessment (evaluation of the effectiveness of the recommended solution). in this stage, people in addition to evaluating the effectiveness of recommended solutions, assess their efficacy (31). when a threat is not considered seriously a (low perceived severity) lower incentive is observed for attention to this issue leading to superficially evaluation of the effectiveness of the recommended solutions. if people do not feel threatened and do not understand the severity, they easily will ignore available information regarding the threat. it should be noted that in case of both increased perceived threat and the perceived efficacy, people are motivated to control the risk and compliance of the recommended solution. the people who believe the threat is serious and are at risk to experience its negative consequences, are scared and are motivated to protect themselves. moreover, they believe that they can effectively stop the threat and they deal with that risk wisely (31, 32). in this study, the lower perceived threat of prostate cancer also made men either with no attention to the threat and its impact on public health due to lack of knowledge threat (with no reply or reaction) or to show the little protective actions due to their lower motivation. it is obvious in the results, since only a limited number of participants have done the recommended solutions regularly. the results of this study showed that the prostate cancer screening behaviors in men over 50 years in hamadan are not desirable. the findings have provided the precise awareness of the effective psychological factors which can be used for designing educational interventions. the results of this study showed that the prostate cancer screening behaviors in men over 50 years in hamadan are not desirable. the findings have provided the precise awareness of the effective psychological factors which can be used for designing educational interventions. | backgroundprostate cancer is the fourth most common cancer worldwide and is the second most lethal cancer.objectivesthe aim of this study was to investigate psychological predictors of prostate cancer screening behaviors among men over 50 years of age in hamadan.materials and methodsthis cross - sectional study was carried out on 200 men over 50 years of age in hamadan, west of iran. participants were recruited with a cluster sampling method. the subjects completed a self - administered questionnaire including demographic characteristics, prostate cancer screening behaviors and psychological factors related to prostate cancer. data was analyzed by spss-18 using chi - square, fisher exact test, and logestic regression.resultsaccording to the results, 8.5 and 7.5 percent of participants reported history of digital rectal exam and prostate - specific antigen test, respectively. also, the subjects reported 18.5%, 49.3% and 50.3% of receivable scores of knowledge, perceived threat, and perceived efficacy of prostate cancer screening behaviors, respectively. there was a significant association between prostate cancer screening behaviors and age groups (p < 0.05).conclusionsthe results showed that providing analytical studies in this field helps to surface the hidden aspects of this context and the health care providers and administrators will hopefully consider them in planning for identification of psychological factors, such as barriers and facilitators factors. |
to win a badminton game, players need to effectively deliver shots to disrupt opponent s readiness and dominate rallies. previous studies of badminton games have reported the development of skills to deliver effective service and overhead strokes1, 2 performing smashes and the characteristics of upper - limb muscle activity in high - level badminton players3. to disrupt an opponent s readiness by effectively delivering a shot, players need to instantaneously predict the spot where the shuttlecock will fall. in addition, increased leg strength for rapid movement to the spot where the shuttlecock falls4, and endurance to continue to move without decreasing the speed of movement5, 6 are important factors. it is also necessary for badminton players to move with a stable stance, while maintaining their own readiness. in this respect, balance ability is associated with multiple factors, including visual information ; for example, greater fluctuations in the center of gravity (cog) are observed when standing with the eyes closed than with them open7. there has also been a report suggesting that the cog fluctuates less with increased lower - limb muscle strength8. for postural stability, the appropriate contraction of lower - limb muscles based on sensory information obtained through the plantar surface is necessary7. in short, balance ability is influenced by various factors, and balance improvement is crucial for skill advancement9. with poor balance ability, postural stability decreases, consequently increasing the load on the lower limbs. in badminton, the physical burden has been reported to be marked6, and the rate of injury to be high10,11,12. therefore, it is important to reduce the risk of injury and increase the performance level by enhancing balance ability13. in addition, to return a shuttlecock falling near the net, players lunge forward mainly by moving their dominant legs. this pattern of movement places a great burden on the muscles of the dominant leg, and is frequently executed in badminton games. it is likely to be a characteristic of badminton, as it is not observed in other sports. on the other hand, when the shuttlecock falls in the back section of the court, players jump off the dominant or non - dominant leg to return it on some occasions. in short, badminton is characterized by the execution of combined jumping and stepping movements, and, in this respect, badminton players balance ability is likely to be under the influence of these combined movement patterns. considering the importance of addressing this issue in terms of injury prevention and performance improvement, this study aimed to clarify the characteristics of cog sway in badminton players by comparing them between players with high and low performance levels. eight male badminton players (high - level group) belonging to teams ranked among the top 3 at the all japan badminton championships and 8 playing badminton for recreation in university clubs (low - level group) were studied (table 1table 1.mean age, years of playing badminton, and physical of the groupsgroupnage (years)years of playingbadminton (years) height (cm)weight (kg)high - level819.30.711.81.4173.05.765.05.2low - level820.30.75.31.3172.44.463.610.4). the leg on the side on which they gripped the racket was considered the dominant limb. objectives and safety before obtaining their consent to voluntarily participate in the measurements. this study was conducted with the approval of the research ethics committee of the health science university (approval number : 15). cog sway during two- and one (dominant and non - dominant)-leg standing with subject s eyes open and closed were recorded using a stabilometer (wbs-1nk, unimex inc.). to maintain the posture during measurement, the subjects were positioned in a space surrounded by white walls, and were instructed to fix their eyes on a target placed 2 m ahead at their eye level. in the comparison of the high- and low - level groups, the possible influence of the body height on cog sway was considered insignificant, as there were no marked differences between the groups in height. cog sway in each stance was recorded at a sampling frequency of 100 hz for 30 seconds. the obtained data were analyzed using sway analysis software (cog - samp version 2.00) to calculate the following 5 items : (1) the total cog sway path length, (2) cog sway path length per unit area, (3) cog sway area, (4) x- and y - axis cog sway amplitudes, and (5) mean x- and y - axis center displacements. item (1) is the total length of the cog sway path during the 30 seconds of measurement, and (2) was obtained by dividing 1) by 3), (3) being the area surrounded by the circumference of the cog sway path. (4) are the amplitudes of cog sway in the horizontal and anteroposterior directions, and (5) indicates the mean center displacements in these directions, respectively. furthermore, the positive and negative directions along the x - axis represent cog displacements in the directions of the dominant and non - dominant legs, respectively, and those of the y - axis represent the ventral and dorsal directions, respectively. student s t - test was used to examine the significance of differences between the high- and low - level groups. table 2table 2.cog sway when players stood on two legs with their eyes open and closedstanding on two legswith eyes openwith eyes closedhigh - level grouplow - level groupsignificantdifferencehigh - level grouplow - level groupsignificantdifferencetotal cog sway path (cm)28.96.827.36.939.38.433.66.3sway area (cm)26.79.424.112.244.227.041.016.4trace length per unit area (cm / cm)1.20.31.30.31.10.40.90.3x - axis sway amplitude (cm)15.33.514.43.922.66.617.94.4y - axis sway amplitude (cm)21.05.619.75.426.96.524.35.8mean x - axis center displacement (cm)0.20.40.70.70.10.50.60.9mean y - axis center displacement (cm)2.01.53.51.62.11.63.22.3 : p<0.05 shows the cog sway when the badminton players stood on two legs with their eyes open and closed. with their eyes open, the cog was maintained near the center by the high - level group, while it was displaced in the direction of the dominant leg by the low - level group, with a significant difference between the two groups (p<0.05). in contrast, with the eyes closed, significant differences were not observed for any item. table 3table 3.cog sway when players stood on the dominant leg with their eyes open and closedstanding on the dominant legwith eyes openwith eyes closedhigh - level grouplow - level groupsignificantdifferencehigh - level grouplow - level groupsignificantdifferencetotal cog sway path (cm)111.114.5118.425.8227.448.7278.665.5sway area (cm)114.537.3124.230.1404.7190.4823.6551.8trace length per unit area (cm / cm)1.00.31.00.10.60.10.50.2x - axis sway amplitude (cm)74.57.378.213.6145.426.3163.817.2y - axis sway amplitude (cm)67.213.173.122.4143.037.9189.167.1mean x - axis center displacement (cm)0.60.60.60.50.80.91.20.8mean y - axis center displacement (cm)0.31.12.31.70.51.41.61.8 : p<0.05 shows the cog sway of standing on the dominant leg with the eyes open and closed. with their eyes open, the cog was maintained near the center by the high - level group, while it was displaced by 2 cm on average in the dorsal direction by the low - level group, with a significant difference between the two groups (p<0.05). in contrast, with the eyes closed, significant differences were not observed for any item. table 4table 4.cog sway when players stood on the non - dominant leg with their eyes open and closedstanding on the non - dominant legwith eyes openwith eyes closedhigh - level grouplow - level groupsignificantdifferencehigh - level grouplow - level groupsignificantdifferencetotal cog sway path (cm)106.317.4112.922.0216.539.9306.987.7sway area (cm)111.832.1119.947.7355.1133.2683.8347.3trace length per unit area (cm / cm)1.00.31.10.40.70.20.50.2x - axis sway amplitude (cm)70.914.975.813.5140.828.3178.835.7y - axis sway amplitude (cm)64.912.269.416.5134.231.7208.379.6mean x - axis center displacement (cm)0.50.80.90.50.50.50.50.9mean y - axis center displacement (cm)1.01.21.71.71.01.11.70.8 : p<0.05 shows the cog sway of standing on the non - dominant leg with the eyes open and closed. with their eyes open, significant differences between the 2 groups were not observed for any item. in contrast, with the eyes closed, the trace length, cog sway area, and x- and y - axis sway amplitudes were greater in the low- than in high - level group, with significant differences between the two groups (p<0.05). this study compared cog sway between badminton players with high and low performance levels, our results show that when the badminton players stood on two or the dominant leg with their eyes open, the cog was maintained near the center by the high - level group, while it was displaced toward the dominant leg or in the dorsal direction by the low - level group and when standing on the non - dominant leg with the eyes closed, the total cog trace length markedly increased in the low - level group. it has been reported that postural maintenance when standing depends on muscle strength, sensory functions, such as the somatic and visual senses, and complex interactions of the spinal reflex and vestibular system14. for example, the otolith and semicircular canals in the inner ear (the vestibular system), sensory organs perceiving the positions of the head and body, are involved in postural maintenance15. furthermore, as cog sway are generally greater when standing with the eyes closed than open, the availability of visual information also markedly influences balance ability16. rooks.17 reported that the elderly s balance ability was improved by resistance training to enhance their muscle strength, suggesting that muscle strength is an important factor for postural maintenance. in agreement with this, the variations in cog sway and displacements observed in the present study are likely to have reflected differences in the functions associated with the balance ability of the subjects ; however, as none of the previous studies of badminton players compared the vision and sensory organs of subjects with different performance levels, it is difficult to discuss whether such functional differences led to the variations in cog sway found between the high- and low - level groups in the present study. also, considering that badminton players with high performance levels have been reported to have greater lower - limb muscle strength4, it is possible that differences in the muscle strength influenced the variations in cog sway between them. however, as wolfson.18 reported that improvement was not observed, even with increased muscle strength, the degree of such influences may not be marked. in short, variations in cog sway due to differences in performance level are likely to be associated with differences in the central nervous activities, responsible for integrating sensory information and generating motor commands, although measurements of such performance - dependent differences in central nervous activity were not made in the present study. in some previous studies, experience - related functional changes were observed even in the spinal neurons with poor plasticity. the h - reflex is frequently used to evaluate stretch as a spinal reflex, and has been reported to show sport - specific changes. for example, the soleus h - reflex is greater in swimmers than in non - swimmers19, while the h - reflex level is lower in professional ballet dancers than in general athletes20. the fact that long - term physical training leads to specific and plastic changes in the central nervous system is widely recognized, and, in this respect, we speculate that the variations in cog sway observed in the present study may have been associated with experience - related differences in central nervous activity, even though measurements in relation to this were not made. in the present study, when badminton players stood on two or the dominant leg with their eyes open, the cog was maintained near the center by the high - level group, while it was displaced toward the dominant leg or in the dorsal direction by the low - level group. in badminton, to return a shuttlecock falling near the net, players need to adopt a lunge position with the dominant leg forward. this pattern of movement places a greater burden on the dominant than on the non - dominant leg, and is a characteristic of badminton, which presumably results in cog displacement toward the dominant leg. on the other hand, players need to maintain their cog near the center of the body to be ready to move in any direction after returning the shuttlecock despite the lateral difference, and this may explain the result that the cog was maintained near the center by the high - level group. in addition, the marked increase in the total cog trace length by the low - level group when standing on the non - dominant leg with their eyes closed (without visual information) may also be regarded as an experience - related tendency. in general, afferent information plays an important role in the motor learning process, but its contribution significantly decreases after learning21. therefore, assuming that there were marked differences in the experience of standing on the non - dominant leg between the high- and low - level groups, the lack of visual information may not have affected the former with such experience. this tendency may also be associated with an ability to appropriately return a shuttlecock falling near the non - dominant leg. in badminton players instantaneously react to the shuttlecock and rapidly move to it throughout the game. the player s physical burden is marked6, and the rate of injury is high12. in order to prevent injury, it is important to improve badminton players balance ability, and therefore, establish methods to objectively evaluate it. although the results of this study may be insufficient in some respects, they support the appropriateness of evaluating balance based on the characteristics of cog sway. | [purpose ] to clarify the characteristics of fluctuations in the center of gravity (cog) of badminton players by comparing them between those with high and low performance levels. [subjects ] eight male badminton players belonging to teams ranked among the top 3 at the all japan badminton championships (high - level group) and 8 playing badminton for recreation in university clubs (low - level group) were studied. [methods ] cog sway during two- and one (dominant and non - dominant)-leg standing with the eyes open and closed were recorded for 30 seconds, using a stabilometer. [results ] with their eyes open, the cog was maintained near the center by the high - level group, while it was displaced in the direction of the dominant leg by the low - level group, with a significant difference between the two groups. in contrast, with the eyes closed, the trace length, sway area, and x- and y - axis sway amplitudes were greater in the low- than in high - level group, with significant differences between the two groups. [conclusion ] these results support the usefulness of standing on the non - dominant leg with the eyes closed for the evaluation of badminton players balance ability. |
paraquat (pq), a nonselective contact herbicide, has been widely used in many countries since the 1960s. it has attracted medical controversy because of high mortality (typical case fatality 50%90%). ingestion of small quantities (> 10 ml) may initiate an irreversible lung fibrosis and renal failure leading to death. several other interventions have been proposed, but none has been shown to be effective in clinical trials. the immunosuppressive therapy is the most promising therapy, though it has not been widely used due to the lack of supporting evidence. here, we present a case in which the immunosuppressive status may provide some kind of protection from pq toxicity. a 34-year - old man, typical mongoloid, agricultural worker, ingested about 50 ml of a 20% solution of pq in a suicide attempt, and vomited some yellow - green frothy liquid. the ingested volume was superior to the previously published lethal dose for this pq formulation. one hour later, he was treated with gastric lavage, oral administration of adsorbent, and symptomatic treatments at the local hospital. about 10 hours after the ingestion, he was transferred to our emergency department with complaints of burning sensation of mouth, sore throat, and epigastric discomfort. upon admission, he weighed 56 kg and had a temperature of 36.9c, heart rate of 96 beats / min, respiration of 22 times / min, and blood pressure of 135/82 mm hg. the electrocardiogram was normal and chest computed tomography (ct) scans were clear. in terms of laboratory tests, white blood cell count was 6200 cells/l with 73.6% neutrophils and 14.6% lymphocytes, hemoglobin concentration 12.5 g / dl, platelet count 16,8000 cells/l, and c - reactive protein level 3.6 mg / l (reference range 08.0 mg the level of serum blood urea nitrogen and creatinine (cr) were 2.7 mmol / l (reference range 2.98.2 the serum alanine aminotransaminase was 24 u / l (reference range 540 u / l), aspartate aminotransaminase 20 u / l (reference range 840 u / l), total bilirubin 9.0 mol / l (reference range 1.021.0 mol / l), creatine kinase (ck) 112 u / l (reference range 38174 u / l), mb isoenzyme of creatine kinase (ck - mb) 27 u / l (reference range 225 u / l), and cardiac troponin - i (ctn - i) 0.07 g / l (reference range 00.04 the concentration of plasma pq was measured by sold - phase extraction using exchange resin and liquid chromatography coupling tandem mass spectrometry, 10 hours after the exposure, and the result (2.17 mg / l) was substantially above the survival limits of the severity index for pq poisoning (sipp) curve (0.30 mg, laboratory results revealed that he had lethal pq poisoning and mildly elevated serum ck - mb and ctn - i. unfortunately, the patient was diagnosed as hiv infected (elisa+, western - blot+), which was not established and treated previously. on admission, the number of lymphocyte of this patient was 905 cells/l, and cd4 lymphocyte count was 380 cells/l. subsequently, the patient received normative immunosuppressive therapy (methylprednisolone and cyclophosphamide [ctx ]). besides, antibiotics and large doses of antioxidants (vitamin c, ambroxol, glutathione, etc.) the patient felt chest distress and tachypnea (respiratory rate 2530 times / min). on the fourth day, the hypoxemia was major as assessed by a pao2 equal to 51.6 mm hg. chest ct scans showed scattered flocculent pieces and ground glass shadow with indistinct edges in the lungs (figure 1a). a rapid impairment of renal function occurred with a maximum on the third day (serum cr reached to 206 hp was performed a total of 6 times following admission. on the seventh day, ctx (total dose of 3 g) and methylprednisolone (total dose of 2 g) were not administrated with gradually reducing dosage, whereas cd4 lymphocyte count reduced to 252 cells/l. on the 12th day, the symptoms of the patient disappeared basically except for oropharyngeal ulcers, and the arterial blood gas, renal function, serum ck - mb, and ctn - i returned to normal. on the 15th day after poisoning, chest ct scans showed nothing abnormal in the lungs (figure 1b), and the patient was transferred to another hospital for aids treatment. it revealed scattered flocculent pieces and ground glass shadow with indistinct edges in the lungs. as a result of its local accumulation, the lung is the primary site of the toxic effects of pq. pq - induced lung injury involves interstitial edema, alveolitis, and interstitial inflammation, ultimately resulting in fibrosis. pq - induced pulmonary fibrosis results from the direct damage caused by oxygen free radicals as well as from the indirect injury caused by inflammatory cells and fibroblasts. moreover, pq - induced high expression of messenger rna for pulmonary monocyte chemoattractant protein-1 and macrophage inflammatory protein-1 is responsible for the fibrosis in the lungs. for the hiv - infected patients, the remarkable feature is impaired immune function, and hiv can infect a variety of cells such as cd4 lymphocytes and macrophages. hiv - encoded proteins or micrornas trigger mitochondrial - mediated apoptosis, which may account for the progressive decline in cd4 lymphocytes in infected patients. simultaneously, functional impairment of hiv - infected macrophages may play a role in the immune deficiency. these immune impairments may be conducive to ameliorate the acute inflammation and fibrosis in the lungs induced by pq. all along, the evolution of the patient 's status was in accordance with characteristics of pq poisoning, but the extent and duration of damage was mismatching and drastically alleviative by the previous biological indices, in spite of early treatment. the cd4 lymphocyte count also confirmed that the patient was in a state of mild suppression of immunological function on admission. at the end of the conventional immunosuppressive therapy, cd4 lymphocyte count also confirmed that the patient was in a state of moderate suppression of immunological function. this patient must have an earlier and more severe immunosuppression state compared with the other patients with pq poisoning ; however, the patient 's disease course was surprisingly smooth, and he recovered well and was discharged, without any immunosuppression - related complications. as this patient 's probability of survival was 20.5% and plasma concentration (2.17 mg / l) at 10 hours after poisoning was far above the survival limits of sipp ; his recovery was basically unthinkable, even in some sense, a miracle. we thought that the particular case of treatment can be indirectly supporting the effectiveness of immunosuppressive therapy in treating patients with pq poisoning, and the degree of immunosuppression and duration remains to be further discussed. | abstractwe described and analyzed the treatment process of an hiv - positive patient with severe paraquat (pq) poisoning.a 34-year - old man ingested about 50 ml of a 20% solution of pq in a suicide attempt. he was treated with gastric lavage, oral administration of adsorbent, and symptomatic treatments at the local hospital, and was transferred to our emergency department. ten hours after the exposure, the concentration of plasma pq was 2.17 mg / l and was substantially above the survival limits of the severity index for pq poisoning (sipp) curve (0.30 mg / l). the equation produced by jones (jones al, elton r, flanagan r. multiple logistic regression analysis of plasma paraquat concentrations as a predictor of outcome in 375 cases of paraquat poisoning. qjm. 1999:92;573578) predicted a 20.5% probability of survival at admission. unfortunately, the patient was diagnosed as hiv infected, and cd4 + lymphocyte count also confirmed that the patient was in a state of mild suppression of immunological function.immediately, the patient received normative immunosuppressive therapy and hemoperfusion (hp). on the 15th day after poisoning, the patient recovered well and was discharged.all along, the evolution of the patient 's status was in accordance with the characteristics of pq poisoning, but the extent and duration of damage was mismatching and drastically alleviative by the previous biological indices. the particular case of treatment may be indirectly supporting the effectiveness of immunosuppressive therapy in treating patients with pq poisoning. |
in general surgery, inguinal hernia repair is one of the most commonly performed procedures. it is estimated that over 20 million groin hernia repairs are performed each year, with over 800,000 inguinal hernia repair procedures performed in the united states alone. this places a significant burden on global healthcare costs and patient quality of life. over the past decade, developments in modern surgical techniques have greatly reduced the rate of recurrence following inguinal hernia repair. as such, the reduction of acute and chronic post - operative pain has become increasingly important as a key clinical target. post - operative pain is known to vary depending on the type of surgical procedure or technique employed, with current research focused on open versus laparoscopic hernia repair. the lichtenstein technique is an open, tension - free mesh - onlay procedure that has been shown to result in low recurrence and complication rates. as such, it is currently recommended by the european hernia society for the open treatment of uncomplicated primary unilateral hernias, and was the chosen method for the recent tisseel / tissucol for mesh fixation in lichtenstein hernia repair (timeli) study. the aim of the timeli study was to determine whether mesh fixation using standard sutures, or using a human fibrin sealant (tisseel / tissucol, baxter healthcare, deerfield, il, usa), impacted on chronic moderate severe complications of pain [a composite of pain, numbness and groin discomfort (pnd) ]. tisseel / tissucol is a biodegradable and biocompatible combination of highly concentrated human - derived fibrinogen and thrombin, which is activated by calcium chloride to polymerize into a fibrin fibre matrix. primary results from this study have been published, and showed tisseel / tissucol to significantly reduce the risk of chronic moderate the main objectives of these analyses were to investigate factors that could potentially influence 12-month pnd using univariate and multivariate analyses and to identify subsets of patients that may benefit specifically from tisseel / tissucol use compared with conventional sutures. these data may assist surgeons in predicting which patients may experience post - surgical complications, provide information on how best to treat them, and aid management of patient expectations. the timeli study was a randomised, blinded, controlled, multicentre european study (nct00306839), whose rationale and methodology have been described in detail previously. briefly, males aged 1880 years diagnosed with an uncomplicated unilateral primary inguinal hernia or an uncomplicated bilateral hernia, who were eligible for surgical repair using the lichtenstein technique, were enrolled into the study. full exclusion criteria have been previously reported, which included among others a body mass index 35 kg / m, a large hernia (l3/m3 ehs groin hernia classification), and concomitant abdominal surgery. on enrolment, patients were randomised to suture or tisseel / tissucol mesh fixation 24 h prior to surgery. inguinal hernia repair was performed using the lichtenstein technique by a surgeon experienced in the procedure. local / regional / general anaesthesia was used depending on the study centre and nerves preserved. if nerve resection did occur, where possible it was subsequently cut, ligated and/or implanted into the muscles according to lichtenstein and at the discretion of the attending surgeon [9, 10 ]. the heavyweight polypropylene flat mesh was tailored for the patient and then fixed by sutures as described by classical lichtenstein technique, or by application of 2 ml of fibrin sealant (where 2 ml of thrombin are added making 4 ml of the final volume) with 0.5 ml used dropwise on the pubic tubercle and pressing the mesh onto this for 2 min, after which the remainder of the sealant (1.5 ml) was sprayed over the entire surface of the mesh as a thin layer. assessments for pain, numbness and groin discomfort were performed 30 mm, e.g., patients with vas pain > 30 or vas numbness > 30 or vas groin discomfort > 30 at pre - operative visit). all statistical analyses were performed using sas software (statistical analysis system, version 8.02) on pentium (compatible ibm). vas scores are presented as mean values standard deviation (sd) and severity categories (none = 0, mild = 130, moderate = 3160, severe = 61100 mm) as percentages of each individual subpopulation. to identify predictors of combined pnd at 12 months (continuous variable), pearson correlations (for continuous variables), mann whitney wilcoxon tests and kruskal wallis tests (for categorical variables) were used in the univariate analyses, and non - parametric mixed covariance analyses with centre as random factor were used for the multivariate analyses. to assess the effect of mesh fixation on separate pnd outcomes at 12 months, non - parametric mixed covariance analysis (when pnd was considered as continuous variable) and mixed logistic models (when pnd was considered as binary variable ; vas = 0 versus vas > 0) with centre as random factor were used. variables included in the univariate analyses were chosen based on their potential to influence the course of post - operative pnd. these were : fixation method (tisseel / tissucol versus sutures) ; age (50 versus > 50 years) ; employment status [blue and white collar, self - employed, other (unemployed / student / retired) ] ; physical activity (sportive versus non - sportive) ; combined vas score at pre - operative visit (continuous variable) ; combined vas score 1 week post - operatively (continuous variable) ; and nerve handling (3 nerves, 2 nerves, 1 nerve, or 0 nerves seen and preserved). age has been considered in two classes instead of a continuous variable. for employment status, this variable has been considered as reflecting the psychological state of mind of the patient. consequently, it has been categorised in three categories : blue and white collar, where blue collar refers to tradesmen (plumbers, electricians etc.) and white collar refers to office workers, business people etc. ; self - employed and others. physical activity was considered in two classes based on engagement in professional or leisure sporting activities (sportive) or not (non - sportive) for nerve handling, patients were grouped according to the number of nerves seen and preserved during surgery ; it was assumed that if nerves were not seen, they were not damaged. are not independent, multivariate analyses were performed using mixed models with centre integrated as random factor. in this way, centre effect was taken into consideration in the model and estimations of fixed factors are more reliable. variables found to be significant at the 0.05 level (p 30 mm, e.g., patients with vas pain > 30 or vas numbness > 30 or vas groin discomfort > 30 at pre - operative visit). all statistical analyses were performed using sas software (statistical analysis system, version 8.02) on pentium (compatible ibm). vas scores are presented as mean values standard deviation (sd) and severity categories (none = 0, mild = 130, moderate = 3160, severe = 61100 mm) as percentages of each individual subpopulation. to identify predictors of combined pnd at 12 months (continuous variable), pearson correlations (for continuous variables), mann whitney wilcoxon tests and kruskal wallis tests (for categorical variables) were used in the univariate analyses, and non - parametric mixed covariance analyses with centre as random factor were used for the multivariate analyses. to assess the effect of mesh fixation on separate pnd outcomes at 12 months, non - parametric mixed covariance analysis (when pnd was considered as continuous variable) and mixed logistic models (when pnd was considered as binary variable ; vas = 0 versus vas > 0) with centre as random factor were used. variables included in the univariate analyses were chosen based on their potential to influence the course of post - operative pnd. these were : fixation method (tisseel / tissucol versus sutures) ; age (50 versus > 50 years) ; employment status [blue and white collar, self - employed, other (unemployed / student / retired) ] ; physical activity (sportive versus non - sportive) ; combined vas score at pre - operative visit (continuous variable) ; combined vas score 1 week post - operatively (continuous variable) ; and nerve handling (3 nerves, 2 nerves, 1 nerve, or 0 nerves seen and preserved). age has been considered in two classes instead of a continuous variable. for employment status, this variable has been considered as reflecting the psychological state of mind of the patient. consequently, it has been categorised in three categories : blue and white collar, where blue collar refers to tradesmen (plumbers, electricians etc.) and white collar refers to office workers, business people etc. ; physical activity was considered in two classes based on engagement in professional or leisure sporting activities (sportive) or not (non - sportive) for nerve handling, patients were grouped according to the number of nerves seen and preserved during surgery ; it was assumed that if nerves were not seen, they were not damaged. are not independent, multivariate analyses were performed using mixed models with centre integrated as random factor. in this way, centre effect was taken into consideration in the model and estimations of fixed factors are more reliable. variables found to be significant at the 0.05 level (p 30 mm ; 64 in the tisseel / tissucol group, 66 in the sutures group).fig. 1patient disposition for the timeli trial : itt population and the subgroup of patients experiencing pre - operative pnd patient disposition for the timeli trial : itt population and the subgroup of patients experiencing pre - operative pnd baseline characteristics for both the itt population and the pre - operative pnd subgroup are summarised in table 1 ; no significant differences between tisseel / tissucol and sutures groups were identified.table 1baseline characteristics (n, % unless otherwise stated) : itt population and patients experiencing pre - operative pnditt populationpatients experiencing pre - operative pnd (at least one vas > 30 mm)tisseel / tissucol n = 158sutures n = 158tisseel / tissucol n = 64sutures n = 66age, median (range), years58 (1984)59 (2180)58 (1984)55 (2177)employment status blue collar37 (23.7)39 (25.0)18 (28.6)23 (34.8) white collar49 (31.4)45 (28.8)17 (27.0)16 (24.2) self - employed14 (9.0)14 (9.0)4 (6.3)3 (4.5) not employed3 (1.9)3 (1.9)3 (4.8)0 (0.0) retired51 (32.7)55 (35.3)21 (33.3)24 (36.4)if employed full time96 (96.0)95 (96.936 (92.3)40 (95.2) part time4 (4.0)3 (3.1)3 (7.7)2 (4.8) bmi, mean (sd)25.5 (2.9)25.5 (2.6)25.3 (3.0)25.5 (2.6)general health asa i / ii n (%) 148 (94.2)153 (96.9)59 (92.2)62 (93.9) asa iii n (%) 9 (5.7)5 (3.2)5 (7.8)4 (6.1)pain none (0)56 (35.4)59 (37.3)12 (18.8)11 (16.7) mild (130)65 (41.1)59 (37.3)15 (23.4)15 (22.7) moderate (3160)28 (17.7)29 (18.4)28 (43.8)29 (43.9) severe (61100)9 (5.7)11 (7.0)9 (14.4)11 (16.7)numbness none (0)113 (71.5)110 (69.6)46 (71.9)45 (68.2) mild (130)33 (20.9)31 (19.6)6 (9.4)4 (6.1) moderate (3160)6 (3.8)14 (8.9)6 (9.4)14 (21.2) severe (61100)6 (3.8)3 (1.9)6 (9.4)3 (4.5)groin discomfort none (0)51 (32.3)47 (29.7)7 (10.9)6 (9.1) mild (130)60 (38.0)63 (40.0)10 (15.6)12 (18.2) moderate (3160)38 (24.1)38 (24.1)38 (59.4)38 (57.6) severe (61100)9 (5.7)10 (6.3)9 (14.1)10 (15.2) asa american society of anesthesiology categorisation, bmi body mass index, itt intention - to - treat, pnd pain, numbness and groin discomfort, sd standard deviation as assessed by the visual analogue scale (vas), ranging from 0 mm (none) to 100 mm (worst conceivable) baseline characteristics (n, % unless otherwise stated) : itt population and patients experiencing pre - operative pnd asa american society of anesthesiology categorisation, bmi body mass index, itt intention - to - treat, pnd pain, numbness and groin discomfort, sd standard deviation as assessed by the visual analogue scale (vas), ranging from 0 mm (none) to 100 mm (worst conceivable) univariate correlation analyses showed that fixation with sutures (compared with tisseel / tissucol), worsening pre - operative pnd and worsening pnd at 1 week post - operatively were significant predictors of pnd at 12 months (n = 299 ; p = 0.008 ; r = 0.23, p 50 years) and employment status [stratified by three classes : blue- and white - collar employment, self - employed, other (unemployed, student, retired) ] (table 2).table 2univariate analyses assessing the impact of demographic, clinical and surgical variables on pnd (combined vas) at 12 months post - operatively : itt population and patients experiencing pre - operative pnd (at least one vas > 30 mm) n itt population p value n pre - operative pnd (at least one vas > 30 mm) p valuefixation method tisseel / tissucol mean sd14915.0 27.26019.0 29.4 median (range)0.0 (0155)10.0 (0150) interquartile range0200.008 0250.003 sutures mean sd15023.5 34.16238.9 44.3 median (range)10.0 (0230)25.0 (0230) interquartile range035050age 50 years mean sd9224.8 38.54434.0 44.6 median (range)10.0 (0230)25.0 (0230) interquartile range0320.053 0500.313 > 50 years mean sd20716.8 26.87826.3 35.3 median (range)0 (0150)11.0 (0150) interquartile range025040employment status blue and white collar mean sd16119.4 30.37026.9 35.3 median (range)10 (0155)10.0 (0140) interquartile range0250.091 0400.697 self - employed mean sd2814.9 44.1748.1 82.8 median (range)0.0 (0230)12.0 (0230) interquartile range011060 other (unemployed / student / retired) mean sd10720.8 28.54430.2 34.7 median (range)10.0 (0150)20.0 (0150) interquartile range025050physical activity sportive mean sd14920.2 31.86725.7 36.4 median (range)10.0 (0230)19.0 (0230) interquartile range0250.2290350.522 non - sportive mean sd15018.3 30.45533.2 41.7 median (range)0.0 (0150)15.0 (0150) interquartile range025050combined vas score at pre - operative visit 299 30 mm) itt intention - to - treat, pnd pain, numbness and groin discomfort, sd standard deviation, vas visual analogue scale p values were calculated using mann whitney wilcoxon tests, kruskal wallis tests, and pearson correlations. significant at the 0.20 level, continuous variable (0300 mm) results of the multivariate analyses using non - parametric covariance modelling are summarised in fig. 2. five variables were found to be significant at the 0.2 level in the univariate analyses (mesh fixation, worsening pre - operative pnd, worsening pnd 1 week post - operatively, age and employment status). among them, several were correlated to each other, precluding their use in the same multivariate model ; i.e., age and employment status are not independent variables, and combined vas score at the pre - operative visit and combined vas score at the 1-week post - operative visit are also not independent of each other. therefore, two models of multivariate analysis were tested in order to separate these related factors.fig. 2variables significantly associated with 12-month pnd score as determined by multivariate analysis : itt population p values calculated using mixed non - parametric covariance analysis performed on rank data with study centre as random factor. variables identified as significant (p 30 mm)itt populationpatients experiencing pre - operative pnd (at least one vas > 30 mm)tisseel / tissucol n = 149sutures n = 150 p valuetisseel / tissucol n = 60sutures n = 62 p valuepain mean sd3.9 11.55.9 14.80.1136.6 14.610.7 19.30.195 median (range)0 (076)0 (090)0 (076)0 (090) interquartile range000005015numbness mean sd4.1 10.67.4 14.60.019 3.4 8.611.0 19.70.008 median (range)0 (091)0 (0100)0 (050)0 (0100) interquartile range0001000019groin discomfort mean sd7.1 14.610.2 16.80.049 9.0 14.617.3 21.50.018 median (range)0 (075)0 (080)0 (050)7.5 (080) interquartile range010020018025 itt intention - to - treat, pnd pain, numbness and pain discomfort, sd standard deviation, vas visual analogue scale p 30 mm) itt intention - to - treat, pnd pain, numbness and pain discomfort, sd standard deviation, vas visual analogue scale p 0) or absence (vas = 0) of separate pnd outcomes at 12 months post - operatively was also analysed. mixed logistic model analysis showed that fixation with sutures led to a higher incidence of numbness at 12 months post - operatively (p = 0.033), but not of pain or groin discomfort (p = 0.110 and 0.108) (table 4).table 4presence of pain, numbness and groin discomfort at the 12-month post - operative visit : itt population and patients with pre - operative pnd (at least one vas > 30 mm)itt populationpatients experiencing pre - operative pnd (at least one vas > 30 mm)tisseel / tissucol n = 149sutures n = 150 p valuetisseel / tissucol n = 60sutures n = 62 p valuepain, n (%) vas = 0 (no pain)125 (83.9)115 (76.7)0.11045 (75.0)40 (64.5)0.220 vas > 0 (some pain)24 (16.1)35 (23.3)15 (25.0)22 (35.5)numbness, n (%) vas = 0 (no numbness)115 (77.2)99 (66.0)0.033 48 (80.0)37 (59.7)0.021 vas > 0 (some numbness)34 (22.8)51 (34.0)12 (20.0)25 (40.3)groin discomfort, n (%) vas = 0 (no discomfort)106 (71.1)95 (63.3)0.10838 (63.3)31 (50.0)0.101 vas > 0 (some discomfort)43 (28.9)55 (36.7)22 (36.7)31 (50.0) itt intention - to - treat, pnd pain, numbness and pain discomfort, vas visual analogue scale p 30 mm) itt intention - to - treat, pnd pain, numbness and pain discomfort, vas visual analogue scale p 0) or absence (vas = 0) of separate pnd outcomes at 2 months was also compared between the two mesh fixation groups. mixed logistic model analysis showed fixation with sutures to be a significant predictor of numbness at 12 months post - operatively (p = 0.021), but was not associated with an increased incidence of pain or groin discomfort when compared with mesh fixation with tisseel / tissucol at this time point (p = 0.220 and 0.101) (table 4). univariate correlation analyses showed that fixation with sutures (compared with tisseel / tissucol), worsening pre - operative pnd and worsening pnd at 1 week post - operatively were significant predictors of pnd at 12 months (n = 299 ; p = 0.008 ; r = 0.23, p 50 years) and employment status [stratified by three classes : blue- and white - collar employment, self - employed, other (unemployed, student, retired) ] (table 2).table 2univariate analyses assessing the impact of demographic, clinical and surgical variables on pnd (combined vas) at 12 months post - operatively : itt population and patients experiencing pre - operative pnd (at least one vas > 30 mm) n itt population p value n pre - operative pnd (at least one vas > 30 mm) p valuefixation method tisseel / tissucol mean sd14915.0 27.26019.0 29.4 median (range)0.0 (0155)10.0 (0150) interquartile range0200.008 0250.003 sutures mean sd15023.5 34.16238.9 44.3 median (range)10.0 (0230)25.0 (0230) interquartile range035050age 50 years mean sd9224.8 38.54434.0 44.6 median (range)10.0 (0230)25.0 (0230) interquartile range0320.053 0500.313 > 50 years mean sd20716.8 26.87826.3 35.3 median (range)0 (0150)11.0 (0150) interquartile range025040employment status blue and white collar mean sd16119.4 30.37026.9 35.3 median (range)10 (0155)10.0 (0140) interquartile range0250.091 0400.697 self - employed mean sd2814.9 44.1748.1 82.8 median (range)0.0 (0230)12.0 (0230) interquartile range011060 other (unemployed / student / retired) mean sd10720.8 28.54430.2 34.7 median (range)10.0 (0150)20.0 (0150) interquartile range025050physical activity sportive mean sd14920.2 31.86725.7 36.4 median (range)10.0 (0230)19.0 (0230) interquartile range0250.2290350.522 non - sportive mean sd15018.3 30.45533.2 41.7 median (range)0.0 (0150)15.0 (0150) interquartile range025050combined vas score at pre - operative visit 299 30 mm) itt intention - to - treat, pnd pain, numbness and groin discomfort, sd standard deviation, vas visual analogue scale p values were calculated using mann whitney wilcoxon tests, kruskal wallis tests, and pearson correlations. significant at the 0.20 level, continuous variable (0300 mm) results of the multivariate analyses using non - parametric covariance modelling are summarised in fig. 2. five variables were found to be significant at the 0.2 level in the univariate analyses (mesh fixation, worsening pre - operative pnd, worsening pnd 1 week post - operatively, age and employment status). among them, several were correlated to each other, precluding their use in the same multivariate model ; i.e., age and employment status are not independent variables, and combined vas score at the pre - operative visit and combined vas score at the 1-week post - operative visit are also not independent of each other. therefore, two models of multivariate analysis were tested in order to separate these related factors.fig. 2variables significantly associated with 12-month pnd score as determined by multivariate analysis : itt population p values calculated using mixed non - parametric covariance analysis performed on rank data with study centre as random factor. variables identified as significant (p 30 mm)itt populationpatients experiencing pre - operative pnd (at least one vas > 30 mm)tisseel / tissucol n = 149sutures n = 150 p valuetisseel / tissucol n = 60sutures n = 62 p valuepain mean sd3.9 11.55.9 14.80.1136.6 14.610.7 19.30.195 median (range)0 (076)0 (090)0 (076)0 (090) interquartile range000005015numbness mean sd4.1 10.67.4 14.60.019 3.4 8.611.0 19.70.008 median (range)0 (091)0 (0100)0 (050)0 (0100) interquartile range0001000019groin discomfort mean sd7.1 14.610.2 16.80.049 9.0 14.617.3 21.50.018 median (range)0 (075)0 (080)0 (050)7.5 (080) interquartile range010020018025 itt intention - to - treat, pnd pain, numbness and pain discomfort, sd standard deviation, vas visual analogue scale p 30 mm) itt intention - to - treat, pnd pain, numbness and pain discomfort, sd standard deviation, vas visual analogue scale p 0) or absence (vas = 0) of separate pnd outcomes at 12 months post - operatively was also analysed. mixed logistic model analysis showed that fixation with sutures led to a higher incidence of numbness at 12 months post - operatively (p = 0.033), but not of pain or groin discomfort (p = 0.110 and 0.108) (table 4).table 4presence of pain, numbness and groin discomfort at the 12-month post - operative visit : itt population and patients with pre - operative pnd (at least one vas > 30 mm)itt populationpatients experiencing pre - operative pnd (at least one vas > 30 mm)tisseel / tissucol n = 149sutures n = 150 p valuetisseel / tissucol n = 60sutures n = 62 p valuepain, n (%) vas = 0 (no pain)125 (83.9)115 (76.7)0.11045 (75.0)40 (64.5)0.220 vas > 0 (some pain)24 (16.1)35 (23.3)15 (25.0)22 (35.5)numbness, n (%) vas = 0 (no numbness)115 (77.2)99 (66.0)0.033 48 (80.0)37 (59.7)0.021 vas > 0 (some numbness)34 (22.8)51 (34.0)12 (20.0)25 (40.3)groin discomfort, n (%) vas = 0 (no discomfort)106 (71.1)95 (63.3)0.10838 (63.3)31 (50.0)0.101 vas > 0 (some discomfort)43 (28.9)55 (36.7)22 (36.7)31 (50.0) itt intention - to - treat, pnd pain, numbness and pain discomfort, vas visual analogue scale p 30 mm) itt intention - to - treat, pnd pain, numbness and pain discomfort, vas visual analogue scale p 0) or absence (vas = 0) of separate pnd outcomes at 2 months was also compared between the two mesh fixation groups. mixed logistic model analysis showed fixation with sutures to be a significant predictor of numbness at 12 months post - operatively (p = 0.021), but was not associated with an increased incidence of pain or groin discomfort when compared with mesh fixation with tisseel / tissucol at this time point (p = 0.220 and 0.101) (table 4). this was a comprehensive secondary analysis of data from the timeli study to investigate factors that could influence the combined outcome of pain, numbness and groin discomfort 12 months after surgery, and to identify any subsets of patients that could gain particular benefit from tisseel / tissucol use during lichtenstein inguinal hernia repair. through multivariate modelling, our study identified three factors that increased the risk of experiencing chronic pnd in the overall population ; these were receiving sutures rather than tisseel / tissucol during surgery, experiencing worsening pre - operative pnd and experiencing worsening pnd 1 week after surgery. univariate analyses also identified younger age (50 years) and employment status as significant at the 0.2 level. nerve handling during surgery and physical activity were not found to have a significant effect on the outcome of pnd 12 months post - surgery. several risk factors for persistent post - operative pain / discomfort have been identified in the literature, including both surgery - related factors such as surgical technique and post - operative complications and patient - specific factors such as pre - operative pain and psychological vulnerability. the risk factors identified in our secondary analyses are generally in agreement with other reports predicting risk factors for post - surgical chronic pain, although direct comparisons can not be made due to our use of the novel pnd outcome. a retrospective, questionnaire - based study including 2,456 patients from the swedish hernia registry investigated factors associated with residual pain 23 years after primary inguinal and femoral hernia repair. they found that age below median (59 years), a high level of pain before the operation, and post - operative complications significantly and independently predicted long - term pain in multivariate logistic analysis when worst pain last week was used as outcome variable. notably, and unlike our current analyses, this study did not find any specific surgical technique to be associated with risk of residual pain. furthermore, a small retrospective study of patients who were referred to a chronic pain clinic following inguinal hernia repair demonstrated a link between pre - operative pain and the development of severe chronic pain after hernia repair ; 14/24 patients presented pre - operatively with severe pain compared with 3/24 sex- and age - matched pain - free controls (p 30 mm) appear more likely to benefit from mesh fixation using tisseel / tissucol. the main endpoint in the timeli study was the composite outcome of pain, numbness and groin discomfort. this combined endpoint was chosen to allow a robust overall quantitative assessment of three overlapping, moderate although pain is generally regarded as the most disabling element of the composite endpoint, the outcomes of groin discomfort and numbness can also negatively affect quality of life, especially if these complications persist over long periods after hernia repair. when comparing the three complications separately in patients treated with tisseel / tissucol and those treated with sutures, differences in the presentation of these separate outcomes fibrin sealant resulted in significantly less numbness 12 months after surgery in both analysis populations. interestingly, the intensity of groin discomfort was higher in patients treated with sutures than with fibrin sealant, but the incidence of discomfort was similar between treatment groups in both the itt population and in patients experiencing pre - operative pnd. the higher mean intensity of groin discomfort in the sutures group could be explained by outliers skewing the data. however, in the subgroup of patients experiencing pre - operative pnd, a higher median vas score was observed that may indicate a true difference. finally, no difference in pain was found between the groups both in the overall study population and the subpopulation experiencing pre - operative pain. these observations may warrant further investigation to explore the mechanisms behind these chronic complications of pain, and the possible benefits of mesh fixation with tisseel / tissucol and how they relate to quality of life. these results provide strong evidence that mesh fixation using tisseel / tissucol should be the preferred technique, especially in patients experiencing pre - operative pnd. because of the large number of inguinal hernia repairs performed annually, and the substantial percentage of patients experiencing pre - operative pnd (41.1 % in this study), using tisseel / tissucol instead of sutures in these patients could potentially reduce the global healthcare burden and improve patient quality of life. limitations of the timeli trial design and primary efficacy and safety analyses have been previously reported. one of the main limitations of the secondary analyses presented here is the relatively small sample size of the subpopulation. despite this limitation, significant differences were observed for many of the comparisons between treatment groups in the subpopulation of patients experiencing pre - operative pnd. finally, as the study population only included patients undergoing surgery for small / medium - sized hernias, the use of fibrin sealant for mesh fixation to repair larger l3 or m3 hernias requires investigation in further clinical studies. the timeli study demonstrated that tisseel / tissucol is a well - tolerated and effective means of mesh fixation during the repair of small / medium inguinal hernias using the lichtenstein technique. these secondary analyses show that pre - operative pnd has a significant impact on predicting chronic moderate severe pnd. as such, the patients experiencing pre - operative pnd may especially benefit from an atraumatic and non - tissue - penetrating mesh fixation technique using tisseel / tissucol, which may improve long - term morbidity over conventional suture fixation. ah declares grant support for this study, consultancy outside submitted work, fees for participation in review activities and no other conflict of interest. gc declares expert testimony and grants / grants pending outside submitted work, grant support for this study and no other conflict of interest. jr declares expert testimony and grants / grants pending outside submitted work, payment for lectures including service on speakers bureaus, grant support for this study and no other conflict of interest. mbd declares conflict of interest directly related to the submitted work and outside the submitted work as a baxter employee, holds stock / stock options with baxter healthcare and no other conflict of interest. mm declares board membership, consultancy, grants / grants pending payment for lectures including service on speakers bureaus and payment for development of educational presentations outside the submitted work, grant support for this study and no other conflict of interest. | purpose the tisseel / tissucol for mesh fixation in lichtenstein hernia repair (timeli) study showed that mesh fixation with human fibrin sealant during inguinal hernia repair significantly reduced moderate severe complications of pain 12 months post - operatively compared with sutures. further analyses may assist surgeons by investigating predictors of post - surgical complications and identifying patients that may benefit from tisseel / tissucol intervention.methodsunivariate and multivariate analyses identified risk factors for combined pain, numbness and groin discomfort (pnd) visual analogue scale (vas) score 12 months post - operatively. variables tested were : fixation method, age, employment status, physical activity, nerve handling, pnd vas score at pre - operative visit and 1 week post - operatively. the effect of fixation technique on separate pnd outcomes 12 months post - surgery was also assessed. analyses included the intention - to - treat (itt) population and a subpopulation with pre - operative pnd vas > 30 mm.results316 patients were included in the itt, with 130 patients in the subpopulation with pre - operative pnd vas > 30. multivariate analysis identified mesh fixation with sutures, worsening pre - operative pnd and worsening pnd 1 week post - surgery as significant predictors of 12-month pnd in the itt population ; mesh fixation with sutures was a significant predictor of 12-month pnd in the pre - operative pnd vas > 30 subpopulation (p < 0.05). mesh fixation with tisseel / tissucol resulted in significantly less numbness and a lower intensity of groin discomfort compared with sutures at 12 months ; there was no difference in pain between the treatment groups.conclusionspre-operative discomfort may be an important predictor of post - operative pain, numbness and discomfort. tisseel / tissucol may improve long - term morbidity over conventional sutures in these patients. |
nmr spectroscopic data were recorded on a bruker avance 500 spectrometer equipped with cryogenic probe for h and c measurements (bruker). gc - ms analyses were carried out using a varian 3900 gc with saturn 2100 ion trap mass spectrometer equipped with hp-5 ms capillary column (30 m 0.25 mm 0.25 m) in electron ionization (70 ev) mode (agilent / varian). column chromatography was performed with 80 200 mesh silica gel (fisher scientific). hplc was carried out with a zorbax eclipse xdb - c8 column (4.6 mm 150 mm, 5 m) on an agilent 1100 series system equipped with fraction collector and diode array detector. the genes from s. arenicola described herein were cloned from the fosmids used in its genome sequencing project. these were cloned into the gateway vector system (invitrogen) to enable their use in the metabolic engineering system, including co - expression with previously characterized enzymes (i.e., to investigate configurations or increase yield). enzymatic products were analyzed by gc - ms of organic extracts from the relevant recombinant cultures. where necessary (i.e., for 3 and 4), these cultures were scaled up to enable production and purification of larger quantities for structural characterization by nmr. previously described as a colorless solid;h and c nmr, as well as ms, data largely match literature values, with the few significant differences supported here by hmbc correlations (si, table s1). previously described as a colorless solid;h and c nmr data largely match literature values, again with the few significant differences supported here by hmbc correlations (si, table s2). | while more commonly associated with plants than microbes, diterpenoid natural products have been reported to have profound effects in marine microbe microbe interactions. intriguingly, the genome of the marine bacterium salinispora arenicola cns-205 contains a putative diterpenoid biosynthetic operon, terp1. here recombinant expression studies are reported, indicating that this three - gene operon leads to the production of isopimara-8,15-dien-19-ol (4). although 4 is not observed in pure cultures of s. arenicola, it is plausible that the terp1 operon is only expressed under certain physiologically relevant conditions such as in the presence of other marine organisms. |
among the forms of histoplasmosis reported from india, disseminated histoplasmosis (dh) is the rarest. we report a case of dh in an immunocompetent individual treated initially with anti tubercular drugs for a granulomatous infection of bone and soft tissue with poor response from south india where the disease is uncommon. so by reporting this case we confirm the importance of considering disseminated fungal infections as a possibility while dealing with disseminated granulomatous infections in immunocompetent individuals although they come from a non - endemic area. a 48-year - old rubber tapper came to our hospital with the symptoms of multiple subcutaneous swellings over upper and lower limbs for 11 months and fever for 2 months. his past history revealed that he had a fall 13 years ago that resulted in a traumatic fracture of l2 vertebra and weakness in both lower limbs which was treated with spinal implant and he recovered uneventfully. however, 2 years ago he had a second fall that resulted in failure of the spinal implant. a month later, he developed weakness of both lower limbs and a non - healing sinus at the surgical site. mri of the spine taken that time showed a paraspinal collection [figure 1 ]. fine - needle aspiration cytology (fnac) from this paraspinal collection showed granulomatous infection for which he received category i anti tubercular drugs for 13 months. however, at the end of this period, he was no better ; also he developed swellings associated with ulceration over his right foot and left hand and fever for 1 month. then the x - rays of foot and hand were taken which showed multiple periarticular lytic lesions [figure 2 ] ; open biopsy and curettage from these lesions showed granulomatous inflammation again. hence, his treatment was changed to category ii anti tubercular drugs which were continued for 9 more months. although he was irregular for followup, he returned to the previous hospital at the end of ninth month of his cat ii treatment because the swellings and ulcers had not healed in spite of the treatment, during which he was referred to our department of medicine from his previous hospital. t2w mri parasagittal and midsagittal images of spine showing paraspinal collection x - ray of the feet (anteroposterior views) showing periarticular lytic lesions (white arrow) he gave no history of diabetes mellitus, hypertension, pulmonary tuberculosis, high risk behavior, intravenous drug abuse, blood transfusion, or of travel abroad. he was a heavy smoker of long standing, had loss of appetite and significant weight loss for 2 years. on examination, we found that he had ulcers over the left hand, right hand and right foot ; generalized lymphadenopathy firm, non - tender, mobile, painless with no matting or overlying sinuses ; multiple subcutaneous swellings on the right forearm, right elbow and right leg ; they were cystic, painless and mobile, with a local rise in temperature ; a surgical scar over the spine extending from t10 to l4 and a sinus at lumbar region. his hemoglobin was 12.7 g / dl, total leukocyte count : 3400/l with 70% neutrophils, esr : 45 mm / h and platelets : 2.3 lakhs / mm. the chest x - ray showed a non - homogenous opacity in the left upper lobe. since the patient had evidence of a disseminated granulomatous disease from the previous histopathology reports, we considered atypical mycobacterial infection, fungal infection and sarcoidosis as possibilities. an excision biopsy of the cervical lymph node showed necrotizing granuloma [figure 3 ] ; the pathologist found on fungal staining capsulated yeast cells with narrow based budding suggestive of histoplasma [figure 4 ]. fungal culture on sabouraud 's dextrose agar of pus from subcutaneous swelling showed growth of dimorphic fungus after 5 weeks of incubation, also consistent with histoplasma. 10 micrograph of a lymph node biopsy showing necrotizing granuloma with hematoxylin and eosin staining fungal culture on sabouraud 's dextrose agar 40 micrograph of (a) a lymph node biopsy showing histoplasma with gomorri 's methenamine sliver staining (b) a biopsy ulcer on fifth toe showing histoplasma with gomorri 's methenamine sliver staining (black arrow) since the latest specimens showed histoplasma on fungal staining, the pathologist reviewed all previous slides of which the bone curettage specimen demonstrated the fungus figure 5. the patient was initially treated with liposomal amphotericin b for 14 days at a dose of 3 mg / kg followed by itraconazole 200 mg twice daily which was planned for the total of 12 months. he became afebrile, his ulcers have healed, his swellings have subsided and his sinus has healed. he is on the followup with an impending treatment of itraconazole for the next 4 months. histoplasma capsulatum is a dimorphic fungus endemic to ohio, missouri and mississippi river valleys in the united states, as well as some river valleys in central america. histoplasmosis may present clinically in different forms asymptomatic infection, an acute or chronic pulmonary infection, mediastinal fibrosis or granulomas and as dh. patients who are immunosuppressed and unable to develop effective cell - mediated immunity against the organism are likely to manifest symptomatic disease during the period of acute dissemination. chronic progressive dh is a slowly progressive infection due to histoplasma capsulatum that occurs mostly in older adults who are not overtly immunosuppressed. these patients have no obvious immunosuppression, but their macrophages can not effectively kill h. capsulatum. physical examination often shows hepatosplenomegaly, lymphadenopathy, pallor and petechiae if pancytopenia is present and in some patients, mucous membrane ulcerations, skin ulcers, nodules, or molluscum - like papules. progressive dh is treated beginning with lipid formulation amphotericin b (3 - 5 mg/ kg / d) or amphotericin b (0.7 - 1.0 mg / kg / d for 1 - 2 wk), then itraconazole (200 mg twice daily for 12 mo). in india, histoplasmosis seems to be prevalent in the gangetic delta. panja and sen reported the first case of dh from calcutta in 1954. among the forms of histoplasmosis reported from india, numerous case series have reported histoplasmosis from all over india, the largest series being from delhi, a compilation of 37 patients from all over india. since clinical and laboratory features have considerable overlap, it is important to consider fungal infections while dealing with disseminated granulomatous infections although patient is immunocompetent. | disseminated histoplasmosis is a relentlessly progressive granulomatous disease which can mimic many other granulomatous diseases including tuberculosis. a 48-year - old male was referred to us with 11 months history of multiple subcutaneous swellings and ulcerations over the upper and lower limbs and fever for 2 months. he was evaluated outside for several months and received anti tubercular drugs for about 2 years in the past for a granulomatous infection of bone and soft tissue identified by various biopsies, without any improvement. when he was evaluated and fresh biopsies were taken, they were stained for fungus and disseminated histoplasmosis was detected. this case confirms the importance of considering fungal infections as a possibility while treating disseminated granulomatous infections, even in immune - competent patients, especially if response to treatment is inadequate. |
benign prostatic hyperplasia (bph) is one of the most common causes of urinary obstruction, which occurs in 50% to 60% of men aged 60 years or older. because of the increasing aged population and advancements in diagnostic tools, the incidence and importance of bph transurethral resection of the prostate (turp) has been recognized as the standard treatment for bph. advancements in medical technology have resulted in the availability of a variety of laser therapies for the treatment of bph, and it will not be long before they replace turp as the standard treatment. in many studies, holmium : yttrium - aluminium - garnet (yag) laser enucleation of the prostate (holep) or greenlight laser photo selective vaporization (pvp) however, the ideal laser must have the effectiveness of the holmium : yag laser plus the handling and safety properties of the greenlight laser. the recently developed thulium : yag (tm : yag) laser has been found to be superior to the holmium : yag laser in spatial beam quality and tissue incision precision and because of its ability to operate in continuous - wave pulsed modes. another advantage of the thulium laser is that it is based on vaporesection, which allows it to resect small pieces of prostate tissue without morcellation. european and chinese groups have conducted many studies of tm : yag laser prostate surgery [8 - 12 ]. two comparative studies of tm : yag laser vaporesection of the prostate (thuvarp) and monopolar turp have been conducted, but no comparison of thuvarp with bipolar turp has been conducted. in korea, no study of tm : yag laser prostate surgery has been undertaken. in this study, we assessed the effectiveness and safety of thuvarp in comparison with those of bipolar turp. this study was conducted in 86 patients who underwent operations to treat bph at daegu fatima hospital between january 2010 and december 2012 ; the patients ' medical records were retrospectively analyzed. the subjects were limited to patients who satisfied the following conditions : a maximal urine flow rate (qmax) of less than 15 ml / s or acute repeated urinary retention and an international prostate symptom score (ipss) greater than 7. this study excluded patients aged 85 or older, whose prostate weighted 100 g or more (on transrectal ultrasonography [trus ]), whose bph was accompanied by neurogenic bladder, or who had a history of prostate, bladder neck, or urethral surgery. of the 86 patients, 43 underwent thuvarp and the remaining 43 underwent bipolar turp. before surgery, the participants underwent a medical history, a physical examination, a digital rectal examination, routine laboratory tests, ipss determination, trus, prostate - specific antigen (psa) measurement, and uroflowmetry with postvoid residual volume (pvr) measurement. ipss, trus, psa, and uroflowmetry with pvr were reassessed 1 month after surgery for comparison with the preoperative data. for patients whose psa values were 4 or greater or who had any other risk factor (e.g., nodule on the digital rectal examination or hypoechoic lesion on trus), a prostate biopsy sample was collected before surgery to rule out cancer. all operations were performed while patients were in the lithotomy position, most of whom were under spinal anesthesia. thuvarp was performed with a 70-w continuous - wave tm : yag laser (revolix, lisa laser products ohg, katlenburg - lindau, germany) and a 26-french continuous flow resectoscope (richard wolf medical instruments, vernon hills, il, usa). a tm : yag laser was delivered through a 550-m end - firing rigifib - su fiber. at the beginning of the operation, an inverted u - shape incision distal to the resection border was made around the verumontanum. after an additional linear incision was made at 5 and 7 o'clock, the median lobe was vaporesected. then, both lateral lobes were also vaporesected until the prostate capsule was identified. during vaporesection, it was important that the prostate tissue was cut into pieces small enough to pass through the resectoscope. bipolar turp was performed in the traditional manner with the use of a bipolar electrical current generator and a wire loop (gyrus medical gmbh, tuttligen, germany) and a 24-french resectoscope (karl storz endoscope, tuttlingen, germany). after surgery, a 20-french three - way silicone urethral catheter was placed in all patients to maintain continuous saline irrigation until the resolution of hematuria an analytical between - group comparison was made of operation time, volume of resected tissue, remaining volume of the prostate (%), postoperative hemoglobin level, period of urethral catheterization (the catheter was removed when hematuria could not be visually observed anymore), days of hospitalization, and preoperative and postoperative data (collected 1 month after surgery) on ipss, trus, serum psa level, uroflowmetry with pvr, and, by extension, perioperative complications such as bleeding (required blood transfusion), temporary urinary retention (treated with recatheterization), urinary irritative symptoms such as dysuria, and temporary incontinence. in this study, the unpaired student t - test, the paired student t - test, and the chi - square test the unpaired student t - test was used to verify the homogeneity and difference of continuous variables, the paired student t - test was used to verify postoperative changes, and the chi - square test was used to verify the difference between groups in postoperative complications. this study was conducted in 86 patients who underwent operations to treat bph at daegu fatima hospital between january 2010 and december 2012 ; the patients ' medical records were retrospectively analyzed. the subjects were limited to patients who satisfied the following conditions : a maximal urine flow rate (qmax) of less than 15 ml / s or acute repeated urinary retention and an international prostate symptom score (ipss) greater than 7. this study excluded patients aged 85 or older, whose prostate weighted 100 g or more (on transrectal ultrasonography [trus ]), whose bph was accompanied by neurogenic bladder, or who had a history of prostate, bladder neck, or urethral surgery. of the 86 patients, 43 underwent thuvarp and the remaining 43 underwent bipolar turp. before surgery, the participants underwent a medical history, a physical examination, a digital rectal examination, routine laboratory tests, ipss determination, trus, prostate - specific antigen (psa) measurement, and uroflowmetry with postvoid residual volume (pvr) measurement. ipss, trus, psa, and uroflowmetry with pvr were reassessed 1 month after surgery for comparison with the preoperative data. for patients whose psa values were 4 or greater or who had any other risk factor (e.g., nodule on the digital rectal examination or hypoechoic lesion on trus), a prostate biopsy sample was collected before surgery to rule out cancer. all operations were performed while patients were in the lithotomy position, most of whom were under spinal anesthesia. thuvarp was performed with a 70-w continuous - wave tm : yag laser (revolix, lisa laser products ohg, katlenburg - lindau, germany) and a 26-french continuous flow resectoscope (richard wolf medical instruments, vernon hills, il, usa). a tm : yag laser was delivered through a 550-m end - firing rigifib - su fiber. at the beginning of the operation, an inverted u - shape incision distal to the resection border was made around the verumontanum. after an additional linear incision was made at 5 and 7 o'clock, the median lobe was vaporesected. then, both lateral lobes were also vaporesected until the prostate capsule was identified. during vaporesection, it was important that the prostate tissue was cut into pieces small enough to pass through the resectoscope. bipolar turp was performed in the traditional manner with the use of a bipolar electrical current generator and a wire loop (gyrus medical gmbh, tuttligen, germany) and a 24-french resectoscope (karl storz endoscope, tuttlingen, germany). after surgery, a 20-french three - way silicone urethral catheter was placed in all patients to maintain continuous saline irrigation until the resolution of hematuria. an analytical between - group comparison was made of operation time, volume of resected tissue, remaining volume of the prostate (%), postoperative hemoglobin level, period of urethral catheterization (the catheter was removed when hematuria could not be visually observed anymore), days of hospitalization, and preoperative and postoperative data (collected 1 month after surgery) on ipss, trus, serum psa level, uroflowmetry with pvr, and, by extension, perioperative complications such as bleeding (required blood transfusion), temporary urinary retention (treated with recatheterization), urinary irritative symptoms such as dysuria, and temporary incontinence. in this study, the unpaired student t - test, the paired student t - test, and the chi - square test were applied to the verification of findings. the unpaired student t - test was used to verify the homogeneity and difference of continuous variables, the paired student t - test was used to verify postoperative changes, and the chi - square test was used to verify the difference between groups in postoperative complications. all 86 patients underwent surgical treatment for symptomatic bph, and each of the two groups included 43 patients. prostate volume was somewhat greater in the thuvarp than in the turp group, but the difference was not significant. the mean operation time was significantly longer in the thuvarp group than in the turp group (113.644.4 minutes compared with 76.732.0 minutes, p 50 g) (fig. the changes in all parameters were significant 1 month after surgery. in the thuvarp group, ipss declined by 57.2%, the psa level fell by 82.7%, trus volume decreased by 66.7%, qmax increased by 102.0%, and pvr decreased by 64.2% (table 3). in the turp group, ipss declined by 51.6%, the psa level fell by 65.2%, trus volume decreased by 60.9%, qmax increased by 51.2%, and the pvr decreased by 51.7% (table 4). in the intergroup analysis, no significant differences between the thuvarp and turp groups, respectively, were found for the changes in ipss (15.49.8 compared with 13.24.7, p=0.357), trus volume (37.216.2 ml compared with 31.115.3 ml, p=0.387), and the pvr (85.4109.4 ml compared with 65.458.9 ml, p=0.414). the decrease in psa was greater in the thuvarp group than in the turp group (4.33.6 ng / dl compared with 2.01.3 ng / dl, p=0.045). the increase in qmax was also much greater (8.96.3 ml / s compared with 4.12.9 ml / s, p<0.001) in the thuvarp group (table 5). postoperative complications were checked for, such as bleeding requiring transfusion, temporary urinary retention, urinary irritative symptoms such as dysuria, and temporary incontinence. blood transfusions were given to one patient (2.3%) and two patients (4.7%) in the thuvarp and turp groups, respectively. temporary urinary retention occurred in six patients (14.0%) and nine patients (20.9%), respectively. dysuria occurred in seven patients (16.3%) and three patients (7.0%) without significant intergroup differences. there was no febrile urinary tract infection and no culture - positive urinary tract infection, respectively. temporary incontinence occurred in nine patients (20.9% ; stress urinary incontinence in five patients, urge incontinence in three patients, and mixed incontinence in one patient) and two patients (4.7% ; stress urinary incontinence in all cases), and the intergroup differences were significant ; however, this condition changed for the better 4 weeks afterward (table 6). currently, a variety of laser therapies are available for prostate surgery to treat bph and have good results ; thus, they are expected to replace turp (the standard prostate surgery technique for bph) before long. there have been many studies of pvp and holep, which are widely recognized as substitutes for turp or open prostatectomy. both of these procedures have had good results, even in high - risk patients or patients with large prostatic adenomas [14 - 16 ]. in particular, holep is drawing attention as an alternative treatment for bladder outlet obstruction. according to previous studies, holep enables the endoscopic removal of prostatic adenoma regardless of its size and is as effective as open prostatectomy ; moreover, it can decrease the severity of complications. despite good clinical results, both of these procedures have limitations. for holep, the steep learning curve and longer operation time seem to be the major drawbacks and limit its widespread clinical application. for pvp, no tissue specimen is provided for histologic evaluation, and the speed of tissue ablation is significantly slower. the recently developed tm : yag laser works with a wavelength of 2013 nm, which can be easily absorbed into water, especially interstitial water. its waves are more continuous than those of other lasers and therefore provide more effective hemostasis. in addition, it provides accurate resection with sufficient vaporization, and the moving laser probe maximizes vaporization but reduces the heat applied to tissue. in 2005, xia they performed tm : yag laser resection with the prostate - tangerine technique on 30 patients and reported its safety and efficacy. bach. reported 1-y follow - up data on thuvarp, which showed a significant improvement in voiding symptoms and patients ' quality of life. thus far, two studies have compared the efficacy and safety of thuvarp and monopolar turp. compared the results of a prospective nonrandomized trial with 1-year follow - up between 58 patients who underwent thuvarp and 42 patients who underwent monopolar turp. they concluded that thuvarp had favorable perioperative safety, had the same therapeutic effect as turp, and had the advantage of significantly less blood loss, shorter length of hospital stay, and shorter catheter indwelling time compared with monopolar turp. xia. performed a prospective randomized trial comparing 52 patients who underwent thuvarp with 48 patients who underwent monopolar turp. they reported that thuvarp was significantly superior to turp in terms of catheterization time, length of hospital stay, and decrease in hemoglobin, although it required an equivalent time to perform. in their report, thuvarp was as efficacious as turp after 1 year of follow - up. in the current study, thuvarp was associated with a shorter catheterization time and a shorter hospital stay compared with turp. however, unlike the two abovementioned studies, the improvement in qmax was much greater. we thought that this might have resulted from the greater resection volume with prostate adenoma. although the resection volume of prostate tissue was smaller with thuvarp than with turp, the decrease in trus volume was much greater than that with turp. also, the reduction in psa value, which might be a proxy indicator of prostate tissue removal, is much greater with thuvarp. the results for thuvarp were equivalent or superior to those for turp in the short term. however, the operation time was longer with thuvarp than with turp, for two possible reasons. first, turp has been the standard surgery used to treat bph, and surgeons have become experienced with this procedure. in contrast, thuvarp is a newer procedure and, although the technique is similar to that of turp and is easy to learn, surgeons need to overcome the learning curve. second, as the prostate volume increased, the operation time increased much more than the increase in prostate volume. postoperative complications such as bleeding requiring transfusion, temporary urinary retention, and dysuria were not significantly different between the treatment groups. however, temporary incontinence occurred more frequently in the thuvarp group (nine patients) than in the turp group (two patients), possibly because of technical problems associated with the manipulation of the resectoscope and laser fiber around the external urethral sphincter area, because two previous comparative studies reported no difference in temporary incontinence. thuvarp met functional outcome and safety expectations ; however, it did not meet efficacy expectations in patients with a large prostate because of the prolonged operation time in this group. this could be interpreted as a potential disadvantage of tm : yag laser prostatectomy compared with the previously introduced holep. bach. introduced the technique of tm : yag laser vapoenucleation of the prostate (thuvep) to identify the efficacy of tm : yag laser prostatectomy in patients with a larger prostate. published a modified thuvep technique, i.e., blunt enucleation of prostate adenoma with laser support. they called this technique tm : yag laser enucleation of the prostate (thulep). as the number of institutes equipped with tm : yag lasers has increased, more studies of tm : yag laser surgery for bph have been investigated. the results are promising, but more long - term data and well - designed comparative studies with turp and other laser technique are needed. the limitations of this study were its nonrandomized design and its short follow - up period. more cases and long - term data are needed to clarify the usefulness of thuvarp. we believe that thuvarp is a promising technique for the effective surgical management of bph. thuvarp, a new laser therapy, has shown results equivalent or superior to those of turp in terms of effectiveness and safety. although further well - designed comparative studies and long - term data are needed, we suggest that thuvarp can be an alternative to turp for the surgical management of bph. | purposein recent years, laser surgery has been widely used to treat benign prostatic hyperplasia (bph). a thulium : yttrium - aluminium - garnet (tm : yag) laser was recently introduced for bph surgery. we compared the effectiveness and safety of tm : yag laser vaporesection of the prostate (thuvarp) with that of bipolar transurethral resection of the prostate (turp).materials and methodsfrom january 2010 to december 2012, 86 patients underwent surgical treatment for symptomatic bph by a single surgeon. we retrospectively analyzed and compared the medical records of 43 patients who underwent thuvarp and 43 patients who underwent bipolar turp. all patients were assessed by using the international prostate symptom score, transrectal ultrasonography, the serum prostate - specific antigen (psa) level, uroflowmetry, and postvoid residual volume before and 1 month after surgery. all complications were compared between the two groups.resultsthuvarp was superior to turp in catheterization time (p 50 g), operation time was much longer with thuvarp. one month after surgery, the decrease in psa was greater (p=0.045) with thuvarp than with turp, and the increase in maximal urine flow rate was greater (p<0.001) with thuvarp than with turp. the postoperative complication transient urinary incontinence was significantly different between the thuvarp group (nine cases, 20.9%) and the turp group (two cases, 4.7%). other complications were comparable between groups.conclusionsthe effectiveness and safety of thuvarp and turp were comparable. thuvarp is a promising alternative surgical technique to turp for bph. |
refractive surgeries utilizing excimer laser technology are widely used to alter corneal curvature and correct vision.1 photorefractive keratectomy (prk) and laser - assisted in situ keratomileusis (lasik), in particular, have a long track record of safety and efficacy. they have each been performed for more than 20 years and have different advantages and disadvantages. surface ablation methods such as prk allow for greater preservation of residual posterior stromal tissue and avoid complications related to flap creation and healing. prk may also have a lower risk of keratectasia.2,3 however, compared with lasik, prk typically has a lengthier and less comfortable recovery process.1,4 corneal haze formation and infectious keratitis are other possible complications of prk that can potentially be vision - threatening.510 topical ophthalmic corticosteroids are often utilized for the management of prk and lasik patients to minimize postoperative pain and inflammation.1 in prk, ophthalmic corticosteroids may have an added benefit of minimizing haze formation, a phenomenon that has been demonstrated in clinical studies,11,12 although there exist contrary data suggesting no significant benefit in this regard.13,14 despite the postoperative benefits of ophthalmic corticosteroids, potential risks associated with their use include intraocular pressure (iop) elevation, formation of cataracts, infection, and delayed corneal epithelial healing.15 loteprednol etabonate (le) is a c-20 ester corticosteroid designed at a molecular level to have an improved therapeutic index over traditional corticosteroids. due to the replacement of the c-20 ketone group present in all other corticosteroids with a chloromethyl ester group, le molecules that are not bound to glucocorticoid receptors are quickly de - esterified into inactive metabolites, reducing the potential for unwanted side effects.1618 the safety and efficacy of le suspension and ointment formulations have been studied in patients undergoing ocular procedures including cataract surgery,1921 lasik,2225 and prk.26,27 these and other investigations have confirmed a minimal risk of iop elevation in patients treated with le, including individuals who are known steroid responders.28,29 a non - settling gel formulation of le became available in 2013, which provides consistent, uniform dosing while eliminating the need for shaking prior to administration.30 the gel formulation is thought to provide increased contact time with the ocular surface.30 in addition, the gel formulation has a ph more similar to that of human tears and a 70% lower preservative concentration than the suspension formulation.30 the safety and efficacy of le ophthalmic gel 0.5% (le gel) were evaluated in two phase iii randomized vehicle - controlled clinical trials in subjects with postoperative pain and inflammation following cataract surgery.31,32 in these studies, only 0.5% of subjects experienced transient, clinically significant iop elevations (10 mmhg) over baseline during the 2-week treatment period. while le gel is approved for the treatment of inflammation and pain following ocular surgery, there have been no published studies evaluating the safety of this new formulation in patients undergoing either lasik or prk. the purpose of this retrospective study was to assess prescribing behaviors and safety outcomes associated with the use of le gel for these procedures. retrospective data were collected on eligible patients at each study site, reflecting the routine care and follow - up of patients who were prescribed le gel 0.5% in association with lasik or prk surgery. the study protocol was approved by the chesapeake institutional review board (columbia, md, usa), which granted a waiver for informed consent given the retrospective nature of the data collection. all subject data were de - identified and kept confidential in accordance with the international conference on harmonization guidelines for good clinical practice.33 patients aged 18 years or older who had undergone lasik or prk surgery prior to march, 2014, and whose perioperative management included le gel were eligible for inclusion. the surgical procedure must have been the primary surgery, not an enhancement or reoperation. the eligibility cutoff date ensured a minimum time interval of 6 months between surgery and data collection. reasons for exclusion included use of le gel for surgical procedures other than lasik or prk, and use of ocular steroids other than le gel for the current lasik / prk procedure. charts of all cases meeting eligibility criteria were identified by personnel at each study site. information was hand - recorded onto case report forms on - site and then entered electronically into a centralized database. data extracted from the medical charts included the following : patient demographics ; surgical details ; le gel dosing, frequency, and duration ; pre- and postsurgical ocular characteristics including sphere, cylinder, axis, and uncorrected visual acuity (ucva) ; pre- and postsurgical iop measurements ; concomitant medications ; adverse events (aes) ; and early discontinuations. the primary outcomes evaluated included iop change from baseline, other aes, any abnormal corneal findings, and early treatment discontinuations. iop findings were evaluated as pre- and postoperative means for the lasik and prk groups, separately. a one - way analysis of variance (anova) was used to evaluate any changes in mean iop by postoperative period (030, 3160, 6190, and > 90 days). the anova was performed using statistix 10 (analytical software, tallahassee, fl, usa), and a p - value 90 days). the anova was performed using statistix 10 (analytical software, tallahassee, fl, usa), and a p - value 90 days (noted during a separate course of le gel for dry eye approximately 6 months post - lasik ; see footnote in table 4). in contrast, among prk eyes, iop elevations of 5 mmhg occurred in 12 (11.5%) eyes within the first postoperative month, 12 (16.7%) eyes during the second postoperative month, six (11.1%) eyes with follow - up during the third postoperative month, and two (3.3%) eyes with follow - up extending longer than 90 days. preoperative application of le gel was noted in ten (5.3%) lasik eyes and 24 (11.5%) prk eyes. administration of le gel in postoperative recovery and throughout the balance of the day of surgery was more commonly reported with lasik than prk (table 3). there were no instances noted of le gel being applied intraoperatively to the stromal bed or directly to the flap following closure during lasik procedures, or before or immediately following placement of a bandage contact lens in prk procedures. during the first postoperative week, le gel was prescribed most frequently as one drop qid (four times daily), regardless of type of surgery (figure 1). the most common duration of postoperative le gel therapy was 714 days for lasik cases and 30 days or longer in prk cases (figure 2). duration of le gel therapy was 60 days or shorter in all lasik cases. among prk cases, more than one - third (34.9%) of eyes were treated with le gel longer than 60 days, and 26.9% of eyes were treated with le gel for more than 90 days. standard operating procedures at each study site typically dictated a tapering of le gel dosing frequency beyond the first week of treatment. postoperatively, the most frequently reported concomitant antibacterials in the lasik group were moxifloxacin 0.5% (53.1% of patients) and besifloxacin 0.6% (39.6%), and in the prk group, moxifloxacin 0.5% (56.5%) and gatifloxacin 0.5% (31.5%). the most common non - corticosteroid anti - inflammatory agents used postoperatively were cyclosporine a 0.05% (42.7%) post - lasik and bromfenac 0.09% or 0.07% (36.1%) post - prk. mean (sd) postoperative sphere and cylinder were 0.04 (0.49) and 0.28 (0.45) diopters in lasik eyes and 0.09 (0.77) and 0.50 (0.45) diopters in prk eyes. there were no reports of abnormal corneal morphology, corneal edema, wound healing / integrity, infection, or reports of corneal infiltrates or any unexpected findings noted in the charts including flap dislocation (lasik). among prk cases, corneal haze was noted in 40 (19.1%) eyes in 22 (20%) patients postoperatively. these were all characterized as mild or trace (or simply recorded as yes) with the following exceptions (three eyes in two patients) : corneal haze was characterized as severe in both eyes of a 21-year - old female patient treated with le gel, one drop qid, and which led to le gel treatment discontinuation. briefly, the procedure involved chemical alcohol epithelial removal with a resulting epithelial wound size of 8.5 mm. no haze was reported for this patient on postoperative day 4 when the bandage contact lens (bcl) was removed. however, trace corneal haze was reported in both eyes on postoperative day 13, progressing to moderate corneal haze on day 48, and severe corneal haze on day 83 and day 118. on the day 118 visit, therapy was switched from le gel to prednisolone 1% one drop qid. the haze failed to resolve and additional treatment was planned including topical mitomycin c. the second case, also performed using chemical alcohol epithelial removal, occurred in a 32-year - old male patient treated postoperatively with le gel, one drop qid, who was first noted to have trace corneal haze in one eye on postoperative day 20 and moderate corneal haze on day 41. topical steroid therapy was switched to difluprednate, but no further follow - up was available. both these patients (as well as all other prk cases) were treated with mitomycin c during the primary keratorefractive procedure. no other patients were noted to have stopped le gel prematurely or switched to a different topical corticosteroid. figure 3 shows the mean (sd) preoperative and postoperative iop over time in lasik and prk eyes. postoperative iop measurements ranged from 9 to 21 mmhg in lasik eyes and from 7 to 29 mmhg in prk eyes. postoperative mean iop did not increase over time in either lasik eyes (f=1.17, p=0.3311) or prk eyes (f=0.98, p=0.407). as indicated earlier, lasik patients received postoperative le gel therapy most often for 714 days, whereas prk patients received postoperative le gel therapy most often for 3160 days. mean (sd) iop over these time frames was 14.68 (2.28) mmhg and 15.60 (2.91) mmhg for lasik and prk patients, respectively, ranging from 9 to 21 mmhg in lasik eyes and 10 to 23 mmhg in prk eyes. clinically significant elevations from baseline in iop (10 mmhg) were noted in only two patients (three eyes), both in the prk group. a 28-year - old male patient (baseline iops, 17 and 19 mmhg) had an iop measurement of 29 mmhg in both eyes on postoperative day 18 while using le gel one drop qid. le gel dosage was decreased to one drop bid, and iop measured 3 days later was 18 mmhg in both eyes, and 19 mmhg in both eyes after another 14 days. a 20-year - old female prk patient (baseline iops, 14 mmhg od, 13 mmhg os) was prescribed le gel one drop qid. less significant / marked iop elevations 5 mmhg were noted in one (0.6%) lasik eye in the first postoperative month and one (4.2%) lasik eye with follow - up > 90 days (noted during a separate course of le gel for dry eye approximately 6 months post - lasik ; see footnote in table 4). in contrast, among prk eyes, iop elevations of 5 mmhg occurred in 12 (11.5%) eyes within the first postoperative month, 12 (16.7%) eyes during the second postoperative month, six (11.1%) eyes with follow - up during the third postoperative month, and two (3.3%) eyes with follow - up extending longer than 90 days. the data gathered in this review of real - world use of le gel in nearly 400 post - lasik and post - prk eyes indicate a high level of safety with this topical corticosteroid in both surgical procedures. there were no unexpected findings, and no patient was noted to have discontinued therapy prematurely with the exception of two prk patients with corneal haze who both discontinued le gel and were switched, one to prednisolone with no significant reduction in haze, and the other to difluprednate with no further follow - up available. consistent with numerous prior studies with le gel and other le 0.5% formulations,1927,31 clinically significant iop elevations (10 mmhg) were rare in this chart review and noted in only two (0.5%) patients (three eyes). in one patient for which sufficient follow - up information was available, reduction in le gel administration frequency corresponded with a return of iop to baseline levels. as might be expected, smaller iop elevations (5 mmhg) were more frequent, and most often observed in prk eyes, but still only noted in a small percentage of eyes overall. notably, in prk patients, considered at greater risk of iop elevation, there were no elevations 10 mmhg reported for any eyes treated with le gel beyond 60 days. in addition, mean postoperative iop did not demonstrate any increase over the follow - up time frame which exceeded 60 days in a little more than one - third and 90 days in a little more than one - fourth of prk eyes. preoperatively, le gel was administered in a small number of lasik and prk cases, and there were no instances of intraoperative administration. ocular corticosteroids are recommended postoperatively for a short - time post - lasik and for periods ranging from weeks to months following prk.1 in this study, almost all lasik patients and nearly half of prk patients began using postoperative le gel on the same day as the surgery following completion of the procedure. the most common duration of le gel treatment following lasik was 714 days, with slightly less than 20% treated more than 30 days postoperatively. in contrast, 80% of prk eyes were treated with le gel for more than 30 days postoperatively, with slightly more than one - third treated for more than 60 days, and slightly more than one - fourth treated for more than 90 days. it should be noted that treatment duration was sometimes difficult to establish from patient charts. in some instances, standing orders were evident in the patient charts, outlining the planned course of treatment including le gel dosing and planned duration, but there was no further documentation of le gel usage within follow - up visit notes. in the absence of specific mention of treatment discontinuation, length of therapy was assumed to be according to respective site protocol. topical corticosteroids are highly valued in ophthalmology for their potent anti - inflammatory activity and utility in preventing certain postoperative complications, and have become a routine component of postsurgical management. however, corticosteroid class side effects such as iop elevation, cataract formation, and delayed healing can complicate therapy and warrant a careful approach and vigilant follow - up when corticosteroids are administered directly onto the eye. the mechanism of corticosteroid - induced iop elevation is theorized to involve glucocorticoid receptor - mediated changes in regulation of myocilin gene expression with a resulting decrease in outflow of aqueous humor secondary to changes in the trabecular meshwork.34 le has the ability to bind to the glucocorticoid receptor with greater affinity than dexamethasone and elicits potent and efficacious anti - inflammatory activity.17,18 however, due to the replacement of the c-20 ketone with a chloromethyl ester, unbound le is rapidly metabolized into inactive metabolites thus limiting the potential to mediate unwanted side effects. in fact, clinical studies to date of this unique c-20 ester corticosteroid have reported consistently low rates of iop elevation, comparable to vehicle and lower in comparison with other topical corticosteroids,33 including dexamethasone,25,27,3537 prednisolone,20,28,29,38,39 and fluoromethalone.23,24,40 the iop findings from this chart review specific to the use of le gel in refractive surgery extend the available safety data for le gel beyond the postcataract surgery setting, and are consistent with findings from studies evaluating other le formulations in refractive surgery. thus, zhang recently described a chart review of 1,552 eyes that underwent excimer laser corneal refractive surgery managed postoperatively with le suspension for 4 weeks (tapered regimen). elevations in iop, defined in this study as any increase in iop over baseline (low reaction, 515 mmhg increase ; and strong reaction, 25 mmhg or > 10 mmhg over baseline, in three (1.1%) fml eyes and four (1.3%) le eyes over the 3 months follow - up. mean iop and/or elevations in iop were also minimal in three prospective, comparative clinical trials of le suspension for control of inflammation and pain following refractive surgery : li reported mean iop was reduced from preoperative iop in 160 eyes treated with le suspension or fml following lasik surgery and significantly lower in the le - treated eyes compared with the fml - treated eyes (p<0.05). gao reported fewer iop elevations in post - lasek surgery eyes treated with le vs those treated with fml (1.5% vs 6% ; p<0.05). patients (n=400) in that study received 1-week treatment with dexamethasone 0.1%/tobramycin 0.03% (dexamethasone / t) and fibroblast growth factor eye drops prior to being switched to either le suspension or fml. finally, wu compared the efficacy of 1-week treatment with le that of dexamethasone / t in controlling postoperative inflammation in 224 post - lasik eyes. an increase in mean iop was noted at 1 week for dexamethasone / t - treated subjects compared with baseline (p<0.05) but not for le - treated subjects. the newer gel formulation of le offers some benefits relative to the ointment and suspension formulations. the gel formulation has 70% less benzalkonium chloride preservative and a more physiologic ph when compared with the suspension formulation. le suspension requires vigorous shaking prior to administration in order to ensure uniform distribution of drug and consistent dosing. le gel is a non - settling formulation that requires no shaking prior to administration. the vehicle behaves as a semisolid gel at rest, but shear - thins to a liquid when the bottle is squeezed, allowing it to flow and easily express as a drop. upon mixing with tear fluid on the ocular surface, the vehicle converts to a liquid.30 this avoids one of the major drawbacks of the ointment formulation, namely blurred vision. however, the le gel formulation is thought to provide prolonged corneal and conjunctival contact time relative to the suspension formulation30 warranting continued vigilance with regard to potential safety ramifications, particularly with long - term use. our study in post - prk and post - lasik patients included a sizable number of prk eyes treated with le gel for periods exceeding 60 and 90 days with little apparent effect on iop. the two cases of iop increase 10 mmhg were noted at days 18 and 41, respectively, with higher frequency of use, and the iop elevation returned to baseline with decreased frequency of administration in the case where follow - up information was available. advancements in prk equipment and technique such as higher - quality lasers, small flying - spot delivery systems, and larger ablation zones may help reduce the incidence of corneal haze, nonetheless it still remains a risk, particularly in cases with high myopia.4144 the frequency of corneal haze following prk in this study was low ; 19.1% of prk eyes were noted to have any instance of corneal haze, and only 1.4% of prk eyes developed haze that was classified as moderate / severe. while this study was not designed to evaluate efficacy and corneal abnormalities were gathered as safety findings, the low rate of corneal haze observed in this population may be an indication of clinical benefit of le gel in that regard as well. while there was no control group in our analysis to provide perspective, the frequency of haze reported was very similar to findings reported in the chart review study by mifflin comparing the suspension formulation of le and fml in prk patients. the percentage of eyes in that study with any incidence of haze ranged from approximately 18% to 27% during the first 2 months of follow - up. visual outcomes in the two treatment groups were excellent, with a small, but statistically significant difference in favor of le for mean uncorrected distance visual acuity at 6 months (p=0.013). the main limitations of this study are the lack of a control group and the real - world, retrospective nature of the data collection, the latter of which contributed unavoidable consequences of missing data, most notably with regard to iop follow - ups and details regarding the duration of le gel treatment in some cases. likewise, data gathering was limited primarily to objective findings such as iop measurements and surgical outcomes ; it was not possible to evaluate more subjective variables such as pain relief or patient satisfaction. the primary goal of this chart review was to characterize patterns of le gel use in refractive surgery and assess the overall safety in these settings. collection of safety data in this study, as in any retrospective chart review, was limited to information previously recorded during routine patient follow - up visits. as a result, it is possible that minor complaints may not have been noted, and patients may not have been questioned about certain aes. however, it is presumed that any such events of clinical significance would have been recorded. finally, applanation tonometry was used to determine pre- and postrefractive iop at all five clinical sites participating in this retrospective chart review. iop measures were not corrected to account for the decreased central corneal thickness (cct) either in the patient charts or in the analysis of cumulative iop data from all five sites. applanation tonometry is based on the assumption that eyes have a uniform shape and cct, and may therefore underestimate the real iop in postrefractive eyes, particularly in postoperative eyes of moderate and highly myopic patients where changes in cct are known to be greater. however, to date, no accepted iop - adjustment formulas have been established specifically for applanation tonometry in postkeratorefractive eyes to account for the change in cct. while dynamic contour tonometry has been suggested to be more accurate for iop measurements in postrefractive surgery eyes,45,46 it is not widely available. as a precaution, we recommend any postkeratorefractive surgery patient with iop increases of 5 mmhg as measured with applanation tonometry be followed more closely, especially in patients with greater depths of laser ablation. despite the limitation of applanation tonometry, it is noteworthy that in the current chart review, there was only a relatively small percentage of patients with iop elevations 5 mmhg. based on the real - world experience captured in this chart review, le gel appears to have a high level of safety and tolerability when used for the management of postoperative pain and inflammation following lasik and prk surgery. aes were few and not unexpected given the nature of refractive surgery cases, and there were no unusual corneal findings or healing abnormalities. the only meaningful safety - related findings included two prk eyes with moderate / severe corneal haze and three prk eyes of two patients with a clinically significant iop elevation. these data corroborate a growing body of research suggesting that le, in gel, suspension, and ointment formulation and in a variety of ocular surgical settings, provides the clinical benefits desired from a topical corticosteroid, and with an optimized safety profile. | backgroundwhile loteprednol etabonate ophthalmic gel 0.5% (le gel) is approved for treatment of postoperative ocular inflammation and pain, there have been no reported studies in patients undergoing laser - assisted in situ keratomileusis (lasik) or photorefractive keratectomy (prk).methodsthis was a retrospective chart review conducted at five refractive surgical centers in the usa. data were collected from primary lasik or prk surgery cases in which le gel was used postoperatively as the clinician s routine standard of care and in which patients were followed - up for up to 6 months. data extracted from charts included patient demographics, surgical details, le gel dosing regimen, pre- and postsurgical refractive characteristics, intraocular pressure (iop) measurements, and visual acuity. primary outcomes included postoperative iop elevations, adverse events, and early discontinuations.resultsdata were collected on 189 lasik eyes (96 patients) and 209 prk eyes (108 patients). mean (standard deviation [sd ]) years of age at surgery was 36.0 (11.7) and 33.9 (11.3) in lasik and prk patients. le gel was prescribed most often four times daily during the first postoperative week, regardless of procedure ; the most common treatment duration was 714 days in lasik and 30 days in prk patients. no unusual corneal findings or healing abnormalities were reported. mean postoperative uncorrected distance visual acuity was 20/24 in lasik and 20/30 in prk eyes. mild / trace corneal haze was reported in 20% of prk patients ; two prk patients with moderate / severe corneal haze were switched to another corticosteroid. mean postoperative iop did not increase over time in either lasik or prk eyes (p0.331) ; clinically significant elevations from baseline in iop (10 mmhg) were noted in only three eyes of two prk patients.conclusionle gel appears to have a high level of safety and tolerability when used for the management of postoperative pain and inflammation following lasik and prk surgery. |
entropy, traditionally denoted by s, is defined as a state quantity in thermodynamics such that the infinitesimal change in entropy ds of a system during a reversible process is equal to the infinitesimal heat transfer dq divided by the kelvin temperature t : once entropy is treated in terms of the statistical behavior of molecules, the abstract concept of entropy becomes clear. the statistical definition of entropy states that entropy is proportional to the natural logarithm of multiplicity w for the given configuration of a system : where kb is boltzmann s constant (1.3810 j / k). w is also referred to as the number of microstates and thermodynamic probability. because the degree of disorderliness for a specific configuration of objects is generally related to the number of accessible arrangements that yield the identical configuration, entropy is often regarded as a measure of disorderliness. we borrowed the statistical definition of entropy kblnw to quantify the amount of histologic disorderliness in the arrangement of tumor cells. during the process of quantification first, tumor cells in tissue sections do not possess thermodynamic properties such as temperature, heat and pressure. second, entropy depends heavily on the number of objects involved. for the newly defined quantity to be a useful parameter independent of the number of tumor cells, the quantity must be normalized with respect to some reference value. additionally, it will be desirable for the measurements to be properly spaced from one another. to achieve these goals, we divide kblnw by kblnweven and take the ratio to the power of, defining the novel disorderliness score as follows : where is a contrast factor and weven is the multiplicity when the tumor cells of a given histologic architecture are redistributed evenly throughout the tissue section. thus defined, the disorderliness scores range from 0 to 1, with 1 being the state of complete disorderliness. to obtain the actual value of multiplicity w in the disorderliness score formula, we subdivide a tissue section into equal unit grids with an ab grid. in this setting, w is equal to the number of ways that n distinguishable tumor cells can be placed in ab distinguishable unit grids such that the i - th unit grid holds ni tumor cells : where i runs from 1 to ab. the numbering i is entirely arbitrary, provided that all the unit grids are numbered without omission. for instance, the grids may be numbered row - wise from the upper left to the lower right corner. the maximum value of w is achieved when no single ni is larger than nj+1. the larger number f+1 and the smaller number f of a set of ni satisfy x(f+1)+yf = n and x+y = ab, where f is the greatest integer not exceeding n / ab, x is the number of unit grids with f+1 tumor cells and y is the number of unit grids with f tumor cells. solving the equations for x and y, we obtain x = n abf and y = ab(f+1)n. therefore, substituting w and weven into the definition of disorderliness score formula above, we obtain the final form : a total of 48 cases, including 16 each of well-, moderately, and poorly differentiated colorectal adenocarcinomas resected between january 2011 and february 2012, were retrieved randomly from the archives of the department of pathology at seoul st. forty - eight representative tissue images, one of each colorectal adenocarcinoma, were taken using a microscope - mounted optical camera with a resolution of 1,3601,024 pixels at a 400 magnification such that each single image was filled with a uniform histologic pattern. ten representative images of randomly chosen tissue sections of normal colorectal mucosa were also prepared using the same camera and microscope settings. the use of all samples was approved by the institutional review board of seoul st. four pathologists, blinded to the original diagnoses, independently assessed tumor differentiation for the 48 tissue images of colorectal adenocarcinoma using a 3-tiered grading system. the pathologists assessments of 14 well-, 13 moderately, and 14 poorly differentiated adenocarcinomas coincided, whereas there was disagreement on the classification of seven tissue sections, which were thereafter excluded from the study. finally, tumor differentiation was evaluated in 10 images of normal colorectal mucosa and 41 images of colorectal adenocarcinoma according to disorderliness score. automated counts of the numbers of cells in tissue images by image analysis software programs are unreliable. first, after opening each stored digital image using photoshop ver. 7.0 (adobe systems inc., mountain view, ca, usa), we marked each tumor cell with a 9-pixel - diameter black dot on a separate blank layer and saved the dotted layer with a filename different from that of the original tissue image. when counting the number of the dots and calculating a disorderliness score, we utilized the image analysis and computational capability of mathematica ver. the first three lines import a dotted image stored in a preferred directory of a computer and invert the image colors, producing white dots on a black background. the second group of command lines creates a matrix with a dimension equivalent to the image resolution, assigning the number 1 to the entries relevant to the coordinates of the centers of the dots and 0 to the rest of the entries. the matrix is then partitioned into submatrices by a 2015 grid, resulting in a total of 300 submatrices. the third command group takes the sum of the entries of each submatrix, which corresponds to ni, inputs those sums into the formula and returns a disorderliness score. here the normality of the data was explored using the shapiro - wilk test and the equality of variances was assessed using levene s test. one - way analysis of variance (anova) was used to evaluate differences in the means among the data groups. a two - sided p - value of less than.05 was considered to be statistically significant. entropy, traditionally denoted by s, is defined as a state quantity in thermodynamics such that the infinitesimal change in entropy ds of a system during a reversible process is equal to the infinitesimal heat transfer dq divided by the kelvin temperature t : once entropy is treated in terms of the statistical behavior of molecules, the abstract concept of entropy becomes clear. the statistical definition of entropy states that entropy is proportional to the natural logarithm of multiplicity w for the given configuration of a system : where kb is boltzmann s constant (1.3810 j / k). w is also referred to as the number of microstates and thermodynamic probability. because the degree of disorderliness for a specific configuration of objects is generally related to the number of accessible arrangements that yield the identical configuration, entropy is often regarded as a measure of disorderliness. we borrowed the statistical definition of entropy kblnw to quantify the amount of histologic disorderliness in the arrangement of tumor cells. during the process of quantification first, tumor cells in tissue sections do not possess thermodynamic properties such as temperature, heat and pressure. second, entropy depends heavily on the number of objects involved. for the newly defined quantity to be a useful parameter independent of the number of tumor cells, the quantity must be normalized with respect to some reference value additionally, it will be desirable for the measurements to be properly spaced from one another. to achieve these goals, we divide kblnw by kblnweven and take the ratio to the power of, defining the novel disorderliness score as follows : where is a contrast factor and weven is the multiplicity when the tumor cells of a given histologic architecture are redistributed evenly throughout the tissue section. thus defined, the disorderliness scores range from 0 to 1, with 1 being the state of complete disorderliness. to obtain the actual value of multiplicity w in the disorderliness score formula, we subdivide a tissue section into equal unit grids with an ab grid. in this setting, w is equal to the number of ways that n distinguishable tumor cells can be placed in ab distinguishable unit grids such that the i - th unit grid holds ni tumor cells : where i runs from 1 to ab. the numbering i is entirely arbitrary, provided that all the unit grids are numbered without omission. for instance, the grids may be numbered row - wise from the upper left to the lower right corner. the maximum value of w is achieved when no single ni is larger than nj+1. we define this configuration as an even distribution. for this configuration, the larger number f+1 and the smaller number f of a set of ni satisfy x(f+1)+yf = n and x+y = ab, where f is the greatest integer not exceeding n / ab, x is the number of unit grids with f+1 tumor cells and y is the number of unit grids with f tumor cells. solving the equations for x and y, we obtain x = n abf and y = ab(f+1)n. therefore, substituting w and weven into the definition of disorderliness score formula above, we obtain the final form : a total of 48 cases, including 16 each of well-, moderately, and poorly differentiated colorectal adenocarcinomas resected between january 2011 and february 2012, were retrieved randomly from the archives of the department of pathology at seoul st. forty - eight representative tissue images, one of each colorectal adenocarcinoma, were taken using a microscope - mounted optical camera with a resolution of 1,3601,024 pixels at a 400 magnification such that each single image was filled with a uniform histologic pattern. ten representative images of randomly chosen tissue sections of normal colorectal mucosa were also prepared using the same camera and microscope settings. the use of all samples was approved by the institutional review board of seoul st. four pathologists, blinded to the original diagnoses, independently assessed tumor differentiation for the 48 tissue images of colorectal adenocarcinoma using a 3-tiered grading system. the pathologists assessments of 14 well-, 13 moderately, and 14 poorly differentiated adenocarcinomas coincided, whereas there was disagreement on the classification of seven tissue sections, which were thereafter excluded from the study. finally, tumor differentiation was evaluated in 10 images of normal colorectal mucosa and 41 images of colorectal adenocarcinoma according to disorderliness score. automated counts of the numbers of cells in tissue images by image analysis software programs are unreliable. accordingly, we employed a semi - automated method. first, after opening each stored digital image using photoshop ver., mountain view, ca, usa), we marked each tumor cell with a 9-pixel - diameter black dot on a separate blank layer and saved the dotted layer with a filename different from that of the original tissue image. when counting the number of the dots and calculating a disorderliness score, we utilized the image analysis and computational capability of mathematica ver. the first three lines import a dotted image stored in a preferred directory of a computer and invert the image colors, producing white dots on a black background. the second group of command lines creates a matrix with a dimension equivalent to the image resolution, assigning the number 1 to the entries relevant to the coordinates of the centers of the dots and 0 to the rest of the entries. the matrix is then partitioned into submatrices by a 2015 grid, resulting in a total of 300 submatrices. the third command group takes the sum of the entries of each submatrix, which corresponds to ni, inputs those sums into the formula and returns a disorderliness score. here the normality of the data was explored using the shapiro - wilk test and the equality of variances was assessed using levene s test. one - way analysis of variance (anova) was used to evaluate differences in the means among the data groups. a two - sided p - value of less than.05 was considered to be statistically significant. all statistical analyses were performed using the software package spss ver. 21.0 (spss inc., chicago, il, usa). before analyzing actual colorectal adenocarcinoma samples, we applied the disorderliness score formula to a series of digitally altered normal colonic mucosa samples simulating cancerous conditions to determine whether the disorderliness score behaves as intended. we marked some additional dots mimicking cell stratification in the vicinity of the altered glands (fig. 1d). to simulate infiltration of tumor cells into the stroma, we displaced some of the dots away from the initial location without adding new dots (fig. 1e) and then placed additional dots to represent a diffuse infiltrative behavior (fig. 1f). the results of the simulations demonstrated that the disorderliness score increased steadily in accordance with decreasing tumor differentiation. the complete list of disorderliness scores of normal colorectal mucosa and colorectal adenocarcinoma classified according to a 3-tiered grading system is presented in table 2 along with means and standard deviations. the disorderliness scores of each group were normally distributed (p=.275, p=.961, p=.593, and p=.919 for normal colorectal mucosa and well-, moderately, and poorly differentiated colorectal adenocarcinoma, respectively) and the variances were equal across the groups (p=.904). in fig. 2, selected images of hematoxylin and eosin stained tissue sections of the four analyzed groups are arranged with their disorderliness scores presented in the lower right corners of each image to exhibit the relationship between disorderliness scores and differentiation. a one - way anova determined that a significant difference was present between at least one pair of the mean disorderliness scores of the four groups (f(3, 47)=62.995, p<.001). then, post hoc analyses using bonferroni correction indicated that the mean disorderliness score was lowest in the normal colorectal mucosa and that a meaningful increase in the means occurred as differentiation decreased (p<.01). error bars presented in fig. altogether, the results suggest that the disorderliness score is a characteristic parameter that can distinguish normal tissue from malignant tissue, and is a sensitive metric for identifying differences in differentiation. before analyzing actual colorectal adenocarcinoma samples, we applied the disorderliness score formula to a series of digitally altered normal colonic mucosa samples simulating cancerous conditions to determine whether the disorderliness score behaves as intended. we marked some additional dots mimicking cell stratification in the vicinity of the altered glands (fig. 1d). to simulate infiltration of tumor cells into the stroma, we displaced some of the dots away from the initial location without adding new dots (fig. 1e) and then placed additional dots to represent a diffuse infiltrative behavior (fig. 1f). the results of the simulations demonstrated that the disorderliness score increased steadily in accordance with decreasing tumor differentiation. the complete list of disorderliness scores of normal colorectal mucosa and colorectal adenocarcinoma classified according to a 3-tiered grading system is presented in table 2 along with means and standard deviations. the disorderliness scores of each group were normally distributed (p=.275, p=.961, p=.593, and p=.919 for normal colorectal mucosa and well-, moderately, and poorly differentiated colorectal adenocarcinoma, respectively) and the variances were equal across the groups (p=.904). in fig. 2, selected images of hematoxylin and eosin stained tissue sections of the four analyzed groups are arranged with their disorderliness scores presented in the lower right corners of each image to exhibit the relationship between disorderliness scores and differentiation. a one - way anova determined that a significant difference was present between at least one pair of the mean disorderliness scores of the four groups (f(3, 47)=62.995, p<.001). then, post hoc analyses using bonferroni correction indicated that the mean disorderliness score was lowest in the normal colorectal mucosa and that a meaningful increase in the means occurred as differentiation decreased (p<.01). error bars presented in fig. altogether, the results suggest that the disorderliness score is a characteristic parameter that can distinguish normal tissue from malignant tissue, and is a sensitive metric for identifying differences in differentiation. despite being one of the most prominent histologic features of malignant tumors, disorderliness in the arrangement of tumor cells has never been considered as a criterion of tumor grading systems for any type of cancer. this lack of attention to the histologic disorderliness in tissue specimens may be partly attributable to the difficulty inherent in visually assessing disorderliness. motivated by the statistical thermodynamic definition of entropy, we successfully quantified the amount of disorderliness of tumor cells and demonstrated that the quantified measurements are correlated with tumor differentiation. in the strictest sense, the disorderliness in a tissue section is not directly linked to thermodynamic entropy as it applies to an atomic or molecular system. nevertheless, the concept of entropy is useful for describing tumor differentiation as we demonstrated and also for predicting prognosis on the basis of physical laws. entropy is often regarded as an arrow of time because it distinguishes past and future as dictated by the second law of thermodynamics. similarly, the disorderliness score or the macroscopic analogue of normalized entropy may be interpreted not only as a measure of tumor differentiation but also as a measure of tumor progression. thus, from a thermodynamics point of view, we expect that prognosis is more intimately related to disorderliness in the histologic architecture of tumors than to differentiation. when the length of a side of a grid unit is less than the closest distance between the centers of two adjacent tumor cells, the multiplicity w is equal to n ! this outcome may initially appear problematic, but rather it shows that the disorderliness score reflects histologic disorderliness well. depending on the scale of an architectural pattern, there is an optimal range of distance from which a meaningful spatial relationship among things can be identified. in our setting, the distance from which we observe the histologic architecture corresponds to the number of divisions of a grid. thus, when a grid is too dense or too loose, the disorderliness score can not recognize the architectural pattern of the tumor. after all, the size of the grid unit has to be empirically determined to aptly reflect the histologic architecture. as is the case with the entropy of a system in a classical thermodynamic process, what counts with a disorderliness score is not the absolute value but the relative value. furthermore, because it is meaningless to ask how many times more disordered an arrangement of tumor cells is in comparison with another, we are free to transform disorderliness scores nonlinearly to provide contrasts between scores for our convenience, provided the transformed scores are arrayed in accordance with the order of the untransformed ones. if we had not been concerned with convenience of use, the disorderliness score could have been simplified to include only the ratio of multiplicity w to weven. this simplification is possible because all of the information regarding histologic disorderliness is included in the ratio. however, in general, w / weven yields an extremely small number, such that the raw value is impractical and inconvenient. on the other hand, stirling s approximation for factorials may be used to simplify the formula as in the case of thermodynamic systems consisting of enormous numbers of atoms and molecules. the application of this approximation to our formula, however, will return an erroneous number because there may be few or even no tumor cells in some unit grids. in summary, we defined a novel disorderliness score with which relative degrees of histologic disorderliness can be computed. statistical analyses demonstrated that the disorderliness score discriminates normal colorectal mucosa from malignancy and identifies differences in the differentiation of colorectal adenocarcinoma. given that increased disorderliness is a common underlying feature of cancerous conditions, our results suggest that the concept of histologic disorderliness may serve as an objective tumor grading scheme for a wide range of tumors that originate from highly organized structures and may be used as a screening strategy for detecting potentially malignant areas in a whole slide image. for this feature to be of practical use in cancer grading, it is necessary to develop an accurate and reliable automated method for counting tumor cells in tissue sections. | backgroundinter - observer and intra - observer variation in histologic tumor grading are well documented. to determine whether histologic disorderliness in the arrangement of tumor cells may serve as an objective criterion for grading, we tested the hypothesis the degree of disorderliness is related to the degree of tumor differentiation on which tumor grading is primarily based.methodsborrowing from the statistical thermodynamic definition of entropy, we defined a novel mathematical formula to compute the relative degree of histologic disorderliness of tumor cells. we then analyzed a total of 51 photomicrographs of normal colorectal mucosa and colorectal adenocarcinoma with varying degrees of differentiation using our formula.resultsa one - way analysis of variance followed by post hoc pairwise comparisons using bonferroni correction indicated that the mean disorderliness score was the lowest for the normal colorectal mucosa and increased with decreasing tumor differentiation.conclusionsdisorderliness, a pathologic feature of malignant tumors that originate from highly organized structures is useful as an objective tumor grading proxy in the field of digital pathology. |
the energy lies within the region of the electro - magnetic spectrum, which is perceived as being warm. infrared cameras produce pictures of invisible infrared or heat radiation, thus enabling exact temperature measurements. ir is emitted by all objects at temperatures above absolute zero, and the amount of radiation increases with temperature. thermography, which is also used in complementary and alternative medicine, is accomplished with an ir camera calibrated to display temperature values across an object like the human body. therefore, thermography allows noncontact measurements of the human body. as mentioned in a previous publication, a special kind of manual therapy is performed by mohamed khalifa in hallein in austria for more than 30 years. his treatment is mainly based on pressure and the application of certain rhythms, and with it he seems to be able to accelerate the self - healing processes of the human body. the first scientific publication on this topic has been published recently in the north american journal of medical sciences. the goal of the present study was to investigate possible acute effects of khalifa s therapy on thermal imaging of surface temperature of the knees and feet in patients with a completely ruptured anterior cruciate ligament (acl). the study was approved by the ethics committee of the university of salzburg, austria (21 - 232 11 - 12 sbg), and registered at clinicaltrials. ten male patients with a mean age sd of 35.9 6.1 years (range : 19 - 45 years), a height of 177.6 7.2 cm, and a weight of 77.0 7.7 kg were investigated. inclusion criteria comprised a unilateral complete rupture of the acl, verified by magnetic resonance imaging, not preceded by surgical intervention. patients had to be male, aged between 18 and 49 years, with normal body weight (body mass index [bmi ] 18 - 26). after the rupture, they had to have experienced at least one giving - way (knee instability), and the knee range - of - motion had to be reduced or inhibited (dysfunction) ; still, they had to be able to walk 10 m without crutches and stand on one leg. patients were excluded from the study if they suffered from metabolic disorders like diabetes mellitus or autoimmune diseases. two of the patients had a rupture of the left acl and the remaining eight had a rupture of the right acl. three had received the injury when playing soccer, six when skiing, and one when getting out of his car. khalifa therapy [figure 1a ] restores the function of the knee in a natural way. the most important thing is not the ruptured ligament itself, but its function / dysfunction. khalifa stimulates the self - healing processes in the human body by applying pressure to the skin in different amplitudes that are transformed to frequencies through piezoelectric mechanisms of cell membranes. further details are described in recent publications. a new manual therapy, investigated with infrared thermography. (a) manual therapy in hallein, austria by mohamed khalifa. data acquisition (thermal imaging ; (b) and documentation (c) of surface body temperature in khalifa s institute. with permission of the depicted persons (two of the authors of the present study) the temperature measurements in khalifa s institute were performed using a flir i7 (flir systems, wilsonville, usa ; figure 1b and c) infrared camera, which operates at a wavelength range from 7.5 to 13 m. sensitivity is > 0.1c at 30c, and the infrared resolution is 140 140 pixel. [figure 1a - c ] approximately 3 hours before starting the measurement, both legs were shaved. pictures were taken of the injured knee, the control knee (which did not receive any intervention), and of both legs together. the temperature was evaluated at three different spots : anterolateral, frontal, and anteromedial. the measurement spot for assessing the temperature changes on the foot was located at the great toe (left and right, respectively ; [figure 2 ]). we used the healthy knee for comparison, because it was not possible to investigate a control group (it would not be ethically correct to give the injured patients any treatment at all just for comparison ; in contrast, a comparison with a group receiving surgery does not make sense, because it is an invasive procedure and not manual therapy). all temperature measurements were performed at both the knees and feet, the injured / treated one and the healthy / untreated one (control). to avoid potential technical recording artifacts, photo was taken, and environmental temperature was also recorded before and after the treatment. thermal imaging. the different temperature measurement spots (altogether 8) are indicated the temperature values of both legs were tested with paired t - test (sigmaplot 12.0, systat software inc., the study was approved by the ethics committee of the university of salzburg, austria (21 - 232 11 - 12 sbg), and registered at clinicaltrials. ten male patients with a mean age sd of 35.9 6.1 years (range : 19 - 45 years), a height of 177.6 7.2 cm, and a weight of 77.0 7.7 kg were investigated. inclusion criteria comprised a unilateral complete rupture of the acl, verified by magnetic resonance imaging, not preceded by surgical intervention. patients had to be male, aged between 18 and 49 years, with normal body weight (body mass index [bmi ] 18 - 26). after the rupture, they had to have experienced at least one giving - way (knee instability), and the knee range - of - motion had to be reduced or inhibited (dysfunction) ; still, they had to be able to walk 10 m without crutches and stand on one leg. patients were excluded from the study if they suffered from metabolic disorders like diabetes mellitus or autoimmune diseases. two of the patients had a rupture of the left acl and the remaining eight had a rupture of the right acl. three had received the injury when playing soccer, six when skiing, and one when getting out of his car. khalifa therapy [figure 1a ] restores the function of the knee in a natural way. it is described as functional - pathological. in this approach, function is the primary concern, not anatomy. the most important thing is not the ruptured ligament itself, but its function / dysfunction. khalifa stimulates the self - healing processes in the human body by applying pressure to the skin in different amplitudes that are transformed to frequencies through piezoelectric mechanisms of cell membranes. further details are described in recent publications. a new manual therapy, investigated with infrared thermography. (a) manual therapy in hallein, austria by mohamed khalifa. data acquisition (thermal imaging ; (b) and documentation (c) of surface body temperature in khalifa s institute. with permission of the depicted persons (two of the authors of the present study) the temperature measurements in khalifa s institute were performed using a flir i7 (flir systems, wilsonville, usa ; figure 1b and c) infrared camera, which operates at a wavelength range from 7.5 to 13 m. sensitivity is > 0.1c at 30c, and the infrared resolution is 140 140 pixel. pictures were taken of the injured knee, the control knee (which did not receive any intervention), and of both legs together. the temperature was evaluated at three different spots : anterolateral, frontal, and anteromedial. the measurement spot for assessing the temperature changes on the foot was located at the great toe (left and right, respectively ; [figure 2 ]). we used the healthy knee for comparison, because it was not possible to investigate a control group (it would not be ethically correct to give the injured patients any treatment at all just for comparison ; in contrast, a comparison with a group receiving surgery does not make sense, because it is an invasive procedure and not manual therapy). all temperature measurements were performed at both the knees and feet, the injured / treated one and the healthy / untreated one (control). to avoid potential technical recording artifacts, photo was taken, and environmental temperature was also recorded before and after the treatment. thermal imaging. the temperature values of both legs were tested with paired t - test (sigmaplot 12.0, systat software inc., chicago, usa). the level of significance was defined as p 0.001). the same effect could also be seen on the anteromedial side, however, with a lower significance (p = 0.017). after treatment, there was still a significant difference on the anterolateral side (p = 0.022), but not on the anteromedial side. again, the different regions of interest in the area of the knee showed significant increases, whereas insignificant changes, even a slight decrease of the median, could be seen on the feet [figure 5a and b ]. in addition to the human body temperature, we also measured environmental temperature before and after treatment. there was a significant (p = 0.014) increase in room temperature (from 24.7 0.8c to 25.2 0.9c). the function of all the 10 injured knees was restored after 60 - 90 minutes of manual therapy, and the patients were able to walk, run, jump [figure 6 ], and bend their knees immediately after the end of the treatment. the functional parameters will be described in studies by other research groups [figure 6 ]. knee function of a patient with a completely ruptured right acl was completely restored immediately after manual khalifa therapy the first scientific article concerning the acute effects of manual khalifa therapy was published recently in the north american journal of medical sciences by our research group and describes first results from near - infrared spectroscopic measurements. it is well known in scientific literature that manual therapy induces changes on the human body surface, which can be measured by thermography. reported, recently, that skin temperature showed significant increases immediately after connective tissue massage. it is interesting that manual treatment can also induce significant temperature elevations in nonmassaged areas. sefton. in 2010 suggested dynamic infrared thermography as a useful tool to measure changes in peripheral blood flow noninvasively and even without contact in manual therapy research. the results of that study are in accordance with the results of the present study. after khalifa therapy, we also found significant increases in temperature at the nontreated knee [figure 5b ]. this is not unusual and could be easily explained as physiological and pathophysiological changes of skin temperature also reflecting the function of the autonomic nervous system. however, the changes of skin temperature after manual therapy are not uniform ; this is also valid for acupuncture, as shown by our research group. for example, yeh. reported a marked pain relief along with a reduction of skin temperature (about 1c) of the affected shoulder in two patients after collateral traditional chinese meridian acupressure therapy. in contrast to these investigations, the 10 patients, in this study, showed significant increases in temperature in the region of interest, both on the treated and also on the nontreated knee. however, it should be mentioned that the quality and quantity of the applied stimuli can not be compared. mohamed khalifa uses only his hands to treat the patients. in literature, one can also find investigations concerning effects of manually assisted mechanical force on cutaneous temperature. again, using infrared cameras, differences in cutaneous temperature were found between the ipsi- and contralateral side after manually assisted mechanical force producing a chiropractic adjustment in the lumbar spine. in all the studies, the primary reason for temperature changes is not described in detail ; most probably it is an increase in microcirculation in deeper structures, but a simple stimulus response or friction should also be taken into account. it should also be mentioned that few studies discussed the influence of environmental temperature. in this study, the room temperature was higher at the end of the treatment, probably because of the great physical effort of the therapist. however, we do not think that our measurement data were influenced by this, because the different regions of interest showed different responses ; in one case, the median value even decreased [compare figure 5b, feet ]. a study was designed at the air force general hospital in beijing to analyze and explore the diagnostic significance of infrared thermography in patients with lumbar intervertebral disc protrusion. forty - five patients received conservative treatment (manual manipulation), and 65 were in the control group. statistical analysis showed that the temperature difference between two sides was significantly higher in the patient group than in the control group. the analysis also showed that the temperature difference at the posterior femur area in the patients group was significantly correlated to the severity of clinical signs caused by nerve root irritation. in this study, we could not correlate the severity of the injury with the temperature differences because we had a very homogenous patient collective. it was, however, interesting to note that the patient with the highest degree of injury (complete rupture of the acl and both collateral ligaments) also showed the highest temperature differences (on the knees and the feet). in 1985 and 1989, researchers from russia employed quantitative infrared thermography after manual therapy and in the evaluation of the effectiveness of treating patients with cervical osteochondrosis by manual therapy. in 1994,, infrared thermography is increasingly applicable in sport and sport rehabilitation it is a method that can be easily applied, and is fast and efficient in detecting different kinds of injuries therefore one can expect its increased use in the future. the following conclusion can be drawn from this study : after successful manual khalifa therapy, the surface temperature values were significantly increased on both the knees (injured and control), with significances being higher on the knee with the ruptured acl. baselines values of the anterolateral and anteromedial side of the injured knee were significantly different from those of the control knee. there were no significant changes in temperature of the feet after treatment ; however, it was interesting that the temperature of the feet before treatment was always lower on the injured side as compared with the control (healthy) side. the temperature in the region of the knee, in contrast, was always higher on the injured side. | background : this preliminary publication describes acute temperature effects after manual khalifa therapy.aims:the goal of this study was to describe temperature distribution and the effects on surface temperature of the knees and feet in patients with completely ruptured anterior cruciate ligament before and immediately after the manual therapy.materials and methods : ten male patients were investigated with thermal imaging. an infrared camera operating at a wavelength range of 7.5 - 13 m was used. temperature was analyzed at three locations on both knees and in addition on both feet.results:the study revealed that baseline temperature of the injured knee differed from that of the untreated control knee. after the therapy on the injured knee, the surface temperature was significantly increased on both knees (injured and control). there were no significant changes in the temperature of the feet.conclusions:further studies using continuous thermal image recording may help to explain the details concerning the temperature distribution. |
aspergillus tracheobronchitis (atb) refers to a unique type of aspergillus - associated pulmonary disease in which the trachea and bronchi may be the main or even sole site of infection. atb represents a rare disease entity accounting for only 3.5% to 5.0% of all cases of invasive aspergillosis and is known to occur primarily in immunocompromised hosts. furthermore, 1 report indicated that atb leads to devastating clinical outcomes with a mortality rate of up to 84% in severe immunocompromised hosts. to aid characterization and early diagnosis of atb, there are several classification systems based on bronchoscopic findings with histologic data and depth of invasion (eg, obstructive, ulcerative, and pseudomembranous atb by denning ; superficial infiltration, full - layer involvement, occlusion, and mixed type by wu). however, it is difficult to characterize various types of tracheobronchial involvement into a uniform system. moreover, diverse clinical manifestations and the rarity of atb render its diagnosis quite difficult. in particular, mass - forming types of atb may not fit clearly into the suggested atb classification systems, and to the best of our knowledge only 2 cases of mass - forming atb have been reported to date. given that the patency of the trachea and bronchi are essential for maintaining sufficient airflow, a central airway mass containing aspergillus is likely to be associated with severe clinical manifestations and fatal outcomes. herein, we report a case of atb that initially manifested as severe dyspnea and total atelectasis of the left lung in a patient with newly detected diabetes. radiographic study, bronchoscopy, and pathologic findings of the lesion led to a diagnosis of mass - forming atb. a 31-year - old man with no past history of known medical illnesses was admitted to our emergency department because of severe dyspnea and accompanying tachypnea (30 breaths per minute). the patient had never smoked and had no previous history of allergic diseases. on physical examination, there was dullness over the left lung field, and decreased breath sounds on the left lung heard on auscultation. arterial blood gas analysis revealed po2 80.3 mmhg, pco2 33.1 mmhg, ph 7.46, and sao2 96.5%. laboratory data showed that platelets, white blood cells, and differential cell counts were within the normal range. the patient 's erythrocyte sedimentation rate was 70 mm / hour (reference range : 09 mm / hour) and c - reactive protein was 27.75 mg / l (reference range : 05 mg / l), which together indicated an underlying inflammatory process. notably, urine glucose was 4 + and hba1c was 19.4%, confirming underlying diabetes mellitus. on imaging studies, subsequently, chest computed tomography (ct) revealed total atelectasis of the left lung and a mass - forming lesion at the distal trachea (figure 1b, white arrow). examination of the lesion with bronchoscopy revealed an erythematous, swollen, and soft mass approximately 4 cm above the carina (figure 1c). we subsequently performed transtracheal biopsy of the lesion ; however, we were unable to obtain enough tissue for culture due to the severe clinical condition of the patient during bronchoscopic examination. bronchial washing culture revealed no microorganisms ; however, upon histopathologic examination using grocott - gomori 's methenamine silver staining (figure 2a, black arrows), invasion of the tracheal cartilage by septate hyphae was observed (figure 2b, black arrows). in addition, numerous inflammatory cells were recruited to the adjacent tracheal epithelium (figure 2b, inset box). the invading hyphae exhibited acute angle branching patterns, indicating possible infection with an aspergillus species. (b) coronal view computed tomography (ct) scan showing a mass - forming lesion (white arrow) and total atelectasis of the left lung. (c) bronchoscopic examination at the distal trachea revealed an erythematous, swollen, and soft mass. (a) a transbronchial biopsy of the lesion showing aspergillus species with acute angle branching and septate hyphae (black arrows) (gms, 400). (b) biopsy showing deep invasion of aspergillus hyphae into tracheal cartilage (black arrows) and various inflammatory cells infiltrations (h&e, 100) ; inset shows a higher magnification of infiltration of inflammatory cells (h&e, 200). (c, d) a follow - up bronchoscopic examination and ct scan on the 19th day of medication revealed successful resolution of the lesion. gms = grocott - gomori 's methenamine silver, h&e = hematoxylin and eosin. during the bronchoscopic examination, we attempted to perform debridement of the lesion via bronchoscopy to maintain airway patency. however, the patient 's clinical condition and respiratory symptoms worsened after bronchoscopy necessitating endotracheal intubation and mechanical ventilation (oxygen saturation was 74.8% in spite of maximal degree of supplementary oxygen). moreover, the likelihood of procedure - associated adverse events (eg, bronchoesophageal fistula) was substantially high considering the severity of the pathologic findings including deep invasion of the aspergillus species into the cartilage wall and the presence of uncontrolled diabetes. on the first day of treatment, 6 mg / kg of voriconazole was administered intravenously for every 12 hours as a loading dose, which was then switched to 400 mg / day of oral voriconazole as a maintenance dose according to the guidelines for treating invasive aspergillosis. after treatment with voriconazole, the respiratory symptoms of the patient gradually improved without additional invasive management. on the 19th day of medication, follow - up ct and bronchoscopy showed successful resolution of the lesion (figure 2c, d). the patient was treated with voriconazole for a total of 10 weeks, and there has been no evidence of recurrence of disease in this patient at the time of this publication. here, we report a rare and severe case of atb that occurred in a young patient with newly detected diabetes but without severe immune suppression. the patient suffered from dyspnea owing to an obstructive mass in the distal trachea coinciding with total atelectasis of the left lung. subsequent examinations revealed that the lesion was an extremely rare type of atb, namely, mass - forming atb. although clinical symptoms of the patient required urgent therapeutic intervention, the possibility of intervention - associated complications was considerably high due to the extensive invasion of atb into the tracheal cartilage and to the presence of uncontrolled diabetes. interestingly, signs and symptoms of respiratory illness in the patient gradually improved, and the lesion successfully resolved based on follow - up images 19 days after treatment with voriconazole. in general, immunocompromised patients are usually associated with poor prognoses. several previous reports have suggested that the immune status of patients with mass - forming atb is not uniform. for example, routsi reported a mass - forming type of atb in an immunocompromised patient who took chemotherapy for erythroleukemia whereas another study reported that a relatively immunocompetent patient with well controlled diabetes mellitus experienced mass - forming atb. the symptoms of the patient in this study were devastating with subsequent respiratory failure, but the patient 's immune system was not severely impaired. the spectrum of the initial clinical manifestations and the underlying immune status of our patient made establishing an appropriate therapeutic strategy quite difficult. interestingly, the patient showed dramatic therapeutic response to voriconazole after treatment for 19 days, with the atb resolved completely thereafter. this outcome was in contrast to a previous report on atb, where antifungal treatment lasting approximately 4 to 19 months was required to achieve complete resolution on chest ct. based on our experience, monotherapy with voriconazole appears to have a beneficial role even in treating rare and severe types of atb. although the reason for mass formation in atb is not clearly understood, intact immune responses in the host appear to influence mass development partly through the accumulation of various inflammatory cells as depicted in the pathologic examination of a previous case. similarly, the pathologic examination of our case also showed prominent infiltration of various inflammatory cells. moreover, our patient had newly detected diabetes with a high level of hba1c (19.4%) before the onset of evident metabolic decompensation. considering the impact of hyperglycemia in the immune system (eg, impairment of transmigration and chemotaxis of neutrophils, decrease of their bactericidal activity, decrease of response to antigens of cd4 cells, and unnecessary glycosylation of antibodies), the gradual decrease in the competence of immune system likely affords sufficient time for mass formation following aspergillus infection. in the same context, the relatively well preserved immune system in our patient may have played an important role in the dramatic response to voriconazole. in this report, we describe a case of mass - forming atb that presented with disastrous respiratory signs and symptoms that required immediate airway management. however, considering the significantly high possibilities of procedure - associated complications, we decided to treat with voriconazole without further interventions. this clinical experience suggests that medication with voriconazole may be an effective therapeutic option in rare and severe atb patients who are not candidates for invasive airway procedures. the institutional review board of chonbuk national university hospital stated that it was not necessary to achieve irb approval for this case report, but that patient consent was required as the study dealt only with retrospective use of the patient 's medical record and related images. written informed consent was obtained from the patient prior to the publication of this case report and accompanying images. | abstractaspergillus tracheobronchitis (atb) represents a rare disease entity accounting for 3.5% to 5.0% of cases of invasive aspergillosis. particularly, mass - forming atb is extremely rare, and clinical reports are limited. given that the patency of the trachea and bronchi are essential for maintaining sufficient airflow, a central airway mass originating from an aspergillus infection is likely to be associated with severe clinical manifestations and fatal outcomes. although several therapeutic options for atb have been suggested, including medication and airway interventions, the optimal choice of treatment in diverse clinical conditions remains under discussion.we report a case of atb that initially manifested as severe dyspnea and total atelectasis of the left lung in a patient with newly detected diabetes.radiographic study, bronchoscopy, and pathologic findings of the lesion revealed mass - forming type of atb.interestingly, our patient 's symptoms dramatically resolved with voriconazole without further invasive intervention.this clinical experience highlights the beneficial role of voriconazole in the treatment of rare and potentially fatal cases of atb. |
a bioinspired cocoon - like anticancer drug delivery system consisting of a deoxyribonuclease (dnase)-degradable dna nanoclew (ncl) embedded with an acid - responsive dnase i nanocapsule (nca) was developed for targeted cancer treatment. the ncl was assembled from a long - chain single - stranded dna synthesized by rolling - circle amplification (rca). multiple gc - pair sequences were integrated into the ncl for enhanced loading capacity of the anticancer drug doxorubicin (dox). meanwhile, negatively charged dnase i was encapsulated in a positively charged acid - degradable polymeric nanogel to facilitate decoration of dnase i into the ncl by electrostatic interactions. in an acidic environment, the activity of dnase i was activated through the acid - triggered shedding of the polymeric shell of the nca, resulting in the cocoon - like self - degradation of the ncl and promoting the release of dox for enhanced therapeutic efficacy. |
|
a new technological world of electrochemical sensorimotors mimicking biological muscles is emerging, requiring thick films of conducting polymers for their construction. here, we present how the best conditions to generate thick films of the polypyrrole / polyvynivlsuphonate blend are determined, how the selfsupported electrodes are constructed, and how their electrochemical and sensing properties are determined. the material can be applied to create sensing artificial muscles. an unexplored and unparalleled technological world is emerging, in which electrochemical tools and robots replicate the intracellular matrix content of functional cells (ions water and reactive macromolecules), and their functions. haptic muscles, dual and simultaneous sensing motors, can now be replicated by sensing artificial muscles. the electrochemical reactions of the constitutive material drive, simultaneously, the movement rate of the motor (through the flowing current) and the mechanical, thermal, or chemical sensing (through the muscle potential evolution) of the working conditions. if each of the film constitutive chains is a reacting molecular motor : where is the electrical double layer ? ; how can electrochemical models include reactiondriven volume variations and conformational energetic changes of the reacting polymeric chains ? ; if we can mimic haptic muscles, can artificial proprioception and artificial proprioceptive robots be developed ?, could the attained results help to describe parallel biochemical functional reactions or biological functions and predict malfunctions ? development of structural and biomimetic electrochemical models and multifunctional electrochemical devices (sensing motors, sensing motor batteries, sensing smart windows, artificial chemical synapse for neuron computer interfaces) as well as electrochemoconformational memories that can actuate as multipotent memories for biomimetic computers, like possible brain memory models. | abstractinvited for this month 's cover picture is the group of professor toribio f. otero at the centre for electrochemistry, intelligent materials and devices at the polytechnic university of cartagena (spain). the cover picture shows an electrochemical cell as well as three representative cyclic voltammetric responses, displaying the electrolyte potential window, the monomer oxidation polymerization potential range, and the polymer oxidation reduction potential window. for more details, read the full text of the full paper at 10.1002/open.201600139. |
now - a - days, children are exposed to mobile phone radiation at a very early age. there is a rapidly growing concern about the possible health effects of radiofrequency (rf) radiation emitted by mobile phones on children 's health. the potentially greater susceptibility of children 's developing nervous systems, higher conductivity of their brain tissue, greater rf penetration due to their head size, and finally the fact that children have a longer lifetime exposure than adults are among the rational for these concerns. moreover, it has been reported that the specific absorption rate (sar) of rf radiation in the children 's brain is higher than that of the adults. differences in the size, shape, water content and tissue distribution of the brain in children are believed to be responsible for the higher sar and vulnerability of children. on the other hand, the issue of children carrying mobile phones in schools and using these communicational devices during instructional time is another important concern. in the islamic republic of iran similar to other countries in some schools the policies regarding mobile phone use are being somehow relaxed. in a report published in 2011, we have shown that a large proportion of children in the city of shiraz, iran use mobile phones. we also indicated a significant increase in some self - reported symptoms among children who use mobile phones. reaction time plays a critical role in performing activities necessary to cope better with life 's threats and/or avoid hazards. reaction time widely varies from one individual to another, and increased reaction time may lead to fatal accidents. we and other investigators have previously studied the effects of exposure to electromagnetic fields (emf) on reaction time. previously, we have indicated that the visual reaction time (vrt) of university students was significantly affected by a 10 min real / sham exposure to emf emitted by mobile phone. we found that these exposures caused decreased reaction time, which might lead to a better response to different hazards. we have previously also shown that occupational exposures to radar radiations decreased reaction time in radar workers. over the past years, our laboratory has focused on studying the health effects of exposure of laboratory animals and humans to some common and/or occupational sources of emf such as mobile phones and their base stations, mobile phone jammers, laptop computers, radars, dentistry cavitrons and mri. the purpose of this study was to investigate whether short - term exposure of elementary school students to rf radiation leads to changes in their reaction time and short - term memory. in this study, sixty male elementary school children, in the age group of 7 - 10-year - old at a boys public elementary school in shiraz, iran were the subjects of the study. the purpose of the study was explained to the students and teachers, and a letter explaining the goal of the study and consent form were sent to the children 's parents. the study was approved by the ethics committee of the shiraz university of medical sciences. computer - assisted - tests of vrt and short - term memory (modified for children) were administered. reaction time is usually defined as the time interval between exposure to a stimulus and detection of a response ; in the present study, it was the amount of time it took an individual to physically respond to the visual stimulus on the display of a laptop computer. the students were asked to perform some preliminary tests for orientation with the vrt test. after orientation, to reduce random variation of measurements, each test was repeated ten times in both real and sham exposure phases. the students vrt was recorded with a simple blind computer assisted - test, before and after a 10 min real / sham exposure to emf of mobile phone. the reason for choosing 10 min intervals for either real exposures or sham exposures was the point that based on our previous studies, only about 16% of the male and 11% of the female students had daily call time longer than 10 min. in this light, participants were asked to sit in an armchair in front of an ergonomic liquid - crystal display monitor. the time interval between the two subsequent sham and real exposure phases was 30 min. a gsm huawei g5520 mobile phone (huawei technologies co. ltd., china) was used for exposure to microwaves. according to manufacturer 's specifications, the highest sar value under the icnirp guidelines for using this device at the ear was 1.45 w / kg. the phone was in a normal talk mode but as the loudspeaker was disconnected, it did not produce any sound. the students were informed that during the experiment they would be exposed to emf emitted by mobile phone, but they were not aware of the order of real / sham exposures. the order of the exposures (sham - real or real - sham) was chosen at random for each participant. the participants mean (standard deviation [sd ]) age was 8.81 0.82 (ranged, 7 - 10) years. the majority of them were between 8 and 9 years of age (74.58%). among the participants, 10.2% were 1 year students, while 13.6%, 61.0% and 15.2% were 2, 3 and 4 year students. the mean (sd) reaction time after a 10 min talk period and after a 10 min sham exposure (switched off mobile) period were 249.0 82.3 ms and 252.9 68.2 ms (p = 0.629), respectively [figure 1 ]. on the other hand, the mean short - term memory scores after the talk and sham exposure periods were 1062.60 305.39 and 1003.84 339.68 (p = 0.030), respectively [figure 2 ]. the mean (standard deviation) reaction time after a 10 min talk period and after a 10 min sham exposure (switched off mobile) period the mean short - term memory scores after the talk and sham exposure periods results obtained in this study showed that a 10 min talk period could not alter the reaction time in elementary school students, while exposures are extending over a short period of time significantly increased the short - term memory scores. to the best of our knowledge, this is the first study to show that short - term exposure of elementary school students to rf radiation leads to the better performance of their short - term memory. these findings, along with our previous reports, rule out the widespread assumption that mobile - emitted - radiations increase the reaction time. have previously reported some beneficial cognitive effects after human short - term exposure to cell phone radiation. in a report published in 2011, mortazavi. showed that the vrt of university students was significantly affected by a 10 min exposure to emf emitted by mobile phone. they found that these exposures caused decreased reaction time which might lead to a better response to different hazards. they also revealed that occupational exposure to radar radiations decreased the reaction time in radar workers. increased brain glucose consumption after exposure to rf radiation, as confirmed by pet studies, our findings are in line with those published by vecchio. in 2012. in their study, subjects underwent two electroencephalographic sessions separated by 1-week. in both sessions, participants conducted a visual go / no - go task before a 45 min real exposure phase to mobile phone gsm emf or after a sham exposure phase (no emf). results of this study showed less power decrease of widely distributed high - frequency alpha rhythms and faster reaction time while no effect was detected in the sham exposure phase. vecchio. concluded that both the peak amplitude of alpha event - related desynchronization and the reaction time are modulated by the effect of the exposure to emf of gsm mobile phone on the cortical activity. furthermore, cognitive beneficial effects of long - term exposure to high - frequency emf have been indicated by some epidemiologic studies. using a word interference test, arns. showed that long - term heavy cell phone use resulted in better performance of normal subjects. moreover, schz. in 2009 reported that long - term cell phone users b (subscribers of 10 years or more) had a 30 - 40% decreased risk of hospitalization due to alzheimer 's disease and vascular dementia. on the other hand, our results contradict those of the previous studies such as that conducted by a group of australian scientists who investigated the reaction time and accuracy rate data during the auditory oddball task. their study showed an increased reaction time after the exposure compared to sham - exposure intervals. our results are also in contrast with those reported in 2006, indicating that exposure to pulsed emfs produced by mobile phone has no short - term effects on human visuomotor choice reaction time and movement time. in this double - blind study, that was claimed by the authors to be the first study to assess human visuomotor behavior after a short - term exposure to mobile phone - generated radiation, it was shown that a 30 min exposure could not change the reaction time. our findings are also in contrast with those of a report that was performed on the effect of exposure to mobile phone radiation on the nervous system activity. this study showed that acute exposure to mobile phone radiation could not induce any change in studied indices of brain activity. as each brain hemisphere is dominant for some of our behaviors, in future studies appropriate tests can be performed separately for right and left brain functions to obtain more powerful results. on the other hand, although the sar value reported in this study (1.45 w / kg) was a manufacturer 's reported highest sar value under the icnirp guidelines for using this phone, in future studies energy absorbed by a unit of mass of exposed tissue over a given time of a person who uses a mobile phone can be measured. to the best of our knowledge, this is the first study to show that short - term exposure of elementary school students to rf radiation leads to the better performance of their short - term memory. this memory enhancing intervention may open new horizons in the treatment of some cognitive impairment problems. | background : now - a - days, children are exposed to mobile phone radiation at a very early age. we have previously shown that a large proportion of children in the city of shiraz, iran use mobile phones. furthermore, we have indicated that the visual reaction time (vrt) of university students was significantly affected by a 10 min real / sham exposure to electromagnetic fields emitted by mobile phone. we found that these exposures decreased the reaction time which might lead to a better response to different hazards. we have also revealed that occupational exposures to radar radiations decreased the reaction time in radar workers. the purpose of this study was to investigate whether short - term exposure of elementary school students to radiofrequency (rf) radiation leads to changes in their reaction time and short - term memory.materials and methods : a total of 60 elementary school children ages ranging from 8 to 10 years studying at a public elementary school in shiraz, iran were enrolled in this study. standardized computer - based tests of vrt and short - term memory (modified for children) were administered. the students were asked to perform some preliminary tests for orientation with the vrt test. after orientation, to reduce the random variation of measurements, each test was repeated ten times in both real and sham exposure phases. the time interval between the two subsequent sham and real exposure phases was 30 min.results:the mean standard deviation reaction times after a 10 min talk period and after a 10 min sham exposure (switched off mobile) period were 249.0 82.3 ms and 252.9 68.2 ms (p = 0.629), respectively. on the other hand, the mean short - term memory scores after the talk and sham exposure periods were 1062.60 305.39, and 1003.84 339.68 (p = 0.030), respectively.conclusion:to the best of our knowledge, this is the first study to show that short - term exposure of elementary school students to rf radiation leads to the better performance of their short - term memory. |
arpe-19 cells (fig. 1a and 1b), a human retinal pigment epithelial cell line, were purchased from the american type culture collection (atcc, manassas, va, usa). they were cultured in t-75 flasks with dulbecco 's modified eagle 's medium (invitrogen, gibco, carlsbad, ca, usa) supplemented with 10% fetal bovine serum (sigma - aldrich, st. louis, mo, usa) and 100 u / ml penicillin and streptomycin (gibco - brl, gaithersburg, md, usa). during incubation, protein kinase inhibitors such as nf-b inhibitor (bay 11 - 7085) and a c - jun nh2-terminal kinase (jnk) map kinase inhibitor (sp600125 ; enzo life sciences, montgomery county, pa, usa), human tnf- (r&d systems, minneapolis, mn, usa), human il-1 (abcam, cambridge, ma, usa), and human ifn- (peprotech, rocky hill, nj, usa) were used. human ptx3 monoclonal antibody (novus biologicals, littleton, co, usa) and -actin polyclonal antibody (santa cruz biotechnology, santa cruz, ca, usa) were used for western blot analysis. all signaling antibodies were purchased from cell signaling technology (danvers, ma, usa). total rna from arpe-19 cells was isolated using a reagent (invitrogen), and reverse transcription was performed using moloney murine leukemia virus reverse transcriptase (invitrogen). the amplification of cdna by polymerase chain reaction was performed using human ptx3-specific primers and the accupower pcr premix kit (bioneer, daejeon, korea). primers were designed using the primer express 1.5 software (applied biosystems, carlsbad, ca, usa) and synthesized by bioneer. the primer sequences were as follows : human ptx3 forward primer, 5-aatgcatctccttgcgattc-3 ; reverse primer, 5-tgaagtgcttgtcccattcc-3 ; ire1 forward primer, 5-cacagtgac gcttcctgaaac-3 ; reverse primer, 5-gccatcattaggatctgggaga-3 ; chop forward primer, 5-ccgtttcctggttctcccttgg-3 ; reverse primer, 5-tgcttctct ggcttggctgac-3, and -actin forward primer, 5-atggtgcgtgacattaaggagaag-3 ; reverse primer, 5-aggaaggaaggctggaagagtg-3. amplification of cdna started with 10 minutes at 95, followed by 40 cycles of 15 seconds at 95 and 1 minute at 59. reverse transcription - polymerase chain reaction for ptx3 ; ire1, chop, and -actin was conducted using iq sybr green supermix (bio - rad, hercules, ca, usa). briefly, the cells were harvested using ripa buffer (sigma - aldrich) containing protease inhibitors (roche applied science, mannheim, germany). protein concentrations were determined using the pierce bca protein assay kit (thermo scientific, rockford, il, usa). samples were resolved by 12% sds - page gels and transferred to pvdf membranes (bio - rad) overnight (120 ma). the transferred membranes were hybridized with various primary antibodies (diluted 1 : 1000, cell signaling technology) overnight at 4, followed by incubation with secondary hrp - conjugated igg antibodies and visualized with supersignal west pico chemiluminescent substrate (thermo scientific). human ptx3 released into the culture medium was measured using an enzyme - linked immunosorbent assay (elisa) kit (human ptx3/tsg-14) from r&d systems, according to the manufacturer 's instructions. briefly, elisa plates (bd biosciences, san jose, ca, usa) were coated with a monoclonal anti - human ptx3 antibody (2 g / ml) in coating buffer (1% bsa in pbs, ph 7.2 to 7.4) overnight at room temperature. the plates were then blocked with coating buffer for 2 hours at room temperature and incubated with either recombinant human ptx3 standards or samples collected in quadruplicate (100 l / well) for another 2 hours. the plates were then incubated with a biotinylated human ptx3 antibody (150 ng / ml) for 2 hours and subsequently incubated with freshly diluted streptavidin - hrp for 20 minutes in the dark. after each step, the plates were washed three times with washing buffer. a chromogenic substrate tetramethylbenzidine (100 l / well) (ebioscience, san diego, ca, usa) was added and incubated for 5 minutes in the dark. the reaction was stopped by adding 2 n h2so4 (50 l / well), and the plates were read at 450 nm using an automatic elisa reader (merck sensident scan, helsinki, finland) cell viability was determined by the mts assay using the celltiter 96 aqueous one solution cell proliferation assay kit (promega, madison, wi, usa). after reagent treatment, 20 l of mts solution was added to each well, and plates were incubated for an additional 2 to 4 hours at 37. absorbance was then measured at 490 nm using a spectramax m2 microplate reader (molecular devices, sunnyvale, ca, usa) to calculate cell survival percentages. cells were seeded on 12-well plates containing glass coverslips and treated the following day with tunicamycin (1 m) for 48 hours. nuclear counterstaining was performed by staining with a solution of 1 g / ml hoechst 33258 for 5 minutes and mounting on a slide using fluorescence mounting medium (dako, glostrup, denmark). arpe-19 cells stably transfected with the pmscv - lmp retro - puro vector carrying specific small hairpin rna (shrna) targeting nucleotides to ptx3 (ptx3 shrna) or ire1 (ire1 shrna) were generated according to the manufacturer 's instructions (open biosystems, lafayette, co, usa). briefly, the ptx3 shrna oligo (5-tgctgttgacagtgagcgcccatcaacctctcttctgtatagtgaagccacagatgtatacagaagagaggttgatgggtgcctactgcctcgga-3) and ire1 shrna oligo (5-tgctgttgacagtgagcgcagtgcataataggaacactttagtgaagccacagatgtaaagtgttcctattatgcactgtgcctactgcctcgga-3) were synthesized and amplified using mir30 common primers (forward primer : 5-cagaaggctcgagaaggtatattgctgttgacagtgagcg-3, reverse primer : 5-ctaaagtagccccttgaattccgaggcagtaggca-3). the polymerase chain reaction products were digested with ecori and xhoi and ligated into pmscv - lmp retro - puro (open biosystems). transfected cells were selected in media containing 2 g / ml puromycin (life technologies, carlsbad, ca, usa). data are represented as mean standard deviation. for comparisons between two groups, we used the student 's two - tailed unpaired t - test. for comparisons of timed series experiments, we performed student 's paired t - tests. arpe-19 cells (fig. 1a and 1b), a human retinal pigment epithelial cell line, were purchased from the american type culture collection (atcc, manassas, va, usa). they were cultured in t-75 flasks with dulbecco 's modified eagle 's medium (invitrogen, gibco, carlsbad, ca, usa) supplemented with 10% fetal bovine serum (sigma - aldrich, st. louis, mo, usa) and 100 u / ml penicillin and streptomycin (gibco - brl, gaithersburg, md, usa). during incubation, protein kinase inhibitors such as nf-b inhibitor (bay 11 - 7085) and a c - jun nh2-terminal kinase (jnk) map kinase inhibitor (sp600125 ; enzo life sciences, montgomery county, pa, usa), human tnf- (r&d systems, minneapolis, mn, usa), human il-1 (abcam, cambridge, ma, usa), and human ifn- (peprotech, rocky hill, nj, usa) were used. human ptx3 monoclonal antibody (novus biologicals, littleton, co, usa) and -actin polyclonal antibody (santa cruz biotechnology, santa cruz, ca, usa) were used for western blot analysis. all signaling antibodies were purchased from cell signaling technology (danvers, ma, usa). total rna from arpe-19 cells was isolated using a reagent (invitrogen), and reverse transcription was performed using moloney murine leukemia virus reverse transcriptase (invitrogen). the amplification of cdna by polymerase chain reaction was performed using human ptx3-specific primers and the accupower pcr premix kit (bioneer, daejeon, korea). primers were designed using the primer express 1.5 software (applied biosystems, carlsbad, ca, usa) and synthesized by bioneer. the primer sequences were as follows : human ptx3 forward primer, 5-aatgcatctccttgcgattc-3 ; reverse primer, 5-tgaagtgcttgtcccattcc-3 ; ire1 forward primer, 5-cacagtgac gcttcctgaaac-3 ; reverse primer, 5-gccatcattaggatctgggaga-3 ; chop forward primer, 5-ccgtttcctggttctcccttgg-3 ; reverse primer, 5-tgcttctct ggcttggctgac-3, and -actin forward primer, 5-atggtgcgtgacattaaggagaag-3 ; reverse primer, 5-aggaaggaaggctggaagagtg-3. amplification of cdna started with 10 minutes at 95, followed by 40 cycles of 15 seconds at 95 and 1 minute at 59. reverse transcription - polymerase chain reaction for ptx3 ; ire1, chop, and -actin was conducted using iq sybr green supermix (bio - rad, hercules, ca, usa)., the cells were harvested using ripa buffer (sigma - aldrich) containing protease inhibitors (roche applied science, mannheim, germany). protein concentrations were determined using the pierce bca protein assay kit (thermo scientific, rockford, il, usa). samples were resolved by 12% sds - page gels and transferred to pvdf membranes (bio - rad) overnight (120 ma). the transferred membranes were hybridized with various primary antibodies (diluted 1 : 1000, cell signaling technology) overnight at 4, followed by incubation with secondary hrp - conjugated igg antibodies and visualized with supersignal west pico chemiluminescent substrate (thermo scientific). human ptx3 released into the culture medium was measured using an enzyme - linked immunosorbent assay (elisa) kit (human ptx3/tsg-14) from r&d systems, according to the manufacturer 's instructions. briefly, elisa plates (bd biosciences, san jose, ca, usa) were coated with a monoclonal anti - human ptx3 antibody (2 g / ml) in coating buffer (1% bsa in pbs, ph 7.2 to 7.4) overnight at room temperature. the plates were then blocked with coating buffer for 2 hours at room temperature and incubated with either recombinant human ptx3 standards or samples collected in quadruplicate (100 l / well) for another 2 hours. the plates were then incubated with a biotinylated human ptx3 antibody (150 ng / ml) for 2 hours and subsequently incubated with freshly diluted streptavidin - hrp for 20 minutes in the dark. after each step, the plates were washed three times with washing buffer. a chromogenic substrate tetramethylbenzidine (100 l / well) (ebioscience, san diego, ca the reaction was stopped by adding 2 n h2so4 (50 l / well), and the plates were read at 450 nm using an automatic elisa reader (merck sensident scan, helsinki, finland) cell viability was determined by the mts assay using the celltiter 96 aqueous one solution cell proliferation assay kit (promega, madison, wi, usa). after reagent treatment, 20 l of mts solution was added to each well, and plates were incubated for an additional 2 to 4 hours at 37. absorbance was then measured at 490 nm using a spectramax m2 microplate reader (molecular devices, sunnyvale, ca, usa) to calculate cell survival percentages. cells were seeded on 12-well plates containing glass coverslips and treated the following day with tunicamycin (1 m) for 48 hours. nuclear counterstaining was performed by staining with a solution of 1 g / ml hoechst 33258 for 5 minutes and mounting on a slide using fluorescence mounting medium (dako, glostrup, denmark). arpe-19 cells stably transfected with the pmscv - lmp retro - puro vector carrying specific small hairpin rna (shrna) targeting nucleotides to ptx3 (ptx3 shrna) or ire1 (ire1 shrna) were generated according to the manufacturer 's instructions (open biosystems, lafayette, co, usa). briefly, the ptx3 shrna oligo (5-tgctgttgacagtgagcgcccatcaacctctcttctgtatagtgaagccacagatgtatacagaagagaggttgatgggtgcctactgcctcgga-3) and ire1 shrna oligo (5-tgctgttgacagtgagcgcagtgcataataggaacactttagtgaagccacagatgtaaagtgttcctattatgcactgtgcctactgcctcgga-3) were synthesized and amplified using mir30 common primers (forward primer : 5-cagaaggctcgagaaggtatattgctgttgacagtgagcg-3, reverse primer : 5-ctaaagtagccccttgaattccgaggcagtaggca-3). the polymerase chain reaction products were digested with ecori and xhoi and ligated into pmscv - lmp retro - puro (open biosystems). transfected cells were selected in media containing 2 g / ml puromycin (life technologies, carlsbad, ca, usa). data are represented as mean standard deviation. for comparisons between two groups, we used the student 's two - tailed unpaired t - test. for comparisons of timed series experiments, we performed student 's paired t - tests. er stress is linked to several pathological conditions, including armd. to verify the cellular effects of the er stress inducer, tunicamycin, arpe-19 cells were exposed to 1 g / ml tunicamycin or the vehicle control (1% dmso) for 48 hours. live cells were counted and are represented as a graph in fig. 2b and 2c. tunicamycin - induced er stress accelerated the death of arpe-19 cells. to verify these results, we assessed er stress - induced cell death in the absence or presence of tunicamycin using the celltiter aqueous one solution assay kit (promega, leiden, the netherlands). the viability of arpe-19 cells decreased with 1 g / ml tunicamycin treatment (24.2%) compared to vehicle (100%). these results indicate that excessive er stress induces cell death in arpe-19 cells. to investigate the effects of er stress on ptx3 production, ptx3 expression was measured from supernatants after 48-hour treatment with the vehicle or tunicamycin (0.01, 0.1, and 1 g / ml) (fig. furthermore, a time course analysis in which arpe-19 cells were treated with 1 g / ml tunicamycin for 6, 12, 24, 36, and 48 hours demonstrated that ptx3 production began to increase by 12 hours, and a more striking increase in ptx3 was evident after 36 hours of tunicamycin treatment (fig. these results suggest that tunicamycin induced er stress can enhance the production of ptx3 in human retinal pigment epithelial cells in both a dose and time dependent manner. to ascertain the effect of tunicamycin induced er stress on ptx3 mrna levels in arpe-19 cells, total rna was isolated 24 hours after treatment with increasing doses of tunicamycin (0.01, 0.1, and 1 g / ml) and at different time points (3, 6, 12, 24, 36, and 48 hours) using 0.1 g / ml of tunicamycin (fig. 4a and 4b). furthermore, ptx3 mrna began to increase by 6 hours, and a more striking increase was observed after 36 hours of tunicamycin treatment (fig., these results suggest that tunicamycin - induced er stress increased ptx3 production at the transcriptional level. in order to verify which signaling pathway could be responsible for the stimulation of ptx3 production by tunicamycin - induced er stress, we used a specific nf-b inhibitor (bay 11 - 7085) and a jnk map kinase inhibitor (sp600125). arpe-19 cells were treated with bay 11 - 7085 (10 m) and sp600125 (10 m) in the presence of tunicamycin, and supernatants were harvested 48 hours after treatment. 5a) ; however, sp600125 had no effect on ptx3 production in the presence of tunicamycin (fig. these data suggest that the nf-b signaling pathway may facilitate increased ptx3 production during er stress in human retinal pigment epithelial cells. in higher eukaryotes, there are three major er stress sensors, ire1, perk, and activating transcription factor 6. these three er stress response branches control the expression of specific transcription factors and signaling events that modulate a variety of downstream er stress responses, which orchestrate adaptation to er stress. in addition to upregulating upr target genes, mammalian ire1 signals through additional pathways include nf-b and jnk. to determine whether ire1 is involved in the upregulation of ptx3 during er stress, we generated control and ire1 shrna transfected arpe-19 cells. real - time reverse transcription - polymerase chain reaction analyses were performed to assess the degree of ire1 silencing (fig. these data suggest that ire1 is an important mediator of ptx3 production by the er stress inducer, tunicamycin. to investigate whether ptx3 production altered cell viability during er stress, we generated control and ptx3 shrna - transfected arpe-19 cells. the cell viability of ptx3 shrna transfected arpe-19 cells decreased with tunicamycin treatment (1 g / ml, 30.8%), as compared to the vehicle - treated control (55.4%) (fig. 6b). these data suggest that ptx3 promotes cell survival during er stress induced by tunicamycin in arpe-19 cells. during physiological er stress, however, in pathologically chronic er stress, prolonged chop expression promotes cell death, and it has been implicated in a number of diseases, including armd, neurodegenerative diseases, atherosclerosis, diabetes, and renal disease. to investigate the effects of ptx3 knockdown on chop expression, we treated control and ptx3 shrna transfected arpe-19 cells with tunicamycin (1 g / ml) and harvested rna and protein at 6, 12, 24, and 48 hours after treatment. chop mrna and protein levels increased after 6 hours and declined at 12 hours in the control shrna transfected arpe-19 cells (fig. 7a and 7b, respectively). however, chop mrna and protein levels increased after 6 hours, and they were prolonged until 48 hours (mrna) or 24 hours (protein) in ptx3 shrna - transfected arpe-19 cells (fig. fold changes in the signal intensity of protein expression were calculated in comparison to the control in control shrna transfected cells (black) or ptx3 shrna transfected cells (white) (fig. these results indicate that er stress stimulates ptx3 production via an ire1-dependent signaling pathway that promotes cell survival in response to er stress - induced cell death in arpe-19 cells. rpe cell absorb light energy focused on the retina by the lens, and contribute to the maintenance of photoreceptor excitability. damage to any of the intricate structures of the retina can lead to visual impairment and blindness. it is also an important feature of armd, the most common cause of irreversible vision loss, particularly in individuals over 65 years of age. age - related alterations in the rpe include a reduction in cell density, which can be caused by apoptosis resulting from accumulation of toxic substances. oxidative stress, hyperglycemia, mitochondrial dysfunction, and er stress are among the many studied pro - apoptotic factors in rpe cell lines. recent studies suggest that the er may also play an important role in response to oxidative stress - induced damage in neuronal and epithelial cells. therefore, er stress in rpe could play an important role in the pathogenesis of choroidal neovascularization complicating amd. pentraxins are key components of the humoral arm of innate immunity, which also include the complement system, collectins, and ficolins. ptx3 is the first member of the long pentraxin subfamily and was identified in the early 1990s as a new secreted protein rapidly induced by il-1 in endothelial cells or by tnf in fibroblasts. ptx3 plays a non - redundant role in humoral innate immunity, assisting in the resistance to selected pathogens by recognizing microbes, activating complement, and facilitating pathogen recognition by phagocytes. ptx3 is also essential in female fertility and acts as a scavenger of cell debris, as well as an immunosuppressant. it specifically binds to late apoptotic cells and subsequently inhibits their uptake by dendritic cells, thus acting as an additional tool for maintaining immune tolerance. ptx3 binds to complement factor h, a complement regulator protein whose main function is to inhibit activation of the alternative complement pathway. its polymorphic variant, harboring a substitution of histidine for tyrosine at codon y420h, has been shown to be strongly associated with armd. we previously reported that human retinal pigment epithelial cells are a major source for ptx3 production in the presence of the proinflammatory cytokines il-1 and tnf-, and they could be important mediators for host defense and inflammatory response in the retina. we also showed that ptx3 concentration was significantly higher in neovascular armd patients and diabetic retinopathy patients than in control patients. these data suggest that ptx3 produced in rpe cells may play an important role in protection against inflammation and proapoptotic factors, including er stress, during retinal injury. furthermore, wu. demonstrated that ptx-3 secretion was regulated during thapsigargin - induced er stress in cumulus - oocyte complexes. in this study, we found that a human rpe cell line, arpe-19, locally produced ptx3, and its expression and production were increased by tunicamycin - induced er stress via an ire1-mediated nf-b signaling pathway. 6, ptx3 shrna transfected cells were more sensitive to tunicamycin - induced cell death. this was because of prolonged expression of chop, a mediator of apoptosis during er stress (fig. these data suggest that ptx3 produced in rpe cells play an important protective role in retinal injury against proapoptotic stimuli such as er stress. the role of ptx3 production in the presence of other pathological stimuli related to retinal degenerative and other eye diseases needs to be investigated. | purposeto investigate the production of long pentraxin 3 (ptx3) in response to tunicamycin - induced endoplasmic reticulum (er) stress and its role in er stress - associated cell death, ptx3 expression was evaluated in the human retinal pigment epithelial cell line, arpe-19.methodsptx3 production in arpe-19 cells was analyzed in the absence or presence of tunicamycin treatment by enzyme - linked immunosorbent assay. ptx3 protein and mrna levels were estimated using western blot analysis and real - time reverse transcription - polymerase chain reaction, respectively. protein and mrna levels of ccaat - enhancer - binding protein homologous protein (chop) and arpe-19 cell viability were measured in the presence of tunicamycin - induced er stress in control or ptx3 small hairpin rna (shrna)-transfected arpe-19 cells.resultsthe protein and mrna levels of ptx3 were found to be significantly increased by tunicamycin treatment. ptx3 production was significantly decreased in inositol - requiring enzyme 1 shrna - transfected arpe-19 cells compared to control shrna - transfected cells. furthermore, pretreatment with the nf-b inhibitor abolished tunicamycin - induced ptx3 production. decreased cell viability and prolonged protein and mrna expression of chop were observed under tunicamycin - induced er stress in ptx3 shrna transfected arpe-19 cells.conclusionsthese results suggest that ptx3 production increased in the presence of tunicamycin - induced er stress. therefore, ptx3 could be an important protector of er stress - induced cell death in human retinal pigment epithelial cells. inositol - requiring enzyme 1 and the nf-b signaling pathway may serve as potential targets for regulation of ptx3 expression in the retina. therefore, their role in ptx3 expression needs to be further investigated. |
surgical intervention is an option for a subset of the 30% of people with epilepsy whose seizures are resistant to antiseizure drugs. some patients with multifocal tonic, atonic, or myoclonic seizures may benefit from partial or complete corpus callosotomy,. partial callosotomy involves sectioning the anterior half to two - thirds of the corpus callosum. when reduction in symptoms has been unsatisfactory following partial callosal resection, complete callosotomy can be beneficial. minimally invasive methods, such as mri - guided laser interstitial thermal ablation (mtla), are being employed to functionally remove or ablate seizure foci. this therapy can achieve effectiveness similar to that of traditional resection, but with reduced morbidity compared with open surgery. laser ablation for epilepsy has been applied to the periventricular region for heterotopia and the hypothalamus for removal of seizure - inducing hamartomas. here, we present the first reported instance of laser ablation of the splenium following a previous unsuccessful anterior callosotomy in a patient with intractable generalized epilepsy. the patient is a 30-year - old ambidextrous male with a history of developmental delay, hypothyroidism, and symptomatic generalized epilepsy. onset of poor feeding and limb jerking episodes began at 9 months in an otherwise normal infancy. seizures worsened throughout childhood and adolescence, despite the introduction of numerous antiseizure medications, including carbamazepine, vigabatrin, gabapentin, lamotrigine, clobazam, clonazepam, diazepam, pyridoxine, valproate, corticosteroids, and topiramate. magnetic resonance imaging in 2004 was unable to identify any structural correlate of the seizures. electroencephalogram monitoring in january of 2005 demonstrated multifocal epileptiform discharges and slow spike waves emanating from the right frontal lobe. a subsequent routine eeg captured a seizure with clonic activity beginning over the left hemisphere. in june of 2005, at another hospital, the patient underwent an anterior two - thirds corpus callosotomy via a right anterior craniotomy. this procedure provided roughly three months of seizure freedom before the patient relapsed with atonic seizures. upon first presentation to our institution in 2006, the patient was experiencing roughly 4 - 5 generalized tonic - clonic and 1 - 2 myoclonic seizures each day, and weekly atonic seizures. additional therapies included felbamate, phenobarbital, rufinamide, and levetiracetam, in combination with a ketogenic diet and combinations of previously used medications. in may of 2013, a 24-hour continuous eeg captured at least 3 different types of seizures : focal left hemisphere seizures, myoclonic atonic seizures, and tonic clonic seizures. both the myoclonic clonic seizures appeared to have bisynchronous onset, suggesting a possible justification for completing the callosotomy. preoperatively, the patient was having 1525 seizures per day, including 12 drop attacks per day. functional status and wakefulness were compromised by the frequent seizures and the side effects of medications. in april of 2015, a stereotactic laser interstitial thermal ablation of the splenium was performed to complete his corpus callosotomy. the operation utilized standard technique for laser - induced thermal therapy, which is a minimally invasive approach for frameless stereotactic placement of a laser fiber at an intracranial target, in this case, the splenium (fig. a unilateral trajectory was first mapped from the right parietal region down to the splenium on preoperative mri scans (fig. 3a) that were merged with a preoperative ct scan and then coregistered to an intraoperative ct with skull fiducials, a medtronic o - arm, and the stealthstation navigation system. the patient was placed in mayfield pin fixation and turned prone. five skull fiducials were used for registration with an error of less than 0.2 mm, and the target was acquired with an alignment error of less than 0.4 mm. the periosteum was exposed, a twist - drill burr hole was made, and the trajectory was rechecked prior to passing the guide cannula and advancing the laser fiber down the planned trajectory. after removing the stylet, the laser was secured with a bolt system, and the o - arm imaging (coregistered to preoperative ct and mri) was utilized to verify placement of the laser, which was found to be within 1 mm of the planned target. after removal of skull fiducials and mayfield pin fixation, the patient was transferred to the mri suite for target acquisition and performance of the laser ablation procedure. trajectory and target acquisition were shown to be excellent, and a test dose was administered. only one ablation was sufficient to cover the entire area of the splenium (fig. d). after removal of all surgical equipment and closure of the wound site, the laser - induced thermal ablation of the splenium was well - tolerated without any associated neurological impairment. at 4 months after surgery the sedating medicines, phenobarbital and clonazepam, have been reduced. because of the severe developmental disability and nonverbal status of the patient, it is not possible to evaluate for the presence of a disconnection syndrome. the patient is a 30-year - old ambidextrous male with a history of developmental delay, hypothyroidism, and symptomatic generalized epilepsy. onset of poor feeding and limb jerking episodes began at 9 months in an otherwise normal infancy. seizures worsened throughout childhood and adolescence, despite the introduction of numerous antiseizure medications, including carbamazepine, vigabatrin, gabapentin, lamotrigine, clobazam, clonazepam, diazepam, pyridoxine, valproate, corticosteroids, and topiramate. magnetic resonance imaging in 2004 was unable to identify any structural correlate of the seizures. electroencephalogram monitoring in january of 2005 demonstrated multifocal epileptiform discharges and slow spike waves emanating from the right frontal lobe. a subsequent routine eeg captured a seizure with clonic activity beginning over the left hemisphere. in june of 2005, at another hospital, the patient underwent an anterior two - thirds corpus callosotomy via a right anterior craniotomy. this procedure provided roughly three months of seizure freedom before the patient relapsed with atonic seizures. upon first presentation to our institution in 2006, the patient was experiencing roughly 4 - 5 generalized tonic - clonic and 1 - 2 myoclonic seizures each day, and weekly atonic seizures. additional therapies included felbamate, phenobarbital, rufinamide, and levetiracetam, in combination with a ketogenic diet and combinations of previously used medications. in may of 2013, a 24-hour continuous eeg captured at least 3 different types of seizures : focal left hemisphere seizures, myoclonic atonic seizures, and tonic clonic seizures. both the myoclonic clonic seizures appeared to have bisynchronous onset, suggesting a possible justification for completing the callosotomy. preoperatively, the patient was having 1525 seizures per day, including 12 drop attacks per day. functional status and wakefulness were compromised by the frequent seizures and the side effects of medications. in april of 2015, a stereotactic laser interstitial thermal ablation of the splenium was performed to complete his corpus callosotomy. the operation utilized standard technique for laser - induced thermal therapy, which is a minimally invasive approach for frameless stereotactic placement of a laser fiber at an intracranial target, in this case, the splenium (fig. a unilateral trajectory was first mapped from the right parietal region down to the splenium on preoperative mri scans (fig. 3a) that were merged with a preoperative ct scan and then coregistered to an intraoperative ct with skull fiducials, a medtronic o - arm, and the stealthstation navigation system. the patient was placed in mayfield pin fixation and turned prone. five skull fiducials were used for registration with an error of less than 0.2 mm, and the target was acquired with an alignment error of less than 0.4 mm. the periosteum was exposed, a twist - drill burr hole was made, and the trajectory was rechecked prior to passing the guide cannula and advancing the laser fiber down the planned trajectory. after removing the stylet, the laser was secured with a bolt system, and the o - arm imaging (coregistered to preoperative ct and mri) was utilized to verify placement of the laser, which was found to be within 1 mm of the planned target. after removal of skull fiducials and mayfield pin fixation, the patient was transferred to the mri suite for target acquisition and performance of the laser ablation procedure. trajectory and target acquisition were shown to be excellent, and a test dose was administered. only one ablation was sufficient to cover the entire area of the splenium (fig. d). after removal of all surgical equipment and closure of the wound site, the laser - induced thermal ablation of the splenium was well - tolerated without any associated neurological impairment. at 4 months after surgery the sedating medicines, phenobarbital and clonazepam, have been reduced. because of the severe developmental disability and nonverbal status of the patient, it is not possible to evaluate for the presence of a disconnection syndrome. corpus callosotomy has been utilized since at least the 1940s as an effective treatment for medically refractory epilepsy, particularly for patients who are not good candidates for a focal resection,. by severing the primary connection between hemispheres, the spread of epileptic activity from one hemisphere to another can be prevented. while this does not eliminate seizures, it has been shown to achieve significant reduction in symptom severity and frequency, especially for tonic and atonic seizures that cause drop attacks. partial callosotomies are thought to offer some advantages over complete callosotomies by preserving perceptual connections between hemispheres and limiting so called disconnection syndromes sometimes associated with total callosotomy, while still achieving meaningful reductions in symptoms. nevertheless, there is good evidence that completion of corpus callosotomy can reduce symptoms when a partial resection has been unsuccessful. ours is the first report on stereotactic laser interstitial thermal ablation of the splenium following anterior callosotomy. however, stereotactic radiosurgery entails a delay of benefit and long - term risks of radiation. this current laser - ablation based, minimally invasive technique marks a novel iteration of this procedure that offers numerous advantages over open surgery while producing the same surgical goal of complete division of the corpus callosum. magnetic resonance imaging - guided laser interstitial thermal ablation may be particularly effective for callosotomy because laser interstitial thermal therapy is dependent on the absorbance properties of the target tissue, and is best suited for relatively homogenous tissues, such as the corpus callosum, that will ablate uniformly with rapid heat drop - off to adjacent structures. this technique may even offer advantages over other minimally invasive techniques, such as stereotactic radiosurgery, because the extremely well - demarcated region of ablation (with transition zone depth of less than 1 mm) can be confirmed immediately with t1-weighted or flair mr images. modification of the approach and trajectory would be required for an anterior two - thirds or complete callosotomy. because of its numerous advantages over traditional surgery, mtla is likely to be an important treatment of medically refractory epilepsy in the years to come. while its initial application has largely been in the treatment of focal seizures due to temporal lobe epilepsy, reports of its use in hypothalamic hamartomas, periventricular heterotopia, and the current splenial ablation demonstrate that the technique can be effective in a variety of scenarios. more experience will be needed to provide a comparison of the completeness of anatomical or physiological resection of laser versus open posterior callosotomy, to evaluate the technique for full callosotomies, and to measure the long - term efficacy. none of the authors have any conflicts of interest to disclose with respect to this manuscript. | partial or complete corpus callosotomies have been applied, traditionally via open surgical or radiosurgical approaches, for the treatment of epilepsy in patients with multifocal tonic, atonic, or myoclonic seizures. minimally invasive methods, such as mri - guided laser interstitial thermal ablation (mtla), are being employed to functionally remove or ablate seizure foci in the treatment of epilepsy. this therapy can achieve effectiveness similar to that of traditional resection, but with reduced morbidity compared with open surgery. here, we present a patient with a history of prior partial corpus callosotomy who continued to suffer from medically refractory epilepsy with bisynchronous onset. we report on the utilization of laser ablation of the splenium in this patient to achieve full corpus callosotomy. adequate ablation of the splenial remnant was confirmed by postoperative mri imaging, and at four - month follow - up, the patient 's seizure frequency had dropped more than 50%. this is the first reported instance of laser ablation of the splenium to achieve full corpus callosotomy following a previous unsuccessful anterior callosotomy in a patient with intractable generalized epilepsy. |
patricia (hpv-008 patricia, nct00122681) is a phase iii, multicenter, randomized, double - blind trial of the hpv-16/18 as04-adjuvanted vaccine vs a hepatitis a vaccine as control (1:1 randomization). the study design and methodology have been fully described elsewhere [1, 15 ]. it should be noted that neither a history of gws nor current gws were exclusion criteria and that no systematic collection of gw data was done. written informed consent / assent was obtained from all participants and/or their parents, and the study was approved by independent ethics committees or institutional review boards. the primary objective of the trial was to assess the efficacy of the hpv-16/18 as04-adjuvanted vaccine against cin2 + associated with hpv-16 or hpv-18 in women who were seronegative at baseline and dna negative at baseline and month 6 for the corresponding type. the objectives of this post hoc analysis, with the end - of - study data at month 48, were to assess vaccine efficacy (ve) against 6-month persistent infection (6mpi) with hpv types 6, 11 and other low - risk (non - oncogenic) hpv types in the total vaccinated cohort (tvc) and in the tvc naive population (see below). cervical samples were obtained from all women every 6 months for hpv dna typing. a broad - spectrum polymerase chain reaction (pcr) spf10 hpv lipa25 version 1 and spf10 hpv deia (labo biomedical products, rijswijk, netherlands ; based on licensed innogenetics spf10 technology) were used to test the cervical and biopsy samples for the presence of dna from 14 oncogenic hpv types (16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, and 68) and 11 non - oncogenic hpv types (6, 11, 34, 40, 42, 43, 44, 53, 54, 70, and 74). because the pcr assay used in this study generated data for 11 low - risk types in addition to 14 high - risk types gynecological and cytological examinations were carried out every 12 months, and women were referred for colposcopy and appropriate treatment, as per the protocol - specified clinical management algorithm. the tvc included all women (n = 18 644) who received at least 1 dose and included women regardless of their baseline cytological, serological, or hpv dna status. the tvc naive (for all 25 hpv types tested) is a subset of this group (n = 11 286), comprising women who had received at least 1 dose and at baseline had normal cytology and were dna negative for 14 oncogenic and 11 low - risk hpv types. persistent cervical hpv infection (6-month definition) was defined as the detection of the same hpv type (by pcr) in cervical samples at 2 consecutive evaluations over approximately a 6-month interval. vaccine efficacy and 95% confidence intervals (cis) were calculated using a conditional exact method. event rates were calculated as the number of cases divided by the total follow - up in years and were expressed per 100 woman - years. the analyses presented here are all post hoc exploratory analyses and should be interpreted with this limitation. statistical analyses were performed using statistical analysis system (sas) 9.1 and proc statxact-7 on windows xp. the trial was carried out between may 2004 and november 2009. in the tvc, mean and median follow - up times were 43.7 months (standard deviation, 11.7) and 47.4 months (range, 062 ; 3.6 and 4.0 years), respectively. there were no significant demographic differences between the hpv vaccine group and the controls ; in particular, there was no difference in the reported number of sexual partners in the last year or reported sexually transmitted infections (data not shown). since women were not specifically screened, diagnosed, or treated for the presence of gws, efficacy against clinical disease can not be evaluated ; however, results of vaccine efficacy against 6mpi infection with low - risk hpv types may be presented. in the tvc, no efficacy was seen for 6mpi with either hpv-6 or hpv-11 (table 1). however, ve of 23.2% (95% ci, 0.5 to 40.9) was seen for hpv-70. in the tvc nave (for all 25 hpv types tested) cohort, ve against 6mpi was 34.5% (95% ci, 11.3 to 51.8) for hpv-6/11 combined, 34.9% (95% ci, 9.1 to 53.7) for hpv-6, 49.5% (95% ci, 21.0 to 68.3) for hpv-74, and 26.7% (95% ci, 8.1 to 41.7) for hpv-53. ve against 6mpi with hpv-11 was comparable at 30.3% (table 1), but the 95% cis included 0. table 1.incidence rates and vaccine efficacy against 6-month persistent infections with all low - risk human papillomavirus types (total vaccinated cohort [tvc ] and tvc naive for all types)efficacy (95% ci)6-month persistent infectionefficacy (95% confidence interval)vaccinecontrolcasesratecasesratetvcn = 8863n = 8870 hpv-6/112320.722600.8110.9% (6.8 to 25.6) hpv-61820.562080.6512.6% (7.2 to 28.8) hpv-11530.16560.175.3% (40.4 to 36.2) hpv-34240.07270.0811.1 (60.1 to 50.9) hpv-40350.11340.102.9 (70.1 to 37.7) hpv-42480.15390.1223.2 (93.1 to 20.9) hpv-43650.20540.1720.6 (76.3 to 17.3) hpv-441020.311040.321.9 (30.2 to 26.1) hpv-534391.394501.422.5 (11.5 to 14.7) hpv-541940.601720.5313.0 (39.5 to 8.5) hpv-701070.331390.4323.2 (0.5 to 40.9) hpv-741160.361480.4621.7 (0.5 to 39.2)tvc naiven = 5259n = 5249 hpv-6/11740.371120.5734.5% (11.3 to 51.8) hpv-6610.31930.4734.9% (9.1 to 53.7) hpv-11140.07200.1030.3% (45.0 to 67.5) hpv-3490.04130.0731.1% (74.2 to 74.0) hpv-40140.07120.0616.1% (174.9 to 50.2) hpv-42200.10120.0666.1% (272.6 to 22.7) hpv-43220.11220.110.4% (88.5 to 47.4) hpv-44300.15310.813.7% (64.5 to 43.7) hpv-531370.691850.2526.7% (8.1 to 41.7) hpv-54760.38650.3316.5% (64.8 to 17.5) hpv-70340.17460.2326.5% (17.0 to 54.3) hpv-74310.16610.3149.5% (21.0 to 68.3)n is the number of evaluable women in each group. rate is the number of cases divided by sum of the follow - up period (per 100 woman - years) ; follow - up period started on the day after the first vaccine dose. women were included in the analysis of the tvc regardless of their hpv dna or serostatus at month 0. women included in the analysis of the tvc nave for all types cohort were hpv dna negative for all 14 oncogenic and 11 non - oncogenic hpv types tested for, were seronegative for hpv-16 and hpv-18, and had negative cytology at month 0. types tested for hpv dna were hpv-6, hpv-11, hpv-16, hpv-18, hpv-31, hpv-33, hpv-34, hpv-35, hpv-39, hpv-40, hpv-42, hpv-43, hpv-44, hpv-45, hpv-51, hpv-52, hpv-53, hpv-54, hpv-56, hpv-58, hpv-59, hpv-66, hpv-68, hpv-70, and hpv-74.abbreviations : hpv, human papillomavirus ; tvc, total vaccinated cohort. incidence rates and vaccine efficacy against 6-month persistent infections with all low - risk human papillomavirus types (total vaccinated cohort [tvc ] and tvc naive for all types) n is the number of evaluable women in each group. rate is the number of cases divided by sum of the follow - up period (per 100 woman - years) ; follow - up period started on the day after the first vaccine dose. women were included in the analysis of the tvc regardless of their hpv dna or serostatus at month 0. women included in the analysis of the tvc nave for all types cohort were hpv dna negative for all 14 oncogenic and 11 non - oncogenic hpv types tested for, were seronegative for hpv-16 and hpv-18, and had negative cytology at month 0. types tested for hpv dna were hpv-6, hpv-11, hpv-16, hpv-18, hpv-31, hpv-33, hpv-34, hpv-35, hpv-39, hpv-40, hpv-42, hpv-43, hpv-44, hpv-45, hpv-51, hpv-52, hpv-53, hpv-54, hpv-56, hpv-58, hpv-59, hpv-66, hpv-68, hpv-70, and hpv-74. the finding that the hpv-16/18 as04-adjuvanted vaccine demonstrates efficacy against 6-month persistent infection with low - risk hpv types is unexpected, as the low - risk types are phylogenetically not closely related to the oncogenic types. however, in the last few years, cell - mediated immune responses to hpv-6 and hpv-11 in women vaccinated with the hpv-16/18 as04-adjuvanted vaccine have been observed. a study comparing l1-specific t helper cell responses induced by the hpv-6/11/16/18 vaccine and the hpv-16/18 as04-adjuvanted vaccine showed that the latter induced cross - reactive t - cell responses to hpv-31 and hpv-45, which was to be expected from the efficacy data. in addition, hpv-6 and hpv-11 l1-reactive t cells were induced after administration of the hpv-16/18 as04-adjuvanted vaccine at frequencies comparable to those in hpv-6/11/16/18 vaccine recipients. a comparative trial showed that both hpv vaccines induced circulating antigen - specific cd4 + t cells to hpv-31 and hpv-45 [19, 20 ]. at month 24, the proportion of t - cell responders was overall significantly higher in the hpv-16/18 as04-adjuvanted vaccine group than in the hpv-6/11/16/18 vaccine group for hpv-31 (86.7% vs 43.3% ; p =.0009) and for hpv-45 (62.5% vs 37.5% ; p =.0793). a follow - up study 4 to 6 years post vaccination showed that frequencies of l1-specific cd4+/cd154+/interferon - gamma / interleukin-2 + t cells in women vaccinated with the hpv-6/11/16/18 vaccine and the hpv-16/18 as04-adjuvanted vaccine were similar for hpv types 6 and 11 (hpv-6 : 0.045% vs 0.045% ; hpv-11 : 0.051% vs 0.033%, respectively) [10, 21 ]. cross - reactivity at the t helper cell (cd4 receptor) level is a plausible mechanism for the vaccine - induced cross protection observed. the cross - reactivity between vaccine and non - vaccine hpv types may be explained by homology and/or structural similarities, which are conserved due to a cross - linking function within the l1 virus - like particle (vlp). antibodies to hpv-6 and hpv-11 can also be measured in women vaccinated with the hpv-16/18 as04-adjuvanted vaccine. to what extent these antibodies are directed against the monoclonal antibody identified epitope(s) in the conformationally identical fg loop of the hpv-6/11, hpv-16, and hpv-18 l1 protein remains to be defined. using vlp enzyme - linked immunosorbent assay, the hpv-6/11 titers induced by the hpv-16/18 as04-adjuvanted vaccine were significantly lower compared with those induced by the hpv-6/11/16/18 vaccine. to date there is no known immune correlate of protection, and the finding that only minimal concentrations of neutralizing antibodies are sufficient to prevent hpv infection could help to explain the observed vaccine efficacy against nonvaccine low - risk types. in this study, efficacy against 6mpi rather than gws was assessed ; ideally, a clinical trial should be conducted to determine the ve of the hpv-16/18 as04-adjuvanted vaccine against gws before definitive conclusions can be drawn. however, if the findings of howell jones are borne out in further ecological or clinical studies, the additional protection afforded against gws could be included in cost benefit analyses, and may assist governments in deciding which vaccine should receive public funding. in conclusion, results from this post hoc analysis suggest that in the tvc naive (negative for all 25 hpv types tested) cohort, a population that approximates young women before sexual debut (the target population for public health vaccination programs), the hpv-16/18 as04-adjuvanted vaccine appears to have moderate efficacy against persistent infections with a number of low - risk hpv types (including hpv-6/11, hpv-74), which together are responsible for the majority of external gws. some protection against low - risk hpv types afforded by the hpv-16/18 as04-adjuvanted vaccine may help to explain the decrease in gws diagnoses seen in the cohort of adolescent females who were offered the hpv-16/18 as04-adjuvanted vaccine in england in recent years, contrary to expectation. | background. public health england has reported a decrease of up to 20.8% in new diagnoses of external genital warts (gws) among women aged < 19 years since the national vaccination program with the human papillomavirus (hpv)-16/18 as04-adjuvanted vaccine began in 2008. a post hoc analysis of the phase iii patricia (papilloma trial against cancer in young adults) trial (nct00122681) was performed to ascertain whether protection against low - risk hpv types was apparent.methods. vaccine efficacy (ve) at 48 months was assessed against 6-month persistent infection (6mpi) with low - risk hpv types in the total vaccinated cohort (tvc) and in the tvc naive (for 25 hpv types tested) populations.results. in the tvc naive cohort, ve against 6mpi (95% confidence interval) was 34.5% (11.3 to 51.8) for hpv-6/11, 34.9% (9.1 to 53.7) for hpv-6, 30.3% (45.0 to 67.5) for hpv-11, and 49.5% (21.0 to 68.3) for hpv-74.conclusions. the hpv-16/18 as04-adjuvanted vaccine appears to have moderate efficacy against persistent infections with a number of low - risk hpv types (hpv-6/11/74), which are responsible for the majority of external gws, and recently, antibody and cell - mediated immune response to hpv-6/11 have been observed. these findings may help to explain the decrease in external gw diagnoses seen in england. |
in industrialised countries injury is the leading cause of death in childhood, accounting for 40% of all childhood deaths between the ages of 1 and 14 years.1 in the eu, every day 14 children die, 2240 are admitted to a hospital and 28 000 attend an emergency department as a result of injury.2 for children under the age of 5 years, the majority of fatal and non - fatal injuries occur in the home.3 children 's risk of injury varies by a range of factors including age, gender and various socioeconomic parameters, with boys having more frequent and more serious injuries.1 4 5 the gender gap is such that it has been estimated by the organisation for economic cooperation and development that if boys had the same injury mortality rate as girls then up to 5000 lives could be saved per year.1 of all injury outcomes, brain trauma is considered severe and impacts significantly on mortality.6 a report on traumatic brain injury (tbi) in the republic of ireland7 found that men were three times more likely to sustain a significant tbi than women and that these gender differences were present from a very young age. brain trauma injury among children contributes significantly to the burden of injury in society and to a large number of disability - adjusted life - years.1 while previous studies have demonstrated gender differences in injury prevalence and fatalities,1 little has been done to investigate gender differences in tbi in young children. therefore, this study aimed to determine the age at which gender differences in tbi start to emerge and to examine tbi - related gender differences in the mechanism and circumstance of injury occurrence, injury severity, the types of injury sustained and injury - related mortality, using tbi data from the two neurosurgical units (nsu) in ireland over a 24-month period. data on tbi were collected from all patients referred to the two nsu in the republic of ireland ; the national neurosurgical centre in beaumont hospital, dublin and the nsu in cork university hospital, cork. prospective data were collected over a 24-month period from april 2002 to april 2004 from beaumont hospital and over a 12-month period from november 2003 to november 2004 from cork university hospital. referrals to the neurosurgical service were initially made by telephone to the on - call team and ct images were electronically linked. the case and imaging were reviewed and a decision was made either to transfer the patient to the neurosurgical centre for admission or to treat the patient in the referring hospital with management advice. data were collected by members of the tbi research group from the nsu admissions records and from the on - all telephone logbooks, inputted onto a microsoft excel database and analysed using stata 9.8 preliminary results on the adult population revealed large gender variations.7 this paper presents further statistical analysis of the paediatric data examining gender differences in tbi. there were 2095 patients registered on the tbi database, of which 342 patients were under 17 years of age and were included in this study. the mean age was 7.6 years, the median age was 8 years (95% ci 6 to 8 years). age distribution by gender for traumatic brain injury (tbi) in a paediatric population. falls were the leading cause of tbi in children (56% in total) with higher rates in girls (66%) than boys (51%). boys were more likely to be injured on the roads (30% of all boys injured) or by being struck by or against an object (17% of all boys injuries). these gender differences are statistically significant (p<0.005, mann whitney u test) and are shown in figure 2. access the article online to view this figure in colour. over half (56%) of tbi sustained by children was as a result of a fall. girls were statistically more likely to sustain a tbi by falling than boys (66% vs 51%, p=0.005). boys were more likely to fall from a height than girls (p=0.024) ; 27 boys (29%) fell more than 2 m or 10 steps compared with seven girls (12%). there was no statistically significant gender difference in the type of surface (hard or soft) that the children fell onto (p=0.52), nor in injury severity (p=0.69). boys were more likely to sustain other injuries associated with the fall ; five boys who fell more than 2 m had other injuries, while there were no documented significant other injuries among the injured girls. mortality after falling (for children admitted to a nsu) was higher for boys but the number of fatalities was too low to calculate statistical significance (five boys and one girl died following a fall). while there was no significant gender difference in the mechanism of road injury, there was a significant difference in the use of protective devices and risk behaviour between boys and girls. overall, girls were statistically more likely to be secured using an age - appropriate restraint in a car than boys (mann whitney u test p<0.05) ; eight out of nine girls and five out of 18 boys wore an age - appropriate restraint in a vehicle (table 1). no medical notes recorded any child cyclist wearing a helmet ; however, nine cyclists were documented to have had no helmet at the time of injury ; eight were boys and the other was a girl. the home was the most frequent location of injury ; half the girls and over one - third of boys were injured there (table 2). overall, gender differences were found in relation to the location or circumstance of the injury (p<0.05), with girls being significantly more likely to be injured at home (p<0.02) and boys being injured more during other activities (p<0.05) or in unknown circumstances (p<0.05). the number of children injured in education and occupation were too low for meaningful analysis. other includes the categories struck by or against and known, but unclassifiable circumstances. ten boys (4%) were intentionally injured by another person ; one infant (< 1 year), two children (512 years) and seven adolescents (1316 years). eight of the boys assaulted had an initial glasgow coma scale (gsc) score between 13 and 15, while the remaining two boys sustained a more severe injury (gcs 38). the less severely injured boys sustained cerebral contusions (four), skull fractures (three), extradural haemhorrhage (edh) (two) and an intracerebral bleed. the more severely injured boys had a subdural haemorrhage (sdh), a subarachnoid haemorrhage and cerebral contusions. while all tbi are considered potentially severe injuries, this study also examined the severity level of tbi using the gcs. injuries were categorised as mild (initial gcs 1315), moderate (gcs 912) and severe (gcs 38). there were significant gender differences in injury pattern (table 3), with boys statistically more likely to sustain an extradural haematoma (p=0.014) and girls more likely to sustain a subdural haematoma (p=0.011). skull fractures, cerebral contusions, subarachnoid haemorrhage and intracerebral bleeds did not show any gender variation. two - thirds (28 out of 42) of the patients with an edh had a skull fracture. the major mechanism of injury for girls sustaining a sdh was falls less than 2 m (table 4), while edh in boys were caused by a mix of falls (51%), road collisions (26%) and being either struck by or against an object (23%). pattern of traumatic brain injury sustained by gender (n=342) patients may have more than one injury type (so total may exceed n=342). mechanism of injury for patients with an extradural haemhorrhage and subdural haemhorrhage mechanism of injury for one boy with an extradural haemorrhage was unknown. deaths outside the nsu and deaths for patients treated in the referring hospital were not recorded. the nsu mortality rate was 7% but when gender was considered this changed to 9% (10 out of 117) and 4% (two out of 57) for boys and girls, respectively, but did not reach statistical significance (p=0.22). over half (56%) of tbi sustained by children was as a result of a fall. girls were statistically more likely to sustain a tbi by falling than boys (66% vs 51%, p=0.005). boys were more likely to fall from a height than girls (p=0.024) ; 27 boys (29%) fell more than 2 m or 10 steps compared with seven girls (12%). there was no statistically significant gender difference in the type of surface (hard or soft) that the children fell onto (p=0.52), nor in injury severity (p=0.69). boys were more likely to sustain other injuries associated with the fall ; five boys who fell more than 2 m had other injuries, while there were no documented significant other injuries among the injured girls. mortality after falling (for children admitted to a nsu) was higher for boys but the number of fatalities was too low to calculate statistical significance (five boys and one girl died following a fall). while there was no significant gender difference in the mechanism of road injury, there was a significant difference in the use of protective devices and risk behaviour between boys and girls. overall, girls were statistically more likely to be secured using an age - appropriate restraint in a car than boys (mann whitney u test p<0.05) ; eight out of nine girls and five out of 18 boys wore an age - appropriate restraint in a vehicle (table 1). no medical notes recorded any child cyclist wearing a helmet ; however, nine cyclists were documented to have had no helmet at the time of injury ; eight were boys and the other was a girl. the home was the most frequent location of injury ; half the girls and over one - third of boys were injured there (table 2). overall, gender differences were found in relation to the location or circumstance of the injury (p<0.05), with girls being significantly more likely to be injured at home (p<0.02) and boys being injured more during other activities (p<0.05) or in unknown circumstances (p<0.05). the number of children injured in education and occupation were too low for meaningful analysis. other includes the categories struck by or against and known, but unclassifiable circumstances. ten boys (4%) were intentionally injured by another person ; one infant (< 1 year), two children (512 years) and seven adolescents (1316 years). eight of the boys assaulted had an initial glasgow coma scale (gsc) score between 13 and 15, while the remaining two boys sustained a more severe injury (gcs 38). the less severely injured boys sustained cerebral contusions (four), skull fractures (three), extradural haemhorrhage (edh) (two) and an intracerebral bleed. the more severely injured boys had a subdural haemorrhage (sdh), a subarachnoid haemorrhage and cerebral contusions. while all tbi are considered potentially severe injuries, this study also examined the severity level of tbi using the gcs. injuries were categorised as mild (initial gcs 1315), moderate (gcs 912) and severe (gcs 38). there were significant gender differences in injury pattern (table 3), with boys statistically more likely to sustain an extradural haematoma (p=0.014) and girls more likely to sustain a subdural haematoma (p=0.011). skull fractures, cerebral contusions, subarachnoid haemorrhage and intracerebral bleeds did not show any gender variation. two - thirds (28 out of 42) of the patients with an edh had a skull fracture. the major mechanism of injury for girls sustaining a sdh was falls less than 2 m (table 4), while edh in boys were caused by a mix of falls (51%), road collisions (26%) and being either struck by or against an object (23%). pattern of traumatic brain injury sustained by gender (n=342) patients may have more than one injury type (so total may exceed n=342). mechanism of injury for patients with an extradural haemhorrhage and subdural haemhorrhage mechanism of injury for one boy with an extradural haemorrhage was unknown.. deaths outside the nsu and deaths for patients treated in the referring hospital were not recorded. the nsu mortality rate was 7% but when gender was considered this changed to 9% (10 out of 117) and 4% (two out of 57) for boys and girls, respectively, but did not reach statistical significance (p=0.22). the key findings of the study are that falls are responsible for the majority of tbi in children. significant gender differences exist, are evident from an early age, and are present throughout childhood and adolescence. boys sustain injuries associated with a greater energy transfer (falls greater than 2 m), are less likely to use protective devices and are more likely to be injured deliberately. this results in a different pattern of injury, with potentially higher levels of associated injury and mortality. road - related injuries and falls are the main causes of severe trauma in children, with head injuries being the main cause of death.6 9 10 11 our findings suggest that while falls occur more frequently in girls ; boys falls tend to be more severe. this finding is supported by the differences in fall mechanism, with boys more likely to fall from height compared to girls. similarly, more boys who were admitted with tbi were injured in a motor collision compared to girls, with a much higher proportion of boys across the age groups not using appropriate restraints. some studies have previously addressed gender differences in risk perception,10 11 some specifically in relation to traffic.12 13 our findings demonstrate that inappropriate restraint is evident at a much earlier age, a time when guardians are responsible for ensuring the safety of child passengers. graine13 has demonstrated that gender differences in obeying rules in adolescence are very much determined by perceived sex stereotypes more than the biological sex. however, our findings suggest that such stereotypes may exist in guardians, who may be more tolerant (or even encouraging) towards risk - prone behaviour among boys, such as climbing heights, and may be more lenient towards boys who refuse to use restraints while in the car.14 15 the gender differences demonstrated in relation to car restraint devices is of particular importance given that in some studies almost half of all tbi result from road collisions.9 10 studies have demonstrated that being an unrestrained occupant, injury to the head and a young age were all associated with a more severe outcome following a road collision.11 girls were not reported to have been injured intentionally in this study. the current study found that 4% of boys were intentionally injured and the risk is greatest for adolescent boys. the intentional injuries in this paper were assaults and no intentional self - harm was reported. data from the trauma audit research network in england6 found that 1.9% of all severe trauma in children was intentional. a scottish study of paediatric mortality from trauma9 found that the incidence of assault and suicide was higher in boys. in a further paper by the same authors16 they state that intentional injury poses a greater threat to child health than any single cause of unintentional injury. the rates of non - operable tbi (parenchymal bleeds and contusions) were similar in boys and girls. however, for operable tbi (edh and sdh), statistical gender differences exist with boys more likely to sustain an edh and girls more likely to have a sdh. the major mechanism for both edh and sdh is falls and up to 50% of these significant falls occur at home. the current study is based on 24-month data collected in the two neurosurgical centres in ireland. all cases that were admitted for tbi were logged and the data present a high level of completeness. yet, for those under 17 years the number of cases is still relatively low and limits the ability to conduct statistical testing. although the majority of the tbi cases in ireland will be admitted to these centres, results should be interpreted with caution. the mortality rates in this study only record the deaths that occurred within the nsu. reliable data on mortality were not available for children who were not admitted to the nsu or who were discharged from the unit and subsequently died. the current study is based on 24-month data collected in the two neurosurgical centres in ireland. all cases that were admitted for tbi were logged and the data present a high level of completeness. yet, for those under 17 years the number of cases is still relatively low and limits the ability to conduct statistical testing. although the majority of the tbi cases in ireland will be admitted to these centres, results should be interpreted with caution. the mortality rates in this study only record the deaths that occurred within the nsu. reliable data on mortality were not available for children who were not admitted to the nsu or who were discharged from the unit and subsequently died. boys are more likely to fall from a greater height, be assaulted, and tend to sustain other injuries. whether or not the reason for such differences is sex stereotyping, it is clear that guardians should be guided to care for boys in the same manner as girls. this includes restricting the height to which they are allowed to climb, and ensuring that they are appropriately restrained when in vehicles. | introductionthe phillips report on traumatic brain injury (tbi) in ireland found that injury was more frequent in men and that gender differences were present in childhood. this study determined when gender differences emerge and examined the effect of gender on the mechanism of injury, injury type and severity and outcome.methodsa national prospective, observational study was conducted over a 2-year period. all patients under 17 years of age referred to a neurosurgical service following tbi were included. data on patient demographics, events surrounding injury, injury type and severity, patient management and outcome were collected from on - call logbooks and neurosurgical admissions records.results342 patients were included. falls were the leading cause of injury for both sexes. boys injuries tended to involve greater energy transfer and involved more risk - prone behaviour resulting in a higher rate of other (non - brain) injury and a higher mortality rate. intentional injury occurred only in boys. while injury severity was similar for boys and girls, significant gender differences in injury type were present ; extradural haematomas were significantly higher in boys (p=0.014) and subdural haematomas were significantly higher in girls (p=0.011). mortality was 1.8% for girls and 4.3% for boys.conclusionsfalls were responsible for most tbi, the home is the most common place of injury and non - operable tbi was common. these findings relate to all children. significant gender differences exist from infancy. boys sustained injuries associated with a greater energy transfer, were less likely to use protective devices and more likely to be injured deliberately. this results in a different pattern of injury, higher levels of associated injury and a higher mortality rate. |
intravesical bacillus calmette - gurin (bcg) instillation is one of the most effective treatment options for non - muscle - invasive bladder cancer, and is generally well tolerated. bcg is an attenuated, but live, strain of mycobacteria, belonging to the mycobacterium tuberculosis complex. it is capable of invasive behavior and occasionally causes systemic or local infections, particularly in immunocompromised hosts. thus, following intravesical bcg therapy bcg infections including granulomatous prostatitis, epididymo - orchitis, osteomyelitis, psoas abscess, and systemic disseminated infection, have been reported, although such events are uncommon. we report here a case of infected aortic aneurysm caused by mycobacterium bovis after intravesical bcg instillation. three days before admission he had developed cyanotic changes in his left lower extremity, which gradually worsened. eighteen months previously the patient had been diagnosed with superficial bladder cancer and had undergone transurethral resection of the bladder tumor (tur - b), followed by intravesical bcg therapy (onco tice strain bcg ; 12.5 mg bcg injected through a catheter into the bladder every week for 6 weeks). three months later, another tur - b was performed because atypical cells were observed in his urine. histological examination revealed transitional cell carcinoma in situ and he underwent another 3 cycles of intravesicular bcg therapy (13 months, 10 months, and 1 month prior to presentation). the patient 's temperature was 37.5 and his other vital signs were stable. computed tomography of the abdomen revealed an aortic aneurysm involving the abdominal aortic bifurcation and left proximal common iliac artery, with inflammatory soft tissue infiltration in the pre - vertebral space and focal pseudoaneurysm ; these had not been seen on a scan performed 17 months earlier (fig. 1). magnetic resonance imaging of the lumbar spine revealed minor cortical erosion of the l4 vertebral body and paravertebral phlegmonous and abscess - like soft tissue lesions around the l4 vertebral body (fig. 2). excision of the aneurysm, wide debridement of the psoas abscess, and an in situ aorto - biiliac interposition graft with a rifampicin - soaked dacron graft were performed. surgical exploration confirmed a 33 cm cystic lesion in the anterior of the psoas muscle, with a hole leading to the site of suspected spondylitis. pathologic examination revealed chronic granulomatous inflammation of the vascular wall, but microscopy did not reveal any microorganism. a polymerase chain reaction (pcr) was positive for m. tuberculosis complex, and 10 colonies of this complex were isolated after 31 days of culture of the resected aneurysm specimen. two pcr assays were performed to differentiate the pathogen from other members of the m. tuberculosis complex and to identify sub - strains of bcg. real - time pcr, targeting the 53-bp mycobacterial interspersed repetitive units (mirus) of the senx3-regx3 intergenic region (ir), was carried out to differentiate m. bovis bcg and non - bcg m. tuberculosis complex. bcg strains contain only 77-bp mycobacterial interspersed repetitive units (miru) within the senx3-regx3 ir, whereas other strains of the m. tuberculosis complex contain both 77-bp and 53-bp mirus. in addition, we performed a multiplex pcr assay, using dual - priming oligonucleotide primers targeting the rd1 gene, for simultaneous identification of the m. tuberculosis complex and m. bovis bcg. both the real - time pcr and the multiplex pcr revealed that the isolated organism was m. bovis bcg. antibiotic susceptibility testing showed that the organism was resistant to pyrazinamide but susceptible to other drugs (table 1). anti - tuberculosis medication with isoniazid, rifampicin, ethambutol, and levofloxacin was started after confirmation of pathologic diagnosis. after 2 months, levofloxacin was discontinued, and isoniazid, rifampicin, and ethambutol were continued for additional 10 months. bcg has been used as a live attenuated vaccine of m. bovis against human tuberculosis since 1921 and as immunotherapy for cancer since 1976. intravesical bcg instillation therapy has been proven to be safe. according to lamm., the most common complications among 2,602 patients were fever (2.9%), hematuria (1%) and infectious granulomatous, while complications such as prostatitis, pneumonia, hepatitis, osteomyelitis and life - threatening bcg sepsis were rare (< 1%). although intravesical bcg therapy has been widely implemented in korea, there are only a few case reports of local infectious complications. with regard to systemic infectious complications, there is one case report of granulomatous hepatitis and one of pulmonary complications, but in both instances only pathologic evidence suggesting m. bovis infection was presented and the infection was not confirmed microbiologically. we report here a case of a systemic infectious complication involving an infected aortic aneurysm and infectious spondylitis with microbiological confirmation of m. bovis in a patient who had received intravesical bcg therapy. infected aneurysm occurring concomitant with infective spondylitis is rare. to date, fewer than 30 patients with infected aneurysm following intravesical bcg therapy have been reported. in 2009, coscas. analyzed 21 patients with aneurysm after bcg therapy and reported that the mean interval between completion of bcg therapy and diagnosis of aneurysm was 23 months (range 4 - 69 months) and the most frequently involved artery was the abdominal aorta (76%), followed by the aortic arch, femoral arteries, popliteal arteries and carotid arteries. in our case, the interval between completion of bcg therapy and diagnosis of infected aneurysm was less than 1 month (17 days) and the multiple infected aneurysm involved the abdominal aortic bifurcation and the left proximal common iliac artery. infection of the aorta after instillation of bcg may be due to either hematogenous spread through the vasa vasorum or lymphatic spread through the retroperitoneum. the aorta can also become infected after direct spread of the infection from a psoas abscess or osteomyelitis. in our case, the latter mechanism may well have been responsible because the hole communicated with a psoas abscess, and the infected aortic aneurysm was observed during surgical inspection. since the risk of metastatic spread may increase significantly when the bladder epithelium is grossly disrupted, bcg should not be instilled within 2 weeks of transurethral resection of bladder cancer, or bladder biopsy. for the same reason, it should not be given if signs or symptoms of macroscopic hematuria or traumatic catheterization remain. other contraindications are urethral stenosis, active tuberculosis, previously documented bcg sepsis, urinary tract infection, and immunosuppression. in our case, when bcg infection is suspected after intravesical bcg therapy, anti - tuberculosis treatment should be promptly initiated. it is important to choose the most appropriate anti - tuberculosis agent but data on the susceptibility of bcg to different anti - tuberculosis agents are limited. as m. bovis has lost the pyrazinamidase gene, all bcg vaccine strains are intrinsically resistant to pyrazinamide. to our knowledge, there are no published data on the anti - tuberculosis susceptibility profile of the bcg tice strain used for intravesical bcg therapy in korea. in our case, the m. bovis isolated was susceptible to all the anti - tuberculosis agents tested, except pyrazinamide. we report here the first case of infected aneurysm with spondylitis following bcg instillation in korea, and show that the causative species was the mycobacterium, m. bovis bcg. this case emphasizes that, although intravesical bcg therapy is considered safe, systemic complications resulting from vascular infection occasionally occur. | a 70-year - old man presented with lower back pain and cyanotic changes in his left lower extremity. he was diagnosed with infected aortic aneurysm and infectious spondylitis. he had received intravesical bacillus calmette - gurin (bcg) therapy up to 1 month before the onset of symptoms. the aneurysm was excised and an aorto - biiliac interposition graft was performed. mycobacterium tuberculosis complex was cultured in the surgical specimens. real - time polymerase chain reaction (pcr) targeting the senx3-regx3 region, and multiplex pcr using dual - priming oligonucleotide primers targeting the rd1 gene, revealed that the organism isolated was mycobacterium bovis bcg. the patient took anti - tuberculosis medication for 1 year, and there was no evidence of recurrence at 18 months follow - up. |
it was first documented by muller in 1904 followed by jadassohn and lewandowsky in 1906. it is classified into four types, of which the two important ones include type-1 (jadassohn lewandowsky type) and type-2 (jackson lawler type). these are characterized by subungual hyperkeratosis, focal palmoplantar keratoderma, oral leukokeratosis, which are usually present since birth. an 8-year - old boy born of nonconsanguineous parentage, with normal developmental milestones for his age ; presented with nail defects since birth along with numerous elevated skin lesions. cutaneous examination revealed dystrophic, discolored, and thickened fingernails and toenails, along with massive subungual hyperkeratosis producing a distal elevation of nail plates and wedge - shaped deformity of the nails. this resulted in the upward growth of the distal edge of the nail plates, accompanied by angulation of the lateral border [figures 13 ]. besides, there were numerous pin - head sized follicular papules over the entire body, concentrated over the face, back, buttocks, abdomen, and gluteal region [figures 46 ]. besides palmoplantar keratoderma was present, along with painful hyperkeratotic plaques [figures 7 and 8 ]. mucosal examination was significant for the presence of asymptomatic oral leukokeratosis over the dorsum of the tongue [figure 9 ]. routine laboratory investigations including complete hemogram, hepatic profile, and renal profile were within normal limits. skin biopsy from a hyperkeratotic lesion around elbow showed orthokeratosis and acanthosis [figure 10 ]. genetic and molecular biological studies could not be carried out due to lack of infrastructure facilities. he was prescribed oral vitamin a at a dose of 25,000 iu, under a multidisciplinary approach after consultation with department of pediatrics and ophthalmology. he has been referred to the department of physical medicine and rehabilitation for weight control exercises. dystrophic finger nails with subungual hyperkeratosis close - up picture of nails showing massive subungual hyperkeratosis dystrophic toe nails with wedge - shaped deformity numerous pin - head sized follicular papules over the body (anterior view) numerous pin - head sized follicular papules over the body (posterior view) follicular papules distributed over the nose and perioral regions hyperkeratotic papules over the palms note the massive plantar keratoderma dorsum of the tongue showing leukokeratosis photomicrograph of a hyperkeratotic plaque showing massive orthokeratosis and acanthosis (h and e, 100) heterozygous mutations involving keratins k6a or k16 are associated with pc-1 whereas those involving k6b and k17 are associated with pc-2. although, autosomal dominant mode is the most common mode of inheritance, there are reports of autosomal recessive inheritance as well. pc has been classified into four types, the common clinical findings in all of them being painful and debilitating plantar keratodermas, nail dystrophy and hypertrophy, oral leukokeratosis, palmoplantar hyperhidrosis, and a variety of epidermal cysts. patients with type 1 pc (jadassohn lewandowsky syndrome) are characterized by the presence of nail dystrophy since birth. this may be accompanied with painful paronychia, hyperkeratosis of palms and soles over the pressure sites, oral leukokeratosis, palmoplantar hyperhidrosis, and follicular keratotic papules distributed throughout the body. another characteristic finding is the presence of verrucous lesions over the elbows, knees, popliteal fossae, and ankles. in addition, hoarseness of voice is also an important feature of pc type 1. in addition to the above mentioned findings, type 2 pc (jackson lawler syndrome) has the features of natal teeth, hair anomalies including pili torti, unruly hair, and bushy eyebrows. oral leukokeratosis and palmoplantar keratoderma is milder in comparison to type 1 pc, but the development of epidermal cysts or steatocysts are the hallmark findings in type 2 pc. type 4 pc is termed as pc tarda, which is manifested in the second or third decade of life. rare cases of pachyonychia congenita tarda have been reported with symptoms developing in the fifth decade of life. recently, a case of pachyonychia congenita associated with b - cell lymphoma has been reported. an interesting case of pc with wooly hair in a 10 month old patient has been also reported. apart from the numerous oral manifestations, median rhomboid glossitis in association with pc has been documented. the clinical features in our case are suggestive of pc type 1 with characteristic subungual hyperkeratosis and follicular papules over the entire body since birth. reported a case of pc, which was treated with oral vitamin a and e. vitamin a stimulates differentiation and leads to normalization of accelerated epidermopoiesis of pathological keratinocytes of epidermis of skin and nail. the upper limit of dose of vitamin a in pediatric patients (18 years) is 17,50035,000 iu. hypervitaminosis a occurs when the consumption is more than or equal to 100,000 iu for months. the patient is under stringent follow - up every 2 weeks, for systemic check - up including fundoscopy and signs of irritability. for management of pain and discomfort due to the palmoplantar keratoderma, patient was advised limitation of walking and standing, use of soft shoes, control of body weight, and use of appropriate clothing. mechanism of manipulating gene expression is now possible which in future, may help to suppress or correct the genetic defect in the chromosomes. the only effective treatment though is nail surgery with radical excision of the nail bed and matrix and grafting at the site but patient being very young, this line of treatment was not accepted by the parents. the authors certify that they have obtained all appropriate patient consent forms. in the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal. the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity can not be guaranteed. full blown cases of pachyonychia congenita are rarely found and our case is unique because it features all the classical manifestations of this rare disease. the authors certify that they have obtained all appropriate patient consent forms. in the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal. the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity can not be guaranteed. full blown cases of pachyonychia congenita are rarely found and our case is unique because it features all the classical manifestations of this rare disease. the authors certify that they have obtained all appropriate patient consent forms. in the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal. the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity can not be guaranteed.. full blown cases of pachyonychia congenita are rarely found and our case is unique because it features all the classical manifestations of this rare disease. | the case of an 8-year - old boy is hereby reported, who presented with nail dystrophy, subungual hyperkeratosis, oral leukokeratosis, and numerous follicular papules all over the body. the features were consistent with a diagnosis of pachyonychia congenita type 1. the case is being reported for its rarity. we also discuss in a nutshell, the literature till date. |
economics, in addition to medical research, influences how medical care is delivered, organized, and progresses. fee - for - service (ffs) payment encourages the delivery of services ; given the current payment structure, time spent doing procedures is rewarded more highly than time with patients or coordinating care. some argue these relative payments should be adjusted ; shifting that balance, however, will differentially affect various specialties. the concern of this discussion, however, is different : regardless of the relative values for evaluation and management versus procedural services, the prevailing system of fee - for - individual - service offers no economic incentives for clinicians to efficiently organize the care delivered by other providers. this paper discusses the role of payment incentives and how realignment of payment can improve both efficiency and quality at any point in time and, furthermore, reduce the rate of growth in expenditures. the focus here is not on payment levels providers typically complain fees are too low and payors complain they are too high but rather on the way that payment is structured. one alternative to fee - for - service, global capitation, provides cost - containing incentives because it gives decision makers a fixed budget for all the care their enrollees need. it works well in highly integrated practices but not for independent practitioners without an external entity to coordinate their care. the failures of utilization management in the managed care efforts of the 1990s demonstrated the need for an alternative approach. episode - based payment is such an alternative to ffs on the one hand and global capitation on the other. bundling together all the payments associated with an episode of care can better align incentives. building on medicare s model for hospital payment, one can define new expanded diagnosis - related groups (edrgs) including not just hospital costs, but also physician and other costs during the stay and during appropriate preadmission and postdischarge periods. physicians and hospitals voluntarily forming an entity i will call a care delivery team (cdt) would receive a bundled payment, along with complete flexibility in allocating the funds. the new financial incentives will encourage efficient care for the patient ; the episode focus will facilitate measuring patient outcomes. payment levels, moreover, should be based on the resources used by cdts achieving superior outcomes, thereby fostering innovation improving outcomes and reducing waste in such care. medicare has recently begun a demonstration of selected aspects of this concept for certain cardiovascular and joint replacement procedures. restructuring payment for the ongoing management of chronic illnesses is more complex than the much shorter and more concentrated care associated with an inpatient episode. in brief, for the former i propose a comprehensive approach with monthly chronic illness management payments to accounts associated with primary care physicians. these payments will be risk - adjusted to reflect the chronic conditions of the physicians patients, and reflect the resources used by those clinicians achieving better than average outcomes for their patients. a major risk pool will pay the cdts directly for hospital and similar episodes, so the chronic illness management payments need not include those costs. a payment intermediary working on behalf of the primary care physicians will monitor the data and, for those whose patients have lower use of inpatient care but comparable or better outcomes, argue that they should receive higher monthly payments for their superior management of care. the monthly payments serve as the basis for paying not just the primary care physician, but also specialists and other ambulatory care services. the comprehensive approach includes methods to ensure enrollment, the sharing of data, and creation of information useful to both patients and clinicians. the first section of this paper outlines several ways payment can be structured, from the perspectives of how dollars are disbursed by payors and how they are received by providers. the second expands on one of these options, payment from a payor bundled around an inpatient episode, and discusses how funds may be disbursed among the providers involved in the episode. a final section discusses the likely implications of such a payment scheme on efficiency, quality, and long - term cost growth. healthcare providers (meaning both physicians and hospitals) often use the term reimbursement for their services, but this is a misnomer. reimbursement actually refers to situations in which one is paid back for money spent on an official or approved purpose. for example, i trusted the sponsors of this workshop would reimburse my travel expenses upon presentation of the appropriate receipts. they would, however, impose certain constraints, such as reimbursing only up to full coach airfare if i chose to fly first class. on the other hand, they would not pay me the price of a full coach ticket if i purchased a nonrefundable, discounted ticket using a roundabout route. that would be akin to offering me a fixed allowance to cover all travel expenses, thereby shifting the risk and potential benefits to me. a fixed travel allowance would give me incentives to search for cheaper airfares (perhaps freeing up funds for an honorarium), but it would also force me to bear the risk of occasionally absorbing the expenses of nonrefundable tickets for trips that had to be cancelled. providers prefer to talk about reimbursement for at least two reasons, one historical and the other political. the historical reason is that hospitals used to have contracts with blue cross plans (and for a number of years, medicare) in which they kept track of the proportion of their patients attributed to these payors and at the end of the year were literally reimbursed for that share of their allowable costs. the political reason is that reimbursement suggests merely being paid back for expenses incurred the language implies no one is making a profit. payments are often above actual costs incurred ; if not, the facility would eventually go bankrupt. medicare sets the payments it offers hospitals and typically does not care whether these payments cover the costs of its patients it is like a fixed travel allowance based on the destination of the traveler. medicare payments to physicians are also set unilaterally, but those payments are based on each unit of service, as if i were allowed a fixed amount for each airline trip, each taxi ride, and each meal. in both instances, there are vigorous arguments over the adequacy of the payments, but little discussion as to the effects of how the payments are structured. ffs generates some revenue for nearly every service provided ; depending on the costs of delivering those services, providers may make or lose money. there are some variable costs involved (such as supplies), but medical practice has substantial fixed costs, reflecting rent and depreciation, as well as malpractice insurance, office staff, and operations. the individual physician is usually the residual claimant ; his or her income is based on what is left after all the costs are subtracted from the revenue received. high fixed costs mean additional services rendered are likely to be profitable even if on average the revenue received is less than the average cost. in economic terms, this means the marginal (or incremental) revenue exceeds marginal (or incremental) costs associated with one additional service rendered. incentive effects, or the additional effort one will expend in a given situation, usually reflect such incremental revenues and costs. this is not necessarily problematic ; the vast majority of businesses have incentives to offer more of whatever they sell. applying these incentives in the context of medical care, however, is problematic because of what is being sold or purchased. physicians sell specific highly skilled services, hospitals sell operating room time and bed days, pharmacies sell drugs, and device manufacturers sell devices. most patients, however, want a treatment for their health problem or ongoing care to keep them healthy. in this context, the specific services and items provided by practitioners are simply inputs. while patients often have (or should have) substantial say in decisions about their care, they rarely have the technical expertise to assess the value of specific inputs in achieving a desired outcome. if a patient needs a surgical procedure, such as for a knee arthroplasty to improve mobility, the patient typically selects the surgeon who decides on the best technical approach. if the system works reasonably well, nothing goes wrong and the procedure is a success. there is nothing, however, in the simple incentives of ffs payment that drives the overall process to become more efficient or produce better quality. for example, the instruments and approach a particular surgeon prefers may be optimal for him or her, but if each surgeon uses a different approach, the operating room team does not have the opportunity to standardize procedures to reduce waste and errors. a useful, although not perfect, analogy is what happens when undertaking a kitchen remodel. the initial decision as to whether to go forward with the project is based on the homeowner s assessment of the benefits and costs involved. in a kitchen remodel situation, some people decide to serve as their own general contractors, hiring specialists to do specific jobs and coordinating the scheduling. unless very experienced however, the do - it - yourself general contractor often runs into problems : the floor refinisher wants to be last, but the painter wants to do the baseboards last. general contractors earn their fees both for ensuring seamless coordination and for their expertise in choosing subcontractors who will perform as expected. the subcontractors know failure to perform will affect repeat business, not from the current client, but from the general contractor who needs reliable subcontractors and can offer many jobs in the future. the problem with the general contractor - subcontractor model is since subcontractors are often working for several general contactors, scheduling can not be fully integrated and each subcontractor s slightly different work style may not mesh well with others. a few companies, however, are fully integrated ; their own crews do all the electrical, plumbing, countertop, and other work. being able to control everything, they prepare all the materials well in advance in the warehouse and then gut the kitchen and install everything in a week of on - site work. they reduce labor costs for initial steps by having workers move from one job to another in the warehouse in the same day. the firm, however, has to bear the risk of having staff on the payroll even when demand slacks off. from the perspective of anyone who has lived through a remodel, the promise of a job completed in a week and on budget is very attractive and this may offset a somewhat higher bid price. although a hospital may hire nursing and other staff and facilitate access to certain hospital - based physicians, such as radiologists, anesthesiologists, and pathologists, each physician typically acts as an independent provider. manage the clinical aspects of the case, but he or she can not pay the others to change their schedules, agree on a practice approach, or otherwise coordinate their activities. various laws and regulations preclude such financial interconnections. even in the unusual situations in which physicians are employed by the same entity, such as a medical school, the new system would pay for an episode of care, such as a knee arthroplasty or care for a heart attack. these are events a patient can understand, rather than the long list of services, disposables, and devices used in delivering the care. although i refer to inpatient care, i include similar episodes addressed in an outpatient setting ; a procedure involving a 23-hour stay is not much different to the patient from one that extends to 25 hours. the episode should include closely related preadmission services, such as an mri performed 1 day before a procedure or the emergency room visit ending in the heart attack admission. likewise, reasonable postdischarge care should be included, including costs due to complications. one s initial reaction may be that such a system could not work because of various legal, political, and economic risk - related reasons. the legal and regulatory barriers, such as those precluding fee - splitting and gainsharing are changeable by new legislation ; i will return later to legitimate concerns about the troublesome conflicts of interest that could arise from simply removing existing prohibitions. the political barriers are less the big p political issues any proposal might face in congress, but those arising between hospitals and their medical staffs. there is often little trust between hospitals and their affiliated physicians. although the hospital accounts for the largest share of expenses within most episodes, there is no reason for it to be the recipient of the payment. instead, the bundled payment could be offered only to a new entity able and willing to provide (or assure the provision of) all the services needed for the episode. legislation altering existing gainsharing regulations could require that any such new entity establish its own forms of governance acceptable to its members. a hospital could threaten to replace individual physicians, but it will not be able to establish such a new entity on its own. because most patients seek out physicians and surgeons, not hospitals, this will encourage win - win arrangements. the new governance rules could be written by the participants with an appropriate balance of power between the hospital on the one hand and the participating physicians on the other. not all physicians on a medical staff will want (or need) to participate in the entity ; just enough are required for the new entity to reasonably accept episode - based payments. avoiding an all - or - none situation reduces the power of a single physician to block the deal. cdts might initially be encouraged under an expansion of medicare s demonstration authority to offer bundled payments to the voluntarily formed new entities. the amount might be no less than that paid under existing part a and b coverage and be guaranteed not to decline even if there are fee schedule reductions in the future. teaching hospitals creating cdts will avoid the cumbersome reporting and documentation requirements of the house staff and attending roles in each patient s care. the new cdt acts as the general contactor accepting a fixed price for the remodel and arranging for and paying the various subcontractors needed to complete the job. a hospital might participate in several separate cdts, such as for cardiovascular or orthopaedic care. the economic risk concerns arise from the nature of a bundled payment to the cdt. even within a specific diagnosis - related group (drg), costs vary across patients in the same hospital. including responsibility for complications within a reasonable period of time substantially increases that variability ; ignoring complications the post - discharge responsibility period may be drg - specific and should maximize the likelihood that readmissions are associated with the cdt s care, rather than the patient s underlying medical problems or poor care in the ambulatory setting. for example, a longer window may be appropriate for admissions of basically healthy people undergoing a joint replacement or delivering a baby, while only a short period would be used for a person with a naturally recurring problem, such as chf or emphysema. in some instances a readmission is clearly a complication of care, such as a wound infection with a hospital - specific strain of mrsa. in other instances, the readmission is almost certainly unrelated, such as for a post - discharge gunshot wound. most readmissions have less clear causes. across many patients with a given initial reason for admission, however, one can readily estimate the percentage readmitted within a specific period of time for any reason. that percentage times the average cost of those readmissions is the amount that would be added to the payment to the cdt to cover, on average, the cost of readmissions. medicare already absorbs some similar episode - based risk with outlier payments for individual hospital admissions that are substantially more costly than the specific drg payment. the payment to the cdt would include the average cost of a reinsurance policy protecting the cdt from the risk associated with unusually expensive cases. for example, if outlier cases and readmissions currently account for 10% of all costs associated with a specific drg, the payment could be increased by a bit over 10% (to allow for the legitimate costs of the reinsurer) and cdts could purchase coverage on their own. reinsurers will have an interest in keeping down such costs and will seek to learn the techniques used by cdts able to reduce occurrences of complications, or manage them very well once they occur. reinsurers can go beyond merely selecting cdts with low complication rates ; some will learn best practice techniques from their clients and pass them on to those cdts wanting to improve their processes. in contrast, the current medicare system provides neither incentives nor mechanisms to learn and disseminate better techniques. the notion of bringing together hospitals and physicians in an economically aligned unit is not new ; it is part of what underlies the concept of focused factories for orthopaedic and cardiovascular services. the interest in them indicates the technical and internal political issues to make them work can be overcome. the first is, by specializing in certain highly profitable categories of care and by drawing those patients out of other hospitals, they impair the ability of the latter to cross - subsidize patients who are less profitable. the first problem is merely a reflection of the current medicare drg rates ; they are too high for some procedures and too low for many other categories. this is a problem of how those prices are set rather than the underlying concept of bundling ; the new severity - adjusted rates implemented by medicare are designed to address this problem. in a reformed system, prices for each inpatient episode (including all professional and facility costs, plus the appropriate preadmission and postdischarge care) should yield roughly the same profit (or net revenue) margin for each edrg category. with the need for cross - subsidies eliminated, some will object that simply having appropriate pricing of edrgs, however, does not eliminate the need for cross - subsidies to cover the uninsured. that is a legitimate point if the discussion is focusing only on a specific payor, such as medicare, but can be addressed by universal coverage for such care, as outlined in my proposal for comprehensive reform. appropriately setting prices for bundled payment is not trivial, but doing it well can yield several benefits. medicare currently sets relative drg weights based largely on the costs nationally of caring for patients in each drg category with adjustments to reflect local input prices. the final figures are then subject to across - the - board adjustments to meet certain budgetary goals and hence reflect high - level political lobbying. a different approach would use not the national average as the standard, but the costs incurred by those cdts achieving better than average outcomes for their patients, again adjusting for local wage rates. (the focus here is on relatively proximate outcomes, eg, unexpected complications or achieving anticipated functional levels within 6 months. long - term outcomes, such as graft patency or device longevity, probably reflect more the choice of intervention than the skill of the cdt.) in contrast to most current attempts to reward quality that focus on either hard endpoints, such as mortality, or adherence to professionally determined processes, the choice of outcome measures should be more patient - oriented. that is, panels should be established with substantial patient input to identify the outcomes patients desire most. clinicians will then be able to experiment with new processes to improve outcomes and reduce costs. we should instead rely on the incentives inherent in bundled payments to reduce the inputs used in an episode ; other market - based incentives to address the prices for physician time are discussed elsewhere. a commitment to set payments based on what it takes to achieve superior outcomes will increase demand by physicians for collection of better data on outcomes. it will also lead to improving risk adjustment techniques to account for underlying patient comorbidities and understanding what techniques lead to the best outcomes. the new system should also explicitly cover the additional costs of new treatments as they are being assessed, much as medicare offers such coverage with evidence determination. better outcomes at specific cdts will result in not just professional and public recognition (thereby attracting referrals) but also in an increased payment level for all, as the new interventions are included in the costs reported by the cdts achieving superior outcomes. the problem of demand creation the classic example being that of redding hospital (redding, ca) and its cardiovascular team who performed procedures on patients who did not need them must also be addressed. physicians choosing to be part of a cdt can not be in the position to self - refer by deciding that a certain patient needs a procedure or admission. clinicians financially involved with the cdt should not be assessing the need for an admission, but in many instances primary care physicians will not have the technical expertise to make such decisions. independent specialists doing those assessments can be compensated based on their time and expenses, without rewards for decisions to either intervene or withhold care. once it has been determined a procedure or admission is warranted, patients will have free choice of cdt teams and physicians within cdts. the cdt members can certainly decide not to undertake a procedure on a given patient. physicians not part of a cdt, however, can be involved in the outpatient management of care and in the decisions of whether an admission or a procedure is needed. primary care physicians and independent medical evaluators outside the cdt may have important insights on the care of patients and the cdt would be able to pay them a fee comparable to their time in the office for consultations. to illustrate the potential of bundled payments, we use data for patients undergoing knee arthroplasties during 2003 to 2004 drawn from enrollees in a set of large commercial health plans across the nation. these unpublished data came from the proprietary ingenix impact national managed care database which is a large administrative claims database containing inpatient confinement, medical claims, pharmacy claims, and member eligibility information. for this illustration, we used a 10% random sample (over 800,000 members from numerous national health plans during 200304). of these, 284,446 members had 24 months of continuous commercial (non - medicare) coverage and 4,910 had knee surgery. the database includes some people aged 65 years and over covered primarily through employer - based plans rather than medicare. the dollar amounts reflect allowed charges as paid by the plans and patients. we used the ingenix symmetry episode grouper 6.5 to create episodes of care, but focus only on the services during and proximate to a hospital admission. patients were selected if they had a knee arthroplasty (cpt-4 code 27447) with a physician identified as an orthopaedic surgeon. we excluded a small number (95) of persons with more than one knee arthroplasty in a year because we could not determine whether the code reflected complications of the index knee operation rather than surgery on the other knee. we only included patients grouped into etg 0721 (joint degeneration, localized, with surgery - knee and lower leg) for the knee arthroplasty group. we examined costs by various types of service and those delivered either during the inpatient stay or in the period before or after admission. the mean episode cost across all 4910 patients was $ 22,454, with an average of $ 18,596 incurred during the inpatient stay and the remainder during preadmission and postdischarge periods, including rehabilitation stays. not all patients incur charges in all categories, and some charges are seen for only a small fraction of all patients (table 1). the total cost is rather stable, with a coefficient of variation of 37%, indicating the standard deviation is a little more than 1/3 of the mean. nearly all episodes include charges for hospital, anesthesiologist, and ancillary costs, along with surgeon fees. hospital costs averaged $ 13,189, nearly 60% of the total, whereas surgeon fees during the episode averaged $ 2948, or about 13% of the total. total ancillary fees exceed surgeon fees but with a coefficient of variation nearly three times as large.table 1costs for various services incurred during knee arthroplasty episodes of care commercially insured patients, 2003 to 2004costs during inpatient stays (acute only)cost preadmission and postdischarge (including rehabilitation stays)costs for the whole episodeservices / feesnumber of patientsmean cost for userscoefficient of variationmean for all patientsnumber of patientsmean cost for userscoefficient of variationmean for all patientsmean costpercent of totalcoefficient of variationsurgeon fees4910$268556.3%$26854273$302146.1%$263$2948 13.1%53.4%inpatient facility costs4910$13,18938.6%$13,1890$0$0$13,189 58.7%38.6%anesthesiologist fees4587$69965.3%$653480$232115.9%$23$676 3%78.4%other professional fees2213$395133.9%$1783713$636154.1%$481$659 2.9%169%ancillary costs 4496$2065212.7%$18914867$1440113.4%$1428$3319 14.8%141.2%rehabilitation facility costs0$0$0848$785251.9%$1356$1356 6.0%300.4%outpatient pharmacy costs0$0$03509$431151.8%$308$308 1.4%212.4%total costs4910 $ 18,5964899$3866111.3%$3858$22,454 100%37% costs for various services incurred during knee arthroplasty episodes of care commercially insured patients, 2003 to 2004 without detailed clinical information, it is impossible to know whether the variability in resource use across patient episodes is due simply to underlying patient factors. the widely documented variability in resource use across geographic areas and individual medical centers without any clear evidence in similar differences in patient risk, however, suggests patient factors may not fully account for what we see. (see, for example, discussions by jon lurie in this issue.) there is little evidence that areas or centers with consistently higher resource use achieve better patient outcomes. in the absence of compelling new information, we should modify the usual baseline in which it is assumed (1) most variation is due to patient risk factors, and (2) increased resource use controlling for patient risk factors is indicative of higher quality. instead, our baseline should be (1) the extent of patient - specific need must be measured with better clinical data, and (2) outcomes should be continually assessed to determine what mixes of inputs and services are best for specific patient problems. the potential for creative resource allocation is apparent ; a relatively small reduction in hospital costs could allow substantially increased compensation for other members of a cdt (table 1). such a saving in hospital costs, however, is likely to require adaptations by nursing staff, anesthesiologists, and others involved in the episode. these solutions can not be easily imposed by external bodies but are likely to be achieved voluntarily by the new cdts with the flexibility to allocate funds. ancillary costs exceed surgeon fees but are usually ordered by the surgeons ; they could also be a source of savings. cdts choosing to share some of their savings with price - sensitive patients may increase their volume, and hence total revenue, at the expense of other, less efficient cdts. there is much concern about how much we spend on medical care and how uneven is the quality of care we get, but little attention has been paid to the implications of how we pay medical care providers. the current system of fees for individual services is at the root of both our cost and quality problems. the incentives implicit in a bundled payment covering all the relevant providers involved in an inpatient episode can encourage far more efficiency. if designed appropriately, such a payment approach can also facilitate learning what works best in practice and then changing processes to improve quality. in the long run, this new focus will impact the translation of new research into practice, emphasizing increased efficiency and improved value. the conceptual arguments in favor of episode - based payments are clear ; the details and transition are more challenging. episode - based payments and bundling are far more complex in the outpatient setting for numerous reasons, so this discussion has focused on inpatient (and similarly intensive and short duration) care. it is easy for payors to bundle payment but much harder for independent practitioners and a hospital to figure out how to share risk, rewards, and responsibilities among themselves. with the fear of malpractice in the background, few providers will leap at the opportunity to redesign care in ways that may appear to be doing less, so a reform of the liability system must be considered. for a few categories of conditions, such as acute myocardial infarction, there is a reasonable consensus on outcomes, such as death within 30 days, that are reasonably well measured. for most patients, such as those having elective surgery, procedure - associated death should be a rare or never event. from the patient perspective, outcomes matter most ; not only should each professional do his or her job excellently, but the overall processes of the team members involved in the care must facilitate hand - offs, optimal choices of treatments, and continuous improvement. developing agreed - upon outcome measures incorporating both professional opinion on what can be measured and patient values on what is important will take time and resources. the model proposed here focuses on quality measures across groups of similar patients, with ample opportunity for increased risk adjustment as we learn about relevant risk factors. without having to score each case as a success or failure one can use robust statistical approaches that account for random variation while seeking to detect consistently better than expected performance. none of these issues are trivial, but the best way to address them is to begin with volunteering organizations, feasible target conditions, and demonstrations. episode - based payment creates incentives for physicians to focus on the best ways to manage resources during an episode of illness or care ; the cdt creates the economic unit in which such incentives can be turned into action. (the issues are somewhat more complicated in managing an ongoing chronic illness involving a wide range of providers who may not normally work together and often requiring patient cooperation in adherence to various treatment regimens. thus, different incentives and structures are needed for a relatively brief episode of care focused on an inpatient stay and for the ongoing management of illness. episode - based payment allows the appropriate compensation for the time professionals need to effectively coordinate services. surgeons may still be paid per procedure and anesthesiologists by the time in the operating room, while the hospitalists involved in the postoperative care may be paid by the shift. the cdt may hire patient navigators and technical support personnel to efficiently coordinate all the members of the team or optimize the use of various implants and instrumentation. payment rates, moreover, might be adjusted by workload to better use scarce resources, such as encouraging the use of operating room time during weekends. the bundled payment that includes not just professional fees, moreover, creates incentives to redesign workflow within the inpatient stay and at other times during the episode. this can range from relatively simple things, such as standard preoperative protocols and drug regimens, to agreeing on a smaller number of implants or a preferred formulary. while one can not assume all imaging performed by referring clinicians meets the cdt s standards cdts might even train referring clinicians in the techniques needed to reduce the preadmission workup process a savings not only in resources but also in time and risk to the patient. episode - based payment must be designed to avoid incentives to skimp on care to increase profits to the cdt. quality concerns, however, are not particularly associated with episode - based payment, as illustrated by the tainted medications derived from chinese manufacturers. there are always incentives for producers to skimp on quality if it is not well monitored and if the losses due to discovery are small relative to the gains for the badly behaving producer. if we no longer assume more is necessarily better, then paying for episodes means attention will shift to the outcomes of episodes, a measure about which patients care, rather than to the processes and inputs, about which they have little technical knowledge. using independent medical evaluators outside the cdts to assess whether surgery is needed offers a useful approach. the independent medical evaluators may also recommend which cdts have the best outcomes based on both risk - adjusted outcome measures and reports gathered from the patients seen. turning our focus to outcomes few meaningful measures are routinely captured in administrative data other than events that should rarely occur, such as death or serious complications. in most instances, medical and surgical interventions are not intended to postpone death but to enhance function and the quality of life. such assessments should be viewed as evaluating not the specific professionals involved but the ability of the whole team to achieve the outcomes desired by the patient and should recognize patients may differ in what they think is important. automobiles are not evaluated in the market solely based on hard end points, such as their crashworthiness and miles per gallon ; customers have varying preferences for style, reliability, and performance. highly unsafe cars should be kept off the road, but there is room for a great deal of individuality in many other aspects. just as road and track and consumer reports may rate the same cars differently, patients should be able to choose among assessment schemes that match their own preferences for certainty, performance, and processes. most healthcare professionals simply want to achieve the best outcomes for their patients, but the fear of malpractice liability may lead some to perform unnecessary tests and to be uneasy about the prospect of experimenting with new ways of organizing and delivering care. episode - based payments to cdts should be combined with reform of the malpractice liability system that benefits patients, providers, and even attorneys. in brief, if an injury occurs due to an error in the care of a patient, there should be a quick resolution with an apology by members of a cdt and compensation paid to the patient. negligence will not need to be proven ; the payment is set through an administrative determination of a preventable adverse event and the extent of the injury sustained. (medical care often involves inherent risks ; no compensation would be provided for unfortunate outcomes without evidence of an error.) plaintiffs attorneys would simply collect and document the data supporting the claim and probably be paid by the hour. a series of similar claims paid by the cdt without evidence it attempted to improve its processes, however, could result in a second - tier suit proving corporate negligence with a much larger potential award. that award would be shared with those patients (and their attorneys) involved in the earlier claims who implicitly granted access to their data. in this reformed system, patients would receive just compensation for errors and cdts would have incentives to learn from previous mistakes, two legitimate arguments of those defending the current system. physicians would not be charged with negligence for what was merely an error, even if an avoidable one, and far less would be spent on litigation, legitimate arguments of those opposing the current system. episode - based payment creates immediate economic incentives for teams to use resources more efficiently. the current incentive is to develop new medications, devices, and procedures with some promise of improved quality of care, irrespective of cost. for some innovations, their attractiveness is even enhanced by additional professional fees associated with their use ; if physicians can earn an additional fee for the procedure accompanying the biologic or device, they effectively become part of the marketing team of the manufacturer. in contrast, episode - based payment will lead clinicians to consider all costs in relation to the enhancement in quality. the most attractive innovations will be those improving quality and reducing cost, even if this means reducing what are now billable services. other innovations may have no measurable effect on quality but will reduce costs ; for instance, new technologies may allow lower - skilled workers to substitute for some of the tasks highly paid clinicians now do. with the cost of the device bundled into the payment, surgeons will demand evidence that innovative devices truly are better. device manufacturers will find, unless they have breakthrough technology with demonstrably better results, they will be financially better off lowering the costs of tried - and - true devices and gaining market share. the new incentives will, therefore, alter the mix of technological innovations entering the healthcare system, slowing the long - term rate of growth in expenditures. reform of the healthcare system needs to go beyond strategies that simply provide more people with insurance coverage that fosters inefficiency, poor quality through disincentives for coordination, and mindless cost - containment efforts through fee reductions. instead, reforms should focus on improving the payment system to appropriately align incentives and facilitate clinicians in being the best professionals they can be. brighton workshop is to discuss where we are now, where we need to go, and how to get there. nearly all observers of the us healthcare system agree it fails to cover a substantial fraction of the population and yet is more expensive than all other systems in the developed world. most agree, while the quality of care in some instances is outstanding, it is not as good as it can be. the rate of growth in expenditures is unsustainable in the long run and something needs to be done to slow this. reductions in provider payments yield short - term cost containment, but many believe the current system merely adapts by increasing the use of services and procedures, further fueling expenditure growth while devaluing physician effort and driving many clinicians out of practice. fragmented payment to individual providers for their own services is one of the causes of this sorry situation. a solution for inpatient and similar care that can work in the us environment is to bundle payments around an episode of care. this new payment will be made to a cdt composed of physicians, hospitals, and other professionals who will provide the necessary services. they will decide how to pay themselves and organize care to both increase quality and efficiency. the cdts will demand better information on patient outcomes and learn from other cdts how to constantly improve. some existing federal and state legislation will need to be modified to allow the creation of cdts. bundled payment could be done without reform of liability laws, but enacting the type of malpractice reform suggested above can help reassure physicians that well - intended innovation will not unduly expose them to liability claims. the underlying data to begin the implementation process are available, but incentives are needed to pool the data from medicare and other payors. creating the new teams will require substantial effort, so there should be clear guidance from national leaders that the payment system will be changing and incentives provided for voluntary early adopters. for example, new cdts might be guaranteed payments no less than their present medicare part a and b payments with exemptions from any future fee reductions, but the ability for their payments to be adjusted upwards along with everyone else. academic medical centers might avoid their troublesome service - by - service documentation requirements if they transformed their practice plans into cdts. a shift to episode - based payment will require a different way of thinking about how care is provided and professionals are paid. it offers, however, an economic basis for creative approaches to medical care delivery that are based on what works, yet adaptive to patient needs and scientific advances. not all the details of such a fundamental change can be worked out in advance, but we can not wait for the perfect solution to our rising healthcare costs. | economics influences how medical care is delivered, organized, and progresses. fee - for - service payment encourages delivery of services. fee - for - individual - service, however, offers no incentives for clinicians to efficiently organize the care their patients need. global capitation provides such incentives ; it works well in highly integrated practices but not for independent practitioners. the failures of utilization management in the 1990s demonstrated the need for a third alternative to better align incentives, such as bundling payment for an episode of care. building on medicare s approach to hospital payment, one can define expanded diagnosis - related groups that include all hospital, physician, and other costs during the stay and appropriate preadmission and postdischarge periods. physicians and hospitals voluntarily forming a new entity (a care delivery team) would receive such bundled payments along with complete flexibility in allocating the funds. modifications to gainsharing and antikickback rules, as well as reforms to malpractice liability laws, will facilitate the functioning of the care delivery teams. the implicit financial incentives encourage efficient care for the patient ; the episode focus will facilitate measuring patient outcomes. payment can be based on the resources used by those care delivery teams achieving superior outcomes, thereby fostering innovation improving outcomes and reducing waste. |
lower lid retraction is a frequent undesirable result following inferior rectus recession operations.13 especially in relatively larger amounts of recession, a special and close relationship between lower lid retractors and muscular fascia makes the complication more severe. one of these techniques, introduced in 1992, involves the posterior dissection of the muscle s fascia attachments and advancing the palpebral head forward.4,5 in 1996, to avoid lower lid retraction, meyer introduced a different approach and defined the lysis of these retractors during surgery.6 it has been reported in several papers that both techniques and different versions have been successfully used.710 the authors have created a novel approach, which was used successfully in their clinical study, for solving the lower lid retraction problem following inferior rectus recession in vertical strabismus without significant changes to the anatomical structure. the purpose of this study was to introduce a new technique and compare this method with the results obtained in standard inferior rectus recession. this study included 20 patients who were examined, operated on, and followed up in the authors department of strabismus, istanbul beyoglu educational and research eye hospital (istanbul, turkey). the new operation technique was created, and all operations were performed by the same surgeon (bg). approval from the prof dr n reat belger beyoglu education and research eye hospital institutional review board and ethics committee was obtained. affirmation of informed consent was obtained from each participant or one or both of the parents for patients younger than 18 years of age. the study and data collection conformed to all local laws and were compliant with the principles of the declaration of helsinki. the patients who were operated on with the standard method were labeled group 1 and those operated on with the new method were labeled group 2. demographic characteristics, diagnosis, applied operations, and follow - up time of group 1 are shown in table 1. in addition to a systematic full eye examination, suitable strabismus examination, which included motor and sensorial examination, was done in all patients. for motor evaluation, patients deviations were measured in the nine cardinal positions of gaze with an alternate prism cover test performed for both near and distance. bilateral fundus photographs and double maddox examination were used for patients torsion evaluation. for sensorial examination, bagolini striated lenses, double maddox tests for near, and worth four - dot test for both near and distant evaluation were used. sinoptophore examination was done both for horizontal, vertical, and torsional deviation measurement and for sensorial status evaluation, and lees screen test was used in cooperating patients to show restriction. topical anesthesia was not applied to any of the patients. in eight of the group 1 patients, in order not to cause lower lid retraction, inferior rectus recession was applied to the whole muscle, being careful to not exceed 4 mm to minimize the amount of eyelid retraction.11 after the globe was fixed with a 5/0 silk suture about 1 mm from the limbus at the 3 oclock and 9 oclock level and after preparing limbal conjunctiva incision, conjunctiva was dissected from the sclera up to the inferior rectus. the inferior rectus was cleaned from the connective tissue surrounding the inferior rectus muscle and opened 1.52 mm from both sides and held with a hook. intermuscular fascia, the intermuscular membrane, and all fascial attachments between the inferior rectus muscle and lockwood s ligament were dissected as far posterior as possible to the posterior septum with blunt dissection. two single - armed 6/0 vicryl sutures were passed and locked to both sides of the muscle, and the muscle was separated from its insertion. the muscle was then recessed and reinserted on the sclera at 4 mm posterior to the original insertion. in two cases (cases 2 and 8), the inferior rectus muscle was hung back 5 mm from its original insertion. in group 2 patients, the conjunctiva was opened in the same way as a limbal conjunctival incision. the conjunctiva was enlarged with blunt dissection from the sclera to the inferior rectus. to reach the inferior rectus, 1.52 mm holes from surrounding tissue from both sides were opened and the inferior rectus was held with a hook. after the muscle was held with a hook (figure 1), intermuscular fascia was recessed about 6 mm ; these tissues were recessed only for passing sutures and had locking safety from connective tissue interruption. by opening a tunnel, about 10% of the muscle tendons surface fibers, which surrounded the anterior ciliary arteries and all fascial attachments between the inferior rectus muscle and lockwood s ligament, were detached from the remaining 90% deeper fibers with fine capsule scissors (figure 2). by putting a large thin iris spatula through this tunnel, the tunnel was enlarged 67 mm posteriorly with blunt dissection (figure 3). deeper parts of the tendon fibers were tied and fixed from both sides by a 6/0 vicryl suture and were dissected from insertion with scissors (figure 4). after that, in order to separate surface and deeper parts of the fibers for enlargement posteriorly, the muscle was held with a clamp and stretched back as far as possible (figure 5). the muscle, as planned, was fixed to the sclera 38 mm from the insertion with sutures on both sides (figure 6). an antibiotic and steroid drop combination was given to patients in both groups for a week. patients were examined on the first day, first week, and first month, and every 3 months periodically in the first year and annually in following periods. in these controls, all strabismus examinations done preoperatively were repeated. lower lid retraction was determined by measuring the margin - to - reflex distance (mrd). the postoperative lower eyelid retraction was calculated by subtracting the preoperative mrd from the postoperative mrd.4,10 each 0.5 mm difference between preoperative and postoperative measurements were evaluated as one (+). the mann the median age of the patients was 24.518.6 (473) years, and the median follow - up was 9.311.8 (343) months. there was no retraction in group 2. while there was a need to perform second and third vertical muscle procedures for treating undercorrection for vertical deviations in group 1, there was no need for additional vertical muscle procedures in group 2 patients. when the groups were compared according to the number of surgeries, there was a statistically significant difference between the two procedures (p<0.05). group 1 preoperative and postoperative deviation values, amount of inferior rectus recession performed, and the difference between preoperative and postoperative mrd values are shown in table 1. except for three patients in group 1 (cases 2, 8, and 9), all patients needed a second or third operation in order to correct vertical deviation. additional surgery was done for undercorrection. for one patient (case 6) who did not need a second operation, horizontal muscle vertical transposition increased recession with hang - back technique was performed for the other two patients (cases 2 and 8). vertical correction in group 1 patients was obtained but lower lid retraction in four patients (cases 2, 5, 8, and 10) was unacceptable and additional reconstructive surgery was performed. three patients (cases 3, 4, and 6) had mild retraction and did not need any additional cosmetic surgery. if it was needed, surgery was performed at least 3 months later after the strabismus surgery. preoperative and postoperative deviation values, amount of inferior rectus recession applied, and difference between preoperative and postoperative mrd of group 2 are shown in table 2. in group 2, vertical deviation was completely corrected in one session for all patients except two (cases 2 and 9), and six of the patients (cases 4, 5, 6, 7, 8, and 10) had additional vertical transposition of the horizontal muscles during the same session. there was no lower lid retraction in patients of this group except for an acceptable scleral show in one patient (case 7). there was no statistically significant difference in the preoperative mrds of group 1 and group 2 (p=0.186), but there was a statistically significant difference in the postoperative mrds (p<0.001). as more muscle surgery was performed in one session in group 2, the final results of group 1 were taken into account when the motor success of group 2 was evaluated. following the operation, the patients sensorial status did not change. the inferior rectus muscle s special anatomical position being close to the inferior oblique and lower lid retractors and the intermuscular membranes and fascia leads to an important complication of lower lid retraction following recession surgery of this muscle. because of this complication, the classic knowledge mentioned in the textbooks is to not exceed more than 4 mm recess when performing lower rectus recession. when it is necessary to exceed this amount, it is advised that the vertical deviation be corrected by doing additional procedures in other vertical muscles.1 in order to avoid these complications, helveston suggested a large dissection going up to the vortex veins.2 however, in this study, noticeable lid retraction was not able to be avoided with this classic method despite using large dissection in all cases. in order to eliminate this complication, jampolsky suggested suturing the capsulopalpebral head separately from the recessed inferior rectus.3 the capsulopalpebral head was advanced by kushner following inferior rectus recession, who used this method and demonstrated that lower lid retraction can be avoided.4 pacheco stated that the complication can be minimized by improving this technique with adjustable form.5 following this application, many authors have stated that they have obtained successful results with this technique.7,8 however, this technique with adjustable form was used in a few of the current cases with no effective results for lower lid position. for this reason, the authors discontinued using this technique. meyer stated that the retractor lysis technique, explained by holds,12 performed in the same session with inferior rectus recession has given very successful results in many different indications. an improved technique performed in the same clinic also minimized lower lid retraction.9 likewise, this technique has been shown to be very effective, especially in restrictive cases.10 however, the authors do not have any experience with it. the technique of recessing the 90% deeper fibers of the inferior rectus muscle while keeping the approximate 10% surface fibers attached, as described in this study, avoids lower lid retraction in patients and protects normal anatomical structures with a high success rate. there was one case in both group 1 and group 2 with muscle entrapment without interruption due to blowout fracture who also benefited from this particular technique. it was observed that this technique necessitates the presence of normal or near - to - normal undisrupted anatomical structures in the inferior rectus muscle region for successful outcomes. the technique itself avoids trauma to the inferior rectus muscle and its neighboring ligaments because only the deeper part of the muscle with related connective tissue is operated upon. since the surface muscle fibers and related connective tissue have been protected to avoid damage to the main structures, postoperative overcorrection due to muscle slippage can be prevented. therefore, other recti muscle procedures can be performed in the same session without impeding anterior segment ischemia. a weakness of the authors technique is that it can not be performed with success in patients with muscles that are severely adhered to the globe, in patients with swollen muscles due to deposition of glycosaminoglycans, in patients with fibrosis, in patients in late stages of dysthyroid ophthalmopathy, or in patients with severe traumatic restrictive deviations. due to the retrospective nature of the present study patients in the two groups were not homogeneous according to their diagnosis and amount of vertical deviation. because almost all patients in group 1 were operated on before performing the new technique, their operations were performed with several steps to prevent anterior segment ischemia. however, in group 2, planned operations were needed to be performed on multiple muscles in the same session. of course, these differences changed the motor success, with a big improvement in group 2 following the first operation. the effect of the new technique solely on the one muscle (inferior rectus) could not be compared to standard recession effects. however, the authors aim was to introduce the new technique and its preventive effect of lower lid retraction. of course, the small number of patients is another limitation to achieving statistically significant results. for evaluation of the real motor effects of this new technique, further study that includes patients with homogeneous diagnosis and vertical deviations this technique requires the use of a microscope and some expertise in muscle surgery as the 10% surface fiber bundle can easily be disinserted with vigorous manipulation. in addition, complications that might be seen with the standard technique, eg, symblepharon, are avoided and the anatomical structure of the muscle and adnexal tissues is widely protected. this new novel technique was found to be an effective surgical method that permitted more recession without the risk of lower lid retraction. | purposeto introduce a novel technique of inferior rectus recession operation to allow larger amounts of recession without causing lower lid retraction and to compare this method with the results obtained in standard inferior rectus recession.material and methodsthis study included 20 patients operated on in the authors clinic. the median age of the patients was 24.518.6 (473) years and the median follow - up was 9.311.8 (343) months. ten patients operated on with the standard method were labeled group 1 and ten patients operated on with the new method were labeled group 2. without exceeding 4 mm, inferior rectus recession to the whole muscle was performed in group 1 patients. inferior rectus recession was also performed on patients in group 2 following the new method. using a spatula, approximately 10% of the muscle surface fibers were detached intact as a thin layer, and the remaining 90% of deeper fibers were recessed 48 mm as planned. patients preoperative deviations and lower lid positions were recorded. the same parameters were checked in the first and third month postoperatively. both groups were evaluated retrospectively by screening their files, and the mann whitney u test was used for statistical evaluation.resultslower lid retraction was seen in four patients of group 1. there was no retraction in group 2. while there was a need to perform additional vertical muscle procedures for vertical deviations and lower lid retractions in group 1, it was observed that there was no need for additional procedures in group 2 patients. there was a statistically meaningful difference between the two procedures (p<0.05).conclusionthis novel technique was found to be an effective surgical method for permitting more recession without the risk of lower lid retraction. |
s. weir mitchell first described a syndrome of chronic allodynic pain (that he called causalgia due to the burning quality of the pain) in soldiers of the american civil war with injuries to peripheral nerves (mitchell. this became known as sudeck s atrophy, and subsequently, with the finding that pain relief could be provided by surgical sympathectomy, as reflex sympathetic dystrophy (rsd ; evans 1946). for over a century these and several other terms were used to describe similar sets of symptoms (see lam. 1996), until in 1994 the international association for the study of pain (iasp) established a new title, complex regional pain syndrome (crps), distinguishing between cases that follow nerve damage (type ii, formerly causalgia) or in which no obvious nerve damage has occurred (type i, formerly rsd ; stanton - hicks. crps has been observed after sprains, surgery, frostbite and other soft tissue injuries (de mos. 2007 ; choi. 2008), and has also been reported in cases where no precipitating injury has occurred (veldman. the pain is disproportionate to the severity of trauma, and is associated with swelling and trophic changes of the skin and nails, neurogenic inflammation, osteoporosis as well as autonomic dysregulation : the limb becomes sweaty and is warm due to decreased sympathetic tone ; in later stages it becomes cold due to denervation or hypersensitivity to noradrenaline. symptoms can resolve within a few months of onset, although the proportion of patients for whom this can be expected is uncertain, as clinical awareness of cprs is still poor (manning 2000). patients experience symptoms for an average of 2 years before being referred to a pain centre, by which time they will have seen five doctors (choi. nonetheless, it has been estimated that 50% of cases develop into a chronic syndrome of pain and disability (schasfoort. the consensus diagnostic criteria established by the iasp include a combination of (1) the presence of an initiating noxious event or cause of immobilisation, (2) continuing pain, allodynia or hyperalgesia that is disproportionate to any inciting event, (3) evidence at some time of oedema, changes in skin blood flow or abnormal sudomotor activity in the region of the pain, and (4) absence of a condition that would otherwise account for the degree of pain and dysfunction. the presence of a known nerve injury leads to the diagnosis of crps type ii, with crps type i diagnosed where no nerve injury has occurred (stanton - hicks., the limb can become paralysed, cold, and sweaty, and can assume dystonic postures, rendering it permanently useless and an enduring misery (doury 1988 ; gordon 1996 ; berger 1999). corticosteroids, amitriptylene and gabapentin provide some relief in some patients, and approximately 85% of patients receive some symptomatic relief from sympathetic blockade if instituted early, indicating that their pain is at least partially maintained by sympathetic mechanisms (aburahma. the degree of this improvement can vary dramatically between individuals, and are often transient (wasner. 2003), and other patients do not respond to sympathetic blockade at all (i.e., sympathetically independent pain ; torebjork. has been elusive, to the point where historically cases have been attributed to malingering or catastrophic psychological reactions to the trauma (for a review, see bruehl and carlson 1992). however, crps is now recognised as a biological disorder, with the discovery of disease mechanisms such as local nerve degeneration (van der laan. 1998 ; oaklander 2008) and elevated levels of inflammatory mediators in cerebrospinal fluid (alexander. 2005) and in the affected limb (huygen. 2002). some symptoms of crps suggest that the neural dysfunction is not limited to the peripheral and autonomic nervous system but that there is also a reorganisation of cortical function. some of these manifestations include symptoms that are referred to as neglect - like because they resemble those seen in patients with hemispatial neglect. half of interviewed patients reported feeling that the afflicted limb seemed foreign or did not seem to belong to them ; and half had difficulty identifying which finger was touched (forderreuther.. motor neglect - a dearth of spontaneous movement of the limb resulting in disuse that aggravates the problem - is often present. paradoxically, when asked to position a visual target straight ahead of the body midline, patients erred towards the affected side, suggesting a pathologically altered perception of body midline in which the affected side of space is over - represented (sumitani. accurate picture from a selection of photographs of their forearms and hands in which the width of the affected limb had been compressed or expanded, their choices reflected an overestimation of limb size (moseley 2005). range of motion can be increased by making movements with both hands while viewing their unaffected hand in a mirror (mccabe. pain can be precipitated by viewing an object approaching the limb, and the pain increases as the object gets closer (mccabe and blake 2008). movement - induced pain is aggravated by viewing the limb through lenses that make the limb look bigger, and reduced by viewing it through a minimising lens (moseley. these observations suggest that the brain has been pathologically reorganised such that there is an extension of the neural representation of peripersonal space (the space within grasp). touch to the affected limb can induce referred sensation in body areas with neighbouring cortical representations (mccabe. functional neuroimaging studies have shown that the representation of the affected limb on motor cortex is enlarged (pleger. 2005), while the representation on primary sensory cortex is reduced (maihofner. this reorganisation appears to be both reversible and directly related to pain symptoms : the degree of pain reduction following rehabilitation correlated with normalisation of the extent of primary sensory cortex (maihofner. recently, two therapeutic interventions for crps have been introduced to relieve pain and other symptoms : mirror box therapy and prism adaptation. mirror box therapy was initially introduced to treat phantom limb pain (ramachandran. 1995). for patients with crps, the treatment can enhance range of motion, and may also reduce pain in some patients (mccabe. 2003b ; tichelaar. 2007). the patient executes synchronous bimanual movements while viewing the reflection of the unaffected hand in a mirror placed in the sagittal midline. the patient sees their affected limb executing the full range of movement and, indeed, the affected hand does execute deft movements with the injured hand in synchrony with the unaffected hand. the prevalence of neglect - like symptoms in crps, and their observation that crps patients exhibited deviations in perceived body midline, led sumitani. when patients with neglect undergo adaptation to rightward - shifting prisms, resulting in a leftward visuomotor after - effect, improvements are observed in neglect symptoms (rossetti. this improvement has been well replicated for many aspects of neglect, including perception of body midline (pisella. (2007) demonstrated that 2 weeks of daily adaptation to 20 prismatic shifts that induced an after - effect towards the affected limb relieved the pain and autonomic dysfunction in five patients with crps and reduced their pathological perceptions of body midline. in a further longitudinal study of a single patient they found that adaptation to neutral or 5 refracting lenses did not produce any effects, and adaptation towards the affected side exacerbated pain. here we report observations on the benefits of both mirror therapy and prism adaptation in a woman with crps type i over 15 weeks in which she underwent periods of daily prism adaptation, and adaptation - free periods. we report several novel observations, including a dissociation between pain and motor disability, that may shed light on the derangement of body representation in crps, and the role of this derangement in the pathogenesis of crps symptoms. sm is a 53-year - old right handed woman who we first examined 5 months after she sustained fractures of the right hand. in may 2008 she heard the crack of the wood hammock breaking but does not remember the fall to the ground or the blow to the head. she was dazed and unable to communicate for about half an hour, and was then able to phone for help. a piece of wood struck her right hand, resulting in spiral fractures of the third and fourth metacarpals. the hand was splinted for 3 weeks, when the splint was discarded because the orthopaedic surgeon observed that she is stiffening up considerably. a week later her physiotherapist noted reduced range of motion, swelling of the hand and tenderness to light touch (allodynia). subsequent x - ray confirmed complete healing of the fracture in the fourth and near complete healing of the third metacarpal. she had been fit prior to this injury. however, at the age of seventeen, sm sustained a traumatic amputation of the entire index finger and half of the middle finger of her left (unaffected) hand. this had been followed by the occasional sensation of phantom pain in the missing index finger, which decreased in frequency with time and which sm described as having been only a mild annoyance. at the time of the present study sm had not experienced any phantom digit pain for many years. during the time that she was wearing the splint know where my hand was. sm reported being unable to sense what her hand was doing, and had difficulty visualising its position when she was not directly looking at it. the pain from her injury was much improved by the time the splint was removed. however, shortly thereafter, she began to experience a different kind of pain in the hand. initially there were intermittent paroxysms of sharp burning pain in the palm, but eventually the pain became continuous and affected her fingers, hand and forearm. three months after her injury, her physiotherapist prescribed daily mirror therapy (see below) upon suspicion of cprs, a diagnosis that was confirmed by the hand and orthopaedic surgeon. when we first examined her, she had been experiencing months of constant pain in her right forearm and hand. this she described as being dull and like a toothache you can just about bear most of the time, and rated as four on a subjective numerical rating scale (nrs ; with 0 indicating no pain at all, and 10 indicating pain as bad as it could be). several times a day she would experience a sharp increase in pain (nrs = 7) that was burning in quality, with the focal point varying from day to day. this could occur spontaneously ; however, opening and closing her hand also caused a sharp pain. amitriptylene had provided no relief and she required narcotic analgesic mediation at least once a day. on palpation, the right hand was warmer than the left and the palm was sweaty. no discolouration or trophic changes were observed, although sm reported that at times her right hand appeared movements were slow and clumsy, with particular impairment of fine finger movements, and she was unable to fully open or close the hand. range of movement was also better when sm was using objects than when performing actions with an empty hand : she could achieve more closure grasp when using objects than when asked to close her fist on verbal command. atypically for crps, allodynia was not conspicuous : light touch did not produce much discomfort. there was, however, hyperalgesia : mild pin prick discomfort was experienced as painful. position sense and two - point discrimination were less acute in the injured right hand compared to the left hand., sm suffered from pain disproportionate to her injury, and examination revealed pain, hyperalgesia, swelling, temperature changes and other symptoms that were disproportionate to sm s original injury and were consistent with the iasp diagnostic criteria for crps (stanton - hicks. sm also demonstrated several motor and sensory abnormalities that have frequently been associated with the disorder. full range of movement was restored when sm made synchronous opening and closing movements of her hands while viewing the reflected image of her unaffected left hand. indeed, if she closed her right hand while using the mirror, she was unable to open it after the mirror was removed even though this would only have required that she be able to relax her hand. mirror therapy did not facilitate movement of the affected hand when attempted while viewing the reflection of the examiner s moving hand in the mirror, nor if she attempted bimanual synchronous movements without the mirror. however, it was effective when viewing the reflection of the examiner s moving hand, if she simultaneously executed the movements with her unaffected hand while it was out of view under the table. thus, the efficacy of mirror therapy was not dependent upon the hand viewed in the mirror being in the homologous position to the injured hand, or looking like her own injured hand. indeed, mirror therapy was effective despite the obvious visual differences between the affected and unaffected hand due to the missing digits on the left (unaffected) hand. rather, efficacy was dependent upon the execution of bimanual, synchronous movements while simultaneously perceiving the visual illusion of normal movement in the injured hand. mirror therapy also provided momentary relief of pain and stiffness, which unfortunately resumed almost immediately after the mirror was removed. however, sm did find it helpful to perform mirror therapy 23 times a day for approximately two minutes per session to relieve the stiffness in her hand. crps symptoms were formally assessed in nine sessions spanning 15 weeks, during which the following conditions were applied : treatment (3 weeks), washout (13 days), treatment using the unaffected hand (left - hand treatment, 1 week), treatment (9 weeks ; see flow chart in fig. 1). the trial of prism adaptation was offered to the patient based on clinical consideration and solely for the purpose of potentially alleviating her misery. decisions on how to apply the therapy were made based on response to therapy and clinical judgment. (the one exception to this was a brief trial of adaptation with the unaffected hand.)fig. sm underwent daily sessions of adaptation to leftward - shifting prisms with her affected hand (treatment, light grey), with her unaffected hand (left - hand treatment, dark grey), or no prism adaptation (washout, white, 6 days only in the second block) treatment schedule and timing of clinical assessments (ca1ca9). in 1-week blocks sm underwent daily sessions of adaptation to leftward - shifting prisms with her affected hand (treatment, light grey), with her unaffected hand (left - hand treatment, dark grey), or no prism adaptation (washout, white, 6 days only in the second block) for each clinical assessment (ca1ca9), oedema and discolouration were evaluated by visual comparison to the unaffected hand. range of movement (rom) was also assessed by direct visual comparison, for which sm was asked to open and close both hands several times. to assess temperature, the examiner simultaneously touched the dorsal surfaces of the fingers of each hand to the upturned palm of sm s left and right hands. in addition to the formal assessments sm recorded daily ratings of pain and rom in her right hand (fig. 2). these were recorded as average ratings for the previous 24 h on scales from 0 (no pain at all/no movement at all) to 10 (pain as bad as it could be/completely normal movement). she continued normal use of mirror therapy as described above, and medical pain relief as required.fig. 2ratings of pain and range of movement (rom) made by sm on each day for the first 9 weeks. the upper figure shows the ratings averaged over each week, with error bars indicating the 95% confidence interval around the mean. ratings were made immediately prior to daily treatment sessions on two 11-point numerical rating scales (nrs) ranging from 0 (no pain at all/no range of movement at all) to 10 (pain as bad as it could be/full range of movement) ratings of pain and range of movement (rom) made by sm on each day for the first 9 weeks. the upper figure shows the ratings averaged over each week, with error bars indicating the 95% confidence interval around the mean. ratings were made immediately prior to daily treatment sessions on two 11-point numerical rating scales (nrs) ranging from 0 (no pain at all/no range of movement at all) to 10 (pain as bad as it could be/full range of movement) for prism adaptation sm wore welding goggles that were fitted with 25-diopter (approximately 17) leftward - shifting fresnel lenses. she made 50 alternate pointing movements to targets located at arm s length and shoulder height at approximately 10 to the left and right of her mid - sagittal plane. she pointed as fast as possible with the index finger of her right hand, returning her hand to her torso in between each pointing movement. the first adaptation session was performed under experimenter guidance immediately after the baseline clinical assessment (ca1) to ensure sm understood the procedure. comparison of errors for ten open - loop pointing movements performed immediately before and prism adaptation confirmed a significant 7.25 rightward visuomotor after - effect [t(9) = 9.3, p < 0.001 ]. full range of movement was restored when sm made synchronous opening and closing movements of her hands while viewing the reflected image of her unaffected left hand. indeed, if she closed her right hand while using the mirror, she was unable to open it after the mirror was removed even though this would only have required that she be able to relax her hand. mirror therapy did not facilitate movement of the affected hand when attempted while viewing the reflection of the examiner s moving hand in the mirror, nor if she attempted bimanual synchronous movements without the mirror. however, it was effective when viewing the reflection of the examiner s moving hand, if she simultaneously executed the movements with her unaffected hand while it was out of view under the table. thus, the efficacy of mirror therapy was not dependent upon the hand viewed in the mirror being in the homologous position to the injured hand, or looking like her own injured hand. indeed, mirror therapy was effective despite the obvious visual differences between the affected and unaffected hand due to the missing digits on the left (unaffected) hand. rather, efficacy was dependent upon the execution of bimanual, synchronous movements while simultaneously perceiving the visual illusion of normal movement in the injured hand. mirror therapy also provided momentary relief of pain and stiffness, which unfortunately resumed almost immediately after the mirror was removed. however, sm did find it helpful to perform mirror therapy 23 times a day for approximately two minutes per session to relieve the stiffness in her hand. crps symptoms were formally assessed in nine sessions spanning 15 weeks, during which the following conditions were applied : treatment (3 weeks), washout (13 days), treatment using the unaffected hand (left - hand treatment, 1 week), treatment (9 weeks ; see flow chart in fig. 1). the trial of prism adaptation was offered to the patient based on clinical consideration and solely for the purpose of potentially alleviating her misery. decisions on how to apply the therapy were made based on response to therapy and clinical judgment. (the one exception to this was a brief trial of adaptation with the unaffected hand.)fig. sm underwent daily sessions of adaptation to leftward - shifting prisms with her affected hand (treatment, light grey), with her unaffected hand (left - hand treatment, dark grey), or no prism adaptation (washout, white, 6 days only in the second block) treatment schedule and timing of clinical assessments (ca1ca9). in 1-week blocks sm underwent daily sessions of adaptation to leftward - shifting prisms with her affected hand (treatment, light grey), with her unaffected hand (left - hand treatment, dark grey), or no prism adaptation (washout, white, 6 days only in the second block) for each clinical assessment (ca1ca9), oedema and discolouration were evaluated by visual comparison to the unaffected hand. range of movement (rom) was also assessed by direct visual comparison, for which sm was asked to open and close both hands several times. to assess temperature, the examiner simultaneously touched the dorsal surfaces of the fingers of each hand to the upturned palm of sm s left and right hands. in addition to the formal assessments sm recorded daily ratings of pain and rom in her right hand (fig. 2). these were recorded as average ratings for the previous 24 h on scales from 0 (no pain at all/no movement at all) to 10 (pain as bad as it could be/completely normal movement). she continued normal use of mirror therapy as described above, and medical pain relief as required.fig. 2ratings of pain and range of movement (rom) made by sm on each day for the first 9 weeks. the upper figure shows the ratings averaged over each week, with error bars indicating the 95% confidence interval around the mean. ratings were made immediately prior to daily treatment sessions on two 11-point numerical rating scales (nrs) ranging from 0 (no pain at all/no range of movement at all) to 10 (pain as bad as it could be/full range of movement) ratings of pain and range of movement (rom) made by sm on each day for the first 9 weeks. the upper figure shows the ratings averaged over each week, with error bars indicating the 95% confidence interval around the mean. ratings were made immediately prior to daily treatment sessions on two 11-point numerical rating scales (nrs) ranging from 0 (no pain at all/no range of movement at all) to 10 (pain as bad as it could be/full range of movement) for prism adaptation sm wore welding goggles that were fitted with 25-diopter (approximately 17) leftward - shifting fresnel lenses. she made 50 alternate pointing movements to targets located at arm s length and shoulder height at approximately 10 to the left and right of her mid - sagittal plane. she pointed as fast as possible with the index finger of her right hand, returning her hand to her torso in between each pointing movement. the first adaptation session was performed under experimenter guidance immediately after the baseline clinical assessment (ca1) to ensure sm understood the procedure. comparison of errors for ten open - loop pointing movements performed immediately before and prism adaptation confirmed a significant 7.25 rightward visuomotor after - effect [t(9) = 9.3, p < 0.001 ]. crps symptoms were formally assessed in nine sessions spanning 15 weeks, during which the following conditions were applied : treatment (3 weeks), washout (13 days), treatment using the unaffected hand (left - hand treatment, 1 week), treatment (9 weeks ; see flow chart in fig. 1). the trial of prism adaptation was offered to the patient based on clinical consideration and solely for the purpose of potentially alleviating her misery. decisions on how to apply the therapy were made based on response to therapy and clinical judgment. (the one exception to this was a brief trial of adaptation with the unaffected hand.)fig. sm underwent daily sessions of adaptation to leftward - shifting prisms with her affected hand (treatment, light grey), with her unaffected hand (left - hand treatment, dark grey), or no prism adaptation (washout, white, 6 days only in the second block) treatment schedule and timing of clinical assessments (ca1ca9). in 1-week blocks sm underwent daily sessions of adaptation to leftward - shifting prisms with her affected hand (treatment, light grey), with her unaffected hand (left - hand treatment, dark grey), or no prism adaptation (washout, white, 6 days only in the second block) for each clinical assessment (ca1ca9), oedema and discolouration were evaluated by visual comparison to the unaffected hand. range of movement (rom) was also assessed by direct visual comparison, for which sm was asked to open and close both hands several times. to assess temperature, the examiner simultaneously touched the dorsal surfaces of the fingers of each hand to the upturned palm of sm s left and right hands. in addition to the formal assessments sm recorded daily ratings of pain and rom in her right hand (fig. 2). these were recorded as average ratings for the previous 24 h on scales from 0 (no pain at all/no movement at all) to 10 (pain as bad as it could be/completely normal movement). she continued normal use of mirror therapy as described above, and medical pain relief as required.fig. 2ratings of pain and range of movement (rom) made by sm on each day for the first 9 weeks. the upper figure shows the ratings averaged over each week, with error bars indicating the 95% confidence interval around the mean. ratings were made immediately prior to daily treatment sessions on two 11-point numerical rating scales (nrs) ranging from 0 (no pain at all/no range of movement at all) to 10 (pain as bad as it could be/full range of movement) ratings of pain and range of movement (rom) made by sm on each day for the first 9 weeks. the upper figure shows the ratings averaged over each week, with error bars indicating the 95% confidence interval around the mean. ratings were made immediately prior to daily treatment sessions on two 11-point numerical rating scales (nrs) ranging from 0 (no pain at all/no range of movement at all) to 10 (pain as bad as it could be/full range of movement) for prism adaptation sm wore welding goggles that were fitted with 25-diopter (approximately 17) leftward - shifting fresnel lenses. she made 50 alternate pointing movements to targets located at arm s length and shoulder height at approximately 10 to the left and right of her mid - sagittal plane. she pointed as fast as possible with the index finger of her right hand, returning her hand to her torso in between each pointing movement. the first adaptation session was performed under experimenter guidance immediately after the baseline clinical assessment (ca1) to ensure sm understood the procedure. comparison of errors for ten open - loop pointing movements performed immediately before and prism adaptation confirmed a significant 7.25 rightward visuomotor after - effect [t(9) = 9.3, p < 0.001 ]. the outcomes of the formal clinical assessments are outlined in table 1, and sm s subjective ratings for pain and rom are shown in fig. 2. sm first underwent 3 weeks of adaptation to leftward - shifting prisms using her right hand. clinical assessments performed at the end of weeks 2 and 3 (ca2 and ca3) revealed a progressive decrease in pain, swelling and temperature difference, as well as an increase in range of movement compared to the baseline clinical assessment (ca1). within 9 days of the start of treatment for the remainder of this treatment period pain remained absent (nrs = 0), or was experienced only as minor pain (like a shoe that is a little too tight, nrs = 1), lasting for a few minutes and no longer than an hour. 95% confidence intervals (cis) constructed around the mean ratings for each week revealed that pain throughout the third week (ci = [0.7, 0.9 ]) was significantly less than throughout the first week (ci = [3.7, 5.7 ]), and was also no different from zero (see fig. 2). similarly, there was a significant increase in rom between the first (ci = [4.5, 7.2 ]) and third (ci = [7.5, 8.8 ]) week of treatment, although at the end of the third week sm was still not able to completely close her hand outside mirror therapy (nrs = 9).table 1details of formal crps assessment sessionsclinical assessment123456789preceding treatmentnone (baseline)treatmenttreatmentwashoutwashoutleft - hand treatmenttreatmenttreatmenttreatmentdays from baseline014212834414876104signs and symptoms oedema+++++++++++ discolouration+++++ decreased rom+++++++++not tested+ temperature increase++hyperhidrosis++, but hyperhidrosis pain at time of assessment410344321straight ahead pointing (m, sem)pre : + 1.25, 0.44 post : + 8.5, 0.64 + 5.5, 0.28 + 0.35, 0.44 + 2.6, 0.470.4, 0.55 (left hand : + 4.55, 0.31)+0.95, 0.56 (left hand : + 2.35, 0.51)+3.75, 0.30 + 5.95, 0.57not testedadditional informationpain is like a toothache you can just about bear most of the timepain is intermittent, and is like a shoe that is a little too tighthand is stiff forearm feels longer compared to left armno difference in sensation of hand sizetips of fingers felt bigger on right compared to left handsymptoms were assessed by direct comparison of the affected and unaffected handbased on medical physical examination. indicates no difference to the unaffected hand ; +, + + and + indicates rightward errorsrating by sm on a scale from 0 (no pain at all) to 10 (pain as bad as it could be) details of formal crps assessment sessions symptoms were assessed by direct comparison of the affected and unaffected hand based on medical physical examination. indicates no difference to the unaffected hand ; +, + + and + + + indicate differences of increasing severity averaged over 10 pointing trials ; + indicates rightward errors rating by sm on a scale from 0 (no pain at all) to 10 (pain as bad as it could be) to determine whether the reduction in sm s pain and other symptoms was contingent upon continued treatment, prism adaptation was discontinued after the end of the third week (washout). the average pain rating over the first week of washout (week 4) was not significantly different from zero (ci = [0.3, 1.5 ]) and sm remained pain free for 5 days (see fig. 2). this was at first intermittent, but over the following days pain continued to increase in frequency and severity until on day 13 of the washout period sm once again had the need for medication for pain relief. over the last 6 days of the washout period (week 5) pain was once again significantly greater than zero (ci = [0.4, 2.6 ]), but still significantly smaller than in week 1 (ci = [3.7, 5.9 ]). the increase in pain during washout was mirrored by a decrease in rom (week 5 : ci = [7.1, 8.2 ]), which returned to week 1 levels (ci = [4.5, 7.2 ]). a gradual return of symptoms was also noted in clinical assessments 4 and 5, with a return of swelling, warmth and discolouration compared to the unaffected hand. interestingly, the patient reported that in the final 2 days of the washout period she experienced occasional sharp jabbing pains in the palm of her left hand, which resembled the pain that she had first felt in her right hand at the onset of crps. by the thirteenth day of the washout period symptoms if prism adaptation could reduce symptoms if performed with the unaffected hand, sm volunteered to undertake daily adaptation sessions using her left hand (left - hand treatment). symptoms continued to worsen further to the deterioration observed during the washout period, with the 95% cis for week 6 showing that average pain (ci = [3.0, 4.4 ]) and rom (ci = [6.5, 7.5 ]) were no different to the week 1 ratings (fig. clinical assessment performed at the end of one week of left - hand treatment (ca6) revealed a stiff, sweaty and swollen hand. sm reported loss of function to pre - treatment levels, with greatly diminished power and pain that was not relieved by medication. this frustrated her a great deal and she spontaneously reported feeling like she wanted to cut her hand off. when sm closed her eyes her right arm from the elbow to the fingertips felt larger and the forearm longer compared to the left. as there was no evidence for symptom relief from adaptation using the unaffected hand, we resumed adaptation with the affected hand to determine if the previous improvements would be recovered (weeks 79). clinical assessment after week 7 (ca7) showed that swelling and temperature difference had once again decreased. in week 8 pain ratings were once again significantly less than in week 1 (cis = [0.4, 2.9 ] and [3.7, 5.7 ] respectively), and pain reduced to zero after 13 days. there was a similar increase in rom to nrs = 9 by week 9, significantly larger than in week 1. pain remained completely absent or mild and infrequent over a further 2 months of treatment (ca8 and ca9), with one notable exception : sm missed prism treatment for 2 days while on holiday and this was followed by a sharp rise in pain 2 days later (nrs = 5) and a decrease in rom (nrs = 7), even though she had recommenced prism treatment. the pain subsided after 4 days. sensory disturbance also decreased in the second treatment period ; in the final two clinical assessments (ca8 and ca9) there was little or no difference between the felt size of the right hand relative to the left. sm is continuing daily adaptation sessions, with a view to gradually decrease the frequency of treatments in the future if pain control is sustained. in both treatment periods the improvement in symptoms were accompanied by improvement in range of motion and function in everyday activities. she has recovered the ability to perform tasks requiring fine motor control or accurately applied pressure such as using a needle and thread, picking up a cup by its handle, bending wire with pliers or ironing a garment. although pain free for several weeks, she is still not able to fully close her hand, except when using a mirror ; and when she closes her hand in the mirror, she is still unable to unclench the closed fist when the mirror is removed. when asked why she can not open her hand, she seems bemused and can only respond that i do nt know how. she is unable to pick up a teapot or carry heavy bags. thus, there is a continuing impairment of motor function that is not simply a limitation due to pain. we find it interesting that in this particular patient there is a history of both phantom digit pain and crps. this may suggest that these syndromes are related, and that some individuals may be more susceptible to their development. crps is three times more common in women than in men and the highest incidence is in women who, like sm, are in middle age (de mos. it is also possible that the traumatic concussion may have increased her vulnerability to development of the syndrome, as this commotion of the brain (commotio cerebri ; mccrory and berkovic 2001) can trigger neuroplasticity and cortical reorganisation (levin 2003 ; anderson. as is typical of crps, her pain was greatly disproportional to the severity of the injury and began after the pain due to fracture had begun to subside. it is noteworthy that she experienced symptoms of body representation disturbance while the limb was immobilized before the pain of crps began. her symptoms of crps included some that suggested a disturbance of body representation : distorted sense of limb size, lack of knowledge of limb location, and hostility towards the limb. in two treatment periods, pain, stiffness and other crps signs and symptoms decreased within 2 weeks (~10 days), replicating the results of sumitani. in addition, we found that the benefits of prism adaptation were maintained with continued treatment, symptoms worsened when treatment was discontinued, and that adaptation to leftward - shifting prisms using the left hand was ineffective. it has recently been suggested that crps arises from incongruence between the true consequences of motor commands and the anticipated consequences or efference copy of those commands to the cortex (mccabe. with reference to pain from repetitive strain injury and phantom limb pain, harris (1999) proposed that a distorted cortical representation of a limb can result in discrepancies between motor intention, proprioception and vision. this leads to the affective sensation of pain in a similar way to the development of nausea with conflicting visual and vestibular signals. in crps, these discrepancies are postulated to initiate protective and defensive sympathetic mechanisms through the autonomic nervous system (mccabe and blake 2008). several observations suggest that patients with crps have pathologically reorganised neural representations of peripersonal space that normalise with recovery. the sensory - motor discordance that is induced by prism lenses may provide an error signal that initiates the normalisation of body representation, reducing that component of pain that is driven by incongruence in motor intention, proprioception and vision. sensory feedback from the affected hand during prism adaptation seems essential for therapeutic benefit, as sm s symptoms were not improved by adaptation with the left hand but continued to escalate to pre - treatment levels. it would be interesting to test whether mirror therapy and prism adaptation could be combined by asking patients to point to targets with their unaffected limb while viewing the reflected image of the unaffected limb through prismatic glasses. if it is possible to induce sensory - motor realignment in the affected limb using this technique, then prism adaptation may also hold therapeutic potential for relieving pain in phantom or hemiplegic limbs (that is, patients who would be unable to perform prism adaptation with their affected limb). when treatment was discontinued pain returned to the affected hand and also began to emerge in the left (unaffected) hand. mirror - image spread, has been reported and is a further argument against purely local inflammatory causes (maleki. however, sm s history of amputation of the first and second digits of the left hand also leads us to speculate that as the prism - induced realignment faded there may have been a reawakening of phantom pain caused by the re - detection of the sensory - motor mismatch caused by the missing digits. finally, we note that although prism adaptation resulted in substantial relief of symptoms and return of function, it was not completely curative. at the final assessment there remained some swelling in the knuckles of the first and second finger, sweatiness of the palm and sensory disturbance. all of these symptoms were very mild and detected only on close comparison to the left hand. alleviation of pain with prism adaptation, accompanied by mirror treatment that may have prevented atrophy and motor deterioration by enabling her full hand movements periodically, did achieve a sustained improvement in range of motion and functionality of the hand. however, sm is still not able to fully close her fingers, and it is therefore clear that there is a deficit in somatomotor function in this syndrome that is independent from pain. noting that sm s symptoms of distorted body image began before her pain, we may speculate that the disturbance of central somatomotor circuits is the primary cause of the syndrome and the pain is secondary to it. this hypothesis, based on our observational case study, requires more systematic testing (for example, through retrospectively surveying the early symptoms of patients with crps). it remains to be seen whether continuing prism adaptation can ultimately restore normal function in limbs affected by crps. we report several observations that may offer insight into the pathophysiology of this enigmatic and vexing disease, and guidance in developing a therapeutic strategy.in this patient, symptoms of body image disturbance preceded the development of other crps symptoms. we may speculate that, in some patients, crps is primarily a disturbance of body representation, and that pain is a consequence, not the cause, of the derangement of body representation. this may be a fruitful area for future research identifying subtypes of the disorder, and it is possible that such patients may be more likely to benefit from mirror therapy and prism adaptation treatment.physiological deconditioning due to disuse, including bone and muscle loss, has been well documented (bortz 1982 ; greenleaf 1984), and previous authors have proposed immobilisation as a direct cause of crps symptoms other than pain (galer and harden 2001). in our patient we may speculate further that it is not pain, but rather immobilisation of the limb after trauma (whether due to splinting or limitations of movement secondary to pain) that precipitates a reorganisation of somatomotor circuits in susceptible individuals, leading to the disturbance in body representation.consistent with this account, although relief of pain after a course of prism adaptation improved range of motion that had been limited by pain, and restored much functionality to the limb, it did not restore the full repertoire of hand postures that could be produced voluntarily. indeed, after closing her hand in the mirror, she was unable to unclench her fist outside the mirror, reporting that i do nt know how. it is clear then that the limitation of voluntary movement is neither due to pain, nor to weakness (since unclenching the fist would only require the ability to relax it). rather, it appears that a derangement of body representation has resulted in the loss of certain postures from the repertoire of hand movements that can be produced by voluntary activation of somatomotor circuits. as is the case in patients with ideomotor apraxia, sm had better range of movement when using objects than when performing actions to verbal command. unlike apraxia, however, sm did not produce an incorrect sequence of movements but, rather, experience paralysis. we can speculate that the mechanism of paralysis in this case might share similarities with conversion disorder.the ability to execute movements in the mirror suggests that the capability of the unaffected hemisphere to generate these postures can be transferred to the affected hemisphere if the affected motor system is provided with visual information that can replace, bypass or dominate the disturbance of kinesthesis.although our observations do not yet offer a basis for optimism that prism adaptation may be curative, they do show that the treatment can provide sustained relief of pain, reduce disability and improve quality of life.when sm underwent 1 week of adaptation using her unaffected hand, symptoms did not improve but returned to baseline. that is, the benefits of prism adaptation are contingent on adapting with the affected limb, suggesting that its benefits derive from perturbation of the dysfunctional somatomotor representation of that limb (compared to, for example, the general spatial representation of the body within extra - personal space).in conjunction with mirror therapy to maintain the potential for full active range of motion, prism adaptation has the potential to prevent progression to a withered, useless limb, which might otherwise be the fate of patients with this disorder. in this patient, symptoms of body image disturbance preceded the development of other crps symptoms. we may speculate that, in some patients, crps is primarily a disturbance of body representation, and that pain is a consequence, not the cause, of the derangement of body representation. this may be a fruitful area for future research identifying subtypes of the disorder, and it is possible that such patients may be more likely to benefit from mirror therapy and prism adaptation treatment. physiological deconditioning due to disuse, including bone and muscle loss, has been well documented (bortz 1982 ; greenleaf 1984), and previous authors have proposed immobilisation as a direct cause of crps symptoms other than pain (galer and harden 2001). in our patient we may speculate further that it is not pain, but rather immobilisation of the limb after trauma (whether due to splinting or limitations of movement secondary to pain) that precipitates a reorganisation of somatomotor circuits in susceptible individuals, leading to the disturbance in body representation. consistent with this account, although relief of pain after a course of prism adaptation improved range of motion that had been limited by pain, and restored much functionality to the limb, it did not restore the full repertoire of hand postures that could be produced voluntarily. indeed, after closing her hand in the mirror, she was unable to unclench her fist outside the mirror, reporting that i do nt know how. it is clear then that the limitation of voluntary movement is neither due to pain, nor to weakness (since unclenching the fist would only require the ability to relax it). rather, it appears that a derangement of body representation has resulted in the loss of certain postures from the repertoire of hand movements that can be produced by voluntary activation of somatomotor circuits. as is the case in patients with ideomotor apraxia, sm had better range of movement when using objects than when performing actions to verbal command. unlike apraxia, however, sm did not produce an incorrect sequence of movements but, rather, experience paralysis. we can speculate that the mechanism of paralysis in this case might share similarities with conversion disorder. the ability to execute movements in the mirror suggests that the capability of the unaffected hemisphere to generate these postures can be transferred to the affected hemisphere if the affected motor system is provided with visual information that can replace, bypass or dominate the disturbance of kinesthesis. although our observations do not yet offer a basis for optimism that prism adaptation may be curative, they do show that the treatment can provide sustained relief of pain, reduce disability and improve quality of life. when sm underwent 1 week of adaptation using her unaffected hand, symptoms did not improve but returned to baseline. that is, the benefits of prism adaptation are contingent on adapting with the affected limb, suggesting that its benefits derive from perturbation of the dysfunctional somatomotor representation of that limb (compared to, for example, the general spatial representation of the body within extra - personal space). in conjunction with mirror therapy to maintain the potential for full active range of motion, prism adaptation has the potential to prevent progression to a withered, useless limb, which might otherwise be the fate of patients with this disorder. | perhaps the most intriguing disorders of body representation are those that are not due to primary disease of brain tissue. strange and sometimes painful phantom limb sensations can result from loss of afference to the brain ; and complex regional pain syndrome (crps)the subject of the current report can follow limb trauma without pathology of either the central or peripheral nervous system. this enigmatic and vexing condition follows relatively minor trauma, and can result in enduring misery and a useless limb. it manifests as severe pain, autonomic dysfunction, motor disability and neglect - like symptoms with distorted body representation. for this special issue on body representation we describe the case of a patient suffering from crps, including symptoms suggesting a distorted representation of the affected limb. we report contrasting effects of mirror box therapy, as well as a new treatment prism adaptation therapy that provided sustained pain relief and reduced disability. the benefits were contingent upon adapting with the affected limb. other novel observations suggest that : (1) pain may be a consequence, not the cause, of a disturbance of body representation that gives rise to the syndrome ; (2) immobilisation, not pain, may precipitate this reorganisation of somatomotor circuits in susceptible individuals ; and (3) limitation of voluntary movement is neither due to pain nor to weakness but, rather, to derangement of body representation which renders certain postures from the repertoire of hand movements inaccessible. |
the life cycle of t. solium involves humans as a definite host and pigs as an intermediate host. human cestode infection may involve adult mature worms, larval forms or both the parasites can be ingested in the form of larvae from raw or inadequately cooked pork or in the form of eggs through fecally contaminated vegetables, food, or water as well as by lf - contamination or direct contact with another human carrier. upon reaching the small intestine, the scolex attaches to the intestinal wall and a proglottid chain grows. t. solium releases three to six proglottids per day, bearing 30,00070,000 eggs (ova) per proglottid, into the intestine. nearly 250,000 ova are passed daily into the human feces and to the environment, and the cycle continues. infections with cysticercus occur after humans consume the ova from exogenous sources or through self - infection via the fecal oral route. ova are digested in the stomach and release oncospheres which penetrate the intestinal wall and reach the bloodstream. these oncospheres develop into cysticerci in any organ but are common in brain, subcutaneous tissue, or eyes. humans become infected when they ingest raw or undercooked measly pork that contains viable cysticercus. adult cestodes inhabit the intestines of vertebrates, whereas the larval forms occur in a variety of vertebrate and invertebrate hosts. the larval form is a post - embryonic stage in which internal organs are either developing or are developed. the parasite can be ingested in the form of larvae from raw or inadequately cooked pork or in the form of eggs through fecally contaminated vegetables, food, or water as well as by self - contamination or direct contact with another human carrier. the ingested eggs develop into embryos (oncospheres) that can penetrate the intestinal wall and disseminate through vascular or lymphatic circulation to develop into cystic larvae (cysticercus cellulosae). although any body site can have cysticercosis, the subcutaneous tissues, brain, and skeletal muscles are the most commonly affected. a healthy, 33-year - old female presented with a complaint of swelling over left lower lip since 810 years and the swelling gradually increased to the present size of 1.5 1 cm in the last 3 months. the patient had no headaches, seizures or any neurological deficits. on examination, the swelling was smooth and well defined with intact overlying mucosa. a 1.5 1 cm cystic swelling was seen over the left lower labial mucosa [figure 1 ]. the lumen showed larval form of cysticercus lined by three layers : inner cuticular, middle granular, and outer loose parenchymatous lining [figure 2 ]. magnetic resonance imaging (mri) showed no evidence of cysticerci in the brain or eye. an excisional biopsy was performed and histopathological examination revealed a cystic cavity containing the tapeworm. cystic swelling over lower lip histopathological slide showing cystic space containing the cysticercus cellulosae, lined by 3 layers inner cuticular, middle granular, and outer loose parenchymatous lining cysticercosis is common in endemic areas like india, southeast asia, latin america, china, and sub - saharan africa. the incidence in developed countries is also on a rise as a result of migration. wilson, observed that an individual with cysticercosis need not be a resident of endemic areas or have a history of consumption of beef or pork. cysticercosis is a parasitic infestation by the larva of pork tapeworm, t. solium.[4911 ] infections with cysticercosis may involve many parts of the body including the subcutaneous tissues, eye, liver, peritoneum, heart, and lungs. however, the skeletal muscle is most commonly affected ; the most common site of severe symptomatic infection is the cns.[4911 ] the most frequently involved oral locations are the tongue, labial or buccal mucosa, and mouth floor 1, 2, 3. most oral presentations are in the form of painless, well - circumscribed, soft swellings that may mimic fluctuant lesions like mucoceles. clinical differential diagnoses depend on the site involved and include retention cysts, lipomas, fibromas, neurofibromas, and mucoceles. histopathological examination confirms diagnosis of cysticercosis by the detection of a cystic space containing the c. cellulosae, lined by three layers : inner cuticular, middle granular, and outer loose parenchymatous lining. the diagnosis of oral cysticercosis is made by direct histological examination. in every case, detailed study should be done in order to exclude the presence of the parasite in other sites. mri and computerized tomography (ct) may be used to evaluate cns involvement. even in an endemic area, lip is a rare site of involvement in cysticercosis. treatment of oral cysticercosis should be according to the specific needs of the patient and relies on antihelminthic drugs or surgery. lip is a rare site of involvement in cysticercosis.confirmative diagnosis of cysticercosis in only made by histopathological examination.in every case, detailed study should be done in order to exclude the presence of the parasite in other sites. confirmative diagnosis of cysticercosis in only made by histopathological examination. in every case, detailed study should be done in order to exclude the presence of the parasite in other sites. | cysticercosis is a common disease in developing countries. labial lesions produced by this parasitic infestation are rare. the most frequently involved oral locations are the tongue, labial or buccal mucosa, and mouth floor. we present here a case report of a 33-year - old - female patient from maharashtra, who reported to our department with a swelling in the left lower lip, which was diagnosed as cysticercosis on histpathological examination. |
according to the world health organization (who), it is estimated that globally 450 million people suffer from mental disorders. around 80% of the people with mental disabilities live in low- and middle - income countries (lmics), four out of five people with serious mental disorders living in lmics do not receive the needed mental health services. mental illness accounts for 14% of all disability adjusted life years (dalys) lost worldwide, and is one of the major contributors to the global burden of disease. among indian population a study from pune suggests that the prevalence of mental health disorders was 5% ; a study from bangalore reports the prevalence of mental health disorders ranged from 9.5 to 102 per 1000 population. a study among elderly population of south india estimated the prevalence of depression to be 12.7%. despite the existing programs for the control of non - communicable disease, including mental illness, mental health disorders remains as one of the hidden disease burdens in india due to stigma and discrimination. self - stigma occurs when a member of a stigmatized group internalize the negative views held by the general public. given its negative impact on treatment seeking, adherence and effectiveness, the stigma associated with mental illness can be considered as a major public health problem. the main determinants and sources of stigma, nature and forms of stigma are of interest hence, understanding the stigma faced by people with mental illness (pwmi) is necessary. in this study a community - based cross - sectional study was carried out from february to july 2014 udupi district, karnataka. the sample size estimated was 430, with prevalence as 50% (as no previous data on stigma was available). relative precision was taken as 10% of the prevalence, cluster effect as 1.5 and 10% non - response rate. data was collected through cluster sampling technique, wards from rural and blocks from urban areas were treated as clusters. probability proportional to sampling size technique was used to select 10 wards / blocks of udupi district, and proportional allocation was used to select sample size from each ward / block based on the population size of the ward / block. convenience sampling was used to select households from each ward / block, data was collected by conducting house - to - house interviews, and one participant from each household was selected for the interview. the approval to carry out the study was taken by institutional ethical committee, kasturba medical college, manipal (ecr/146/inst / ka/2014). the questionnaire consisted of two parts ; first part included the open - ended questions and were interviewer administered which consisted of basic demographics, knowledge on mental health, previous and present contact with mentally ill people and if they personally had experienced any mental health problem. the second part was used to assess stigma through the community attitudes toward the mentally ill (cami) scale and it was self administered. cami scale was a 5-point likert scale, the responses ranged from strongly agree to strongly disagree. cami scale has four subscales : authoritarianism (au), benevolence (be), social restrictiveness (sr), and community mental health ideology (cmhi). au is a view of the mentally ill person as someone who is inferior and requires supervision and coercion. be corresponds to a humanistic and sympathetic view of mentally ill persons, a higher be score corresponds to a less humanistic and less sympathetic (malevolent) view of pwmi. sr means the belief that mentally ill patients are a threat to society and should be avoided. cmhi is the acceptance of mental health services and the integration of mentally ill patients in the community. this measures the behavior toward mentally ill patients by an individual with respect to the questions of each subscale. a pilot study was conducted priory among 40 people and minor changes without altering the meaning of the questions were done according to the indian scenario. the data collected was tabulated and analyzed by using the software, statistical package for social sciences (spss) version 15. the chi - square test was performed to find out the association between stigma and other factors. a probability (p value) level of less than 0.05 was considered significant. for analysis purpose the five categories of socio - economic status the questionnaire consisted of two parts ; first part included the open - ended questions and were interviewer administered which consisted of basic demographics, knowledge on mental health, previous and present contact with mentally ill people and if they personally had experienced any mental health problem. the second part was used to assess stigma through the community attitudes toward the mentally ill (cami) scale and it was self administered. cami scale was a 5-point likert scale, the responses ranged from strongly agree to strongly disagree. cami scale has four subscales : authoritarianism (au), benevolence (be), social restrictiveness (sr), and community mental health ideology (cmhi). view of the mentally ill person as someone who is inferior and requires supervision and coercion. be corresponds to a humanistic and sympathetic view of mentally ill persons, a higher be score corresponds to a less humanistic and less sympathetic (malevolent) view of pwmi. sr means the belief that mentally ill patients are a threat to society and should be avoided. cmhi is the acceptance of mental health services and the integration of mentally ill patients in the community. this measures the behavior toward mentally ill patients by an individual with respect to the questions of each subscale. a pilot study was conducted priory among 40 people and minor changes without altering the meaning of the questions were done according to the indian scenario. the data collected was tabulated and analyzed by using the software, statistical package for social sciences (spss) version 15. the chi - square test was performed to find out the association between stigma and other factors. a probability (p value) level of less than 0.05 was considered significant. for analysis purpose the five categories of socio - economic status a total of 500 participants were included in the study, 55 participants data were excluded from the analysis due to missing data. the results of 445 participants are presented under various domains as frequencies and percentages followed by their interpretation. of the total 445 study participants, socio - demographic variables variables to assess knowledge and perceptions on mental health with frequencies and percentages are described in table 2. majority of the participants were not aware of the names of mental illness. those who knew among them only half of the participants could name only one of the mental illnesses. mental health knowledge and perception majority of the participants reported that, they would identify a mentally ill person by his behavior and attitude. around 18% had at least one family member, relative or a friend having mental illness either currently or in the past with or known to them. among all the participants, 14.59% had worked with pwmi some time in their lives. of those who had information, 18.9% obtained from media, 12.4% from hospitals and health programs and 7.9% through books and other sources. a significant number of participants (76.4%) would approach hospital for the treatment ; approximately 1 in 10 reported they would go to traditional healers, whereas 14.4% had no idea on the treatment for mental health when asked about facility preference. cami scale was used to assess stigma, under four components : authoritarianism, benevolence, social restrictiveness and community mental health ideology. based on the total scores of stigma of cami scale, quartiles were considered as cut off points for low, medium and high stigma. less than equal to q1 were considered as low stigma, q1 to q2 was considered as medium stigma and more than q2 was considered as high stigma. the overall prevalence of stigma toward mental illness was 74.61% (95% confidence interval : 0.7057, 0.7866) prevalence of stigma (uploaded separately) the distribution of stigma toward mental illness in the community table 3 shows the stigma scores for the components of cami scale. stigma scores for the components of cami authoritarianism (au) : table 4 shows the distribution of high stigma scores for au. high stigma among females (79.6%) stigma is high among primary education level participants (81.8%) and among high social class people (83.3%). distribution of high stigma according to au benevolence (be) : table 5 shows the distribution of high stigma scores for be. stigma scores for be remains high among married (77.8%) compared to unmarried, high among primary education level participants, (81.8%) and remains the same among all the social class people. distribution of high stigma according to be social restrictiveness (sr) : table 6 depicts the distribution of high stigma scores for sr. stigma scores remain almost the same for marital status, education level and all the social class people. distribution of high stigma according to sr community mental health ideology (cmhi) : table 7 shows the distribution of high stigma scores for cmhi. stigma scores remain high among married (77.8%), high among primary education level participants (81.8%) and remain the same among all the social class people. a total of 500 participants were included in the study, 55 participants data were excluded from the analysis due to missing data. the results of 445 participants are presented under various domains as frequencies and percentages followed by their interpretation. of the total 445 study participants, variables to assess knowledge and perceptions on mental health with frequencies and percentages are described in table 2. majority of the participants were not aware of the names of mental illness. those who knew among them only half of the participants could name only one of the mental illnesses. mental health knowledge and perception majority of the participants reported that, they would identify a mentally ill person by his behavior and attitude. around 18% had at least one family member, relative or a friend having mental illness either currently or in the past with or known to them. among all the participants, 14.59% had worked with pwmi some time in their lives. around three fifth of the participants had no information on mental illness. of those who had information, 18.9% obtained from media, 12.4% from hospitals and health programs and 7.9% through books and other sources. a significant number of participants (76.4%) would approach hospital for the treatment ; approximately 1 in 10 reported they would go to traditional healers, whereas 14.4% had no idea on the treatment for mental health when asked about facility preference. cami scale was used to assess stigma, under four components : authoritarianism, benevolence, social restrictiveness and community mental health ideology. based on the total scores of stigma of cami scale, less than equal to q1 were considered as low stigma, q1 to q2 was considered as medium stigma and more than q2 was considered as high stigma. the overall prevalence of stigma toward mental illness was 74.61% (95% confidence interval : 0.7057, 0.7866) prevalence of stigma (uploaded separately) the distribution of stigma toward mental illness in the community stigma scores for the components of cami authoritarianism (au) : table 4 shows the distribution of high stigma scores for au. high stigma among females (79.6%) stigma is high among primary education level participants (81.8%) and among high social class people (83.3%). distribution of high stigma according to au benevolence (be) : table 5 shows the distribution of high stigma scores for be. stigma scores for be remains high among married (77.8%) compared to unmarried, high among primary education level participants, (81.8%) and remains the same among all the social class people. distribution of high stigma according to be social restrictiveness (sr) : table 6 depicts the distribution of high stigma scores for sr. stigma scores remain almost the same for marital status, education level and all the social class people. distribution of high stigma according to sr community mental health ideology (cmhi) : table 7 shows the distribution of high stigma scores for cmhi. stigma was seen to be high among females (79.6%). stigma scores remain high among married (77.8%), high among primary education level participants (81.8%) and remain the same among all the social class people. to the best of the author 's knowledge, this is the first study in south asia region addressing the issue of stigma faced by pwmi. although mental illness is an important public health issue it has not been given much attention and very few studies have been conducted on stigma toward pwmi in the nation. this study has provided a baseline to design and implement interventions to address the issue of stigma in the region. with the help of stakeholders who are involved in giving care to mentally ill people, we have come up with few interventions such as creating awareness and trying to bring about behavioral change in the community through mass media, local folk dances (e.g. yakshagana) and healthcare workers. with the help of a non - governmental organization we have planned to conduct an intervention trial in one village as a pilot project. only literate participants were recruited in the present study which can be a potential source of bias. another source of bias could result from the sampling technique employed since participants were recruited conveniently due to time constraints. the aim of the present study was to assess the burden of stigma toward pwmi as well as the factors associated with it. the overall stigma scores against pwmi were high among females and high social class people. studies conducted in africa and europe could not identify any association between gender and age with stigma toward pwmi. high stigma among females can be attributed to poor dissemination of information on mental illness among them. the present study informs that the people belonging to high social class tend to have higher stigma and education could be a significant factor for this association. the high stigma among people belonging to the high social class might be because they are more concerned with their status and reputation compared to low social class people. although some of the studies have found higher stigma among rural population, the current study does not provide evidence to this finding. the role of education on stigma against pwmi has been neutral in the present study ; however some studies reported that education has negative effect on stigma. on the contrary the few studies exhibited that providing exposure to mental health information can reduce stigma levels toward pwmi. stigma is one of the main barriers for quality mental health care and it takes diverse appearance in different forms. the present study was intended to assess the burden of stigma toward pwmi as well as the factors associated with it. the stigma toward pwmi was associated with gender with respect to au, be and cmhi. hence, the study suggests that there is a strong need to eliminate stigma associated with mental illness to improve the mental health status of the region. the results of this study can act as a baseline to design and implement integrated interventions at different levels to address the issue of stigma in the region. | background : stigma associated with mental illnesses is one of the principal causes for mentally ill people not receiving adequate mental health care and treatment. the study was conducted to assess the extent of stigma associated with mental illness and knowledge of mental illness among the community.materials and methods : community - based, cross - sectional study was conducted among 445 respondents from udupi district ; the community attitude toward the mentally ill (cami) scale was used to assess stigma. the probability proportional to sampling size technique was adopted to select the wards / blocks. household from blocks / wards were selected using convenience sampling. self- administered semi - structured questionnaire was used to collect the information. data was analyzed using the software spss version 15.results:of the total 445 respondents, the prevalence of stigma toward mentally ill people was 74.61% (95% confidence interval, 0.7057, 0.7866). the prevalence of stigma was high under all the four domains of cami scale. high prevalence of stigma was seen among females and people with higher income.conclusions:the overall prevalence of stigma toward pwmi was found to be high. the stigma toward pwmi was associated with gender with respect to au, be and cmhi. hence, the study suggests that there is a strong need to eliminate stigma associated with mental illness to improve the mental health status of the region. |
the construction of projection operators onto finite element spaces which commute with the governing differential operators has always been a central feature of the analysis of mixed finite element methods, cf. however, the fact that the canonical projections, defined from the degrees of freedom, are usually not bounded in the natural sobolev norms has resulted in additional complexity of the stability arguments for such methods. in fact, for a long time, it was not known how to construct commuting projections which also are bounded in spaces like and, without making extra regularity assumptions. however, during the last decade rather general constructions of such projections have been given, leading to elegant and compact stability proofs. the first successful construction was given by schberl in, where a smoothing operator, constructed by perturbing the mesh, is combined with the canonical projection to obtain a commuting projection operator which also is bounded. in a related paper, christiansen proposed to use a more standard smoothing operator defined by a mollifier function. in the setting of finite element exterior calculus, variants of such constructions, all based on a proper combination of smoothing and canonical projections, are analyzed in [5, section 5 ], [6, section 5 ], and. however, these projections lack another key property of the canonical projections ; they are not locally defined. in fact, it has not been clear if it is possible to construct bounded and commuting projections which are locally defined. in recent work, the construction is inspired by the well - known clment operator, which is based on local projection operators defined on macroelements. in its original form, where the finite element space consists of continuous piecewise polynomial subspaces of the sobolev space h, however, by modifying the clment operator, such that the local projections are defined with respect to piecewise polynomial spaces, a projection is easily obtained. the more challenging part, successfully addressed in ref., is to obtain commuting projections. is discussed in the setting of exterior calculus and the de rham complex on bounded domains in, and covers all orders of the basic finite element spaces described in refs.. however, the lowest order case, corresponding to the whitney elements, represents in many ways the most challenging part of the construction. a key difficulty is to relate the projection onto the space of whitney k - forms, constructed from local projections on macroelements defined from subsimplexes of the mesh of dimension k, to the corresponding projection onto whitney - forms, constructed by local projections on the corresponding macroelements associated to - dimensional subsimplexes. in ref., a double complex structure, which resembles the ech - de rham double complex, cf. ref. such structures were apparently first introduced by weil in his proof of de rham 's theorem, cf. as far as we know, the construction given in ref. represents the first time a double complex has been utilized in numerical analysis. the purpose of the present article is to explain the construction given in in the simplest possible setting. in particular, we want to motivate why double complexes seems to be a natural tool for generalizing clment type operators, based on local projections on macroelements, to obtain bounded commuting projections. in the discussion below, we will therefore restrict the discussion to the lowest - order case of whitney elements and to the case of two space dimensions. for a given polygon, we consider the associated de rham complex of the form here the operator is given by, mapping a vector field into scalar fields. the space is the space of all vector fields with, while is the corresponding sobolev space consisting of all with., we will continue to use bold typeface for vector - valued quantities and for operators returning vector fields. hence, for a given triangulation of, we let be the corresponding space of continuous piecewise linear functions and the space of piecewise constants. it consists of all piecewise rigid motions with continuous tangential components on all edges of. alternatively, the spaces,, and correspond to the space of whitney forms of order 0, 1, and 2, respectively. in addition, the projections will be local and bounded in the norms of, and, respectively. we let be the set of subsimplexes of of dimension j. in other words, is the set of vertices, the set of edges, and the set of triangles, while is the union of the three sets. for each subset, the associated macroelement f is given by a vertex macroelement and an edge macroelement 1. if, then the piecewise linear function is determined by its values at each vertex, since where y is the piecewise linear hat function associated to the vertex y, that is, and on the complement of the macroelement y. hence, to determine, it is enough to determine for all. however, since functions in general do not have point values, we can not take to be u(y). instead, the idea of the clment operator is to compute, for all, from a local projection py applied to u. the local projections py are defined by solving discrete laplace we let be the restriction of the space to y, that is, is the space of piecewise linear functions on y. neumann problem can naturally be separated into two parts, a mean value contribution and a second part which only depends on the gradient of the function u. more precisely, we define pyu by where. the operator maps into such that the mean value of over y is zero, and this defines uniquely. furthermore, it is straightforward to check that it is a projection, that is, if, since we obviously have in this case. in addition to the macroelements f, we will also need extended macroelements given by alternatively, is the union of all triangles of which intersect f. an example of an extended macroelement is shown in fig. 2. in the special case that, that is, f is a vertex, then. in general, if with then we let be the restriction of to on these macroelements, we utilize discrete complexes of the form here denotes the two - dimensional curl - operator, that is, the operator which maps a scalar field u to the vector field. the complex property follows since. the spaces and consist of piecewise linear and piecewise constant functions on, and restricted to vanishing boundary values in the piecewise linear case, and to vanishing integral over in the piecewise constant case. finally, the space is the lowest order raviart thomas space on with vanishing normal components on the boundary. since the macroelements are simply connected, it follows that the complex given in (4.1) is exact. this means that any element in can be expressed as, where, and any divergence free element of is equal to for a unique.recall that the projection is required to satisfy the commuting property since the left hand side of this identity only depends on, so must the right hand side. furthermore, since we want to be local, we need to see that depends locally on. then we have that from the definition of the operator, we see that the second term here already depends on. furthermore, we observe that let be a fixed edge with vertices y0 and y1, and consider the tangential component of on f. we have where and is the length of f. here, we assume that the functions are extended by zero outside y, such that is a piecewise constant function on the extended macroelement, and with integral equal to zero. in other words, belongs to the space, and by the exactness of the complex (4.1), it follows that there is a unique function such that hence, from integration by parts we obtain recall that functions in are uniquely determined by the integrals of the tangential components over all edges. from the calculations above, we can therefore conclude that where is the whitney 1-form associated to the edge, scaled such that. in other words, and any admits a representation of the form for any, we now define by the identity follows from (4.4). for each, we introduce the operator defined by with the mean value of set to zero. hence, by construction, we have therefore, if we define an operator by then the desired commuting relation follows, cf. (4.3) and (4.5). therefore, the operator will instead be of the form where is a local projection defined with respect to the extended macroelement. the operator is defined by these conditions determine uniquely as a consequence of the exactness of the complex (2.2) restricted to the domain. in fact, the operator admits the decomposition where the operators and are defined by subsystems of (4.6). more precisely, has integral zero over and satisfies while is determined by the operator is a projection onto, since for any, we have on the other hand, it follows from (4.7) that for,, and this implies that on f, therefore, it follows that for any and, and as a consequence, we have therefore seen that is a projection operator, which is local and satisfies the desired commuting relation (4.2). in the construction of the projection above, we have already implicitly used a double complex structure. to see this more clearly, consider the direct sum over all of the complexes of the form (4.1). this gives the exact complex here the differential operators and are applied to each component in the sum. the operator, introduced in the construction of the operator above, represents another operator naturally acting on these spaces. the operator 0 is of the form here the space is a substitute for any of the local spaces, or for. furthermore, it is implicitly assumed that the functions uy are extended by zero outside y. in fact, if and all the components of have the same mean value with respect to y, the function will be in. this was exactly what we utilized above to define such that.we similarly define an operator by where the notation is used to denote convex combination. we obtain a double complex of the form this is a double complex in the sense that each row and each column is a complex. in particular,. furthermore, the operators 0 and 1 commute with the differential operators and, that is, in particular, consider the function, where is the function introduced above to define the operator. this function is divergence free, since as a consequence of the exactness of the last row of the double complex above, we conclude that there is a unique such that. the components of the function z will be utilized in the construction of the operator below. it remains to construct the locally defined projection onto such that we start by computing. the function is a constant on t and the only nonzero contributions in the sum above on t arise from the three edges, and. from the edge we have similar calculations show we therefore obtain that for any, we now define by the identity is a consequence of the calculations above. from the definition of the operator, we now obtain where the last identity follows by combining (4.7) and (4.8). hence, if we define by then the identity follows by construction. however, in the present case, the operator is also a projection. to see this, it is enough to show that however, due to the exactness of the complex (2.2), restricted to, there is a such that on. therefore, by the projection property of the operator we obtain we therefore define to be the operator. we have constructed clment - type projection operators for discretization of the de rham complex in two space dimensions. only the lowest - order finite element spaces, that is, the whitney forms, are considered. the projections are locally defined, they commute with the differential operators of the de rham complex, and they are bounded in the natural sobolev norms. a discussion in the general case, covering higher - order piecewise polynomial spaces and arbitrary space dimensions, can be found in the recent paper. | the construction of projection operators, which commute with the exterior derivative and at the same time are bounded in the proper sobolev spaces, represents a key tool in the recent stability analysis of finite element exterior calculus. these so - called bounded cochain projections have been constructed by combining a smoothing operator and the unbounded canonical projections defined by the degrees of freedom. however, an undesired property of these bounded projections is that, in contrast to the canonical projections, they are nonlocal. the purpose of this article is to discuss a recent alternative construction of bounded cochain projections, which also are local. a key tool for the new construction is the structure of a double complex, resembling the ech - de rham double complex of algebraic topology. 2014 wiley periodicals, inc. numer methods partial differential eq 31 : 541551, 2015 |
a number of pharmacological interventions are now established and available for the treatment of mood disorders. however, there are considerable drawbacks of currently available treatment modalities, such as relatively slow therapeutic effects and limited efficacy for treatment - resistant cases, which impose substantial burdens on the affected individuals as well as on public health and society [3, 4 ]. accordingly, there exists a compelling need for a more improved neurobiological understanding of mood disorders, which may complement the limitations of the prevailing monoamine hypothesis, and corresponding new treatment strategies. in line with these circumstances, the glutamatergic system is receiving more attention as one of the potential targets of novel therapeutic agents for mood disorders [2, 5 ]. glutamate is the major excitatory neurotransmitter in the brain, and growing evidence indicates abnormalities in the glutamatergic system of patients with mood disorders [2, 5 ]. researchers are working to develop medications acting on the glutamatergic system, which may lead to a breakthrough in the pursuit of more effective measures to treat mood disorders. glutamate is a ubiquitous molecule that is engaged in the majority of the excitatory transmission in the brain, yet excessive glutamate release may cause brain damage due to excitotoxicity. for the adequate neurotransmission of glutamate, not only glutamatergic neurons but also astrocytes are indispensable. indeed, astrocytes are essential in glutamatergic activities including glutamate reuptake, synthesis of glutamate precursors, and removal of excess glutamate [8, 9 ]. in addition, there is evidence that astrocytes play an important role in the neuroglial system which enables an efficient coupling of glutamatergic neuronal activities and task - dependent changes in brain energy utilization. thus, perturbations in astrocytic function may contribute to alterations in glutamate and energy metabolism observed in mood disorders. in the present review, we will discuss the roles of the glutamatergic system, astrocytes, and brain energy metabolism in the pathogenesis of mood disorders. glutamate is an essential and abundant amino acid with various functions in the brain, most notably as an excitatory neurotransmitter and precursor of the inhibitory neurotransmitter -aminobutyric acid (gaba) [5, 12 ]. inappropriate regulation of glutamate is known to incur neurotoxicity and other deleterious effects on neurotransmission, neuroenergetics, and cell viability. accordingly, a considerable number of studies have been conducted to investigate the potential association between the glutamatergic system and neurological or psychiatric disorders. in line with these studies, the importance of the glutamatergic system has been increasingly emphasized in the study of mood disorders. as glutamate plays a crucial role in synaptic transmission and plasticity, perturbation of the glutamatergic system is considered to be at least partially involved in synaptic abnormalities found in mood disorders. indeed, several studies observed abnormalities of the glutamatergic system in depression, particularly in glutamate clearance at the synaptic space and in modulation of astrocytic energy metabolism involving glutamate [13, 14 ]. the fast - onset antidepressant effect of the drug tianeptine is also notable in light of the glutamate hypothesis of depression, as the medication appears to exert its influence partly through the glutamatergic system. ketamine, an n - methyl - d - aspartate (nmda) receptor antagonist, has also been reported to exert a rapid antidepressant effect in patients with mdd [6, 16 ]. several findings from postmortem studies, which may provide important histological and molecular information for the neurobiological understanding of psychiatric disorders, are also in accordance with the evidence of glutamate abnormalities in mood disorders. for instance, an elevated level of glutamate was identified in the postmortem frontal cortex of patients with mdd or bd, while dysregulated expression of glutamate - related genes was observed in the hippocampus of patients with depression. also, the level of glutathione, which functions as a physiologic reservoir of neuronal glutamate, was reduced in the postmortem prefrontal cortex. there also have been reports of altered binding properties of the nmda receptor in the brain of suicide victims, decreased expression of the nmda receptor subunits in the prefrontal cortex of patients with mdd, and abnormalities in the levels of excitatory amino acid transporters (eaats) in the postmortem prefrontal cortex of patients with bipolar disorder (bd). however, the inherent shortcomings of postmortem studies, including the extremely limited repository of available brain tissues which often results in underpowered studies with small sample sizes and the confounding effects of varying durations of premortem agonal period or postmortem interval and terminal stress level, suggest that in - vivo approaches are warranted to obtain a more complete picture of the living brain. in contrast to the postmortem approach, magnetic resonance spectroscopy (mrs) provides a non - invasive method which allows in - vivo study of the biochemical environment in the brain. since glutamate and glutamine share a highly similar structure and thereby have overlapping chemical shifts, mrs studies conducted at field strength lower than 3.0 tesla generally assess the combined signal that mainly comes from the two metabolites, which is referred to as " glx ". in the following sections, we will summarize the glutamate- or glx - related outcomes from mrs studies in mdd and bd. the existing mrs literature consistently indicates reductions in the glx level of several brain regions in mdd. for example, in a study which assessed the levels of various brain metabolites in the anterior cingulate cortex (acc) and parietal white matter, the level of glx was significantly lower in patients with mdd. in the same study, when only severely depressed patients were considered, the levels of glutamate alone as well as glx were reduced. another study found a decreased acc glx level in mdd, which was later restored to the normal level in the mdd group effectively treated with electroconvulsive therapy (ect) but not in the untreated mdd group. it was also reported by a different study that the glx level was reduced in the dorsolateral prefrontal cortex (pfc) of patients with treatment - resistant mdd, and that the difference in the glx level between the patient and control groups disappeared after successful treatment of mdd with ect. mdd - associated reductions in the glx level were also observed in the dorsomedial / dorsal anterolateral pfc and ventromedial pfc, in a study that controlled the possible influence of medication by implementing a minimum medication - free period of four weeks as a selection criterion. in addition, even in a study which used a minimum medication - free period of eight weeks, the hippocampal glx level was significantly lower in the mdd group. interestingly, there exist a number of studies which reported normal or elevated glx levels in remitted mdd [32, 33 ]. in association with the reports of normalized glx level after successful ect for mdd, these results suggest that glx, which declines along with the depressive state, may be restored or compensated [28, 29, 32 ]. also, an mrs study conducted in the melancholic subtype of depression reported that the level of glutamate in the occipital lobe was actually increased. meanwhile, there are a few studies that did not observe glx reductions in mdd [35, 36 ], although they appear to have limited implications. a study reported an elevated glx level in elderly patients with mdd, but the increase was not statistically significant and the outcome may not be generalized to non - elderly populations. in another study that focused on the acc and occipital cortex, mdd - related differences in glx were found to be not significant, even though a decreasing trend in the acc glx level was observed. as suggested by these studies, it is possible that the direction and magnitude of changes in the level of glutamate may differ in different brain regions, but the converging evidence generally suggests that meaningful alterations in glutamate level do occur in mdd. unlike the case of mdd, the level of glx is generally reported to be elevated in bd [25, 37 ]. in the acute manic state of bd, an increased glx level in the left dorsolateral pfc was found. furthermore, elevated glx levels were also observed in the cingulate gyrus of the patients with bd, not only in the manic state but also in the mixed or depressed states. based on the concurrent increases in glx and lactate, the researchers of the study proposed that disturbance in the brain energy metabolism, in particular the change in the energy redox state from oxidative phosphorylation to glycolysis, might explain the changed glx level. findings from studies that used phosphorus mrs, which showed ph level decreases in conjunction with lactate level increases, corroborate the shift toward glycolysis in brain energy metabolism. according to a study which distinguished the melancholic and non - melancholic subtypes of bd depression, glx was more heightened in the bd group in comparison with the control group, and the increase in glx was more pronounced in the melancholic bd subgroup. in addition, after treatment with lamotrigine, an anti - glutamatergic mood stabilizer, the treatment group that had undergone remission showed a significant reduction in glx, compared to the non - remission group. in a study which included patients with rapid cycling (rc) bipolar ii disorder, those with non - rc bd, and healthy controls, the glx level in the left dorsolateral pfc turned out to be significantly higher in the rc group in all mood states. although the study was conducted in a small population at a preliminary scale, the fact that the rc subtype is considered as a severe bd subtype implicates the possibility that the elevated glx level may be an important factor in the manifestation of characteristic symptoms of bd. there exists a report suggesting that a substantial number of patients with postpartum depression should be diagnosed to have bd. it is thus notable that the level of glutamate, which is generally increased in bd, was reported to be increased in the medial pfc of patients with postpartum depression. as changes in female hormones are known to be associated with fluctuations in the glutamate level in the medial pfc, it can be hypothesized that the hormonal changes that occur during the postpartum period may induce disturbance in the glutamatergic system, which would in turn lead to the pathogenesis of postpartum depression. it is intriguing that the increasing tendency of glutamate level in postpartum depression is more comparable to the glutamatergic change in bd than to the change in mdd. continued research would be necessary to further elucidate the pathophysiology of postpartum depression and its possible association with that of bd. in sum, the general tendencies of decreased glx level in mdd and increased glx level in bd are considered to be significant, even when the effect of brain regional differences in the level of glutamate is taken into account [25, 37 ]. the existing mrs literature consistently indicates reductions in the glx level of several brain regions in mdd. for example, in a study which assessed the levels of various brain metabolites in the anterior cingulate cortex (acc) and parietal white matter, the level of glx was significantly lower in patients with mdd. in the same study, when only severely depressed patients were considered, the levels of glutamate alone as well as glx were reduced. another study found a decreased acc glx level in mdd, which was later restored to the normal level in the mdd group effectively treated with electroconvulsive therapy (ect) but not in the untreated mdd group. it was also reported by a different study that the glx level was reduced in the dorsolateral prefrontal cortex (pfc) of patients with treatment - resistant mdd, and that the difference in the glx level between the patient and control groups disappeared after successful treatment of mdd with ect. mdd - associated reductions in the glx level were also observed in the dorsomedial / dorsal anterolateral pfc and ventromedial pfc, in a study that controlled the possible influence of medication by implementing a minimum medication - free period of four weeks as a selection criterion. in addition, even in a study which used a minimum medication - free period of eight weeks, the hippocampal glx level was significantly lower in the mdd group. interestingly, there exist a number of studies which reported normal or elevated glx levels in remitted mdd [32, 33 ]. in association with the reports of normalized glx level after successful ect for mdd, these results suggest that glx, which declines along with the depressive state, may be restored or compensated [28, 29, 32 ]. also, an mrs study conducted in the melancholic subtype of depression reported that the level of glutamate in the occipital lobe was actually increased. meanwhile, there are a few studies that did not observe glx reductions in mdd [35, 36 ], although they appear to have limited implications. a study reported an elevated glx level in elderly patients with mdd, but the increase was not statistically significant and the outcome may not be generalized to non - elderly populations. in another study that focused on the acc and occipital cortex, mdd - related differences in glx were found to be not significant, even though a decreasing trend in the acc glx level was observed. as suggested by these studies, it is possible that the direction and magnitude of changes in the level of glutamate may differ in different brain regions, but the converging evidence generally suggests that meaningful alterations in glutamate level do occur in mdd. unlike the case of mdd, the level of glx is generally reported to be elevated in bd [25, 37 ]. in the acute manic state of bd, an increased glx level in the left dorsolateral pfc furthermore, elevated glx levels were also observed in the cingulate gyrus of the patients with bd, not only in the manic state but also in the mixed or depressed states. based on the concurrent increases in glx and lactate, the researchers of the study proposed that disturbance in the brain energy metabolism, in particular the change in the energy redox state from oxidative phosphorylation to glycolysis, might explain the changed glx level. findings from studies that used phosphorus mrs, which showed ph level decreases in conjunction with lactate level increases, corroborate the shift toward glycolysis in brain energy metabolism. according to a study which distinguished the melancholic and non - melancholic subtypes of bd depression, glx was more heightened in the bd group in comparison with the control group, and the increase in glx was more pronounced in the melancholic bd subgroup. in addition, after treatment with lamotrigine, an anti - glutamatergic mood stabilizer, the treatment group that had undergone remission showed a significant reduction in glx, compared to the non - remission group. in a study which included patients with rapid cycling (rc) bipolar ii disorder, those with non - rc bd, and healthy controls, the glx level in the left dorsolateral pfc turned out to be significantly higher in the rc group in all mood states. although the study was conducted in a small population at a preliminary scale, the fact that the rc subtype is considered as a severe bd subtype implicates the possibility that the elevated glx level may be an important factor in the manifestation of characteristic symptoms of bd. there exists a report suggesting that a substantial number of patients with postpartum depression should be diagnosed to have bd. it is thus notable that the level of glutamate, which is generally increased in bd, was reported to be increased in the medial pfc of patients with postpartum depression. as changes in female hormones are known to be associated with fluctuations in the glutamate level in the medial pfc, it can be hypothesized that the hormonal changes that occur during the postpartum period may induce disturbance in the glutamatergic system, which would in turn lead to the pathogenesis of postpartum depression. it is intriguing that the increasing tendency of glutamate level in postpartum depression is more comparable to the glutamatergic change in bd than to the change in mdd. continued research would be necessary to further elucidate the pathophysiology of postpartum depression and its possible association with that of bd. in sum, the general tendencies of decreased glx level in mdd and increased glx level in bd are considered to be significant, even when the effect of brain regional differences in the level of glutamate is taken into account [25, 37 ]. astrocytes are deeply involved not only in glutamate metabolism but also in neuronal energy supply [10, 47 ]. indeed, astrocytes uptake glutamate released to the synaptic cleft and synthesize glutamine from glutamate, while they deliver energy sources including glucose and lactate based on neuronal energy requirements [8, 9, 10 ]. thus, there exists a tight coupling between the glutamatergic system and brain energy metabolism via astrocytic functions. it is thus of particular interest that astrocytic abnormalities are continuously implicated in human and animal studies of mood disorders, although changes in other kinds of glial cells have also been noticed [48, 49, 50 ]. animal models of mood disorders have revealed several changes in astrocytes, which are manifested by phenomena such as altered expression or immunoreactivity of glial fibrillary acid protein (gfap), which is a common marker of astrogliosis and astrocytic glutamate transporters. evidence from human postmortem studies also indicates glial abnormalities including reductions in astrocytic densities or decreased gfap levels. for instance, a study which used postmortem amygdala sample showed that the density of gfap - immunoreactive astrocytes was significantly lower in mdd samples than in bd, schizophrenia, or control samples. a series of in vivo human studies conducted by a research group suggest that reduced density of reactive astrocytes is associated with mdd in an age - dependent manner, as age was positively correlated with gfap immunoreactivity or level [54, 55 ]. these studies imply a meaningful relationship between mood disorders and reduced astrocytic density or gfap levels, especially in younger patients with mdd [54, 55 ]. based on these findings, it has been proposed that the interplay of stress - induced changes, glial dysfunction and disturbed glutamatergic system may be deeply involved in the pathogenesis of depression. as stress may incur an excess of glucocorticoids or reductions in neutrophin levels which are thought to be associated with decreased astrocytic density and impaired astrocytic function, it may in turn lead to disruption of glutamatergic system and subsequent neurotoxicity [48, 52, 56 ]. furthermore, it has been suggested that antidepressants may at least partially exert their effects via directly affecting astrocytes, as these drugs have been shown to influence several factors including the number of astrocytes, gfap expression, and astrocytic signaling pathways. accordingly, further research to elucidate the association between astrocytes and the pathogenesis of mood disorders as well as the pharmacodynamics of antidepressants may contribute to the development of novel therapeutic targets. extensive clinical evidence indicates that depression is a common comorbidity of diabetes mellitus (dm), a disorder of dysregulated glycemic control. according to a meta - analysis, having dm there have been attempts from different approaches to investigate the underpinnings of the association between depression and dm, which is suggested to be bidirectional and complex. for the influence of depression on dm, depressive symptoms are reported to exacerbate dm by hindering self - care and management in patients with dm. for the influence of dm on depression, psychosocial factors did not significantly predict the incidence of depression in dm, whereas biochemical factors, notably glutamate abnormalities, are shown to be implicated in dm - related depression [62, 63 ]. in a rat model of streptozotocin - induced diabetes, dm also, in the identical model, an elevated level of glutamate was observed in the retina of diabetic rats. a human mrs study reported a higher prefrontal glx level in patients with type 1 dm, whereas the levels of glutamate and glutamine in the subcortical brain regions were found be significantly lower in patients with type 2 dm and mdd than in those with dm alone. as indicated by the evidence suggesting glutamatergic abnormalities in dm - related depression, medications acting on the glutamatergic system may prove to be effective in the treatment of depressive symptoms in dm. in consideration of the importance of astrocytes in the regulation of the glutamatergic system, it may be of particular interest that dm appears to be associated with changes in the number or function of astrocytes. a number of studies showed dm - induced reductions in gfap levels in streptozotocin - induced dm, which are suggested to be due to hyperglycemia [66, 67 ]. also, in diabetic rats, ischemia resulted in rapid astrocytic death as well as increased synthesis of inducible nitric oxide synthase, which would lead to an increase in the level of nitric oxide. although it has been proposed that reactive astrocytes may have protective effects against central nervous system injury, this result suggests that diabetic hyperglycemia may induce prolonged or excess response of reactive astrocytes and astrocytic death. another rat study showed that the level of astrocytic gfap was reduced while glutamate uptake was increased in streptozotocin - induced dm, and these dm - related effects were suppressed by insulin treatment. as these studies consistently indicate astrocytic alterations in dm, future investigations on whether there is an association between dm - induced depressive symptoms and changes in the number and function of astrocytes. as discussed in earlier sections, the evidence of glutamate disturbance in mood disorders has been established by a considerable amount of research [5, 70 ]. because the glutamatergic system plays many important roles in neurotransmission and neuroenergetic metabolism, the glutamate hypothesis of mood disorders may have important implications, which may be useful to overcome the shortcomings of the monoamine hypothesis as well as to identify novel therapeutic targets. as the importance of the glutamatergic system is more highlighted, the role of astrocytes, which is suggested to be impaired in mood disorders, is also being emphasized. for a better understanding of the neurobiology of mood disorders, further research to elucidate the complex relationships between perturbations in the glutamatergic system, astrocytic dysfunction, and altered brain energy metabolism | the role of glutamatergic system in the neurobiology of mood disorders draws increasing attention, as disturbance of this system is consistently implicated in mood disorders including major depressive disorder and bipolar disorder. thus, the glutamate hypothesis of mood disorders is expected to complement and improve the prevailing monoamine hypothesis, and may indicate novel therapeutic targets. since the contribution of astrocytes is found to be crucial not only in the modulation of the glutamatergic system but also in the maintenance of brain energy metabolism, alterations in the astrocytic function and neuroenergetic environment are suggested as the potential neurobiological underpinnings of mood disorders. in the present review, the evidence of glutamatergic abnormalities in mood disorders based on postmortem and magnetic resonance spectroscopy (mrs) studies is presented, and disrupted energy metabolism involving astrocytic dysfunction is proposed as the underlying mechanism linking altered energy metabolism, perturbations in the glutamatergic system, and pathogenesis of mood disorders. |
many infertility patients still experience recurrent implantation failure (rif), regardless of the immense strides forward in the field of assisted reproductive technology (art). implantation failure has been ascribed to various factors, such as uterine abnormalities, endometrial factors, and adenomyosis. endometrial factors including submucous fibroids, endometrial polyps, endometrial hyperplasia, endometritis, and synechiae are also known as implantation failure causes. adenomyosis is recognized by endometrial tissue within the myometrium that has the relevant quality with endometriosis. an important step in art is embryo cryopreservation, which contributes to improved pregnancy rates and reduces multiple pregnancies. using once - frozen - thawed embryos, many healthy live births are achieved every year. when all of the thawed embryos survive and supernumerary embryos are available for refreezing after frozen embryo transfer (et), these embryos can be refrozen for future et. therefore, this approach can provide new opportunities, especially in cases with multiple implantation failure. the present report discusses a rare case with a history of rif, fibroids, and adenomyosis in the uterus. she gave birth at 36 weeks to a healthy baby weighing 2.0 kg after et of her refrozen - thawed cleavage - stage embryos. the case was a 39-year - old female with a 6-year history of primary infertility. vaginal sonography revealed diffusely enlarged uterus (12.513.5 cm) with adenomyosis and three 1.5-cm fibroids on the posterior, fundal and anterofundal uterine wall. the husband 's sperm concentration was 2510/ml, with 40% progressive motility and 4% normal morphology (strict criteria). pituitary function was suppressed by administration of 0.5 mg / day intramuscular (i m) buserelin (suprefact, aventis, frankfurt, germany), starting in the luteal phase of the menstrual cycle. when the ultrasound showed inactive ovaries, buserelin was reduced to 0.25 mg / day i m and continued until the day of human chorionic gonadotropin (hcg) administration. controlled ovarian hyperstimulation was initiated with 150 iu / day recombinant follicle - stimulating hormone (gonal f, serono, geneva, switzerland) on day 2 of the menstrual cycle. ovarian response was monitored by serial ultrasound examinations and serum estradiol levels, then the hcg dose was adjusted. a single dose of 10,000 iu hcg (pregnyl, organon, oss, the netherlands) was administered when at least two follicles reached a mean diameter of 18 mm. transvaginal oocyte retrieval was performed 34 to 36 hours after hcg administration with a 17-gauge needle (cook, queensland, australia). a total of 33 cumulus - oocyte complexes (cocs), including 32 metaphase ii (mii) oocytes and one germinal vesicle oocyte, were retrieved and incubated in culture medium at 37, 6% co2 for 3 hours. we performed insemination and intracytoplasmic sperm injection (icsi) methods together according to the clinic 's treatment plan. twelve cocs were inseminated with 25,000 progressive spermatozoa per oocyte in 100 l droplets of g - ivf (vitrolife, gothenburg, sweden), and 20 mii oocytes underwent icsi. all zygotes from in vitro fertilization (ivf) and the injected oocytes were washed twice and cultured in droplets of g1 (vitrolife). on day 2 post - insemination, a total of 20 embryos at 46-cell stages were obtained (seven embryos from ivf and 13 embryos from ivf). embryos were graded from a to b, based on percent fragmentation and expected cell counts : grade a, equal - sized symmetrical blastomeres with no fragmentation ; grade b, equal - sized symmetrical blastomeres with < 10% fragmentation ; grade c, uneven blastomeres with fragmentation of no more than 50% of the blastomeres ; grade d, fragmentation of more than 50% of the blastomeres. due to ovarian hyperstimulation syndrome (ohss) risk, on day 2 after insemination 16 grade b and c embryos (at 35 cell stages) were cryopreserved on four cryotops (kitazato biopharma, fujinomiya, japan) by vitrification. briefly, after a two - step loading with equilibration solution containing 7.5% (v / v) ethylene glycol (eg) and 7.5% (v / v) dimethyl sulfoxide (dmso), and vitrification solution containing 15% (v / v) eg, 15% (v / v) dmso, and 0.5 mol / l sucrose, embryos were loaded onto the polyester sheet of cryotop in a volume of < 0.1 l. after loading, the media was removed to leave only a thin layer covering the embryos, and the sheets were quickly immersed into liquid nitrogen (ln2) and capped, then stored in a large container. after 3 and 6 months, three and four of the b c grade embryos (at 68-cell stages) that had been warmed and cultured for 24 hours were transferred to the uterus, respectively. for warming, the protective cap was removed from the cryotop while it was still submerged in ln2 and the sheet was immersed directly into warming solution containing 1 mol / l sucrose. the embryos were sequentially incubated in diluents solution, washed three times in g1 v5 medium (vitrolife) and incubated at 37 and 6% co2 until et. the patient was prepared for et with oral estradiol (e2) to attain endometrial thickness 8 mm and a triple - line pattern on ultrasound scans. at that time, the patient was given 100 mg of i m progesterone in oil daily and et was preformed 3 days later under ultrasound guidance. however, the first and second frozen - warmed et (fet) implantations failed. the embryos were subsequently cultured in g1 v5 medium at 37 and 6% co2 overnight. two grade b and c 8-cell embryos were transferred and two grade c 7- and 8-cell embryos were re - vitrified. one year after re - vitrification, the two revitrified cleavage embryos were warmed and both survived (figure 1). on the day of warming, two 7- and 8-cell stage refrozen - warmed embryos were transferred to the uterus. the pregnancy was confirmed, and she delivered a healthy female infant weighing 2 kg by caesarean section at 36 weeks of gestation. the case was a 39-year - old female with a 6-year history of primary infertility. vaginal sonography revealed diffusely enlarged uterus (12.513.5 cm) with adenomyosis and three 1.5-cm fibroids on the posterior, fundal and anterofundal uterine wall. the husband 's sperm concentration was 2510/ml, with 40% progressive motility and 4% normal morphology (strict criteria). pituitary function was suppressed by administration of 0.5 mg / day intramuscular (i m) buserelin (suprefact, aventis, frankfurt, germany), starting in the luteal phase of the menstrual cycle. when the ultrasound showed inactive ovaries, buserelin was reduced to 0.25 mg / day i m and continued until the day of human chorionic gonadotropin (hcg) administration. controlled ovarian hyperstimulation was initiated with 150 iu / day recombinant follicle - stimulating hormone (gonal f, serono, geneva, switzerland) on day 2 of the menstrual cycle. ovarian response was monitored by serial ultrasound examinations and serum estradiol levels, then the hcg dose was adjusted. a single dose of 10,000 iu hcg (pregnyl, organon, oss, the netherlands) was administered when at least two follicles reached a mean diameter of 18 mm. transvaginal oocyte retrieval was performed 34 to 36 hours after hcg administration with a 17-gauge needle (cook, queensland, australia). a total of 33 cumulus - oocyte complexes (cocs), including 32 metaphase ii (mii) oocytes and one germinal vesicle oocyte, were retrieved and incubated in culture medium at 37, 6% co2 for 3 hours. we performed insemination and intracytoplasmic sperm injection (icsi) methods together according to the clinic 's treatment plan. twelve cocs were inseminated with 25,000 progressive spermatozoa per oocyte in 100 l droplets of g - ivf (vitrolife, gothenburg, sweden), and 20 mii oocytes underwent icsi. all zygotes from in vitro fertilization (ivf) and the injected oocytes were washed twice and cultured in droplets of g1 (vitrolife). on day 2 post - insemination, a total of 20 embryos at 46-cell stages were obtained (seven embryos from ivf and 13 embryos from ivf). embryos were graded from a to b, based on percent fragmentation and expected cell counts : grade a, equal - sized symmetrical blastomeres with no fragmentation ; grade b, equal - sized symmetrical blastomeres with < 10% fragmentation ; grade c, uneven blastomeres with fragmentation of no more than 50% of the blastomeres ; grade d, fragmentation of more than 50% of the blastomeres. due to ovarian hyperstimulation syndrome (ohss) risk, on day 2 after insemination 16 grade b and c embryos (at 35 cell stages) were cryopreserved on four cryotops (kitazato biopharma, fujinomiya, japan) by vitrification. briefly, after a two - step loading with equilibration solution containing 7.5% (v / v) ethylene glycol (eg) and 7.5% (v / v) dimethyl sulfoxide (dmso), and vitrification solution containing 15% (v / v) eg, 15% (v / v) dmso, and 0.5 mol / l sucrose, embryos were loaded onto the polyester sheet of cryotop in a volume of < 0.1 l. after loading, the media was removed to leave only a thin layer covering the embryos, and the sheets were quickly immersed into liquid nitrogen (ln2) and capped, then stored in a large container. after 3 and 6 months, three and four of the b c grade embryos (at 68-cell stages) that had been warmed and cultured for 24 hours were transferred to the uterus, respectively. for warming, the protective cap was removed from the cryotop while it was still submerged in ln2 and the sheet was immersed directly into warming solution containing 1 mol / l sucrose. the embryos were sequentially incubated in diluents solution, washed three times in g1 v5 medium (vitrolife) and incubated at 37 and 6% co2 until et. the patient was prepared for et with oral estradiol (e2) to attain endometrial thickness 8 mm and a triple - line pattern on ultrasound scans. at that time, the patient was given 100 mg of i m progesterone in oil daily and et was preformed 3 days later under ultrasound guidance. however, the first and second frozen - warmed et (fet) implantations failed. the embryos were subsequently cultured in g1 v5 medium at 37 and 6% co2 overnight. two grade b and c 8-cell embryos were transferred and two grade c 7- and 8-cell embryos were re - vitrified. one year after re - vitrification, the two revitrified cleavage embryos were warmed and both survived (figure 1). on the day of warming, two 7- and 8-cell stage refrozen - warmed embryos were transferred to the uterus. the pregnancy was confirmed, and she delivered a healthy female infant weighing 2 kg by caesarean section at 36 weeks of gestation. to the best of our knowledge, this is the first successful report on double - frozen cleavage stage et in a 39-year - old patient with a history of rif, fibroid, and adenomyosis in uterus. despite three unsuccessful attempts with vitrified - warmed embryos, the patient achieved pregnancy and live birth after the et of double - frozen - warmed embryos. previous studies have also presented success with the births of healthy babies after in vitro development of refrozen embryos. in these cases,, there have been no reports demonstrating that human embryos can be successfully refrozen - warmed at the cleavage stage in an advanced - age patient with rif. cryopreservation of supernumerary embryos during human ivf protocols provides a chance for patients to make repeated attempts at gestation after single - oocyte retrieval, ameliorating pregnancy rates and preventing the waste of valuable genetic material. therefore, with technological progress, multiple cryopreservation of embryos has been contributed to treatment availability in art. there is an increased level of progesterone on the day of ovulation trigger, which was negatively associated with pregnancy rate in the initial fresh et cycles. there may be surplus warmed embryos available for re - cryopreservation when embryos are warmed and transferred in fet. these surplus embryos may be refrozen for later transfer to achieve successful pregnancies and live births. the refreezing process increases the cumulative pregnancy rate, while decreasing the risk of multiple gestation. a new pathophysiological condition has been designated as rif, described by multiple failures to achieve pregnancy after et. in certain cases, a unique condition due to unknown endometrial abnormalities, which do not even allow the initial steps of embryo implantation (apposition, attachment), can be described as rif. a wide variety of reasons for rif have been defined, such as maternal anatomic factors, including congenital uterine abnormalities, uterine fibroids, endometrial polyps, hydrosalpinges, adhesions, and endometriosis. there is a considerable number of macrophages in the eutopic endometrium of patients with endometriosis, myomas, and adenomyosis. the macrophage density increase induced by adenomyosis may cause a hostile immune environment for the implanting embryos. the appropriately activated macrophagesecreted cytokines tumor necrosis factor and interleukin 1, plus reactive oxygen (ros) and nitrogen species are all potentially toxic to embryos. it has been shown that an elevated level of nitric oxide is related to unfavorable embryo development and poor pregnancy rates in the endometrial environment of patients with adenomyosis. in addition, endometrial biopsies taken from adenomyosis showed that this tissue is comprised of a high quantity of antioxidant enzymes, such as superoxide dismutase, catalase, and glutathione peroxidase, which are obvious signs of positional oxidative stress caused by excessive ros production. the embryos directly damaged by these ros and nitrogen species have been reported to augment local production of prostagrandin f2 (pgf2), causing an increase in myometrial contractility that can further disturb implantation. we recommend freezing two embryos with average quality in each cryo - device. in the aforementioned case, ideally, one should not have surplus warmed early embryos, though this may occasionally occur. however refrozen - warmed embryos reached implantation and achieved live birth in a severe case with primary infertility., this case report asserts the position that repeated cryopreservation can be safely used for vitrification and suggests that human embryos could be re - vitrified. however, there is still a demand for prospective controlled studies on the obstetric and neonatal effects of refreezing and of vitrification in particular, despite these desirable results. | the aim was to report a healthy live birth using re - vitrified - warmed cleavage - stage embryos derived from supernumerary warmed embryos after frozen embryo transfer (et) in a patient with recurrent implantation failure (rif). the case was a 39-year - old female with a history of polycystic ovarian syndrome and adenomyosis, along with rif. after ovarian hyperstimulation, 33 cumulus - oocyte complexes were retrieved and fertilized with conventional in vitro fertilization and intracytoplasmic sperm injection. because of the risk of ovarian hyperstimulation syndrome, 16 grade b and c embryos were vitrified. after 3 and 6 months, 3 and 4 b c warmed embryos were transferred to the uterus, respectively. however, implantation did not take place. ten months later, four embryos were warmed, two grade b 8-cell embryos were transferred, and two embryos were re - vitrified. one year later, the two re - vitrified cleavage - stage embryos were warmed, which resulted in a successful live birth. this finding showed that following first warming, it is feasible to refreeze supernumerary warmed embryos for subsequent et in patients with a history of rif. |
the functioning of the cerebral cortex depends critically on the precise balance between excitatory and inhibitory neurotransmitter systems. excitation is mediated via glutamate by pyramidal neurons, the projection neurons of the cortex, and by a special class of local neurons in cortical layer iv, the spiny stellate cells. inhibition is mediated via -aminobutyric acid (gaba) by cortical interneurons, which regulate the degree of glutamatergic excitation, filtering the input and regulate the output of projection neurons. gabaergic interneurons, the nonpyramidal cells of the cerebral cortex, take many different forms of dendritic and axonal arborization, which have been used for their morphological classification ever since their first description by ramon y cajal [15 ]. moreover, interneurons also differ in their firing patterns, the neuropeptides they express, their calcium - binding protein content, and other molecular markers such as ion channels, receptors, and transporters. based on the combination of structural, functional, and biochemical criteria, interneurons have been subdivided into many different subclasses and it is still a matter of hot debate among the experts of how many interneuron subtypes exist in the cortices of different species [68 ]. at the circuit level, interneurons control the flow of information and synchronization in the cerebral cortex. there are about five times more glutamatergic neurons than gabaergic neurons in the neocortex ; this ratio is consistently observed across many mammalian species. this then suggests that the numerical balance of excitatory and inhibitory neurons may be important for normal brain function and behavior. even though gabaergic interneurons comprise only a small fraction of the cells in the neocortex, disturbances in their development, and hence the delicate balance between excitation and inhibition, can lead to neurological or neuropsychiatric diseases such as epilepsy, autism, and schizophrenia (reviewed in [913 ]). however, as we will describe later in this paper, alterations in gabaergic interneuron can also occur in the adult and aging brain, with important repercussions for cortical function and plasticity. cortical projection neurons, the excitatory pyramidal cells, arise in the ventricular zone (vz) of the dorsal telencephalon and then migrate radially to form the laminated neocortex. in contrast, gabaergic interneurons originate from the vz of the ventral telencephalon from three regions : different interneuron subtypes are generated in the medial ganglionic eminence (mge), the caudal ganglionic eminence (cge), and the preoptic area (poa) (see figure 1). for example, parvalbumine positive and somatostatin - positive interneurons arise mainly from the mge, while most calretinin - positive interneurons are born in the cge and the poa gives birth to vasoactive intestinal peptide and neuropeptide y - positive interneurons. interneurons originating from these regions then migrate tangentially in separate streams over long distances towards their cortical destinations [1522 ]. the cellular and molecular mechanisms that regulate and guide interneuron migration out of the ganglionic eminences and poa into the neocortex are beginning to be described. different groups of signaling molecules, including semaphorins and slits, act as repulsive cues for migrating interneurons [23, 24 ]. on the other hand, two isoforms of neuregulin act as short- and long - term attractants that demarcate the migratory route of cortical interneurons. another group of signaling molecules that is expressed widely in the basal telencephalon during interneuron migration is the ephrins and their receptors, the eph receptor tyrosine kinases. as will be described later, recent findings from our lab provided direct evidence for distinct roles of eph / ephrin interactions in the guidance of cortical interneuron migration. the mammalian eph / ephrin system consists of a family of receptor tyrosine kinases subdivided into 9 ephas and 5 ephbs. a - type receptors bind to all a - type ephrins (ephrina15), which are tethered to the cell membrane by a gpi anchor. b - type receptors bind to all b - type ephrins (ephrinb13), which have a transmembrane domain that is followed by a short cytoplasmatic region. an exception is epha4, which can bind to both a - type and b - type ligands [2628 ]. a distinctive feature of this signaling system is that an eph receptor can also act as a ligand in the same manner that an ephrin ligand can act as a receptor. ephrin binding induces eph forward signaling ; however, ephrins can also signal into the cell, which is called reverse signaling (for review, see [2931 ]). using a library of riboprobes for all members of the eph / ephrin gene family, we systematically mapped with in situ hybridizations the complete set of these wiring molecules at different developmental stages. our results revealed that many members of the eph / ephrin system can be detected in the developing telencephalon and that they exhibit highly dynamic expression patterns [32, 33 ]. based on the spatial and temporal expression patterns we could make some prediction about the potential roles of these wiring molecules in regulating the tangential migration of cortical interneurons. these hypotheses have then been tested with different bioassays in vitro and in diverse gene - targeted mouse lines directly in vivo. for example, we could demonstrate that ephrin - a3, which is expressed in the striatum, prevents migrating cortical interneurons from invading this inappropriate region. we could also show that ephrin - a5 is expressed in the vz of the ganglionic eminences, the dorsal boundary of the migratory route of mge - derived interneurons, and that this molecule serves as an inhibitory border to channel these neurons into the subventricular zone. thus, as illustrated in figure 2, the deep corridor of migrating cortical interneurons is at least in part defined by the concerted action of two different ephrin - a ligands, with ephrin - a5 flanking the dorsal portion and ephrin - a3 the ventral portion of this migratory stream. these repulsive effects are mediated by the epha4 receptor, which is expressed by cortical interneurons [32, 34 ]. as already mentioned above, particular interneuron subtypes are generated in a temporally regulated manner in the mge, cge, and poa of the basal telencephalon. we could reveal that poa- and mge - derived cortical interneurons migrate within spatially segregated corridors. ephrin - b3, expressed in poa - derived interneurons traversing the superficial route, acts as a repellent signal for deeply migrating interneurons born in the mge, which is mediated by epha4 forward signaling. in contrast, epha4 induces repulsive ephrin - b3 reverse signaling in interneurons generated in the poa, restricting this population to the superficial path (figure 3). perturbation of this bidirectional ephrin - b3/epha4 signaling in vitro and in ephrin - b3/epha4 double mutants in vivo leads to a partial intermingling of cells in these segregated migratory pathways and as shown in figure 4to a delayed migration of calbindin - positive interneurons to the cortex. thus cell contact - mediated bidirectional ephrin - b3/epha4 signaling mediates the sorting of mge- and poa - derived interneurons in the deep and superficial migratory stream. we could also demonstrate that epha4-induced reverse signaling has a motogenic effect of mge - derived interneurons. in these experiments we first used different in vitro assays for cell migration and found that recombinant epha4 stimulates the migratory speed of cortical interneurons. thus, in addition to its established role in providing cell - contacted mediated repulsion, epha4 can also tune the molecular machinery for neuronal migration. the ephrin ligands mediating epha4 reverse signaling and the signal transduction cascade involved in this process are currently under investigation. however, in order to study the function of epha4 on interneuron migration in vivo, we already examined cortical interneurons in an epha4 knockout mouse line. we found that there was a delayed relocation of calbindin - positive interneurons into the cortex. disrupted - in - schizophrenia 1 (disc1) is a prominent susceptibility gene for major psychiatric disorders [36, 37 ]. for example, previous work suggested that disc1 plays an important role during neuronal proliferation, differentiation, neurite outgrowth, and synapse formation (reviewed in [38, 39 ]). there are also some studies that report that disc1 is a necessary component for the correct positioning of radially migrating cortical pyramidal neurons [40, 41 ]. for this we first performed rt - pcr, in situ hybridization and immunostainings to verify that disc1 is expressed in the mge at the appropriate developmental stages. as illustrated in figure 5, disc1 is expressed in the tips of the leading processes. in addition, we also found disc1 immunoreactivity at the rear of the nucleus, opposite to the leading process. a closer inspection revealed that disc1 colocalizes with lis1, previously described as a centrosomal protein (figure 6). thus disc1 is found in important strategic positions to control the molecular machinery involved in interneuron migration, for example, by interacting with cytoskeletal proteins tubulin and actin, motor proteins of the dynein and kinesin family, and regulatory proteins [40, 43 ]. to examine the functional role of disc1 during interneuron migration, we performed in utero and ex utero electroporation to suppress disc1 in the mge in vivo and in vitro. our results indicate that, after disc1 knockdown, the proportion of tangentially migrating mge neurons that reached their cortical target was reduced by 15%. in addition, there were profound alterations in the morphology of disc1-deficient neurons, which exhibited longer and less branched leading processes than control cells. these results indicate that disc1 has an impact on the migratory behaviour of interneurons during early development that might lead to deficits in the number and/or composition of gabaergic neurons in the cortex. as mentioned in section 1, dysfunctions of local gabaergic circuits thus our findings support the notion that schizophrenia is a neurodevelopmental disease that may result from defects in interneuron integration. vulnerability for psychiatric diseases is not uniform throughout life, but is increased during certain stages of pre- and postnatal development [46, 47 ]. the factors that make neuronal subsystems especially open for environmental influences during well - defined, so - called critical periods have been the subject of much research in the neurosciences. as a typical example, the binocular visual cortex exhibits a well - studied critical period during which, under undisturbed conditions, the orientation preferences for stimuli seen through one versus the other eye are harmonised in visual cortical neurons. it has long been known that temporary closure (i.e., monocular deprivation) of one eye during this critical period will shift the excitability of cortical neurons towards the open eye [49, 50 ]. this critical period for ocular dominance plasticity starts a few days after eye opening in mice, has a maximum at about postnatal day 28, and ends at around postnatal day 32, when short periods of deprivation have no detectable effect in the cortex. longer periods of deprivation, however, are still able to induce ocular dominance plasticity until postnatal day 100 (p100), but no longer (figure 7,). the mechanisms regulating this period of enhanced plasticity have been the subject of intense research for many years. it has become obvious that the critical period is initiated by a shift in the cortical balance of excitation and inhibition [52, 53 ] (see for review), a shift that is effected by the maturation of fast - spiking gabaergic interneurons, the so - called basket cells which are characterised by their expression of parvalbumin. thus, the start of the critical period is delayed in knockout mice lacking the gaba synthesising enzyme gad65 and is triggered in these mice as soon as inhibition at gabaa receptors is increased by the intracerebral infusion of diazepam. enhanced inhibition in early childhood prepones the start of the critical period [53, 56, 57 ]. on the other hand, several interventions have been shown in recent years to reinstate critical period - like plasticity in adult animals by reducing intracortical inhibition : treatment with the antidepressant fluoxetine allows for ocular dominance plasticity in adult rats ; the effect is accompanied by reduced cortical gaba levels and prevented by diazepam infusion. the same holds true for environmental enrichment, and again diazepam infusion averts the effect. indeed, directly attenuating gaba release by a gad inhibitor reestablishes cp - like plasticity in adult rats. thus, it seems that gabaergic neurons single - handedly regulate visual cortical plasticity, and this impression is even enhanced by the recent observation that intracortical transplantation of embryonal cells from the medial ganglionic eminence (mge), which are destined to become gabaergic cortical interneurons, induces a period of enhanced plasticity in mice beyond the critical period. interestingly, this effect is only present during a narrow time frame when the transplanted cells have a certain cellular age (33 to 35 day) corresponding to the age they would have had during the natural critical period in normal development. surprising as this active time window may be, it is in line with a lot of research on the activity - dependent maturation of parvalbumin - containing interneurons in the visual cortex. before and during the critical period for ocular dominance plasticity, the strength of cortical inhibition triples. further research specified that the number of perisomatic boutons around pyramidal cells in the visual cortex increases until postnatal day 28, which marks the peak of the critical period ; again, visual deprivation prevented the increase. these results imply that the maturation of basket cells is necessary for the start of the critical period for ocular dominance plasticity, and they show that this maturation is activity dependent. as mentioned above, transsynaptic transfer of the homeoprotein otx2 from the retina, which is triggered by light perception, has been shown to induce the maturation of parvalbumin - containing interneurons and the start of the critical period. a high concentration of polysialic acid (psa), which traps otx2, has been shown to prevent the start of the critical period, such that premature removal of psa leads to an earlier maturation of parvalbumin - expressing cells and a preponed critical period. recent work has elucidated to a large degree the cell - autonomous mechanisms that promote the developmental synapse formation in basket cells : a knockdown of the gaba - synthesizing enzyme gad67 leads to deficits in axon branching and perisomatic synapse formation, whereas overexpression of gad67 speeds up these processes, (see for review). thus, inhibitory innervation patterns are regulated by the cell 's own activity, which in turn depends on gaba synthesis. an interesting recent twist in this story is the finding that the complete blockade of gaba synthesis in single cells does not, as one would expect, shrink axonal arbors drastically, but contrariwise increases their density and complexity. the authors of that study suggest a model according to which basket cells make tentative contacts with many potential postsynaptic targets, which are pruned or stabilized by synaptic activity. while little activity is sufficient to remove, but not to stabilize connections, complete blockade allows for neither and therefore keeps axonal complexity and synapse number high. in summary, visual stimulation induces the maturation of parvalbumin - containing basket cells, which is internally regulated by gabaergic activity, and shifts the excitation - inhibition balance of visual cortical neurons such that critical period plasticity becomes possible. while it seems established that gabaergic inhibition controls the level of cortical plasticity, it is much less clear in how far gabaergic neurons are involved in the expression of plastic changes. even after the drastic reduction of visual cortical inhibition just about the level that would evoke seizures, the ocular dominance shift evoked by monocular deprivation can be observed, and complete silencing of intracortical connections by muscimol confirms that the effective changes are expressed at thalamocortical synapses. indeed, ocular dominance plasticity is dependent on hebbian plasticity at nmda receptors [7072 ]. one recent study showed that gabaergic neurons are more binocular, that is, less dominated by one eye, in normal mice, but show a similar shift toward the open eye after monocular deprivation during the critical period. if monocular deprivation was performed after the critical period, the ocular dominance shift of gabaergic neurons was even stronger than that of excitatory neurons. another study, however, provided somewhat conflicting results : in vivo intracellular recording from pyramidal cells and fast - spiking interneurons showed that while excitatory cells have a normal bias towards the contralateral eye which they rapidly lose after a short monocular deprivation, fast - spiking interneurons were unbiased at the outset, showed a paradoxical shift towards the closed eye after short deprivation, and only shifted on to an ipsilateral bias after longer deprivation periods. the discrepancies may arise from differences in anaesthesia and method or simply from the fact that the latter study focused on fast - spiking, parvalbumin - containing interneurons which play a central role in regulating the critical period for ocular dominance plasticity, whereas the kameyama study did not distinguish among gabaergic neuronal subtypes. both studies agree, however, that intracortical inhibition changes in response to monocular deprivation, and in adult plasticity, this change may even have a stronger influence on network function than the relatively small change in excitatory transmission. in another primary sensory area, the somatosensory cortex, the role of gabaergic interneurons in the response to sensory deprivation has been firmly established in recent years (see for review). if a single row of whiskers was removed in mice starting on postnatal day 7, the number of parvalbumin - positive interneurons was significantly reduced in the cortical barrels representing that row, whereas it was increased in adjacent barrels. this loss of parvalbumin expression went along with a lower number of perisomatic synaptic varicosities and weaker inhibitory transmission, an effect that required experience - dependent release of bdnf. further research confirmed the reduction in parvalbumin expression and showed that, upon whisker trimming, fast - spiking interneurons in the barrel cortex, but not other kinds of nonpyramidal cells, become less excitable, while their excitatory thalamocortical input is reduced. interestingly, these findings are somewhat at variance with earlier research demonstrating that in rats in which a row of whiskers was plucked between postnatal days 1 and 60, the number of gabaergic synapses on dendritic spines, but not on somata, was strongly reduced in the deprived barrels (see for review). a potential approach to reconcile these conflicting results might be that whisker trimming at a very early age delays the maturation of cortical inhibition in a similar way as dark rearing does in the visual cortex. here, this kind of deprivation also results in reduced parvalbumin expression. as parvalbumin - positive interneurons mature quickly before the onset of the critical period for ocular dominance plasticity in the visual cortex [63, 82 ], so they do in the somatosensory cortex between postnatal days 10 and 30. it is conceivable that only a longer period of deprivation (two months in) allows for the full adaptation to changed input. although such issues still need to be clarified, it appears that the mechanisms regulating sensory plasticity are similar in different cortical areas (see for review), involving the expression of parvalbumin and the formation of perisomatic synapses by basket interneurons in both the somatosensory and the visual cortex. in the auditory cortex, too, similar processes seem to control critical period plasticity [85, 86 ]. this uniformity of function across the neocortex holds a promise for our ability to understand cortical plasticity, but a lot of work still remains to be done to understand the cellular and network mechanisms by which plasticity is enabled. visual acuity and contrast sensitivity decline in an accelerated fashion [8789 ]. in order to test in how far mice might serve as an animal model of age - related vision loss in humans, we have just shown that, in pigmented mice, too, visual acuity and contrast sensitivity deteriorate, starting at approx. 18 months of age, and the progressive loss parallels that which is seen in humans. while age - related degradations in the sensory organs certainly impair access to the environment, there has been a long - standing notion that central nervous changes may also contribute to the decline in visual or somatosensory function [91, 92 ]. indeed, we could show in the same study that visual cortical activity, as measured by optical imaging of intrinsic signals, and cortex - dependent behavioural plasticity were strongly reduced in old mice (figure 8,). a precise connection between cellular changes and visual function loss in old animals has been achieved in macaques. in these animals, orientation tuning of visual cortical neurons electrophoretic application of gaba or the the gaba agonist muscimol to the recorded neurons, however, restored orientation selectivity similar to that seen in young animals, whereas the gaba receptor antagonist bicuculline abolished orientation tuning in visual cortical neurons of young monkeys. a similar degradation of visual cortical function, that is, decreased orientation sensitivity, higher spontaneous activity, and lower signal - to - noise ratio, was observed in aged cats and, partly, in rats [95, 96 ]. looking for the reason of this decrease in intracortical inhibition, hua and colleagues found the density and proportion of gaba - immunopositive neurons in the cat visual cortex to be decreased by about half in old compared to young animals, does this loss of inhibitory interneurons affect all gabaergic subtypes equally ? in humans and dogs it appears that basket cells characterised by parvalbumin are remarkably resilient to old age [98, 99 ]. this fits to the most recent finding that the activity of parvalbumin - containing interneurons has almost no effect on the orientation tuning of visual cortical pyramidal cells, whereas a genetically induced loss of dendrite - targeting interneurons leads to impaired orientation tuning in the mouse visual cortex. the density of calbindin - immunoreactive interneurons, in contrast, is diminished in almost all of the aged human brain, but significantly so only in a few areas, among them the primary visual cortex. the density of calretinin - positive neurons is also affected by age, but mostly in temporal areas. somewhat conflicting results were found in the somatosensory and motor cortices of rats, where the density of both parvalbumin- and somatostatin - positive interneurons was found to be decreased in old animals. it is as yet unclear whether the discrepancy concerning parvalbumin - positive cells is due to differences in brain region, strain, or species. it appears certain, however, that some kinds of gabaergic interneurons are lost during ageing and that this loss may be the reason for the functional degradation found in old animals. despite being only a minority of all cortical neurons, inhibitory interneurons have a key role in modulating cortical function and plasticity, and even subtle impairments to the integrity of these cells can lead to severe neuronal and psychiatric disturbances. it is therefore crucial to understand the development of gabaergic interneurons, their integration into cortical circuits, and the factors necessary for their preservation. in consequence | inhibitory interneurons comprise only about 20% of cortical neurons and thus constitute a clear minority compared to the vast number of excitatory projection neurons. they are, however, an influential minority with important roles in cortical maturation, function, and plasticity. in this paper, we will highlight the functional importance of cortical inhibition throughout brain development, starting with the embryonal formation of the cortex, proceeding by the regulation of sensory cortical plasticity in adulthood, and finishing with the gaba involvement in sensory information processing in old age. |
blunt trauma is the most common cause of renal injury with road traffic accident as the mechanism of injury in the majority of cases. the management of renal trauma has become increasingly conservative with multiple series showing renal preservation after high grade injury., we evaluated the clinical features and outcome of patients who presented with high grade iii - v renal trauma to our institute. the goals were to further refine the absolute indications for exploration and determine the outcomes of conservative management. we retrospectively reviewed the records of all patients with blunt renal injury who presented from january 2005 to december 2012. patient data was obtained from our medical records department and the data retrieved was complete. of the total 55 blunt renal injury patients, we identified 44 consecutive patients with high grade injury (grade iii - v). grade was assigned based on contrast enhanced computed tomography imaging after stabilizing the patient according to the american association for the surgery of trauma kidney injury scale proposed in 1989. regardless of injury grade, all patients who were hemodynamically stable after resuscitation were considered candidates for conservative management. patients who had ongoing hemodynamic instability despite blood transfusion and resuscitation, who had expanding hematoma and who had a pulsatile retroperitoneal hematoma were considered for immediate exploratory laparotomy. conservative management consisted of bed rest, analgesia, hydration and broad spectrum antibiotics in the presence of urinoma. patients treated conservatively were followed - up with continuous hemodynamic monitoring, serial hematocrit determination and abdominal girth measurement. the indications for repeat imaging were urinary leak (grade iv injuries) and ongoing hemorrhage. strict bed rest was advised until the gross hematuria resolved and patients were discharged after 3 - 4 days of ambulation and uneventful hospital stay. all statistical analyses were performed by online statistical tool http://www.graphpad.com/quickcalcs/ and a p < 0.05 was considered to be significant. the continuous variables were presented as mean standard deviation or median and interquartile range, as appropriate. differences between categorical variables were analyzed using the fisher exact test (two tailed). we retrospectively reviewed the records of all patients with blunt renal injury who presented from january 2005 to december 2012. patient data was obtained from our medical records department and the data retrieved was complete. of the total 55 blunt renal injury patients, we identified 44 consecutive patients with high grade injury (grade iii - v). grade was assigned based on contrast enhanced computed tomography imaging after stabilizing the patient according to the american association for the surgery of trauma kidney injury scale proposed in 1989. regardless of injury grade, all patients who were hemodynamically stable after resuscitation were considered candidates for conservative management. patients who had ongoing hemodynamic instability despite blood transfusion and resuscitation, who had expanding hematoma and who had a pulsatile retroperitoneal hematoma were considered for immediate exploratory laparotomy. conservative management consisted of bed rest, analgesia, hydration and broad spectrum antibiotics in the presence of urinoma. patients treated conservatively were followed - up with continuous hemodynamic monitoring, serial hematocrit determination and abdominal girth measurement. the indications for repeat imaging were urinary leak (grade iv injuries) and ongoing hemorrhage. strict bed rest was advised until the gross hematuria resolved and patients were discharged after 3 - 4 days of ambulation and uneventful hospital stay. all statistical analyses were performed by online statistical tool http://www.graphpad.com/quickcalcs/ and a p < 0.05 was considered to be significant. the continuous variables were presented as mean standard deviation or median and interquartile range, as appropriate. differences between categorical variables were analyzed using the fisher exact test (two tailed). we retrospectively reviewed the records of all patients with blunt renal injury who presented from january 2005 to december 2012. patient data was obtained from our medical records department and the data retrieved was complete. of the total 55 blunt renal injury patients, we identified 44 consecutive patients with high grade injury (grade iii - v). grade was assigned based on contrast enhanced computed tomography imaging after stabilizing the patient according to the american association for the surgery of trauma kidney injury scale proposed in 1989. regardless of injury grade, all patients who were hemodynamically stable after resuscitation were considered candidates for conservative management. patients who had ongoing hemodynamic instability despite blood transfusion and resuscitation, who had expanding hematoma and who had a pulsatile retroperitoneal hematoma were considered for immediate exploratory laparotomy. conservative management consisted of bed rest, analgesia, hydration and broad spectrum antibiotics in the presence of urinoma. patients treated conservatively were followed - up with continuous hemodynamic monitoring, serial hematocrit determination and abdominal girth measurement. the indications for repeat imaging were urinary leak (grade iv injuries) and ongoing hemorrhage. strict bed rest was advised until the gross hematuria resolved and patients were discharged after 3 - 4 days of ambulation and uneventful hospital stay. all statistical analyses were performed by online statistical tool http://www.graphpad.com/quickcalcs/ and a p < 0.05 was considered to be significant. the continuous variables were presented as mean standard deviation or median and interquartile range, as appropriate. differences between categorical variables were analyzed using the fisher exact test (two tailed). of the 55 patients, 44 (80%) were male, 11 (20%) were female. high velocity automobile and motor vehicle accidents were responsible for 45 of the 55 injuries (81.8%) and the remaining 10 (18.1%) were due to fall from height and assault injuries. at presentation, 35 (64%) patients had hypotension (i.e., systolic blood pressure 90 mm of hg). all these 35 patients had high grade renal injury and 7 underwent nephrectomy (4 immediate ; 3 delayed). of the 55 patients, grade iii injuries occurred in 22 (40%), grade iv in 18 (32.7%) and grade v in 4 patients (7.2%). macroscopic hematuria was seen in 38 patients (71%), microscopic hematuria in 11 (22%) and only 6 patients had no evidence of hematuria. in 15 of 55 patients (27.4%), liver laceration was seen in 10 (18.1%), splenic injury in 6 patients (10.9%), injury to the duodenum and pancreas in 2 patients (3.6%) and bowel injury in 1 patient (1.8%). rest of the patients had injuries such as rib fractures, pneumothorax, upper and lower limb fractures, head injury and pelvic fractures. the patients who needed intervention required more blood transfusion for resuscitation as measured by packed red blood cell units. out of the 8 patients who required more than 10 units, 6 underwent nephrectomy (4 immediate, 2 delayed), whereas only 1 out of 47 patients who required less than 10 units had delayed nephrectomy (p = 0.0001). tachycardia, hemoglobin at admission and degree of hematuria were not significant predictors for emergency intervention. in our study, 19 patients had other associated intra - abdominal injuries. in the 4 patients requiring emergency nephrectomy, all of them had associated abdominal injuries - two of them had liver laceration and two had splenic rupture for which splenectomy was done. number of patients who required intervention grade wise of the 44 high grade injury patients 40 required no emergency intervention and underwent a trail of conservative management. in 7 of these 40 patients (all grade iv), complications required procedural intervention - 2 patients for extravasation and 5 patients for secondary hemorrhage [figure 1 ]. extravasation of urine required retrograde insertion of a ureteral stent with percutaneous urinoma drainage. among patients with secondary hemorrhage, 3 underwent nephrectomy, 1 underwent successful embolization for pseudo aneurysm and 1 underwent renorrhaphy [figure 2 ]. patients with complications were significantly older and hemodynamically unstable at presentation requiring more packed cell units for resuscitation. in patients with renal trauma with conservative intent who were explored for other intra - abdominal surgery, none of the patients required nephrectomy as there was no expanding or pulsatile retroperitoneal hematoma. of the 44 high grade injury patients 40 required no emergency intervention and underwent a trail of conservative management. in 7 of these 40 patients (all grade iv), complications required procedural intervention - 2 patients for extravasation and 5 patients for secondary hemorrhage [figure 1 ]. extravasation of urine required retrograde insertion of a ureteral stent with percutaneous urinoma drainage. among patients with secondary hemorrhage, 3 underwent nephrectomy, 1 underwent successful embolization for pseudo aneurysm and 1 underwent renorrhaphy [figure 2 ]. patients with complications were significantly older and hemodynamically unstable at presentation requiring more packed cell units for resuscitation. in patients with renal trauma with conservative intent who were explored for other intra - abdominal surgery, none of the patients required nephrectomy as there was no expanding or pulsatile retroperitoneal hematoma. of the 44 high grade injury patients 40 required no emergency intervention and underwent a trail of conservative management. in 7 of these 40 patients (all grade iv), complications required procedural intervention - 2 patients for extravasation and 5 patients for secondary hemorrhage [figure 1 ]. extravasation of urine required retrograde insertion of a ureteral stent with percutaneous urinoma drainage. among patients with secondary hemorrhage, 3 underwent nephrectomy, 1 underwent successful embolization for pseudo aneurysm and 1 underwent renorrhaphy [figure 2 ]. patients with complications were significantly older and hemodynamically unstable at presentation requiring more packed cell units for resuscitation. in patients with renal trauma with conservative intent who were explored for other intra - abdominal surgery, none of the patients required nephrectomy as there was no expanding or pulsatile retroperitoneal hematoma. the vast majority of renal injuries result from blunt mechanisms like motor vehicle crashes and falls. significant renal injuries including laceration and vascular injuries account for 4 - 25% of blunt injuries. in our study, the proportion of patients with high grade injuries is 80%, as our institute is a tertiary referral center ; patients with high grade injury and hemodynamic instability are usually referred from other centers. although management of renal contusion and minor laceration is usually straightforward, there is no consensus on optimal management of high grade injury. in the absence of clear - cut indications like ongoing life threatening hemorrhage, expanding retroperitoneal hematoma and pulsatile retroperitoneal hematoma different management strategies emerge. some groups advocate exploration based on injury grade alone, the presence of devitalized segments or presence of urinoma. the reported operative rate for blunt renal trauma is 2 - 10%. of the operative interventions, similar to other studies an increased risk of nephrectomy was seen in our study with high american association for surgery of trauma grades and this grading was the most powerful predictor of nephrectomy. when grade iii, iv renal injuries are managed expectantly, delayed renal bleeding is found in 13 - 25%. in our study, five of the patients had secondary hemorrhage of which one underwent renorrhaphy, one angioembolization, and three nephrectomy. asssociated intraabdominal injuries was seen in 34.5% of our patients compared to 43% seen in literature. grade v injuries and the need for more packed cell transfusions during resuscitation predict the need for emergency intervention. | introduction : there is no consensus on the optimal management of high grade renal trauma. delayed surgery increases the likelihood of secondary hemorrhage and persistent urinary extravasation, whereas immediate surgery results in high renal loss. hence, the present study was undertaken to evaluate the predictors of nephrectomy and outcome of high grade (iii - v) renal injury, treated primarily with conservative intent.materials and methods : the records of 55 patients who were admitted to our institute with varying degrees of blunt renal trauma from january 2005 to december 2012 were retrospectively reviewed. grade iii - v renal injury was defined as high grade blunt renal trauma and was present in 44 patients. the factors analyzed to predict emergency intervention were demographic profile, grade of injury, degree of hemodynamic instability, requirement of blood transfusion, need for intervention, mode of intervention, and duration of intensive care unit stay.results:rest of the 40 patients with high grade injury (grade 3 and 4)did not require emergency intervention and underwent a trail of conservative management. 7 of the 40 patients with high grade renal injury (grade 3 and 4), who were managed conservatively experienced complications requiring procedural intervention and three required a delayed nephrectomy. presence of grade v injuries with hemodynamic instability and requirement of more than 10 packed cell units for resuscitation were predictors of nephrectomy. predictors of complications were urinary extravasation and hemodynamic instability at presentation.conclusion:majority of the high grade renal injuries can be successfully managed conservatively. grade v injuries and the need for more packed cell transfusions during resuscitation predict the need for emergency intervention. |
clinical seizures as well as photoparoxysmal responses can be triggered by an intermittent photic stimulation (ips), most commonly in generalized epilepsies.1 while some focal seizures are caused by an ips, most are caused by problems of the occipital lobe or visual cortex.2 now we are reporting the case of a 12-year - old female patient with a partial seizure triggered by an ips, proved to be a left temporal lobe seizure, which is supported by continuous video - eeg monitoring. a 12-year - old girl with a history of three convulsions was hospitalized for diagnostic evaluation including continuous video - eeg monitoring. her mother heard a crashing sound followed by regular gasping and sounds of her striking the floor. however, she did not see the convulsive movement because of the locked door. after the convulsions, the patient was confused for several minutes, and complained of nausea and generalized myalgia. she did not have any history of perinatal problems, developmental delay or febrile convulsions. she did not have any relatives with epilepsy in her family. in a neurological examination her mri scan with epilepsy protocol was also normal. during the continuous video - eeg monitoring, interestingly, this epileptic seizure was induced by photic stimulation. immediately after a 15-hz ips this was followed by a forced turning of the head to the right and then a secondary generalized tonic - clonic seizure. after a seizure of about 3 minutes 1) showed a photoparoxysmal response (generalized spike and waves around 3 hz during 3 seconds) during the 15-hz ips followed by ictal discharge with an onset of rhythmic alpha activity over the left temporal area (t5 maximum). she did not complain or remember any visual problems, such as loss of sight, flickering lights, or visual hallucinations during the seizure or postictal period. the patient was given levetiracetam, 1,000 mg / d and had no seizures for 6 months. the follow - up eeg revealed photoparoxysmal response, however, no seizure was elicited by ips. a quarter of patients with spontaneous seizures and eeg photosensitivity belong to a variety of idiopathic epileptic syndromes, such as juvenile myoclonic epilepsy, childhood absence epilepsy and epilepsy with grand mal on awakening.1 the overall annual incidence of cases with newly presenting seizures and unequivocal photosensitivity in the united kingdom is 2% of all new cases with epileptic seizures.3 the photoparoxysmal response pattern is usually a generalized polyspikes and slow waves. this wave is highly associated with clinical photosensitivity and clinical events such as jerks or subjective sensations.4 since there have been several reports of photic stimulation induced occipital lobe seizures, some investigators believe that the origin of focal seizures that are photosensitive can only be occipital.1,57 in these cases, corticocortical non - specific visual afferents from the visual area to the frontorolandic cortex seem to be involved in photosensitivity and subsequent spreading occurs through cortical pathways and possibly through thalamocortical pathways.4 there have been a few reports describing photosensitive focal seizure arising from the temporal lobe. benbadis. has proposed that true temporal lobe epilepsy can also be photosensitive.7 their case is supported by electroclinical data and confirmed by a freedom from seizures after a temporal lobectomy. in 1999, another three cases of complex partial seizures provoked by photic stimulation were reported.8,9 the authors suggested the possibility of activation of distant epileptogenic structure in temporal lobe by photic stimulation of the normal occipital cortex through cortico - cortical transmission. inoue. presented a case diagnosed from clinical symptoms, eegs, and a single photon emission computer tomography.10 they suggested the photic - driving occipital pathways and afferent pathways from the extraocular muscles or orbicularis oculi can cause temporal lobe seizures. there may be a possibility of the coexistence of idiopathic generalized epilepsy and focal epilepsy.1113 rei enatus reported a 13-year - old girl with well controlled generalized epilepsy and medically - refractory left temporal epilepsy.14 wolf and goosses found that 12 of 103 patients with photic - induced seizures had focal epilepsy. in 8 cases, there was associated evidence of generalized epilepsy and the photic - induced seizures were thought to be generalized. in our case, however, according to medical history, semiology and video - eeg monitoring, there was no evidence of the coexistence of idiopathic generalized epilepsy. the only seizure that we did observe was a complex partial seizure with secondary generalization of left temporal lobe onset. this is a rare case of photic stimulation induced focal seizure from the temporal lobe. | there are only a few case reports of photic stimulation induced partial seizures arising from the temporal lobe. a 12-year - old female with a history of three convulsions was admitted for a diagnostic evaluation. during continuous video - electroencephalogram monitoring, a complex partial seizure with secondary generalization was induced immediately after a photoparoxysmal response with a 15-hz photic stimulation. this is a rare case of photosensitive temporal lobe seizure. |
the amplatzer duct occluder (ado) has been used extensively in many medical centers and its effectiveness and safety for transcatheter patent ductus arteriosus (pda) closure have been confirmed by many studies.14 the ado is manufactured in several sizes, and the proper size is generally chosen based on angiographic findings. pda diameters and characteristics can also be obtained via the non - invasive method of transthoracic echocardiographic (tte) imaging prior to the occlusion procedure. echocardiographic and angiographic measurements of the pda have revealed good association in canine models5, 6 and human studies.7, 8 the aim of this study was to establish whether or not tte measurements could make it feasible to estimate an adequate ado size before catheter intervention. we reviewed the records of 21 patients who underwent successful transcatheter closure of pda (appropriate device position with no shunt) between july 2005 and november 2009 in our institution. seven patients (2 men/5 women) were included in our study since detailed data of the tte imaging of their pda were available. each patient underwent a complete two - dimensional tte study and color flow mapping (vivid-7 computed sonography machine, vingmed - ge, horten, norway, 3.5-mhz transducer) within 1 month before the procedure. conventional cross - sectional studies of the pda were performed from the parasternal short - axis view. after visualization of the descending thoracic aorta and ductus arteriosus through tte imaging, the diameters of the duct at the aortic and pulmonic sites were measured. the distance between the mid - position of these two diameters was defined as the pda length. the pda types were defined based on a previously used echocardiographic classification. in type a, the narrowest segment was at the pulmonary insertion, whereas in type b the ductus was short and narrowest at the aortic insertion.8 the following echocardiographic measurement was assessed based on the american society of echocardiography (ase) guidelines and standards : left ventricular ejection fraction (lvef), systolic and diastolic left ventricular dimension (lvd), left atrium (la) size, pulmonary artery pressure (pap), and systolic and diastolic peak gradient (pg). the technique of transcatheter closure was similar to that described by pass.2 to summarize, an angiogram was obtained in biplane projections so as to profile the shape and the position of the ductus. the selection of a device was to ensure that the smallest diameter of the device at the attachment point was at least 2 mm larger than the narrowest angiographic diameter of the ductus. (the diameter of the device neighboring the retention disk is 2 mm larger than that at attachment point) the proper size of the device was advanced into the descending aorta until the retention disk was opened in the proximal descending aorta and snug against the aortic end of the ampulla. transcatheter pda closure was performed using the ado (aga medical corporation, golden valley, mn, usa) and its chinese copycat, cardi - o - fix occluder (starway medical technology inc, beijing, china). with respect to the normal distribution of the homogenecity of the scores and variances, linear regression analysis was performed to show the linear relationship between the tte diameter of the pda and the ado actual size. seven patients underwent transcatheter closure using amplatzer type occlusion devices (amplatzer : 5 and cardi - o - fix : 2). the demographic data, pda echocardiographic measurements, and deployed device size for all these patients are presented in table 1. the tte - diameter of the aortic end of the pda also strongly correlated with the smallest size of the occluder device (duct occluder size = 0.543 + 0.941 tte measured diameter, r = 0.90 ; p value 0.01). the tte diameters of the pda (at aortic end) were the same as the smallest device size (at attachment point) in 4 patients and the larger difference was 1 mm in the other patients. our results indicate a good correlation between the tte measurement of pda at the aortic site and the size of the implanted ado device. we provide an equation to predict the size of the ado using a tte evaluation of the pda prior the procedure. chiming in with our results, the ramaciotti. study of 52 subjects reported a good correlation between tte - derived and angiographic diameter of the pda at the aortic site with no significant association between the measurements of the pda length.8 ting - liang. also found a good correlation between pre - procedure tte measurements and the waist of the implanted ado (ting - liang liu, yu - lin w, jian - jun z. comprehensive assessment of the diameter variations of patent ductus arteriosus during the transcatheter closure procedure. [abstract ] journal of medical imaging, 2004). in regard to our findings, no significant association existed between the device size and the pda diameter at the pulmonic site ; however, ramaciotti in conclusion, echocardiographic assessment may provide an accurate estimation of the adequate size of the ado prior the occlusion procedure. still, further clinical testing in large population samples with a variety of angiographic types of the pda is necessary to establish a more precise formula for the prediction of the adequate size of such devices in our institution and to evaluate the limitations of this method more precisely. | backgroundtranscatheter occlusion of the patent ductus arteriosus (pda) is a minimally invasive treatment. the appropriate device size is chosen based on the angiographic measurement of the pda. the current study aimed to assess the relationship between the transthoracic echocardiographic (tte) measurements of the pda prior to the occlusion procedure and the actual size of the deployed device.methodswe reviewed the available records of 7 patients (2 male) who underwent the procedure at our institution (mean age : 21 12.7 years, range : 7 to 46 years). pda closure was performed successfully using the amplatzer duct occluder (n = 5) and its chinese copycat, cardi - o - fix occluder (n = 2).resultsthe tte measurement of the aortic end diameter of the pda showed a good linear regression correlation with the size of the implanted duct occluder [duct occluder size = 0.543 + (0.941 tte measured diameter), r = 0.907 ; p value 0.01].conclusiontte can provide a good estimation of the size of the amplatzer duct occluder. |
the pervasiveness of negative attitudes toward older people and lack of nurses ' interest in caring for them has become increasingly problematic as numbers of older people continue to increase worldwide [13 ]. amid the current nursing shortage, there is a growing demand for nurses to care for the health care needs of older people. thirty years ago, d. feldbaum and m. feldbaum addressed the issue of ageism in a united states survey of undergraduate nursing students (n = 3,942) and registered nurses (rn 's) (n = 5,300) to describe student and rn attitudes about caring for older people. they concluded that persons who were interested in caring for older people were older themselves (> 55), were of minority status, and had ongoing contact with older people at home or at work. they suggested strategies to increase nurses ' interest in older people that included recruiting more minorities into nursing, increasing financial incentives to nurses caring for older people, and increasing gerontology content in curricula in schools of nursing. in an attempt to increase nursing students ' willingness to care for older people after graduation, we offered nursing students suggestions for creative bonding activities they could share with older people. since the d. feldbaum and m. feldbaum study, numerous approaches have addressed issues related to ageism ; yet, negative attitudes about older people among nursing and other healthcare professional students persist [3, 5, 6 ]. minorities and older health professional students and workers have been cited as groups that favored work with older people. researchers have more recently reported an inverse relationship between age of the caregiver and better attitudes among hispanic social work students. additionally, when geriatric didactic content has been added to the nursing school curricula, there have been inconsistent results with little or no gain in knowledge, little or no attitude change, and little or no interest in caring for older people after graduation [2, 79 ]. in a study of curricula in four schools of nursing, the one school that had made major curricula changes with a focus on older people reported changes in attitudes of students towards older people. successful aging paradigm framework throughout the curricula, (2) the provision of in - service education classes to build faculty expertise in gerontology, and (3) the institution of multiple student experiences with well elders living in the community. however, students ' willingness to care for older people post - graduation was not evaluated. in two recent qualitative studies, medical students ' attitudes towards older people did improve after year - long contact between medical students and community dwelling older adults [10, 11 ]. the older adults served as mentors / advisors with the medical students [10, 11 ]. attitudes and knowledge about older people have been described in undergraduate and graduate college students (n = 125). in these college students, frequency of communication with elders was positively correlated with better attitudes about older people. yet, student age and knowledge about aging had no relationship to students ' attitudes about older people. other researchers have measured frequency of communication, proximity to older people, and student anxiety about aging and reported no relationship between attitudes of college students (n = 107) and frequency of daily contact with older people. yet, those students who resided with older people had more anxiety about aging than students whose sole contact with older people was in a work environment. in a survey of physician assistant students (n = 36), students who had weekly socialization with older people did have better attitudes towards older people than students who had yearly contact. in a small group (n = 27) of nutrition students, 1/2 of the students (n = 13) that preferred working with older people also had better attitudes and previous frequent contact with older people. throughout the literature, knowledge about aging [7, 8 ], frequency of contact [1013 ], minority status, age of a student or caregiver [46 ], type of older person with whom one communicates [7, 10, 11, 13 ], and implementation of curricula changes [2, 10, 11, 13 ] may or may not determine if future health professionals are willing to care for older people. surprisingly, in a longitudinal study of baccalaureate nursing students, the introduction of additional knowledge about elders and increased student contact with elders decreased students ' interest rather than increased their interest in caring for older people. because nurses are the largest health care work force that will provide care for elders, researchers continue to focus on ways to increase nursing students ' willingness to care for older people after graduation. researchers have reported novel approaches to address the challenges surrounding nursing students ' knowledge, attitudes, and willingness to care for older people after graduation. the theory of self - transcendence was used as a conceptual framework in two studies [15, 16 ] to test a creative bonding intervention (cbi) to promote positive communication between elders and undergraduate nursing students in the usa (a pilot study) and in taiwan (a prepost test quasi experimental study). the theory of self - transcendence guided the present study and provided the rationale to test the cbi. in the theory of self - transcendence, reed identified three major concepts : self - transcendence, vulnerability, and well - being. in the present study, reed described self - transcendence as a developmental trait that may be used by vulnerable populations. self - transcendence has four dimensions : (1) intrapersonal self - transcendence within self(2) interpersonal self - transcendence between self and others(3) temporal self - transcendence past, present, and future time and (4) transpersonal self - transcendence outside, of self, for example, spirituality. reed discussed that in vulnerable persons, the introduction of creative activities might serve to promote self - transcendence and well - being. self - transcendence was one outcome variable in the present study measured by reed 's self - transcendence scale (sts). in previous studies [15, 16 ], the focus of the communication between the student and older person was on the interpersonal self - transcendence (between self and others) and temporal self - transcendence (present, past, and future time). by self - report following the cbi, students [15, 16 ] reported that they had grown personally after their encounters with older people (intrapersonal self - transcendence). during the cbi activities to promote temporal self - transcendence, students were encouraged to ask the older person to reminiscence about their favorite colors, favorite past experiences, or previous hobbies during the cbi activities [15, 16 ]. in the two previous studies [15, 16 ] students attitudes [17, 18 ] and self - transcendence were measured before and after a one semester course, care of the older adult. in the larger study, an experimental group of students (n = 100) were randomly assigned to implement the cbi while a control group of students (n = 100) implemented a friendly visit only. students in the cbi group increased in self - transcendence (p <.06) ; however, there was significant improvement (p <.05) in students ' attitudes towards older people. the purpose of the present study was to utilize the cbi to continue to investigate the relationship of students ' attitudes toward older people, to describe self - transcendence, and to evaluate students ' willingness to take care of older people. researchers inferred that if self - transcendence increased and attitudes towards older people improved, students would increase their willingness to take care of older people after graduation. the research question was, in a group of senior baccalaureate nursing students, will the cbi improve attitudes towards older people, self - transcendence, and willingness to take care of older people ? hypotheses were (1) compared to the control group students who participate in the cbi will have better attitudes towards older people ; (2) compared to the control group students who participate in the cbi will have an increase in self - transcendence ; (3) compared to the control group, students who participate in the cbi will have an increase in willingness to take care of older people following graduation. the collection of data occurred during the fall of 2008 and the spring of 2009 at a catholic southeastern florida university. this pretest posttest descriptive cross - sectional design included students from junior and senior classes that served as controls ; one section of seniors (n = 28) was the experimental group where the cbi was piloted. a convenience sample of two groups of junior students and one group of senior students with no exposure to the cbi served as the control group (n = 84). there was no exclusion criteria for any of the participants enrolled in select junior and senior nursing courses. initially the researchers intended the study as descriptive only, thus the small sample and unequal size between groups. after the decision was made to pilot the cbi, the institutional review board (irb) (ethics board) approved adding the intervention only in time to include the final group of seniors in the care of the older adult course during their final six weeks before graduation. therefore, the implementation of the cbi was limited to a final group of 14 seniors. absences at pretesting or post - testing and timing (seniors getting ready to graduate) contributed to the small sample for the cbi group. both the cbi group and the control group of seniors had clinical experiences with older well people living in the community. there was a focus on well people in the care of the older adult course due to the literature that has supported the need for young persons to have experiences with well older people before these people become ill [1, 10, 11 ]. the questionnaire packet completed by the participants was comprised of a sociodemographic survey that included age, ethnicity, family structure, interaction with older people, living arrangements regarding older relatives or grandparents, visitation with older people or grandparents, volunteerism with older people, preference among three age categories to work with after graduation, and willingness to take care of older people. two instruments administered before and after intervention were the self - transcendence scale and attitudes toward old people scale [17, 18 ]. data were collected anonymously with volunteers choosing their own identification numbers for pre- and postdata packets. reed, s self - transcendence scale (sts) measured self - transcendence. participants were asked to indicate on a 4-point likert scale how strongly they agreed with the 15 statements (1 : not at all, to 4 : equals very much), resulting in scores ranging from 15 to 60 with the higher scores indicating higher levels of self - transcendence. reed reported an alpha coefficient of.90 indicating high internal consistency for the scale. attitude towards older people was measured using the attitudes toward old people scale [17, 18 ]. participants were asked to indicate on a 7-point likert scale how strongly they agreed or disagreed with the 22 items. seventeen items were positively worded and responses were summed to create a positive attitude subscale. the protocol and method of obtaining informed consent were approved by the institutional review board (irb) of the university where researchers were affiliated. anonymity was protected as no names were on any information in the packets with a reminder on the instruments not to put names on any of the materials one group of senior students (n = 28) enrolled in the course, care of the older adult, was exposed to the cbi as part of the course content. the control group of students were from volunteers of three groups of students from junior and senior classes (n = 84). all information obtained was anonymous ; therefore, students were not informed of their own scores. student participation did not influence any course grades as instructors did not know who completed research packets. interventionists who were not involved in teaching any didactic course content nor involved in student grading presented a mini - cbi one - hour workshop to the senior experimental students enrolled in the course, care of the older adult. students enrolled in the course were required to have 45 hours of clinical experience with older persons living in the community. the interventionists also offered additional time with interested students if students wanted more instruction about any of the three cbi activities. the cbi activities were (1) a monoprint, (2) a ribbon gem, and (3) the self - image portrait. interventionists suggested that students might use their portrait to introduce themselves to individuals or groups of older people when they first met, following researchers ' suggestions from previous cbi studies [15, 16 ] (see examples of photos of students completing the self - image activities and examples of student self - image portraits in figures 13). if the older people were interested, students would offer them the opportunity to create their own self - portrait or create another cbi activity. a copy of the cbi workbook was given to each of the experimental students along with the needed art supplies to complete the three activities. participants were 90% women and 70% minority with a median age of 25, including 14 in the intervention group and 56 in the control group. at some point in their lives half had worked or volunteered with older people and 44% lived with older relatives. the majority (57%) interacted with older people at least several times per week. students in the control group were asked to identify their age group preference (children, middle - aged, or older people) to care for following graduation. older people were the first preference at the pretest for 18% of the respondents ; however, at the posttest only 9% of the respondents preferred to take care of older people. in contrast, the proportion of students that preferred the middle - aged remained constant at 50% and the proportion that preferred children increased from 33% to 41%. in the absence of the cbi, there was a dramatic decrease in preference to take care of older people, illustrating the problem the cbi was intended to address. although there were no statistically significant differences in baseline scores (see table 1), the researchers used gain scores to protect against the possible confounding influence of baseline differences a one - tail independent - samples t - test was conducted to evaluate the hypothesis that students ' positive attitudes toward older people would improve more for the cbi group (m = 10.71, sd = 11.09) than the control group (m = 3.79, sd = 11.74), t(68) = 1.99, p =.025. the standardized difference in means (d =.57) indicated a medium effect size. students ' negative attitudes toward older people improved more for the cbi group (m = 3.79, sd = 3.66) than the control group (m = 0.66, sd = 3.89), t(68) = 2.72, p =.008. the standardized difference in means (d =.78) indicated a large effect size. on average, the cbi led to important improvement in attitudes toward older people, especially diminishing negative attitudes. a one - tail independent samples t - test was conducted to evaluate the hypothesis that students ' self - transcendence would increase more for the cbi group (m =.64, sd = 5.7) than the control group (m =.59, sd = 6.17), t(68) =.032, p =.49. a one - tail independent samples t - test was conducted to evaluate the hypothesis that students ' willingness to take care of older people would increase more for the cbi group (m = 1.36, sd = 2.29) than the control group (m =.22, sd = 2.37), t(58) = 1.45, p =.08. low power may be attributed to the small sample size, the unequal size of the groups, and imprecision in the willingness measure which was based on only one question. although there was a positive correlation between willingness to take care of older people and positive attitudes, r =.24, p =.03, the increase in positive attitudes was not sufficient to generate a significant increase in willingness. it is important to note that willingness to take care of older people is uncorrelated with negative attitudes, r =.06, p =.33. even though this was a pilot study, limitations should be noted and corrected in future studies. first, the use of a convenience sample limited the generalizability of the results and introduced possible self - selection bias. second, the glaring differences in sample size between the control group and the experimental group reduced the power of all the hypothesis tests. to increase numbers within the cbi group, phase ii of the study is in progress implementing the cbi over two semesters with several classes of senior students enrolled in the care of the older adult course. finally, since differences in self - transcendence were not found on reed 's sts, perhaps a different theoretical framework would better explain the effects of the cbi. reed has acknowledged that self - transcendence changes may occur only over long periods of time. regardless of the small size of the cbi group, this pilot study provided evidence that the cbi improved students ' attitudes towards older people, with increases in positive attitudes and even larger decreases in negative attitudes. students often expressed surprise that the cbi experience was more enjoyable than they had expected. this experience seems to be more effective in destroying negative stereotypes than in building positive bonds. perhaps positive bonding requires a longer timeframe. although not statistically significant, there was evidence that the cbi promoted students ' willingness to take care of older people after graduation. in the absence of the cbi there was a dramatic decrease in preference to take care of older people after graduation, the results suggest that interventions which promote positive attitudes toward older people are more effective in increasing willingness than interventions that disabuse students of the negative stereotypes that may underlie negative attitudes. given the shortage of nurses in settings that serve older persons such as skilled nursing facilities, the purpose of our study was to facilitate students ' willingness to care for older persons after graduation. the course, care of the older adult, was designed with a focus on well older persons. the expectation was that the cbi group would rethink their ideas about older persons if they had a positive bonding experience with well older people. in a previous study, when the cbi was implemented by students in a nursing home in contrast to the previous literature [2, 7, 9 ] where there was little or no attitude change in students, our study found there were significant improvements in attitude in the cbi group. in previous studies [2, 7, 9 ] willingness to care for older people was not evaluated. continued contact with community - dwelling older people among nursing students had a positive change in attitudes similar to the medical students [10, 11 ] when they had multiple contacts with community - dwelling well elders who served as mentors over a year - long period. from our study and previous studies, multiple interventions with community - dwelling older people hold promise not only to change students ' attitudes toward older people but also to promote students ' commitment to care for an ever - growing older population. due to the small number of experimental students in our study and only one question regarding willingness to take care of and preference for caring for specific age groups following graduation, additional questions are needed in these domains to discover new strategies to promote students ' interest in older people. in the comparative study of four nursing schools, students in the school that adopted major curricula changes did have more positive attitudes, but students ' plans after graduation were not reported. therefore, major curricula changes including creative activities such as the cbi and longitudinal follow up with students after graduation may provide educators with additional strategies to increase students ' interest in older people. an intervention that allows nursing students to spend time with older people utilizing creative activities may provide a dual benefit. students ' interest in geriatric nursing may increase, and older people may benefit from the additional time students spend with them during implementation of creative activities. | although numbers of older people are increasing, nursing students have negative attitudes towards older people and do not plan to care for them following graduation. multiple strategies have been implemented to reverse students ' attitudes with mixed results. the purpose of this pilot quasi - experimental study was to test a creative - bonding intervention (cbi) with students implementing art activities with older people to promote students ' willingness to take care of them. using a self - transcendence conceptual framework, control (n = 56) and experimental (n = 14) student groups were pre- and post - tested on attitudes toward older people, self - transcendence, and willingness to serve. the cbi improved attitudes towards older people with negative attitudes significantly changed (p =.008) but with no significant differences on self - transcendence and willingness to serve. however, willingness to serve results approached significance (p =.08). the willingness measure (one question) should be expanded. curricula changes that incorporate creative activities such as the cbi with larger and equal numbers in student groups and longitudinal follow up to determine long - term results after graduation are suggested. |
brugada syndrome, first described in 1992, is a life threatening disease and is usually overlooked during emergency service admissions.1) it is characterized by typical electrocardiography (ecg) resembling right bundle branch block (rbbb), static or dynamic st - segment elevation in leads v 1 - 3. there is familial tendency in some cases.2) a majority of patients have a structurally normal heart and are likely to remain asymptomatic, however they may present to emergency departments with syncope and various arrhythmias (atrial fibrillation, ventricular tachycardia, ventricular fibrillation - cardiac arrest and etc.).1)2) therefore it is crucially important for emergency medicine physicians not to omit this potential diagnosis. herein we report a case with brugada syndrome which was iatrogenically unmasked after propafenone administration for atrial fibrillation. a 62-year - old male presented to the emergency department of a local hospital complaining of palpitation. because emergency department physicians interpreted the ecg as indicating atrial fibrillation, they administered intravenous propafenone (fig. 1). after this, the patient experienced dizziness and became hypotensive (blood pressure : 80/50 mm hg). ecg after propafenone infusion showed an rbbb pattern, st - segment elevation in leads v 1 - 3 and st - segment depression in leads dii, diii and avf (fig. he was thus immediately transferred to our center with the diagnosis of acute myocardial infarction. on admission to our center other than the above mentioned characteristics, ecg revealed atrial fibrillation with a ventricular rate of 155/min. given that he was symptomatic and hypotensive, direct current cardioversion was performed (100 joules). after shock, the ecg was in sinus rhythm and compatible with brugada syndrome (fig. 3). after cardioversion, his symptoms subsided and blood pressure returned to within the normal range. ecg changes were in accordance with iatrogenic unmasking of concealed type brugada syndrome. due to ethical reasons we did not give additional propafenone for challenge. from acquiring detailed history, we learnt that one of his sisters had the diagnosis of brugada syndrome (fig., we found that his daughter also had the asymptomatic type 2 ecg pattern of brugada. we recommended him for further electrophysiologic evaluation for possible ventricular arrhythmia detection and risk stratification. in the present paper, we report a case with brugada syndrome which was iatrogenically unmasked after propafenone administration for atrial fibrillation. as described in the introduction, the syndrome is commonly overlooked at admission but has several important diagnostic features. it is more common in males and asian populations.1)2) in brugada syndrome there are three typical types of repolarization presentation, based on the appearance of the st - segments in leads v 1 - 3. type 1 has st - segment elevation, ending with a negative t wave, forming a " coved " appearance. type 2 has a downsloping st - segment elevation above baseline forming a " saddle back " st appearance. type 3 has the same saddleback appearance as type 2, but with less st - segment elevation. ecg readings are dynamic and may transform from one type to another or may even completely normalize. increased vagal activity, fever, tricyclic antidepressant agents, or class i a, ic and iii antiarrhythmic agents may unmask the ecg similarly to that which occurred in our case.3)4) in conclusion, in case of admission with atrial fibrillation to emergency department, a commence of class ic antiarrhythmic agent in order to return to normal sinus rhythm may unmask concealed brugada syndrome. the appearance of post treatment st - segments elevation in leads v 1 - 3 with rbbb patterns should alert emergency physicians so that they do not omit this life threatening disease. | brugada syndrome is a life threatening disease that is usually overlooked during emergency service admissions. it is characterized by typical electrocardiography resembling right bundle branch block, static or dynamic st - segment elevation in leads v 1 - 3. there is familial tendency in some cases. a majority of patients have a structurally normal heart and are likely to remain asymptomatic, however they may present to emergency departments with syncope and various serious arrhythmias. therefore it is crucially important for emergency medicine physicians not to omit this potential diagnosis. herein we report a case with brugada syndrome which was iatrogenically unmasked after propafenone administration for atrial fibrillation. |
health technology assessments (htas) provide critical input to a large array of medical decisions made by payers, patients, clinicians, hospitals, and manufacturers. these decisions involve diagnostic testing, treatment selection, care management, patient perspectives, patient safety, insurance coverage, pharmaceutical innovation, equipment planning, device purchasing, and total cost of care. good htas provide an independent and unbiased summary of existing information, leading to better decisions that maximize the health of patients. htas include numerous components surrounding a technology, such as the indicated patient populations, current standard(s) of care, motivations for the proposed technology, syntheses of relevant evidence, and discussions of guidelines, previous htas, ongoing trials, and cost / reimbursement. the most important component of an hta, at present, is the evidence synthesis. this typically consists of a summary of existing research results for a technology or intervention. often, however, the published evidence does not permit firm conclusions because of low quantity, poor study design and reporting, inconsistent results among studies in the body of evidence, use of surrogate endpoints rather than patient - oriented endpoints, and follow - up that is too short to truly assess the impact on patient health. a statement that the evidence is insufficient, therefore, is an all - too - common refrain in htas, and hta authors are typically loathe to go beyond the evidence. this raises a question : can the addition of electronic clinical data (ecd) help fill the gap, providing a more complete information set for decision - making ? our perspective is that of ecri institute, an independent, nonprofit applied health services research organization that has worked since the 1960s with u.s. federal and state agencies and thousands of hospitals, health plans and health care delivery systems, private foundations, and ministries of health worldwide. decision makers are routinely faced with the challenge of evaluating whether to adopt or reimburse for aggressively marketed drugs, devices, and procedures that quickly diffuse into practice. our htas are designed to provide decision makers with information on health technology and services on a breadth of health conditions, medical / surgical treatments, behavioral health interventions, drugs, devices, health services, and care settings. our approach has been to develop a variety of information tools, ranging from concise, rapid - turnaround htas to large - scale systematic reviews and comparative laboratory evaluations, when appropriate, on more than 1,000 topics. given the advent of electronic health records (ehr), we explore in this commentary potential uses for ecd to improve htas and inform decision - making. we discuss current uses of ecd, possible benefits of using ecd in htas, potential pitfalls in such use, and how incorporating ecd in htas might yield better medical decisions. most htas currently use ecd only indirectly : they synthesize data from studies that may have used ecd. for example, most htas of metabolic (bariatric) surgery include the well - known swedish obese subjects study,1 a nonrandomized study of ecd describing virtually all patients in sweden who received metabolic surgery from 1987 to 2001. htas often summarize data from registries, which are centralized databases of ecd (e.g., the hta by singh. 2 on the epidemiology of knee and hip arthroplasty). decision makers currently use ecd to help inform many types of decisions and to replace or supplement hta. for example : in an effort to reduce long - term risks of cardiovascular disease due to diabetes, kaiser permanente northern california used 2.5 years of data from electronic medical records to perform a markov model cost - effectiveness analysis.3geisinger health system (danville, pa. developed their proven - health navigator computer system to permit real - time feedback on many aspects of patient care such as referral tracking, emergency department visits, hospital readmissions, and medical expenses.4geisinger also designed a nine - component bundle for ehr to coordinate multidisciplinary diabetes care, assess quality metrics, and improve adherence to clinical practice guidelines.5an analysis of veterans administration electronic records detected 1,000 patients in a five - month period who were past due for a resupply of statins. upon further review, about 20 percent had no sound reason for not refilling their prescriptions ; the records search enabled fast identification and clinical review.6 in an effort to reduce long - term risks of cardiovascular disease due to diabetes, kaiser permanente northern california used 2.5 years of data from electronic medical records to perform a markov model cost - effectiveness analysis.3 geisinger health system (danville, pa. developed their proven - health navigator computer system to permit real - time feedback on many aspects of patient care such as referral tracking, emergency department visits, hospital readmissions, and medical expenses.4 geisinger also designed a nine - component bundle for ehr to coordinate multidisciplinary diabetes care, assess quality metrics, and improve adherence to clinical practice guidelines.5 an analysis of veterans administration electronic records detected 1,000 patients in a five - month period who were past due for a resupply of statins. upon further review, about 20 percent had no sound reason for not refilling their prescriptions ; the records search enabled fast identification and clinical review.6 these questions reflect the pressing clinical issues that the evidence may or may not answer. one way ecd could improve htas is by enabling reviewers to answer key questions not addressed by published studies. in our systematic review of surgical treatments for inguinal hernia,7 one key question involved whether a surgical procedure to repair a known hernia on one side should include an exploratory procedure on the contralateral side (to determine whether the asymptomatic side had already herniated or was about to herniate). no studies have compared a surgical exploratory approach with a wait - and - see approach for the contralateral side. if ecd had been available, however, it might have enabled us to analyze the data and answer the question. another example concerns rare harms of treatments : most published studies are too small to detect rare harms. food and drug administration performs surveillance to capture harms (see a summary of drug - related surveillance at http://www.fda.gov/drugs/guidancecomplianceregulatoryinformation/surveillance/ucm090385.htm), but such efforts are insufficient according to a 2009 report from the u.s. government accountability office.8 ecd - derived research may be sufficiently powerful to detect rare harms and estimate their likelihood. furthermore, ecd exist at the individual patient level, rather than at the summarized group level. data on individual patients may permit analyses of new questions not answerable from the overall means, such as why a treatment works for some patients but not others.9 this is known as heterogeneity of treatment effect (hte), and it has received insufficient attention from both primary researchers and systematic reviewers.10 varadhan. (2013)11 recently lamented the ongoing confusion among the various purposes and methods of hte analyses and proposed a framework to guide future work. the framework includes predictive hte analysis, which intends to estimate each individual patient s chance of benefit or harm.. armed with individual - level ecd, hta developers could more easily do so. another way ecd could improve htas is to predict the clinical impact of the uptake of a new treatment (or the phasing out of an outdated treatment). for example, metabolic surgery is widely believed to reverse the effects of type 2 diabetes, to the point that after surgery many patients no longer require diabetes medications.12 ecd could provide baseline information on a population s rates of morbid obesity and diabetes, as well as how many patients annually undergo metabolic surgery. an hta would first summarize published studies of metabolic surgery and then estimate the chance that a given obese patient with diabetes would no longer need diabetes medication. these estimates could be combined to model hypothetical scenarios of uptake ; for example, if 20 percent more of these patients at a given health system underwent metabolic surgery, how many fewer diabetes medications would be prescribed, and what would the cost implications be ? such theoretical questions are addressed formally within a decision model, which is occasionally used by hta authors.13 for example, trikalinos and lau (2007)14 constructed a decision model to inform a systematic review on the diagnosis and treatment of obstructive sleep apnea. an incorporation of ecd may provide them, and therefore allow more robust decision models. ecd could also improve htas in enabling decision - making to determine how to apply the hta s results to a local population.15 this is related to the distinction between efficacy (how well a treatment works under optimal conditions) and effectiveness (how well a treatment works under typical conditions). published research studies often employ stringent patient inclusion criteria (e.g., non - smokers ages 2060 years without diabetes or hypertension). thus, an evidence synthesis of such studies may not apply to other patient populations (e.g., older than age 60). ecd could include such patients who had received the same treatment as patients who had been in the published studies, and analyses of the ecd could answer questions such as (1) does the treatment work differently for patients who were ineligible for the trials, (2) are harms differentially likely for trial - ineligible patients, and (3) is the treatment being administered in settings similar to those in trials. on a related note, the grading of recommendations assessment development and evaluation (grade) working group has published guidance on how nonrandomized studies (which are often based on ecd) can be used to inform judgments about applicability.16 ecd can also be used to summarize practice variation by clinical specialty or geographic region. however, if an analysis of ecd demonstrates areas of substantial variation (e.g., higher mastectomy rates in certain parts of the united states),17 then hta users could act accordingly (e.g., greater education efforts in those regions toward compliance with national guidelines on mastectomy). ecd analysis could also reveal valid reasons for the geographic variation, such as better patient outcomes for areas with nonnormative rates, and this discovery could inform future research. publication bias occurs when authors selectively publish their findings, resulting in systematically different results between published and unpublished studies.18 thus, a summary of the published evidence alone is inaccurate. selective outcome reporting bias can occur when authors measure an outcome but choose not to include data on that outcome in the published report (possibly because the data on that outcome did not support the authors overall conclusions).19 this also can result in biased estimates of effects. ecd may help clarify the influence of these biases in the published literature, since data are often collected without regard to future publication. realizing these benefits of ecd may require substantial funding support from organizations such as the patient - centered outcomes research institute (pcori). many projects already funded by pcori have utilized claims data, which is an important source of ecd.20 another important source of ecd is registry data, and pcori has posted guidance on the optimal analysis of such data.21 further, a recent pcori topic brief, discussing research on those with multiple chronic conditions (mccs) stated : there are few issues more critical to the us healthcare system and to the us economy than developing better ways to care for people with mccs. substantial efforts are needed to develop evidence from clinical trials, observational studies, and authors of htas should recognize the risks of interpreting data that are collected outside the structure and oversight of a research study. ioannidis (2013)23 warned about ecd : there are so many biases in these data, ranging from measurement errors, to mis - classification, confounding by indication, and zillions of selection biases, that consent bias is only one among many deadly contributors to the composite analytical chaos.23 these concerns are true of most retrospectively collected nonrandomized data the risk of false conclusions. thus hta authors seeking to incorporate ecd should be keenly aware of ways to measure the risk of bias, and they should be willing to exclude data at high risk of bias. various guidance documents exist for this purpose, such as chapter 13 in the cochrane handbook for systematic reviews of interventions,24 recent guidance for evidence - based practice centers,25,26 and the newcastle - ottawa scale.27 perhaps the most widely cited problem with ecd is the inference of cause. patients who received one treatment may have had better health outcomes than other patients who received a different treatment because their prognosis was better in the first place, not as a result of the treatment they received. thus, a good ecd analysis will control for prognosis (e.g., age, comorbidities, other treatments received) before attempting to measure the impact of a treatment choice. others include the self - selected nature of some ecd (i.e., perhaps the data exist in a database because the outcomes were good), the lack of blinding (i.e., knowledge of treatment affecting subsequent management and/or compliance), and inconsistent measurement techniques (i.e., the same outcome measured in different ways over time). if only a few patients exist with a certain constellation of medical conditions, test results, and interventions, then confidentiality may be compromised, and hta authors should be aware of how to prevent this. also, when data are collected outside of a research study (e.g., routine clinical practice data from electronic medical records), many patients never sign consent forms permitting the use of their clinical data for research purposes. using ecd in hta would produce better medical decisions in at least three ways : better application to local settings. published trials involve specialized populations who are relative easy to manage clinically (e.g., few comorbidities). decision makers armed with knowledge of their own patient population (e.g., rates of various comorbidities) may be best suited to assess whether and how trial results and ecd are best applied to their patients.better evidence generation. examples of ecd use in htas may motivate hospitals and payers to collect their own tailored ecd using more structured methods and comprehensive health outcomes. this action bolsters certain financial encouragement toward evidence generation, such as coverage with evidence development used by the centers for medicare & medicaid services.32validation of existing policies. ecd has the potential to confirm or validate medical coverage policy decisions, and it also can serve to motivate policy changes. for example, new evidence from ecd that a covered treatment is associated with important health risks might motivate payers to modify or eliminate coverage for that treatment. published trials involve specialized populations who are relative easy to manage clinically (e.g., few comorbidities). decision makers armed with knowledge of their own patient population (e.g., rates of various comorbidities) may be best suited to assess whether and how trial results and ecd are best applied to their patients. examples of ecd use in htas may motivate hospitals and payers to collect their own tailored ecd using more structured methods and comprehensive health outcomes. this action bolsters certain financial encouragement toward evidence generation, such as coverage with evidence development used by the centers for medicare & medicaid services.32 validation of existing policies. ecd has the potential to confirm or validate medical coverage policy decisions, and it also can serve to motivate policy changes. for example, new evidence from ecd that a covered treatment is associated with important health risks might motivate payers to modify or eliminate coverage for that treatment. htas are useful to decision makers, but judicious use of ecd could make them more useful. | health technology assessments represent comprehensive summaries of available evidence and information on a technology. they are used by medical decision makers in a variety of ways, including diagnostic testing, treatment selection, care management, patient perspectives, patient safety, insurance coverage, pharmaceutical innovation, equipment planning, device purchasing, and total cost - of - care. electronic clinical data, which are captured routinely by clinicians and hospitals, are only rarely incorporated into formal health technology assessments. this disconnect reveals a key opportunity. in this paper, we discuss current uses of electronic clinical data, several benefits of including it in health technology assessments, potential pitfalls of that inclusion, and the implications for better medical decisions. |
triptolide (1, figure 1), a diterpene triepoxide, was first isolated from the medicinal plant tripterygium wilfordii hook f (twhf) and structurally characterized in 1972. in the following 43 years, it has been reported to be active in vitro by inhibiting proliferation and inducing apoptosis of various cancer cell lines and as preventing tumor growth and metastases in vivo. more recently, triptolide has been found to be effective against various cancers such as pancreatic cancer, neuroblastoma, breast cancer, and prostate cancer. the mechanisms of action of triptolide have been extensively investigated, and evidence has been provided that triptolide can covalently modify proteins presumably by epoxide ring opening reactions. it was recently shown that triptolide inhibits the atpase activity of human xpb (xeroderma pigmentosum b) by covalently binding cys342 of xpb to the 12,13-epoxide. because xpb is part of transcription factor thfiih, rna ii polymerase - mediated transcription and dna excision repair are inhibited. many of the observed anticancer effects can be explained by this mechanism, but other mechanisms have been observed such as epigenetic modifications, suppressing kinases, and hsp70 expression. triptolide was also reported to be the first dctpp1 (dctp pyrophosphatase) inhibitor. it is of interest to note that this is a noncovalent interaction of triptolide with the target protein. furthermore, the compound has multiple biological activities that could have value in other therapeutic areas. triptolide was reported to stimulate polycystin-2 channel opening, thereby restoring calcium signaling and resulting in attenuation of cyst formation in a mouse model of polycystic kidney disease. in addition, triptolide was shown to preserve cognitive function in transgenic mouse models of alzheimer s disease. the anticancer and other activities of triptolide such as its immunosuppressive and anti - inflammatory properties are more thoroughly described in recent reviews. recent studies focus on the development of triptolide and its derivatives as potential antileukemic and antineoplastic agents. despite its promising bioactivities, poor aqueous solubility, dose - dependent toxicity, narrow therapeutic window, and lack of patent protection of triptolide are impediments to its preclinical development and clinical success. two early stage clinical trials of triptolide as a potential drug for rheumatoid arthritis were conducted in the us over a decade ago. the 5-hydroxytriptolide derivative 5-hydroxytriptolide (lldt-8, 2, figure 1) is currently in phase i clinical trial in china for rheumatoid arthritis. structures of triptolide (1), 5-hydroxytriptolide (2), omtriptolide (3), and the disodium phosphonooxymethyl prodrug of triptolide (4). prodrug strategies, involving carboxylic and amino acid esters, have been utilized previously with the intent to achieve desirable water solubility of triptolide. while several prodrugs of triptolide have been reported in the literature, triptolide succinate (omtriptolide, f6008, pg490 - 88, 3, figure 1) is the only one reported to have entered clinical trials. unfortunately, the cleavage of the prodrug moiety was slow and incomplete, and significant interpatient variability was reported. this does not discount the prodrug strategy but suggests that other prodrugs that provide a reliable release of triptolide are needed. a nontoxic, water - soluble, chemically stable, and patentable prodrug approach would be a viable option to overcome some of the physicochemical limitations of triptolide for the clinical development of this natural product. historically, the use of a phosphate group as a promoiety has successfully overcome numerous delivery problems of potential drugs. these prodrugs are formed by either direct linkage of a phosphate moiety onto a hydroxyl group of a parent drug in the form of a phosphomonoester or by attaching it to the parent drug via a chemical linker. the phosphate promoiety is ionized at physiological ph, resulting in a significant increase in aqueous solubility of poorly soluble phenol- and alcohol - bearing parent drugs. additionally, these phosphomonoester prodrugs are typically stable with long shelf - lives and undergo an alkaline phosphatase (ec 3.1.3.1)-catalyzed bioconversion in vivo to release the parent alcohol or phenol drug and inorganic phosphate. numerous phosphomonoester prodrugs have shown good in vitro and in vivo conversion to the parent drug in the presence of alkaline phosphatases. the aforementioned omtriptolide was ineffective in clinical trials due to its incomplete and slow bioconversion in vivo. we hypothesized that the succinate promoiety directly attached to the 14-oh group of triptolide would not be easily accessible for enzymatic cleavage due to steric crowding. therefore, the prerequisites for a novel prodrug strategy of triptolide were three - fold : enhanced aqueous solubility, chemical stability, and fast, complete bioconversion in vivo. we aimed to achieve these objectives by incorporating the phosphonooxymethyl promoiety, as it possesses a favorable combination of high aqueous solubility and chemical stability. this strategy has been successful for solubility enhancement of paclitaxel and propofol, and, in both cases, the promoiety was attached to a sterically hindered hydroxyl group. previously, the synthesis and evaluation of the phosphonooxymethyl derivative of triptolide 4 (figure 1) for pancreatic cancer and several other preclinical cancer models has been reported. we are now describing an improved synthesis for 4, its physicochemical characterization, and its pharmacodynamic evaluation in human colon adenocarcinoma and ovarian cancer xenografts via intraperitoneal and oral routes and using less frequent dosing schedules than employed in previous studies. our initial attempts to prepare 4 in two steps from triptolide by either o - alkylation with chloromethyl phosphate diesters or direct alkylation of the hydroxyl group with chloroiodomethane were not successful. therefore, an alternative strategy based on methylthiomethylation of the hydroxyl group was selected (schemes 1 and 2) to furnish key intermediate 5. we observed complete conversion of triptolide during the pummerer rearrangement, but a mixture of products was obtained. the products were separated by column chromatography and identified by nmr. while the target methylthiomethyl ether 5 was the main component (5052% yield), acetoxymethyl ether 6 was identified as a major byproduct (38% yield), and triptonide (7) formed in 10% (scheme 1). this composition is similar to what was previously observed for this type of reaction using phenylsulfonyl derivatives. our attempts to carry out a basic hydrolysis of the acetoxymethyl ether 6 resulted in decomposition of the product, but triptolide could be recovered by acidic hydrolysis of 6 in 7580% yield. an alternative approach (scheme 2) based on treating triptolide with dimethyl sulfide and benzoyl peroxide in acetonitrile resulted in a similar yield of compound 5 (51%) with triptonide as the only side product in 46%. this methodology, however, allowed for significant reduction of the reaction time from 5 days to 2 h and also made purification of 5 easier. in the next step (scheme 2), the conversion of methylthiomethyl ether 5 to dibenzyl phosphate 8 was achieved using an n - iodosuccinimide - mediated (nis) nucleophilic displacement with dibenzyl phosphate in ch2cl2/thf in the presence of 4 molecular sieves. while the yield was high (91%), chromatographic purification on silica gel was difficult because of pronounced decomposition due to instability of the benzylic esters of the phosphate. however, in larger scale preparations where contact between the compound and silica gel is required for a longer period of time, 60100% degradation was observed depending on the amount of substrate and the level of deactivation of the silica gel. attempts to use alternate sorbents such as florisil or alumina, as well as triethylamine deactivation of silica gel, resulted in similar levels of degradation. it was not possible to avoid purification prior to hydrogenation due to the various sulfur derivatives formed during the course of the synthesis. these compounds, even in minute quantities, can poison the pd / c catalyst used in the benzyl ether cleavage. this led to increased catalytic loading and longer reaction time, which in turn resulted in a larger number and quantity of impurities that contaminated the final product. additionally, during the formation of dibenzyl phosphate 8, 710% of succinimide was produced from the reagent nis, which coeluted during column chromatography. an alternative purification methodology was developed utilizing a sequence of extractions that are described in experimental section, which removed most of the impurities while avoiding product decomposition. it results in the removal of most sulfur derivatives and succinimide without the use of chromatographic purification. in the penultimate step, dibenzyl phosphate 8 was subjected to hydrogenation in the presence of 10% pd / c. the final composition of the product included up to 6% of triptolide as a result of hydrolysis during the final chemical step. because the product decomposes during silica gel column chromatography, it was isolated in 99% purity by preparative hplc using a c18 column. physicochemical characterizations of 4 were conducted to assess its solubility and chemical stability. adjusting solution ph can be a simple and effective method to increase the water solubility of a weakly acidic or basic injectable drug. however, ph adjustment is not a viable approach to increase the solubility of molecules such as triptolide that lack ionizable groups. for such compounds, various strategies including the use of cosolvents, surfactants, and complexing agents (for example, parenterally safe cyclodextrins) some of these techniques can contribute significantly to toxicity. ideally phosphonooxymethyl prodrugs will have good water solubility, particularly at physiological ph. avoiding ph extremes and/or cosolvent addition could allow for rapid parenteral infusion without the risk of drug precipitation. using hplc, the aqueous solubility (buffered to ph 7.4 with tris at room temperature) of triptolide was determined to be 17 g / ml while that of 4 was 61 mg / ml. we also estimated the second dissociation constant (pka2) of 4. in solution, depending on the ph, the prodrug would exist in its diacidic, monobasic, or dibasic states as represented in scheme 3. the pka1 has limited pharmaceutical relevance, because the ph of most physiologically acceptable solutions would ensure ionization of the diacidic species. however, the pka2 is significant given its influence on aqueous solubility, chemical stability, and effectiveness as an enzyme substrate to ensure bioconversion. therefore, within the pharmaceutically relevant ph range, 4 would exist in an equilibrium between its monobasic and dibasic species. thus, titration of an equilibrium mixture of these two species provides an acid ionization constant, pka2, whose value corresponds to the inflection point. estimation of this pka2 using p nmr is advantageous, as the p isotope has high natural abundance (100%) and its chemical shift is indicative of the change in ionization state of the phosphorus moiety. the experimental data shown for the change in observed phosphorus chemical shifts of 4 in solutions at varying ph (figure 2) was used to determine pka2 (eq 4, experimental part). the ph dependency of this observed chemical shift measurement resulted in a sigmoidal curve, which is typical of an acid base titration. the pka2 value of 4 was found to be 6.61, which compares favorably to estimates from the literature. at ph 7.4 p nmr titration curve for the second dissociation constant (pka2) of 4. curve fit of the experimental data to eq 4 (in experimental section) estimates the chemical shift of the monobasic (mb) and dibasic (db) fractions of 4 as 6.0 ppm and 0.62 ppm, respectively. following oral dosing, prodrugs are exposed to a wide ph range in the gi tract, from highly acidic in the stomach to neutral in the colon. also, a wide array of hydrolytic enzymes, such as pepsin and pancreatin, are present in the gi tract. these enzymes have the natural function of digesting macromolecules for use as nutrients, but they can also bind and hydrolyze drug compounds. therefore, prodrugs must be stable in the acidic, basic, and enzymatic conditions of the gi tract for in vivo oral dosing. therefore, in vitro physiological stability of prodrugs in various buffers (ph 19) and in simulated gastrointestinal fluids should be assessed to gain insight into the stability of prodrugs. thus, 4 was incubated with simulated gastric fluid (sgf), simulated intestinal fluid (sif), and various buffers (ph 19). oral dosing exposes compounds to ph 12 in the stomach, ph 4.5 at the beginning of the small intestine, ph 6.6 on average for the small intestine, and ph 57 in the colon. the gastric emptying time varies from 0.51 h in the fasted state to several hours after a heavy meal. incubation of 4 in these solutions is a rapid way to determine if 4 would be stable under conditions found in the gi tract. compound 4 demonstrated ph - dependent stability and rapidly degraded with conversion to triptolide in simulated gastric fluid and at very low ph values (12) and in simulated gastric fluid whereas it was markedly stable at higher ph values (39) and in simulated intestinal fluid (table 1). the shorter half - life at low ph for 4 could result in acid - mediated removal of the promoiety in the stomach however, 4 can be protected from the stomach acid by enteric coating. prodrugs, by their nature, tend to be less chemically stable than the parent drugs. to be practically useful prodrugs intended for intravenous administration should exhibit adequate solution state stability so that a ready - to - use preparation with a reasonably long shelf life (i.e., 2 or more years) can be formulated. if the solution state stability is inadequate, the drug can be formulated as a dry powder (usually by lyophilization) and reconstituted into solution right before administration. for example, safadi and co - workers described the development of phosphonooxymethyl carbonates as novel, water - soluble prodrugs of hindered alcohols. however, the lack of adequate chemical stability limited the commercial and clinical potential of this prodrug concept. the chemical hydrolysis of 4 was followed at ph of 7.4 because the neutral ph range is perfectly suited for formulation delivery from a physiological perspective. we found that the hydrolysis of 4 followed pseudo - first - order kinetics. using the pseudo - first - order rate constants, determined at several temperatures between 40 and 70 c (table 2), the arrhenius plot was drawn (not shown). from this plot, the activation energy (ea) was calculated to be 63.4 kj / mol. by extrapolating the plot to lower temperatures, this enabled the calculation of the half - life (t1/2) and shelf life (t90) of 4 at 25 and 4 c (table 3). thus, the chemical stability of 4 at neutral ph was found to be quite satisfactory giving an estimated shelf life of approximately 2 years (at 4 c). therefore, the formulation of 4 in a freeze - dried form or as an aqueous solution at ph 7.4 is predicted to have an acceptable shelf life. a prerequisite for a successful phosphate prodrug strategy is conversion catalyzed by alkaline phosphatase. in general, phosphomonoesters, such as phosphonooxymethyl prodrugs, are good substrates for both acid and alkaline phosphatases which are found in a wide variety of living organisms including bacteria, plants, and animals. alkaline phosphatase is found throughout the body and is mainly associated with plasma membranes of the intestine, placenta, bone, liver, and kidney at high concentrations. this enzyme participates in hydrolase / transferase reactions on a variety of phosphate - containing compounds under physiological conditions. for the in vitro evaluation of the dephosphorylation of 4, alkaline phosphatase from bovine intestinal mucosa was chosen. as implied by its name, the in vitro assay for phosphate monoester prodrugs is typically performed at ph 9.8, an optimum ph for the activity of alkaline phosphatases. the evaluation of bioconversion kinetics is, however, more relevant if performed at physiological ph. thus, a change in ph of reaction media to 7.4 may, in principle, reduce the catalytic efficiency of the enzyme. however, for proof - of - concept, confirming that 4 was indeed the substrate of alkaline phosphatase was paramount. clearly, if 4 is administered parenterally in humans, the overwhelming presence of alkaline phosphate in vivo should guarantee bioconversion. we carried out the bioconversion of 4 into triptolide in the presence of alkaline phosphatase in glycine buffer at ph 9.8 (scheme 4). exposure of 4 to phosphatases cleaves the phosphate group and releases the hydroxymethyl derivative 9, which is chemically unstable and spontaneously releases triptolide and formaldehyde. the release of formaldehyde from prodrugs could raise a possible concern because of perceived toxicity. however, it is well - known that the turnover of formaldehyde in the human body from endogenous formaldehyde production by normal metabolism and from exogenous exposure (for example from food) is in the range of 3159 g per day. because prodrugs only release milligram amounts of formaldehyde from phosphonooxymethyl prodrugs per day, the small amount of formaldehyde adds very little to the baseline exposure of gram quantities produced by normal metabolism. in addition, given the short half - life of 1.5 min for formaldehyde, which is converted to formic acid, exposure to formaldehyde produced by a prodrug would be limited to approximately 10 min. both the disappearance of 4 and the formation of triptolide were measured. the half - life (t1/2) of 4 was determined to be 2 min in the presence of alkaline phosphatase, showing rapid conversion of the modified drug into its parent compound. additionally, 4 was found to be stable for 1 h in a similar assay conducted in the absence of alkaline phosphatase. the short half - life of 4 in this assay indicates that the enzymatically catalyzed breakdown of 4 occurred at a fast rate. a short half - life for 4 is consistent with our hypothesis that a methylene - linked phosphate prodrug would be released rapidly and not be hampered by steric hindrance as seen with the succinate prodrug omtriptolide. steric hindrance has been noted in the bioconversion of a number of phosphate and phosphonooxymethyl prodrugs. it was previously reported that compound 4 can reduce tumor growth, prevent tumor progression, and improve survival in multiple mouse models of pancreatic cancer. the efficacy of 4 has also been demonstrated in preclinical models of osteosarcoma, nonsmall cell lung carcinoma, human papillomavirus - positive head and neck squamous cell carcinoma, and ovarian cancer. these studies evaluated the efficacy of 4 after daily intraperitoneal (ip) administration. here we used tumor xenograft models to evaluate the efficacy of 4 when administered on a less frequent schedule and when administered by the oral route. this study was designed to evaluate the potential efficacy and toxicity of 4 when administered ip daily (qd) over a range of doses and when administered on various schedules for 28 days. the animal model used in the study was the ht-29 human colon adenocarcinoma cell line implanted in female athymic nude mice as a subcutaneous tumor. treatment groups with ten mice per group included four dose levels (0.1, 0.3, 0.6, and 0.9 mg / kg) and five dose regimens over the 4-week treatment period (daily [qd ] for 4 weeks ; qd for 2 weeks then no treatment for 2 weeks ; qd for weeks 1 and 3 with no treatment during weeks 2 and 4 ; 3/week for 4 weeks ; qd for 2 weeks then 3/week). compound 4 administered daily ip was found to be effective in reducing or eliminating xenograft tumors of the human colon adenocarcinoma ht-29 in this animal model at dose levels from 0.3 to 0.9 mg / kg (figure 3). dose regimens in which 0.9 mg / kg of 4 was administered less frequently than daily or with a break from daily dosing were also found to be effective (figure 4). in the groups that received 0.9 mg / kg daily for 4 weeks or 0.9 mg / kg daily for 2 weeks followed by 3/week, all mice that survived until the end of the study (7/10 and 9/10, respectively) were tumor free. compound 4 was generally well tolerated in female athymic nude mice with the only test - article related deaths observed in those mice receiving 0.9 mg / kg doses for at least 14 consecutive days (3 in the qd for 4 weeks clinical signs of toxicity were noted in some mice in higher dose groups after 14 days of dosing. the frequency of mortality and severity of adverse clinical signs escalated with dose level and frequency. the mice receiving a daily dose of 0.9 mg / kg had the least mean group weight gain and the highest incidence of skin irritation and necrosis toward the end of the study. groups receiving a lower dose of 4 or 0.9 mg / kg on an intermittent schedule had fewer clinical signs of toxicity and higher weight gain over the course of the study. efficacy and tolerability of 4 in a mouse model of human colon adenocarcinoma with daily ip administration. (a) mean ht-29 solid tumor volume over time ; (b) tumor weight at necropsy ; (c) survival over time. efficacy and tolerability of 4 in a mouse model of human colon adenocarcinoma with intermittent dosing schedules. compound 4 was administered ip at 0.9 mg / kg at the schedule indicated. (a) mean ht-29 solid tumor volume over time ; (b) tumor weight at necropsy ; (c) survival over time. this study was designed to evaluate the efficacy and tolerability of 4 in a mouse model of human ovarian cancer when administered via an intraperitoneal and oral route. the animal model used in this study was the a2780 human ovarian cancer cell line implanted in female athymic nude mice as a subcutaneous tumor. treatments included daily doses of 4 ranging from 0.1 mg / kg to 1.2 mg / kg (ten mice per group). administration of 4 by intraperitoneal injection was effective and well tolerated in female athymic nude mice with subcutaneous xenograft tumors of the human a2780 ovarian carcinoma at daily doses of 0.6 or 0.9 mg / kg (data not shown). administration of 4 by oral gavage was also effective at daily doses of 0.6 or 0.9 mg / kg but with slightly higher rates of morbidity and mortality (figure 5). frequency of mortality and severity of adverse clinical signs escalated with dose level and only two mice in the 1.2 mg / kg oral dose group survived beyond day 5 (data not shown). clinical signs of acute toxicity included anorexia, dehydration, and moribund condition or death. in the vehicle control group, 8 of 10 mice were euthanized before the end of the study because tumor volume had surpassed the tumor volume end point. however, in the 0.6 mg / kg and 0.9 mg / kg groups, most of the mice survived until the end of the study (7 of 10 and 6 of 10, respectively) and all but one in each group was tumor free. efficacy and tolerability for compound 4 in a mouse model of human ovarian carcinoma with daily oral administration. (a) mean tumor volume over time ; (b) tumor weight at necropsy ; (c) survival over time. to overcome solubility problems associated with the natural products, the disodium phosphonooxymethyl prodrug of triptolide was prepared. the synthesis, physicochemical characterization, and in vivo efficacy in mouse models of human colon adenocarcinoma and human ovarian carcinoma demonstrated that 4 has suitable properties to be a clinical candidate. because the synthesis could be accomplished in three steps from the natural product, scale - up of this method for the clinical use of the prodrug does not pose a problem. the chemical stability of 4, with a predicted shelf life of about 2 years at 4 c, will allow storage of the prodrug over an extended time period. the in vivo mouse models of human colon adenocarcinoma and human ovarian carcinoma provide additional information about the efficacy and tolerability of 4, suggesting that daily administration may not be required and that 4 may be effective when administered orally. after additional preclinical safety and toxicity testing, compound 4 entered phase i clinical trials in 2013 for evaluation in advanced gastrointestinal tumors. unless otherwise specified, all materials, reagents, and solvents were obtained from commercial suppliers and were used without further purification. the progress of a synthetic procedure was monitored, where possible, by thin layer chromatography (tlc) and the compounds of interest were visualized by short - wave uv lamp or ceric ammonium molybdate stain. h nmr spectra were recorded on a 400 mhz and c nmr spectra were recorded on a 100 mhz spectrometer. chemical shifts are reported in parts per million (ppm) using the solvent (cdcl3) residual peak as the internal standard (for h nmr : 7.27 ppm and for c nmr : 77.2 ppm). the multiplicities of the signals are assigned using the following abbreviations : s = singlet, d = doublet, t = triplet, br = broad, m = multiplet. high - resolution mass spectrometry (hrms) was performed by the university of minnesota mass spectrometry facility. the hplc system used consisted of a waters 2695 alliance hplc with waters 2996 photodiode array detector (milford, ma). the column used for analysis was a phenomenex c18 (2) 150 4.6 mm, 5 m particle size column (torrance, ca). for the analysis of triptolide and 4, the mobile phase consisted of acetonitrile (10% to 70% v / v) and a 10 mm sodium phosphate monobasic buffer solution adjusted to ph 7 with 1 n naoh solution (90% to 30% v / v) for gradient elution over 20 min. the retention times were 6.0 and 13.5 min for 4 and triptolide, respectively. a solution of triptolide (1 ; 2.0 g, 5.6 mmol) in acetic acid (100 ml, 1.8 mol) and a solution of acetic anhydride (20 ml, 220 mmol) in dmso (30 ml, 420 mmol) were mixed and stirred at room temperature for a period of 5 days. the reaction mixture was then poured into water (1 l) and neutralized with solid sodium bicarbonate added portionwise. the mixture was extracted with ethyl acetate (4 250 ml), and the combined organic extract was dried over anhydrous sodium sulfate. hexanes 1:5) to produce compound 5 (1.21 g ; 52%) as a white foam. hrms calculated for (c22h28o6sna) required m / z [m + na ] 443.1505, found m / z 443.1507. in addition, acetoxymethyl ether 6 (896 mg, 38%) and triptonide 7(55) (191 mg, 10%) were isolated and identified. h nmr (400 mhz, cd2cl2) 0.80 (d, 3h, j = 6.9 hz), 0.94 (d, 3h, j = 7.0 hz), 1.05 (s, 3h), 1.21 (m, 1h), 1.53 (td, 1h, j1 = 12.5, j2 = 5.6, and j3 = 1.3 hz), 1.91 (t, 1h, j = 14.1 hz), 2.06 (s, 3h), 2.142.27 (m, 4h), 2.68 (m, 1h), 3.30 (d, 1h, j = 5.4 hz), 3.49 (d, 1h, j = 3.1 hz), 3.58 (s, 1h), 3.77 (d, 1h, j = 3.1 hz), 4.65 (m, 2h), 5.30 (d, 1 h, j = 6.5 hz), 5.44 (d, 1h, j = 6.5 hz) ppm ; c nmr (100 mhz, cd2cl2) 14.0, 17.1, 17.4, 17.6, 21.4, 24.0, 27.2, 30.2, 36.3, 40.9, 55.3, 55.7, 60.5, 61.6, 64.1, 64.4, 70.6, 80.3, 89.7, 125.8, 160.7, 170.9, 173.7 ppm ; hrms calculated for (c23h29o8) required m / z [m + h ] 433.1862, found m / z 433.1850. to a solution of triptolide (19.95 g, 55.36 mmol) in anhydrous acetonitrile (560 ml) at 0 c dimethyl sulfide (31.8 ml, 433 mmol ; 8 equiv) was added. then benzoyl peroxide (53.7 g, 221 mmol, 4 equiv) was added portionwise during the course of 2 h. thereafter, the reaction mixture was stirred at 0 c for 2 h, diluted with ethyl acetate (1200 ml), washed with diluted sodium carbonate (saturated na2co3 : h2o, 1:2) (2 150 ml) and brine (150 ml), and dried over sodium sulfate overnight. the solvent was then removed under reduced pressure, and the resulting viscous mass containing crystals was filtered through a glass filter and washed with cold ethyl acetate (50 ml). the collected solid was air - dried to yield triptonide (7 ; 7.01 g). the filtrate s volume was removed under reduced pressure, and the residue was dried overnight under high vacuum to produce 47.4 g of crude product. ch2cl2 (1:1 followed by 2:1) mixtures as eluents to produce the target compound 5 (11.97 g ; 51.4%) and additional amounts of triptonide (7 ; 2.10 g ; the total yield of triptonide was 9.11 g, 46%). to a solution of compound 5 (6.0 g ; 14.3 mmol) in dry dichloromethane (240 ml) were added powdered 4 molecular sieves (6.0 g). the reaction mixture was placed under dry nitrogen, and then a solution of dibenzyl phosphate (4.78 g (17.2 mmol) and n - iodosuccinimide (3.86 g ; 17.2 mmol) in anhydrous tetrahydrofuran (240 ml) was added slowly at 1520 c. after the addition was completed, the reaction mixture was stirred at rt for a period of 3 h, filtered, and diluted with dichloromethane (2400 ml). the solution was shaken with 0.1 m thiosulfate (240 ml) until fully decolorized and then washed with saturated sodium bicarbonate (240 ml) and brine (240 ml). the organic solution was dried over sodium sulfate for 0.5 h and filtered, and then the solvent was removed under reduced pressure. the residue was dissolved in anhydrous acetonitrile (900 ml), and the solution was extracted with pentane (4 200 ml). the acetonitrile solution was evaporated on a rotary evaporator followed by high vacuum overnight drying. yield : 8.42 g (91%) of dibenzyl ester 8, which was used directly in the next step without additional purification. the small sample was purified by silica gel flash chromatography (50% etoac / hexanes) to give compound 8 as white foam. h nmr (400 mhz, cdcl3) 0.72 (d, 3h, j = 6.8 hz), 0.89 (d, 3h, j = 6.8 hz), 1.05 (s, 3h), 1.27 (m, 1h), 1.48 (m, 1h), 1.82 (dd, 1h, j1 = 14.7 and j2 = 13.4 hz), 2.032.35 (m, 4h), 2.64 (m, 1h), 3.14 (d, 1h, j = 5.5 hz), 3.46 (d, 1h, j = 3.1 hz), 3.65 (s, 1h), 3.76 (d, 1h, j = 3.1 hz), 4.65 (m, 2h), 5.02 (m, 4h), 5.27 (m, 1h), 5.47 (m, 1h), 7.34 (m, 10h) ppm ; c nmr (100 mhz, cdcl3) 13.6, 16.8, 17.0, 23.3, 26.2, 29.62, 29.67, 35.7, 40.3, 54.7, 55.2, 59.3, 61.1, 63.6, 64.0, 69.36, 69.39, 69.42, 69.45, 69.9, 78.2, 92.9, 93.0, 125.5, 127.9, 128.0, 128.6, 135.5, 135.6, 160.1, 173.2 ppm ; hrms calculated for (c35h39o10pna) required m / z [m + na ] 673.2179, found m / z 673.2176. to a 1 l round - bottom flask equipped with septa and stir bar were added pd / c (1.8 g) and anhydrous tetrahydrofuran (10 ml). the flask was cooled in an ice bath and saturated with hydrogen gas using a bubbler under stirring up to full replacement of air. the bubbler was removed, and a solution of dibenzyl ester 8 (8.42 g ; 12.94 mmol) in dry thf (700 ml) was added into the flask through a cannula while stirring and cooling the flask with an ice bath. then the reaction mixture was saturated with hydrogen again and left under stirring in the hydrogen atmosphere for 3 h. the reaction mixture was monitored by tlc (etoac hexanes, 3:2) until disappearance of dibenzyl ester 8. after completion, the reaction mixture was purged with nitrogen and filtered through a pad of celite. the thf solution was cooled to 1012 c and an ice cold solution of anhydrous sodium carbonate (1.235 g ; 11.65 mmol) in deionized water (240 ml) was added slowly with stirring to keep the temperature below 18 c. then the solvents were removed on a rotary evaporator followed by high vacuum evaporation to give a slightly cloudy aqueous solution. the solution was placed into equipment for continuous extraction with dichloromethane and underwent extraction for 72 h. then the aqueous solution was separated from ch2cl2 and extracted with ethyl acetate (4 30 ml). traces of organic solvent were removed by rotary evaporation, and the aqueous solution was passed through a 0.2 m acrodisc syringe filter to give a clear aqueous solution. the solution was freeze - dried, producing 4 (5.64 g ; 85%). purification by preparative hplc eluted with 15% methanol in water provides 99% pure 4 as a colorless hygroscopic powder. h nmr (400 mhz, d2o) 0.81 (d, 3h, j = 6.8 hz), 1.00 (d, 3h, j = 6.8 hz), 1.03 (s, 3h), 1.35 (m, 1h), 1.50 (m, 1h), 2.00 (dd, 1h, j1 = 14.7 and j2 = 13.4 hz), 2.082.61 (m, 4h), 2.85 (m, 1h), 3.63 (d, 1h, j = 5.5 hz), 3.81 (d, 1h, j = 3.1 hz), 3.86 (s, 1h), 4.12 (d, 1h, j = 3.1 hz), 4.92 (m, 2h), 5.07 (m, 2h) ppm ; c nmr (100 mhz, d2o) 12.9, 16.0, 16.3, 16.5, 22.3, 25.5, 28.9, 35.2, 39.8, 55.4, 56.1, 61.0, 61.5, 65.1, 65.5, 71.9, 77.6, 91.7, 123.8, 164.2, 177.3 ppm ; hrms calculated for (c21h26o10p) required m / z [m + 1 ] 469.1264, found m / z 469.1267. approximately 5 mg of each compound was weighed into 2 ml glass vials (in triplicate) ; 0.2 ml of tris buffer (ph 7.4) was added for samples of 4 and 2 ml for triptolide samples. the vials were then capped, sonicated, and vortexed prior to submersion in a constant temperature shaking bath (100 shakes / min maintained at 25 c) for 24 h after which time excess solid drug was removed from the saturated solution by centrifugation and filtration. a 4 mm solution of 4 was prepared in 10% d2o in an isotonic solution to prepare stock solutions of 15 ml volume. samples of varying ph were prepared by adding small volumes (l) of 1 n hcl or 1 n naoh solution and recording the resulting ph (denver instrument, bohemia, ny). aliquots (0.5 ml) were withdrawn from the stock solution after each alteration of ph and transferred to nmr tubes. twelve to fifteen such samples for analysis were prepared in the ph range of 310. solutions were analyzed by p nmr spectroscopy using a 400 mhz nmr instrument. the p probe was calibrated using 85% h3po4 as an external standard for the chemical shift. in solution, depending on the ph and the dissociation constant (ka), 4 exists in its diacidic, monobasic, or dibasic fractions as shown in scheme 3. the fraction of 4 in its diacidic fraction may be ignored given the low and unlikely ph of such a solution within a physiological scenario. the fraction of 4 in the monobasic form (fmb) and the fraction in the dibasic form (fdb) can, therefore, be expressed by eqs 1 and 2, respectively:12 [h ] represents the molar hydrogen ion concentration. the observed chemical shift (obsd) of the p signal is a product of the mole fraction of the prodrug species multiplied by its chemical shift and is expressed by eq 3.3mb and db represent the chemical shifts for the monobasic and the dibasic fraction of 4, respectively. substituting eqs 1 and 2 into 3, gives eq 4.4 the experimental data obtained indicate a shift in the p chemical shift with a variation in ph. this change in observed chemical shift as a function of ph is fit to eq 4 using the graphpad prism graphing software (version 5.0, graphpad software, inc., la jolla, ca) to estimate the second dissociation constant (pka2) of 4. a 20.0 mg amount of 4 was dissolved in sodium chloride injection usp, and the volume was made up to 100 ml. similarly, 3.00 mg of 4 was dissolved in sodium chloride injection usp and the volume made up to 100 ml. ampules were sterilized, to each ampule was added 0.5 ml of the solution of 4, and then they were flame - sealed. ampules were stored in ovens maintained at 70, 60, 50, and 40 c. solutions stored at 70 c were sampled 4, 8, 10, 14, and 24 h after storage. solutions stored at 60 c were sampled 8, 14, 24, 32, 48, and 72 h after storage. solutions stored at 50 c were sampled 2, 4, 6, 8, and 11 days after storage. solutions stored at 40 c were sampled 4, 8, 13, 17, and 21 days after storage. simulated gastric fluid (sgf) : the fluid was generated by preparing a solution of sodium chloride (0.20 g), concentrated hcl (0.70 ml), and pepsin (sigma, p-7000, 0.32 g) in deionized water (95 ml). simulated intestinal fluid (sif) : the fluid was generated by preparing a solution of monobasic potassium phosphate (kh2po4, 0.68 g), 0.1 n aqueous sodium hydroxide (38 ml), and pancreatin (sigma, p-1625, 1.0 g) in deionized water (57 ml). the ph of the solution was adjusted to 7.5 by addition of 1 n aqueous sodium hydroxide, and then the final volume was adjusted to 100 ml by addition of deionized water. the source of cell lines for tumor xenografts was a cryopreserved vial supplied by atcc. the ht-29 human colorectal adenocarcinoma cell line was established from the tumor tissue of a 44-year old adult female. cells were grown as a monolayer in cell culture - treated disposable flasks and cultured in hyclone mccoy s 5a culture media supplemented with 10% v / v fetal bovine serum. the original vial was thawed and cultured to create a master cell bank (mcb). the mcb vials were tested for contamination by mycoplasma organisms and for a panel of selected rodent pathogens and confirmed negative prior to culture of cells for implantation in research animals. mice were injected subcutaneously on the right flank with 1.74 10 ht-29 tumor cells in a solution of 50% martigel/50% unsupplemented mccoy s 5a culture medium in a volume of 0.1 ml using a 25 gauge needle. the a2780 human ovarian cancer cell line was established from tumor tissue from an untreated patient. the source of the cell line for tumor xenografts in this study was a cryopreserved vial ordered from the ecacc (european collection of cell cultures) via the vendor sigma - aldrich. cells were grown as a monolayer in cell culture - treated disposable flasks and cultured in rpmi 1640 culture media supplemented with 10% v / v fetal bovine serum. the mcb vials were tested for contamination by mycoplasma organisms and for a panel of selected rodent pathogens and confirmed negative prior to culture of cells for implantation in research animals. mice were each injected subcutaneously on the right or left flank with 2.5 10 tumor cells in a solution of 50% matrigel/50% unsupplemented rpmi 1640 culture medium in a volume of 0.1 ml. female athymic nude mice, age 7 to 9 weeks, were received from taconic farms (albany, ny). the animals were examined and weighed on the day following receipt, and weights were measured and recorded twice weekly thereafter. all animals were allowed to acclimate to the laboratory environment for at least 7 days prior to subcutaneous injection of cancer cells. the average tumor volume at randomization was 110 mm for the ht-29 study and 188 mm for the a2780 study. there were 10 mice in each group, and the duration of treatment was 28 days for the ht-29 study and 30 days for the a2780 study. the dose concentration for each animal was based on the average of the body weight measurement for all of the animals in its respective dose group. the carboplatin dose in the a2780 study was 60 mg / kg administered twice each week. the test article was formulated in usp saline and delivered in a volume of 0.2 ml. the following parameters and end points were evaluated : tumor volume, tumor volume changes, tumor weight at study end, clinical signs, survival, body weights, and body weight changes. tumor measurements were performed at least twice weekly following the first appearance of tumors. a calibrated digital caliper was used to measure the length and width of each tumor. tumor volume was calculated by the formula l w/2, where w is the smallest dimension recorded. | a disodium phosphonooxymethyl prodrug of the antitumor agent triptolide was prepared from the natural product in three steps (39% yield) and displayed excellent aqueous solubility at ph 7.4 (61 mg / ml) compared to the natural product (17 g / ml). the estimated shelf life (t90) for hydrolysis of the prodrug at 4 c and ph 7.4 was found to be two years. in a mouse model of human colon adenocarcinoma (ht-29), the prodrug administered intraperitoneally was effective in reducing or eliminating xenograft tumors at dose levels as low as 0.3 mg / kg when given daily and at 0.9 mg / kg when given less frequently. when given via intraperitoneal and oral routes at daily doses of 0.6 and 0.9 mg / kg, the prodrug was also effective and well tolerated in a mouse model of human ovarian cancer (a2780). |
to improve the weight - bearing ratio (wbr) of a paretic lower limb while walking in hemiplegic stroke patients, it is important to perform gait training that takes motor and sensory disturbances and balance ability into account. lower limb weight - bearing training using lower limb weight scales is conducted for paretic and non - paretic legs, but determination of whether the load is appropriate or insufficient is performed subjectively by instructors in many cases. studies on paretic lower limb weight - bearing during static standing and gait1, 2 and measurement3 of lower limb weight - bearing while walking after treatment for orthopedic diseases4 have been reported. a shoe - type load - measuring apparatus (product name : step aid, kkimac, tokyo, japan) was recently developed. it is equipped with an insole - type pressure load sensor and provides feedback through sound on whether lower limb weight - bearing while walking is appropriate, excessive, or insufficient. in this study, the association between the wbr of a paretic lower limb and gait ability was investigated in hemiplegic stroke patients using this apparatus. the subjects comprised 17 hemiplegic stroke patients who were admitted to our hospital for rehabilitation (mean age : 6111 years, 15 males and 2 females) ; 11 had cerebral infarctions, and 6 had cerebral bleeding. the grade of motor paralysis based on the brunnstrom classification5 was iii, iv, v, and vi in 4, 5, 1, and 7 patients, respectively, and the mean time to measurement from onset was 14835 days. the patients were divided into 2 groups as follows : 8 patients who could walk independently (using a cane and lower limb orthosis), and 9 patients who required assistance (using a wheelchair). the 10-m walking time inside and outside parallel bars was measured, and the balance was evaluated using the berg balance scale (bbs)6. the wbr of the paretic lower limb was measured on static standing and while walking inside and outside parallel bars, and the coefficient of variation (cv) was calculated. the wbr of the paretic lower limb was measured during static standing held for 3 seconds. paretic lower limb weight - bearing was evaluated by wearing a step aid (kkimac) on the paretic foot. the period from initiation to completion of the motion this apparatus is linked wirelessly to a measurement device through the pressure sensor built into the shoe insole, and it measures the load on each step. sound signals are set for appropriate and under - load ranges, and feedback on the gait condition is provided so that the weight - bearing condition can be appropriately modified during training. the items compared between the 2 groups were the 10-m walking time inside and outside parallel bars, bbs, wbr of the paretic lower limb and its cv (%) during static standing, 10-m gait inside and outside parallel bars, and the difference in the wbr between walking inside and outside parallel bars. the wbr (%) was calculated as follows : (measured weight - bearing / body weight) 100. the cv (%) was calculated as follows : standard deviation / average of the wbr during walking. the 2 groups were compared using the student s t - test and mann - whitney s u test, and the significance level was set at less than 5%. information about this study was provided in writing to all of the subjects prior to starting the study, and all subjects provided their informed consent. this study was performed following the regulations of the clinical study committee of hyogo prefectural rehabilitation nishi - harima hospital. the gait speeds and results of balance ability evaluation in the independent gait and gait - assisted groups of hemiplegic stroke patients are shown in table 1table 1.the 10-m gait time and balance ability evaluation in the independent gait and gait - assisted groups of the hemiplegic stroke patientsindependentgait group(n=8)gait - assistedgroup(n=9)10-m gait time (sec)inside parallel bars9.81.328.714.5outside parallel bars8.10.834.928.1bbs (score)53.22.640.26.4bbs : berg balance scale. statistically different at p<0.05, statistically different at p<0.01, statistically different at p<0.001. the walking time was significantly shorter in the independent gait group than in the gait - assisted group inside and outside parallel bars (9.81.3 vs. 28.714.5 seconds and 8.10.8 vs. 34.928.1 seconds, respectively ; inside parallel bars, p<0.01 ; outside parallel bars, p<0.05), and the bbs score was significantly higher (53.22.6 vs. 40.26.4, respectively ; p<0.001). statistically different at p<0.05, statistically different at p<0.01, statistically different at p<0.001 the results for the wbr of the paretic lower limb in the independent gait and gait - assisted groups are shown in table 2table 2.weight bearing ratio and coefficient of variation value of the paretic limb in the independent gait and gait - assisted groups of the hemiplegic stroke patientsindependentgait group(n=8)gait - assistedgroup(n=9)wbr (%) standing rest97.72.571.312.1gait inside parallel bars93.74.685.911.2gait outside parallel bars95.46.385.19.1cv (%) gait inside parallel bars1.20.11.60.6gait outside parallel bars1.10.13.31.4wbr : weight bearing ratio, cv : coefficient of variation (standard deviation / average of wbr during walking), student s t - test. averagesd. the wbr of the paretic lower limb during static standing was significantly higher in the independent gait group (97.72.5% vs. 71.312.1%, respectively ; p<0.001), and similar findings were obtained while walking inside and outside the parallel bars. regarding the cv value, no significant difference was noted between the 2 groups in walking inside the parallel bars, but it was significantly higher in the gait - assisted group while walking outside the parallel bars (1.10.1 vs. 3.31.4, respectively ; p<0.001). wbr : weight bearing ratio, cv : coefficient of variation (standard deviation / average of wbr during walking), student s t - test. averagesd. statistically different at p<0.01, since the ability to walk independently is the main factor determining whether patients with a cerebrovascular disorder accompanied by motor paralysis can return home7, many studies on the wbr of paretic lower limbs have been reported ; however, paretic lower limb weight - bearing during static standing was mainly investigated in clinical cases in previous studies1, 2. recently, an insole load measurement apparatus equipped with a pressure sensor was developed, and measurement of weight - bearing on the sole during walking became possible. the step aid, used to evaluate lower limb weight - bearing, consists of a shoe with a built - in capacitance pressure sensor, and information on whether weight - bearing while walking is within an appropriate or underload region is fed back with sounds and lights. this study focused on the wbr of the paretic lower limb in rehabilitation gait training in patients with cerebrovascular disorders accompanied by motor paralysis, and it investigated how the wbr of the paretic lower limb is involved in the independent gait of these patients using the step aid. it has occasionally been reported that paretic lower limb weight - bearing serves as an index to predict independent gait of patients with a cerebrovascular disorder accompanied by motor paralysis8, 9. in the present study, the wbrs of the paretic lower limbs during static standing and gait inside and outside parallel bars were significantly higher in the independent gait group than in the gait - assisted group, confirming that the wbr of the paretic lower limb is an important index concerning achievement of independent gait. in addition, the cv value of the wbr of paretic lower limbs while walking outside the parallel bars was significantly higher in the gait - assisted group than in the independent gait group, showing the variation in paretic lower limb weight - bearing. the use of a cane to walk outside the parallel bars compensates for the support on the affected side and shifts the center of gravity of the body toward the affected side, which depends on the supportive function of the paretic lower limb. the bbs score was significantly lower in the gait - assisted group than in the independent gait group, suggesting that the balance function was poor and, thus, the supportive function was also reduced on the paretic side. due to these factors, variation of the wbr of the paretic lower limbs it appears that the bbs decreases as the wbr decreases, as well as vice versa. in conclusion, the cv and the wbr on the paretic side while walking are important indices concerning achievement of independent gait in hemiplegic stroke patients, and follow - up of the course of lower limb wbr using the step aid may be useful for gait rehabilitation in hemiplegic stroke patients and diseases requiring weight - bearing training after orthopedic treatment. | [purpose ] this study investigated the association between the weight - bearing ratio (wbr) and gait ability of a paretic lower limb while walking using a shoe - type load - measuring apparatus. [subjects ] the subjects comprised 17 stroke patients who were classified into the following two groups : the independent walking group, and the non - independent walking group. [methods ] the 10-m walking time (inside and outside parallel bars) and the berg balance scale (bbs) were measured. the wbr of the paretic lower limb was measured during static standing and while walking inside and outside parallel bars, and the coefficient of variation (cv) was calculated. wbr was evaluated using the step aid. [results ] the bbs and wbr were significantly decreased in the non - independent walking group, while the 10-m walking time and the cv were significantly increased in the non - independent walking group. [conclusion ] the cv and wbr of a paretic lower limb while walking appear to be important indices of achievement of independent gait in hemiplegic stroke patients, and they may be used in gait rehabilitation for diseases requiring weight - bearing training to follow the course of training using a shoe - type load - measuring apparatus. |
radical cystectomy (rc) with or without neoadjuvant chemotherapy still remains the gold standard treatment for muscle - invasive bladder cancer. most of the studies have reported the locoregional recurrence rate (lrr), ranging from 23% to 50% after rc alone in locally advanced bladder cancer patients.15 bladder - confined disease and extravesical extension should be distinguished to evaluate the role of postoperative radiation therapy (port) properly. however, retrospective data regarding port are insufficient, and only one prospective study that tested port showed improvement in disease - free survival (dfs) without any improvement in overall survival (os).68 the radiation - induced late complications are the main limiting factor for the use of port after rc worldwide ; however, the risk for radiation - induced complications can be minimized by novel radiotherapy techniques (conformal radiotherapy or intensity - modulated radiotherapy).4 the present study evaluates the benefit of conformal radiotherapy - based port in patients with nonmetastatic bladder cancer extending beyond the wall of the bladder (t3t4) after rc, as well as its toxicity profile and its effect on dfs and os. bladder cancer patients treated at the damietta cancer institute from 1998 to 2005 were retrospectively reviewed. during that period, 750 bladder cancer patients were treated at the institute ; among those, 530 (71%) patients were treated with radical intent. after meeting the eligibility criteria, 235 medical records for patients with nonmetastatic stage iii and iv cancer were reviewed. the american joint committee of cancer clinical staging system 2010 was used for staging patients.9 only the patients with nonmeta - static (t3t4, n0/1, m0) cancer who underwent rc were included in this study. the rc procedure included the removal of the bladder, seminal vesicles, prostate, perivesical fat, and peritoneal coverage, in addition to bilateral pelvic lymphadenectomy in men. in women, it included the removal of bladder, perivesical fat and peritoneal covering, urethra, uterus, ovary, and anterior wall of the vagina. the port was delivered by using linear accelerator elekta dual - photon energy 6 and 10 mv. computed tomography (ct) simulation with axial ct images was used for planning with dose calculation, using rocs or multidata planning systems. the radiotherapy fields extended from the l5s1 to the inferior margins of the obturator foramina if there were no prostate invasion, below the ischial tuberosity in cases of prostate invasion, and laterally to 12 cm beyond the margin of the bony pelvis at its widest part. anteriorly, the field extends 1 cm beyond the symphysis pubis and posteriorly to the level of the third sacral vertebra. the clinical target volume included internal, external iliac nodal areas, and an operative bed guided by the preoperative ct data for initial tumor localization. metal clips inserted intraoperatively were considered an excellent guide in the process of clinical target volume delineation. all patients were scheduled to receive a dose of 50 gy in 25 fractions in a period of 5 weeks with a boost of 10 gy to the positive margin. the follow - up intervals remained every 3 months during the first and second years, then every 6 months for the following 3 years, and then annually. the follow - up procedures include ct chest, abdomen, and pelvis (annually) in addition to the routine laboratory examination and cystoscopy (every 6 months). patients with no updated information in the database were contacted through telephone calls. when updated information was not realized, those patients (3% of the series) were considered lost for follow - up. data were analyzed according to the following primary and secondary end points : os (time from the date of surgery to occurrence of death) and dfs (time from the date of surgery to occurrence of lrr or distant metastasis [dm ]). a statistical package software system (spss) was used for evaluation of the data. the log - rank test was used to compare survival between groups, and a p - value < 0.05 was considered statistically significant. univariate and multivariate analyses of the prognostic features including pathological type, stage, and port were performed. the rc procedure included the removal of the bladder, seminal vesicles, prostate, perivesical fat, and peritoneal coverage, in addition to bilateral pelvic lymphadenectomy in men. in women, it included the removal of bladder, perivesical fat and peritoneal covering, urethra, uterus, ovary, and anterior wall of the vagina. the port was delivered by using linear accelerator elekta dual - photon energy 6 and 10 mv. computed tomography (ct) simulation with axial ct images was used for planning with dose calculation, using rocs or multidata planning systems. the radiotherapy fields extended from the l5s1 to the inferior margins of the obturator foramina if there were no prostate invasion, below the ischial tuberosity in cases of prostate invasion, and laterally to 12 cm beyond the margin of the bony pelvis at its widest part. anteriorly, the field extends 1 cm beyond the symphysis pubis and posteriorly to the level of the third sacral vertebra. the clinical target volume included internal, external iliac nodal areas, and an operative bed guided by the preoperative ct data for initial tumor localization. metal clips inserted intraoperatively were considered an excellent guide in the process of clinical target volume delineation. all patients were scheduled to receive a dose of 50 gy in 25 fractions in a period of 5 weeks with a boost of 10 gy to the positive margin. the follow - up intervals remained every 3 months during the first and second years, then every 6 months for the following 3 years, and then annually. the follow - up procedures include ct chest, abdomen, and pelvis (annually) in addition to the routine laboratory examination and cystoscopy (every 6 months). patients with no updated information in the database were contacted through telephone calls. when updated information was not realized, those patients (3% of the series) were considered lost for follow - up. data were analyzed according to the following primary and secondary end points : os (time from the date of surgery to occurrence of death) and dfs (time from the date of surgery to occurrence of lrr or distant metastasis [dm ]). a statistical package software system (spss) was used for evaluation of the data. the log - rank test was used to compare survival between groups, and a p - value < 0.05 was considered statistically significant. univariate and multivariate analyses of the prognostic features including pathological type, stage, and port were performed. patient - related characteristics (age, sex, stage, lymph node involvement, surgical margin status, grade, pathological type, and port) are shown in table 1. all patients underwent rc with continent / incontinent diversions, including the ureterocolic diversion (n=76), ureterocutaneous diversion (n=54), ilial conduit (n=34), and neo - bladder (n=6). ninety - two (54%) of the 170 patients were offered radiotherapy ; the remaining patients performed only rc. the age of the patients varied between 32 and 73 years (mean, 5811 years). according to the american joint committee of cancer clinical staging system, predominant preoperative stage was t2, followed by t3. one hundred four patients presented with transitional cell carcinoma, 53 patients with squamous cell carcinoma, and 13 patients with adenocarcinoma. the dose ranged from 42 to 60 gy, with a mean dose of 496 gy. the most common reason for not completing protocol was social issues. among those seven patients, five the median follow - up was 47 months (range, 1777 months). at time of analysis, 81 (48%) patients were alive (58% in port versus 35% in non - port) and 89 (52%) died. a total of 73 (43%) patients developed lrr, of whom 30 (33%) were in the port group and 43 (55%) were in the non - port group. the overall dmr of the whole cohort was 39%, with nearly no difference between the port and non - port groups, as illustrated in table 2. the 5-year dfs for the whole group of patients was 53%11% (table 3). the 5-year dfs for the port group was 65%13% compared with 40%9% for the non - port group (p=0.04), as shown in figure 1. the other studied factors, including stage and pathological type, showed 5-year dfs of 60%15% in stage iii patients compared with 20%6% for stage iv patients, with p=0.02. there were no significant difference rates of dfs according to histopathological types (transitional cell carcinoma versus squamous cell carcinoma with the exclusion of adenocarcinoma), with a p - value of 0.9. the only significant factor was the stage : 5-year os was 54%13% and 16%8% in t3 and t4, respectively (p=0.02). the port group of patients showed a 5-year os of 52%11%, in contrast to the non - port group of patients (38%8%) ; however, the p - value was nonsignificant (p=0.3), as shown in figure 2. using multivariate analysis, we found port, stage, and extravesical extension (positive surgical margins) to be important prognostic factors for lrr. the most common acute grade 3 complication was gastrointestinal toxicity, with diarrhea in 19% (17/92 patients), and proctitis required treatment only in 12 patients (13%). seven (8%) patients in the port group developed intestinal obstruction within 2 years of completion of treatment. the median follow - up was 47 months (range, 1777 months). at time of analysis, 81 (48%) patients were alive (58% in port versus 35% in non - port) and 89 (52%) died. a total of 73 (43%) patients developed lrr, of whom 30 (33%) were in the port group and 43 (55%) were in the non - port group. the overall dmr of the whole cohort was 39%, with nearly no difference between the port and non - port groups, as illustrated in table 2. the 5-year dfs for the whole group of patients was 53%11% (table 3). the 5-year dfs for the port group was 65%13% compared with 40%9% for the non - port group (p=0.04), as shown in figure 1. the other studied factors, including stage and pathological type, showed 5-year dfs of 60%15% in stage iii patients compared with 20%6% for stage iv patients, with p=0.02. there were no significant difference rates of dfs according to histopathological types (transitional cell carcinoma versus squamous cell carcinoma with the exclusion of adenocarcinoma), with a p - value of 0.9. the only significant factor was the stage : 5-year os was 54%13% and 16%8% in t3 and t4, respectively (p=0.02). the port group of patients showed a 5-year os of 52%11%, in contrast to the non - port group of patients (38%8%) ; however, the p - value was nonsignificant (p=0.3), as shown in figure 2. using multivariate analysis, we found port, stage, and extravesical extension (positive surgical margins) to be important prognostic factors for lrr. the most common acute grade 3 complication was gastrointestinal toxicity, with diarrhea in 19% (17/92 patients), and proctitis required treatment only in 12 patients (13%). chronic adverse effects observed were of a rare and a mild nature. seven (8%) patients in the port group developed intestinal obstruction within 2 years of completion of treatment. however, the role of port in bladder cancer is still controversial in many western publications compared with in egyptian ones.18 in our cohort, patients treated with port had the worst clinicopathological features. the most common argument against the use of port is the radiation - induced complications, especially the late small bowel complications, as seen in our study (8% of cases had small bowel obstruction). however, this small bowel obstruction rate is significantly lower than that reported by reisinger (37%).10 higher rates of small bowel complications are related to the large volume of irradiated small bowel and dose.10 in contrast, zaghloul reported much lower small bowel complication rates (4.5%). the reason could be explained by the lower total dose (45 gy/25) and the lower dose per fraction (1.8 gy), and in one group, hyperfractionation was used.7 however, zaghloul also reported a small bowel obstruction of 6% (similar to our findings) in another series of adenocarcinoma bladder patients treated with cystectomy and port (4/69 patients).11 in our study, lrr was comparable to greven (51%),12 volkmer (48.6%),13 and cheng (51%).14 in contrast, lrr in our cohort was higher compared with gupta (29%)15 and hassan (30%).16 the reason for higher lr in our study compared with these studies can be explained by the predominant t3 and t4 cohort. the dmr in our study are consistent with that of related studies.17,18 it is interesting to mention that, in our study, port improved the 5-year dfs (65%13% versus 40%9%) with a p - value of 0.04. these results are better than those reported by cozzarini (44%)19 and zaghloul (47%)7 and were similar to three other egyptian studies.11,17,20 pathological stage was considered the most important prognostic factor in bladder cancer patients after rc. we evaluated the effect of stage iii and iv cancer on dfs and found that there is significant difference between stage iii (60%15%) and stage iv (20%6%) patients, with p=0.02. these data were comparable to the greven series, with dfs 51% in patients with stage pt3.12 our results were found to be better than those reported by visser, with 5-year dfss of 31% and 23% for cancer stages iii and iv, respectively.21 the 5-year os in our series was 44%10%. nishiyama showed an os of 59% in pt3 and 43% in pt4;5 in addition, takahashi showed an os of 47% and 38% in pt3 and pt4, respectively.6 these findings are comparable to our results. the port had no significant effect on the os with p=0.3 in our study, which is consistent with other studies.11,13,15 the histopathological types (transitional carcinoma versus squamous carcinoma) did not affect the dfs or os in our study, with p=0.9 and p=0.7, respectively. rogers reported a 5-year os of 60%2% after rc for transitional and 55%11% for squamous cell carcinoma. a recent large series review of more than 28,000 patients in the netherlands23 has concluded that the survival of muscle - invasive bladder cancer is not affected by histopathology subtypes (transitional cell, squamous cell, and adenocarcinoma). limitations of our study were its retrospective nature, that a possible selection bias could not be excluded and that adenocarcinoma cases were not analyzed (which is why there were no data regarding its outcome and the decreased number of orthotopic diversions ; a possible reason was that the majority of patients had locally advanced disease in our cohort). standard treatment for locally advanced bladder cancers is rc with or without neoadjuvant chemotherapy ; however, patients treated with up - front rc can benefit from port by decreasing lr rates. | background : radical cystectomy (rc) with or without neoadjuvant chemotherapy is the standard treatment for muscle - invasive bladder cancers. however, the locoregional recurrence rate is still significantly higher for locally advanced cases post - rc. the underuse of postoperative radiotherapy (port) in such cases after rc is related mainly to a lack of proven survival benefit. here we are reporting our long - term egyptian experience with bladder cancer patients treated with up - front rc with or without conformal port.patients and methods : this retrospective study included 170 locally advanced bladder cancer (t3t4, n0/n1, m0) patients who had rc performed with or without port at damietta cancer institute during the period of 19982006. the treatment outcomes and toxicity profile of port were evaluated and compared with those of a non - port group of patients.results:ninety-two patients received port ; 78 did not. at median follow - up of 47 months (range, 1777 months), 33% locoregional recurrences were seen in the port group versus 55% in the non - port group (p<0.001). the overall distant metastasis rate in the whole group was 39%, with no difference between the two groups. the 5-year disease - free survival for the whole group of patients was 53%11%, which was significantly affected by additional port, and 65%13% compared with 40%9% for the non - port group (p=0.04). the pathological subtypes did not affect 5-year disease - free survival significantly (p=0.9). the 5-year overall survival was 44%10%. using multivariate analysis, port, stage, and extravesical extension (positive surgical margins) were found to be important prognostic factors for locoregional control. stage and lymph node status were important prognosticators for distant metastasis control.conclusion:port was found to be a safe and effective tool in decreasing local recurrence rates and improving disease - free survival. |
functional neuroimaging studies, which explored processing of emotional material in schizophrenia, have often reported deficits in cerebral activation in patients compared to control participants in various limbic, paralimbic, and prefrontal regions (e.g., [14 ]). a few other studies documented abnormal overactivation in patients relative to controls or no difference between the groups [510 ]. these divergent findings have been attributed to the type of emotional task (passive viewing, emotion identification, emotional memory, etc.) and to the characteristics of the recruited patients (first - episode versus chronic, medicated versus unmediated, presence of prominent negative versus prominent positive symptoms, etc.). however, what could have played an equally or even more important role in the obtained results is the kind of functional neuroimaging contrast used in the statistical analysis. it should be pointed out to readers less familiar with the functional neuroimaging literature that the functional magnetic resonance imaging (fmri) studies in various clinical populations (including schizophrenia and related psychoses) have relied primarily on comparisons between two different states under investigation (e.g., active experimental task versus passive relaxed state) and as such fmri is principally a relative technique with no absolute baseline. the most commonly used contrast in functional neuroimaging studies of emotions consists of subtracting brain activation associated with processing of neutral stimuli from the cerebral activity associated with processing of emotional stimuli. another contrast routinely used is to subtract brain function linked with a resting baseline from the brain activation associated with emotional stimuli. interestingly, in a meta - analysis examining amygdala recruitment in response to aversive emotional material in schizophrenia, anticevic and colleagues have found that underactivation of the amygdala in patients compared with controls was only present in studies that used an emotional minus neutral contrast and not present in those that employed an emotional minus rest condition. hence, the deficient activation of the amygdala in patients compared to controls could have been explained by an increase of activity in this region in response to neutral stimuli. in other words, it is not a deficit in the amygdala activation, but rather its oversensitivity to the neutral material in individuals diagnosed with schizophrenia that may have produced the impression that patients do not recruit this region to the same extent as controls. to date, only a few studies have overtly reported or explored the brain activation associated with the processing of neutral stimuli versus baseline in schizophrenia patients, including previous work by our group [1215 ]. we found that while patients with schizophrenia had relative deactivation compared with controls in the middle frontal gyrus, orbitofrontal cortex, cingulate gyrus and precuneus during recognition memory of emotional relative to neutral images, they activated some of these same regions to a significantly greater degree than did the healthy controls during recognition memory of neutral pictures relative to a resting baseline. considering the methodological heterogeneity that exists in the schizophrenia literature with regard to the neural correlates of emotion processing, explicitly examining the differences in the pattern of brain activation between patients and healthy subjects in response to neutral stimuli may broaden our understanding of emotional thus, the aim of the present study was two - fold : (1) to extend our previous findings and explore whether patients with schizophrenia show an atypical pattern of brain activity in response to neutral stimuli during the incidental encoding of emotional stimuli that preceded our emotional recognition memory paradigm and (2) to explore potential sex differences, as previous studies investigating processing of emotionally neutral stimuli examined exclusively or primarily men. thirty - seven individuals diagnosed with schizophrenia (19 men) according to dsm - iv diagnostic criteria and 37 healthy controls (19 men) participated in the study. all patients were in a stable phase of their illness (defined as no relapse within the last two months and no change in their antipsychotic treatment within the last month). the groups were matched for age, sex, handedness (edinburgh inventory), and parental socioeconomic status (national occupational classification (noc)). all patients were reevaluated by experienced psychiatrists before being assigned to the research group (dsm - iv, criteria a - e) ; affective, schizoaffective, and schizophreniform psychoses were excluded. control participants were screened with the nonpatients edition of the clinical interview for dsm - iv (scid). symptom severity was rated according to the positive and negative syndrome scale (panss). all the patients received at least one atypical antipsychotic (chlorpromazine equivalence was calculated) (27 patients received one, 9 received two, and 1 received three. clozapine : n = 19, mean dosage = 452.63 (77.23) mgs ; olanzapine : n = 12, mean dosage = 14.58 (5.4) mgs ; risperidone : n = 11, mean dosage = 3.73 (1.67) mgs ; quetiapine : n = 7, mean dosage = 585.71 (238.85) mgs). general exclusion criteria included age below 18 or above 45 years, past or present neurological or axis - i psychiatric disorder, alcoholism or drug abuse, noncompliance with testing procedures, abnormal uncorrected vision, or any contra - indication for mri such as a cardiac pacemaker, an aneurysm clip, a metal prostheses or cardiac valve replacement, the presence of metal in an eye or any part of the body, certain dental work, or claustrophobia. in agreement with the declaration of helsinki, the ability of schizophrenia patients to give informed consent was established using the guidelines of the canadian psychiatric association. the study was approved by the ethics committees of the fernand - seguin research center of the louis - h lafontaine hospital and the regroupement neuroimagerie qubec. participants passively viewed blocks of positive, negative, and neutral pictures while in the fmri scanner. each block was 48.5 seconds in length and there were 16-second periods of rest separating the blocks from one another. each picture appeared for 3000 ms followed by a blank screen with a fixation point. to assess the participants subjective emotional responses to the presented images, participants were represented with the images of each block at the end of the fmri session and were asked to rate the block of images as whole on a scale ranging from 0 (absence of any emotional reaction) to 8 (strongest emotion ever felt in one 's lifetime) the intensity of experienced emotion. blood oxygenation level dependent (bold) signals were recorded using a single - shot, gradient - recalled echoplanar imaging sequence (repetition time (tr) = 3000 ms, echo time (te) = 30 ms, flip angle = 90 degrees, and matrix 64 64 voxels) on a mri siemens trio system at 3.0 tesla, which is operational at the functional neuroimaging unit at the university of montreal geriatric institute. the functional volumes were then registered to individual high - resolution coplanar anatomical images taken during the same scanning session (three - dimensional, spoiled gradient echosequence ; 28 slices, slice thickness = 5 mm, tr = 22 ms, and te = 4 ms, and flip angle = 30 ; matrix 256 256 voxels) to better identify activated structures. the fmri data was analyzed using statistical parametric mapping software (spm5 ; wellcome department of cognitive neurology, london, uk) according to the methods outlined by friston. functional images were realigned to the mean volume of each session to correct for artifacts due to subject motion, were spatially normalized into the standardized brain template (voxel size : 3.5 mm 3.5 mm 3.5 mm), and were spatially smoothed with a three - dimensional isotropic gaussian kernel (12 mm fwhm) to improve the signal - to - noise ratio. statistical analyses were carried out using a standard peak - detection approach and the general linear model implemented in spm5 to identify the dynamic cerebral changes associated with the processing of emotional material. first, fmri data of each participant was analyzed using a fixed - effects model to investigate individual brain activation maps and to contrast the brain activity associated with different conditions. the fixed - effects analysis produced individual contrast images that were then used as raw data for the implementation of a random - effects model to investigate the pattern of activation during the different emotional contrasts (i.e., neg versus ntr, pos versus ntr, and ntr versus rest) in each group (i.e. healthy controls and schizophrenia patients). any potential differences between groups were examined using a two - sample t - test. due to the strict character of the second - level analysis based on a random - effects model, the statistical maps were thresholded at a level of p = 0.005 uncorrected for multiple comparisons. the centers for each of our a priori rois were produced using the mask for roi analyses software (marina). aal uses the anatomical boundaries of each region using the mni template as a reference. a search sphere with a radius of 12 mm was applied to the center of the hippocampus using the small volume correction function in spm5. for the amygdala the aal tool in spm provided the anatomic labeling of each activation peak within the roi. for the a priori search, a probability threshold for multiple comparison of a corrected p 0.05), while schizophrenia patients rated the neutral images with a greater emotional intensity than did the healthy subjects (healthy : mean = 1.08 (0.97), schizophrenia : mean = 1.74 (1.38), p = 0.027). detailed information regarding functional neuroimaging data (brain regions with brodmann areas, mni coordinates, number of activated voxels in a given cluster, z - scores, p values, etc.) is provided in the tables and figures ; for brain regions activated during emotion processing refer to table 2 ; for brain regions activated during processing of neutral stimuli refer to table 2 and figure 1 ; for sex differences in cerebral activation during processing of neutral stimuli refer to table 3 and figure 1. consistently with numerous previous studies investigating neural correlates of emotion processing in schizophrenia, which involved diverse paradigms ranging from discrimination of emotional stimuli [1, 26 ], happy, and sad mood induction [3, 27 ] and experience of various emotional states [2, 4, 28 ], to passive viewing of emotional stimuli, in the present study, we observed relatively less activation in patients versus controls in the brain regions typically associated with emotion processing in the general population. deficit was apparent when making a classic comparison between processing of emotional versus neutral stimuli and should lead us to conclude that individuals diagnosed with schizophrenia can not properly activate their limbic system structures. importantly however, we have also made a comparison between the neutral stimuli and simple rest and found that under these circumstances it was the patients who activated several brain regions to a greater extent than did comparison participants. this pattern of functional neuroimaging results was complemented by the subjective rating data, which showed an attribution of greater emotional salience to neutral stimuli in patients relative to controls. a few investigations of processing of emotionally neutral stimuli in schizophrenia patients have documented increases in the amygdala, hippocampus, parahippocampal, posterior cingulate, and fusiform gyrus [12, 13, 15 ] in response to faces with neutral expressions. our current findings support and extend these previous results in showing increased activity in the amygdala and fusiform gyrus in addition to other brain regions implicated in affect, including the middle and anterior cingulate gyrus, middle temporal pole, middle temporal gyrus, and orbitofrontal cortex. the middle frontal and parietal cortex, also activated to a greater extent in patients relative to controls during neutral versus rest condition, has been found to play a more general role in nonemotional episodic memory [31, 32 ]. although the participants were not told to try and remember the images, they knew that a memory task would follow the initial encoding phase of the study and so it is feasible that, relative to controls, schizophrenia patients made a greater implicit (or explicit) effort to remember the stimuli. previous studies investigating responses to neutral stimuli in schizophrenia used samples consisting exclusively or primarily of male patients (and controls), rendering it impossible to verify whether the same pattern of subjective experience and cerebral activation would be also present in women with schizophrenia. because in the present study we included a sufficiently large number of male and female participants, we could make sex - specific comparisons. thus, we observed that relative to the same - sex controls, men with schizophrenia activated a significantly larger neural network that included the cingulate gyrus, as well as prefrontal and parietal cortices, while only a slight difference in cerebral activation was found between the two groups of women. thus, the difference in the processing of emotionally neutral material found between all the participating patients and the comparison group appeared to be driven mainly by men. this finding emphasizes the need to analyze data of the two sexes separately in the studies of emotional processing and cognitive function in schizophrenia and related psychosis, as noted elsewhere [33, 34 ]. an interesting model of the origin of psychosis is that it is characterized by attribution of emotion to external and internal events, which are typically considered neutral [35, 36 ]. thus, the increased neural response to neutral stimuli in our schizophrenia sample may reflect an atypical assignment of motivational salience to the neutral pictures a premise reinforced by the fact that the schizophrenia patients attributed greater emotional importance to the neutral images than did the healthy subjects. an interesting topic of debate is whether this abnormal pattern of activity reflects a trait or state marker of the disorder. seiferth and colleagues reported increased neural responses to neutral faces in persons at risk for psychosis. nonetheless, evidence has also been put forth emphasizing the potential role of clinical symptoms on this interesting pattern of activity. for instance, some have reported a significant positive relationship between positive symptoms and brain activation associated with nonemotional stimuli in patients with schizophrenia [15, 38 ], as well as increased visual attention to neutral but not threatening components of social scenes in patients with persecutory delusions. more research in this area, particularly in populations at high risk for developing schizophrenia, the present study supports and extends a few previous reports of enhanced neural and subjective sensitivity to the emotionally neutral material in individuals diagnosed with schizophrenia. importantly, we have shown for the first time that this effect is present primarily in male patients, while women with schizophrenia appear more similar to the same - sex control participants in this particular context. | the majority of functional neuroimaging studies investigating neural correlates of emotion processing in schizophrenia report a significant deficit in limbic structures activation in patients relative to control participants. recently it has been suggested that this apparent deficit could be due to an enhanced sensitivity of the neutral material in individuals diagnosed with schizophrenia, rather than due to their inefficiency in emotion processing. the purpose of the present study was to test this supposition and verify if the potential effect is present in both men and women diagnosed with schizophrenia. in order to do that we examined the pattern of cerebral activation associated with processing of neutral stimuli in schizophrenia. thirty - seven schizophrenia patients and 37 healthy controls viewed neutral and emotional images while in a functional magnetic resonance imaging scanner. schizophrenia patients rated the neutral images as more emotionally salient than controls. additionally, patients showed significant activation during processing of neutral images in limbic and prefrontal regions ; similar areas were underactivated in patients relative to controls during processing of emotional information. investigation of sex differences revealed that the enhanced responsiveness to the emotionally neutral material was attributed primarily to men with schizophrenia. |
despite continuing advances in ophthalmic care, endophthalmitis remains a rare but potentially serious complication of intraocular procedures. therefore, risk reduction strategies are especially important to improve overall patient outcomes.1 these practices may vary substantially between nations, perhaps due to the relative lack of evidence from randomized clinical trials (rcts). for example, povidone - iodine antisepsis is the only technique to reach category ii evidence in reducing endophthalmitis rates2 and is generally used before intraocular surgery and intravitreal injection3 in all nonallergic patients in most nations. these may be divided into endophthalmitis prophylaxis strategies for cataract surgery and for intravitreal injections. these two categories of endophthalmitis have not only many similarities but also important differences in risk factors, clinical features, and microbiological profiles. endophthalmitis following intravitreal injections is more likely to present earlier and to result in worse outcomes. microbial isolates from intravitreal injections are more likely to contain streptococcus species and other oral flora.46 the present manuscript reviews the available literature on antibiotic prophylaxis of endophthalmitis with cataract surgery and intravitreal injection, emphasizing differences between the us and other parts of the world. relevant articles were reviewed, especially those comparing rates of endophthalmitis following cataract surgery with and without intracameral antibiotics as well as endophthalmitis following intravitreal injection with and without topical antibiotics. this is intended to provide a concise summary for the practicing ophthalmologist but is not a systematic review ; therefore, it is possible that some relevant studies may have been missed. the reported incidence rates of acute - onset postoperative endophthalmitis (defined as presenting within 6 weeks) (figure 1) range from approximately 0.03% to 0.2% in many large series.1,7 using medicare claims data, the rate in the us was reported to be approximately 0.1% in 20032004 ; it is likely that the majority of these patients did not receive intracameral antibiotics.8 in contrast, the swedish national cataract register reported a rate of 0.048% in 20022004, and most of these patients did receive intracameral cefuroxime.9 however, comparing cohorts on different continents, even during a similar time period, is problematic, because many other factors may have influenced these rates, including differences in patient demographics, surgeons, equipment, techniques, and unknown factors. the european society of cataract and refractive surgeons (escrs) performed a large multicenter prospective rct and reported that intracameral injection of cefuroxime was associated with an approximately fivefold reduction in endophthalmitis rates following phacoemulsification.10 a specific criticism of the escrs study was the high rate of endophthalmitis in patients not randomized to receive intracameral cefuroxime (the rates of proven endophthalmitis in these two groups were 0.18% and 0.23%), which may have exaggerated the apparent treatment benefits. in addition, this study, which enrolled patients during 20032006, used levofloxacin as the topical antibiotic. it has been suggested that newer and more efficacious fourth - generation fluoroquinolones, such as moxifloxacin and gatifloxacin, might have reduced the apparent benefits of intracameral cefuroxime in this trial.11 favorable results using various intracameral antibiotics (including cefuroxime, cefazolin, moxifloxacin, and vancomycin) were subsequently reported in the uk,12 spain,1315 france,16 singapore,17 the us,18,19 sweden,20 japan,21 portugal,22 ireland,23 israel,24 and other nations (table 1). alternatively, two large series of cataract surgeries from canada25 and india26 reported no significant benefits associated with intracameral antibiotics. of note, none of these later series were rcts. the first cohort was generally an earlier group of patients treated without intra - cameral antibiotics, and the second cohort was generally a later group of patients treated after an institution s protocol was changed and antibiotics were initiated. when interpreting these results, it is important to consider that the two groups of patients were not treated at the same time ; generally the antibiotic - treated patients underwent surgery in later years than the nonantibiotic - treated patients. therefore, there may be important differences between the two cohorts other than the use of intracameral antibiotics, which also may have impacted the endophthalmitis rates. these differences may include differences in surgeons, equipment, techniques, or unknown factors. among these later series, rates of endophthalmitis in the cohorts not treated with intracameral antibiotics were also relatively high. in eight out of these 15 series, rates of endophthalmitis in the nonantibiotic - treated eyes (operated earlier in time) were greater than 0.2%, or higher than the nonantibiotic - treated eyes in the escrs rct. again, these relatively high rates may have exaggerated the apparent treatment benefits of intracameral antibiotics. in comparison, the reported rate of endophthalmitis without the use of intracameral antibiotics from the bascom palmer eye institute during a comparable time period (20022009) was 0.028% in 28,568 surgeries.27 this rate is similar to the rates reported in the escrs study for patients randomized to receive intracameral cefuroxime (0.025% and 0.050%) as well as the rates reported in most of the eyes treated with intracameral antibiotics in the cohort studies. although many studies report favorable results, there are other concerns about intracameral antibiotics, especially in nations (such as the us) in which an approved, prepackaged antibiotic indicated for intracameral use is not available and compounded antibiotics must be used. these concerns include risks of dilution errors and contaminants, increased costs, increased bacterial drug resistance, and other complications.28 accidental overdoses of intracameral cefuroxime have been associated with uveitis, macular edema, and retinal vascular leakage.29 postoperative hemorrhagic occlusive retinal vasculitis has been associated with intracameral vancomycin.30 in 2012, the european medicines agency approved aprokam (thea pharmaceuticals, clermont - ferrand, france), a prepackaged cefuroxime indicated for single use during cataract surgery, which is now available in 26 european nations. the availability of this product alleviates many of the concerns about compounded antibiotics but aprokam is not universally used, even in nations where it is available. the escrs conducted a telephone survey of 250 members, in which the interviews were completed by 193 surgeons (77%) from 31 european nations in 2012. intracameral antibiotics were used always or usually by 74% of respondents ; of the 26% who did not routinely use intracameral antibiotics, 52% gave there is no need as their reason for not using them.31 a review of the relevant literature from nine european countries, published in 2013, reported broad use of povidone - iodine or chlorhexidine antisepsis, but wide variations in the use of intracameral antibiotics. for example, intracameral antibiotics were used almost universally in sweden, where their omission was regarded as unethical. similarly, intracameral injection of cefuroxime was strongly recommended and used in a majority of cataract surgeries in france. however, the use of intracameral antibiotics was much lower and varied substantially in the uk, spain, germany, belgium, italy, the netherlands, and poland.32 in addition, a survey of 386 japanese cataract surgeons, conducted in 2014, reported the addition of antibiotics to the irrigating bottle in 22% and the injection of intracameral antibiotics in 7%.33 the american society of cataract and refractive surgery (ascrs) conducted an online poll of 7,677 members in 2014. the poll was completed by 1,147 members (15%), of whom 65% were from the us, 13% from latin america, and 9% from europe. intracameral antibiotics were injected at the conclusion of surgery by 36% of all respondents ; these percentages were 30% of us respondents and 70% of european respondents. half (50%) of all respondents reported using any type of intracameral antibiotic, but only 16% of these respondents used antibiotics in the irrigating solution. the most common reported antibiotics directly injected were moxifloxacin (mixed from commercial vigamox, 29%) and vancomycin (22%) ; the most commonly reported antibiotic mixed into the irrigating solution was vancomycin (15%). of respondents from nations (including the us) without access to a commercially available formulation of cefuroxime for intracameral injection, 69% reported that they would use this drug if it were approved and if the cost were reasonable.34 the reported incidence rates of endophthalmitis following intravitreal injection of antivascular endothelial growth factor agents range from ~0.02% to 0.3% per injection.35 because most patients are treated with a series of injections, the cumulative rate of endophthalmitis per patient is higher. unlike the situation with cataract surgery, in which the escrs conducted a rct, there are no major rcts evaluating alternative intravitreal injection techniques. therefore, an expert committee published guidelines in 200436 and revised these guidelines in 2014.3 these consensus guidelines include deferring injections in the presence of active external infection, reducing aerosolized droplets containing oral contaminants, and the use of topical povidone - iodine before injection. however, these guidelines allow for substantial variability in technique, including the setting in which the injections are performed (clinic room vs operating room) and the use of prophylactic topical antibiotics. in addition, there are many other factors that may influence endophthalmitis rates for which there is no consensus, including the use of facemasks, surgical drapes, eyelid speculums, conjunctival displacement, and location of injection site (superior vs inferior, rotating sites). in the us, intravitreal injections are generally performed in a clinic setting, but injections are performed in an operating room setting in many european nations. a study compared 8,647 injections performed by a us - based surgeon in a clinic setting versus 3,063 injections performed by an italian surgeon in an operating room. the endophthalmitis rates were 0.035% in the clinic and 0.065% in the operating room, which were not significantly different.37 there also appear to be differences between nations regarding the use of topical antibiotics before or after intravitreal injections.38 multiple studies (but no rcts) from the us,3943 canada,44 iran,45,46 and korea47 have reported no statistically significant differences in endophthalmitis rates between eyes treated with antibiotics or not (table 2). an additional series of 316,576 intravitreal injections in france did not specifically report rates of endophthalmitis with and without antibiotic prophylaxis but reported an overall rate of 0.021% and that prophylaxis with an antibiotic or antiseptic was associated with increased rates of endophthalmitis in both univariate (p=0.21) and multivariate (p=0.001) analyses.48 alternatively, a series of 11,450 injections from france reported a rate of endophthalmitis of 0.03% in antibiotic - treated eyes and 0.23% in nontreated eyes (p=0.024).49 a potential criticism of this study is the relatively high rate of endophthalmitis in nonantibiotic - treated eyes, which may have exaggerated the apparent benefit of antibiotics in this one study. the american society of retina specialists (asrs) annual preferences and trends (pat) survey gives information about differences in technique between us members and international members. the 2013 survey reported that injections were performed more commonly in a surgery center, hospital, or other location (rather than the clinic) by international members than by us members (57.3% vs 1.8%). topical antibiotics were used with intravitreal injection more commonly by international members than by us members (70.9% vs 21.8%). facemasks were used more commonly by international members than by us members on the injecting physician (49.1% vs 14.3%) and on both the physician and the patient (16.8% vs 3.7%).50 the 2014 asrs pat survey reported generally similar usage rates of an eyelid speculum during intravitreal injections between us members and international members.51 the 2015 asrs pat survey reported persistence of the disparity between us members and international members regarding topical antibiotics for intravitreal injections : only 9.5% of us members reported using topical antibiotics, as opposed to 60.6% of international members.52 there are currently two major apparent areas of discrepancy between us and non - us ophthalmologists regarding endophthalmitis prophylaxis. us ophthalmologists appear relatively less likely to use intracameral antibiotics during cataract surgery and relatively less likely to use topical antibiotics with intravitreal injections. there may be many reasons for these differences, but it is important to note that there is very little pertinent information available from rcts. in the 2014 ascrs survey,34 the major reported reason for not using intracameral antibiotics during cataract surgery was the lack of a commercially available prepackaged antibiotic for this indication. however, many us cataract surgeons simply believe that intracameral antibiotics are unnecessary, based on concerns about the escrs and other studies as well as risks of dilution errors, toxicity, and selection of drug - resistant organisms. should a commercially manufactured, approved intracameral antibiotic become available, it is reasonable to suspect that it would be adopted by more us surgeons, although the precise number can not be predicted. of note, the ascrs clinical cataract committee strongly supports the investigation towards an approved commercial antibiotic preparation which may improve the safety of intracameral antibiotics.7 based on many newer published series of intravitreal injections without topical antibiotics, it is possible that non - us ophthalmologists will increasingly forgo topical antibiotics with intravitreal injections. the majority of the published trials (although no rcts) have reported no apparent benefit associated with topical antibiotics in this setting. there is some evidence that topical antibiotics may actually increase the endophthalmitis rate after intravitreal injections, perhaps by unfavorably altering conjunctival flora.38 continued good outcomes without topical antibiotics in this setting may encourage non - us ophthalmologists to stop using them. at the present time, there is no global consensus regarding endophthalmitis prophylaxis practices, and it appears unlikely that additional major rcts will be conducted to conclusively define the roles of intracameral antibiotics in cataract surgery and topical antibiotics in intravitreal injections. | endophthalmitis remains a rare but important cause of visual loss. prophylaxis strategies are important to reduce rates of endophthalmitis after cataract surgery, intravitreal injection, and other procedures. there is substantial variability between the us and the rest of the world. during cataract surgery, intracameral antibiotics are commonly used in many nations, especially in europe, but are less commonly used in the us. a randomized clinical trial from the european society of cataract and refractive surgeons reported an approximately fivefold reduction in endophthalmitis rates associated with intracameral cefuroxime but these results are controversial. there are no randomized clinical trials regarding endophthalmitis associated with intravitreal injection. topical antibiotics are commonly used in many nations, but are less commonly used in the us. at this time, there is no global consensus and it appears unlikely that additional major clinical trials will conclusively define the optimal endophthalmitis prophylaxis techniques. |
streptococcus pneumoniae is the most common bacterial pathogen associated with community - acquired bacterial pneumonia (cabp) [10, 14 ].. however, the number of strains that are resistant to commonly used antibiotics continues to increase. ceftaroline, the active form of the prodrug ceftaroline fosamil, is a parenteral cephalosporin exhibiting broad spectrum in vitro bactericidal activity against gram - positive pathogens, including multidrug - resistant (mdr) s. pneumoniae and methicillin - resistant staphylococcus aureus, and common gram - negative organisms [5, 12, 15 ]. ceftaroline fosamil is approved in the united states for the treatment of patients with cabp and acute bacterial skin and skin structure infections and for similar indications in europe [16, 18 ]. we previously demonstrated that ceftaroline was the most active -lactam agent tested against a subset of 260 mdr s. pneumoniae isolates collected across canada between 2003 and 2008. the canadian bacterial surveillance network (cbsn) has collected s. pneumoniae isolates as part of a nationwide surveillance program since 1988. in recent years, there has been not only an increase in the prevalence of mdr s. pneumoniae, but also an increase in the degree of resistance to the -lactam antibiotics. surveillance studies in the united states also indicate an increase in nonsusceptibility of s. pneumoniae to common -lactam antibiotics [6, 7 ]. the objective of this study was to assess the in vitro activity of ceftaroline and comparative agents against cbsn s. pneumoniae the cbsn encompasses volunteer community and hospital - affiliated laboratories across canada, which provide services to community and tertiary - care hospitals, community clinics, physician offices, and long - term care facilities. 186 laboratories have participated in the cbsn, with 40 laboratories submitting annually since 1993. only one isolate per patient episode is included ; laboratories are asked to submit all sterile - site isolates and a defined number of consecutive nonsterile - site isolates annually, based on laboratory size. all isolates are submitted to a central laboratory where they are confirmed as s. pneumoniae and serotyped using latex antisera (statens serum institute, denmark) and quellung reaction. isolates that can not be serotyped at the central laboratory are serotyped at canada s national microbiology laboratory. broth microdilution susceptibility testing is performed and interpreted according to the clinical and laboratory standards institute (clsi) guidelines. for this study, nonmeningeal breakpoints for ceftaroline, penicillin, amoxicillin, and ceftriaxone in addition, an analysis by meningeal breakpoints was included to determine resistant isolates to penicillin and ceftriaxone. from 2008 to 2011 there were 1,043 (15.1 %) isolates collected from pediatric patients (015 years old), 3,350 (48.6 %) isolates collected from adults between 16 and 64 years of age, and 2,491 (36.1 %) from adults aged 65 years ; age data were not available for 11 patients. of 6,895 isolates, 3,088 (45 %) were recovered from sterile specimens (2,868 blood, 76 cerebral spinal fluid, 63 pleural fluid, and 81 other), and 3,796 (55 %) isolates were from nonsterile specimens (2,572 sputum, 417 eye, 247 ear, and 560 other). among sterile - site isolates, the most common serotypes were 19a (17 %), 7f (13 %), and 3 (8 %). among nonsterile - site isolates, the most common serotypes isolated were 19a (11 %), 3 (9 %), and 11a (9 %). there were decreases in many common serotypes following the introduction of pcv10 in some provinces in 2009 and pcv13 in 2010. serotypes included in pcv10 (1, 4, 5, 6b, 7f, 9 v, 14, 18c, 19f, 23f) and pcv13 (all in pcv10 and 3, 6a, 19a) accounted for 53.9 % of isolates in 2008, but this decreased to 44.6 % of isolates in 2011. the proportion of isolates resistant to more than two classes of antibiotics (mdr isolates) increased over time (fig. 1). overall, 6.6 % (456/6,895) of pneumococcal isolates were mdr. among mdr isolates, resistance rates exceeded 95 % for erythromycin, tetracycline, and trimethoprim / sulfamethoxazole (table 1). the mic90 of cethromycin, ceftaroline, and ceftobiprole against mdr isolates were 0.12, 0.25, and 1 mg / l, respectively (table 2). the highest mics observed for ceftaroline, ceftobiprole, and cethromycin were 0.5, 2, and 4 mg / l, respectively.fig. 1percent of isolates nonsusceptible to common antibiotics and multidrug - resistant (mdr) isolates by year, 20082011. mdr = multidrug - resistant, resistant to > 2 classes of antibiotics (classes : -lactams [penicillin / amoxicillin / ceftriaxone ], erythromycin, tetracycline, trimethoprim / sulfamethoxazole, ciprofloxacin). nonsusceptibility based on clsi interpretive breakpoints (amoxicillin mic > 2 mg / l ; ceftaroline mic > 0.5 mg / l ; ceftriaxone mic > 1 mg / l ; erythromycin mic > 0.25 mg / l ; penicillin mic > 2 mg / l ; trimethoprim / sulfamethoxazole (smx / tmp) mic > 0.5 mg / l for ciprofloxacintable 1percent of resistant streptococcus pneumoniae isolates from canada, 20082011drugpercent (%) of isolates resistantall isolates (n = 6895)mdr isolates (n = 456) [n / n = 6.6 % ] penicillin (nonmeningitis)0.46.1penicillin (meningitis)18.687.1amoxicillin 3.451.1ceftriaxone (nonmeningitis)0.46.1ceftriaxone (meningitis)4.663.4erythromycin 25.199.8 high - level13.282.5 low - level12.017.3trimethoprim / sulfamethoxazole12.798.5tetracycline12.996.7ciprofloxacin1.88.1 mdr multidrug - resistant, resistant to > 2 classes of antibiotics (classes : -lactams [penicillin / amoxicillin / ceftriaxone ], erythromycin, tetracycline, trimethoprim / sulfamethoxazole, ciprofloxacin) nonmeningeal breakpoints used high - level erythromycin resistance = mic 16 mg / l ; low - level erythromycin resistance = mic 1 to 2 classes of antibiotics (classes : -lactams [penicillin / amoxicillin / ceftriaxone ], erythromycin, tetracycline, trimethoprim / sulfamethoxazole, ciprofloxacin). nonsusceptibility based on clsi interpretive breakpoints (amoxicillin mic > 2 mg / l ; ceftaroline mic > 0.5 mg / l ; ceftriaxone mic > 1 mg / l ; erythromycin mic > 0.25 mg / l ; penicillin mic > 2 mg / l ; trimethoprim / sulfamethoxazole (smx / tmp) mic > 0.5 l for ciprofloxacin percent of resistant streptococcus pneumoniae isolates from canada, 20082011 mdr multidrug - resistant, resistant to > 2 classes of antibiotics (classes : -lactams [penicillin / amoxicillin / ceftriaxone ], erythromycin, tetracycline, trimethoprim / sulfamethoxazole, ciprofloxacin) nonmeningeal breakpoints used high - level erythromycin resistance = mic 16 mg / l ; low - level erythromycin resistance = mic 1 to 2 classes of antibiotics (classes : -lactams [penicillin / amoxicillin / ceftriaxone ], erythromycin, tetracycline, trimethoprim / sulfamethoxazole, ciprofloxacin) in vitro activities of antimicrobial agents against streptococcus pneumoniae isolates from canada, 20082011 mdr = multidrug - resistant, resistant to > 2 classes of antibiotics (classes : -lactams [penicillin / amoxicillin / ceftriaxone ], erythromycin, tetracycline, trimethoprim / sulfamethoxazole, ciprofloxacin) emerging s. pneumoniae resistance, particularly for macrolides, is evident based on these surveillance data and reports from sentry. high - level macrolide resistance is increasing, with more than half of erythromycin - resistant isolates considered to have high - level resistance in this study. guidelines may no longer be able to recommend macrolides for first - line therapy based on > 25 % resistance levels. resistance to -lactam agents, apart from ceftaroline, also increased throughout the study period. ceftaroline, ceftobiprole, and cethromycin exhibited more potent in vitro activity against mdr pneumococci than ceftriaxone. potent in vitro activity of ceftaroline against pneumococci has also been reported from the assessing worldwide antimicrobial resistance evaluation (aware) program. in vitro activity of ceftaroline can be attributed to its high affinity for s. pneumoniae penicillin - binding proteins (pbps), including pbps 1a, 2b, and 2x [8, 11 ]. in an integrated analysis of 2 phase 3 clinical trials comparing ceftaroline fosamil with ceftriaxone in the treatment of patients with cabp, clinical cure at the test - of - cure visit was higher in the ceftaroline fosamil group than in the ceftriaxone group in patients with s.pneumoniae (85.5 vs 68.6 %, respectively). an analysis of patients in these trials that evaluated clinical response rates at an earlier end point, 72 h after initiation of therapy, showed similar results, with 73 % of patients in the ceftaroline fosamil group compared with 56 % of patients in the ceftriaxone group experiencing clinical response following a s. pneumoniae infection (p = 0.03). in summary, the percentage of mdr s. pneumoniae isolates increased from approximately 5 % in 2008 to 8 % in 2011. among the -lactam antibiotics tested, ceftaroline demonstrated the most potent in vitro activity against mdr s. pneumoniae. these data suggest that ceftaroline fosamil can play an important role in the treatment of infection caused by s. pneumoniae, including mdr strains. based on the high clinical and microbiological response rates in clinical trials and the potent in vitro activity against s. pneumoniae in this analysis, ceftaroline fosamil is a useful option for management of cabp. abbott, dr. everett chalmers regional hospital, fredericton, new brunswick ; h. almohri, lifelabs medical laboratory services, ontario ; m. alfa, st. boniface general hospital, winnipeg, manitoba ; a. belhaj, rouge valley health system, toronto, ontario ; j. blondeau, royal university hospital, saskatoon, saskatchewan ; l. bocci, chaleur regional hospital, bathurst, new brunswick ; w. ciccotelli, grand river hospital, kitchener, ontario ; r. davidson and k. forward, qeii elizabeth health sciences centre, halifax, nova scotia ; h.r. michael s hospital, toronto, ontario ; j. downey, toronto east general hospital, toronto, ontario ; s. el - bailey, saint john regional hospital, saint john, new brunswick ; g. german, queen elizabeth hospital, charlottetown, prince edward island ; h. giang, ross memorial hospital, lindsay, ontario ; d. hoban and g. zhanel, health sciences centre, winnipeg, manitoba ; y. hussein, cape breton regional hospital, sydney, nova scotia ; k. katz, north york general hospital, north york, ontario and shared hospital laboratory inc, toronto, ontario ; p.c. kibsey, royal jubilee hospital, victoria, british columbia and nanaimo district general hospital, nanaimo, british columbia ; s. krajden, st. joseph s health centre, toronto, ontario ; m. kuhn, the moncton hospital, moncton, new brunswick ; p.r. laberge, centre hospitalier regional de sept - iles, sept - iles, quebec ; k.s. lee, humber river regional hospital, toronto, ontario ; b. nash, whitehorse general hospital, whitehorse, yukon ; d. noria, the scarborough hospital, toronto, ontario ; k. ostrowska and a. sarabia, trillium health partners, toronto, ontario ; p. pieroni, westman regional laboratory, brandon, manitoba ; r. price, royal victoria hospital, barrie, ontario ; n. rau, halton healthcare, oakville, ontario ; d. richardson, william osler health services, brampton, ontario and headwaters health care centre, orangeville, ontario ; s. richardson, hospital for sick children, toronto, ontario ; v. sales, markham stouffville hospital, markham, ontario ; a.e. simor, sunnybrook health sciences centre, toronto and lakeridge health, oshawa, ontario ; g. tyrrell, alberta provincial health laboratory, edmonton, alberta. | between 2008 and 2011, 6,895 streptococcus pneumoniae isolates were submitted to the canadian bacterial surveillance network and underwent in vitro susceptibility testing. fifteen percent of s. pneumoniae isolates were collected from pediatric patients (015 years old), 48.6 % of isolates were collected from adults between 16 and 64 years of age, and 36.1 % from adults aged 65 years ; age data were not available for 11 patients. forty - five percent of s. pneumoniae isolates were recovered from sterile specimens, and 55 % of isolates were from nonsterile specimens. overall, 0.4 % of isolates were resistant to penicillin, 0.4 % to ceftriaxone, 3 % to amoxicillin, 25 % to erythromycin, and 13 % to trimethoprim / sulfamethoxazole ; 6.6 % of isolates were multidrug resistant (mdr). among mdr isolates, resistance rates exceeded 95 % for erythromycin, tetracycline, and trimethoprim / sulfamethoxazole. the mic90 of cethromycin, ceftaroline, and ceftobiprole against mdr isolates were 0.12, 0.25, and 1 mg / l, respectively. ceftaroline, the active form of the prodrug ceftaroline fosamil, exhibited potent in vitro activity against the tested s. pneumoniae including all 456 multidrug - resistant strains. no ceftaroline - resistant isolates were identified. |
lung transplantation continues to be hampered by the number of available donors [1, 2 ]. ex vivo lung perfusion (evlp) has emerged as an essential tool for the reassessment, under a controlled scenario, of lungs from heart - beating donors (hbds) that initially did not meet transplantation criteria [38 ]. the method is also an excellent tool for reassessing lungs of donors after cardiac death (dcd) [9, 10 ]. dcds are classified according to the maastricht classification and may be subdivided as controlled and uncontrolled. often the controlled dcds are of interest since these patients are under hospital care, and their clinical history and lung function are known. these controlled donors are, however, limited in number compared with the potential numbers of uncontrolled dcds. the disadvantage of using lungs from uncontrolled donors, however, is that lung function is not known and has to be validated before the lungs can be accepted for transplant. there are also some issues regarding the optimal preservation of uncontrolled donor lungs such as how long warm ischemic time the lungs can withstand and whether it is better to harvest the lungs after the period of warm ischemia or cool the lungs inside the deceased body. the formalities of the donation process have to be also managed properly according to the law of each country. as mentioned above, how to perform the optimal evlp has also been a focus of the discussion. after the warming phase in evlp, the lung is 37c and fully ventilated, and it is ready to be reassessed for transplant suitability. to reassess the lungs adequately, the atelectasis is eliminated by increasing the peep up to 10 cm h2o for 1015 minutes at the time when the lungs have reached 37c. all of the lung atelectasis has to be eliminated for the lung to be tested adequately. if the lung is tested with the lung atelectasis present, a shunt will be formed where the blood is not oxygenated. in the present study, we hypothesize that elimination of atelectasis is preferably made under conditions where, the lung is ventilated but not perfused. in the present study the lung perfusion is temporarily shut down during 10 minutes. during that time, the lung is fully ventilated, and the peep is increased to 10 cm h2o. according to our knowledge, no such study has been performed previously. the study was approved by the ethics committee for animal research, lund university, sweden (no. all animals received care according to the european convention for the protection of vertebrate animals used for experimental and other scientific purposes, to the usa principles of laboratory animal care of the national society for medical research, and to the guide for the care and use of laboratory animals. 20 mg / ml, bayer ag, leverkusen, germany, 2 mg / kg) mixed with ketamine (ketaminol vet. 100 mg / ml, farmaceutici gellini s.p.a., aprilia, italy, 20 mg / kg) while the pig was still in its stable. the pig was then transferred to the laboratory and placed on the operating table in the supine position. oral intubation was performed using a 7.5 mm endotracheal tube after the induction of anesthesia with sodium thiopental (pentothal, abbott laboratories, north chicago, il, usa) and pancuronium bromide (pavulon, n.v. anesthesia was maintained by infusions of ketamine (ketaminol vet.), midazolam (midazolam panpharma, oslo, norway), and fentanyl (leptanal, lilly, france). mechanical ventilation was established with a siemens - elema ventilator (servo ventilator 300, siemens, solna, sweden). the pulmonary artery was cannulated via the right ventricle with a 28 f cannula secured with a purse string suture placed in the outflow tract of the a. pulmonalis. a clamp was placed on the v. cava superior, and another clamp on the v. cava inferior. the lungs were perfused antegradely with 5 l of cold perfadex containing 1.0 ml isotonic trometamol (addex - tham 3.3 mmol / ml, fresenius kabi ab, uppsala, sweden), 2 ml calcium chloride (0.45 mmol / ml), and 3 ml nitroglycerine (5 mg / ml, bmm pharma ab, stockholm, sweden) at a low perfusion pressure (0.05 was considered not significant (n.s.). the results are presented as median and range or mean and standard error of the mean (sem). no significant differences were observed in animal weight in the two groups (72 1 kg in the modified evlp group and 73 2 kg in the conventional evlp group (p > 0.05)). neither were there any differences in arterial oxygen partial pressure at an inspired oxygen fraction of 1.0 (64.8 6.0 kpa in the modified evlp group and 67.7 1.8 kpa in the conventional evlp group) before organ harvesting. no anatomical anomalies, signs of infection, or malignancies were found in any of the animals at autopsy. the time from the initiating of the evlp circuit and until the perfusate from the lung had reached 37c was calculated. no significant differences in the evlp time were observed in the two groups (25 2 minutes in the modified evlp group and 26 3 minutes in the conventional evlp group (p 0.05). in the conventional evlp group, the pvr was 366 24 before the maneuver and 464 39 after the maneuver (p < 0.05). comparing the two groups, the modified evlp group showed significantly lower pvr after the maneuver compared with the conventional evlp group (p < 0.05) (figure 3). the lungs were weighed after harvesting and after evlp to assess the degree of lung edema. the time from disconnecting the evlp circuit and until the lungs were weighed was calculated. no significant differences in the evlp time were observed in the two groups (3 0.3 minutes in the modified evlp group and 3 0.5 minutes in the conventional evlp group (n.s.)). interestingly, the pulmonary grafts receiving the modified evlp showed unchanged weight before and after the maneuver, indicating a dry pulmonary graft with good quality, while the pulmonary grafts from the conventional evlp showed increased pulmonary graft weight indicating a wet and heavy pulmonary graft with poor quality. in the modified evlp group, the pulmonary graft weight was 723 43 grams before the maneuver and 746 43 grams after the maneuver (n.s.). in the conventional evlp group, the pulmonary graft weight was 690 15 grams before the maneuver and 973 60 grams after the maneuver (p < 0.001). comparing the two groups, the modified evlp group showed significantly lower pulmonary graft weight after the maneuver compared with the conventional evlp group (p < 0.001) (figure 4). pulmonary artery flow (l / min), that is, cardiac output (co), in the ex vivo model and pulmonary artery pressure (pap) were measured continuously. the pulmonary artery flow was not allowed to exceed 4 l / min, and the pap was not allowed to exceed 20 mmhg. no significant differences in pulmonary artery flow or pap were seen before and after the different maneuvers in the two groups or between the two groups during the evaluation of the pulmonary graft. the pulmonary arterial branches were macroscopically studied for thrombotic material by opening the arteries distally as far as possible. lung transplantation is used to treat patients with a variety of end - stage pulmonary diseases. while indications for lung transplantation continue to increase, widespread application of this procedure remains limited due to the lack of suitable donor organs. lately, great interest has been focused on the expansion of the donor pool using organs from dcds [7, 9, 13, 14 ]. some years ago, we reported the results of the first six double - lung transplantations performed in the world with donor lungs from hbds that were rejected for transplantation by the scandiatransplant, the eurotransplant, and the uk transplant organizations after in situ evaluation due to poor arterial oxygen tension. the evlp method, which has been described in detail previously [5, 15, 16 ], has been suggested as a novel method of differentiating between good and poor pulmonary grafts in a group referred to as marginal donors due to poor arterial oxygen tension. we found evlp to be an excellent tool to reveal lung pathology and to evaluate lung function prior to decision making regarding lung transplantation, thereby increasing the number of potential lungs available for transplantation. evlp has also been successful in evaluating lung function in experimental lung preservation and lung transplantation [6, 17 ]. when grafts characterized as good using this method were transplanted, the results revealed no significant differences from those with lungs fulfilling the standard criteria. however, these patients often showed a slight increase in primary graft dysfunction, displayed as slight increase in interstitial whitening, on the chest x - ray on the first days after the transplant. in the present study, we present a modified form of evlp for eliminating atelectasis. in conventional evlp, the golden standard to eliminate the atelectasis is to increase peep up to 10 cm h2o for 1015 minutes after the lung has reached 37c. the perfusion of the lung is kept on maximum flow, while the lungs are ventilated with increased peep. we have noticed in earlier studies (work in progress) that during this maneuver it is very easy to harm the lung and create a slight edema while eliminating the atelectasis. however, it is crucial to eliminate the atelectasis to be able to perform an adequate validation of the lungs. if there is atelectasis, a shunt will be formed in this part of the lung resulting in nonfunctional lung parenchyma. this may lead to false low blood gas values and, in the worst case, failure to meet the criteria for lung transplantation. in the present study, we hypothesize that lung injury could be minimized by shutting down the perfusion without disconnecting the evlp circuit, ventilating the lung with increased peep for 10 minutes. we refer to this maneuver as modified evlp. as expected, both groups had significant higher blood gases after eliminating the atelectasis, but the lungs from the modified evlp group had significant higher blood gases compared with the conventional evlp group. both groups, however, met the criteria for acceptance for lung transplantation. interestingly, the lungs receiving modified evlp had a significant lower lung weight compared with the conventional evlp lungs indicating less lung injury and lung edema with the modified evlp. there were also significantly higher airway pressure and pvr in the conventional evlp group compared with the modified evlp group, also indicating lung injury in the conventional evlp group. clinically, it is preferable to transplant a dry lung compared with a slightly heavier lung due to interstitial lung edema. the recipient who receives the dry lung with less lung injury will likely experience shorter time on a ventilator and shorter time at the icu after the transplantation. the signs of primary graft dysfunction will probably be also less, which will affect the recipient 's morbidity and longtime mortality. limitations in our study are the rather small study groups, the use of the evlp and not a transplant model, and being assessed in vivo. the observations from our study need to be taken into a clinical setting to be further assessed. modified evlp with normoventilation of the lungs without ongoing lung perfusion for 10 minutes may eliminate atelectasis almost completely without harming the lungs, thereby making it possible to evaluate blood gases properly in order to decide whether to transplant. | to evaluate the lung function of donors after circulatory deaths (dcds), ex vivo lung perfusion (evlp) has been shown to be a valuable method. we present modified evlp where lung atelectasis is removed, while the lung perfusion is temporarily shut down. twelve pigs were randomized into two groups : modified evlp and conventional evlp. when the lungs had reached 37c in the evlp circuit, lung perfusion was temporarily shut down in the modified evlp group, and positive end - expiratory pressure (peep) was increased to 10 cm h2o for 10 minutes. in the conventional evlp group, peep was increased to 10 cm h2o for 10 minutes with unchanged lung perfusion. in the modified evlp group, the arterial oxygen partial pressure (pao2) was 18.5 7.0 kpa before and 64.5 6.0 kpa after the maneuver (p < 0.001). in the conventional evlp group, the pao2 was 16.8 3.1 kpa and 46.8 2.7 kpa after the maneuver (p < 0.01 ; p < 0.01). in the modified evlp group, the pulmonary graft weight was unchanged, while in the conventional evlp group, the pulmonary graft weight was significantly increased. modified evlp with normoventilation of the lungs without ongoing lung perfusion for 10 minutes may eliminate atelectasis almost completely without harming the lungs. |
the development of modern nursing education in iran has been parallel with many other countries (1). there is a movement towards advanced nursing education to keep pace with today s health care demands and nursing faculties have an important role to achieve this aim. in recent years, the ministry of health and medical education in iran (mhmei) has increased the admission of nursing student without changes in faculty numbers. this condition has increased the working pressure in nursing faculties (2, 3). to sustain a significant link between the faculty work and the discipline of nursing, faculty members are expected to be excellent instructors, engage in meaningful researches, and participate in academic and community service activities ; these can lead them to role strain (5). the professional roles for a faculty in university and college settings are generally three parts which encompass teaching, research, and executive service (4, 6, 7). in the recent years, mhmei added cultural - educational - social role to these roles (8). based on role theory, when an individual faces with challenges or conflicting sets of expectations and demands for one position in the organization, role conflict occurs (9). role conflict could result from inconsistencies in the expected behaviors associated with an individual s role (2, 10). in nursing faculty, this situation has induced a misunderstanding and miscommunication climate and the faculty has not found a clear perception of what is expected of their performance or how they will be evaluated (11). many studies have suggested that role conflict has been negatively related to job satisfaction and organizational commitment of nursing faculty (12 - 15). the current sociological view is that organizational conflict should be neither avoided nor encouraged, but managed (16). because of frequent and various effects of role conflict on nursing faculty, it is important to understand the causes of role conflict. a person may be very overwhelmed in one conflicting situation, yet can handle several simultaneous conflicts later. the difference is in the quality or significance of that conflict to the person experiencing it. we did not find any qualitative research about role conflict in nursing faculty in the literature. the purpose of this research was to explore the experiences of role conflict in iranian nursing faculties. a qualitative approach (conventional content analysis) was used to discover role conflict experiences among nursing faculty members. this qualitative approach is an appropriate selection for exploring the data and develops the dominant and major themes of the participant s experiences (17). the first researcher communicated with each of the participants to describe the purpose of research and research questions and the participants were asked if they had any questions. in this study, the participants were nursing faculty members from seven universities. during the sampling process, 19 nursing faculties were selected through a purposeful sampling technique with maximum variation sampling method (table 1). we tried to select highly experienced participants according to their educational degrees, job responsibilities, durations of work, and gender. with regard to the aim of the research, the characteristics of the participants included : nursing faculty members with master of science and doctorate degrees who announced their desire to participate in the research and explain their own experiences about the aim of the research. no one of our participants were excluded from the study. after obtaining written or oral informed consent, based on the participants preferences, the interviews were performed in a private room at the participants work places. accordingly, 19 unstructured, face - to - face, in - depth interviews using open - ended questions were conducted by the first author. the interviewer was a faculty member of nursing with 18 years of experience and was trained on interviewing in qualitative studies. the first author initiated the interviews with a general open - ended question about the experience of professional roles and proceeded questions that were more specific. the interviews were directed by subsequent questions and the researcher directed his / her questions based on a specific category. some of the questions were : would you please describe your roles as a faculty member ? the sampling continued until data saturation was achieved or until no new codes were derived in the three final interviews and all the conceptual levels were completed. max - q - data (version 10) software was used to assist with storage, searching, initial and final coding of qualitative data. in this study, a qualitative data analysis was performed simultaneously with data collection. the qualitative content analysis used in the present study was based on graneheim and lundman methods, which was conducted in the following steps (17) : 1) digital recordings of each interview were transcribed to create verbatim written accounts. the transcription was performed at the end of each day, as recommended by polit and beck (18). the total transcribed texts were read multiple times to obtain the sense of whole ; 2) the important parts of the text were divided to meaningful units ; then, these meaningful units were categorized as condensed units ; 3) the condensed units were categorized as subcategories ; 4) according to the similarities and differences, subcategories were divided to categories ; 5) the final categories according to the similarities and differences were formulated as the theme of the expression of the latent content of the text. the first author analyzed the total data, while the other three authors compared the codes, and minor disagreements were resolved after discussion. thereafter, the codes (and meaningful units) were read several times and compared to the context. after the categorization of the data at the group level, the researchers returned to the individual level to ensure that the categories were differentiated at an equal level of abstraction. the analysis was an inductive process and the goal was to create a detailed description and list of themes or categories related to the phenomenon under investigation, that was, role conflict. trustworthiness was achieved through several criteria including credibility, dependability ; confirm ability, and transferability (18). prolonged engagement with the participants within the research field helped the researchers to gain the participants trust and as well as giving a better understanding of the research fields. member checking was conducted by asking the participants to ascertain the preliminary findings from the earlier interviews. constant comparative analyses were performed from the first to the 19th interviews and resulted differentiation in the categorization of data., the participants were selected from various experiences, ages, certifications, universities, and genders. dependability was obtained by submitting the original data to a theme for the researcher team members and six reviewers. confirm ability was obtained through asking three participants to compare the results of the study with their own experiences. multi - observation was conducted for improving the rigor of the study (17, 18). the current study was part of a doctoral thesis in phd degree of nursing education. research ethics approval was obtained from baqiyatallah university of medical sciences (no. 33, 10/27/2013), a nursing faculty in tehran, iran. the participants were asked to sign consent forms and were informed that they could withdraw from the study at any time. code numbers were placed on the audiotapes or transcripts, which were stored in a locked location. a qualitative approach (conventional content analysis) was used to discover role conflict experiences among nursing faculty members. this qualitative approach is an appropriate selection for exploring the data and develops the dominant and major themes of the participant s experiences (17). the sampling process began in july 2013 and ended in march 2014. the first researcher communicated with each of the participants to describe the purpose of research and research questions and the participants were asked if they had any questions. in this study, the participants were nursing faculty members from seven universities. during the sampling process, 19 nursing faculties were selected through a purposeful sampling technique with maximum variation sampling method (table 1). we tried to select highly experienced participants according to their educational degrees, job responsibilities, durations of work, and gender. with regard to the aim of the research, the characteristics of the participants included : nursing faculty members with master of science and doctorate degrees who announced their desire to participate in the research and explain their own experiences about the aim of the research. after obtaining written or oral informed consent, the interview was scheduled according to the participant s agreement. based on the participants preferences, accordingly, 19 unstructured, face - to - face, in - depth interviews using open - ended questions were conducted by the first author. the interviewer was a faculty member of nursing with 18 years of experience and was trained on interviewing in qualitative studies. the first author initiated the interviews with a general open - ended question about the experience of professional roles and proceeded questions that were more specific. the interviews were directed by subsequent questions and the researcher directed his / her questions based on a specific category. some of the questions were : would you please describe your roles as a faculty member ? the sampling continued until data saturation was achieved or until no new codes were derived in the three final interviews and all the conceptual levels were completed. max - q - data (version 10) software was used to assist with storage, searching, initial and final coding of qualitative data. in this study, a qualitative data analysis was performed simultaneously with data collection. the qualitative content analysis used in the present study was based on graneheim and lundman methods, which was conducted in the following steps (17) : 1) digital recordings of each interview were transcribed to create verbatim written accounts. the transcription was performed at the end of each day, as recommended by polit and beck (18). the total transcribed texts were read multiple times to obtain the sense of whole ; 2) the important parts of the text were divided to meaningful units ; then, these meaningful units were categorized as condensed units ; 3) the condensed units were categorized as subcategories ; 4) according to the similarities and differences, subcategories were divided to categories ; 5) the final categories according to the similarities and differences were formulated as the theme of the expression of the latent content of the text. the first author analyzed the total data, while the other three authors compared the codes, and minor disagreements were resolved after discussion. thereafter, the codes (and meaningful units) were read several times and compared to the context. after the categorization of the data at the group level, the researchers returned to the individual level to ensure that the categories were differentiated at an equal level of abstraction. the analysis was an inductive process and the goal was to create a detailed description and list of themes or categories related to the phenomenon under investigation, that was, role conflict. trustworthiness was achieved through several criteria including credibility, dependability ; confirm ability, and transferability (18). prolonged engagement with the participants within the research field helped the researchers to gain the participants trust and as well as giving a better understanding of the research fields. member checking was conducted by asking the participants to ascertain the preliminary findings from the earlier interviews. constant comparative analyses were performed from the first to the 19th interviews and resulted differentiation in the categorization of data. for this reason, the participants were selected from various experiences, ages, certifications, universities, and genders. dependability was obtained by submitting the original data to a theme for the researcher team members and six reviewers. confirm ability was obtained through asking three participants to compare the results of the study with their own experiences. multi - observation was conducted for improving the rigor of the study (17, 18). the current study was part of a doctoral thesis in phd degree of nursing education. the participants were asked to sign consent forms and were informed that they could withdraw from the study at any time. code numbers were placed on the audiotapes or transcripts, which were stored in a locked location. of the 19 faculty members, 10 (56.25%) were female and 9 (43.75%) were male nurses. the occupational statuses of the participants included 15 instructors, three department managers and one educational assistant from seven nursing colleges. content analysis of data from the interviews and field notes generated 275 codes, nine sub - categories, and three categories. during the data analysis, categories related to these main categories were : roles interference ; role ambiguity, and conflicting expectations roles interference was one of the three categories in this research identified by faculty members as a cause of role conflict. faculty members declared that they had many roles that needed to be done simultaneously ; while, there was inappropriate balance between the roles. the participants claimed that according to the job description announced by the mhmei, they have multiple professional roles. furthermore, they had social and family - related roles. in relation to this, for example, nursing care for neurological disorders, nursing care in critical care units and so on. i have two research projects now and i am an educational development office (edo) member too. furthermore, i have multiple family roles such as being a husband, a father, a son and so on. except for the classroom time, universities have not considered certain times to do other roles and instructors had to do different roles in limited times. as a result, the faculty members could not split their roles and had to do multiple roles simultaneously. when a person performs many roles concurrently, the expectations of a role can conflict with other roles, and this condition leads to role conflict. i have limited time to perform my roles, so i have to do all of my roles simultaneously and thus, role interference occurs. except for the class time, we do not have clear time slots for other duties. i do some of my remaining tasks at home ; concurrently, i must do my family - related roles. another participant also said : i have a limited time and i have to play my roles in parallel. i have to do some of my job - related duties at home and at the same time, i have to do my family - related roles. in the last semester (participant 8, female, group manager, 25- experience). unfavorable balance of roles was the last subcategory of this category. hours of clinical courses had been doubled compared to the theoretical courses in nursing educational programs in iran. faculty members who had clinical education had to spend more time for their educational roles. those who had a managerial position had to allocate a lot of time doing administrative tasks too. each clinical credit is 34 - 56 hours, while each theoretical credit is 17 hours. more than half of my credits are clinical education ; thus, i spend a lot of time in the hospital. there is imbalance between my roles and i can not do all of them properly (participant 2, male, 5- experience). this had two sub - categories : ambiguity on job description and decision - making under uncertainty. faculty members mentioned that their job description was ambiguous and they faced with ambiguous roles. the participants stated that the academy expected them to do education, research, executive service, and cultural roles. although, in guidelines it was not clear explained how faculty members must do these roles. in most participants, a manager of group said : i see that some of college policies are unclear. there is a general description about faculty duties, but there is no explanation about quality and required hours for these duties. for example, i want to do research, but the college does not determine specific hours for that. i am the manager of the group, but i have not been dedicated specific time for my managerial roles. decision - making uncertainty was the second subcategory of the role ambiguity category. when job description and authority are not cleared, faculty can not decision certainly, especially when they are in hospitals. occasionally, faculty members saw differences between what they were said in the academy and what clinical nurses did in hospitals. in this situation, they did not know if their decision was correct or not. when i go to hospital with my students, we enter into an organization with its own specific rules. i wanted to support my student, but there was not a clear job description for faculty in hospitals. if i support my student, i possibly create a challenge with the unit personnel. most of the participants expressed conflicting expectation as the main cause of the role conflict. this category included four subcategories : contradictory expectations, different role priorities between instructors and college faculty members had family roles too ; they did not transfer their work to home. on the other hand, faculty members had a heavy workload and they had to use home time to do their duties. furthermore, universities expected the faculty members to complete all their roles with high quality. along with these expectations, faculty wanted to indicate some time for their favorite tasks or resting they expect me to do all of my duties simultaneously immediately, but i have not been given enough time. they do not note my ability (participant 19, male, 8- experience). another participant said : since i have become an educational assistant, my friends in college have had some expectations of me in course planning. on the other hand, we have faculty member shortage and i have to cover all the course plans too. indeed, the role expectations have changed over time. at a time, education was more valuable than other roles, but based on new policies, research is more important for universities. most faculties knew educational and cultural roles as their main roles, while research and publishing articles had more score for upgrading. a group manager said : i think the main aim at the university is preparing students for professional roles as a nurse. in my ideas, teaching and education have the most priority in my roles, but the university managers look for gaining good levels in ranking. i think this is a wrong way and this condition can reduce students professional performance in future the organizational policy is the acceptance of students in msc and phd levels, but i think extreme attention to advanced education can harm the basic levels of nursing education (participant 7, male, group manager, 16- experience). they believed when one of their colleagues did more work load, mangers or students expected all the faculty members to do the same. she accepts all the duties at the college and my group manager expects others to do the same. she does not have responsibility at home, but i have two little children and must take care of them. when an instructor works above normal duties, the managers expectations increases and others must work hard too some of the instructors make a bad model in the college. they do something that is not a job requirement, but that turns to a routine since then (participant 9, female, 15- experience). during the last decades, iranian nursing universities faced with shortage of nursing faculties and their students increased in recent years. faculty must teach 16 credits each term normally, but sometimes this increases to 22 - 23 credits. in addition, they have to teach nonspecific topics and be present in hospital wards in which they have not worked before. occasionally, faculty has no choice for select interesting topics and they go under force. the following statement is one example of the participants claims : we have faculty shortage in the university. we have around 730 nursing students in different levels ; however, we are 21 nursing faculty members. as a result, i had to teach 23 credits last term. my manager said : you must go to the hospital five days a week with 20 students. another participant said : i want to do research on my favorite topics, for example burn patients, but we do not have burn unit in our university hospitals. therefore, i have to research on other topics that i am not interested to roles interference was one of the three categories in this research identified by faculty members as a cause of role conflict. this category had three subcategories : multiple roles, role concurrency, and unfavorable balance of roles. faculty members declared that they had many roles that needed to be done simultaneously ; while, there was inappropriate balance between the roles. multiple roles were the first subcategories of the role interference category. the participants claimed that according to the job description announced by the mhmei, they have multiple professional roles. furthermore, they had social and family - related roles. in relation to this, for example, nursing care for neurological disorders, nursing care in critical care units and so on. i have two research projects now and i am an educational development office (edo) member too. furthermore, i have multiple family roles such as being a husband, a father, a son and so on. as you can see, i have many roles (participant 16, male faculty member, 13- experience). except for the classroom time, universities have not considered certain times to do other roles and instructors had to do different roles in limited times. as a result, the faculty members could not split their roles and had to do multiple roles simultaneously. when a person performs many roles concurrently, the expectations of a role can conflict with other roles, and this condition leads to role conflict. i have limited time to perform my roles, so i have to do all of my roles simultaneously and thus, role interference occurs. except for the class time, we do not have clear time slots for other duties. i do some of my remaining tasks at home ; concurrently, i must do my family - related roles. another participant also said : i have a limited time and i have to play my roles in parallel. i have to do some of my job - related duties at home and at the same time, i have to do my family - related roles. in the last semester, i had 20 educational credits. hours of clinical courses had been doubled compared to the theoretical courses in nursing educational programs in iran. faculty members who had clinical education had to spend more time for their educational roles. those who had a managerial position had to allocate a lot of time doing administrative tasks too. each clinical credit is 34 - 56 hours, while each theoretical credit is 17 hours. more than half of my credits are clinical education ; thus, i spend a lot of time in the hospital. there is imbalance between my roles and i can not do all of them properly this had two sub - categories : ambiguity on job description and decision - making under uncertainty. faculty members mentioned that their job description was ambiguous and they faced with ambiguous roles. the participants stated that the academy expected them to do education, research, executive service, and cultural roles. although, in guidelines it was not clear explained how faculty members must do these roles. in most participants, a manager of group said : i see that some of college policies are unclear. there is a general description about faculty duties, but there is no explanation about quality and required hours for these duties. for example, i want to do research, but the college does not determine specific hours for that. i am the manager of the group, but i have not been dedicated specific time for my managerial roles. when job description and authority are not cleared, faculty can not decision certainly, especially when they are in hospitals. occasionally, faculty members saw differences between what they were said in the academy and what clinical nurses did in hospitals. in this situation, they did not know if their decision was correct or not. a phd participant said : when i go to hospital with my students, we enter into an organization with its own specific rules. i wanted to support my student, but there was not a clear job description for faculty in hospitals. if i support my student, i possibly create a challenge with the unit personnel. most of the participants expressed conflicting expectation as the main cause of the role conflict. this category included four subcategories : contradictory expectations, different role priorities between instructors and college faculty members had family roles too ; they did not transfer their work to home. on the other hand, faculty members had a heavy workload and they had to use home time to do their duties. furthermore, universities expected the faculty members to complete all their roles with high quality. along with these expectations, faculty wanted to indicate some time for their favorite tasks or resting they expect me to do all of my duties simultaneously immediately, but i have not been given enough time. they do not note my ability (participant 19, male, 8- experience). another participant said : since i have become an educational assistant, my friends in college have had some expectations of me in course planning. on the other hand, we have faculty member shortage and i have to cover all the course plans too. indeed, the role expectations have changed over time. at a time, education was more valuable than other roles, but based on new policies, research is more important for universities. most faculties knew educational and cultural roles as their main roles, while research and publishing articles had more score for upgrading. a group manager said : i think the main aim at the university is preparing students for professional roles as a nurse. in my ideas, teaching and education have the most priority in my roles, but the university managers look for gaining good levels in ranking. i think this is a wrong way and this condition can reduce students professional performance in future the organizational policy is the acceptance of students in msc and phd levels, but i think extreme attention to advanced education can harm the basic levels of nursing education they believed when one of their colleagues did more work load, mangers or students expected all the faculty members to do the same. she accepts all the duties at the college and my group manager expects others to do the same. she does not have responsibility at home, but i have two little children and must take care of them. when an instructor works above normal duties, the managers expectations increases and others must work hard too some of the instructors make a bad model in the college. they do something that is not a job requirement, but that turns to a routine since then (participant 9, female, 15- experience). during the last decades, iranian nursing universities faced with shortage of nursing faculties and their students increased in recent years. faculty must teach 16 credits each term normally, but sometimes this increases to 22 - 23 credits. in addition, they have to teach nonspecific topics and be present in hospital wards in which they have not worked before. occasionally, faculty has no choice for select interesting topics and they go under force. the following statement is one example of the participants claims : we have faculty shortage in the university. we have around 730 nursing students in different levels ; however, we are 21 nursing faculty members. as a result my manager said : you must go to the hospital five days a week with 20 students. another participant said : i want to do research on my favorite topics, for example burn patients, but we do not have burn unit in our university hospitals. therefore, i have to research on other topics that i am not interested to (participant 1, male, 3- experience). this qualitative study provided an important understanding of the experience of role conflict among nursing faculty members in iran. this qualitative study showed that nursing faculty members experienced role conflict when they worked in conflict climate. working in conflict climate as the main theme in this study developed with role interference, role ambiguity and conflicting expectations. roles interference was one of the factors that affected the emergence of role conflict among faculty members. role interference arises when a person with multiple roles has to do the roles simultaneously. sometimes, the demands inherent to those roles are in opposition with each other (19, 20). multiple roles were one of the subcategories of this category. based on the faculty job description (8), faculty members have multiple roles, including teaching, education, research, and executive services. according to settles study (21), most adults have multiple roles and group memberships and this can produce interference and conflict. the results of this study showed that faculty members performed their roles concurrently which led to roles interference. several findings from this study are consistent with those from previous research (6). the unfavorable balance of roles concept was extracted from the data to reflect the difficulties associated. it seems that with the difference between theoretical and practical credits on one side and the inappropriate division of credits between faculty members on another side, the unfavorable balance of roles can be developed. a job description is a list that a person might use for general tasks or functions and responsibility of a position. it may often include to whom the position is reported, specifications such as the qualification or skills needed by the person in the job. we explored that the participants in this study did not have adequate necessary information to complete the required duties. specht (2) reported that nurses transitioning into academe who did not receive direction and guidance experienced role strain, or more specifically role conflict and role ambiguity. these findings are similar to those reported in other studies (2, 11). we found that the participant faced with uncertainly in decision making, especially in clinical environments. in this situation, the person knows the correct action, but the limitations due to either ambiguity in job description or inappropriate authority lead to decision making uncertainly. atashzadeh shorideh. reported (22) that where one doubted to do the right action, conflict was developed. other studies reported that uncertainly in decision - making, role ambiguity and role conflict occurred for the person (5, 11). finally, conflicting expectations was the last category of this study. the faculty members faced with many varied expectations in their institute as well as in their family environments. when two roles have paradoxical expectations and an individual has to be responsible for incongruent expectations, role conflict may be involved. the participants said that they had several roles at the same time as a worker and family member. duties expected from him at home might have to be put on hold if work is demanding more of his time. in addition, when there are differences in role priority, separation between personal and organizational goals develop. the faculty members believed that their main roles was education and other roles had less priority. study (5). in another study the nurses experienced ethical conflict due to a disparity between their own and the organizational expectations (24). most of the categories that emerged in this study were similar to other studies in the world, but some of them such as unfavorable balance of roles, inappropriate modeling, and force in role playing were not seen in other available studies. perhaps the culture and organizational climate in iran are the reasons for such categories and themes. role conflict is defined as a conflict among the roles corresponding to two or more statuses. role conflict is experienced when we find ourselves pulled in various directions, as we try to respond to the many statuses we hold. role conflict is considered a serious problem for them and causes dissatisfaction (25). understanding the factors that can lead to role conflict could decrease role conflict complications, increase satisfaction and retention, and ultimately lead to a decrease in the shortage of both faculty members and nurses. role conflict affects relationships between faculty members and nursing students and it can affect the quantity and quality of nursing education too. nursing faculty members who experience role conflict may lose their professional performance and fail to provide the best educational situation for their students. they must also design strategies to reduce conflict - causing conditions, improve decision - making strategies, and try to diminish role conflict factors. first, it was conducted in nursing colleges and the findings can not be generalized beyond other faculty members. second, our findings may not apply to islamic azad university, due to difference between policies. we suggest that such qualitative research be conducted in other colleges, islamic azad university, and with other faculty members in iran. understanding the nature and the causes of conflict in them can play an important role in the prediction and prevention of adverse effects in universities. this will help them to apply better strategies for solving role conflict challenges in their institutes. | background : few studies have been conducted on role conflict in nursing faculty in the world. this research reports the first study about this subject in iran.objectives:the purpose of this research was to explore the experiences of role conflict in iranian nursing faculty members.materials and methods : we conducted a qualitative study using a conventional content analysis approach. we used semi - structured and in - depth interviews by purposive sampling of 19 (15 instructors, three group managers and one educational assistant) participants to identify the influential factors of role conflict among nurse faculty members, working in seven nursing colleges in iran.results:the three following categories emerged from data analysis : roles interference ; role ambiguity, and conflicting expectations. the main theme was working in conflict climate.conclusions:this study highlighted the influential factors that could produce role conflict for nursing faculty members. the results can help university leaders to improve nursing faculty working conditions. |
since rasmussen, it has been known that the organ the corti receives efferent innervations from olivocochlear neurons. the medial olivocochlear system (moc) has mainly contralateral connections with the outer hair cells (ohc). the majority of the information on the moc system comes from electrical stimulation in animals. rajan and johnstone have shown that contralateral acoustic stimulation (cas) generates similar effects as those of the electrical stimulation, at the floor of the fourth ventricle. the oae responses have been used extensively as a probing tool in the assessment of the cochlear function [510 ]. they can be categorized by the invoking stimulus in 2 classes the evoked and the spontaneous oaes. a sub - category of the first class is called distortion product oaes (dpoaes) and refers to cochlear responses evoked by 2 pure tones f1 and f2. to obtain a dpoae response, one can either vary the amplitude of the stimulus at a fixed frequency (input - output i / o- function) or fix the amplitude and vary the frequency (dp - gram). the i / o function provides information about the hearing threshold and the associated nonlinear oae behavior. in the analysis of dpoae i / o functions, a number of variables are of critical importance, including : (i) the dpoae amplitude ; (ii) the dpoae slope ; and (iii) the dpoae threshold. the latter is used in the estimation of the hearing threshold the slope value decreases at higher stimulus intensities, especially in the range from 50 to 80 db pespl, where the cochlear compression occurs. cochlear compression decreases with the increased severity of cochlear lesions, so the dpoae slope can represent a variable with high specificity and low sensitivity. studied dpoae i / o functions in pigmented guinea pigs with induced middle and inner ear alterations and reported that animals exposed to noise presented steeper dpoae slopes, suggesting a loss of cochlear compression. animals characterized by middle ear alterations did not show any changes in the dpoae slope values. in this context, the authors suggested that the dpoae i / o functions and the value of the i / o slope could be useful indices in distinguishing conductive from sensorial hearing loss. in humans, when the moc pathway is activated by noise in the contralateral ear, changes in the dpoae amplitude level can be recorded in the ipsilateral ear. the broad - band - noise and the white noise are frequently used as contralateral acoustic stimuli. moulin. found that contralateral broad - band noise (bbn) has a suppressive effect on dpoaes recorded from 0.5 khz to 5 khz. this effect was not caused by cross - hearing due to the usage of earphones and no change in the noise floor occurred under increasing contralateral stimulation. deeter. also studied the contralateral stimulation with bbn levels of 60, 70 and 80 db spl in adults. the contralateral stimulation reduced the amplitudes of the dpoaes and the suppression effects were more pronounced as the level of the contralateral noise increased.. found that contralateral stimulation with white noise resulted in a significant suppression of teoaes amplitudes in healthy controls. quantitatively, bassim. concluded that after contralateral stimulation with a bbn of 60 db spl, the average dpoae suppression was 1.1 db (0.32.7 db). atcherson. affirmed that, in general, the broader the bandwidth of the noise stimulation, the greater the suppressive effect. harrison. suggested that otoacoustic emissions (dpoaes) can be both enhanced and suppressed. dpoae amplitude is suppressed by an increase in contralateral stimulation and enhanced by a decrease in the cas. concluded that the suppression is frequency - dependent, at least for the middle frequencies of 1 and 2 khz. sun confirmed these findings, reporting that, at the middle frequency peaks the suppression effect on dpoaes was larger. similarly, ibargen., reported that white noise and pure - tones at 1, 1.5, and 2 khz had the greatest suppressor effects on the teoae amplitude with suppression effects varying from 0.5 to 2.5 db. the data in the literature suggest that contralateral acoustic stimulation alters the dp - gram amplitudes of neonatal subjects [9,1821,27 ], but it is still unknown whether the dpoae i / o functions are also altered. if an inhibitory efferent effect significantly reduces the dpoae amplitude, it should also affect (partially or fully) the dpoae i / o parameters such as the amplitude and the slope. to elucidate this hypothesis the present study assessed the effects of contralateral acoustic stimulation on dpoae input / output functions in a sample of term neonatal subjects. sixty randomly selected term neonates (32 males and 28 females) from the hospital of ferrara university participated in the study. the inclusion criteria were : (i) an age between 36 and 60 hours ; (ii) lack of any risk indicators associated with permanent congenital or progressive hearing loss (jcih, 2007) ; (iii) teoaes (elicited by nonlinear clicks of 803db spl) with an overall reproducibility level of at least 75% and a signal - to - noise ratio at 2, 3 and 4 khz exceeding 6 db. the dpoae data were recorded with an ilo-292 apparatus (version 5.6, ilodynamics) and dpoae i / o functions were obtained only at 2 khz and 4 khz, in the presence of a 60 db spl broad band - contralateral white noise, contralaterally using the tdh39 headphones. the study s initial design intended the evaluation of more frequency points, but difficulties in obtaining valid responses at 1 or 1.5 khz made us restrict testing to 2 frequency points. noise was generated by a dedicated software program (tone gen, nch software). the levels of noise were calibrated with a bruel and kjaer impulse precision sound level meter type 2209, coupled with a 1-inch condenser microphone type 4145 for free field use. the latter has a normal incidence free field response, which is linear from 1 to 2 khz (3 db), 218 khz (1.5 db) and meets the requirement of the ansi (american national standards institute) for a laboratory standard type l microphone. responses were acquired at stimulus intensities between 35 and 70 db pespl, at 2 and 4 khz. each response was an average of 8 responses (higher averages would excessively prolong the test sequence). the stimulus paradigm proposed by kummer was used, in which the primary tone stimulus was set to l1=(0.4 l2) + 39 db pespl. the dpoae slope values were estimated from 2 sets of data : (i) from all tested stimulus intensities, measuring the inclination of the dpoae response - growth from 35 to 70 db pespl ; (ii) from a sub - set of data referring to l2 levels between 40 and 60 db pespl. linear trend modeling was used for fitting the data with linear functions and subsequent estimation of the dpoae i / o slopes (see the appendix for additional details). all test procedures were explained to the parents of the subjects, who provided written informed consent. sixty randomly selected term neonates (32 males and 28 females) from the hospital of ferrara university participated in the study. the inclusion criteria were : (i) an age between 36 and 60 hours ; (ii) lack of any risk indicators associated with permanent congenital or progressive hearing loss (jcih, 2007) ; (iii) teoaes (elicited by nonlinear clicks of 803db spl) with an overall reproducibility level of at least 75% and a signal - to - noise ratio at 2, 3 and 4 khz exceeding 6 db. the dpoae data were recorded with an ilo-292 apparatus (version 5.6, ilodynamics) and dpoae i / o functions were obtained only at 2 khz and 4 khz, in the presence of a 60 db spl broad band - contralateral white noise, contralaterally using the tdh39 headphones. the study s initial design intended the evaluation of more frequency points, but difficulties in obtaining valid responses at 1 or 1.5 khz made us restrict testing to 2 frequency points. noise was generated by a dedicated software program (tone gen, nch software). the levels of noise were calibrated with a bruel and kjaer impulse precision sound level meter type 2209, coupled with a 1-inch condenser microphone type 4145 for free field use. the latter has a normal incidence free field response, which is linear from 1 to 2 khz (3 db), 218 khz (1.5 db) and meets the requirement of the ansi (american national standards institute) for a laboratory standard type l microphone. responses were acquired at stimulus intensities between 35 and 70 db pespl, at 2 and 4 khz. each response was an average of 8 responses (higher averages would excessively prolong the test sequence). the stimulus paradigm proposed by kummer was used, in which the primary tone stimulus was set to l1=(0.4 l2) + 39 db pespl. the dpoae slope values were estimated from 2 sets of data : (i) from all tested stimulus intensities, measuring the inclination of the dpoae response - growth from 35 to 70 db pespl ; (ii) from a sub - set of data referring to l2 levels between 40 and 60 db pespl. linear trend modeling was used for fitting the data with linear functions and subsequent estimation of the dpoae i / o slopes (see the appendix for additional details). all test procedures were explained to the parents of the subjects, who provided written informed consent. anova analyses were performed to compare the values of the dpoae slopes. values of p 0.05 were considered statistically significant. in the first phase of the analyses all data from all stimulus levels (ie, 3570 db pespl) were included. the dpoae responses were considered as valid when the corresponding s / n ratio 0 db. this criterion is low for high - level dpoae responses (ie, 6555 db spl), but it is adequate for responses elicited by low - level stimuli (40 db). one way to control the validity of this criterion is to consider that, theoretically, the amplitudes of the dpoae i / o functions decrease in a monotonic manner from higher to lower eliciting stimuli. in this context, physiological processes should generate responses that decrease in amplitude according to the eliciting stimulus. since no cases were observed with low s / n values at higher stimuli and with correspondingly higher s / n values at lower stimuli, the chosen criterion was considered appropriate. the amplitudes of the dpoae i / o functions were altered after contralateral acoustic stimulation at all l2 levels and in both 2 and 4 khz tested frequencies. the mean suppression was 1.74 db (sd=0.67) and 1.87 db (sd=0.67) at 2 and 4 khz, respectively. significant suppression was observed only at a few stimulus levels. specifically at 2 khz, the dpoae responses elicited by a l2=50 db pespl stimulus presented significant suppression (p=0.034). similarly, at 4 khz the suppression was significant at l2=50 and 60 db pespl. subjects who did not present an s / n 3 db at l2=60 db pespl were excluded. forty - five cases presented s / ns 3 db spl at 2 khz and 46 at 4 khz. at 2 khz, suppression effects were observed at l2=35, 50, 55, 60 and 70 db pespl. at 4 khz, suppression effects were observed at all l2 stimulus levels from 5070 db pespl. for this frequency, suppression effects were also observed at lower l2 levels (3545 db spl), but were not significant. the analyses were conducted on 2 datasets. in the first set, all dpoae amplitude data were included (l2=3570 db pespl), using an s / n 0 db response criterion. in the second dataset only data from stimulus levels l2=4060 db pespl were included, using an s / n 3 db response criterion. in the first set, the slope of the dpoae i / o function presented means of 2.84 and 2.79 at 2 khz and 2.84 and 2.21 khz at 4 khz, without and with cas, respectively. after contralateral acoustic stimulation, the slopes became slightly flatter, but the induced alteration was not significant either at 2 or at 4 khz (p=0.83 and 0.37, respectively). in the second set, the slope of the dpoae i / o function presented means of 2.99 and 2.36 at 2 khz and 3.63 and 2.46 at 4 khz, without and with cas, respectively. the suppression effect on the dpoae slopes was higher than in the first group, but the estimated differences were not statistically significant (p=0.16 and 0.28). the objective of this study was to investigate the possible alteration of the dpoae i / o parameters in term neonates, after a 60 db spl contralateral acoustic stimulation. from the available test frequencies, data were assessed only at 2 and 4 khz, because the dpoae responses at the lower frequencies (11.5 khz) presented very poor s / n ratios even at moderate to high stimuli (5060 db pespl). significant suppression effects were observed at various l2 stimulus levels for both 2 and 4 khz, but the corresponding dpoae slope values did not show significant alterations. the suppression of the dpoae amplitudes after cas, observed in this study, corroborate the data presented previously by other authors. studied the suppression with narrow band noise and concluded that the cas was frequency - specific. evaluated the cas in dp - grams with narrow band noise (nbn) at 60 db spl and found that the average suppression was 1.1 db (range of 0.32.7). zhang. affirmed the importance of dpoae for the evaluation of the efferent system, but the observed suppression was approximately 0.92db (sd=0.71). the average suppression at 2 and 4 khz was 1.74 and 1.87 db (sd=0.67 and 0.67), respectively, and significant suppression effects were restricted to moderate - to - high l2 stimuli (50 and 60 db pespl). when the available data were filtered with a 3 db criterion, broader suppression effects were observed at both tested frequencies. the different suppression patterns observed in the 2 sets of data (all cases and those exceeding the s / n 3 db criterion) provide the grounds to assume that the detectability of suppression depends on the s / n of the dpoae responses. thus, different acquisition parameters (averages per sample, level of ambient noise) might be necessary for this type of dpoae recording, rather than those established in various hearing screening studies. the data show that contralateral acoustic stimulation does not significantly modify the slope of the dpoae i / o functions. data from previous studies [3234 ] on adults with normal hearing or with varieties of hearing pathologies are available, but a direct comparison with the present data is not reliable. for example, abdala. evaluated 4 subjects with auditory neuropathy and found that they lacked efferent suppression of oaes. wang and zhong studied the medial olivocochlear system (mocs) by the cas in individuals with cochlear and retrocochlear hearing loss. while the cas effect was less frequently present in individuals with cochlear hearing loss, the individuals with retrocochlear hearing impairment presented no suppression, and in some cases they presented increased dpoae amplitudes. interestingly, abdala, in a study of the suppression of the dp - gram amplitude and tuning curves on premature newborns, reported no dpoae suppression. the influence of the immature conductive pathways can not be entirely ruled out as a factor contributing to these results. the data from the present study show that in term neonates cas significantly affects only the amplitude of the dpoae i / o functions these findings can shred light on the nature of cas, suggesting that it might be primarily a linear phenomenon, deprived of the cochlear compression and non - linear components seen in the healthy cochlea. from the available data it is not possible to conclude whether the sample size influenced the obtained results, and the study should be replicated with a larger sample size and assessing a larger number of frequency points. | summarybackgroundthe literature suggests that contralateral acoustic stimulation (cas) alters the amplitude of the distortion product otoacoustic emissions (dpoaes), but it is still unknown whether the dpoae input / output (i / o) functions are also affected. to elucidate this aspect of the dpoaes, the present study assessed the effects of cas on dpoae i / o functions at the frequencies of 2 khz and 4 khz, in a sample of term neonatal subjects.material/methodssixty randomly selected neonates were included in the study. the dpoae i / o functions were obtained at 2 khz and 4 khz, in the presence of a 60 db spl broad band - contralateral white noise, using the tdh39 headphones contralaterally. dpoaes were recorded up to a stimulus level of l2=35 db pespl.resultssignificant dpoae amplitude suppression effects were observed at various l2 stimulus levels for both tested frequencies at 2 and 4 khz. in contrast, the corresponding dpoae slopes showed various alterations that were not statistically significant.conclusionsthe data from the present study show that contralateral acoustic stimulation significantly affects only the amplitude of the dpoae i / o functions ; the slope is affected, but not significantly. this observation can shed light on the nature of cas, suggesting that the latter is primarily a linear phenomenon without the cochlear compression and non - linear components seen in the healthy cochlea. from the available data it is not possible to infer whether the sample size has influenced the obtained results and the study should be repeated with a larger sample size and assessing more frequencies. |
alzheimer 's disease (ad) is a progressive neurodegenerative disease characterized by accruing cognitive and noncognitive deficits. among the latter, aberrant motor behavior with either overall slowing or hyperactivity, and depression are common symptoms [15 ]. in patients with ad, presence of apathy as indicated by decreased motor activity and decreased agitation / hyperactivity as indicated by increased motor activity is associated with faster functional and cognitive decline [57 ]. levels of dopamine, noradrenaline, and serotonin are decreased in patients with ad [811 ]. in animal models of ad, dopamine, noradrenaline, and serotonin all bupropion is a monoamine reuptake inhibitor selective for dopaminergic and to a lesser extent noradrenergic neurotransmission but has no effect on serotonergic neurotransmission. bupropion improved visual memory in patients with major depressive disorder. in rodent animal models, bupropion significantly decreased the duration of immobility on the forced swim test and increased locomotor activity in freely moving animals. citalopram is a potent selective inhibitor of serotonin reuptake and increases extracellular serotonin concentrations in the hippocampus of rats but has no effect on the uptake of noradrenaline and dopamine. citalopram was recently reported to improve spatial memory in rats and to decrease immobility time in the forced swim test. a standard paradigm for the assessment of cognition in animal research is the investigation of spatial learning in water and dry - land mazes [2325 ]. while early work on spatial orientation in rodents was performed in complex dry - land mazes, since the mid 1980s complex spatial tasks predominantly are assessed in water mazes. hence, water maze learning likely not only assesses cognitive processes of spatial memory but is confounded by noncognitive components such as anxiety. it was the goal of the present study to assess whether common substances used for treatment of depression in humans affect spatial learning in a transgenic animal model of ad. three groups of 4.5-month - old male app23 mice (charles river) and one group of same aged male wild - type mice were used in this study. three or four animals were housed in a cage and were maintained on a 12 h light / dark cycle in a temperature (22 2c) and humidity (55 5%) controlled room similar to previous protocols [23, 27, 28 ]. injection of bupropion (20 mg / kg body weight), another with citalopram (10 mg / kg body weight), respectively, starting fourteen days prior to onset of experiments. one group of app23 mice and wild - type mice were nacl - sham treated with the same protocol. to assess spatial memory, we used a complex maze that has been described previously (figure 1). starting on the date of the last treatment, animals were trained four times a day for three consecutive days and two times on the fourth day. they had a maximum time of 300 s to find the exit, where they were rewarded with a food pellet. different parameters, for example, duration, moving and resting time were recorded by a tracking system (multitrack, accuscan, usa). all statistical analyses were carried out using the statistics program spss (spss 17.0 for windows, spss inc. both wild - type and app23 animals improved their performance during repeated exposure to the dry - land maze as shown by a significant effect of trial on total time (two - way anova ; f 13,154 = 6.751, p < 0.001), resting time (two - way anova ; f 13,154 = 5.042, p < 0.001), and moving time (two - way anova ; f 13,154 = 9.157, p < 0.001). both groups increased their running speed over all trials (two - way anova ; f 13,154 = 11.577, p < 0.001) with wild - type animals more so than app23 animals (two - way anova ; f 1,154 = 28.676, p < 0.001) (figure 2(a)). to catch the efficacy of spatial learning, both wild - type and app23 animals improved their performance during repeated exposure to the dry - land maze as shown by a significant effect of trial on distance (two - way anova ; f 13,154 = 4.942, p < 0.001) (figure 2(b)). path length was shorter for wild - type animals than for app23 animals (two - way anova ; f 1,154 = 37,767, p < 0.001). to assess the effect of treating app23 animals, we performed a two - way anova with treatment groups sham treatment, bupropion treatment, and citalopram - treatment. there was a significant effect of treatment group on total time (f 2,224 = 12.794, p < 0.001) with fisher lsd multiple comparison testing indicating significant differences (table 1, figure 3). likewise, a significant effect of treatment group was found on resting time (f 2,224 = 18.103, p < 0.001) with fisher lsd multiple comparison testing indicating significant differences for treatment with bupropion but not for citalopram treatment (table 1, figure 3). contrary, no overall effect of treatment was found on moving time (f 2,224 = 2.224, p = 0.111 ; table 1, figure 3). analysis of running speed featured significant treatment differences (f 2,224 = 17.507, p < 0.001) with fisher lsd multiple comparison testing showing that bupropion - treated animals run faster while citalopram - treated animals run with less speed than sham - treated animals (table 2, figure 4(a)). further there was no significant effect of treatment group on distance (f 2,224 = 0.124, p = 0.883) (table 2, figure 4(b)). maze studies are an established means to investigate spatial learning in experimental animals, both in water mazes and dry - land mazes. compared to wild - type animals, the total, moving, and resting time to find the goal zone were decreased in app23 transgenic animals and the running speed was increased. however, path length was also shorter in wild - type than app23 animals. we conclude that the difference between wild - type and app23 animals reflects both, better spatial learning and higher psychomotor activity. this is in good harmony with previous studies showing diminished learning in middle - aged app23 animals [29, 30 ]. reduced running speed in app23 is in good harmony with a previous study with reduced psychomotor activity in another transgenic mouse model of ad, the app / ps1 transgenic model. citalopram has been used in dosages from 0.01 mg / kg to 8 mg / kg. the effects on spatial cognition remain ambiguous and depend on dosage, paradigm, species, and the interaction thereof. at low dosages, citalopram did not affect spatial learning or even improved it but had negative effects in dosages higher than 4 mg / kg in rats. at moderate dosages of about 5 mg / kg, citalopram decreased immobility time in the forced swim test. to our knowledge, the present study is the first to address the effects of citalopram on spatial learning in a transgenic mouse model of ad. in this model, high dosages of citalopram did not change path length, total, moving, or resting time, while running speed was slightly decreased. we interpret this such as to indicate that spatial learning per se is unaffected but that psychomotor activity is slightly decreased. this is in good harmony with previous reports showing either a slight decrease of psychomotor activity on administration of comparable dosages of citalopram or unchanged locomotor activity. at least in clinical studies, no benefit on cognition was found on treating ad patients with citalopram [35, 36 ]. on treatment of app23 animals with bupropion, resting time decreased and running speed increased while length of path and moving time remained unchanged. we interpret this finding such as to indicate that bupropion does not improve spatial learning per se but that it increases psychomotor activity. this is in good harmony with a previous study in mice showing an increased locomotor activity in dosages from 1 mg / kg to 20 mg / kg. altogether, bupropion and citalopram differentially affect psychomotor activity in the app23 transgenic mouse model of ad while spatial learning per se is unaffected. | background. incipient alzheimer 's disease is often disguised as depressive disorder. over the course of ad, depressive symptoms are even more frequent. hence, treatment with antidepressants is common in ad. it was the goal of the present study to assess whether two common antidepressants with different mechanisms of action affect spatial learning in a transgenic animal model of alzheimer 's disease. methods. we assessed spatial memory of male wild - type and b6c3-tg(appswe, psen1de9)85dbo (app23) transgenic animals in a complex dry - land maze. animals were treated with citalopram (10 mg / kg) and bupropion (20 mg / kg). results. moving and resting time until finding the goal zone decreased in 4.5-month - old sham - treated wild - type animals and, to a lesser extent, in app23 animals. compared with sham - treated app23 animals, treatment with bupropion reduced resting time and increased speed. on treatment with citalopram, moving and resting time were unchanged but speed decreased. length of the path to the goal zone did not change on either bupropion or citalopram. conclusion. bupropion increases psychomotor activity in app23 transgenic animals, while citalopram slightly reduces psychomotor activity. spatial learning per se is unaffected by treatment with either bupropion or citalopram. |
during the first half of the 20th century, the evidence lor the therapeutic efficacy of new drugs, in particular anti - infectious drugs, was often so obvious that the naturalistic observations of therapeutic successes in treated patients were sufficient to demonstrate efficacy. however, soon the demonstration of the therapeutic efficacy of new drugs became less obvious, and the need to implement a methodology to demonstrate efficacy appeared necessary. the demonstration of drug efficacyis essentially a comparative exercise in which a new drug is evaluated versus a comparator, a placebo, or a reference active drug. the clinical efficacy of a treatment is assessed by clinical trials, the methodology of which has been developed and perfected since the early experiments of sir austin bradford hill in the 1950s ; the cornerstone ol clinical trials is the randomization process which ensures that groups ol patients receiving the different treatments are similar. from a statistical viewpoint, the demonstration of efficacy is based on the rejection of the null hypothesis, ie, that there is no difference between the experimental and the comparator treatments. several clinical trial designs are used during drug development and generally a couple of randomized controlled trials should provide a demonstration of the statistically significant superiority of the experimental treatment over the comparator. for example, the us food and drug administration (fda) requires at least two phase iii pivotal trials with positive results to allow registration of a new drug. regulatory authorities such as the european committee for medicinal product for human use (chmp) from the european medicines agency (ema) regularly publish guidelines on how to evaluate and demonstrate the efficacy and safety of drugs in different therapeutic indications, for example more than 20 chmp guidelines set the framework for clinical development and clinical trial methodology lor neuropsychiatrie drugs in europe.. the establishment ol efficacy is achieved at the end of phase iii, when the results of the pivotal trials which are key to support the registration process are available. the efficacy conclusion for a given indication will not be modified after this stage, although replication of therapeutic efficacy studies sometimes leads to disappointing results in comparison with those from the pivotal trials. any new observation of efficacy in subgroups of patients by serendipity will need to be confirmed by randomized evidence obtained in phase illb trials, in order to obtain an extension of the indication on the drug label. in the perspective of drug efficacy demonstration, the naturalistic studies represent a weaker design in terms of clinical and statistical quality and power. although a comparison between an active treatment and a comparator can still be done in a naturalistic setting, such a setting does not permit control for all sources of bias in the estimation of efficacy because of the absence of randomization. the randomized evidence is the support lor demonstrating the benefits expected in bra for the majority of drugs. there are rare exceptions to this rule, either due to the scarcity of cases or the terminal stage of an incurable illness, or because of an imminent medical threat to the population due to infectious agents, which could justify omitting proper clinical trials. in cases of threat of a pandemic infectious disease, it could be necessary to market drugs or vaccines despite limited information from randomized clinical trials ; in such cases, there would also be little to no information based on naturalistic observations, and the decisions to administer the therapy in an emergency would be based on surrogate outcomes. another situation where naturalistic observations might influence the bra would be when the efficacy of a drug, as demonstrated in randomized clinical trials, did not seem to be maintained in the clinical setting ; for example, the clinical benefit irom psychotropic drugs seems to have declined over the last decades. the evaluation ol the safety profile of a drug is more complex than the demonstration of its efficacy. clinical trials are designed and powered to demonstrate the efficacy of the drug ; although a lot of safety information is collected during randomized trials, this information covers essentially frequent adrs, or more exactly the frequent adverse events rather than drug reactions (as the causal relationship between events and the taking of the drug is not yet established). a minority of trials are designed specifically for the assessment of safety, such as trials which assess ecg changes due to drugs expected to affect cardiac electrical conduction. indeed, the clinical development is limited in terms of patient exposure and duration of exposure : only a few thousand patients receive the drug during the clinical development, most ol these during a relatively short period. common adrs can be identified during the clinical development, but rare reactions, with frequency less than 0.1%, are generally not identified. it will require the exposure of 10 000 patients or more in order to detect rare serious adrs. the randomized controlled trials performed during phases i to iii do not have the power to properly assess the full safety profile of a drug, and the safety profile of the drug and its bra established at the time of registration remain limited by this difficulty to capture rare or / and delayed adr. during the post - registration period, however, the rarity of spontaneous declarations by prescribers and the complexity of assessing the causality of adverse events lead to the idea that pharmacovigilance is insufficient to fully characterize the bra during the post - marketing period. this can be complemented by pharmacoepidemiology studies such as observational cohort studies, also called post - approval safety studies in europe, where patients are prescribed the drug of interest on purely medical grounds, without any randomization. the pharmacovigilance surveillance and the observational pharmacoepidemiology studies offer a naturalistic observational setting which is essential to build the more comprehensive safety profile post - registration and to confirm the preregistration bra ; the naturalistic setting plays a critical role lor marketed drugs. there is a growing interest in quantitative estimates of the bra, and we review several quantitative and semi - quantitative methods developed with this goal. each of these methods presents advantages and limitations, meaning that so far none has received unanimous approval nor is systematically used by regulatory authorities or by pharmaceutical industries. the methods presented provide an average bra for a population of patients, ie, they are not intended for a benefit - risk estimation in individual patients. number needed to treat (nnt) and number needed to harm (nnh) are simple methods which are useful for assessing the bra in a single clinical trial. the nnt is the number of patients who need to be treated with the drug in order to achieve one more occurrence of efficacious treatment of the disease targeted by the drug. it is not an absolute value - the nnt depends on the conditions compared : experimental drug versus no treatment, or a more or less efficacious alternative. hie nnh means the number of patients who need to be treated before one more patient will experience an adr. the nnh : nnt ratio is a simple tool to measure the increase in the number ol therapeutic successes achieved for each additional adr incurred from using the drug of interest rather than the reference treatment ; it is a simple tool to assess the benefit : risk ratio. if nnilnnt is greater than 1, fewer patients need to be treated to observe a benefit from the drug than to have one additional occurrence of an adr ; in other words the bra is positive, at least numerically. this metric is widely used by clinicians as well as reimbursement agencies or health insurances because of the simplicity of the concept and its easy calculation. indeed, a therapeutic success of a drug can have a low clinical impact, for example the decrease of the intensity of symptoms, whereas an adr can be severe. therefore, simply counting the chance of one success versus the risk of one adr is simplistic. in addition, the risk profile of a drug concerns several different adrs, and such complexity is difficult to summarize by just one single nnh value. in an attempt to account for the differences in the safetyprofile, it is possible to take into account the patient utility value ol the outcome, ie, to consider patients ' preference and quantify the preference lor avoiding the disease ol interest or a specific adr. quality - adjusted time without symptoms and toxicity is a method where the time lost due to an adr is subtracted from the time gained from the treatment. in this calculation, one can also use quality - adjusted life years (qalys), a measure of both the quality and the quantity of life. benefit is measured by drug - attributed gain in qalys, and the cumulative risks and disease progression are calculated to obtain drug - attributed loss of qalys. this approach allows direct comparison of the gain (benefit) with the loss (risk) into a single metrics. for an individual patient, this estimation can be valid, but for a population of patients the attribution of the value of a year of life gained or lost is more difficult, as individual opinions diverge about this value. a somewhat similar approach is the incremental net health benefit (inhb), where the method described above is used in a comparative manner between two drugs. multi - criteria decision analysis (mcda) is a tool to support decision - making where several benefits and risks can be taken into account. this method had been developed initially to support decision - making in the domains of business and administration. in drug - related mcda, several risks measured by adr, treatment discontinuations, drug / drug or drug / disease interactions can be considered, while several benefits can be represented, such as biochemical or clinical efficacy end points and quality of life end points. the method is based on hierarchical decision trees that include defined options with different probabilities of occurrence. diffrent expected performance scores are obtained, and the different weighted scores for each option can be calculated. this approach is promising as it identifies which areas (risks or benefits) are more influential and need more scrutiny, allowing a more explicit decision process. however, the model can be quite complex and statistically tricky, and the assigned weights can bring bias of subjectivity into the model. a rectangle is formed by multiplying the strength of the benefit (such as the magnitude of the positive efficacyresponse) by the response rate. the rectangle is then multiplied by the dimension (quantification) of evidence to form a tridimensional efficacy cuboid. for a given adr, severity, frequency, and strength of evidence the positive benefit : risk ratio is demonstrated when the volume of the cuboid for benefits outbalances the sum of all cuboids for the different adrs. however, if the concept is theoretically interesting, there is no practical way of comparing the benefit and risk cuboids, and it is not certain that the volume represented by the sum of adrs can be geometrically compared with a volume measuring the benefit of a drug. the methods mentioned above, despite their complexity, still do not allow determination, in a simple way, of the relative importance of the benefits and the risks of a given drug in a specific indication. number needed to treat (nnt) and number needed to harm (nnh) are simple methods which are useful for assessing the bra in a single clinical trial. the nnt is the number of patients who need to be treated with the drug in order to achieve one more occurrence of efficacious treatment of the disease targeted by the drug. it is not an absolute value - the nnt depends on the conditions compared : experimental drug versus no treatment, or a more or less efficacious alternative. hie nnh means the number of patients who need to be treated before one more patient will experience an adr. the nnh : nnt ratio is a simple tool to measure the increase in the number ol therapeutic successes achieved for each additional adr incurred from using the drug of interest rather than the reference treatment ; it is a simple tool to assess the benefit : risk ratio. if nnilnnt is greater than 1, fewer patients need to be treated to observe a benefit from the drug than to have one additional occurrence of an adr ; in other words the bra is positive, at least numerically. this metric is widely used by clinicians as well as reimbursement agencies or health insurances because of the simplicity of the concept and its easy calculation. indeed, a therapeutic success of a drug can have a low clinical impact, for example the decrease of the intensity of symptoms, whereas an adr can be severe. therefore, simply counting the chance of one success versus the risk of one adr is simplistic. in addition, the risk profile of a drug concerns several different adrs, and such complexity is difficult to summarize by just one single nnh value. in an attempt to account for the differences in the safetyprofile, it is possible to take into account the patient utility value ol the outcome, ie, to consider patients ' preference and quantify the preference lor avoiding the disease ol interest or a specific adr. quality - adjusted time without symptoms and toxicity is a method where the time lost due to an adr is subtracted from the time gained from the treatment. in this calculation, one can also use quality - adjusted life years (qalys), a measure of both the quality and the quantity of life. benefit is measured by drug - attributed gain in qalys, and the cumulative risks and disease progression are calculated to obtain drug - attributed loss of qalys. this approach allows direct comparison of the gain (benefit) with the loss (risk) into a single metrics. for an individual patient, this estimation can be valid, but for a population of patients the attribution of the value of a year of life gained or lost is more difficult, as individual opinions diverge about this value. a somewhat similar approach is the incremental net health benefit (inhb), where the method described above is used in a comparative manner between two drugs. multi - criteria decision analysis (mcda) is a tool to support decision - making where several benefits and risks can be taken into account. this method had been developed initially to support decision - making in the domains of business and administration. in drug - related mcda, several risks measured by adr, treatment discontinuations, drug / drug or drug / disease interactions can be considered, while several benefits can be represented, such as biochemical or clinical efficacy end points and quality of life end points. the method is based on hierarchical decision trees that include defined options with different probabilities of occurrence. diffrent expected performance scores are obtained, and the different weighted scores for each option can be calculated. uncertainty parameters and sensitivity analyses can also be computed in mcda. this approach is promising as it identifies which areas (risks or benefits) are more influential and need more scrutiny, allowing a more explicit decision process. however, the model can be quite complex and statistically tricky, and the assigned weights can bring bias of subjectivity into the model. other approaches have been proposed. in one of these, a rectangle is formed by multiplying the strength of the benefit (such as the magnitude of the positive efficacyresponse) by the response rate. the rectangle is then multiplied by the dimension (quantification) of evidence to form a tridimensional efficacy cuboid. for a given adr, severity, frequency, and strength of evidence the positive benefit : risk ratio is demonstrated when the volume of the cuboid for benefits outbalances the sum of all cuboids for the different adrs. however, if the concept is theoretically interesting, there is no practical way of comparing the benefit and risk cuboids, and it is not certain that the volume represented by the sum of adrs can be geometrically compared with a volume measuring the benefit of a drug. the methods mentioned above, despite their complexity, still do not allow determination, in a simple way, of the relative importance of the benefits and the risks of a given drug in a specific indication. the position of regulatory authorities on the bra question is instructive, because these authorities have the dual objective of encouraging pharmaceutical therapeutic progress, while protecting public health. quantitative methods such as those presented above play only a supportive role in the registration or drug surveillance process. relying on qualitative assessment and expert opinions makes it necessary to ensure that the regulatory process is valid, consistent, and transparent. the fda does not use a quantitative assessment of the bra, and relies on a qualitative assessment of the quantitative data collected during drug development. for the fda, the drug benefit derives from the efficacy end points of clinical trials, and risks are based on adverse events reported in trials and, once the drug is on the market, on spontaneous safety data. the assessment is based on a judgment where, in addition to the benefit and risks. other factors enter into account such as the notion of unmet medical need or the risk management plan proposed to mitigate the potential safety risks of the drugs. an important element in the bra performed by the fda is the opinion given by the advisory committees before drug registration, where different specialists independent of the fda, and sometimes also representatives from patient groups, assess the drug dossier, and take a decision by a vote. the fda qualitative assessment can be guided by a framework, in a way similar to that of the ema. it allows in particular standardization of the consistency and transparency in the bra process and decision, which is essential for the prescribes, the patients, and the pharmaceutical industry. in europe, the ema published in 2008 a paper entitled reflection paper on benefit - risk assessment methods in the context of the evaluation of marketing authorisation applications of medicinal products for human use : the agency explored approaches to improving the methodology for this assessment and the consistency and transparency of the evaluations. for the ema, as for the fda, assessments by experts are essential in bra, and quantitative approaches do not yet replace this qualitative assessment. first, the agency proposes the use of a specific template for the benefit - risk section of the drug dossier, with specific guidance for the assessors. hiis guidance allows summarization ol the main data about benefits and risks of the evaluated drug in a structured manner. in particular, the bra must be performed considering the therapeutic context of the assessed drug. the reflection paper also emphasizes the uncertainties and variability of these estimations and their impact on the decision. second, it contains an acknowledgment of the need to support research in the development of quantitative or semiquantitative bra methodologies. the recently created european network of centres for pharmacoepidemiology and pharmacovigilance is part of this initiative. clearly, the fda and the ema still rely on expert opinions and qualitative assessment, and not yet on quantitative methods, to summarize the evidence obtained in clinical trials to construct the bra prior to registration of new drugs. but both agencies encourage the use of frameworks to structure these assessments in order to ensure consistency in the evaluation and decisions. contrary to the drug efficacy, for which statistical tests can be used to demonstrate superiority of an experimental drug over a comparator in a controlled study design, the methodology to demonstrate in a definitive way the safety ol a treatment is less straightforward and can not be fully captured by randomized controlled studydesign. for a given safety issue, the risk can be estimated on the basis of incidences of adr compared between active and reference treatments ; however, the safety profile of a drug includes numerous safety issues, and it is difficult to summarize this configuration into a onedimensional concept. moreover, once the safety risks are identified, in a benefit - risk perspective, one needs to define the acceptance level for each of the risks. what is the tolerated threshold incidence for a given severe adr such as a drug - induced hepatic failure : should one accept an incidence of one case per 10 000 treated patients, or one case per 100 000, or even less ? the response depends on the indication and efficacy of the drug. to add to the difficulty, the efficacy of a drug is well measured in randomized trials, while the risk of a specific adr can only be assessed once this adr has been observed : as long as this is not the case, the adr remains hypothetical, based on some supposed biological mechanism, or even ignored when the adr is idiosyncratic. for example, the risk ol agranulocytosis with clozapine became obvious when the first case series were recorded, not at the time of registration. the potential for a given risk based on the known mechanism of action of the drug (or on that of the pharmacological class of the drug) also enters into the balance, and this potential risk can only be quantified with much uncertainty. the dimension of time is central to the evaluation of risks, and the bra of a drug starts during the preclinical development, to continue during the clinical development and the marketing phase. once on the market, the first years are critical for a drug bra, as the exposure to the new drug increases considerably in terms of number of patients, of duration of exposure and of heterogeneity of patients compared with the selected patient population included in the clinical trials. however, even the first few years on the market are sometimes not enough to establish a full bra : the longterm exposure can be critical, as certain adr may be observed only alter an exposure ol several years, such as cancers or chronic organ toxicity. immunodepression - related lymphoprolilerative disorders take about 5 years to appear, and liver cirrhosis may appear only alter decades of treatment with methotrexate, delayed toxicity can be observed in the offspring of patients exposed to a drug, as seen with vaginal adenocarcinomas in daughters of women who had taken diethylstilbestrol during pregnancy. the information gathered from randomized studies done during the clinical development corresponds to a drug exposure of limited duration : at this stage of development, the long - term exposure to the drug (1 year or more) is restricted to a limited number ol patients - a lew hundred. the international conference on harmonisation (ich) guideline ela on the long - term safety requires only 100 patients followed up for 1 year in a registration dossier. only the naturalistic observations of large - scale and long - duration post - marketing exposure will bring the information on rare and/or delayed adr. the bra, based on randomized evidence during the initial clinical development phase, becomes mainly based on naturalistic evidence during the post - marketing period, ie, on evidence from pharmacoepidemiological observational studies and the pharmacovigilance system. an important limitation inherent to all quantitative bra estimations is the level of subjectivity in estimating the impact of the adr, or of the safety risk. also patients suffering from a life - threatening disorder such as cancer might not assess a given adr the same way as patients suffering from a less severe disorder such as depression. it is unclear to what extent one could compare the utility - based approaches with a subjective and individualized assessment to the evidencebased appraisal of drugs. another limitation of quantitative bra methods is the risk of oversimplification of the parameters of the benefitrisk ratio ; the nnh : nnt ratio is an example of a mathematical tool too simple to capture the complexity of the problem. this review focuses on the public health perspective, ie, the bra for the population of potential patients : this is the view of the regulatory authorities and that of the pharmaceutical industry. the bra based on average values represents what one could expect for the population of patients (in clinical trials or pharmacoepidemiological studies). for a given patient, the efficacy and safety of a given treatment can differ, and often does, from what was concluded on the basis of a population of patients : a patient can be a responder or a nonresponder to a drug, and the efficacy of a medically recognized drug can be null at the individual level. similarly, the individual safety profile often differs from the average safety profile seen in a population. the subjective perception ol an adr also plays a role : a given adr can be tolerated by certain patients, but may be unacceptable to others. in this sense, the mcda technique reduced to the individual level is very similar to decision analysis, an economic technique whose use has been suggested in medicine since the 1960s : the bra integrates probabilities in its computation and one can use it to determine lor a given patient what the best alternative is. in conclusion, the bra is a dynamic process that evolves according to the cumulated knowledge acquired on drugs, mainly on their safety, as well as on more general conditions such as acceptance of risks in public health terms, or the existence of therapeutic alternatives. clearly, the evidence from randomized clinical trials is critical to furnish the bases for the bra before registration of the drug, but collecting information on the patients exposed once the drug is marketed is critical to pursue the bra process during the life cycle of the drugs. ? | randomized evidence from clinical trials and naturalistic evidence collected from pharmacoepidemiology and pharmacovigilance activities both contribute to the initial and continuous assessment of the benefits and risks of a drug, ie, the balance between therapeutic efficacy and safety risks. benefit - risk assessment (bra) mainly relies on a qualitative assessment of quantitative data. current attempts to quantify bra are reviewed and discussed, along with the expectations of regulatory authorities such as the food and drug administration and the european medicines agency. no method provides a fully satisfactory solution regarding bra, because it is difficult to reduce its multidimensional aspect to simple metrics, in a context where other therapeutic alternatives play a role. consistency and transparency are key in this assessment, which is performed throughout the whole drug life cycle. bra is mainly based on randomized clinical studies during clinical development, and it is continued and consolidated by naturalistic data once the drug is on the market. |
diabetes mellitus leads to the development of retinopathy, which is the main cause of vision loss in young adults in developed countries. according to the world health organization (who), diabetic retinopathy (dr) accounts for approximately 5% of global blindness. dr is characterized by gradually progressive alterations in the retinal microvasculature, leading to areas of retinal non - perfusion, increased vasopermeability, and, in response to retinal nonperfusion, pathologic intraocular proliferation of retinal vessels. it is believed that the main etiologic mechanisms of dr are hypoxia - induced inflammation and angiogenesis. visfatin was originally cloned from human peripheral blood lymphocytes and characterized as nicotinamide phosphoribosyltransferase (nampt), an enzyme that synthesizes nicotinamide mononucleotide from nicotinamide. visfatin is involved in the regulation of glucose homeostasis by exerting a hypoglycemic effect through the reduction of glucose release from hepatocytes and the stimulation of glucose utilization in peripheral tissues. a recent study showed that visfatin exerted angiogenic effects on human umbilical vein endothelial cells through the mammalian target of rapamycin (mtor) signaling pathway. therefore, it is hypothesized that visfatin may be involved in the pathogenesis of dr. although studies have focused on the relation of serum visfatin with diabetes, no investigation on the association of serum visfatin and dr has been performed. we aimed to determine serum and vitreous levels of visfatin in patients with dr to assess the role of visfatin in dr. we enrolled 280 diabetic patients [124 patients without dr, 56 with non - pdr (npdr), and 100 with pdr ] undergoing vitreoretinal surgery. serum was obtained from all the participants and vitreous samples were drawn from the diabetic patients at the time of surgery. exclusion criteria were chronic disease (other than diabetes), allergy, neoplasm, previous vitrectomy, photocoagulation, and intra - vitreal hemorrhages during the 3 months preceding the study. the control group consisted of 78 patients who had undergone vitrectomy for the treatment of retinal detachment (rd) with no proliferative vitreoretinopathy. this study was approved by the research ethics committee of our hospital and was conducted in agreement with the declaration of helsinki. written informed consent was obtained from the patients and healthy volunteers prior to their participation in this study. vitreous samples were collected undiluted by manual suction to a syringe through the aspiration line of vitrectomy, before opening the infusion line. vitreous samples were transferred on ice, centrifuged, and supernatants were stored at 80c until analysis. the serum and vitreous samples were analyzed for visfatin using a commercially available elisa (r&d systems inc., the differences in characteristics between patients with pdr and npdr, diabetic patients without dr, and control subjects were compared using chi - square tests, one - way anova, or kruskal - wallis test. statistical analysis was carried out using spss version 13.0 software program (spss inc, chicago, illinois). we enrolled 280 diabetic patients [124 patients without dr, 56 with non - pdr (npdr), and 100 with pdr ] undergoing vitreoretinal surgery. serum was obtained from all the participants and vitreous samples were drawn from the diabetic patients at the time of surgery. exclusion criteria were chronic disease (other than diabetes), allergy, neoplasm, previous vitrectomy, photocoagulation, and intra - vitreal hemorrhages during the 3 months preceding the study. the control group consisted of 78 patients who had undergone vitrectomy for the treatment of retinal detachment (rd) with no proliferative vitreoretinopathy. this study was approved by the research ethics committee of our hospital and was conducted in agreement with the declaration of helsinki. written informed consent was obtained from the patients and healthy volunteers prior to their participation in this study. vitreous samples were collected undiluted by manual suction to a syringe through the aspiration line of vitrectomy, before opening the infusion line. vitreous samples were transferred on ice, centrifuged, and supernatants were stored at 80c until analysis. the serum and vitreous samples were analyzed for visfatin using a commercially available elisa (r&d systems inc., the differences in characteristics between patients with pdr and npdr, diabetic patients without dr, and control subjects were compared using chi - square tests, one - way anova, or kruskal - wallis test. statistical analysis was carried out using spss version 13.0 software program (spss inc, chicago, illinois). the clinical characteristics of diabetic patients and control subjects are presented in table 1. increased levels of systolic blood pressure (sbp), diastolic blood pressure (dbp), hba1c, fasting plasma glucose (fpg), 2-h postprandial plasma glucose (p2hpg), and triglycerides (tg) the levels of hdl - c were significantly elevated in npdr and pdr patients compared with controls. furthermore, diabetic patients without dr had relatively higher low - density lipoprotein cholesterol (ldl - c) levels than the other 3 groups. serum and vitreous visfatin levels in controls, diabetic patients without dr, npdr patients, and pdr patients are shown in table 2. serum and vitreous visfatin levels in pdr patients were significantly elevated compared with those in the other 3 groups. control subjects had significantly lower levels of serum and vitreous visfatin compared with diabetic patients without dr, npdr patients, and pdr patients. in addition, npdr patients showed elevated vitreous visfatin levels compared with patients without dr. however, no significant differences in serum visfatin levels were found between npdr patients and patients without dr. the clinical characteristics of diabetic patients and control subjects are presented in table 1. increased levels of systolic blood pressure (sbp), diastolic blood pressure (dbp), hba1c, fasting plasma glucose (fpg), 2-h postprandial plasma glucose (p2hpg), and triglycerides (tg) the levels of hdl - c were significantly elevated in npdr and pdr patients compared with controls. furthermore, diabetic patients without dr had relatively higher low - density lipoprotein cholesterol (ldl - c) levels than the other 3 groups. serum and vitreous visfatin levels in controls, diabetic patients without dr, npdr patients, and pdr patients are shown in table 2. serum and vitreous visfatin levels in pdr patients were significantly elevated compared with those in the other 3 groups. control subjects had significantly lower levels of serum and vitreous visfatin compared with diabetic patients without dr, npdr patients, and pdr patients. in addition, npdr patients showed elevated vitreous visfatin levels compared with patients without dr. however, no significant differences in serum visfatin levels were found between npdr patients and patients without dr. this study provides the first report of the association of serum and vitreous visfatin levels with the presence and severity of dr. the results indicate that serum and vitreous visfatin levels in pdr patients were significantly elevated compared with those in control subjects, diabetic patients without dr, and npdr patients. visfatin exerted insulin - mimetic effects in cultured cells and lowered plasma glucose levels by binding to and activating the insulin receptor in mice. mice heterozygous for a targeted mutation in the visfatin gene had modestly higher levels of plasma glucose relative to wild - type littermates. serum visfatin levels were found to be elevated in patients with type 2 diabetes, type 1 diabetes, and gestational diabetes mellitus. in addition, a polymorphism in the promoter of visfatin is associated with the presence of type 2 diabetes. all these results point to the role of visfatin in the mechanism of diabetes. adipose tissue is no longer considered to be an inactive organ that only stores lipids and serves as an energy reservoir. numerous studies have shown that it is an active endocrine organ and secretes many substances called adipokines, including tumor necrosis factor (tnf-), adiponectin, leptin, resistin, and apelin, which are involved in the regulation of several metabolic and physiologic processes. serum and vitreous levels of several adipokines such as leptin, resistin, and apelin were found to be higher in patients with pdr compared with controls [1214 ]. on the other hand, serum adiponectin concentrations in patients with pdr or npdr were significantly lower than those in patients without diabetic retinopathy, indicating that adipokines play an important role in the pathogenesis of dr. our results showed that serum and vitreous visfatin levels were significantly elevated in patients with pdr and npdr compared with controls. pdr patients showed significantly higher levels of serum and vitreous visfatin compared with npdr patients. this suggests that serum and vitreous visfatin may serve as a biomarker to predict the presence and severity of dr in order to evaluate the risk of developing dr in diabetic patients and then to target strategies to prevent dr for patients with diabetes. angiogenesis, the process by which new vascular networks develop from preexisting vessels, is a traditional characteristic of pdr and often leads to catastrophic loss of vision due to vitreous hemorrhage and/or traction retinal detachment. a recent study showed that visfatin potently stimulates neovascularization in chick chorioallantoic membrane and mouse matrigel plug. it also activates migration, invasion, and tube formation in human umbilical vein endothelial cells (huvecs). moreover, visfatin evokes activation of the extracellular signal - regulated kinase 1/2 (erk1/2) in endothelial cells, which is closely linked to angiogenesis. in another study, visfatin was found to concentration- and time - dependently enhance cell migration and tube formation, indicating the angiogenic capability of huvecs via regulating vegf, which is an important regulator for the angiogenesis of dr. therefore, visfatin may be involved in the pathogenesis of dr by promoting the angiogenesis process. second, our study had a cross - sectional design and the causative relationship must be confirmed by longitudinal studies. serum and vitreous visfatin levels may serve as new biomarkers in addition to the traditional methods for assessing the risk of dr. | backgroundangiogenesis plays an important role in the mechanism of diabetic retinopathy (dr). visfatin, a recently identified adipokine, is thought to possess an angiogenic effect. the aim of our study was to investigate serum and vitreous levels of visfatin in patients with proliferative diabetic retinopathy (pdr) and non - pdr (npdr).material / methodsa total of 280 diabetic patients (124 without dr, 56 with npdr, and 100 with pdr) and 78 control subjects were enrolled in this study. serum and vitreous levels of visfatin were measured by enzyme - linked immunosorbent assay (elisa).resultsserum and vitreous visfatin levels in pdr patients were significantly elevated compared with those in the other 3 groups. npdr patients showed elevated vitreous visfatin levels compared with patients without dr. however, no significant differences in serum visfatin levels were found between npdr patients and patients without dr. in addition, control subjects had significantly lower levels of serum and vitreous visfatin compared with diabetic patients without dr, npdr patients, and pdr patients.conclusionsserum and vitreous visfatin levels are associated with the presence and severity of dr. |
visceral leishmaniasis (vl), also known as kala - azar, is the most severe form of leishmaniasis (http://www.dndi.org/diseases/vl.html). with no vaccine in sight, treatment for kala - azar phylogenetics suggests that leishmania is relatively early branching eukaryotic cells and their cell organization differs considerably from that of mammalian cells [2, 3 ]. hence, the biochemical differences between the host and parasite can be exploited for identification of new targets for rational drug design. it is also imperative that the probability of developing drug resistance should be less with these targets. this can be achieved by targeting an essential cellular process, which has the pressure to remain conserved and can not be bypassed by using alternative pathway. one interesting target which emerged from our microarray experiments was long - chain fatty acid - coa ligase (ec 6.2.1.3) (genbank accession no. xm_001681734), a key enzyme involved in the metabolism of fatty acids in all organisms [59 ]. fatty acyl - coa has multiple roles involved in protein transport [10, 11 ], enzyme activation, protein acylation, cell signaling, transcriptional regulation, and particularly -oxidation and phospholipid biosynthesis. especially in leishmania, long - chain fatty acids are predominant precursors of total lipid composition (the combination of phospholipids, sphingolipids, and ergosterol). long - chain fatty acyl - coa ligase is critical enzyme processing long - chain fatty acid acylation which is essential for lysophosphatidylinositol (lyso - pi) incorporation into glycosyl phosphatidylinositols (gpis) [16, 17 ]. these gpis - anchors are the major surface virulent factors in leishmania and have received considerable attention. de novo sphingolipid biosynthesis starts with the condensation of serine and the product of long - chain fatty acyl - coa ligase. l. major preferentially incorporates myristoyl - coa (c14) over palmitoyl - coa (c16) into their long - chain base [19, 20 ]. this selection of specific long - chain fatty acyl - coa reflects the presence of myristoyl - specific long - chain fatty acyl - coa ligase in leishmania. gaining new knowledge on fatty acid metabolism will not only provide fundamental insight into the molecular bases of leishmania pathogenesis but also reveal new targets for selective drugs. enzymes involved in fatty acid and sterol metabolism have been shown to be important pharmaceutical targets in leishmania and other kinetoplastida. triacsin c, a specific inhibitor of long - chain fatty acyl - coa synthetase, was shown to have an inhibitory effect on the growth of cryptosporidium parvum in vitro. four fatty acyl - coa synthetases have been described previously in trypanosoma brucei, displaying different chain - length specificities [24, 25 ]. (l. major, l. infantum, and l. braziliensis) has been sequenced, and the availability of putative long - chain fatty acyl - coa ligase genes was present in all three leishmania spp. at chromosome 13, which would be required for initiation of -oxidation and fatty acid metabolism. in the present study we confirm the presence of long - chain fatty acyl - coa ligase gene in leishmania donovani clinical isolate collected from, the state of bihar india [2629 ], which alone accounts for 50% of the total burden of visceral leishmaniasis worldwide. further progress in the understanding of this enzyme is likely to be achieved through the whole genome sequence (wgs) project of these clinically important isolates [2629 ], underway in our laboratory (http://www.leishmaniaresearchsociety.org/). the clinical isolates of l. donovani were collected from two kala - azar patients selected from muzaffarpur, bihar. the criterion for visceral leishmaniasis diagnosis was the presence of leishman - donovan (ld) bodies in splenic aspirations performed, which was graded to standard criteria. response to sodium antimony gluconate (sag) treatment was evaluated by repeating splenic aspiration at day 30 of treatment. patients were designated as antimonial responsive (l. donovani isolate 2001) based on the absence of fever, clinical improvement with reduction in spleen size, and absence of parasites in splenic aspirate while patients who showed presence of parasites in splenic aspiration were considered to be antimonial unresponsive (l. donovani isolate 39) [2629 ]. l. donovani isolates 2001 (sag - sensitive) and 39 (sag - resistant) used in the present study, were maintained in culture as described previously in [2629 ]. for nuclear dna isolation 1015 ml log - phase culture was taken and centrifuged at 5,000 rpm for 8 min at 4c. the supernatant was decanted ; cell pellet was resuspended in 36 ml net buffer and centrifuged at 5,000 rpm for 8 min at 4c. the supernatant was discarded, and the pellet was redissolved in 750 l net buffer, 7.5 l proteinase k (10 mg / ml stock) (mbi, fermentas, cat no. the cell lysate was centrifuged at 18,000 rpm for 1 hr at 4c. the supernatant containing nuclear dna was transferred to a fresh tube and given rnase treatment (20 g / ml) (mbi, fermentas, cat no. dna was extracted first with one volume phenol / chloroform / isoamyl alcohol (25 : 24 : 1) and finally with chloroform. nuclear dna was precipitated with 2.5 volumes of prechilled absolute ethanol, dissolved in nuclease - free water and stored at 4c for future use. pcr amplification was carried out using pfu dna polymerase (mbi, fermentas, cat no. reactions were carried out in a perkin elmer geneamp pcr system with 2001 nuclear dna (1050 ng) as template. the following oligonucleotide primers were designed on the basis of available gene sequence of l. major (genbank accession no. xm_001681734) : forward primer : 5gggccatatgctgcagcg 3 (18 mer) and reverse primer : 5ggcctcgagctaaaacaaatcatcg3 (25 mer). the amplification conditions were initial denaturation at 95c for 10 min, denaturation at 95c for 30 sec, annealing at 65c for 1 min, extension at 72c for 2 min, and final extension at 72c for 10 min ; 30 cycles. the pcr product was purified from agarose gel using mbi fermentas dna extraction kit (mbi, fermentas, cat no. l. donovani nuclear dna (16 g for each reaction) of two different clinical isolates, drug (sag) sensitive 2001 and drug (sag) resistant 39, were digested with 40-unit three different restriction enzymes (pvuii, bamhi, and xhoi), which were cut overnight and separated on 0.8% agarose gel by electrophoresis at 50 v. in order to improve transfer efficacy, dna in agarose gel was treated with 0.25 n hcl for 15 min (partial depurination), rinsed with autoclaved water 3x, and treated with 0.4 n naoh (breaking backbone at depurinated region) for 30 min. dna was transferred to nylon membrane by conventional downward capillary transfer method for 5 h using 3 mm whatman paper wick. after transfer on nylon membrane the dna was neutralized in 0.5 m tris (ph 7.4), 1.5 m nacl, 2x for 5 min at room temperature. the membrane nylon membrane was incubated with 2.5 ml of prehybridization buffer (0.6 m nacl, 0.5 m tris - hcl (ph 7.5), 0.008 m edta, 1% sodium pyrophosphate, 0.2% sds, and 50 g / ml heparin) and incubated in a hybridization oven at 65c for 2 h. radioactive probe was prepared by labeling 25 ng of the dnas with [-p ] dctp by random priming method (brit / barc, india) and purified using a desalting column (sephadex g-50). the radioactivity was checked with a geiger muller counter (dosimeter) and stored at 20c. the probe was added to the prehybridization buffer and incubated at 65c overnight in hybridization oven. membrane was washed twice with 2x ssc, 0.1% sds (15 min each) at 65c and then washed with 2x ssc, 0.1% sds for 30 min at 65c to reduce background signals. hybridized membrane was layered over a wet whatman paper sheet to soak extra solution and covered with saran wrap (cellophane paper) and exposed to x - ray film. after 418 h exposure in an exposure cassette at 70c, x - ray film was developed for analysis. the amino acid sequence of leishmania long - chain fatty acyl - coa ligase, obtained from our microarray experiments, was compared with sequences available in genedb orthomcl4080 database (http://www.genedb.org/) to identify the nearest ortholog of this sequence in kinetoplastida. multiple sequence alignments were performed using clustal w version 1.8 (http://www.ebi.ac.uk/clustalw) and t - cofee. to calculate evolutionary distances of kinetoplastida long - chain fatty acyl - coa ligases with human acyl coa synthetases (acss), phylogenetic dendrograms were constructed by neighbor - joining method and tree topologies were evaluated by performing bootstrap analysis of 1000 data sets using mega 3.1 (molecular evolutionary genetics analysis). all 26 human acss amino acid sequences were selected, along with their transcript variants which are aligned with different long - chain fatty acyl - coa ligase ortholog present in kinetoplastida family, to define the clade difference with trypanosome and leishmania long - chain fatty acyl - coa ligase, and human acyl - coa synthetases. the amino acid sequence of leishmania long - chain fatty acyl - coa ligase was retrieved from the ncbi database (genbank accession no. it was ascertained that the 3d structure of leishmania long - chain fatty acyl - coa ligase protein was not available in protein data bank (pdb) ; hence, the present exercise of developing the 3d model of this protein was undertaken. cblast (http://www.ncbi.nlm.nih.gov/structure/cblast/cblast.cgi) and psi - blast search was performed against pdb with the default parameter to find suitable templates for homology modeling. the sequence alignment of leishmania long - chain fatty acyl - coa ligase and respective templates was carried out using the clustalw (http://www.ebi.ac.uk/clustalw) and modeller9v8 programs [34, 35 ]. the sequences that showed the maximum identity with high score and lower e - value were used as a reference structure to build a 3d model. the retrieved sequences of thermus thermophilus (pdb accession code : 1ult, 1v25, 1v26) and archaeoglobus fulgidus (pdb accession code : 3g7s) long - chain fatty acyl - coa ligases served as template for homology modeling based on its maximum sequence similarity to leishmania long - chain fatty acyl - coa ligase. the resulting alignment was used as an input for the automated comparative homology modeling for generating 3d model structure of leishmania long - chain fatty acyl - coa ligase. the backbones of core region of the protein were transferred directly from the corresponding coordinates of templates. out of 50 models generated by modeller, the one with the best dope score, minimum mof (modeller objective function), and best varify 3d profile was subjected to energy minimization. in order to assess the stereochemical qualities of 3d model, three types of fatty acyl coa ligase have been defined with respect to the length of the aliphatic chain of the substrate : short (sc - ec 6.2.1.1), medium (mc - ec 6.2.1.2), and long - chain (lc - ec 6.2.1.3) fatty acyl - coa ligase. fatty acid activation step involves the linking of the carboxyl group of the fatty acid through an acyl bond to the phosphoryl group of amp. subsequently, a transfer of the fatty acyl group to the sulfhydryl group of coa occurs, releasing amp [3840 ]. this magnesium - dependent two - step acylation of fatty acid by fatty acyl coa synthetases was defined as unidirectional bi uni uni bi ping - pong mechanism [36, 39 ]. genome analysis suggests that l. major oxidizes fatty acids via -oxidation in two separate cellular compartments : the glycosome and mitochondria. an argument for the involvement of glycosome in lipid metabolism is the fact that in each of three trypanosomatid genomes three genes called half abc transporters (gati 1 - 3) have been found identical with peroxisomal transporters involved in fatty acid transport. in t. brucei these transporters might be coupled with fatty acyl - coa ligase in glycosome, which can provide activated form of fatty acids to these transporters like oleoyl - coa, and also other acylated fatty acids. in t. brucei, little -oxidation was observed in mitochondria. however, t. brucei contains at least two enzymes involved in -oxidation of fatty acid (2-enoyl - coa hydratase and hydroxyacyl - dehydrogenase, encompassed in a single protein) with glycosome localization. the presence of a pts (peroxisomal targeting sequence) on t. brucei and t. cruzi carnitine acetyl transferase, catalysing the last peroxisomal step in fatty acid oxidation, suggests that the major -oxidation processes are situated in glycosomes. in l. donovani, one of the -oxidation enzyme 3-hydroxyacyl - coa dehydrogenase has been localized to glycosomes. the hypothetical localization of leishmania long - chain fatty acyl - coa ligase was predicted in mitochondria or glycosome but, with the reference of other organisms, the specialized localization of specific long - chain fatty acyl - coa ligase family protein needs to be taken into account in future. as mentioned in a previous study -oxidation has been found to be unregulated in leishmania 's amastigotes then in promastigote stage [4648 ]. this specialized increase was described so that, in infectious stage, energy requirement was supplemented to utilize fatty acid as carbon and energy source rather than glucose. long - chain fatty acyl - coa ligase is the key enzyme involved in -oxidation of fatty acids, and its compartmentation in glycosome supports a strong evidence of the involvement of this enzyme in cellular biogenesis and its importance at particular stage of leishmania life cycle. in the same way upregulation of long - chain fatty acyl - coa ligase with combination of other enzymes involved in fatty acid catabolism might play a crucial role in cell survival at infectious stage of leishmania, and these analyses must be supplemented with experimental biology. the presence of l. donovani long - chain fatty acyl - coa ligase gene in the clinical isolates was ascertained by pcr amplification. the putative long - chain fatty acid - coa ligase gene of l. major is present in the leishmania genome databank (http://www.genedb.org/) on chromosome 13 (figure 1). specific 2010 bp size amplified product was obtained, showing the presence of long - chain fatty acyl - coa ligase gene in the l. donovani clinical isolate (figure 2(d)). the amplified product was sequenced and confirmed to be long - chain fatty acid - coa ligase gene by performing ncbi - blast identity with l. major gene. ncbi - blast result showed 96% sequence similarity and 1% gaps with l. major long - chain fatty acyl - coa ligase gene (genbank accession no. xm_001681734). the starting 18 nucleotides and 19 nucleotides from the end sequence were missed due to direct amplified product sequencing. these nucleotides were collected from its maximum similar l. major long - chain fatty acyl - coa ligase sequence (genbank accession no. xm_001681734). for the determination of long - chain fatty acid - coa ligase gene copy number, nuclear dna from the l. donovani clinical isolates (2001, 39) the restriction map was designed from the complete putative long - chain fatty acyl - coa ligase gene and the flanking region present in chromosome 13 of l. major (figure 2). southern hybridization was performed using the 2010 bp long - chain fatty acid - coa ligase gene pcr product as probe (figure 2(c)). the same blot was also probed with alpha tubulin gene probe as an internal control, showing equal loading (figure 2(b)). complete digestion resulted in a single copy within the l. donovani genome, as bamhi enzyme showed only one band of approximately 3848 bp, except pvuii which was cut once into the gene sequence and xhoi which was cut twice into the gene sequence, which exhibited two and three hybridizing bands, respectively. the results showed that long - chain fatty acid - coa ligase is present as a single copy gene in the l. donovani genome. the restriction pattern also verifying the restriction pattern of l. donovani and l. major long - chain fatty acyl coa ligase coding region is almost the same. leishmania long - chain fatty acyl - coa ligase gene was translated from full length orf on the basis of its nucleic acid sequence. long - chain fatty acyl - coa synthetase from t. thermophilus, yeast, and e. coli and all 26 distinct human acyl - coa synthetases were subjected to phylogenetic analysis to facilitate the evaluation of conserved motif with relationship of reference leishmania long - chain fatty acyl - coa ligase amino acid sequence. the amino acid sequence of leishmania long - chain fatty acyl - coa ligase (ldlcfa) was aligned with lc - facs from t. thermophilus (ttlc - facs,1ulta), human (lcfa_human, p41215), yeast (lcf1_yeast, p30624), and e. coli (lcfa_ecoli, p29212) on the basis of psi - blast (figure 3). however the overall similarity of leishmania long - chain fatty acyl - coa ligase (ldlcfa) with other fatty acyl - coa synthetases family proteins is low, about 17% with ttlc - facs, 15% with lcfa_human, 14% with lcf1_yeast, and 13% with lcfa_ecoli. based on the crystal structure of ttlc - facs and alignment with other long - chain fatty acyl - coa synthetases, the amino acid sequence of leishmania long - chain fatty acyl - coa ligase shows conserve region corresponding to the linker (l), adenine (a), and gate (g) motifs as well as the p - loop, the phosphate - binding site. previous studies [32, 36 ] put forward different motifs which can give insight to enhance our understanding of predicted structure - function relationships in leishmania. p - loop is the motif i which is also known as amp - binding domain found in a close proximity to the adenosine moiety and helps to maintain the substrate in the proper orientation. the consensus sequence of motif i, [y, f]tsg[t, s]tgxpk shows high level of conservation with respect to leishmania long - chain fatty acyl - coa ligase, that is, 237-ftagttgppk-246. motif ii contains the l - motif (432-drlkdl-437) that acts as a linker between the large n - terminal domain and the smaller c - terminal domain in ttlc - facs. the linker region is thought to be critical for catalysis function as it facilitates a conformational change upon atp binding that permits subsequent binding of the fatty acyl and/or coa substrates. in leishmania long - chain fatty acyl - coa ligase, this linker region (517-gnkdvl-522) is less similar compared with other organisms and is likely to be critical in enzyme activity. motif iii was found to be in all acyl coa synthetases and a part of a - motif (adenine motif). this region has been described as an atp / amp - binding domain in other acyl - coa synthetases [4951 ]. the conserved consensus sequence of a - motif is ygxte, a highly conserved motif with respect to leishmania long - chain fatty acyl - coa ligase region, that is, ygfme. from the crystal structure of ttlc - facs, it was proposed that y324 was an adenine - binding residue and also conserved throughout all organisms including leishmania. the crystal structure of s. enterica acetyl - coa synthetase revealed that the glutamate residue of a - motif is positioned near oxygen o1 of the amp phosphate. this region was predicted to be involved in substrate binding or stabilization, conserved in leishmania long - chain fatty acyl - coa ligase also. motif iv comprises the first five residues of the nine - amino acid g-(or gate) motif (226-vpmfhvnaw-234) of ttlc - facs (36), showing less sequence similarity with leishmania long - chain fatty acyl - coa ligase (281-cswcvagal-289). from the crystal structure of ttlc - facs, it was proposed that the indole ring of w234 acts as a gate and blocks the entry of fatty acids into its substrate binding tunnel unless atp is first bound, resulting in a conformational change that swings the gate open (36). however, a tryptophan residue corresponding to w234 was not found in any leishmania, human, yeast, and e. coli fatty acyl - coa synthetase sequences. in contrast, although no highly conserved sequences were identified, a corresponding gate residue may be located elsewhere in the structure of leishmania long - chain fatty acyl - coa ligase. the fatty acyl - coa synthetases are part of a large family of proteins referred to as the atp - amp - binding proteins. a common feature of enzymes in this family is that they all form an adenylated intermediate as part of their catalytic cycle. this group of enzymes is diverse in catalyzing the activation of a wide variety of carboxyl - containing substrates, including amino acids, fatty acids, and luciferin. sequence comparison of members of the atp - amp - binding protein family has identified two highly conserved sequence elements, y[t]s[gttg]x[pkgv]g[yg]xt[e ] (the bracket shows the conserved sequence in leishmania long - chain fatty acyl - coa ligase), which encompass the atp - amp signature motif (figure 4). in fatty acyl - coa synthetases family proteins, there was a third sequence element defined as facs signature motif that was less conserved and partially overlaps the facs signature motif, which is involved in both catalysis and specificity of the fatty acid substrate. there are a number of notable features within the facs signature motif : (i) this region contains two invariant glycine residues (at positions 2 and 7) and a highly conserved glycine at position 16, leishmania long - chain fatty acyl - coa ligase shares glycine residue with other facss at position 7 and 16 but tyr instead of gly was found in position 2. (ii) this region contains additional six residues that are invariant in the fatty acyl - coa synthetases : w, t, d, d, r, and k, but in leishmania long - chain fatty acyl - coa ligase these residues are f, s, d, g, n, and d. (iii) the residue in the fourth position is hydrophobic and is a leucine, a methionine, or phenylalanine. however, in leishmania long - chain fatty acyl - coa ligase hydrophobic residue valine was situated in position 4. (iv) this region of enzyme contains hydrophobic residues (leucine, isoleucine, or valine) at positions 4, 9, 18, 20, and 21. these residues, in addition to tryptophan or phenylalanine residues at position 3, may comprise part of a fatty - acid - binding pocket. all of these five conserved regions from facs signature motif are having similarity among them except leishmania long - chain fatty acyl - coa ligase, with some variable regions. these less conserved regions in leishmania long - chain fatty acyl - coa ligase - facs signature motif were predicted to adopt inconsistent specificity and catalytic activities of the fatty acid substrate compared to other fatty acyl coa synthetases. we performed phylogenetic analysis to infer evolutionary relationships of all available sequences from kinetoplastida long - chain fatty acyl - coa ligases (table 1) and human (host) acss family sequences. this experiment was performed to validate that the parasite enzyme is unquestionably different from the human enzyme, and this aspect merits further study to validate this enzyme as a drug target. we obtained comparable results using the neighbor - joining distance - based algorithm as well as maximum parsimony. we found 9 clades, including kinetoplastida clade (one set of six kinetoplastida long - chain fatty acyl - coa ligase protein family) forming a clade with high bootstrap support (figure 5). kinetoplastida clade was highly dissimilar and distinct from all ancestral nodes with other human acss family proteins and showing distinctiveness of kinetoplastida long - chain fatty acyl - coa ligases, including leishmania long - chain fatty acyl - coa ligase. this divergence of leishmania long - chain fatty acyl - coa ligase with respect to the homologous human enzymes may be an important protein as a potential target candidate for chemotherapeutic antileishmanial drugs. the backbone root - mean - square - deviation (rmsd) values between final model and template crystal structure used are 1.04 with thermus thermophilus (pdb accession code : 1ult, 1v25, 1v26) and 1.40 with archaeoglobus fulgidus (pdb accession code : 3g7s) long - chain fatty acyl - coa ligase. small rmsd can be interpreted as structures share common structural homology and the generated structure is reasonable for structural similarity analysis (figure 6). the final modeled structure of leishmania long - chain fatty acyl - coa ligase was evaluated for overall quality using available analyses procedures. these analysis compare specific properties of the model with those of known high - quality protein structures using programs like procheck, verify3d, and whatif (table 2). an important indicator of the stereochemical quality of the model is distribution of the main chain torsion angles phi and psi in ramachandran plot (figure 7). the plot clearly shows the vast majority of the amino acids in a phi - psi distribution consistent with right -helices, and the remaining fall into beta configuration. plots comparison shows that the structure is reasonable overall because the space distribution for the homology - modeled structure was similar to the x - ray structure of the thermus thermophilus long - chain fatty acyl - coa ligase (pdb accession code : 1ulta). the results showed that our modeled structure was reasonably good at that much less sequence identity. earlier during the course of work, microarray analysis was performed on the same clinical l. donovani isolates (2001 and 39) in order to identify differential gene expression. out of all genes found differentially expressed, significant upregulation of long - chain fatty acyl - coa ligase gene in sag unresponsive clinical isolate was found to be intracellular amastigote specific and has confirmed the involvement of long - chain fatty acyl - coa ligase in resistance. similarly, it has been proven before that the rate limiting enzyme, long - chain fatty acyl - coa ligase of -oxidation, was found to be upregulated in amastigotes derived from cloned line of l. donovani isr because, during late stages of differentiation, the parasites shift from glucose to fatty acid oxidation as the main source of energy, and thereby there is increase in enzyme activity associated with -oxidation capacity [47, 48 ]. early in vivo studies showed that enzymatic activities associated with -oxidation of fatty acids were significantly higher in l. mexicana amastigotes. additionally microarray experiments with intracellular amastigotes hybridized onto affymetrix mouse430_2 genechips showed that several genes involved in fatty acid biosynthesis pathway were found to be upregulated. presently studies are ongoing in our laboratory on microarray analysis using intracellular amastigotes hybridized to affymetrix genechip human genome u133 plus 2.0 array which will further yield useful information towards the fatty acid / lipid metabolism within this clinical isolate. a very recent study by yao., 2010, on differential expression of plasma membrane proteins in logarithmic versus metacyclic promastigotes of l. chagasi has also identified long - chain fatty acyl - coa synthetase. as mentioned before, long - chain fatty acid - coa ligase is present in both prokaryotes and eukaryotes. this divergence of leishmania long - chain fatty acyl - coa ligase with respect to the homologous human enzymes may be an important protein as a potential target candidate for chemotherapeutic antileishmanial drugs. many differences exist between host and parasite pertaining to the structure and arrangement of this enzyme. however, leishmania has significant divergence and adaptation to specific environmental conditions between its two life stages, in the insect vector and human host. this can affect the parasites metabolic machinery in terms of presence of certain pathways, their subcellular localization and expression at different developmental stages, and the interplay between scavenging and synthesis of key metabolites. it has been argued previously that successful targets for metabolic intervention are most likely to be found among enzymes exerting strong control of flux through metabolic pathways. even if a unique or highly divergent enzymatic process is found in the parasites, this does not necessarily mean it can be developed as a target for useful inhibitors. on the other hand, enzymes that are present in both the parasites and their animal hosts will often differ sufficiently in their sequence for inhibitors to be specific. finally, even orthologous enzymes functioning in the same pathway and in the same subcellular compartment of the parasites may have different inhibitor binding properties, leading to variability in the effectiveness and specificity of inhibitors targeting any particular enzyme. the detection of the long - chain fatty acid - coa ligase gene in the genome of l. donovani clinical isolate, in the present study, deserves a full exploration with respect to its potential as a drug target. changes in membrane lipids / deficiency of certain fatty acids and disease association have been documented [34, 58 ]. modulation of enzymes involved in lipid synthesis and of others possibly involved in cell wall metabolism may modify access of drug to the plasma membrane. moreover, our microarray experiment indicated that this enzyme was amastigote specific making it all the more important to study it further and test if it can be exploited as a validated drug target. we have also shown earlier in our laboratory that modification of lipid composition on the plasma membrane of the parasite might have important implications towards generating susceptibility / resistance to antileishmanial drugs. as this enzyme stipulates several important cellular processes in leishmania like stage - specific expression [47, 48 ], host - parasite interaction, cell membrane composition [17, 18 ], phospholipid biosynthesis [16, 21 ], and drug resistance, the present study proposed further evaluation of leishmania long - chain fatty acyl - coa ligase as a candidate drug target. | fatty acyl - coa synthetase (fatty acid : coa ligase, amp - forming ; (ec 6.2.1.3)) catalyzes the formation of fatty acyl - coa by a two - step process that proceeds through the hydrolysis of pyrophosphate. fatty acyl - coa represents bioactive compounds that are involved in protein transport, enzyme activation, protein acylation, cell signaling, and transcriptional control in addition to serving as substrates for beta oxidation and phospholipid biosynthesis. fatty acyl - coa synthetase occupies a pivotal role in cellular homeostasis, particularly in lipid metabolism. our interest in fatty acyl - coa synthetase stems from the identification of this enzyme, long - chain fatty acyl - coa ligase (lcfa) by microarray analysis. we found this enzyme to be differentially expressed by leishmania donovani amastigotes resistant to antimonial treatment. in the present study, we confirm the presence of long - chain fatty acyl - coa ligase gene in the genome of clinical isolates of leishmania donovani collected from the disease endemic area in india. we predict a molecular model for this enzyme for in silico docking studies using chemical library available in our institute. on the basis of the data presented in this work, we propose that long - chain fatty acyl - coa ligase enzyme serves as an important protein and a potential target candidate for development of selective inhibitors against leishmaniasis. |
although the view of food somewhat differs between western and eastern nutritionists, both share the similar belief that proper nutrition is essential for chieving optimal health. while their methods are generally viewed as distinct, a substantial amount of overlap exists between these two systems. yet, since the two cultures use different languages to describe the properties of food, most people in the western world, including asian americans, find eastern explanations difficult to understand because of its use of archaic and metaphoric expressions. nevertheless, both western and eastern approaches to nutrition possess their own respective strengths and weaknesses. upon closer analysis, it can be seen that western nutritionists, whether mindfully or unknowingly, are gradually adopting some eastern methodology in order to address certain limitations of western approaches. it is evident that the strengths of one system can address the weaknesses of the other. thus, blending the best of western and eastern practices will form a comprehensive, systematic, and holistic nutritional approach to achieve better health. note : in this analysis of eastern and western nutrition, traditional chinese nutrition is used as the example of eastern nutrition, while nutrition in the united states is used as the example of western nutrition. the view of a healthy diet has undergone major transformations and still continues to be revised as scientific research on human nutrition progresses. according to walter c. willett, m.d., the chairman of the department of nutrition at harvard school of public health and a professor at harvard medical school, as late as the 1950s, a healthy diet meant eggs, bacon, and butter - slathered toast for breakfast, roast beef and mashed potatoes with gravy for dinner (willett, 2001). americans are slowly letting go of the typical western diet and adopting diets more conducive to health, such as the mediterranean diet, low - glycemic diet, and anti - inflammatory diet. as exemplified through the new united states department of agriculture (usda) myplate icon, the key nutritional messages of the 2010 dietary guidelines for americans are balance, variety, moderation and adequacy (.eat.right., 2011). western nutritionists study food composition - proteins, carbohydrates, fats, vitamins, and minerals and make dietary recommendations based on scientific experimentation and epidemiological studies. through the reductionist analysis, food is examined based on its components rather than as a unifying whole. without taking into consideration the uniqueness of each individual in terms of lifestyle, genetic make - up, and overall dietary practices, findings from these studies generally become the basis of nutritional advice, such as recommended daily allowances (rdas), for the overall population (kaput and rodriguez, 2006). nevertheless, recent discoveries indicate that food components can directly alter physiological functions through interactions with the body 's molecular machinery, which differs from individual to individual at the genetic level. these findings have stimulated the emergence of novel research approaches to nutrition (raqib and cravioto, 2009). certainly, a common observation is that two individuals can follow the same diet and exercise plan, but one gains weight while the other does not. the emerging fields of nutrigenomics and nutrigenetics are quickly developing to address the discrepancies between peoples responses to identical substances. with genomic tools, scientists working in nutrigenomics seek to understand how nutritional molecules influence biological systems through metabolic pathways and homeostatic control. ultimately, the search is for the optimal diet. conversely, the objective of nutrigenetics is to decipher how differences in an individual 's genetic makeup determine how the body reacts to food. furthermore, personalized nutrition, uncovering the ideal diet for an individual, is the fundamental goal of nutrigenetics (costa., 2010 ; mutch., the progress of western nutrition towards personalized diets, based upon one 's genetic make - up, stresses the importance of the individual. because of the wide variety of genetic polymorphisms that can impact nutrient absorption, metabolism, and transport, great caution must be practiced when making recommendations to the general population. for example, although the use of margarines with plant sterols added to reduce levels of circulating cholesterol may benefit some, others individuals with mutations in the atp - binding cassette (abc) transporters that are essential in promoting excretion of sterols may suffer from increased intake of sterols (mutch., even though humans are approximately 99.9% identical at the genetic level, the 0.1% difference in the genetic sequence is sufficient to produce phenotypical differences such as varying eye colors, height, susceptibility to diseases, and responses to bioactive components of food. consequently, diets must be personalized to each individual 's needs for optimal health (raqib and cravioto, 2009). while the examination of isolated nutritional factors have been a focus in the western research and practice, the holistic view of each person has consistently been the main component of eastern medicine. the key message of eastern nutrition is the fact that an optimal universal diet does not exist. rather, an individual diet must be designed for each person based on his or her constitution, lifestyle, environment, climate, and season. the main goal of eastern nutrition is to use food as a means to achieve balance and harmony within the body. in the language of traditional chinese medicine (tcm), the expression of yin - yang (hot and cold) and the five phases (sweet, acrid, sour, bitter, and salty) characterize both the person and the food. while yin - yang allows for the description between opposites hot and cold or wet and dry, the five - phases give the illustration greater dimension by providing shape, character, and hue. because neither the features of our bodies nor food are stagnant, the diets that result in balance and optimal performance will vary accordingly (kastner 2009), (beinfield and korngold, 1991), (shi., 2011). indeed, foods are selected to correspond to an individual 's pattern, including heat, cold, and dampness conditions, and modified based on other important factors including lifestyle, environment, climate, and season. in both nutritional systems, imbalance often leads to poor health. while the two approaches to nutrition emphasize the significance of balance, their view of this balance does not completely coincide. in eastern tradition, the concept of balance in relationship to food and the individual denotes both internal and external harmony of yin and yang (van der greef., 2010), in contrast, because food is described in terms of proteins, carbohydrates, fats, vitamins, and minerals and quantified by properties such as the caloric content and glycemic index in the western world, their description of a balanced diet differs from the eastern terminology. for instance, eastern nutritionists emphasize the importance of following a dietary plan that results in a state of balance meaning an individual with a hot constitution should follow a diet with a cooling nature (pitchford, 2002). however, western nutritionists focus mainly upon balance in terms of caloric intake meeting the energy needs of the body and nutritional value of food providing the essential nutrients and macromolecules for homeostasis, growth, and development (sizer and whitney, 2008). although researchers in western nutrition have recognized that fruits and vegetables confer beneficial disease preventing properties, when scientists have attempted to isolate single components from these foods and incorporate them into a magic pill for disease prevention, randomized control trials (rcts) of these studies suggest that these molecules in their isolated form do not confer the same benefits as when they are consumed from whole food sources. for instance, observational studies indicate that eating fruits and vegetables high in antioxidants reduces the risk for cardiovascular disease, certain types of cancer, memory loss, and progressive eye diseases. however, the majority of rcts, in which participants taking a specific antioxidant are compared with controls taking a placebo, have failed to show that supplemental antioxidants significantly decrease the risk of the health conditions previously mentioned. researchers now recognize the importance of understanding how all the complex compounds present in food interact with the body. in the case of fruits and vegetables, antioxidants and other nutrients found in fruits and vegetables may be essential for health benefits to manifest (willett, 2001), (bookshelf : u.s. national library of medicine, 2011). indeed, analyzing beta - carotene in the absence of its context led to disastrous results for some participants of the beta - carotene and retinol efficacy trial (caret). based upon observational evidence that individuals with high intake of fruits and vegetables rich in beta - carotene have lower incidences of lung cancer, caret researchers gave beta - carotene (30 mg) and retinyl palmitate (25,000 iu) daily to participants who were adults with high risk for lung cancer however, this study was halted 21 months earlier than intended because of the startling findings that compared with the placebo group, there was 28% more lung cancer and 17% more death in participants who were taking the beta - carotene supplement (omenn., 1996). it remains unclear why the synthetic form of beta - carotene results in a contrasting phenomenon than the beta - carotene naturally found in fruits and vegetables. since the majority of individuals in the study were smokers, one explanation that researchers proposed is that the combination of cigarette smoke, which generates large amounts of free radicals, and mega - doses of supplemental beta - carotene interacts negatively in the respiratory tract and epithelial lung cells. recently, scientists have discovered evidence that smokers supplemented with beta - carotene developed more aberrant cell growth in the respiratory epithelium than those taking the placebo (wright., 2010). certainly, the results of these studies emphasize the fundamental of eastern tradition : for complete understanding, the part can not be separated from the whole. although inflammation is the body 's natural mechanism to heal and fight against infection, an overactive immune system that results in chronic inflammation is now thought to be the underlying cause of multiple health conditions, including cancer, diabetes, heart disease, and obesity. in contrast to the red, swelling reaction that is typically seen on the surface when the body heals in response to a cut or infection, chronic inflammation is often described as an oxidative stress that arises from the imbalance between free radicals and antioxidants is one possible source of chronic inflammation (raqib and cravioto, 2009). scientists are now quantifying the intensity of inflammation with markers like c - reactive protein (crp), which is a compound produced by the liver (okeefe., 2008). the western concept of inflammation is viewed by the east as internal heat deriving from the dominance of yang. this heat can result from dysregulation of the internal organs, psychological stress, and heat - producing foods, which are also called pro - inflammatory foods in western nutrition. while the basis for their recommendations is dissimilar, the foods that western and eastern nutritionists suggest avoiding to reduce inflammation greatly overlap. both approaches advise to minimize or eliminate foods that are highly processed, deep fried, high in sugar, or high in saturated or trans fats (okeefe., 2008). instead, whole grains, lean protein sources, fruits, vegetables, and nuts are key components of an anti - inflammatory diet. while the western approach is scientifically based, eastern approaches have evolved over thousands of years upon the basis of empirical evidence. nevertheless, neither system is perfect but instead both have much to learn from the other in order to develop approaches that will allow individuals to achieve optimal health. reductionist approach, in which the whole is fragmented into individual parts to facilitate examination, this has resulted in ample information about substances in the absence of their contexts. on the other hand, the holistic approach of the east often fails to explain the mechanisms behind why certain practices work. additionally, in the west, the emphasis is mainly on the nutritional content of the food before it is consumed and to a lesser degree on its interaction with the individual once it is ingested. while it has been recognized that diets should be personalized, to simplify the process, currently customization on the usda myplate website is based only upon age, sex, weight, height, and level of physical activity. however, this individualized plan is not truly personalized. instead, the information entered is used to calculate the estimated daily caloric need and then generate dietary recommendations based on that calorie level. this usda daily food plan is based upon the 2010 dietary guidelines for americans, created after detailed analysis of current scientific evidence from nutritional and epidemiological studies, data analysis, food pattern modeling, and other methods of research. in contrast, the east teaches that depending on the constitution, lifestyle, environment, climate, and season, each person needs a unique diet that will permit balance to be established within the body. furthermore, it is not only the type of food alone that is relevant ; the entire process from food production to digestion is essential. eastern nutritionists consider how, where, and when the food is grown or raised, how it is prepared, how and when it is consumed, and the body 's response to the food. the eastern healing tradition stresses the importance of appropriately timing meals and taking the time to enjoy food and not multitasking while eating. both the east and the west have unique approaches that would strengthen the other when combined. while a barrier in the form of misunderstanding or lack of interest seems to hinder the effective transmission of knowledge, until this integration is achieved, both methodologies will be lacking in essential components necessary to guide individuals to optimal health. | eastern and western approaches to nutrition are unique and possess both strengths and weaknesses. blending the best of both techniques will allow for the development of an integrative nutrition system that is more effective than either tradition on its own. the western view to nutrition is already adopting certain attributes of the eastern medicine philosophy as exemplified by the progression towards individualized nutrition through methods such as nutrigenetics. nevertheless, many differences still remain between eastern and western nutritional concepts. becoming fluent in both western and eastern methodologies can ensure the extraction of the best from both techniques for the development of a comprehensive, systematic, and holistic nutritional approach to achieve optimal health. |
stress is a common ingredient in our day - to - day life, a continuous challenge we have to face in an unceasingly changing world. due to the enormous impact that stress has on health and quality of life, an interdisciplinary approach arose in the last decades in the form of psychoneuroimmunology, incorporating various aspects from psychology, immunology, endocrinology and neuroscience. there are several neural structures directly involved in stress coping. when encountering a stressful event, the nervous system processes the information and compares it with the organism s actual state and long term goals. if the event is perceived as potentially contextual changing or threatening, both nervous and endocrine systems harmonize in developing a response in order to cope properly, both mentally and emotionally. higher cortical structures, like the prefrontal cortex are involved in cognitive processing, e.g. trying to make the best decision, staying calm or thinking of solutions, whereas limbic - related subcortical areas like the amygdala are important in emotional responses, e.g. being afraid, anxious or angry and, in conjunction with the hippocampal formation, playing a role in memory formation. but it is of crucial importance to adapt the organism s internal state and maintain the homeostasis unchanged (e.g. vital respiratory and cardio - vascular functions). this task is accomplished especially by a complex network of nervous and endocrine structures that form the so - called hypothalamic - pituitary - adrenal (hpa) axis. a primary role of the hpa axis is the induction of glucocorticoids (gc), the main stress hormones, with major roles in our survival. apart from their notorious implications in the immune system, studies in neuroendocrinology also point out important implications for gc in cognitive functions, particularly in the modulation of memory. in this review, we discuss about the effects of gc on memory impairment, with special emphasis on situations where the person experiences a stressful situation that triggers an acute change in the neurohormonal status, as well as the implications of memory and neurohormonal status in severe brain diseases (such as alzheimer s disease and depression) or brain alterations (such as hippocampal atrophy) linked to long - term stress exposure. acting on the amygdala, gc help enhance the memory of emotionally relevant events through its connections with the hippocampus. this process seems also to be dose - dependent : intermediate levels of gc enhance memory consolidation, whereas extremely low or high levels tend to impair it. however, gc appear to have negative effects on memory retrieval, regardless of their blood levels. the effects of gc on memory are also supported by the wide distribution of gc within the central nervous system, with the existence of two types of receptors with affinity for glucocorticoids : type i, also called mineralocorticoid receptors, and type ii, or glucocorticoid receptors. type i receptors are highly expressed in limbic areas like the hippocampus and entorhinal cortex and seem to be associated with memory enhancement, whereas type ii receptors are distributed both in limbic areas (hypothalamus and hippocampus) and cortical areas, especially the prefrontal cortex and their preferential activation has been associated with memory impairment. increased levels and activity of gc could result in memory impairment through an alteration of brain circuits and biochemical processes responsible for memory formation and storage. a number of case control studies revealed detrimental effects of gc on declarative memory, including decreased memory performance in asthmatic children treated with high doses of prednisone, or a correlation between the levels of cortisol, acth and memory impairment in patients with cushing s disease, as well as a decrease in verbal memory performance (word list recall) following a low - dose dexamethasone administration in normal adults. in addition to impairment of previously learnt information, there is evidence that another type of episodic memory, the autobiographic memory (remembering episodes of one s own past) is impaired. in a double - blind, placebo - controlled study on 22 healthy male students, buss observed that the students receiving 10 mg hydrocortisone had a worse performance in an autobiographic memory test than those who were on placebo. it has been suggested that acute glucocorticoid administration is probably not responsible for causing significant hippocampal atrophy, such as the one produced by chronic elevated glucocorticoid levels, but temporary memory impairment could be due to a specific interplay of receptor activation and non - genomic pathways. moreover, in these subjects, gc impaired the retrieval of neutral events, whereas positive and negative events (emotionally relevant experiences) were only mildly affected, possibly because such events were better consolidated. the authors reasoned that the observed depression - associated hypercortisolemia could be responsible for the impairment of autobiographic memory retrieval observed in these patients. reported an enhancement of autobiographic memory retrieval in patients with post traumatic stress disorder (ptsd) following the administration of hydrocortisone as compared with healthy controls treated with the same dose, where an impairment of neutral information was observed. high gc levels induced by acute stress seem to have a variable impact on spatial memory. for instance, de quervain. observed an impairment of spatial memory retrieval in stressed rats compared to control rats during platform searching in a water - maze test. conrad. showed a similar spatial memory retrieval impairment in chronically - stressed rats during spatial tasks in the y maze. on the other hand, sandi. found that acute corticosterone exposure facilitated the storage of information in rats during tasks in morris water maze. stress - exposed rats (trained at 19c) or injected with corticosterone were able to learn faster and consolidate memory better than non - stressed rats, trained at 25c. social memory, a type of memory for person recognition, is mediated by the hippocampus and is also impaired by gc exposure. social stress is the stress response during social interactions with other persons and the subsequent acutely elevated cortisol levels could disrupt social memory through a non - genomic pathway involving membrane - associated glucocorticoid receptors. the hippocampus is highly influenced by increased levels of gc, either stress - induced or after exogenous administration. it has been evidenced that both age - related increase in gc levels [1317 ] and diseases associated with a chronic increase in cortisol levels, such as cushing s syndrome, major depressive disorder and post - traumatic stress disorder, are linked with hippocampal atrophy and dysfunction in humans. hippocampal atrophy is the result of several cellular and molecular events, which include downregulation of receptors, shrinkage of dendritic arborization, alteration of synapses, inhibition of ltp, impairment of energy metabolism, activation of nmda - dependent excitotoxicity. neuronal atrophy could be induced in part by a reduction of brain - derived neurotrophic factor (bdnf), a factor involved in the survival and trophicity of neurons and synapses. also, there is evidence of interactions between gc and serotoninergic system by 5-ht1a serotonin receptor modulation. pharmacological decrease of serotonin in the hippocampus resulted in a blockade of stress effects on memory, suggesting that serotonin could be involved in hippocampal damage during stress. however, malberg. reported a reversal of downregulation of neurogenesis in animals exposed to stress following treatment with a selective serotonin reuptake inhibitor. in fact, both in vivo and in vitro results showed that gc tend to inhibit neurogenesis through type ii receptor activation, while type i activation led to a mixed effect, some studies suggesting a decrease in neurogenesis and others actually an increase. moreover, it is worth noting that hippocampal atrophy is not only the consequence of high cortisol level, but also a cause. the hippocampal damage disrupts the normal inhibitory control on the hpa axis, leading to an excess of crh secretion and eventually to increased glucocorticoid levels, worsening the hippocampal atrophy. chronic exposure to gc results in a preferential activation of type ii receptors and induces neuronal death and attenuation of neurogenesis.. using magnetic resonance imaging (mri), hippocampal atrophy was described in patients with cushing s syndrome. resmini found that only patients with severe memory impairments showed a reduction of the hippocampal volume and identified older age as the only predictor of hippocampal reduction in both patients and controls matched for age, gender and years of education. however, both verbal and spatial memory were impaired in patients as compared yo with controls, even after cure. in experimental models, ohl showed in a study on male tree shrews that hippocampal reduction occurred in both cortisol - treated animals as well as in psychosocial stress - exposed group. in patients with unipolar depression, while some demonstrated a clear reduction in hippocampal volume, others have failed to find significant changes. recently, kohler suggested that cerebrovascular disease - induced white matter abnormalities are more important than the cortisol level for cognitive impairment in people with depression. despite the huge amount of evidence for gc - induced hippocampal damage, there are opinions against this concept. some studies revealed low levels of cortisol in patients with ptsd, arguing against the role of high cortisol levels in hippocampal damage. regarding this issue, it is possible that cortisol levels are elevated at the onset of this disease, and decreasing chronically. others have speculated that people who were born with a small hippocampus and a lower intelligence rather than stress itself are at risk for developing ptsd. this theory was criticized by observations that people with ptsd showed a decrease of their iq after the traumatic event. a reduction of the hippocampal volume was also found in metabolic disorders, such as type-2 diabetes mellitus, however this reduction was not correlated with diurnal cortisol level, but with a blunting of cortisol awakening response (car), a rise in cortisol post wake - up. while the reduction of hippocampal volume would be the cause of this ablated hpa axis response to awakening, knowing that hippocampal integrity is crucial for cortisol regulation, the actual hippocampal atrophy seems to be caused by hyperglycemia itself, through the formation of glycated end - products, generation of oxygen species and endothelial damage. alzheimer s disease (ad) is the most common neurodegenerative disease and the most common dementing illness. it affects primarily hippocampus - related memory, leading to a progressive loss of memory and other cognitive functions. while there are some theories regarding the neurobiology of this disease, no cure is known in present. clinical studies demonstrated that chronic stress and glucocorticoid levels can be a risk factor for ad and are associated with early hippocampal atrophy and cognitive decline [2731 ]. experiments on transgenic mice elucidated the pathophysiology of gc in ad - spectrum dementias, showing that gc influenced both amyloid deposition and tau hyperphosphorylation, chronic stress being a trigger for app misprocessing. hyperphosphorylation is induced by two kinases, glycogen synthase kinase 3 (gsk3) and cyclin - dependent kinase 5 (cdk5), both of them being stimulated by gc. on the other hand, gc appear to increase tau levels. moreover, gc stimulates -secretase, the enzyme starting the so - called amyloidogenetic pathway and increase app levels by increasing the transcription of app gene [3234 ]. an important thing to keep in mind is that transgenic rat neural cells expressing human tau gene (htau) are more vulnerable to gc - induced a pathology than cell lines with rat tau gene. the identification of an enzyme involved in cortisol metabolism, 11-hydroxysteroid dehydrogenase type 1 as a genetic susceptibility for ad further increased the evidence for gc role in molecular biology of this disease. a haplotype of this gene is associated with high levels of cortisol and an increased risk for developing ad. in addition, there are findings suggesting that high csf levels of cortisol are associated with the presence of apoe4, one of the three isoforms of apolipoprotein e involved in lipid circulation in central nervous system. apoe4 is at present the most studied genetic risk factor in the sporadic form of ad because of its role in a deposition. regarding the link between altered neurosteroidogenesis and ad, mackenzie. found no evidence of cortisol synthesis in the hippocampus and cerebellum in post - mortem samples from ad patients, despite high levels of cortisol in the blood and csf. stress adaptation and resilience are critical conditions for the organism s welfare and depend on highly complex nervous and endocrine networks, centered on the hpa axis. when a person s resources and stress - adapting mechanisms are affected, a series of biological and neuropsychological consequences develop. glucocorticoids are one of the most important players in stress resilience and have both beneficial and detrimental effects on declarative memory in a time - dependent, dose - dependent and receptor type - dependent fashion. chronic stress induces dysfunction of the hpa axis, leading to increased levels of glucocorticoids and impairment of different aspects of declarative memory (verbal memory, social memory, spatial memory) mainly through hippocampal damage. while chronic exposure to glucocorticoids results in hippocampal atrophy, in the amygdala, especially the baso - lateral complex, the effect is the opposite, namely an increase in dendritic arborization and spinogenesis of neurons. also, chronic stress can be a risk factor for the development of alzheimer s disease, especi ally when a genetic background and other environmental influences are present. | responses to stress are mediated by a complex network of the nervous and endocrine systems. glucocorticoids, which are among the most important players in stress resilience, may have important implications in the cognitive functions, particularly in the modulation of memory. declarative memory, the memory for facts, events and word meaning is the most studied type of memory on which glucocorticoids exert an influence, both positively through consolidation and negatively through impairment. these effects depend on the receptor type, dose, time of exposure, memory component and the salience of stimuli, retrieval being generally affected and storage being facilitated, especially for emotionally relevant events. glucocorticoids also induce hippocampal atrophy, which is a hallmark seen in various diseases accompanied by a chronic high level of cortisol, such as the cushing syndrome, major depression, post - traumatic stress disorder. also, chronic stress might be a risk factor for the development of alzheimer s disease, especially when a genetic background and other environmental influences are present. |
twenty - eight patients admitted to beijing 302 hospital in beijing, china, were enrolled in this study in september 2009. all patients had mild clinical courses and fulfilled the case definition for pandemic (h1n1) 2009 (3). median interval from onset of illness to hospitalization was 1 day (range 03 days), and median time of hospitalization was 7 days (range 614 days). serum samples were obtained from patients 1 day after illness onset and 4, 14, 36, and 48 days later for cytokine and antibody measurement. serum samples from 22 healthy persons were used to determine cytokine and antibody baseline levels. serum cytokine concentrations were detected by using the bd cytometric bead array human cytokine kit (bd biosciences, san jose, ca, usa) and a bd facscalibur flow cytometer, according to the manufacturer s instructions. cd3 t - lymphocyte counts were 27% of lymphocyte counts in 4 (14.3%) patients. fourteen (50.0%) patients had a cd4:cd8 ratio less than the standard reference ratio of 1.4. lymphocyte subsets were defined as the following combinations : cd3+/cd45 + for cd3 t - lymphocytes ; cd3+/cd4/+/cd45 + for cd4 t - lymphocytes ; cd3+/cd8+/cd45 + for cd8 t - lymphocytes ; cd19+/cd45 + for b - lymphocytes ; and cd3+/cd(16 + 56)+/cd45 + for natural killer cells. flow cytometric results showing development of peripheral blood lymphocyte subsets during the disease course were divided into 3 groups on the basis of time of illness onset until date of blood sample collection : 13, 46, or 710 days. these groups were used because the longest time from onset of illness to hospitalization was 3 days for all patients, and the peak temperature for patients was observed 3 days after illness onset. mean counts and percentages of all t- and b - lymphocyte subsets increased after 3 days of illness compared with results obtained during the first 3 days of illness (figure 1). however, the increase in cd8 and b cells was not significant. another study showed a decrease in cd4, cd8, and b cells 2 days of symptom onset in patients with pandemic (h1n1) 2009 than in healthy persons (4). our results show impaired adaptive immune responses and a gradual increase during recovery in mildly affected patients. flow cytometric analysis of peripheral blood lymphocyte subset counts of 28 patients with pandemic (h1n1) 2009, china. counts and percentages we measured serum cytokine concentrations and hemagglutination inhibition (hai) antibody titers in patients during hospitalization and the follow - up period (figure 2). we observed an increase in interleulin-6 (il-6) levels 1 day after illness onset, which were 6.0-fold higher than the baseline level, and a 2.3-fold increase in interferon- (ifn-) levels. these levels decreased to baseline levels 5 days after illness onset, although the il-6 level 5 days after illness onset was higher than levels 15 and 37 days after illness onset. the maximum il-10 level 1 day after symptom onset was 3.2-fold higher than the baseline level. this level decreased to a value lower than the baseline level within 4 days, and then gradually increased to the baseline level 37 days after illness onset. serum il-6, ifn-, and il-10 levels were not related to patient temperature 1 day after symptom onset, peak temperature during the disease, or period of fever. these levels showed minor differences that were not related to cough or sore throat in patients. serum cytokine concentrations and hemagglutination inhibition (hai) antibody titers of 28 patients with pandemic (h1n1) 2009 during hospitalization and the follow - up period 15, 37, and 49 days after symptom onset, china. serum concentrations of interferon- (ifn-), interleukin-10 (il-10), and il-6 are medians (pg / ml). serum hai antibody titers were transformed by using the natural logarithm and are shown as means. p<0.05 when il-6 or hai antibody levels were compared with those at day 5 ; p<0.05 when il-10 level was compared with those at baseline ; p<0.05 when il-10 level was compared with those at days 5 or 15 ; p<0.05 when value was compared with that at any other time point ; p<0.05 when value was compared with those at days 5, 15, or 49. only 1 patient had an hai antibody titer 10 (titer 20) 1 day after illness onset. the hai geometric mean titer increased 5 days after symptom onset compared with that 1 day after symptom onset and continued to increase until it reached a peak level of 137.9 at 37 days after symptom onset (25.5-fold increase). peak hai antibody titers 40 and 4-fold increases were observed in 27 (96.4%) patients. reported increased serum levels of il-6, ifn-, and tumor necrosis factor- in patients with pandemic (h1n1) 2009 during the first 5 days after symptom onset ; no difference in levels of these 3 cytokines was observed in patients with mild disease and controls (5). however, similar to another report (4), we detected increases of il-6 and ifn- levels in patients with mild disease during the first 3 days after symptom onset. these different patterns may be caused by different intervals from time of symptom onset to date of sample collection (5 days vs. 3 days) because il-6 and ifn- levels in our study quickly decreased to baseline levels 7 days after symptom onset. these results suggest that serum il-6 and ifn- levels may be increased in patients with pandemic (h1n1) 2009 within the first 3 days after symptom onset, followed by a decrease to baseline levels 5 days after symptom onset in patients with mild disease or a continuous increase in severely affected patients. il-6 and ifn- are associated with antiviral immune responses during influenza infection (68). however, continuous, excessive release of il-6 three days after illness onset likely contributed to serious pulmonary inflammation and tissue injury, as has been documented for severe acute respiratory syndrome and 1918 pandemic influenza, but this release could be tempered by production of il-10 (6,7,911). the proportion of persons 1860 years of age with a 4-fold increase in hai titer who received 1 dose (15 g) of monovalent pandemic (h1n1) 2009 nonadjuvant vaccine was 96.2%, and the proportion with an increased hai titer 40 was 97.1%, results similar to those of a recent study (12). however, the geometric mean titer in healthy vaccinated persons was 237.8, a 34.5-fold increase over the prevaccination titer, which was greater than that for patients naturally infected with pandemic (h1n1) 2009 virus (12). this finding may have resulted from impaired adaptive immune responses against pandemic (h1n1) 2009 virus in the initial phase, which included decreased numbers of cd4 and b lymphocytes and an increase in t regulatory cells (4). in conclusion, our data indicated changes in cellular profiles during pandemic (h1n1) 2009 virus infection ; showed that transient production of il-6, ifn-, and il-10 are main effectors of the early innate immune response against pandemic (h1n1) 2009 virus ; and indicated that adaptive immune responses are impaired in the initial phase after infection. these factors may help clarify the pathogenesis of pandemic (h1n1) 2009 virus and provide new approaches in overcoming severe infections. | we analyzed changes in immunologic values over time for 28 hospitalized patients with pandemic (h1n1) 2009. levels of interleukin-6, interferon-, and interleukin-10 increased 1 day after illness onset and then decreased to baseline levels. levels of virus - specific antibody were undetectable 1 day after illness onset and peaked 36 days later. |
fixation with plate / screw system is now a standard treatment modality for fractures, osteotomies, and reconstruction of defects of the cranio - maxillofacial skeleton. various types of plating systems have been developed from time to time for fixing fractures and in the continuity defects of the mandible. in conventional bone plate / screw system, the plate must be perfectly adapted to the underlying bone to prevent alterations in anatomically fractured fragments. there have also been incidents of loosening of one or more screws during the convalescence period, resulting in changes in occlusal relationship. this problem, to an extent, has been overcome by the development of locking plate / screw systems where the screw locks not only the bone but also the plate and serves as a mini - internal fixator. it is assumed that this relationship of plate and screw will reduce the number of fixation screws per osseous fragment, and thus, minimal hardware can achieve the same fixation objectives as with bulkier plating systems. cortical necrosis, which is observed in compression plates, is not noticed in locking plates since the plate gains its rigidity by locking the screw rather than by being compressed against the bone. to gain adequate stability, the locking plate need not be compressed or adapted against the underlying bone ; thus, stripping and loosening of the screws is not noticed in this system. this study was done to substantiate the possible advantages that are offered by new internal locking miniplates over conventional miniplates. bite force generated by the patient was recorded preoperatively and postoperatively after fixation of these plates on different days in patients for the same type of fractures of mandible. comparative evaluation of bite force was done, so that masticatory efficiency offered by these two plating systems can be assessed, which in turn gives an idea of the stability achieved postoperatively after fixation. this study was carried out on 20 patients who suffered from fractures of mandible in the region from symphysis to the body of the mandible. no sex predilectionnormal healthy individuals with no debilitating systemic diseasessingle, non - comminuted mandibular fractures excluding condylar and coronoid processesall patients who could be treated either intraorally or extraorallyfollow - up at regular intervals for a period of 6 weeks. normal healthy individuals with no debilitating systemic diseases single, non - comminuted mandibular fractures excluding condylar and coronoid processes all patients who could be treated either intraorally or extraorally follow - up at regular intervals for a period of 6 weeks. preoperatively, bite force recording was done on fractured and contralateral side before fixing erich arch bar. patients were randomly divided into two groups : group a- ten patients who had undergone osteosynthesis for the fracture of mandible using single 4-hole, with / without gap, stainless steel internal locking miniplate (2.0 mm system) (sk surgicals, pune, maharashtra) group b- ten patients who had undergone osteosynthesis for mandibular fracture using two 4-hole, with / without gap, stainless steel conventional miniplates (2.0 mm system) (sk surgicals) patients were operated under anesthesia (general / local) following strict asepsis. sublabial / degloving incision was made ; reflection of mucoperiosteal flap was done leading to exposure of fracture fragments. blunt dissection was performed ; periosteum was incised leading to exposure of fractured fragments. in a few patients, anatomical reduction of fracture fragments was done, followed by intermaxillary fixation with the help of tie wires. fixation in group a patients was done using single 4-hole, with / without gap, stainless steel internal locking miniplate, keeping at least two holes on each side of the fracture line [figure 1 ]. fixation with single inter - locking plate fixation in group b patients was done using two stainless steel, 4-hole, with / without gap miniplates, keeping at least two holes on each side of the fracture line [figure 2 ]. fixation with two miniplates after bone plate fixation, intermaxillary fixation was released and the occlusion checked. this was accomplished by instructing the subject to bite as forcefully as possible and the bite force values were recorded. bite force recordings were done preoperatively before fixing erich arch bar and postoperatively at each follow - up (7, 14, 21, 28, and 90 day) [figures 3 and 4 ]. bite force recording on non - fracture site bite force recording on fracture site bite force measurements were made using indigenous bite force recorder in 50 normal healthy individuals belonging to different age groups at different sites between incisors and molar region. mean bite force was 15 kg and 20 kg for females and males, respectively, at the incisor region and 33 kg and 40 kg for females and males, respectively, at the molar region. out of the 20 patients treated, 18 (90%) were males and 2 (10%) were females ; the percentage of sexual distribution was same in both the groups, with a mean age of 27.2 years the youngest patient was 14 years old and the eldest was 46 years old. the etiology was road traffic accident in 12 (60%) patients, assault in 1 (5%) patient, and miscellaneous causes in the remaining 7 (35%) patients which include falls or occupational injuries. the duration of time from injury to the time at which definitive management was accomplished ranged from 1 to 10 days, with a mean of 7.4 days/3.5 days. out of 20 fractures, 7 (35%) patients had single parasymphysis fracture and 13 (65%) patients had body fractures. in 10 patients, step and deformity was noticed on palpation, there was associated existing extraoral soft tissue injury in 6 (30%) patients, and clinical examination was difficult in 7 (35%) patients due to reduced mouth opening. after application of locking plates, all the fractures appeared to be well reduced and stable. postoperatively, mobility of fracture fragments or occlusal discrepancies were not noticed in any patient. two (20%) patients developed infection at the site of wound, which was drained and got resolved on administration of antibiotics. after application of conventional miniplates the difference in mean bite forces preoperatively was 7.47 kg, when comparison was done between fractured and contralateral non - fractured sites in all 20 patients over the control group. then it was recorded as 9.42 kg, 8.72 kg, 8 kg, and 2.27 kg on the 14, 21, 28, and 90 days, respectively [graph 1 ]. mean percent bite force over control group in fractured and contra lateral non fractured site at various post operative days (a) the difference in mean bite force was 0.62 kg when comparison was done between group a with that of group b on the fractured side of molar over the control group preoperatively ; postoperatively, it was 3.78 kg, 1.85 kg, 2.72 kg, 2.38 kg, and 4.21 kg on 7, 14, 21, 28, and 90 days, respectively [graph 2 ]. mean percent bite force over control in group a and group b at various posts operative days in premolar and molar regions (b) the difference in mean bite force when comparison was done in group a with that of group b on the fractured side of incisors over the control group preoperatively was 0.76 kg ; postoperatively on the 7 day, it was 4.43 kg. then it was recorded as 4.32 kg, 3.79 kg, 3.38 kg, and 3.66 kg on 14, 21, 28, and 90 days, respectively [graph 3 ]. mean percent bite force over control in group a and group b at various posts operative days in incisor region no sex predilectionnormal healthy individuals with no debilitating systemic diseasessingle, non - comminuted mandibular fractures excluding condylar and coronoid processesall patients who could be treated either intraorally or extraorallyfollow - up at regular intervals for a period of 6 weeks. normal healthy individuals with no debilitating systemic diseases single, non - comminuted mandibular fractures excluding condylar and coronoid processes all patients who could be treated either intraorally or extraorally follow - up at regular intervals for a period of 6 weeks. preoperatively, bite force recording was done on fractured and contralateral side before fixing erich arch bar. patients were randomly divided into two groups : group a- ten patients who had undergone osteosynthesis for the fracture of mandible using single 4-hole, with / without gap, stainless steel internal locking miniplate (2.0 mm system) (sk surgicals, pune, maharashtra) group b- ten patients who had undergone osteosynthesis for mandibular fracture using two 4-hole, with / without gap, stainless steel conventional miniplates (2.0 mm system) (sk surgicals) sublabial / degloving incision was made ; reflection of mucoperiosteal flap was done leading to exposure of fracture fragments. blunt dissection was performed ; periosteum was incised leading to exposure of fractured fragments. in a few patients, anatomical reduction of fracture fragments was done, followed by intermaxillary fixation with the help of tie wires. fixation in group a patients was done using single 4-hole, with / without gap, stainless steel internal locking miniplate, keeping at least two holes on each side of the fracture line [figure 1 ]. fixation with single inter - locking plate fixation in group b patients was done using two stainless steel, 4-hole, with / without gap miniplates, keeping at least two holes on each side of the fracture line [figure 2 ]. fixation with two miniplates after bone plate fixation, intermaxillary fixation was released and the occlusion checked. this was accomplished by instructing the subject to bite as forcefully as possible and the bite force values were recorded. bite force recordings were done preoperatively before fixing erich arch bar and postoperatively at each follow - up (7, 14, 21, 28, and 90 day) [figures 3 and 4 ]. bite force measurements were made using indigenous bite force recorder in 50 normal healthy individuals belonging to different age groups at different sites between incisors and molar region. mean bite force was 15 kg and 20 kg for females and males, respectively, at the incisor region and 33 kg and 40 kg for females and males, respectively, at the molar region. out of the 20 patients treated, 18 (90%) were males and 2 (10%) were females ; the percentage of sexual distribution was same in both the groups, with a mean age of 27.2 years the youngest patient was 14 years old and the eldest was 46 years old. the etiology was road traffic accident in 12 (60%) patients, assault in 1 (5%) patient, and miscellaneous causes in the remaining 7 (35%) patients which include falls or occupational injuries. the duration of time from injury to the time at which definitive management was accomplished ranged from 1 to 10 days, with a mean of 7.4 days/3.5 days. out of 20 fractures, 7 (35%) patients had single parasymphysis fracture and 13 (65%) patients had body fractures. in 10 patients, step and deformity was noticed on palpation, there was associated existing extraoral soft tissue injury in 6 (30%) patients, and clinical examination was difficult in 7 (35%) patients due to reduced mouth opening. after application of locking plates, all the fractures appeared to be well reduced and stable. postoperatively, mobility of fracture fragments or occlusal discrepancies were not noticed in any patient. two (20%) patients developed infection at the site of wound, which was drained and got resolved on administration of antibiotics. after application of conventional miniplates, all fractures appeared to be well reduced and stable. the difference in mean bite forces preoperatively was 7.47 kg, when comparison was done between fractured and contralateral non - fractured sites in all 20 patients over the control group. then it was recorded as 9.42 kg, 8.72 kg, 8 kg, and 2.27 kg on the 14, 21, 28, and 90 days, respectively [graph 1 ]. mean percent bite force over control group in fractured and contra lateral non fractured site at various post operative days (a) the difference in mean bite force was 0.62 kg when comparison was done between group a with that of group b on the fractured side of molar over the control group preoperatively ; postoperatively, it was 3.78 kg, 1.85 kg, 2.72 kg, 2.38 kg, and 4.21 kg on 7, 14, 21, 28, and 90 days, respectively [graph 2 ]. mean percent bite force over control in group a and group b at various posts operative days in premolar and molar regions (b) the difference in mean bite force when comparison was done in group a with that of group b on the fractured side of incisors over the control group preoperatively was 0.76 kg ; postoperatively on the 7 day, it was 4.43 kg. then it was recorded as 4.32 kg, 3.79 kg, 3.38 kg, and 3.66 kg on 14, 21, 28, and 90 days, respectively [graph 3 ]. mean percent bite force over control in group a and group b at various posts operative days in incisor region rigid internal fixation (rif) was considered an unacceptable mode of therapy until 1958 because of high rate of associated complications. during the ensuing 20 years, reconstructive surgeons witnessed tremendous improvement in the development of rif, which has led to a more acceptable complication rate. more recently, authors have reported decreasing complication rates, especially related to operator 's experience. the semi - rigid system with monocortical plates and screws is currently used universally for the fixation of bony fractures in the maxillofacial region. the miniplate system gives sufficient support and stability to bone fragments, allows precise anatomical reduction, and is easy to use. proponents of the rif believe that prevention of interfragmentary mobility is the key to success and should be the goal when treating fractures. a longstanding problem in miniplate osteosynthesis has been loosening of one or more screws and the plate must be adapted meticulously to the contours of the bone, as errors in fixation will result in permanent malocclusion. these problems have been overcome by development of a screw which locks not only to the bone but also to the bone plates. the past 10 years have witnessed the use of locking plate / screw systems in maxillofacial surgery. these plates function as internal fixators, and stability is achieved by locking the screw to the plate. the locking mechanism is such that the hole in the bone plate is engineered to accept screws that lock to it by the thread under the head of the screw, i.e. one thread will engage the bone and another will engage a threaded area of the bone plate, and this provides several potential advantages to such fixation devices. the main advantage of the locking plate over the conventional plate is that the locking plate does not require precise adaptation of the plate to the underlying bone. as the screws are tightened, they lock to the plate, thus stabilizing the segments without the need to compress the plate to the bone. a second advantage of locking plate / screw system is that the screws are unlikely to loosen from the bone plate even if the screw is inserted into the fracture gap or a comminuted segment ; hence, there is decreased incidence of inflammatory complications from loosening of the plate and screws. one more potential advantage in locking plate / screw system is that it does not disrupt the underlying cortical bone perfusion or the vascular supply of bone, and allows the periosteoum to grow under the plates, supporting fracture healing. this avoids the cortical necrosis which is sometimes seen under the plate which is compressed against the bone. evaluate the mechanical stresses over the bone and hardware after sagittal split ramusosteotomy (ssro) fixed with standard titanium or locking plate / screws using finite element analysis. a 3-dimensional finite element model of the mandible was created, and ssro and 5 mm advancement was simulated on a computer model. the model was fixed with either 2.0-mm titanium conventional miniplate / screw or 2.0-mm titanium locking miniplate / screw system, and oblique 200 n bite forces were applied. this study also concluded that locking miniplates system spreads the load over the plates and screws and diminishes the amount of force transferred to each unit. so, locking plates is efficacious enough to bear the masticatory loads during osteosythesis of fracture and provides the advantage of a greater bite force. did a biomechanical comparison between locking and non - locking plates to determine the degree of plate adaptation affecting the stability by using 130 polyurethane synthetic mandible replicas. in their study, they observed that the degree of plate adaptation affected the mechanical behavior of non - locking plates but did not affect the locking plates. gerlaeh and schwarz evaluated the maximal biting forces in 22 patients with fractures of angle of mandible treated with miniplate osteosynthesis as per champy 's tension banding principle. an electric test procedure for evaluating the load resistance between the incisors, canines, and molars they revealed that after 1 week of surgical treatment of fractures, only 31% of the maximal vertical loading found in controls was registered. these values increased to 58% at the 6 week postoperatively. in our study, the operated sites of molars in patients treated with internal locking miniplates generated a bite force of 40% on day 7, 47% on day 14, 56% on day 21, 63% on day 28, and 92% on day 90, compared to the control group. similarly, bite force generated postoperatively by patients treated with conventional miniplates on the operated sites of molars was 33% on day 7, 46% on day 14, 52% on day 21, 60% on day 28, and 89% on day 90, compared to the control group. when the operated sites of incisors were taken into consideration, patients in group a generated bite force of 57% on day 7, 71% on day 14, 82% on day 21, 87% on day 28, and 102% on day 9, compared to the control group. similarly, bite force generated in the operated sites of incisors by patients treated with conventional miniplates was 36% on day 7, 55% on day 14, 67% on day 21, 78% on day 28, and 93% on day 90, in comparison to the control group. this difference in bite force which was generated by patients in group a in comparison to group b patients over the control group is statistically inconclusive, because the size of sample was limited. the results obtained from the study done by tams. showed that one bone plate is sufficient for symphysis fractures, as well as in the treatment of mandibular body fractures. in our study, we found that fixation of fractures of parasymphysis and the body of mandible by a single locking plate provided sufficient stability when compared to two plates being used for fixation of the same type of fractures by conventional miniplates. we had achieved the same fixation objectives by using single locking plate against two miniplates used for fixation of same type of fracture. in our study, we did not notice fracture site mobility in any patient. this is in agreement with kallela. where they found that the fracture site stability is dependent on the rigidity produced by the plate and screw system. collins. carried a prospective study comparing 2 mm locking plates and 2 mm conventional plates in mandibular fractures, in which surgical technique that was used to apply both the plating systems was the same. all fractures appeared to be well reduced and postoperative radiographs taken within the first 2 days showed excellent reduction., all fractures appeared to be well reduced and stable, and postoperative radiographs confirmed the adequacy of reduction ; we did not encounter intraoperative difficulties in the form of screw being not locked with the plates. ellis and graham had mentioned that locking plates require precisely centered drill hole with the plate hole to ensure perpendicular placement of the screw. if screws are not placed perpendicular to the plate, the screw will not engage the threaded plate hole adequately and therefore will not lock ; this is considered to be one of the disadvantages of locking plate / screw system. in the study done by tunovien. the infection may be treated conservatively by draining pus if present and packing with whitehead 's varnish or impregnated gauze. similarly, ellis and graham treated postoperative infection in the out - patient setting with incision and drainage, irrigation, and oral antibiotics. locking head screws have a reduced tendency to loosen, which decreases the rate of postoperative infection and failure. in our study, 2 (20%) patients treated with locking plates / screw systems and 2 (20%) patients treated with conventional miniplates / screw system developed infection at the site of wound which was drained and got resolved on administration of antibiotics. the results obtained from our study show that the mean difference of biting force in patients treated with internal locking miniplates / screw system and in patients treated with conventional miniplates / system over the control group was statistically insignificant. when comparisons was done regarding outcome of treatment and complications noticed between patients treated with internal locking miniplates / screw system and patients treated with conventional miniplates / system, statistically insignificant results were obtained. it was observed in our study that patients treated with locking plate / screw system postoperatively generated more bite force compared to those treated with conventional miniplates / screw system. hence, it provides adequate stability and reduces the amount of hardware with minimum chances of loosening of screws and cortical necrosis. only the cost of hardware is increased by 8 - 10% when locking plate / screw system is used, compared to conventional miniplates / screw system. | aims and objectives : the aim of present study was to compare the stability of fractured mandibular fragments under functional load, when fixed with conventional miniplate and internal locking miniplate.materials and methods : bite force (in kg) recorded in twenty mandible fractured patients and fifty normal healthy individuals. bite force was measured at incisor and molar regions. comparative evaluation of bite force generated was performed between 10 cases treated with conventional miniplates and 10 cases treated with internal locking miniplates. bite force generated by patients in mandibular fracture between symphysis and the angle of mandible was recorded in incisor and molar regions preoperatively. the fracture fragments were fixed using the above fixation techniques. then same recording was undertaken on the 7th, 14th, 21st, 28th, and 90th days postoperatively.results:bite force generated by patients treated with locking plates at the 7th, 14th, 21st, 28th, and 90th postoperative days was significantly higher as compared to those in patients treated with miniplates.conclusion:it was observed in our study that the locking plate / screw system offers significant advantages over the conventional plating system. there are no intraoperative difficulties associated with placement of the plate. |
obesity is a risk factor for five of the top ten causes of death in the united states (cardiovascular disease, cancer, stroke, diabetes, and kidney disease) and associated conditions such as hypertension, dyslipidemia, and sleep apnea. although weight gain is often discussed as a matter of individuals behavioral choices (i.e., diet, physical activity), the importance of environmental factors, including working conditions, is increasingly recognized. some studies have examined weight gain as a consequence of job strain, but results have been inconclusive especially for women. two cross - sectional studies reported that high job strain was associated with greater body mass index (bmi) for women, but the few large - scale longitudinal studies have not provided consistent evidence for the link between job strain and subsequent weight gain or obesity incidence. these inconsistent findings may be partly explained by the possibility that associations of job strain with weight gain are not uniform across the range of baseline bmi : in particular, a tendency of initially overweight people to gain weight under stress, countered by a tendency of people who were initially on the lower spectrum of bmi to lose weight under stress. using the whitehall ii data, kivimki. demonstrated that during a 5-year follow - up period, among those who reported high job strain at baseline, men with low baseline bmi (27 block. found similar evidence of effect modification by baseline bmi for both job demands and job control for men ; but for women, the association was significant only for job demands. in both studies, job strain and its components (i.e., job control, job demands) were measured only once at baseline, and therefore they could not account for potential change in the exposure during the follow - up period. in the japan work stress and health cohort study, ishizaki. measured job strain twice and examined the association between the chance in job strain and change in bmi over 6 years among 1371 women and 2200 men. overall they found no significant associations, and the pattern of bmi gain and job strain exposure was quite similar across different levels of baseline bmi. this study further examines the association between job strain and bmi change by including the possibility of effect modification by baseline bmi as well as changes in job strain exposure over time. more specifically, we expect that the greater the baseline bmi is, the greater the effect of job strain on bmi gain. we used data from over 52 000 working women participating in the nurses health study ii to evaluate the relation between change in job strain and change in bmi over a 4-year period. this is a prospective analysis of data from the nurses health study ii (nhsii), an ongoing cohort study started in 1989 with 116 430 female registered nurses, age 2542 at the time of enrollment. every two years since 1989, these women have been providing a wide range of information on health, lifestyle, health behavior, and work characteristics through self - administered questionnaires. job strain was measured twice, in 1993 and 1997 ; this analysis uses the 1993 data as baseline and 1997 data as follow - up. at baseline, 87 021 women participated ; of those, 71 694 (82.4%) women provided data also at follow - up. those who did not provide follow - up data were more likely to be obese (19% vs. 15%), african american (3% vs. 1%), a current smoker (14% vs. 10%), and reported high job strain in 1993 (22% vs. 20%). we excluded 2568 who developed cancer before 2001 because cancer may have affected their weight before diagnosis. those who were not working (n=12 593) or who were pregnant (n=2358) at either baseline or follow - up were excluded. in addition, those with missing data on job strain (n=500) or body weight (n=3273) were excluded ; so were women with a bmi value less than 15 or greater than 50 (n=314). after exclusions, 52 656 women (73.4% of those who were present at baseline and follow - up) were included in the current analysis. those who were included and those who were excluded had nearly identical distributions of all study variables, including the baseline bmi and job strain exposure. body mass index (bmi, weight (kg)/height (m)) was calculated using the data on height reported at the enrollment in 1989 and the current body weight reported in 1993 and 1997. in the analysis, we subtracted the 1993 bmi from the 1997 bmi and used the change as a continuous outcome. a previous validation study confirmed that the self - reported measures of anthropometry were highly correlated with technician - measured data (r = 0.98) in a validation subsample. psychological job demands and job control, the components of job strain, were assessed using karasek s job content questionnaire. psychological job demands are measured with five items, and job control with nine items. we calculated the mean score for each scale after applying reverse coding to make higher scores indicate stronger endorsement for experiencing job demands and job control. cronbach s alpha in this sample was.73 for job demands, and.80 for job control. scores were dichotomized at the median in order to define high job strain as a combination of high job demands (i.e., above median) and low job control (i.e., below median). women were categorized according to their baseline job strain and changes in job strain during follow - up in accordance with previous studies. information on age, race / ethnicity, smoking and pregnancy history was obtained at baseline in 1989. pregnancy history and smoking were updated in each follow - up questionnaire. average sleep duration over a 24-hour period (5 lbs (2.27 kg), 15.4% lost > 5 lbs, and 33.8% maintained the weight within 5 lbs. the average change in bmi was 0.87 kg / m, which translates as 5.25 lbs (2.38 kg) increase for the woman of the average height in this sample (5 feet 5 inches (1.65 m)). figure 1 shows the median change in bmi by baseline bmi category (underweight : bmi<18.5 ; normal : 18.524.9 ; overweight : 2529.9 ; class i obesity : 30.034.9 ; class ii and iii obesity : 35.0). those who were lower and higher ends of the baseline bmi distribution tended to have a smaller average increase than those who were in the middle of the distribution. table 2 summarizes the regression analysis results by showing the mean difference in bmi change associated with baseline bmi, baseline bmi squared, job strain change categories, and the interaction between baseline bmi and job strain change. model 2 had additional adjustments for job types at both baseline and follow - up as well as behavioral covariates at baseline ; however, as shown in table 2, including these additional covariates did not materially change the results. the main effect of job strain change was statistically significant : on average, those who experienced job strain change in either direction (decreased or increased) had a greater bmi gain (b=0.063 0.077, p=0.01 0.03) than those with no job strain exposure at either time point. women who experienced job strain at both times also gained bmi compared to women who experienced job strain at neither time, and the bmi gain for them was greater than for women who reported high job strain at only one of the two time periods. the interaction between baseline bmi and job strain change was statistically significant (p=0.015), which indicates that the relationship between job strain change and bmi change depends on each woman s baseline bmi. the positive and significant regression coefficient for the interaction between baseline bmi and job strain that remained high (b=0.022, p=0.001) indicates that the greater the baseline bmi, the greater the bmi gain associated with job strain that remained high. the nature of this interaction is illustrated in figure 2 as marginal means of bmi change by job strain change and baseline bmi. the differences in bmi change among the four job strain change groups are not prominent in the under- and normal weight range. however, among women whose baseline bmi was in the overweight or obese range, the difference between job strain that remained low (gray solid line) and job strain that remained high (black solid line) is greater ; that is, those who experienced job strain at both times gained more bmi than those whose job strain remained low, and the greater the baseline bmi, the greater the bmi gain associated with job strain that remained high. those who experienced high job strain only once, either at baseline (job strain decreased, gray dotted line) or at follow - up (job strain increased, black dotted lines) had a greater bmi gain, as described in the previous paragraph. the magnitude of bmi gain associated with increased or decreased job strain is uniform across the full range of baseline bmi (i.e., interaction was not significant). as a sensitivity analysis, we conducted the same regression analysis with those who did not change job types (e.g., emergency room nursing, operating room nursing, nursing management) between baseline and follow - up because taking a different type of job could be a stressful event that impacts bmi change regardless of change in job strain that may or may not accompanied the job change. the results were similar to the full sample results, both the main effect and interaction, which suggest that change in job types did not impact the association between job strain and bmi change. this study examined the association between the change in job strain exposure and the change in bmi over 4 years among more than 52 000 working women. our specific focus was to test whether the effect of job strain on bmi gain would be greater for women whose baseline bmi was at the higher end of the spectrum. the analysis indicated that experience of job strain at baseline, follow - up, or both times were associated with a greater bmi gain. moreover, the higher the baseline bmi, the greater the bmi gain associated with job strain that remained high. this study clarifies previous inconsistent findings for women by using a large sample size and multiple measurements of both job strain and bmi as well as by accounting for a quadratic relationship between baseline bmi and bmi change over time. our data showed that the bmi gain associated with constantly high job strain is greater for women who had a higher bmi at baseline. three previous studies took similar approaches to examining the association between bmi change and job strain change, yet reported different findings.. followed 722 women over 9 years to examine the interaction between baseline bmi and a baseline measure of job demands. their results were similar to ours : the interaction was significant in that the bmi increase associated with job strain was greater for initially obese women than for normal and overweight women. a limitation of the block study is that because they measured job demands only once at baseline, the bmi change after 9 years was averaged across groups who may have experienced job demand changes during the 9 year follow - up period. ishizaki.s study of japanese workers had two measurements of job strain 6 years apart and categorized the change in job strain the same way we did in this study. among the 1370 women, however, ishizaki. did not find support for baseline bmi moderating the association between job strain change and bmi change. this could be due to the smaller sample size, the smaller proportion of overweight and obese women (14% in this japanese sample), and also a further loss of statistical power by categorizing the baseline bmi distribution. eek and stergren accounted for the baseline bmi in quartiles while they examined the associations between job strain change and bmi change over 5 years with nearly 5500 women in the scania public health cohort study. although they did not include the interaction term, their findings for middle - aged women are similar to the main effect of job strain change in our analysis. while cross - sectional studies and some prospective studies with job strain measured only at the baseline reported inconsistent findings, the current study together with eek and stergren provides stronger evidence for the link between job strain and women s weight gain over time. both physiological and behavioral paths from job strain exposure to weight gain have been suggested. exposure to chronic stress, including job strain, results in neuroendocrine dysregulation, such as increased cortisol production and disruption of diurnal cortisol curve, which is associated with greater bmi and waist circumference as well as higher intra - abdominal fat. this association is especially prominent among women, and there has been a report suggesting that obese women may be more vulnerable to stress - induced disturbance of cortisol production, which offers potential explanation for our findings. in addition to these physiological changes, exposure to job strain may also lead to unhealthy behaviors, but so far research findings are inconsistent. our results suggest that one explanation for previous inconsistent findings may be those with higher bmi being more prone to developing unhealthy behavioral habits under stress. although its methodological shortcomings have been pointed out, a recent pooled longitudinal analysis of 4 european studies showed that among those who did not have a healthy lifestyle at the baseline, high job strain exposure was associated with a lower likelihood of adopting healthy behaviors. important future research questions include whether job strain leads to unhealthy behaviors and whether the link is stronger for overweight and obese individuals. in our sample, women who reported high job strain only at baseline or follow - up had on average greater bmi increase than those who reported no job strain at either time. eek and stergren found a similar result. if the women had been exposed to high job strain for a long time before the baseline, the effect may linger even if the exposure diminished during the study period. those who reported high job strain only at baseline were more likely to have changed the types of jobs during the study period than those who reported no strain at both times (46.3% vs. 37.3%). potentially as a result of the job change, their job strain declined, but other job characteristics may have changed as well. for example, it is common for nurses who are new to the workplace to take less desirable shifts, which might result in weight gain. moreover, changing jobs in and of itself could be stressful, especially if the job change was not voluntary. however, our sensitivity analysis showed that job change was not a likely factor to alter the association between job strain and bmi change in this sample. this study has a number of strengths such as a large sample size, well - established measure of job strain, and prospective design. nevertheless, the interpretation of the results should take into account the following data limitations. obesity is strongly patterned by socioeconomic status (ses), often measured by income, education, and occupation. for this analysis, household income was not available, although the participants were all registered nurses with roughly similar educational backgrounds. examining weight change in a socioeconomically somewhat homogeneous sample (i.e., a single - occupation sample) limits generalizability of our findings ; however, single - occupation samples have its advantages as well because the homogeneous sample helps to separate the effect of job strain from that of ses. we did control for the type of the nursing job, which could be a rough proxy to ses (e.g., nurse administration, nursing education, er nurse). in our sample, both the job control and demands scales had a full - range, normal distribution. moreover, the mean job demands and control scores differ significantly across different types of nursing jobs : the mean job control score was the highest for nursing educators and administrators and the lowest for er and or nurses, whereas the mean job demands score was the highest for er and or nurses as well as nurse administrators. this mitigates the concern that a single occupation sample may limit the variability of the job demands and job control scores. although the job type had a significant association with bmi change (data not shown), including the variable did not change the regression coefficients for the job strain main effect or interaction. the same was true for the sleep variable. because sleep was recalled retrospectively in 2009, the validity of the data is questionable ; however, the presence or absence of this variable did not change the main results. all study variables, including height and weight, were collected via self - report, which is subject to various biases. in a validation subsample, the self - reported measures of anthropometry were highly correlated with technician - measured data (r = 0.98). in addition, because this analysis used the change in bmi as the dependent variable, the potential downward bias is unlikely to have affected our results. finally, we followed the standard formulation of job strain, which involves dichotomizing the job control and demands scores at the sample median score. this could lead to misclassification of exposure to those who scored on the median score and biases the results toward the null. we acknowledge this limitation, but in order to make comparisons with other studies easier, we followed this widely accepted procedure. future research should also examine other types of job stress such as effort - reward imbalance. this analysis of over 52 000 working women s weight change over 4 years showed that the association between job strain and weight gain is stronger for those with higher baseline bmi. this finding is directly applicable to over 3 million registered nurses in the united states. we contribute to job stress research by providing methodologically sound analysis of women s data in a sample large enough to detect interactions between variables. our findings identify that women with higher bmi are more vulnerable to weight gain if they were exposed to high job strain. future research focusing on mediating mechanisms between job strain and weight gain should explore the possibility of differential responses to job strain by initial weight. finally, our findings underscore the importance of an integrated approach toward obesity prevention in the workplace between health promotion (traditionally focuses on individual health behaviors) and occupational safety (addresses changes in work characteristics, including job stressors, to reduce adverse health impacts) as the national institute for occupational safety and health (niosh) advocates in its total worker health program (http://www.cdc.gov/niosh/twh/). occupational safety and health practitioners and health promoters should be aware of the different vulnerability to work stress by bmi levels, and intervention resources should be allocated more toward those who are already overweight and exposed to work stress. | objectivesthe relationship between job strain and weight gain has been unclear, especially for women. using data from over 52 000 working women, we compare the association between change in job strain and change in bmi across different levels of baseline bmi.subjects/methodswe used data from participants in the nurses health study ii (n=52 656, mean age = 38.4), an ongoing prospective cohort study. using linear regression, we modeled the change in bmi over 4 years as a function of the change in job strain, baseline bmi, and the interaction between the two. change in job strain was characterized in four categories combining baseline and follow - up levels : consistently low strain [low at both points ], decreased strain [high strain at baseline only ], increased strain [high strain at follow - up only ], and consistently high strain [high at both points ]. age, race / ethnicity, pregnancy history, job types, and health behaviors at baseline were controlled for in the model.resultsin adjusted models, women who reported high job strain at least once during the four - year period had a greater increase in bmi (bmi=0.060.12, p<0.05) than those who never reported high job strain. the association between the change in job strain exposure and the change in bmi depended on the baseline bmi level (p=0.015 for the interaction) : the greater the baseline bmi, the greater the bmi gain associated with consistently high job strain. the bmi gain associated with increased or decreased job strain was uniform across the range of baseline bmi.conclusionswomen with higher bmi may be more vulnerable to bmi gain when exposed to constant work stress. future research focusing on mediating mechanisms between job strain and bmi change should explore the possibility of differential responses to job strain by initial bmi. |
sexual dimorphisms are widespread and variable in nature and can result from either natural or sexual selection acting differentially on male and female traits [14 ]. often, extensive mate - choice experiments, predation experiments, or documentation of sex - specific life histories need to be performed in single species before we understand which form of selection led to the evolution of the sex - specific traits. a complementary approach to direct experimentation, however, is to survey the patterns of sexual dimorphism across a group of closely related organisms and discover whether these are congruent with the findings obtained for single members of the group. these comparative studies across species can help address whether the experimental knowledge obtained for a few species is generalizable across species. the eyespots in the nymphalid butterfly species bicyclus anynana have been the subject of multiple laboratory experiments that concluded that they are likely evolving under both natural and sexual selection. mate choice experiments as well as predation and mark - recapture experiments indicated that the dorsal eyespots are involved in mate signaling, whereas ventral eyespots play a role in deflecting the attacks of vertebrate predators [58 ]. in addition, this species is sexually dimorphic regarding eyespot number with females displaying, on average, one more hindwing dorsal eyespot than males (e. westerman, pers. comm.). comparative studies performed across 54 species in the genus bicyclus indicated that eyespots on the dorsal and forewing surfaces were likely evolving under disruptive sexual selection, whereas eyespots on the ventral and hindwing surfaces were likely evolving under stabilizing natural selection. in addition, patterns of eyespot gains and losses, explored separately across males and females of the genus, showed that sexual dimorphisms were likely the result of both sex - limited gains and sex - limited losses of eyespots, most often leading to females becoming the more ornamented sex. outside of bicyclus, it is currently unclear whether female - biased eyespot ornamentation is a typical feature of nymphalid butterflies and whether eyespots in particular wing surfaces are especially prone to evolve sexual dimorphism. in order to address these questions we documented the presence or absence of eyespots across the dorsal and ventral wing surfaces of both males and females in 450 different nymphalid species belonging to 399 different genera. we used these presence / absence data to quantify sexual dimorphism and evaluate how dimorphism was distributed across the wing surfaces. we scored eyespot wing patterns from a collection of digital images previously taken from two male and two female specimens from pinned collections housed at the peabody museum, yale university, the museum or comparative zoology, harvard university, and the american museum of natural history, new york. we scored the representatives of 399 genera previously sampled for a molecular phylogeny of the nymphalidae and 51 additional species, for a total of 450 species. eyespots were defined as circular pattern elements on the wing margin with at least two concentric rings of colored scales or with a single color disc and a central pupil. eyespots were scored as present (1) or absent (0) for each of the wing compartments depicted in figure 1. we investigated two aspects of eyespot sexual dimorphism as follows.for a rough estimate of a species dimorphism, we tallied the total number of eyespots on each wing surface, and across all surfaces for each sex, and calculated the difference in this number between sexes.in order to determine if dimorphic eyespots were uniformly distributed among the wing surfaces or preferentially located on particular surfaces, female eyespot values were subtracted from male eyespot values for each wing compartment bearing eyespots within a species, and these quantities were compared across wing surfaces (figure 1). for a rough estimate of a species dimorphism, we tallied the total number of eyespots on each wing surface, and across all surfaces for each sex, and calculated the difference in this number between sexes. in order to determine if dimorphic eyespots were uniformly distributed among the wing surfaces or preferentially located on particular surfaces, female eyespot values were subtracted from male eyespot values for each wing compartment bearing eyespots within a species, and these quantities were compared across wing surfaces (figure 1). of the 450 species surveyed for this study, 278 (61.8%) had at least one eyespot on their wings. from these, 60 species (21.6%) had no difference in total eyespot number between males and females (but they were often dimorphic in eyespot position), 123 species (44.2%) had females with more eyespots than males, and 95 species (34.2%) had males with more eyespots than females (figure 2). in addition, the degree of eyespot dimorphism was higher for the female - biased species relative to the male - biased species. from the 123 species in which the female was more ornamented, females averaged 2.32 more eyespots than males, with a median difference of 2 eyespots. on the other hand, in the 94 species that possessed more ornamented males, males averaged 1.74 more eyespots than females, with a median difference of 1 eyespot. in summary, lastly, of the 279 species with ornamented individuals, 148 (53.0%) had polymorphic females (with variation in eyespot number), while 174 (62.4%) had polymorphic males. further information on the descriptive statistics of this dataset can be found in (oliver. eyespots do not occur in equal numbers across all wing surfaces. in both sexes, ventral surfaces, on average, have more eyespots than do dorsal surfaces, and hindwings have more eyespots than do forewings (figure 3). the surfaces with the highest number of eyespots also display the largest proportion of sexual dimorphism : 66% of all eyespot dimorphism was found on the ventral surface31% forewing and 35% hindwing, while only 34% was found on the dorsal surface12% forewing and 22% hindwing. furthermore, 57% of dimorphism was on the hindwing surfaces compared to 43% on the forewing surfaces. eyespots are distributed among the wing surfaces differently in males and females (figures 4(a) and 4(b)). ventral surfaces contained 76% of the total number of eyespots found on males but only 69% of the eyespots were found on females. males had relatively more eyespots on their ventral hindwing when compared with females52% to 47%. conversely, females had relatively more eyespots on their dorsal hindwing when compared with males22% to 15%. males and females had an equal relative occurrence of eyespots on the ventral forewing surface22% and 24%, respectively. considering only the subset of eyespots that are dimorphic, these eyespots, too, were distributed differently in males and females (figures 4(c) and 4(d)). males had more eyespots on their ventral surface relative to females72% to 60%, respectively while females had more eyespots on their dorsal surface relative to males40% to 28%. both males and females, however, had more eyespots on the hindwings relative to forewings (55% for males and 58% for females). in general, the wing compartments that most commonly contained eyespots were proportionately the least sexually dimorphic (pearson correlation, r = 0.73, p < 0.001) (figure 5). all surfaces, except the dorsal forewing, showed a significant negative correlation between eyespot frequency and eyespot dimorphism (table 1). eyespots were commonly found in four wing compartments on the ventral hindwing : the cu1 (239 species ; 86.28% of species with at least one eyespot), m1 (181 species ; 65.34%), rs (175 species ; 63.18%), and m3 (176.5 species ; 63.72%), and the m1 compartment on the ventral forewing (167 species ; 60.29%). the most common eyespot location, the cu1 compartment on the ventral hindwing, was dimorphic in only 13.81% of the species. the second most common eyespot location, the m1 compartment of the ventral forewing, was dimorphic in only 19.46% of the species, demonstrating the tendency for common eyespot compartments to have a relatively low dimorphic rate. in contrast, the 2a and r3 compartments on the ventral forewing were proportionately the most sexually dimorphic (100% and 94.44%, resp.), but only a small proportion of species carried eyespots at these positions (0.36% and 3.25% of all eyespot - bearing species, resp.). a majority of nymphalid species has females with more eyespots than males, supporting data previously obtained for the genus bicyclus. however, a significant proportion of species display the opposite pattern, and many species are monomorphic in total eyespot number. ventral hindwings have, on average, the greatest share of eyespots ; yet this wing surface has proportionately the least amount of sexual dimorphism relative to the other three wing surfaces. sexual dimorphism is, thus, primarily found in wing surfaces that can be hidden from predators when the butterfly sits with its wings closed. these results are congruent with the sexual dimorphism displayed in b. anynana and with both mate choice and predation experiments previously performed on this species. these results also support the comparative work performed across the genus bicyclus. both sexes of b. anynana are polymorphic regarding the number of eyespots on the dorsal hindwing but females have, on average, one additional eyespot relative to males (westerman., it is currently unclear why females have additional eyespots on this surface, but sexual selection via male choice is a possibility. males alone notice the number of eyespots on the dorsal hindwings of females in mate choice trials, whereas females do not discriminate males based on this trait (westerman. both males and females, however, notice the number of eyespots on the dorsal forewings of the opposite sex [7, 8, 13 ]. a more limited set of experiments showed that females do not pay attention to eyespots on the ventral surfaces of males, but the reciprocal experiment with males has yet to be done. a larger number of eyespots on the dorsal hindwing of females may, thus, result from sexual selection on females by males. the ventral eyespots of butterflies are generally the most visible to natural enemies as they are displayed when butterflies rest with their wings folded over their bodies. in some circumstances (either using nave predators or under low light conditions), the attacks tend to target the area of the eyespots, in particular the hindwings, allowing the butterfly to escape with parts of the wing missing. these experiments suggest that sexual dimorphism on these wing surfaces may be maladaptive because both sexes benefit equally from the predator evading mechanism provided by these eyespots. these experiments lend support to the results of the survey that show that ventral surfaces, and especially ventral hindwing surfaces, are proportionately the least sexually dimorphic. while large dorsal forewing eyespots also function as an intimidating defense in some species [1520 ], this strategy may be restricted to fewer lineages. comparative work performed across the genus bicyclus also supports the results of this survey ; namely, hindwing and ventral eyespots are proportionately less sexually dimorphic than forewing or dorsal eyespots. estimates of rates of eyespot gains and losses calculated separately for males and females indicated that eyespots on the dorsal surface evolve at higher rates and at sex - specific rates, relative to eyespots on the ventral surface. this increased lability of the dorsal surface is associated with a higher frequency of dimorphic eyespots on this surface. eyespots on bicyclus forewings were also more labile and also had higher sex - specific rates of evolution relative to hindwing eyespots. so, research on bicyclus may explain many of the prevalent patterns in the general nymphalid dataset. these results are interesting when contrasted against two recent studies that inferred the wing surface where eyespot first originated within nymphalids. four of the five most common eyespots were estimated to be the original eyespots that appeared on the ventral hindwing of an ancestral nymphalid roughly 90 million years ago (oliver. in review). the fact that these eyespots are the most prevalent in species today may simply be due to their retention in a majority of lineages since their origin. the more recent dorsal eyespots seem to have originated 30 million years later (oliver. in review). despite their late origins, these dorsal eyespots have evolved some of the highest levels of sexual dimorphism seen across nymphalid eyespots. sexual differences in behavior, including basking propensity, mate searching, egg laying, courtship behavior, and associated observational angles towards the wings of the opposite sex, may all contribute to the variation in sexual dimorphisms in eyespots across wing surfaces. for example, bicyclus species do not bask, so their dorsal wing patterns may not be as visible to predators and be subject to as much natural selection as the dorsal wing pattern of species that bask or those where one sex basks more than the other. in addition, when courting, bicyclus males and females (females also court males in this species) both approach the opposite sex at an angle that makes their dorsal wing surfaces especially visible. behavioral data such as this can help determine the relative importance of certain wing surfaces in mate signaling. in addition, sex - specific patterns of natural selection and further behavioral information for multiple nymphalid species are needed if we want to understand the full extent of the patterns of sexual dimorphism in this clade of butterflies. | differences between sexes of the same species are widespread and are variable in nature. while it is often assumed that males are more ornamented than females, in the nymphalid butterfly genus bicyclus, females have, on average, more eyespot wing color patterns than males. here we extend these studies by surveying eyespot pattern sexual dimorphism across the nymphalidae family of butterflies. eyespot presence or absence was scored from a total of 38 wing compartments for two males and two females of each of 450 nymphalid species belonging to 399 different genera. differences in eyespot number between sexes of each species were tallied for each wing surface (e.g., dorsal and ventral) of forewings and hindwings. in roughly 44% of the species with eyespots, females had more eyespots than males, in 34%, males had more eyespots than females, and, in the remaining 22% of the species, there was monomorphism in eyespot number. dorsal and forewing surfaces were less patterned, but proportionally more dimorphic, than ventral and hindwing surfaces, respectively. in addition, wing compartments that frequently displayed eyespots were among the least sexually dimorphic. this survey suggests that dimorphism arises predominantly in hidden or private surfaces of a butterfly 's wing, as previously demonstrated for the genus bicyclus. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.